National Library of Energy BETA

Sample records for fission chain reaction

  1. Lesson 5 - Fission and Chain Reactions | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Lesson 5 - Fission and Chain Reactions Lesson Four showed how the nuclei of atoms store energy and how unstable atoms decay and release energy. How do nuclear engineers use this ...

  2. Polymerase chain reaction system

    DOE Patents [OSTI]

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  3. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction...

    National Nuclear Security Administration (NNSA)

    Self Sustain Nuclear Chain Reaction Chicago, IL Metallurgical Laboratory scientists led by Enrico Fermi achieve the first self-sustained nuclear chain reaction in pile...

  4. Dual phase multiplex polymerase chain reaction

    DOE Patents [OSTI]

    Pemov, Alexander (Charlottesville, VA); Bavykin, Sergei (Darien, IL)

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  5. Integrated polymerase chain reaction/electrophoresis instrument

    DOE Patents [OSTI]

    Andresen, Brian D. (Livermore, CA)

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  6. Angular momentum effects in fusion-fission and fusion-evaporation reactions

    SciTech Connect (OSTI)

    Plasil, F.

    1980-01-01

    The study of heavy-ion fusion reactions is complicated by the possible contributions of several mechanisms. The various types of heavy-ion-induced fission are discussed. Then compound-nucleus fission is considered with reference to fission barriers deduced from heavy-ion-induced fission. Next, the problems associated with measured values of evaporation-residue cross sections and the angular momentum dependence of incomplete fusion are examined. Finally, the de-excitation of compound nuclei is again taken up, this time with reference to the greatly enhanced ..cap alpha.. emission predicted on the basis of the rotating liquid drop model. 24 figures. (RWR)

  7. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Conference: Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices Citation Details In-Document Search Title: Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources in energy science and technology. A paper copy

  8. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction | National

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets

  9. Fission-Fusion: A new reaction mechanism for nuclear astrophysics based on laser-ion acceleration

    SciTech Connect (OSTI)

    Thirolf, P. G.; Gross, M.; Allinger, K.; Bin, J.; Henig, A.; Kiefer, D.; Habs, D.; Ma, W.; Schreiber, J.

    2011-10-28

    We propose to produce neutron-rich nuclei in the range of the astrophysical r-process around the waiting point N = 126 by fissioning a dense laser-accelerated thorium ion bunch in a thorium target (covered by a CH{sub 2} layer), where the light fission fragments of the beam fuse with the light fission fragments of the target. Via the 'hole-boring' mode of laser Radiation Pressure Acceleration using a high-intensity, short pulse laser, very efficiently bunches of {sup 232}Th with solid-state density can be generated from a Th target and a deuterated CD{sub 2} foil, both forming the production target assembly. Laser-accelerated Th ions with about 7 MeV/u will pass through a thin CH{sub 2} layer placed in front of a thicker second Th foil (both forming the reaction target) closely behind the production target and disintegrate into light and heavy fission fragments. In addition, light ions (d,C) from the CD{sub 2} layer of the production target will be accelerated as well, inducing the fission process of {sup 232}Th also in the second Th layer. The laser-accelerated ion bunches with solid-state density, which are about 10{sup 14} times more dense than classically accelerated ion bunches, allow for a high probability that generated fission products can fuse again. The high ion beam density may lead to a strong collective modification of the stopping power, leading to significant range and thus yield enhancement. Using a high-intensity laser as envisaged for the ELI-Nuclear Physics project in Bucharest (ELI-NP), order-of-magnitude estimates promise a fusion yield of about 10{sup 3} ions per laser pulse in the mass range of A = 180-190, thus enabling to approach the r-process waiting point at N = 126.

  10. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Patents [OSTI]

    Nasarabadi, Shanavaz (Livermore, CA)

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  11. Fission and quasifission modes in heavy-ion-induced reactions leading to the formation of Hs{sup *}

    SciTech Connect (OSTI)

    Itkis, I. M.; Kozulin, E. M.; Itkis, M. G.; Knyazheva, G. N.; Bogachev, A. A.; Chernysheva, E. V.; Krupa, L.; Oganessian, Yu. Ts.; Zagrebaev, V. I.; Rusanov, A. Ya.; Goennenwein, F.; Dorvaux, O.; Stuttge, L.; Hanappe, F.; Vardaci, E.; Goes Brennand, E. de

    2011-06-15

    Mass and energy distributions of binary reaction products obtained in the reactions {sup 22}Ne+{sup 249}Cf,{sup 26}Mg+{sup 248}Cm, {sup 36}S+{sup 238}U, and {sup 58}Fe+{sup 208}Pb have been measured. All reactions lead to Hs isotopes. At energies below the Coulomb barrier the bimodal fission of Hs{sup *}, formed in the reaction {sup 26}Mg+{sup 248}Cm, is observed. In the reaction {sup 36}S+{sup 238}U, leading to the formation of a similar compound nucleus, the main part of the symmetric fragments arises from the quasifission process. At energies above the Coulomb barrier fusion-fission is the main process leading to the formation of symmetric fragments for both reactions with Mg and S ions. In the case of the {sup 58}Fe+{sup 208}Pb reaction the quasifission process dominates at all measured energies.

  12. Fusion-fission and quasifission in the reactions with heavy ions leading to the formation of Hs

    SciTech Connect (OSTI)

    Itkis, I. M.; Itkis, M. G.; Knyazheva, G. N.; Kozulin, E. M.

    2012-10-20

    Mass and energy distributions of binary reaction products obtained in the reactions {sup 22}Ne+{sup 249}Cf,{sup 26}Mg+{sup 248}Cm,{sup 36}S+{sup 238}U and {sup 58}Fe+{sup 208}Pb leading to Hs isotopes have been measured. At energies below the Coulomb barrier the bimodal fission of Hs*, formed in the reaction {sup 26}Mg+{sup 248}Cm, is observed. In the reaction {sup 36}S+{sup 238}U the considerable part of the symmetric fragments arises from the quasifission process. At energies above the Coulomb barrier the symmetric fragments originate mainly from fusion-fission process for both reactions with Mg and S ions. In the case of the {sup 58}Fe+{sup 208}Pb reaction the quasifission process dominates at all measured energies. The pre- and post-scission neutron multiplicities as a function of the fragment mass have been obtained for the reactions studied.

  13. Nested methylation-specific polymerase chain reaction cancer detection method

    DOE Patents [OSTI]

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  14. Rotation of Nuclei as Observed in Ternary Fission of the Reaction 235U(nth,f) Induced by Polarized Neutron

    SciTech Connect (OSTI)

    Goennenwein, F.; Gagarski, A.; Guseva, I.; Petrov, G.; Sokolov, V.; Zavarukhkina, T.; Mutterer, M.; Nesvizhevski, V.; Bunakov, V.; Kadmensky, S.

    2007-05-22

    Ternary fission of the standard reaction 235U(nth,f) induced by cold polarized neutrons has been investigated. Fission fragments and light charged particles were recorded in coincidence. Following cold neutron capture the compound nucleus 236U* has spin 3- or 4-. At the saddle point of the fissioning 236U* nucleus these states are collective. They are expected to retain a sizable collectivity down to the scission point. In fact, a collective rotation has been sensed by the shift in the angular distribution of the light charged particles which depends on the orientation of neutron polarization. Direct observation of the rotation of 236U* excited in a cold neutron reaction is reported here for the first time. It is proposed to call the new phenomenon the 'ROT-effect'.

  15. First-Hand Recollections of the First Self-Sustaining Chain Reaction |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Department of Energy First-Hand Recollections of the First Self-Sustaining Chain Reaction First-Hand Recollections of the First Self-Sustaining Chain Reaction August 3, 2012 - 4:53pm Addthis On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 (CP-1) went critical and produced the world's first self-sustaining, controlled nuclear chain reaction. Seventy years later, two of the last surviving CP-1 pioneers, Harold Agnew and Warren Nyer, recall that

  16. Dynamical Dipole Mode in Heavy-Ion Fusion-Evaporation and Fission Reactions in the {sup 192}Pb Mass Region

    SciTech Connect (OSTI)

    Silvestri, R.; Inglima, G.; La Commara, M.; Martin, B.; Sandoli, M.; Pierroutsakou, D.; Parascandolo, C.; Boiano, A.; Romoli, M.; Agodi, C.; Alba, R.; Colonna, M.; Coniglione, R.; Del Zoppo, A.; Maiolino, C.; Santonocito, D.; Baran, V.; De Filippo, E.; Di Toro, M.; Rizzo, C.

    2011-10-28

    The prompt {gamma}-ray emission related with the dynamical dipole mode decay was investigated in the {sup 192}Pb mass region by means of the {sup 40}Ca+{sup 152}Sm and {sup 48}Ca+{sup 144}Sm fusion-evaporation and fission reactions at E{sub lab} = 11 and 10.1 MeV/nucleon, respectively. The two reactions populate, through entrance channel having different charge asymmetries, the {sup 192}Pb compound nucleus at an excitation energy of 236 MeV with identical spin distribution. Preliminary results of this experiment show that the dynamical dipole mode survives in collisions involving heavier mass reaction partners than those studied previously. As a fast cooling mechanism on the fusion path, the prompt dipole {gamma} radiation could be of interest for the synthesis of super-heavy elements through ''hot'' fusion reactions.

  17. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hanson, Susan Kloek

    2013-07-30

    Method of producing C.sub.8-C.sub.15 hydrocarbons. comprising providing a ketone starting material; providing an aldol starting material comprising chloromethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.3, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  18. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  19. Enrico Fermi and the First Self-Sustaining Nuclear Chain Reaction

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Enrico Fermi and the First Self-Sustaining Nuclear Chain Reaction Resources with Additional Information * Fermi Honored * Atoms for Peace * Centennial of Birth * Stamp Patents * Audio/Video Clips * Selected by NSTA for SciLinks "The President of the United States of America ... for especially meritorious contributions to the development, use, or control of atomic energy, grant[s] an award of merit to Enrico Fermi for his contributions to basic neutron physics and the achievement of the

  20. Fission Spectrum

    DOE R&D Accomplishments [OSTI]

    Bloch, F.; Staub, H.

    1943-08-18

    Measurements of the spectrum of the fission neutrons of 25 are described, in which the energy of the neutrons is determined from the ionization produced by individual hydrogen recoils. The slow neutrons producing fission are obtained by slowing down the fast neutrons from the Be-D reaction of the Stanford cyclotron. In order to distinguish between fission neutrons and the remaining fast cyclotron neutrons both the cyclotron current and the pusle amplifier are modulated. A hollow neutron container, in which slow neutrons have a lifetime of about 2 milliseconds, avoids the use of large distances. This method results in much higher intensities than the usual modulation arrangement. The results show a continuous distribution of neutrons with a rather wide maximum at about 0.8 MV falling off to half of its maximum value at 2.0 MV. The total number of netrons is determined by comparison with the number of fission fragments. The result seems to indicate that only about 30% of the neutrons have energies below .8 MV. Various tests are described which were performed in order to rule out modification of the spectrum by inelastic scattering. Decl. May 4, 1951

  1. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  2. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    SciTech Connect (OSTI)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  3. Investigation of the reaction {sup 208}Pb({sup 18}O, f): Fragment spins and phenomenological analysis of the angular anisotropy of fission fragments

    SciTech Connect (OSTI)

    Rusanov, A. Ya. Adeev, G. D.; Itkis, M. G.; Karpov, A. V.; Nadtochy, P. N.; Pashkevich, V. V.; Pokrovsky, I. V.; Salamatin, V. S.; Chubarian, G. G.

    2007-10-15

    The average multiplicity of gamma rays emitted by fragments originating from the fission of {sup 226}Th nuclei formed via a complete fusion of {sup 18}O and {sup 208}Pb nuclei at laboratory energies of {sup 18}O projectile ions in the range E{sub lab} = 78-198.5 MeV is measured and analyzed. The total spins of fission fragments are found and used in an empirical analysis of the energy dependence of the anisotropy of these fragments under the assumption that their angular distributions are formed in the vicinity of the scission point. The average temperature of compound nuclei at the scission point and their average angular momenta in the entrance channel are found for this analysis. Also, the moments of inertia are calculated for this purpose for the chain of fissile thorium nuclei at the scission point. All of these parameters are determined at the scission point by means of three-dimensional dynamical calculations based on Langevin equations. A strong alignment of fragment spins is assumed in analyzing the anisotropy in question. In that case, the energy dependence of the anisotropy of fission fragments is faithfully reproduced at energies in excess of the Coulomb barrier (E{sub c.m.} - E{sub B} {>=} 30 MeV). It is assumed that, as the excitation energy and the angular momentum of a fissile nucleus are increased, the region where the angular distributions of fragments are formed is gradually shifted from the region of nuclear deformations in the vicinity of the saddle point to the region of nuclear deformations in the vicinity of the scission point, the total angular momentum of the nucleus undergoing fission being split into the orbital component, which is responsible for the anisotropy of fragments, and the spin component. This conclusion can be qualitatively explained on the basis of linear-response theory.

  4. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOE Patents [OSTI]

    Chen, Xian (Los Alamos, NM); Gupta, Goutam (Santa Fe, NM); Bradbury, E. Morton (Santa Fe, NM)

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  5. Interplay between compound and fragments aspects of nuclear fission...

    Office of Scientific and Technical Information (OSTI)

    aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments aspects of nuclear fission and ...

  6. Microscopic Calculation of Fission Fragment Energies for the...

    Office of Scientific and Technical Information (OSTI)

    Microscopic Calculation of Fission Fragment Energies for the 239Pu(nth,f) Reaction Citation Details In-Document Search Title: Microscopic Calculation of Fission Fragment Energies...

  7. Spontaneous Fission

    DOE R&D Accomplishments [OSTI]

    Segre, Emilio

    1950-11-22

    The first attempt to discover spontaneous fission in uranium was made by [Willard] Libby, who, however, failed to detect it on account of the smallness of effect. In 1940, [K. A.] Petrzhak and [G. N.] Flerov, using more sensitive methods, discovered spontaneous fission in uranium and gave some rough estimates of the spontaneous fission decay constant of this substance. Subsequently, extensive experimental work on the subject has been performed by several investigators and will be quoted in the various sections. [N.] Bohr and [A.] Wheeler have given a theory of the effect based on the usual ideas of penetration of potential barriers. On this project spontaneous fission has been studied for the past several years in an effort to obtain a complete picture of the phenomenon. For this purpose the spontaneous fission decay constants {lambda} have been measured for separated isotopes of the heavy elements wherever possible. Moreover, the number {nu} of neutrons emitted per fission has been measured wherever feasible, and other characteristics of the spontaneous fission process have been studied. This report summarizes the spontaneous fission work done at Los Alamos up to January 1, 1945. A chronological record of the work is contained in the Los Alamos monthly reports.

  8. Investigation of the {sup 208}Pb({sup 18}O, f) fission reaction: Mass-energy distributions of fission fragments and their correlation with the gamma-ray multiplicity

    SciTech Connect (OSTI)

    Rusanov, A. Ya.; Itkis, M. G.; Kondratiev, N. A.; Pashkevich, V. V.; Pokrovsky, I. V.; Salamatin, V. S.; Chubarian, G. G.

    2008-06-15

    The mass-energy distributions of fragments originating from the fission of the compound nucleus {sup 226}Th and their correlations with the multiplicity of gamma rays emitted from these fragments are measured and analyzed in {sup 18}O + {sup 208}Pb interaction induced by projectile oxygen ions of energy in the range E{sub lab} = 78-198.5 MeV. Manifestations of an asymmetric fission mode, which is damped exponentially with increasing E{sub lab}, are demonstrated. Theoretical calculations of fission valleys reveal that only two independent valleys, symmetric and asymmetric, exist in the vicinity of the scission point. The dependence of the multiplicity of gamma rays emitted from both fission fragments on their mass, M{sub {gamma}}(M), has a complicated structure and is highly sensitive to shell effects in both primary and final fragments. A two-component analysis of the dependence M{sub {gamma}}(M) shows that the asymmetric mode survives in fission only at low partial-wave orbital angular momenta of compound nuclei. It is found that, for all E{sub lab}, the gamma-ray multiplicity M{sub {gamma}}as a function of the total kinetic energy (TKE) of fragments, M{sub {gamma}}(TKE), decreases linearly with increasing TKE. An analysis of the energy balance in the fission process at the laboratory energy of E{sub lab} = 78 MeV revealed the region of cold fission of fragments whose total kinetic energy is TKE {approx}Q{sub max}.

  9. Investigation of the reaction {sup 208}Pb({sup 18}O, f): Folding angular distributions of fission fragments and gamma-ray multiplicity

    SciTech Connect (OSTI)

    Rusanov, A. Ya. Itkis, M. G.; Kondratiev, N. A.; Pokrovsky, I. V.; Salamatin, V. S.; Chubarian, G. G.

    2007-10-15

    Correlations between folding angular distributions of fission fragments and the gamma-ray multiplicity are studied for {sup 18}O + {sup 208}Pb interactions at energies of the beam of {sup 18}O ions in the range E{sub lab} = 78-198.5 MeV. The probabilities are determined for complete-and incomplete-fusion processes inevitably followed by the fission of nuclei formed in these processes. It is found that the probability of incomplete fusion followed by fission increases with increasing energy of bombarding ions. It is shown that, for the incomplete-fusion process, folding angular distributions of fission fragments have a two-component structure. The width of folding angular distributions (FWHM) for complete fusion grows linearly with increasing energy of {sup 18}O ions. The multiplicity of gamma rays from fission fragments as a function of the linear-momentum transfer behaves differently for different energies of projectile ions. This circumstance is explained here by the distinction between the average angular momenta of participant nuclei in the fusion and fission channels, which is due to the difference in the probabilities of fission in the cases where different numbers of nucleons are captured by the target nucleus.

  10. Benchmarking nuclear fission theory

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Bertsch, G. F.; Loveland, W.; Nazarewicz, W.; Talou, P.

    2015-05-14

    We suggest a small set of fission observables to be used as test cases for validation of theoretical calculations. Thus, the purpose is to provide common data to facilitate the comparison of different fission theories and models. The proposed observables are chosen from fission barriers, spontaneous fission lifetimes, fission yield characteristics, and fission isomer excitation energies.

  11. MODELING AND FISSION CROSS SECTIONS FOR AMERICIUM.

    SciTech Connect (OSTI)

    ROCHMAN, D.; HERMAN, M.; OBLOZINSKY, P.

    2005-05-01

    This is the final report of the work performed under the LANL contract on the modeling and fission cross section for americium isotopes (May 2004-June 2005). The purpose of the contract was to provide fission cross sections for americium isotopes with the nuclear reaction model code EMPIRE 2.19. The following work was performed: (1) Fission calculations capability suitable for americium was implemented to the EMPIRE-2.19 code. (2) Calculations of neutron-induced fission cross sections for {sup 239}Am to {sup 244g}Am were performed with EMPIRE-2.19 for energies up to 20 MeV. For the neutron-induced reaction of {sup 240}Am, fission cross sections were predicted and uncertainties were assessed. (3) Set of fission barrier heights for each americium isotopes was chosen so that the new calculations fit the experimental data and follow the systematics found in the literature.

  12. Fission meter

    DOE Patents [OSTI]

    Rowland, Mark S. (Alamo, CA); Snyderman, Neal J. (Berkeley, CA)

    2012-04-10

    A neutron detector system for discriminating fissile material from non-fissile material wherein a digital data acquisition unit collects data at high rate, and in real-time processes large volumes of data directly into information that a first responder can use to discriminate materials. The system comprises counting neutrons from the unknown source and detecting excess grouped neutrons to identify fission in the unknown source.

  13. Interplay between compound and fragments aspects of nuclear fission...

    Office of Scientific and Technical Information (OSTI)

    Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments...

  14. Fission theory: Its relevance to the nuclear cross section data base

    SciTech Connect (OSTI)

    Lynn, J.E.

    1989-01-01

    The development of fission reaction theory in relation to its predictive power in the calculation of neutron cross-sections is reviewed. The topics covered include the transition state spectrum and the channel theory; the discovery of complex topography in the fission barrier and the consequences of intermediate structure in fission cross-sections; the evidence of experimental data in parameterizing the fission barrier; and the role of other aspects of collective nuclear motion in controlling fission reaction rates. 51 refs., 6 figs.

  15. Microscopic Description of Nuclear Fission: Fission Barrier Heights...

    Office of Scientific and Technical Information (OSTI)

    Microscopic Description of Nuclear Fission: Fission Barrier Heights of Even-Even Actinides Citation Details In-Document Search Title: Microscopic Description of Nuclear Fission:...

  16. Microscopic Description of Nuclear Fission: Fission Barrier Heights...

    Office of Scientific and Technical Information (OSTI)

    Microscopic Description of Nuclear Fission: Fission Barrier Heights of Even-Even Actinides Citation Details In-Document Search Title: Microscopic Description of Nuclear Fission: ...

  17. Microscopic Calculation of Fission Fragment Energies for the...

    Office of Scientific and Technical Information (OSTI)

    for the 239Pu(nth,f) Reaction Citation Details In-Document Search Title: Microscopic Calculation of Fission Fragment Energies for the 239Pu(nth,f) Reaction We calculate the ...

  18. Interplay between compound and fragments aspects of nuclear fission and

    Office of Scientific and Technical Information (OSTI)

    heavy-ion reaction (Conference) | SciTech Connect Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction The scission point in nuclear fission plays a special role where one-body system changes to two-body system. Inverse of this situation is realized in heavy-ion fusion reaction where two-body system changes to one body

  19. Reexamination of fission fragment angular distributions and the fission process: Formalism

    SciTech Connect (OSTI)

    Bond, P.D.

    1985-08-01

    The theory of fission fragment angular distributions is examined and the universally used expression is found to be valid only under restrictive assumptions. A more general angular distribution formula is derived and applied to recent data of high spin systems. At the same time it is shown that the strong anisotropies observed from such systems can be understood without changing the essential basis of standard fission theory. The effects of reaction mechanisms other than complete fusion on fission fragment angular distributions are discussed and possible angular distribution signatures of noncompound nucleus formation are mentioned.

  20. Fission gas detection system

    DOE Patents [OSTI]

    Colburn, Richard P. (Pasco, WA)

    1985-01-01

    A device for collecting fission gas released by a failed fuel rod which device uses a filter to pass coolant but which filter blocks fission gas bubbles which cannot pass through the filter due to the surface tension of the bubble.

  1. Our 50-year odyssey with fission: Summary

    SciTech Connect (OSTI)

    Nix, J.R.

    1989-01-01

    On the occasion of this International Conference on Fifty Years Research in Nuclear Fission, we summarize our present understanding of the fission process and the challenges that lie ahead. The basic properties of fission arise from a delicate competition between disruptive Coulomb forces, cohesive nuclear forces, and fluctuating shell and pairing forces. These static forces are primarily responsible for such experimental phenomena as deformed ground-state nuclear shapes, fission into fragments of unequal size, sawtooth neutron yields, spontaneously fissioning isomers, broad resonances and narrow intermediate structure in fission cross sections, and cluster radioactivity. However, inertial and dissipative forces also play decisive roles in the dynamical evolution of a fissioning nucleus. The energy dissipated between the saddle and scission points is small for low initial excitation energy at the saddle point and increases with increasing excitation energy. At moderate excitation energies, the dissipation of collective energy into internal single-particle excitation energy proceeds largely through the interaction of nucleons with the mean field and with each other in the vicinity of the nuclear surface, as well as through the transfer of nucleons between the two portions of the evolving dumbell-like system. These unique dissipation mechanisms arise from the Pauli exclusion principle for fermions and the details of the nucleon-nucleon interaction, which make the mean free path of a nucleon near the Fermi surface at low excitation energy longer than the nuclear radius. With its inverse process of heavy-ion fusion reactions, fission continues to yield surprises in the study of large-amplitude collective nuclear motion. 87 refs., 12 figs.

  2. Liquid uranium alloy-helium fission reactor

    DOE Patents [OSTI]

    Minkov, Vladimir (Skokie, IL)

    1986-01-01

    This invention teaches a nuclear fission reactor having a core vessel and at least one tandem heat exchanger vessel coupled therewith across upper and lower passages to define a closed flow loop. Nuclear fuel such as a uranium alloy in its liquid phase fills these vessels and flow passages. Solid control elements in the reactor core vessel are adapted to be adjusted relative to one another to control fission reaction of the liquid fuel therein. Moderator elements in the other vessel and flow passages preclude fission reaction therein. An inert gas such as helium is bubbled upwardly through the heat exchanger vessel operable to move the liquid fuel upwardly therein and unidirectionally around the closed loop and downwardly through the core vessel. This helium gas is further directed to heat conversion means outside of the reactor vessels to utilize the heat from the fission reaction to generate useful output. The nuclear fuel operates in the 1200.degree.-1800.degree. C. range, and even higher to 2500.degree. C., limited only by the thermal effectiveness of the structural materials, increasing the efficiency of power generation from the normal 30-35% with 300.degree.-500.degree. C. upper limit temperature to 50-65%. Irradiation of the circulating liquid fuel, as contrasted to only localized irradiation of a solid fuel, provides improved fuel utilization.

  3. Liquid uranium alloy-helium fission reactor

    DOE Patents [OSTI]

    Minkov, V.

    1984-06-13

    This invention describes a nuclear fission reactor which has a core vessel and at least one tandem heat exchanger vessel coupled therewith across upper and lower passages to define a closed flow loop. Nuclear fuel such as a uranium alloy in its liquid phase fills these vessels and flow passages. Solid control elements in the reactor core vessel are adapted to be adjusted relative to one another to control fission reaction of the liquid fuel therein. Moderator elements in the other vessel and flow passages preclude fission reaction therein. An inert gas such as helium is bubbled upwardly through the heat exchanger vessel operable to move the liquid fuel upwardly therein and unidirectionally around the closed loop and downwardly through the core vessel. This helium gas is further directed to heat conversion means outside of the reactor vessels to utilize the heat from the fission reaction to generate useful output. The nuclear fuel operates in the 1200 to 1800/sup 0/C range, and even higher to 2500/sup 0/C.

  4. Fission barrier properties, resonance fluctuations and isomer fission

    Office of Scientific and Technical Information (OSTI)

    cross-sections. (Conference) | SciTech Connect Fission barrier properties, resonance fluctuations and isomer fission cross-sections. Citation Details In-Document Search Title: Fission barrier properties, resonance fluctuations and isomer fission cross-sections. Although the main picture of fission bamer physics was established some time ago many of the details still have to be settled. Consequently, the application to evaluation of crosssections of unmeasurable or exotic nuclides and their

  5. Microscopic Calculation of Fission Fragment Energies for the 239Pu(nth,f)

    Office of Scientific and Technical Information (OSTI)

    Reaction (Technical Report) | SciTech Connect Microscopic Calculation of Fission Fragment Energies for the 239Pu(nth,f) Reaction Citation Details In-Document Search Title: Microscopic Calculation of Fission Fragment Energies for the 239Pu(nth,f) Reaction We calculate the total kinetic and excitation energies of fragments produced in the thermal-induced fission of {sup 239}Pu. This result is a proof-of-principle demonstration for a microscopic approach to the calculation of fission-fragment

  6. Attempt to confirm superheavy element production in the 48Ca +238U reaction

    SciTech Connect (OSTI)

    Gregorich, K.E.; Loveland, W.; Peterson, D.; Zielinski, P.M.; Nelson, S.L.; Chung, Y.H.; Dullmann, Ch.E.; Folden III, C.M.; Aleklett,K.; Eichler, R.; Hoffman D.C.; Omtvedt, J.P.; Pang, G.K.; Schwantes,J.M.; Soverna, S.; Sprunger, P.; Sudowe, R.; Wilson, R.E.; Nitsche, H.

    2005-03-24

    An attempt to confirm production of superheavy elements in the reaction of 48Ca beams with actinide targets has been performed using the 238U(48Ca,3n)283112 reaction. Two 48Ca projectile energies were used, that spanned the energy range where the largest cross sections have been reported for this reaction. No spontaneous fission events were observed. No alpha decay chains consistent with either reported or theoretically predicted element 112 decay properties were observed. The cross section limits reached are significantly smaller than the recently reported cross sections.

  7. Attempt to confirm superheavy element production in the {sup 48}Ca+{sup 238}U reaction

    SciTech Connect (OSTI)

    Gregorich, K.E.; Sudowe, R.; Loveland, W.; Sprunger, P.; Peterson, D.; Zielinski, P.M.; Nelson, S.L.; Duellmann, Ch.E.; Folden III, C.M.; Hoffman, D.C.; Wilson, R.E.; Nitsche, H.; Chung, Y.H.; Aleklett, K.; Eichler, R.; Soverna, S.; Omtvedt, J.P.; Pang, G.K.; Schwantes, J.M.

    2005-07-01

    An attempt to confirm production of superheavy elements in the reaction of {sup 48}Ca beams with actinide targets has been performed using the {sup 238}U({sup 48}Ca,3n){sup 283}112 reaction. Two {sup 48}Ca projectile energies were used that spanned the energy range where the largest cross sections have been reported for this reaction. No spontaneous fission events were observed. No {alpha} decay chains consistent with either reported or theoretically predicted element 112 decay properties were observed. The cross-section limits reached are significantly smaller than the recently reported cross sections.

  8. Microscopic Description of Nuclear Fission: Fission Barrier Heights of

    Office of Scientific and Technical Information (OSTI)

    Even-Even Actinides (Conference) | SciTech Connect Microscopic Description of Nuclear Fission: Fission Barrier Heights of Even-Even Actinides Citation Details In-Document Search Title: Microscopic Description of Nuclear Fission: Fission Barrier Heights of Even-Even Actinides Authors: McDonnell, J ; Schunck, N ; Nazarewicz, W Publication Date: 2013-01-22 OSTI Identifier: 1062216 Report Number(s): LLNL-PROC-612272 DOE Contract Number: W-7405-ENG-48 Resource Type: Conference Resource Relation:

  9. Fission barrier properties, resonance fluctuations and isomer fission

    Office of Scientific and Technical Information (OSTI)

    cross-sections. (Conference) | SciTech Connect Fission barrier properties, resonance fluctuations and isomer fission cross-sections. Citation Details In-Document Search Title: Fission barrier properties, resonance fluctuations and isomer fission cross-sections. × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize

  10. Microscopic Theory of Fission (Conference) | SciTech Connect

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Microscopic Theory of Fission Citation Details In-Document Search Title: Microscopic Theory of Fission Authors: Younes, W ; Gogny, D Publication Date: 2008-01-03 OSTI Identifier: 924187 Report Number(s): LLNL-PROC-400347 DOE Contract Number: W-7405-ENG-48 Resource Type: Conference Resource Relation: Conference: Presented at: Compound Nuclear Reactions and Related Topics, Fish Camp, CA, United States, Oct 22 - Oct 26, 2007 Research Org: Lawrence Livermore National Laboratory (LLNL), Livermore, CA

  11. Flow cytometric detection of human immunodeficiency virus type 1 proviral DNA by the polymerase chain reaction incorporating digoxigenin- or fluorescein-labeled dUTP

    SciTech Connect (OSTI)

    Yang, Gang; Olson, J.C.; Pu, R.; Vyas, G.N.

    1995-10-01

    Serological assays are routinely used in the laboratory diagnosis of human immunodeficiency virus type-1 (HrV-1) infection, but the polymerase chain reaction (PCR) is ultimately the most sensitive and direct method for establishing definitive diagnosis. As an alternative to the conventional radioactive PCR procedure we have developed and evaluated a pair of rapid nonradioisotopic flow cytometric detection methods. Using heminested PCR we directly incorporated fluorescein-12-dUTP (fluo-dUTP) or digoxigenin-11-dUTP (dig-dUTP) into the PCR-amplicons. The labeled amplicons were hybridized with biotinylated antisense and sense probes, followed by capture of the hybrid DNA using streptavidin-coated beads which were finally analyzed in a flow cytometer by (1) direct detection of the fluorescence intensity of the amplicons incorporating fluo-dUTP and (2) immunodetection of the amplicons incorporating dig-dUTP by anti-digoxigenin IgG labeled with fluorescein isothiocyanate (FITC). Although both assays were functionally comparable with radiolabeled probe in reliably detecting as low as five copies of HIV-1 proviral DNA sequences, the immunodetection of dig-dUTP consistently yielded higher mean channel fluorescence and gave a stable signal over an extended period of 12-14 weeks. In testing a panel of 20 pedigreed PBMC specimens from blood donors with or without HIV-1 infection, the results of both flow cytometric assays were identical with those of the conventional radioactive procedure. Therefore, we conclude that the dig-dUTP incorporation in amplicons, hybridization with a pair of sense-antisense biotinylated probes and immunodetection of hybrids by flow cytometric analyses is the nonisotopic method of choice for PCR-diagnosis of HIV-1 infection. 21 refs., 2 figs., 4 tabs.

  12. Process for treating fission waste

    DOE Patents [OSTI]

    Rohrmann, Charles A.; Wick, Oswald J.

    1983-01-01

    A method is described for the treatment of fission waste. A glass forming agent, a metal oxide, and a reducing agent are mixed with the fission waste and the mixture is heated. After melting, the mixture separates into a glass phase and a metal phase. The glass phase may be used to safely store the fission waste, while the metal phase contains noble metals recovered from the fission waste.

  13. A New Method of Prompt Fission Neutron Energy Spectrum Unfolding

    SciTech Connect (OSTI)

    Zeynalova, O. V. [Moscow State Institute of Radioengineering, Electronics and Automation, Moscow (Russian Federation); Joint Institute for Nuclear Research, Dubna (Russian Federation); Zeynalov, Sh. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Hambsch, F.-J.; Oberstedt, S. [EC-JRC-Institute for Reference Materials and Measurements, Geel (Belgium)

    2010-11-25

    The prompt neutron emission in spontaneous fission of {sup 252}Cf has been investigated applying digital signal electronics along with associated digital signal processing algorithms. The goal was to find out the reasons of a long time existing discrepancy between theoretical calculations and the measurements of prompt fission neutron (PFN) emission dependence on the total kinetic energy (TKE) of fission fragments (FF). On the one hand the {sup 252}Cf(sf) reaction is one of the main references for nuclear data, on the other hand the understanding of PFN emission mechanism is very important for nuclear fission theory. Using a twin Frisch-grid ionization chamber for fission fragment (FF) detection and a NE213-equivalent neutron detector in total about 10{sup 7} fission fragment-neutron coincidences have been registered. Fission fragment kinetic energy, mass and angular distribution, neutron time-of-flight and pulse shape have been investigated using a 12 bit waveform digitizer. The signal waveforms have been analyzed using digital signal processing algorithms. For the first time the dependence of the number of emitted neutrons as a function of total kinetic energy (TKE) of the fragments is in very good agreement with theoretical calculations in the range of TKE from 140-220 MeV.

  14. Measurements of actinide-fission product yields in Caliban and Prospero metallic core reactor fission neutron fields

    SciTech Connect (OSTI)

    Casoli, P.; Authier, N. [CEA, Centre de Valduc, 21120 Is-sur-Tille (France); Laurec, J.; Bauge, E.; Granier, T. [CEA, Centre DIF, 91297 Arpajon (France)

    2011-07-01

    In the 1970's and early 1980's, an experimental program was performed on the facilities of the CEA Valduc Research Center to measure several actinide-fission product yields. Experiments were, in particular, completed on the Caliban and Prospero metallic core reactors to study fission-neutron-induced reactions on {sup 233}U, {sup 235}U, and {sup 239}Pu. Thick actinide samples were irradiated and the number of nuclei of each fission product was determined by gamma spectrometry. Fission chambers were irradiated simultaneously to measure the numbers of fissions in thin deposits of the same actinides. The masses of the thick samples and the thin deposits were determined by mass spectrometry and alpha spectrometry. The results of these experiments will be fully presented in this paper for the first time. A description of the Caliban and Prospero reactors, their characteristics and performances, and explanations about the experimental approach will also be given in the article. A recent work has been completed to analyze and reinterpret these measurements and particularly to evaluate the associated uncertainties. In this context, calculations have also been carried out with the Monte Carlo transport code Tripoli-4, using the published benchmarked Caliban description and a three-dimensional model of Prospero, to determine the average neutron energy causing fission. Simulation results will be discussed in this paper. Finally, new fission yield measurements will be proposed on Caliban and Prospero reactors to strengthen the results of the first experiments. (authors)

  15. Fusion-fission hybrid studies in the United States

    SciTech Connect (OSTI)

    Moir, R.W.; Lee, J.D.; Berwald, D.H.; Cheng, E.T.; Delene, J.G.; Jassby, D.L.

    1986-05-20

    Systems and conceptual design studies have been carried out on the following three hybrid types: (1) The fission-suppressed hybrid, which maximizes fissile material produced (Pu or /sup 233/U) per unit of total nuclear power by suppressing the fission process and multiplying neutrons by (n,2n) reactions in materials like beryllium. (2) The fast-fission hybrid, which maximizes fissile material produced per unit of fusion power by maximizing fission of /sup 238/U (Pu is produced) in which twice the fissile atoms per unit of fusion power (but only a third per unit of nuclear power) are made. (3) The power hybrid, which amplifies power in the blanket for power production but does not produce fuel to sell. All three types must sell electrical power to be economical.

  16. Event-by-Event Simulation of Induced Fission

    SciTech Connect (OSTI)

    Vogt, R; Randrup, J

    2007-12-13

    We are developing a novel code that treats induced fission by statistical (or Monte-Carlo) simulation of individual decay chains. After its initial excitation, the fissionable compound nucleus may either deexcite by evaporation or undergo binary fission into a large number of fission channels each with different energetics involving both energy dissipation and deformed scission prefragments. After separation and Coulomb acceleration, each fission fragment undergoes a succession of individual (neutron) evaporations, leading to two bound but still excited fission products (that may further decay electromagnetically and, ultimately, weakly), as well as typically several neutrons. (The inclusion of other possible ejectiles is planned.) This kind of approach makes it possible to study more detailed observables than could be addressed with previous treatments which have tended to focus on average quantities. In particular, any type of correlation observable can readily be extracted from a generated set of events. With a view towards making the code practically useful in a variety of applications, emphasis is being put on making it numerically efficient so that large event samples can be generated quickly. In its present form, the code can generate one million full events in about 12 seconds on a MacBook laptop computer. The development of this qualitatively new tool is still at an early stage and quantitative reproduction of existing data should not be expected until a number of detailed refinement have been implemented.

  17. Benchmarking the LAHET fission models

    SciTech Connect (OSTI)

    Prael, R.E.

    1995-12-31

    There has been considerable interest in improving the fission models in the LAHET Monte Carlo code for the transport and interaction of nucleons, pions, muons, fight ions, and antinucleons. Although subactinide fission contributes little to neutron production in lead or tungsten targets, it can be significant for simulation of target activation and fission product contamination. The availability of new data permits new comparisons to be made between experiment and calculation.

  18. Science based stockpile stewardship, uncertainty quantification, and fission fragment beams

    SciTech Connect (OSTI)

    Stoyer, M A; McNabb, D; Burke, J; Bernstein, L A; Wu, C Y

    2009-09-14

    Stewardship of this nation's nuclear weapons is predicated on developing a fundamental scientific understanding of the physics and chemistry required to describe weapon performance without the need to resort to underground nuclear testing and to predict expected future performance as a result of intended or unintended modifications. In order to construct more reliable models, underground nuclear test data is being reanalyzed in novel ways. The extent to which underground experimental data can be matched with simulations is one measure of the credibility of our capability to predict weapon performance. To improve the interpretation of these experiments with quantified uncertainties, improved nuclear data is required. As an example, the fission yield of a device was often determined by measuring fission products. Conversion of the measured fission products to yield was accomplished through explosion code calculations (models) and a good set of nuclear reaction cross-sections. Because of the unique high-fluence environment of an exploding nuclear weapon, many reactions occurred on radioactive nuclides, for which only theoretically calculated cross-sections are available. Inverse kinematics reactions at CARIBU offer the opportunity to measure cross-sections on unstable neutron-rich fission fragments and thus improve the quality of the nuclear reaction cross-section sets. One of the fission products measured was {sup 95}Zr, the accumulation of all mass 95 fission products of Y, Sr, Rb and Kr (see Fig. 1). Subsequent neutron-induced reactions on these short lived fission products were assumed to cancel out - in other words, the destruction of mass 95 nuclides was more or less equal to the production of mass 95 nuclides. If a {sup 95}Sr was destroyed by an (n,2n) reaction it was also produced by (n,2n) reactions on {sup 96}Sr, for example. However, since these nuclides all have fairly short half-lives (seconds to minutes or even less), no experimental nuclear reaction cross-sections exist, and only theoretically modeled cross-sections are available. Inverse kinematics reactions at CARIBU offer the opportunity, should the beam intensity be sufficient, to measure cross-sections on a few important nuclides in order to benchmark the theoretical calculations and significantly improve the nuclear data. The nuclides in Fig. 1 are prioritized by importance factor and displayed in stoplight colors, green the highest and red the lowest priority.

  19. Testing actinide fission yield treatment in CINDER90 for use in MCNP6 burnup calculations

    SciTech Connect (OSTI)

    Fensin, Michael Lorne; Umbel, Marissa

    2015-09-18

    Most of the development of the MCNPX/6 burnup capability focused on features that were applied to the Boltzman transport or used to prepare coefficients for use in CINDER90, with little change to CINDER90 or the CINDER90 data. Though a scheme exists for best solving the coupled Boltzman and Bateman equations, the most significant approximation is that the employed nuclear data are correct and complete. Thus, the CINDER90 library file contains 60 different actinide fission yields encompassing 36 fissionable actinides (thermal, fast, high energy and spontaneous fission). Fission reaction data exists for more than 60 actinides and as a result, fission yield data must be approximated for actinides that do not possess fission yield information. Several types of approximations are used for estimating fission yields for actinides which do not possess explicit fission yield data. The objective of this study is to test whether or not certain approximations of fission yield selection have any impact on predictability of major actinides and fission products. Further we assess which other fission products, available in MCNP6 Tier 3, result in the largest difference in production. Because the CINDER90 library file is in ASCII format and therefore easily amendable, we assess reasons for choosing, as well as compare actinide and major fission product prediction for the H. B. Robinson benchmark for, three separate fission yield selection methods: (1) the current CINDER90 library file method (Base); (2) the element method (Element); and (3) the isobar method (Isobar). Results show that the three methods tested result in similar prediction of major actinides, Tc-99 and Cs-137; however, certain fission products resulted in significantly different production depending on the method of choice.

  20. The series of carbon-chain complexes {Ru(dppe)Cp*}?{?-(C?C)x} (x = 48, 11): Synthesis, structures, properties and some reactions

    SciTech Connect (OSTI)

    Bruce, Michael I.; Cole, Marcus L.; Ellis, Benjamin G.; Gaudio, Maryka; Nicholson, Brian K.; Parker, Christian R.; Skelton, Brian W.; White, Allan H.

    2015-01-28

    The construction of a series of compounds {Ru(dppe)Cp*}2(?-C2x) (Ru*-C2x-Ru*, x = 48, 11)) is described. A direct reaction between RuCl(dppe)Cp* and Me3Si(Ctriple bond; length of mdashC)4SiMe3 afforded Ru*-C8-Ru* in 89% yield. The Pd(0)/Cu(I)-catalysed coupling of Ru{Ctriple bond; length of mdashCCtriple bond; length of mdashCAu(PPh3)}(dppe)Cp*Ru*-C4-Au (2 equiv.) with diiodoethyne gave Ru*-C10-Ru* (64%), or of 1 equiv. with I(Ctriple bond; length of mdashC)3I gave Ru*-C14-Ru* (36%); similarly, Ru{(Ctriple bond; length of mdashC)4Au(PPh3)}(dppe)Cp*Ru*-C8-Au and I(Ctriple bond; length of mdashC)3I gave Ru*-C22-Ru* (12%). Desilylation (TBAF) of Ru{(Ctriple bond; length of mdashC)xSiMe3}(dppe)Cp*Ru*-C2x-Si (x = 3, 4) followed by oxidative coupling [Cu(OAc)2/py] gave Ru*-C12-Ru* (82%) and Ru*-C16-Ru* (58%), respectively. Similar oxidative coupling of Ru(Ctriple bond; length of mdashCCtriple bond; length of mdashCH)(dppe)Cp* was a second route to Ru*-C8-Ru* (82%). Appropriate precursors are already known, or obtained by coupling of Ru*-C2x-Si (x = 2, 4) with AuCl(PPh3)/NaOMe [Ru*-C4-Au, 95%; Ru*-C8-Au, 74%] or from Pd(0)/Cu(I) catalysed coupling of Ru*-C2x-Au (x = 2, 3) with I(Ctriple bond; length of mdashC)2SiMe3 (Ru*-C8-Si, 64%; Ru*-C10-Si, 2%). Reactions between Ru*-C2x-Ru* (x = 3, 4) and Fe2(CO)9 gave {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}2Fe(C3-Ru*)2 and {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}{?3-C(Ctriple bond; length of mdashC)2[Ru(dppe)Cp*]} Fe(C3-Ru*)(C5-Ru*), respectively. The redox properties of the series of complexes with 2x = 216 were measured and showed a diminution of the separation of the first two oxidation potentials, ?E = E2 - E1, with increasing carbon chain length. The X-ray-determined molecular structures of Ru*-C8-Si, Ru*-C8-Ru*, Ru*-C14-Ru* (two C6H6 solvates), {Ru(PPh3)2Cp}2{?-(Ctriple bond; length of mdashC)4}4CHCl3Ru-C8-Ru4CHCl3 and of Fe(C3-Ru*)2 and Fe(C3-Ru*)(C5-Ru*) are reported.

  1. Fission Product Data Measured at Los Alamos for Fission Spectrum and Thermal Neutrons on {sup 239}Pu, {sup 235}U, {sup 238}U

    SciTech Connect (OSTI)

    Selby, H.D.; Mac Innes, M.R.; Barr, D.W.; Keksis, A.L.; Meade, R.A.; Burns, C.J.; Chadwick, M.B.; Wallstrom, T.C.

    2010-12-15

    We describe measurements of fission product data at Los Alamos that are important for determining the number of fissions that have occurred when neutrons are incident on plutonium and uranium isotopes. The fission-spectrum measurements were made using a fission chamber designed by the National Institute for Standards and Technology (NIST) in the BIG TEN critical assembly, as part of the Inter-laboratory Liquid Metal Fast Breeder Reactor (LMFBR) Reaction Rate (ILRR) collaboration. The thermal measurements were made at Los Alamos' Omega West Reactor. A related set of measurements were made of fission-product ratios (so-called R-values) in neutron environments provided by a number of Los Alamos critical assemblies that range from having average energies causing fission of 400-600 keV (BIG TEN and the outer regions of the Flattop-25 assembly) to higher energies (1.4-1.9 MeV) in the Jezebel, and in the central regions of the Flattop-25 and Flattop-Pu, critical assemblies. From these data we determine ratios of fission product yields in different fuel and neutron environments (Q-values) and fission product yields in fission spectrum neutron environments for {sup 99}Mo, {sup 95}Zr, {sup 137}Cs, {sup 140}Ba, {sup 141,143}Ce, and {sup 147}Nd. Modest incident-energy dependence exists for the {sup 147}Nd fission product yield; this is discussed in the context of models for fission that include thermal and dynamical effects. The fission product data agree with measurements by Maeck and other authors using mass-spectrometry methods, and with the ILRR collaboration results that used gamma spectroscopy for quantifying fission products. We note that the measurements also contradict earlier 1950s historical Los Alamos estimates by {approx}5-7%, most likely owing to self-shielding corrections not made in the early thermal measurements. Our experimental results provide a confirmation of the England-Rider ENDF/B-VI evaluated fission-spectrum fission product yields that were carried over to the ENDF/B-VII.0 library, except for {sup 99}Mo where the present results are about 4%-relative higher for neutrons incident on {sup 239}Pu and {sup 235}U. Additionally, our results illustrate the importance of representing the incident energy dependence of fission product yields over the fast neutron energy range for high-accuracy work, for example the {sup 147}Nd from neutron reactions on plutonium. An upgrade to the ENDF library, for ENDF/B-VII.1, based on these and other data, is described in a companion paper to this work.

  2. Post-scission fission theory: Neutron emission in fission

    SciTech Connect (OSTI)

    Madland, D.G.

    1997-11-01

    A survey of theoretical representations of two of the observables in neutron emission in fission is given, namely, the prompt fission neutron spectrum N (E) and the average prompt neutron multiplicity {bar {nu}}{sub p}. Early representations of the two observables are presented and their deficiencies are discussed. This is followed by summaries and examples of recent theoretical models for the calculation of these quantities. Emphasis is placed upon the predictability and accuracy of the recent models. In particular, the dependencies of N (E) and {bar {nu}}{sub p} upon the fissioning nucleus and its excitation energy are treated. Recent work in the calculation of the prompt fission neutron spectrum matrix N (E, E{sub n}), where E{sub n} is the energy of the neutron inducing fission, is then discussed. Concluding remarks address the current status of our ability to calculate these observables with confidence, the direction of future theoretical efforts, and limitations to current (and future) approaches.

  3. Localization of human elav-like neuronal protein 1 (Hel-N1) on chromosome 9p21 by chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization

    SciTech Connect (OSTI)

    Han, Jian; Knops, J.F.; Longshore, J.W.; King, P.H.

    1996-08-15

    Hel-N1 is a member of the highly conserved elav family of neuronal genes. It shares considerable sequence homology with HuD, another human member, and both genes are expressed in brain. HuD was recently mapped to chromosome 1p34. Here, we have utilized chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization to map Hel-N1 to chromosome 9p21. The different chromosomal locations of these homologous genes underscore their distinct identities. 10 refs., 2 figs.

  4. Fission Particle Emission Multiplicity Simulation

    Energy Science and Technology Software Center (OSTI)

    2006-09-27

    Simulates discrete neutron and gamma-ray emission from the fission of heavy nuclei that is either spontaneous or neutron induced. This is a function library that encapsulates the fission physics and is intended to be called Monte Carlo transport code.

  5. Fission throughout the periodic table

    SciTech Connect (OSTI)

    Moretto, L.G.; Wozniak, G.J.

    1989-04-01

    The dualistic view of fission and evaporation as two distinct compound nucleus processes is substituted with a unified view in which fission, complex fragment emission, and light particle evaporation are seen as different aspects of a single process. 47 refs., 22 figs.

  6. Average and effective Q-values for fission product average (n...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Average and effective Q-values for fission product average (n,2n) and (n,3n) reaction cross sections Citation Details In-Document Search Title: Average and...

  7. Microscopic Description of Induced Nuclear Fission (Conference...

    Office of Scientific and Technical Information (OSTI)

    Microscopic Description of Induced Nuclear Fission Citation Details In-Document Search Title: Microscopic Description of Induced Nuclear Fission You are accessing a document...

  8. Excitation Energy Sorting Mechanisms in Fission (Conference)...

    Office of Scientific and Technical Information (OSTI)

    Excitation Energy Sorting Mechanisms in Fission Citation Details In-Document Search Title: Excitation Energy Sorting Mechanisms in Fission You are accessing a document from the...

  9. Testing actinide fission yield treatment in CINDER90 for use in MCNP6 burnup calculations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Fensin, Michael Lorne; Umbel, Marissa

    2015-09-18

    Most of the development of the MCNPX/6 burnup capability focused on features that were applied to the Boltzman transport or used to prepare coefficients for use in CINDER90, with little change to CINDER90 or the CINDER90 data. Though a scheme exists for best solving the coupled Boltzman and Bateman equations, the most significant approximation is that the employed nuclear data are correct and complete. Thus, the CINDER90 library file contains 60 different actinide fission yields encompassing 36 fissionable actinides (thermal, fast, high energy and spontaneous fission). Fission reaction data exists for more than 60 actinides and as a result, fissionmore » yield data must be approximated for actinides that do not possess fission yield information. Several types of approximations are used for estimating fission yields for actinides which do not possess explicit fission yield data. The objective of this study is to test whether or not certain approximations of fission yield selection have any impact on predictability of major actinides and fission products. Further we assess which other fission products, available in MCNP6 Tier 3, result in the largest difference in production. Because the CINDER90 library file is in ASCII format and therefore easily amendable, we assess reasons for choosing, as well as compare actinide and major fission product prediction for the H. B. Robinson benchmark for, three separate fission yield selection methods: (1) the current CINDER90 library file method (Base); (2) the element method (Element); and (3) the isobar method (Isobar). Results show that the three methods tested result in similar prediction of major actinides, Tc-99 and Cs-137; however, certain fission products resulted in significantly different production depending on the method of choice.« less

  10. Spontaneous Fission Modes and Lifetimes of Superheavy Elements in the Nuclear Density Functional Theory

    SciTech Connect (OSTI)

    Staszczak, A,

    2013-01-01

    Background: The reactions with the neutron-rich 48Ca beam and actinide targets resulted in the detection of new superheavy (SH) nuclides with Z=104 118. The unambiguous identification of the new isotopes, however, still poses a problem because their -decay chains terminate by spontaneous fission (SF) before reaching the known region of the nuclear chart. The understanding of the competition between -decay and SF channels in SH nuclei is, therefore, of crucial importance for our ability to map the SH region and to assess its extent.

    Purpose: We perform self-consistent calculations of the competing decay modes of even-even SH isotopes with 108 Z 126 and 148 N 188.

    Methods: We use the state-of-the-art computational framework based on self-consistent symmetry-unrestricted nuclear density functional theory capable of describing the competition between nuclear attraction and electrostatic repulsion. We apply the SkM* Skyrme energy density functional. The collective mass tensor of the fissioning superfluid nucleus is computed by means of the cranking approximation to the adiabatic time-dependent Hartree-Fock-Bogoliubov (HFB) approach. This paper constitutes a systematic self-consistent study of spontaneous fission in the SH region, carried out at a full HFB level, that simultaneously takes into account both triaxiality and reflection asymmetry.

    Results: Breaking axial symmetry and parity turns out to be crucial for a realistic estimate of collective action; it results in lowering SF lifetimes by more than 7 orders of magnitude in some cases. We predict two competing SF modes: reflection symmetric modes and reflection asymmetric modes.

    Conclusions: The shortest-lived SH isotopes decay by SF; they are expected to lie in a narrow corridor formed by 280Hs, 284Fl, and 118284Uuo that separates the regions of SH nuclei synthesized in cold-fusion and hot-fusion reactions. The region of long-lived SH nuclei is expected to be centered on 294Ds with a total half-life of 1.5 days. Our survey provides a solid benchmark for the future improvements of self-consistent SF calculations in the region of SH nuclei.

  11. Average and effective Q-values for fission product average (n,2n) and

    Office of Scientific and Technical Information (OSTI)

    (n,3n) reaction cross sections (Technical Report) | SciTech Connect Technical Report: Average and effective Q-values for fission product average (n,2n) and (n,3n) reaction cross sections Citation Details In-Document Search Title: Average and effective Q-values for fission product average (n,2n) and (n,3n) reaction cross sections Authors: Kawano, Toshihiko [1] + Show Author Affiliations Los Alamos National Laboratory (LANL), Los Alamos, NM (United States) Publication Date: 2015-10-01 OSTI

  12. Control system for a small fission reactor

    DOE Patents [OSTI]

    Burelbach, J.P.; Kann, W.J.; Saiveau, J.G.

    1985-02-08

    A system for controlling the reactivity of a small fission reactor includes an elongated, flexible hollow tube in the general form of a helical coiled spring axially positioned around and outside of the reactor vessel in an annular space between the reactor vessel and a surrounding cylindrical-shaped neutron reflector. A neutron absorbing material is provided within the hollow tube with the rate of the reaction controlled by the extension and compression of the hollow tube, e.g., extension of the tube increases reactivity while its compression reduces reactivity, in varying the amount of neutron absorbing material disposed between the reactor vessel and the neutron reflector. Conventional mechanical displacement means may be employed to control the coil density of the hollow tube as desired.

  13. Search for Singlet Fission Chromophores

    SciTech Connect (OSTI)

    Havlas, Z.; Akdag, A.; Smith, M. B.; Dron, P.; Johnson, J. C.; Nozik, A. J.; Michl, J.

    2012-01-01

    Singlet fission, in which a singlet excited chromophore shares its energy with a ground-state neighbor and both end up in their triplet states, is of potential interest for solar cells. Only a handful of compounds, mostly alternant hydrocarbons, are known to perform efficiently. In view of the large number of conditions that a successful candidate for a practical cell has to meet, it appears desirable to extend the present list of high performers to additional classes of compounds. We have (i) identified design rules for new singlet fission chromophores and for their coupling to covalent dimers, (ii) synthesized them, and (iii) evaluated their performance as neat solids or covalent dimers.

  14. Process for treating fission waste. [Patent application

    DOE Patents [OSTI]

    Rohrmann, C.A.; Wick, O.J.

    1981-11-17

    A method is described for the treatment of fission waste. A glass forming agent, a metal oxide, and a reducing agent are mixed with the fission waste and the mixture is heated. After melting, the mixture separates into a glass phase and a metal phase. The glass phase may be used to safely store the fission waste, while the metal phase contains noble metals recovered from the fission waste.

  15. Suppressed-fission ICF hybrid reactor

    SciTech Connect (OSTI)

    Hogan, W.J.; Meier, W.R.

    1986-05-20

    A suppressed-fission ICF hybrid reactor has been designed to maximize the production of /sup 233/U. In this design, Be is used as a neutron multiplier. An annular array of Be columns surrounds the fusion pulse inside the reaction chember. The Be columns consist of short cylinders of Be joined together with steel snap rings. Vertical holes in the Be carry liquid lithium coolant and steel-clad thorium fuel pins. The lithium coolant is supplied at the top of the chamber, traverses through the Be columns and exits at the bottom. The columns are attached to top and bottom plates in such a way as to tolerate radiation-induced swelling and the vibrations resulting from each fusion pulse. A thin (10 cm) liquid Li fall region protects the Be columns from direct exposure to the X-rays and debris emitted by the fuel capsule. A neutronics study of this design indicates that the specific production of /sup 233/U fuel is increased by operating at relatively large thorium volume fractions. A design at a fertile fuel fraction of 30 vol % produces a total breeding ratio of over 2.1. The /sup 6/Li to /sup 7/Li ratio is adjusted to keep the tritium breeding ratio at about 1.0. In such a reactor, about 3400 kg of /sup 233/U can be produced per full power year at a fusion power level of 800 MW. Reactor support ratios greater than 13 can be achieved, leading to beneficial results even if the fusion reactor cost is significantly greater than that of a fission reactor.

  16. Fission Product Yields of {sup 233}U, {sup 235}U, {sup 238}U and {sup 239}Pu in Fields of Thermal Neutrons, Fission Neutrons and 14.7-MeV Neutrons

    SciTech Connect (OSTI)

    Laurec, J.; Adam, A.; Bruyne, T. de [Commissariat a l'Energie Atomique, Centre DAM-Ile de France (CEA DAM DIF), 91297 Arpajon (France); Bauge, E., E-mail: eric.bauge@cea.f [Commissariat a l'Energie Atomique, Centre DAM-Ile de France (CEA DAM DIF), 91297 Arpajon (France); Granier, T.; Aupiais, J.; Bersillon, O.; Le Petit, G. [Commissariat a l'Energie Atomique, Centre DAM-Ile de France (CEA DAM DIF), 91297 Arpajon (France); Authier, N.; Casoli, P. [Commissariat a l'Energie Atomique, Centre de Valduc, 21120 Is-sur-Tille (France)

    2010-12-15

    The yields of more than fifteen fission products have been carefully measured using radiochemical techniques, for {sup 235}U(n,f), {sup 239}Pu(n,f) in a thermal spectrum, for {sup 233}U(n,f), {sup 235}U(n,f), and {sup 239}Pu(n,f) reactions in a fission neutron spectrum, and for {sup 233}U(n,f), {sup 235}U(n,f), {sup 238}U(n,f), and {sup 239}Pu(n,f) for 14.7 MeV monoenergetic neutrons. Irradiations were performed at the EL3 reactor, at the Caliban and Prospero critical assemblies, and at the Lancelot electrostatic accelerator in CEA-Valduc. Fissions were counted in thin deposits using fission ionization chambers. The number of fission products of each species were measured by gamma spectrometry of co-located thick deposits.

  17. Small Self-Regulating Fission Reactor System

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    359 This document is approved for public release; further dissemination unlimited Small Self-Regulating Fission Reactor System ANTICIPATED IMPACT PATH FORWARD DESCRIPTION BACKGROUND & MOTIVATION INNOVATION A power system for special government applications Point of Contact: Patrick McClure, NEN-5, pmcclure@lanl.gov (505)667-9534 Small Self-Regulating Fission Reactor System A small self- regulating fission reactor made with U 235 . LANL and NASA with the support of NSTec performed a proof of

  18. Fission barriers and half-lives

    SciTech Connect (OSTI)

    Moeller, P.; Nix, J.R.; Swiatecki, W.J.

    1989-01-01

    We briefly review the development of theoretical models for the calculation of fission barriers and half-lives. We focus on how results of actual calculations in a unified macroscopic-microscopic approach provide an interpretation of the mechanisms behind some of the large number of phenomena observed in fission. As instructive examples we choose studies of the rapidly varying fission properties of elements at the end of the periodic system. 31 refs., 10 figs.

  19. Manhattan Project: Fission Comes to America, 1939

    Office of Scientific and Technical Information (OSTI)

    Excerpt from the comic book "Adventures Inside the Atom." Click on this image or visit the "Library" to view the whole comic book. FISSION COMES TO AMERICA (1939) Events > Atomic Discoveries, 1890s-1939 A Miniature Solar System, 1890s-1919 Exploring the Atom, 1919-1932 Atomic Bombardment, 1932-1938 The Discovery of Fission, 1938-1939 Fission Comes to America, 1939 News of the fission experiments of Otto Hahn and Fritz Strassmann, and of the Meitner-Frisch calculations that

  20. FISSION PRODUCT REMOVAL FROM ORGANIC SOLUTIONS

    DOE Patents [OSTI]

    Moore, R.H.

    1960-05-10

    The decontamination of organic solvents from fission products and in particular the treatment of solvents that were used for the extraction of uranium and/or plutonium from aqueous acid solutions of neutron-irradiated uranium are treated. The process broadly comprises heating manganese carbonate in air to a temperature of between 300 and 500 deg C whereby manganese dioxide is formed; mixing the manganese dioxide with the fission product-containing organic solvent to be treated whereby the fission products are precipitated on the manganese dioxide; and separating the fission product-containing manganese dioxide from the solvent.

  1. Control of a laser inertial confinement fusion-fission power plant

    SciTech Connect (OSTI)

    Moses, Edward L; Latkowski, Jeffrey F; Kramer, Kevin J

    2015-11-05

    A laser inertial-confinement fusion-fission energy power plant is described. The fusion-fission hybrid system uses inertial confinement fusion to produce neutrons from a fusion reaction of deuterium and tritium. The fusion neutrons drive a sub-critical blanket of fissile or fertile fuel. A coolant circulated through the fuel extracts heat from the fuel that is used to generate electricity. The inertial confinement fusion reaction can be implemented using central hot spot or fast ignition fusion, and direct or indirect drive. The fusion neutrons result in ultra-deep burn-up of the fuel in the fission blanket, thus enabling the burning of nuclear waste. Fuels include depleted uranium, natural uranium, enriched uranium, spent nuclear fuel, thorium, and weapons grade plutonium. LIFE engines can meet worldwide electricity needs in a safe and sustainable manner, while drastically shrinking the highly undesirable stockpiles of depleted uranium, spent nuclear fuel and excess weapons materials.

  2. Control of a laser inertial confinement fusion-fission power plant

    SciTech Connect (OSTI)

    Moses, Edward I.; Latkowski, Jeffery F.; Kramer, Kevin J.

    2015-10-27

    A laser inertial-confinement fusion-fission energy power plant is described. The fusion-fission hybrid system uses inertial confinement fusion to produce neutrons from a fusion reaction of deuterium and tritium. The fusion neutrons drive a sub-critical blanket of fissile or fertile fuel. A coolant circulated through the fuel extracts heat from the fuel that is used to generate electricity. The inertial confinement fusion reaction can be implemented using central hot spot or fast ignition fusion, and direct or indirect drive. The fusion neutrons result in ultra-deep burn-up of the fuel in the fission blanket, thus enabling the burning of nuclear waste. Fuels include depleted uranium, natural uranium, enriched uranium, spent nuclear fuel, thorium, and weapons grade plutonium. LIFE engines can meet worldwide electricity needs in a safe and sustainable manner, while drastically shrinking the highly undesirable stockpiles of depleted uranium, spent nuclear fuel and excess weapons materials.

  3. Comparative studies of actinide and sub-actinide fission cross section calculation from MCNP6 and TALYS

    SciTech Connect (OSTI)

    Perkasa, Y. S.; Waris, A. Kurniadi, R. Su'ud, Z.

    2014-09-30

    Comparative studies of actinide and sub-actinide fission cross section calculation from MCNP6 and TALYS have been conducted. In this work, fission cross section resulted from MCNP6 prediction will be compared with result from TALYS calculation. MCNP6 with its event generator CEM03.03 and LAQGSM03.03 have been validated and verified for several intermediate and heavy nuclides fission reaction data and also has a good agreement with experimental data for fission reaction that induced by photons, pions, and nucleons at energy from several ten of MeV to about 1 TeV. The calculation that induced within TALYS will be focused mainly to several hundred MeV for actinide and sub-actinide nuclides and will be compared with MCNP6 code and several experimental data from other evaluator.

  4. Monitoring system for a liquid-cooled nuclear fission reactor

    DOE Patents [OSTI]

    DeVolpi, Alexander (Bolingbrook, IL)

    1987-01-01

    A monitoring system for detecting changes in the liquid levels in various regions of a water-cooled nuclear power reactor, viz., in the downcomer, in the core, in the inlet and outlet plenums, at the head, and elsewhere; and also for detecting changes in the density of the liquid in these regions. A plurality of gamma radiation detectors are used, arranged vertically along the outside of the reactor vessel, and collimator means for each detector limits the gamma-radiation it receives as emitting from only isolated regions of the vessel. Excess neutrons produced by the fission reaction will be captured by the water coolant, by the steel reactor walls, or by the fuel or control structures in the vessel. Neutron capture by steel generates gamma radiation having an energy level of the order of 5-12 MeV, whereas neutron capture by water provides an energy level of approximately 2.2 MeV, and neutron capture by the fission fuel or its cladding provides an energy level of 1 MeV or less. The intensity of neutron capture thus changes significantly at any water-metal interface. Comparative analysis of adjacent gamma detectors senses changes from the normal condition with liquid coolant present to advise of changes in the presence and/or density of the coolant at these specific regions. The gamma detectors can also sense fission-product gas accumulation at the reactor head to advise of a failure of fuel-pin cladding.

  5. Control system for a small fission reactor

    DOE Patents [OSTI]

    Burelbach, James P. (Glen Ellyn, IL); Kann, William J. (Park Ridge, IL); Saiveau, James G. (Hickory Hills, IL)

    1986-01-01

    A system for controlling the reactivity of a small fission reactor includes an elongated, flexible hollow tube in the general form of a helical coiled spring axially positioned around and outside of the reactor vessel in an annular space between the reactor vessel and a surrounding cylindrical-shaped neutron reflector. A neutron absorbing material is provided within the hollow tube with the rate of the reaction controlled by the extension and compression of the hollow tube, e.g., extension of the tube increases reactivity while its compression reduces reactivity, in varying the amount of neutron absorbing material disposed between the reactor vessel and the neutron reflector. Conventional mechanical displacement means may be employed to control the coil density of the hollow tube as desired. In another embodiment, a plurality of flexible hollow tubes each containing a neutron absorber are positioned adjacent to one another in spaced relation around the periphery of the reactor vessel and inside the outer neutron reflector with reactivity controlled by the extension and compression of all or some of the coiled hollow tubes. Yet another embodiment of the invention envisions the neutron reflector in the form of an expandable coil spring positioned in an annular space between the reactor vessel and an outer neutron absorbing structure for controlling the neutron flux reflected back into the reactor vessel.

  6. Fission Product Transmutation in Mixed Radiation Fields

    SciTech Connect (OSTI)

    Harmon, Frank; Burgett, Erick; Starovoitova, Valeriia; Tsveretkov, Pavel

    2015-01-15

    Work under this grant addressed a part of the challenge facing the closure of the nuclear fuel cycle; reducing the radiotoxicity of lived fission products (LLFP). It was based on the possibility that partitioning of isotopes and accelerator-based transmutation on particular LLFP combined with geological disposal may lead to an acceptable societal solution to the problem of management. The feasibility of using photonuclear processes based on the excitation of the giant dipole resonance (GDR) by bremsstrahlung radiation as a cost effective transmutation method was accessed. The nuclear reactions of interest: (?,xn), (n,?), (?,p) can be induced by bremsstrahlung radiation produced by high power electron accelerators. The driver of these processes would be an accelerator that produces a high energy and high power electron beam of ~ 100 MeV. The major advantages of such accelerators for this purpose are that they are essentially available off the shelf and potentially would be of reasonable cost for this application. Methods were examined that used photo produced neutrons or the bremsstrahlung photons only, or use both photons and neutrons in combination for irradiations of selected LLFP. Extrapolating the results to plausible engineering scale transmuters it was found that the energy cost for 129I and 99Tc transmutation by these methods are about 2 and 4%, respectively, of the energy produced from 1000MWe.

  7. Future challenges for nuclear data research in fission (u) (Journal

    Office of Scientific and Technical Information (OSTI)

    Article) | SciTech Connect Journal Article: Future challenges for nuclear data research in fission (u) Citation Details In-Document Search Title: Future challenges for nuclear data research in fission (u) I describe some high priority research areas in nuclear fission, where applications in nuclear reactor technologies and in modeling criticality in general are demanding higher accuracies in our databases. We focus on fission cross sections, fission neutron spectra, and fission product data.

  8. Prompt fission neutron spectra of actinides

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Capote, R.; Chen, Y. -J.; Hambsch, F. -J.; Kornilov, N. V.; Lestone, J. P.; Litaize, O.; Morillon, B.; Neudecker, D.; Oberstedt, S.; Ohsawa, T.; et al

    2016-01-06

    Here, the energy spectrum of prompt neutrons emitted in fission (PFNS) plays a very important role in nuclear science and technology. A Coordinated Research Project (CRP) "Evaluation of Prompt Fission Neutron Spectra of Actinides" was established by the IAEA Nuclear Data Section in 2009, with the major goal to produce new PFNS evaluations with uncertainties for actinide nuclei.

  9. Theoretical Description of the Fission Process

    SciTech Connect (OSTI)

    Witold Nazarewicz

    2009-10-25

    Advanced theoretical methods and high-performance computers may finally unlock the secrets of nuclear fission, a fundamental nuclear decay that is of great relevance to society. In this work, we studied the phenomenon of spontaneous fission using the symmetry-unrestricted nuclear density functional theory (DFT). Our results show that many observed properties of fissioning nuclei can be explained in terms of pathways in multidimensional collective space corresponding to different geometries of fission products. From the calculated collective potential and collective mass, we estimated spontaneous fission half-lives, and good agreement with experimental data was found. We also predicted a new phenomenon of trimodal spontaneous fission for some transfermium isotopes. Our calculations demonstrate that fission barriers of excited superheavy nuclei vary rapidly with particle number, pointing to the importance of shell effects even at large excitation energies. The results are consistent with recent experiments where superheavy elements were created by bombarding an actinide target with 48-calcium; yet even at high excitation energies, sizable fission barriers remained. Not only does this reveal clues about the conditions for creating new elements, it also provides a wider context for understanding other types of fission. Understanding of the fission process is crucial for many areas of science and technology. Fission governs existence of many transuranium elements, including the predicted long-lived superheavy species. In nuclear astrophysics, fission influences the formation of heavy elements on the final stages of the r-process in a very high neutron density environment. Fission applications are numerous. Improved understanding of the fission process will enable scientists to enhance the safety and reliability of the nations nuclear stockpile and nuclear reactors. The deployment of a fleet of safe and efficient advanced reactors, which will also minimize radiotoxic waste and be proliferation-resistant, is a goal for the advanced nuclear fuel cycles program. While in the past the design, construction, and operation of reactors were supported through empirical trials, this new phase in nuclear energy production is expected to heavily rely on advanced modeling and simulation capabilities.

  10. Time dependent particle emission from fission products (Conference...

    Office of Scientific and Technical Information (OSTI)

    Time dependent particle emission from fission products Citation Details In-Document Search Title: Time dependent particle emission from fission products You are accessing a...

  11. Future challenges for nuclear data research in fission (u) (Journal...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Future challenges for nuclear data research in fission (u) Citation Details In-Document Search Title: Future challenges for nuclear data research in fission (u) ...

  12. Density Functional Theory Approach to Nuclear Fission (Conference...

    Office of Scientific and Technical Information (OSTI)

    Density Functional Theory Approach to Nuclear Fission Citation Details In-Document Search Title: Density Functional Theory Approach to Nuclear Fission You are accessing a...

  13. Error estimates for fission neutron outputs (Conference) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    Error estimates for fission neutron outputs Citation Details In-Document Search Title: Error estimates for fission neutron outputs You are accessing a document from the...

  14. The Microscopic Theory of Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Presented at: 4th international workshop on nuclear fission and fission-product spectroscopy, cadarache, France, May 13 - May 16, 2009 Research Org: ...

  15. Advanced modeling of prompt fission neutrons (Conference) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: 4th International Workshop on Nuclear Fission and Fission-Product Spectroscopy ; May 13, 2009 ; Cadarache, France Research Org: Los Alamos National ...

  16. Density Functional Theory Approach to Nuclear Fission (Conference...

    Office of Scientific and Technical Information (OSTI)

    Density Functional Theory Approach to Nuclear Fission Citation Details In-Document Search Title: Density Functional Theory Approach to Nuclear Fission Authors: Schunck, N Publication ...

  17. Description of induced nuclear fission with Skyrme energy functionals...

    Office of Scientific and Technical Information (OSTI)

    Citation Details In-Document Search Title: Description of induced nuclear fission with Skyrme energy functionals: Static potential energy surfaces and fission fragment properties ...

  18. Development of position-sensitive time-of-flight spectrometer for fission fragment research

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Arnold, C. W.; Tovesson, F.; Meierbachtol, K.; Bredeweg, T.; Jandel, M.; Jorgenson, H. J.; Laptev, A.; Rusev, G.; Shields, D. W.; White, M.; et al

    2014-07-09

    A position-sensitive, high-resolution time-of-flight detector for fission fragments has been developed. The SPectrometer for Ion DEtermination in fission Research (SPIDER) is a 2E–2v spectrometer designed to measure the mass of light fission fragments to a single mass unit. The time pick-off detector pairs to be used in SPIDER have been tested with α-particles from 229Th and its decay chain and α-particles and spontaneous fission fragments from 252Cf. Each detector module is comprised of thin electron conversion foil, electrostatic mirror, microchannel plates, and delay-line anodes. Particle trajectories on the order of 700 mm are determined accurately to within 0.7 mm. Flightmore » times were measured with 250 ps resolution FWHM. Computed particle velocities are accurate to within 0.06 mm/ns corresponding to a precision of 0.5%. As a result, an ionization chamber capable of 400 keV energy resolution coupled with the velocity measurements described here will pave the way for modestly efficient measurements of light fission fragments with unit mass resolution.« less

  19. Quantum nature of ROT and TRI asymmetries in the ternary fission of nuclei

    SciTech Connect (OSTI)

    Bunakov, V. E.; Kadmensky, S. G.; Kadmensky, S. S.

    2010-08-15

    Effects of T-odd asymmetry in ternary-nuclear-fission reactions induced by polarized cold neutrons are considered within quantum theory. It is shown that the asymmetry coefficient can be expressed in terms of experimental angular distributions of third particles in reactions induced by unpolarized neutrons. The explicit form of this coefficient makes it possible to explain the difference in the magnitudes and signs of the TRI and ROT effects observed experimentally for different targets.

  20. Fission-suppressed fusion breeder on the thorium cycle and nonproliferation

    SciTech Connect (OSTI)

    Moir, R. W.

    2012-06-19

    Fusion reactors could be designed to breed fissile material while suppressing fissioning thereby enhancing safety. The produced fuel could be used to startup and makeup fuel for fission reactors. Each fusion reaction can produce typically 0.6 fissile atoms and release about 1.6 times the 14 MeV neutron's energy in the blanket in the fission-suppressed design. This production rate is 2660 kg/1000 MW of fusion power for a year. The revenues would be doubled from such a plant by selling fuel at a price of 60/g and electricity at $0.05/kWh for Q=P{sub fusion}/P{sub input}=4. Fusion reactors could be designed to destroy fission wastes by transmutation and fissioning but this is not a natural use of fusion whereas it is a designed use of fission reactors. Fusion could supply makeup fuel to fission reactors that were dedicated to fissioning wastes with some of their neutrons. The design for safety and heat removal and other items is already accomplished with fission reactors. Whereas fusion reactors have geometry that compromises safety with a complex and thin wall separating the fusion zone from the blanket zone where wastes could be destroyed. Nonproliferation can be enhanced by mixing {sup 233}U with {sup 238}U. Also nonproliferation is enhanced in typical fission-suppressed designs by generating up to 0.05 {sup 232}U atoms for each {sup 233}U atom produced from thorium, about twice the IAEA standards of 'reduced protection' or 'self protection.' With 2.4%{sup 232}U, high explosive material is predicted to degrade owing to ionizing radiation after a little over 1/2 year and the heat rate is 77 W just after separation and climbs to over 600 W ten years later. The fissile material can be used to fuel most any fission reactor but is especially appropriate for molten salt reactors (MSR) also called liquid fluoride thorium reactors (LFTR) because of the molten fuel does not need hands on fabrication and handling.

  1. Sleeve reaction chamber system

    DOE Patents [OSTI]

    Northrup, M. Allen (Berkeley, CA); Beeman, Barton V. (San Mateo, CA); Benett, William J. (Livermore, CA); Hadley, Dean R. (Manteca, CA); Landre, Phoebe (Livermore, CA); Lehew, Stacy L. (Livermore, CA); Krulevitch, Peter A. (Pleasanton, CA)

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  2. A New Facility for High-Energy Neutron-Induced Fission Studies

    SciTech Connect (OSTI)

    Prokofiev, A.; Carlsson, M.; Einarsson, L.; Haag, N.; Pomp, S.; Bergenwall, B.; Blomgren, J.; Hildebrand, A.; Johansson, C.; Mermod, P.; Oesterlund, M.; Tippawan, U.; Dangtip, S.

    2005-05-24

    A new facility is constructed for measurements of neutron-induced fission cross sections in the 20-180 MeV energy region versus the np scattering cross section, which is adopted as the primary neutron standard. The advantage of the experiment compared to earlier studies is that the fission-fragment detection and the neutron-flux measurement via np scattering are performed simultaneously and at the same position in the beam, and, therefore, many sources of systematic errors cancel out. Further reduction of systematic errors is achieved due to 'embedded' determination of effective solid angle of particle detectors using {alpha}-particles from the radioactive decay of the target nuclei. The performance of the facility is illustrated by first data obtained for angular distributions of fission fragments in the 238U(n,f) reaction.

  3. Tri And Rot Effects In Ternary Fission: What Can Be Learned?

    SciTech Connect (OSTI)

    Goennenwein, F.; Gagarski, A.; Petrov, G.; Guseva, I.; Zavarukhina, T.; Mutterer, M.; Kalben, J. von; Kopatch, Yu.; Tiourine, G.; Trzaska, W.; Sillanpaea, M.; Soldner, T.; Nesvizhevsky, V.

    2010-04-30

    Inducing fission by polarized neutrons allows studying subtle effects of the dynamics of the process. In the present experiments ternary fission of {sup 235}U and {sup 239}Pu was investigated with cold neutrons in the (n,f) reaction at the Institut Laue-Langevin, Grenoble. Asymmetries in the emission of ternary particles were discovered by making use of the neutron spin flipping. It was found that two effects are interfering. There is first an asymmetry in the total yields of ternary particles having been called the TRI-effect. Second, it was observed that the angular distributions of ternary particles are shifted back and forth when flipping the neutron spin. This shift was named ROT effect. Guided by trajectory calculations of the three-body decay, the signs and sizes of the ROT effect are interpreted in terms of the K-numbers of the transition states at the saddle point of fission.

  4. Chemical behavior of fission products in the ORNL fission product release program. Supplement. [PWR; BWR

    SciTech Connect (OSTI)

    Collins, J.L.; Osborne, M.F.; Lorenz, R.A.

    1983-01-01

    Tests data are presented for BWR and PWR rods in test HI-4 and test HI-5. Operating conditions fission product release data are included.

  5. Aqueous cutting fluid for machining fissionable materials

    DOE Patents [OSTI]

    Duerksen, Walter K. (Norris, TN); Googin, John M. (Oak Ridge, TN); Napier, Jr., Bradley (Powell, TN)

    1984-01-01

    The present invention is directed to a cutting fluid for machining fissionable material. The cutting fluid is formed of glycol, water and boron compound in an adequate concentration for effective neutron attenuation so as to inhibit criticality incidents during machining.

  6. Modeling Fission Product Sorption in Graphite Structures

    SciTech Connect (OSTI)

    Szlufarska, Izabela; Morgan, Dane; Allen, Todd

    2013-04-08

    The goal of this project is to determine changes in adsorption and desorption of fission products to/from nuclear-grade graphite in response to a changing chemical environment. First, the project team will employ principle calculations and thermodynamic analysis to predict stability of fission products on graphite in the presence of structural defects commonly observed in very high- temperature reactor (VHTR) graphites. Desorption rates will be determined as a function of partial pressure of oxygen and iodine, relative humidity, and temperature. They will then carry out experimental characterization to determine the statistical distribution of structural features. This structural information will yield distributions of binding sites to be used as an input for a sorption model. Sorption isotherms calculated under this project will contribute to understanding of the physical bases of the source terms that are used in higher-level codes that model fission product transport and retention in graphite. The project will include the following tasks: Perform structural characterization of the VHTR graphite to determine crystallographic phases, defect structures and their distribution, volume fraction of coke, and amount of sp2 versus sp3 bonding. This information will be used as guidance for ab initio modeling and as input for sorptivity models; Perform ab initio calculations of binding energies to determine stability of fission products on the different sorption sites present in nuclear graphite microstructures. The project will use density functional theory (DFT) methods to calculate binding energies in vacuum and in oxidizing environments. The team will also calculate stability of iodine complexes with fission products on graphite sorption sites; Model graphite sorption isotherms to quantify concentration of fission products in graphite. The binding energies will be combined with a Langmuir isotherm statistical model to predict the sorbed concentration of fission products on each type of graphite site. The model will include multiple simultaneous adsorbing species, which will allow for competitive adsorption effects between different fission product species and O and OH (for modeling accident conditions).

  7. MCNP6 Fission Multiplicity with FMULT Card

    SciTech Connect (OSTI)

    Wilcox, Trevor; Fensin, Michael Lorne; Hendricks, John S.; James, Michael R.; McKinney, Gregg W.

    2012-06-18

    With the merger of MCNPX and MCNP5 into MCNP6, MCNP6 now provides all the capabilities of both codes allowing the user to access all the fission multiplicity data sets. Detailed in this paper is: (1) the new FMULT card capabilities for accessing these different data sets; (2) benchmark calculations, as compared to experiment, detailing the results of selecting these separate data sets for thermal neutron induced fission on U-235.

  8. Logging Calibration Models for Fission Neutron Sondes (September 1981) |

    Office of Environmental Management (EM)

    Department of Energy Logging Calibration Models for Fission Neutron Sondes (September 1981) Logging Calibration Models for Fission Neutron Sondes (September 1981) Logging Calibration Models for Fission Neutron Sondes (September 1981) PDF icon Logging Calibration Models for Fission Neutron Sondes (September 1981) More Documents & Publications A Model for Water Factor Measurements With Fission-Neutron Logging Tools (May 1983) Field Calibration Facilities for Environmental Measurement of

  9. Realistic fission models, new beta-decay half-lives and the r-process in neutron star mergers

    SciTech Connect (OSTI)

    Shibagaki, S.; Kajino, T. [Department of Astronomy, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Chiba, S. [Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology, Ookayama, Meguro-ku, Tokyo, 152-8850 (Japan); Lorusso, G.; Nishimura, S. [RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Mathews, G. J. [Center for Astrophysics, Department of Physics, University of Notre Dame, IN 46556 (United States)

    2014-05-02

    Almost half of heavy nuclei beyond iron are considered to be produced by rapid neutron capture process (r-process). This process occurs in the neutron-rich environment such as core-collapse supernovae or neutron star mergers, but the main production site is still unknown. In the r-process of neutron star mergers, nuclear fission reactions play an important role. Also beta-decay half-lives of magic nuclei are crucial for the r-process. We have carried out r-process nucleosynthesis calculations based upon new theoretical estimates of fission fragment distributions and new beta-decay half-lives for N=82 nuclei measured at RIBF-RIKEN. We investigate the effect of nuclear fission on abundance patterns in the matter ejected from neutron star mergers with two different fission fragment mass distributions. We also discuss how the new experimental beta-decay half-lives affect the r-process.

  10. Event-by-event fission simulation code, generates complete fission events

    Energy Science and Technology Software Center (OSTI)

    2013-04-01

    FREYA is a computer code that generates complete fission events. The output includes the energy and momentum of these final state particles: fission products, prompt neutrons and prompt photons. The version of FREYA that is to be released is a module for MCNP6.

  11. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, Richard P. (Livermore, CA)

    1992-01-01

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain.

  12. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, R.P.

    1992-10-20

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain. 6 figs.

  13. Heavy Element Synthesis Reactions W. Loveland Oregon State University

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reactions W. Loveland Oregon State University The role of ATLAS in helping us understand heavy element synthesis reactions and heavy element properties * Hot (E*=35-60 MeV) and Cold (E*=15 MeV) fusion reactions * Multi-nucleon transfer reactions * Fission * Atomic physics and chemistry of the heaviest elements * Structure of the heaviest nuclei The challenge of studying the heaviest elements at ATLAS * ATLAS beam time is oversubscribed * Low cross section studies - High luminosity - ATLAS has

  14. Statistics at work in heavy-ion reactions

    SciTech Connect (OSTI)

    Moretto, L.G.

    1982-07-01

    In the first part special aspects of the compound nucleus decay are considered. The evaporation of particles intermediate between nucleons and fission fragments is explored both theoretically and experimentally. The limitations of the fission decay width expression obtained with the transition state method are discussed, and a more general approach is proposed. In the second part the process of angular momentum transfer in deep inelastic reactions is considered. The limit of statistical equilibrium is studied and specifically applied to the estimation of the degree of alignment of the fragment spins. The magnitude and alignment of the transferred angular momentum is experimentally determined from sequentially emitted alpha, gamma, and fission fragments.

  15. Prospects for further studies of effects of T-odd asymmetry in the emission of light particles in the polarized-neutron-induced ternary fission of heavy nuclei

    SciTech Connect (OSTI)

    Petrov, G. A. Gagarskii, A. M.; Guseva, I. S.; Kopatch, Yu. N.; Goennenwein, F.; Mutterer, M.

    2008-07-15

    Prospects for further studies of TRI and ROT effects of T-odd asymmetry in the emission of light particles in the ternary and binary fission of heavy nuclei that is induced by slow polarized neutrons are considered with a view to studying the mechanism for the formation of these effects and using them to get new information about fission dynamics. It is planned to investigate the dependence of the corresponding T-odd-asymmetry coefficients on the main characteristics of the fission reaction.

  16. Interference of fission amplitudes of neutron resonances and T-odd asymmetry for various prescission third particles in the ternary fission of nuclei

    SciTech Connect (OSTI)

    Kadmensky, S. G.; Bunakov, V. E.; Kadmensky, S. S.

    2011-12-15

    Differential cross sections for reactions of the true ternary fission of nuclei that was induced by cold polarized neutrons were constructed with allowance of the effect that Coriolis interaction and the interference between fission amplitudes of neutron resonances excited in fissile nuclei upon incidentneutron capture by target nuclei exerted on angular distributions of prescission third particles (alpha particles, neutrons, or photons). It is shown that T -odd TRI- and ROT-type asymmetries for prescission alpha particles are associated with, respectively, the odd and even components of the Coriolis interaction-perturbed amplitude of angular distributions of particles belonging to the types indicated above. These asymmetries have angular distributions differing from each other and stemming from a nontrivial dependence of these components on the neutron-resonance spins J{sub s} and their projections K{sub s} onto the symmetry axis of the nucleus involved. It is shown that angular distributions of prescission photons and neutrons from reactions of the ternary fission of nuclei that is induced by cold polarized neutrons are determined by the effect of Coriolis forces exclusively. Therefore, the emerging T-odd asymmetries have a character of a ROT-type asymmetry and are universal for all target nuclei.

  17. Microscopic Theory of Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Microscopic Theory of Fission Citation Details In-Document Search Title: Microscopic Theory of Fission You are accessing a document from the Department of Energy's (DOE) SciTech ...

  18. Room-return scattering in fission neutron outputs (Conference...

    Office of Scientific and Technical Information (OSTI)

    Room-return scattering in fission neutron outputs Citation Details In-Document Search Title: Room-return scattering in fission neutron outputs You are accessing a document from...

  19. T invariance and T-odd asymmetries for the cold-polarized-neutron-induced fission of nonoriented nuclei

    SciTech Connect (OSTI)

    Kadmensky, S. G., E-mail: kadmensky@phys.vsu.ru [Voronezh State University (Russian Federation); Bunakov, V. E. [National Research Center Kurchatov Institute, Petersburg Nuclear Physics Institute (Russian Federation); Titova, L. V. [Voronezh State University (Russian Federation)

    2014-12-15

    It is shown that the coefficients D{sup exp} for all T-odd asymmetries observed experimentally in the cross sections for the reactions of cold-polarized-neutron-induced fission of nonoriented target nuclei (which involves the emission of prescission and evaporated particles) comply in shape and scale with the coefficients D{sup theor} calculated for the analogous asymmetries on the basis of quantum-mechanical nuclear-fission theory for T-invariant Hamiltonians of fissile systems. It is also shown that the asymmetries in question arise upon taking into account the effect of (i) the interference between the fission amplitudes of s- and p-wave resonances of a polarized fissile compound nucleus formed in the aforementioned reactions; (ii) the collective rotation of the compound nucleus in question (this rotation entails a change in the angular distributions of fission fragments and third particles); and (iii) the wriggling vibrations of this compound nucleus in the vicinity of its scission point, which lead to the appearance of high aligned spins of fission fragments, with the result that the emission of neutrons and photons evaporated from these fragments becomes anisotropic. The possible contribution of T-noninvariant interactions to the formation of the T-odd asymmetries under analysis is estimated by using the results obtained in experimentally testing the detailed-balance principle, (P-A) theorem, and T invariance of cross sections for elastic proton-proton and proton-neutron scattering.

  20. Fission Product Sorptivity in Graphite

    SciTech Connect (OSTI)

    Tompson, Jr., Robert V.; Loyalka, Sudarshan; Ghosh, Tushar; Viswanath, Dabir; Walton, Kyle; Haffner, Robert

    2015-04-01

    Both adsorption and absorption (sorption) of fission product (FP) gases on/into graphite are issues of interest in very high temperature reactors (VHTRs). In the original proposal, we proposed to use packed beds of graphite particles to measure sorption at a variety of temperatures and to use an electrodynamic balance (EDB) to measure sorption onto single graphite particles (a few ?m in diameter) at room temperature. The use of packed beds at elevated temperature is not an issue. However, the TPOC requested revision of this initial proposal to included single particle measurements at elevated temperatures up to 1100 C. To accommodate the desire of NEUP to extend the single particle EDB measurements to elevated temperatures it was necessary to significantly revise the plan and the budget. These revisions were approved. In the EDB method, we levitate a single graphite particle (the size, surface characteristics, morphology, purity, and composition of the particle can be varied) or agglomerate in the balance and measure the sorption of species by observing the changes in mass. This process involves the use of an electron stepping technique to measure the total charge on a particle which, in conjunction with the measured suspension voltages for the particle, allows for determinations of mass and, hence, of mass changes which then correspond to measurements of sorption. Accommodating elevated temperatures with this type of system required a significant system redesign and required additional time that ultimately was not available. These constraints also meant that the grant had to focus on fewer species as a result. Overall, the extension of the original proposed single particle work to elevated temperatures added greatly to the complexity of the proposed project and added greatly to the time that would eventually be required as well. This means that the bulk of the experimental progress was made using the packed bed sorption systems. Only being able to recruit one graduate student meant that data acquisition with the packed bed systems ended up competing for the graduate students available time with the electrodynamic balance redesign and assembly portions of the project. This competition for available time was eventually mitigated to some extent by the later recruitment of an undergraduate student to help with data collection using the packed bed system. It was only the recruitment of the second student that allowed the single particle balance design and construction efforts to proceed as far as they did during the project period. It should be added that some significant time was also spent by the graduate student cataloging previous work involving graphite. This eventually resulted in a review paper being submitted and accepted (Adsorption of Iodine on Graphite in High Temperature Gas-Cooled Reactor Systems: A Review, Kyle L. Walton, Tushar K. Ghosh, Dabir S. Viswanath, Sudarshan K. Loyalka, Robert V. Tompson). Our specific revised objectives in this project were as follows: Experimentally obtain isotherms of Iodine for reactor grade IG-110 samples of graphite particles over a range of temperatures and pressures using an EDB and a temperature controlled EDB; Experimentally obtain isotherms of Iodine for reactor grade IG-110 samples of graphite particles over a range of temperatures and pressures using a packed column bed apparatus; Explore the effect that charge has on the adsorption isotherms of iodine by varying the charges on and the voltages used to suspend the microscopic particles in the EDB; and To interpret these results in terms of the existing models (Langmuir, BET, Freundlich, and others) which we will modify as necessary to include charge related effects.

  1. Recent advances in modeling fission cross sections over intermediate

    Office of Scientific and Technical Information (OSTI)

    structures (Conference) | SciTech Connect modeling fission cross sections over intermediate structures Citation Details In-Document Search Title: Recent advances in modeling fission cross sections over intermediate structures More accurate fission cross section calculations in presence of underlying intermediate structure are strongly desired. This paper recalls the common approximations used below the fission threshold and quantifies their impact. In particular, an exact expanded R-matrix

  2. Description of induced nuclear fission with Skyrme energy functionals:

    Office of Scientific and Technical Information (OSTI)

    Static potential energy surfaces and fission fragment properties (Journal Article) | SciTech Connect functionals: Static potential energy surfaces and fission fragment properties Citation Details In-Document Search Title: Description of induced nuclear fission with Skyrme energy functionals: Static potential energy surfaces and fission fragment properties Authors: Schunck, N. ; Duke, D. ; Carr, H. ; Knoll, A. Publication Date: 2014-11-06 OSTI Identifier: 1180689 Grant/Contract Number:

  3. Optimally moderated nuclear fission reactor and fuel source therefor

    DOE Patents [OSTI]

    Ougouag, Abderrafi M.; Terry, William K.; Gougar, Hans D.

    2008-07-22

    An improved nuclear fission reactor of the continuous fueling type involves determining an asymptotic equilibrium state for the nuclear fission reactor and providing the reactor with a moderator-to-fuel ratio that is optimally moderated for the asymptotic equilibrium state of the nuclear fission reactor; the fuel-to-moderator ratio allowing the nuclear fission reactor to be substantially continuously operated in an optimally moderated state.

  4. The Microscopic Theory of Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Conference: The Microscopic Theory of Fission Citation Details In-Document Search Title: The Microscopic Theory of Fission Fission-fragment properties have been calculated for thermal neutron-induced fission on a {sup 239}Pu target, using constrained Hartree-Fock-Bogoliubov calculations with a finite-range effective interaction. A quantitative criterion based on the interaction energy between the nascent fragments is introduced to define the scission configurations. The validity of this

  5. Theory in evaluation of actinide fission and capture cross sections.

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Theory in evaluation of actinide fission and capture cross sections. Citation Details In-Document Search Title: Theory in evaluation of actinide fission and capture cross sections. The authors discuss the possibilities and limitations of the use of theory as a tool in the evaluation of actinide fission and capture cross-sections. They consider especially the target {sup 235}U as an example. They emphasize the roles of intermediate structure in the fission

  6. Interlaboratory reaction rate program. 12th progress report, November 1976-October 1979

    SciTech Connect (OSTI)

    Lippincott, E.P.; McElroy, W.N.; Preston, C.C.

    1980-09-01

    The Interlaboratory Reaction Rate UILRR) program is establishing the capability to accurately measure neutron-induced reactions and reaction rates for reactor fuels and materials development programs. The goal for the principal fission reactions, /sup 235/U, /sup 238/U and /sup 239/Pu, is an accuracy to within +- 5% at the 95% confidence level. Accurate measurement of other fission and nonfission reactions is also required, but to a lesser accuracy, between +- 5% and 10% at the 95% confidence level. A secondary program objective is improvement in knowledge of the nuclear parameters involved in the standarization of fuels and materials dosimetry measurements of neutron flux, spectra, fluence and burnup.

  7. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOE Patents [OSTI]

    Northrup, M. Allen (Berkeley, CA); Hsueh, Yun-Tai (Davis, CA); Smith, Rosemary L. (Davis, CA)

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  8. Supply Chain | NISAC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    model informs analyses of the availability of transportation fuel in the event the fuel supply chain is disrupted. The portion of the fuel supply system represented by the...

  9. Fission rate measurements in fuel plate type assembly reactor cores

    SciTech Connect (OSTI)

    Rogers, J.W.

    1988-01-01

    The methods, materials and equipment have been developed to allow extensive and precise measurement of fission rate distributions in water moderated, U-Al fuel plate assembly type reactor cores. Fission rate monitors are accurately positioned in the reactor core, the reactor is operated at a low power for a short time, the fission rate monitors are counted with detectors incorporating automated sample changers and the measurements are converted to fission rate distributions. These measured fission rate distributions have been successfully used as baseline information related to the operation of test and experimental reactors with respect to fission power and distribution, fuel loading and fission experiments for approximately twenty years at the Idaho National Engineering Laboratory (INEL). 7 refs., 8 figs.

  10. Fusion-fission energy systems evaluation

    SciTech Connect (OSTI)

    Teofilo, V.L.; Aase, D.T.; Bickford, W.E.

    1980-01-01

    This report serves as the basis for comparing the fusion-fission (hybrid) energy system concept with other advanced technology fissile fuel breeding concepts evaluated in the Nonproliferation Alternative Systems Assessment Program (NASAP). As such, much of the information and data provided herein is in a form that meets the NASAP data requirements. Since the hybrid concept has not been studied as extensively as many of the other fission concepts being examined in NASAP, the provided data and information are sparse relative to these more developed concepts. Nevertheless, this report is intended to provide a perspective on hybrids and to summarize the findings of the rather limited analyses made to date on this concept.

  11. Impacts to the ethylene supply chain from a hurricane disruption.

    SciTech Connect (OSTI)

    Sun, Amy Cha-Tien; Downes, Paula Sue; Heinen, Russell; Welk, Margaret Ellen

    2010-03-01

    Analysis of chemical supply chains is an inherently complex task, given the dependence of these supply chains on multiple infrastructure systems (e.g., the petroleum sector, transportation, etc.). This effort requires data and information at various levels of resolution, ranging from network-level distribution systems to individual chemical reactions. Sandia National Laboratories (Sandia) has integrated its existing simulation and infrastructure analysis capabilities with chemical data models to analyze the chemical supply chains of several nationally critical chemical commodities. This paper describes how Sandia models the ethylene supply chain; that is, the supply chain for the most widely used raw material for plastics production including a description of the types of data and modeling capabilities that are required to represent the ethylene supply chain. The paper concludes with a description of Sandia's use the model to project how the supply chain would be affected by and adapt to a disruptive scenario hurricane.

  12. Emilio Segrè and Spontaneous Fission

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Emilio Segrè and Spontaneous Fission As the staff at Los Alamos began research in the spring of 1943, the most formidable problems it confronted were related to the new materials that would be used in atomic bombs. These materials, uranium-235 and plutonium, were largely unknown. Uranium-235 formed only a tiny fraction of natural uranium (less than 1 percent) and plutonium had been discovered only two years earlier at the University of California, Berkeley, Radiation Laboratory by chemistry

  13. Calculated fission properties of the heaviest elements

    SciTech Connect (OSTI)

    Moeller, P.; Nix, J.R.; Swiatecki, W.J.

    1986-09-01

    A quantitative calculation is presented that shows where high-kinetic-energy symmetric fission occurs and why it is associated with a sudden and large decrease in fission half-lives. The study is based on calculations of potential-energy surfaces in the macroscopic-microscopic model and a semi-empirical model for the nuclear inertia. For the macroscopic part a Yukawa-plus-exponential model is used and for the microscopic part a folded-Yukawa single-particle potential is used. The three-quadratic-surface parameterization generates shapes for which the potential-energy surfaces are calculated. The use of this parameterization and the use of the finite-range macroscopic model allows for the study of two touching spheres and similar shapes. The results of the calculations in terms of potential-energy surfaces and fission half-lives are presented for heavy even nuclei. The surfaces are displayed in the form of contour diagrams as functions of two moments of the shape. 53 refs., 15 figs., 1 tab.

  14. Capture and fission with DANCE and NEUANCE

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jandel, M.; Baramsai, B.; Bond, E.; Rusev, G.; Walker, C.; Bredeweg, T. A.; Chadwick, M. B.; Couture, A.; Fowler, M. M.; Hayes, A.; et al

    2015-12-23

    A summary of the current and future experimental program at DANCE is presented. Measurements of neutron capture cross sections are planned for many actinide isotopes with the goal to reduce the present uncertainties in nuclear data libraries. Detailed studies of capture gamma rays in the neutron resonance region will be performed in order to derive correlated data on the de-excitation of the compound nucleus. New approaches on how to remove the DANCE detector response from experimental data and retain the correlations between the cascade gamma rays are presented. Studies on 235U are focused on quantifying the population of short-lived isomericmore » states in 236U after neutron capture. For this purpose, a new neutron detector array NEUANCE is under construction. It will be installed in the central cavity of the DANCE array and enable the highly efficient tagging of fission and capture events. In addition, developments of fission fragment detectors are also underway to expand DANCE capabilities to measurements of fully correlated data on fission observables.« less

  15. Capture and fission with DANCE and NEUANCE

    SciTech Connect (OSTI)

    Jandel, M.; Baramsai, B.; Bond, E.; Rusev, G.; Walker, C.; Bredeweg, T. A.; Chadwick, M. B.; Couture, A.; Fowler, M. M.; Hayes, A.; Kawano, T.; Mosby, S.; Stetcu, I.; Taddeucci, T. N.; Talou, P.; Ullmann, J. L.; Vieira, D. J.; Wilhelmy, J. B.

    2015-12-23

    A summary of the current and future experimental program at DANCE is presented. Measurements of neutron capture cross sections are planned for many actinide isotopes with the goal to reduce the present uncertainties in nuclear data libraries. Detailed studies of capture gamma rays in the neutron resonance region will be performed in order to derive correlated data on the de-excitation of the compound nucleus. New approaches on how to remove the DANCE detector response from experimental data and retain the correlations between the cascade gamma rays are presented. Studies on 235U are focused on quantifying the population of short-lived isomeric states in 236U after neutron capture. For this purpose, a new neutron detector array NEUANCE is under construction. It will be installed in the central cavity of the DANCE array and enable the highly efficient tagging of fission and capture events. In addition, developments of fission fragment detectors are also underway to expand DANCE capabilities to measurements of fully correlated data on fission observables.

  16. Undergraduate Measurements For Fission Reactor Applications

    SciTech Connect (OSTI)

    Hicks, S. F.; Kersting, L. J.; Lueck, C. J.; McDonough, P.; Crider, B. P.; McEllistrem, M. T.; Peters, E. E.; Vanhoy, J. R.

    2011-06-01

    Undergraduate students at the University of Dallas (UD) have investigated elastic and inelastic neutron scattering cross sections on structural materials important for criticality considerations in nuclear fission processes. Neutrons scattered off of {sup 23}Na and {sup Nat}Fe were detected using neutron time-of-flight techniques at the University of Kentucky Low-Energy Nuclear Accelerator Facility. These measurements are part of an effort to increase the efficiency of power generation from existing fission reactors in the US and in the design of new fission systems. Students have learned the basics of how to operate the Model CN Van de Graaff generator at the laboratory, setup detectors and electronics, use data acquisition systems, and they are currently analyzing the angular dependence of the scattered neutrons for incident neutron energies of 3.57 and 3.80 MeV. Most students participating in the project will use the research experience as the material for their undergraduate research thesis required for all Bachelor of Science students at the University of Dallas. The first student projects on this topic were completed during the summer of 2010; an overview of student participation in this investigation and their preliminary results will be presented.

  17. Studies of the /sup 32/S + /sup 182/W reaction

    SciTech Connect (OSTI)

    Back, B.B.; Keller, J.G.; Worsham, A.; Glagola, B.G.; Henderson, D.; Kaufman, S.; Sanders, S.J.; Siemssen, R.; Videbaek, F.; Wilkins, B.D.

    1986-01-01

    Fission-like products from the reaction /sup 32/S + /sup 182/W were measured over the entire angular range from theta = 10-170/sup 0/ and for bombarding energies of E/sub lab/ = 166, 177, 222, and 260 MeV using an array of eight Si detectors. From the measured energy and flight time the product mass was determined event-by-event by performing the appropriate corrections for the plasma delay and pulse height defect associated with Si detectors. The mass, angular, and total kinetic energy distributions of fission-like fragments are obtained by assuming two-body kinematics. The angular distributions indicate that a fraction of the observed cross section is associated with quasi-fission reactions as observed previously in several other reactions involving /sup 32/S projectiles. Furthermore, we observe an angular dependence of the fragment mass distributions, a feature which is strictly incompatible with compound nucleus decay. Both of these observations indicate that a fraction of fission-like products originate from quasi-fission, a process in which a large degree of mass transfer occurs between the two interaction nuclei in a short time scale. 14 refs., 4 figs., 1 tab.

  18. HYPERFUSE: a hypervelocity inertial confinement system for fusion energy production and fission waste transmutation

    SciTech Connect (OSTI)

    Makowitz, H.; Powell, J.R.; Wiswall, R.

    1980-01-01

    Parametric system studies of an inertial confinement fusion (ICF) reactor system to transmute fission products from a LWR economy have been carried out. The ICF reactors would produce net power in addition to transmuting fission products. The particular ICF concept examined is an impact fusion approach termed HYPERFUSE, in which hypervelocity pellets, traveling on the order of 100 to 300 km/sec, collide with each other or a target block in a reactor chamber and initiate a thermonuclear reaction. The DT fusion fuel is contained in a shell of the material to be transmuted, e.g., /sup 137/Cs, /sup 90/Sr, /sup 129/I, /sup 99/Tc, etc. The 14-MeV fusion neutrons released during the pellet burn cause transmutation reactions (e.g., (n,2n), (n,..cap alpha..), (n,..gamma..), etc.) that convert the long-lived fission products (FP's) either to stable products or to species that decay with a short half-life to a stable product. The transmutation parametric studies conclude that the design of the hypervelocity projectiles should emphasize the achievement of high densities in the transmutation regions (greater than the DT fusion fuel density), as well as the DT ignition and burn criterion (rho R = 1.0 to 3.0) requirements. These studies also indicate that masses on the order of 1.0 g at densities of rho greater than or equal to 500.0 g/cm/sup 3/ are required for a practical fusion-based fission product transmutation system.

  19. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  20. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen (Berkeley, CA); Mariella, Jr., Raymond P. (Danville, CA); Carrano, Anthony V. (Livermore, CA); Balch, Joseph W. (Livermore, CA)

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  1. Prompt fission gamma-ray studies at DANCE

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jandel, M.; Rusev, G.; Bond, E. M.; Bredeweg, T. A.; Chadwick, M. B.; Couture, A.; Fowler, M.. M; Haight, R. C.; Kawano, T.; Keksis, A. L.; et al

    2014-11-26

    Measurements of correlated data on prompt-fission ?-rays (PFG) have been carried out for various actinide isotopes in recent years using the Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory (LANL). We have developed a model that conveniently parametrizes the correlated data of ?-ray multiplicity and energy. New results on two- dimensional prompt-fission ?-ray multiplicity versus energy distributions from spontaneous fission on ?Cf and neutron-induced fission on 242mAm are presented together with previously obtained results on 233,235U and ?Pu. Correlated PFG data from ?Cf are also compared to results of the detailed theoretical model developed at LANL,morefor different thresholds of PFG energies. Future plans to measure correlated data on fission fragments, prompt fission neutrons and ?-rays at DANCE are presented.less

  2. Multiple scattering effects in fission neutron outputs (Conference) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Conference: Multiple scattering effects in fission neutron outputs Citation Details In-Document Search Title: Multiple scattering effects in fission neutron outputs Authors: Taddeucci, Terry N [1] + Show Author Affiliations Los Alamos National Laboratory Publication Date: 2011-02-24 OSTI Identifier: 1053153 Report Number(s): LA-UR-11-01326; LA-UR-11-1326 DOE Contract Number: AC52-06NA25396 Resource Type: Conference Resource Relation: Conference: Fission fprogram Review, ;

  3. Neutron flux profile monitor for use in a fission reactor

    DOE Patents [OSTI]

    Kopp, Manfred K.; Valentine, Kenneth H.

    1983-01-01

    A neutron flux monitor is provided which consists of a plurality of fission counters arranged as spaced-apart point detectors along a delay line. As a fission event occurs in any one of the counters, two delayed current pulses are generated at the output of the delay line. The time separation of the pulses identifies the counter in which the particular fission event occured. Neutron flux profiles of reactor cores can be more accurately measured as a result.

  4. A microscopic theory of low energy fission: fragment properties

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Conference: A microscopic theory of low energy fission: fragment properties Citation Details In-Document Search Title: A microscopic theory of low energy fission: fragment properties Authors: Younes, W ; Gogny, D ; Schunck, N Publication Date: 2013-01-11 OSTI Identifier: 1062214 Report Number(s): LLNL-PROC-609985 DOE Contract Number: W-7405-ENG-48 Resource Type: Conference Resource Relation: Conference: Presented at: Fifth International Conference on Fission

  5. A microscopic theory of low energy fission: fragment properties

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Conference: A microscopic theory of low energy fission: fragment properties Citation Details In-Document Search Title: A microscopic theory of low energy fission: fragment properties Authors: Younes, W ; Gogny, D ; Schunck, N Publication Date: 2013-01-11 OSTI Identifier: 1062214 Report Number(s): LLNL-PROC-609985 DOE Contract Number: W-7405-ENG-48 Resource Type: Conference Resource Relation: Conference: Presented at: Fifth International Conference on Fission

  6. Fifty years of nuclear fission: Nuclear data and measurements series

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (Technical Report) | SciTech Connect Technical Report: Fifty years of nuclear fission: Nuclear data and measurements series Citation Details In-Document Search Title: Fifty years of nuclear fission: Nuclear data and measurements series This report is the written version of a colloquium first presented at Argonne National Laboratory in January 1989. The paper begins with an historical preamble about the events leading to the discovery of nuclear fission. This leads naturally to an account of

  7. Time dependent particle emission from fission products (Conference) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Time dependent particle emission from fission products Citation Details In-Document Search Title: Time dependent particle emission from fission products Decay heating following nuclear fission is an important factor in the design of nuclear facilities; impacting a variety of aspects ranging from cooling requirements to shielding design. Calculations of decay heat, often assumed to be a simple product of activity and average decay product energy, are complicated by the so

  8. SEPARATION OF PLUTONIUM FROM URANIUM AND FISSION PRODUCTS

    DOE Patents [OSTI]

    Boyd, G.E.; Adamson, A.W.; Schubert, J.; Russell, E.R.

    1958-10-01

    A chromatographic adsorption process is presented for the separation of plutonium from other fission products formed by the irradiation of uranium. The plutonium and the lighter element fission products are adsorbed on a sulfonated phenol-formaldehyde resin bed from a nitric acid solution containing the dissolved uranium. Successive washes of sulfuric, phosphoric, and nitric acids remove the bulk of the fission products, then an eluate of dilute phosphoric and nitric acids removes the remaining plutonium and fission products. The plutonium is selectively removed by passing this solution through zirconium phosphate, from which the plutonium is dissolved with nitric acid. This process provides a convenient and efficient means for isolating plutonium.

  9. Nuclear fission and transuranium elements: Fifty years ago

    SciTech Connect (OSTI)

    Seaborg, G.T.

    1988-09-01

    This paper reviews some historical aspects of the knowledge and discovery of transuranium elements. This fission of plutonium is discussed also. 12 refs., 6 figs.

  10. Description of Induced Nuclear Fission with Skyrme Energy Functionals...

    Office of Scientific and Technical Information (OSTI)

    Fragment Properties Citation Details In-Document Search Title: Description of Induced Nuclear Fission with Skyrme Energy Functionals: I. Static Potential Energy Surfaces and...

  11. Description of Induced Nuclear Fission with Skyrme Energy Functionals...

    Office of Scientific and Technical Information (OSTI)

    Temperature Effects Citation Details In-Document Search Title: Description of Induced Nuclear Fission with Skyrme Energy Functionals: II. Finite Temperature Effects You are...

  12. Description of Induced Nuclear Fission with Skyrme Energy Functionals...

    Office of Scientific and Technical Information (OSTI)

    II. Finite Temperature Effects Citation Details In-Document Search Title: Description of Induced Nuclear Fission with Skyrme Energy Functionals: II. Finite Temperature Effects ...

  13. Fission Younes, W; Gogny, D 73 NUCLEAR PHYSICS AND RADIATION...

    Office of Scientific and Technical Information (OSTI)

    in a Time-Dependent Microscopic Theory of Fission Younes, W; Gogny, D 73 NUCLEAR PHYSICS AND RADIATION PHYSICS Abstract not provided Lawrence Livermore National Laboratory...

  14. Spontaneous fission half-lives for ground state nuclides

    SciTech Connect (OSTI)

    Holden, N.E. [Brookhaven National Lab., Upton, NY (United States); Hoffman, D.C. [Lawrence Berkeley Lab., CA (United States)

    1993-08-01

    Measurements of the spontaneous fission half-lives of nuclides of elements Z = 90 to 108 have been compiled and evaluated. Recommended values are presented.

  15. DOE Science Showcase - Fission Theory | OSTI, US Dept of Energy...

    Office of Scientific and Technical Information (OSTI)

    particle systems, the development of carbon-free energy and to national security, much work continues at the Department of Energy (DOE) to understand fission's inherent complexity. ...

  16. ENDF/B-VII.1 Nuclear Data for Science and Technology: Cross Sections, Covariances, Fission Product Yields and Decay Data

    SciTech Connect (OSTI)

    G. Palmiotti

    2011-12-01

    The ENDF/B-VII.1 library is our latest recommended evaluated nuclear data file for use in nuclear science and technology applications, and incorporates advances made in the five years since the release of ENDF/B-VII.0. These advances focus on neutron cross sections, covariances, fission product yields and decay data, and represent work by the US Cross Section Evaluation Working Group (CSEWG) in nuclear data evaluation that utilizes developments in nuclear theory, modeling, simulation, and experiment. The principal advances in the new library are: (1) An increase in the breadth of neutron reaction cross section coverage, extending from 393 nuclides to 418 nuclides; (2) Covariance uncertainty data for 185 of the most important nuclides, as documented in companion papers in this edition; (3) R-matrix analyses of neutron reactions on light nuclei, including isotopes of He, Li, and Be; (4) Resonance parameter analyses at lower energies and statistical high energy reactions at higher energies for isotopes of F, Cl, K, Ti, V, Mn, Cr, Ni, Zr and W; (5) Modifications to thermal neutron reactions on fission products (isotopes of Mo, Tc, Rh, Ag, Cs, Nd, Sm, Eu) and neutron absorber materials (Cd, Gd); (6) Improved minor actinide evaluations for isotopes of U, Np, Pu, and Am (we are not making changes to the major actinides 235,238U and 239Pu at this point, except for delayed neutron data, and instead we intend to update them after a further period of research in experiment and theory), and our adoption of JENDL-4.0 evaluations for isotopes of Cm, Bk, Cf, Es, Fm, and some other minor actinides; (7) Fission energy release evaluations; (8) Fission product yield advances for fission-spectrum neutrons and 14 MeV neutrons incident on 239Pu; and (9) A new Decay Data sublibrary. Integral validation testing of the ENDF/B-VII.1 library is provided for a variety of quantities: For nuclear criticality, the VII.1 library maintains the generally-good performance seen for VII.0 for a wide range of MCNP simulations of criticality benchmarks, with improved performance coming from new structural material evaluations, especially for Ti, Mn, Cr, Zr and W. For Be we see some improvements although the fast assembly data appear to be mutually inconsistent. Actinide cross section updates are also assessed through comparisons of fission and capture reaction rate measurements in critical assemblies and fast reactors. We describe the cross section evaluations that have been updated for ENDF/B-VII.1 and the measured data and calculations that motivated the changes, and therefore this paper augments the ENDF/B-VII.0 publication [1].

  17. Fission gas retention in irradiated metallic fuel

    SciTech Connect (OSTI)

    Fenske, G.R.; Gruber, E.E.; Kramer, J.M.

    1987-01-01

    Theoretical calculations and experimental measurements of the quantity of retained fission gas in irradiated metallic fuel (U-5Fs) are presented. The calculations utilize the Booth method to model the steady-state release of gases from fuel grains and a simplified grain-boundary gas model to predict the gas release from intergranular regions. The quantity of gas retained in as-irradiated fuel was determined by collecting the gases released from short segments of EBR-II driver fuel that were melted in a gas-tight furnace. Comparison of the calculations to the measurements shows quantitative agreement with both the magnitude and the axial variation of the retained gas content.

  18. Pairing-induced speedup of nuclear spontaneous fission

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sadhukhan, Jhilam; Dobaczewski, J.; Nazarewicz, W.; Sheikh, J. A.; Baran, A.

    2014-12-22

    Collective inertia is strongly influenced at the level crossing at which the quantum system changes its microscopic configuration diabatically. Pairing correlations tend to make the large-amplitude nuclear collective motion more adiabatic by reducing the effect of these configuration changes. Competition between pairing and level crossing is thus expected to have a profound impact on spontaneous fission lifetimes. To elucidate the role of nucleonic pairing on spontaneous fission, we study the dynamic fission trajectories of 264Fm and 240Pu using the state-of-the-art self-consistent framework. We employ the superfluid nuclear density functional theory with the Skyrme energy density functional SkM* and a density-dependentmore » pairing interaction. Along with shape variables, proton and neutron pairing correlations are taken as collective coordinates. The collective inertia tensor is calculated within the nonperturbative cranking approximation. The fission paths are obtained by using the least action principle in a four-dimensional collective space of shape and pairing coordinates. Pairing correlations are enhanced along the minimum-action fission path. For the symmetric fission of 264Fm, where the effect of triaxiality on the fission barrier is large, the geometry of the fission pathway in the space of the shape degrees of freedom is weakly impacted by pairing. This is not the case for 240Pu, where pairing fluctuations restore the axial symmetry of the dynamic fission trajectory. The minimum-action fission path is strongly impacted by nucleonic pairing. In some cases, the dynamical coupling between shape and pairing degrees of freedom can lead to a dramatic departure from the static picture. As a result, in the dynamical description of nuclear fission, particle-particle correlations should be considered on the same footing as those associated with shape degrees of freedom.« less

  19. Pairing-induced speedup of nuclear spontaneous fission

    SciTech Connect (OSTI)

    Sadhukhan, Jhilam; Dobaczewski, J.; Nazarewicz, W.; Sheikh, J. A.; Baran, A.

    2014-12-22

    Collective inertia is strongly influenced at the level crossing at which the quantum system changes its microscopic configuration diabatically. Pairing correlations tend to make the large-amplitude nuclear collective motion more adiabatic by reducing the effect of these configuration changes. Competition between pairing and level crossing is thus expected to have a profound impact on spontaneous fission lifetimes. To elucidate the role of nucleonic pairing on spontaneous fission, we study the dynamic fission trajectories of 264Fm and 240Pu using the state-of-the-art self-consistent framework. We employ the superfluid nuclear density functional theory with the Skyrme energy density functional SkM* and a density-dependent pairing interaction. Along with shape variables, proton and neutron pairing correlations are taken as collective coordinates. The collective inertia tensor is calculated within the nonperturbative cranking approximation. The fission paths are obtained by using the least action principle in a four-dimensional collective space of shape and pairing coordinates. Pairing correlations are enhanced along the minimum-action fission path. For the symmetric fission of 264Fm, where the effect of triaxiality on the fission barrier is large, the geometry of the fission pathway in the space of the shape degrees of freedom is weakly impacted by pairing. This is not the case for 240Pu, where pairing fluctuations restore the axial symmetry of the dynamic fission trajectory. The minimum-action fission path is strongly impacted by nucleonic pairing. In some cases, the dynamical coupling between shape and pairing degrees of freedom can lead to a dramatic departure from the static picture. As a result, in the dynamical description of nuclear fission, particle-particle correlations should be considered on the same footing as those associated with shape degrees of freedom.

  20. Electroplating method for producing ultralow-mass fissionable deposits

    DOE Patents [OSTI]

    Ruddy, Francis H. (Monroeville, PA)

    1989-01-01

    A method for producing ultralow-mass fissionable deposits for nuclear reactor dosimetry is described, including the steps of holding a radioactive parent until the radioactive parent reaches secular equilibrium with a daughter isotope, chemically separating the daughter from the parent, electroplating the daughter on a suitable substrate, and holding the electroplated daughter until the daughter decays to the fissionable deposit.

  1. Microfabricated sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen (Berkeley, CA)

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  2. Fission energy program of the US Department of Energy, FY 1981

    SciTech Connect (OSTI)

    Ferguson, Robert L.

    1980-03-01

    Information is presented concerning the National Energy Plan and fission energy policy; fission energy program management; converter reactor systems; breeder reactor systems; and special nuclear evaluations and systems.

  3. Recent advances in nuclear fission theory: pre- and post-scission...

    Office of Scientific and Technical Information (OSTI)

    Conference: Recent advances in nuclear fission theory: pre- and post-scission physics Citation Details In-Document Search Title: Recent advances in nuclear fission theory: pre- and ...

  4. Recent advances in nuclear fission theory: pre- and post-scission...

    Office of Scientific and Technical Information (OSTI)

    Recent advances in nuclear fission theory: pre- and post-scission physics Citation Details In-Document Search Title: Recent advances in nuclear fission theory: pre- and ...

  5. Fission matrix capability for MCNP, Part II - Applications

    SciTech Connect (OSTI)

    Carney, S. E.; Brown, F. B.; Kiedrowski, B. C.; Martin, W. R.

    2013-07-01

    This paper describes the initial experience and results from implementing a fission matrix capability into the MCNP Monte Carlo code. The fission matrix is obtained at essentially no cost during the normal simulation for criticality calculations. It can be used to provide estimates of the fundamental mode power distribution, the reactor dominance ratio, the eigenvalue spectrum, and higher mode spatial eigenfunctions. It can also be used to accelerate the convergence of the power method iterations. Past difficulties and limitations of the fission matrix approach are overcome with a new sparse representation of the matrix, permitting much larger and more accurate fission matrix representations. Numerous examples are presented. A companion paper (Part I - Theory) describes the theoretical basis for the fission matrix method. (authors)

  6. Direct reactions for nuclear structure and nuclear astrophysics

    SciTech Connect (OSTI)

    Jones, Katherine Louise

    2014-12-18

    Direct reactions are powerful probes for studying the atomic nucleus. Modern direct reaction studies are illuminating both the fundamental nature of the nucleus and its role in nucleosynthetic processes occurring in the cosmos. This report covers experiments using knockout reactions on neutron-deficient fragmentation beams, transfer reactions on fission fragment beams, and theoretical sensitivity studies relating to the astrophysical r-process. Results from experiments on 108,106Sn at the NSCL, and on 131Sn at HRIBF are presented as well as the results from the nucleosynthesis study.

  7. Improved Fission Neutron Data Base for Active Interrogation of Actinides

    SciTech Connect (OSTI)

    Pozzi, Sara; Czirr, J. Bart; Haight, Robert; Kovash, Michael; Tsvetkov, Pavel

    2013-11-06

    This project will develop an innovative neutron detection system for active interrogation measurements. Many active interrogation methods to detect fissionable material are based on the detection of neutrons from fission induced by fast neutrons or high-energy gamma rays. The energy spectrum of the fission neutrons provides data to identify the fissionable isotopes and materials such as shielding between the fissionable material and the detector. The proposed path for the project is as follows. First, the team will develop new neutron detection systems and algorithms by Monte Carlo simulations and bench-top experiments. Next, They will characterize and calibrate detection systems both with monoenergetic and white neutron sources. Finally, high-fidelity measurements of neutron emission from fissions induced by fast neutrons will be performed. Several existing fission chambers containing U-235, Pu-239, U-238, or Th-232 will be used to measure the neutron-induced fission neutron emission spectra. The challenge for making confident measurements is the detection of neutrons in the energy ranges of 0.01 1 MeV and above 8 MeV, regions where the basic data on the neutron energy spectrum emitted from fission is least well known. In addition, improvements in the specificity of neutron detectors are required throughout the complete energy range: they must be able to clearly distinguish neutrons from other radiations, in particular gamma rays and cosmic rays. The team believes that all of these challenges can be addressed successfully with emerging technologies under development by this collaboration. In particular, the collaboration will address the area of fission neutron emission spectra for isotopes of interest in the advanced fuel cycle initiative (AFCI).

  8. On the competition between hydrogen abstraction versus C-O bond fission in initiating dimethyl ether combustion

    SciTech Connect (OSTI)

    Francisco, J.

    1999-07-01

    There has been a growing interest in the potential use of dimethyl ether (DME) as a diesel fuel in compression ignition engines. There are two initiation steps involved in the combustion of DME, one involving C-O bond fission and the other involving hydrogen abstraction by molecular oxygen. The kinetics and thermodynamics of C-O bond fission were explored computationally in a previous paper. The present paper addresses the competing process--hydrogen abstraction by molecular oxygen. Ab initio molecular orbital calculations are used to study the structures and energetics of the reactants, products, and the transition state for the CH{sub 3}OCH{sub 3} + O{sub 2} reaction. The calculations predict a barrier for hydrogen abstraction from CH{sub 3}OCH{sub 3} by O{sub 2} of 47.4 kcal/mol. This is lower than the barrier height for C-O bond fission previously calculated to be 81.1 kcal/mol. The results support values used in current models for the combustion of DME. Moreover, an examination of rates for C-O bond fission versus hydrogen abstraction by O{sub 2} suggests that the bimolecular process is the dominant pathway.

  9. Detecting fission from special nuclear material sources

    DOE Patents [OSTI]

    Rowland, Mark S. (Alamo, CA); Snyderman, Neal J. (Berkeley, CA)

    2012-06-05

    A neutron detector system for discriminating fissile material from non-fissile material wherein a digital data acquisition unit collects data at high rate, and in real-time processes large volumes of data directly into information that a first responder can use to discriminate materials. The system comprises counting neutrons from the unknown source and detecting excess grouped neutrons to identify fission in the unknown source. The system includes a graphing component that displays the plot of the neutron distribution from the unknown source over a Poisson distribution and a plot of neutrons due to background or environmental sources. The system further includes a known neutron source placed in proximity to the unknown source to actively interrogate the unknown source in order to accentuate differences in neutron emission from the unknown source from Poisson distributions and/or environmental sources.

  10. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference...

    Office of Scientific and Technical Information (OSTI)

    This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' ... simulation approach: (1) analytical expressions for the thermal entrance length are ...

  11. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Errormore » rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  12. Electron-capture delayed fission properties of neutron-deficient einsteinium nuclei

    SciTech Connect (OSTI)

    Shaughnessy, Dawn A.

    2000-01-05

    Electron-capture delayed fission (ECDF) properties of neutron-deficient einsteinium isotopes were investigated using a combination of chemical separations and on-line radiation detection methods. {sup 242}Es was produced via the {sup 233}U({sup 14}N,5n){sup 242}Es reaction at a beam energy of 87 MeV (on target) in the lab system, and was found to decay with a half-life of 11 {+-} 3 seconds. The ECDF of {sup 242}Es showed a highly asymmetric mass distribution with an average pre-neutron emission total kinetic energy (TKE) of 183 {+-} 18 MeV. The probability of delayed fission (P{sub DF}) was measured to be 0.006 {+-} 0.002. In conjunction with this experiment, the excitation functions of the {sup 233}U({sup 14}N,xn){sup 247{minus}x}Es and {sup 233}U({sup 15}N,xn){sup 248{minus}x}Es reactions were measured for {sup 243}Es, {sup 244}Es and {sup 245}Es at projectile energies between 80 MeV and 100 MeV.

  13. Manhattan Project: The Discovery of Fission, 1938-1939

    Office of Scientific and Technical Information (OSTI)

    Lise Meitner and Otto Hahn, Kaiser-Wilhelm Institute, Berlin THE DISCOVERY OF FISSION Berlin, Germany (1938-1939) Events > Atomic Discoveries, 1890s-1939 A Miniature Solar System, 1890s-1919 Exploring the Atom, 1919-1932 Atomic Bombardment, 1932-1938 The Discovery of Fission, 1938-1939 Fission Comes to America, 1939 The English word "atom" derives from the Greek word "atomon" ("ατομον"), which means "that which cannot be divided." In 1938, the

  14. Sensitivity analysis of the fission gas behavior model in BISON.

    SciTech Connect (OSTI)

    Swiler, Laura Painton; Pastore, Giovanni; Perez, Danielle; Williamson, Richard

    2013-05-01

    This report summarizes the result of a NEAMS project focused on sensitivity analysis of a new model for the fission gas behavior (release and swelling) in the BISON fuel performance code of Idaho National Laboratory. Using the new model in BISON, the sensitivity of the calculated fission gas release and swelling to the involved parameters and the associated uncertainties is investigated. The study results in a quantitative assessment of the role of intrinsic uncertainties in the analysis of fission gas behavior in nuclear fuel.

  15. Manufacturing Supply Chain

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Supply Chain - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future Stationary Power Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste Management Programs Advanced Nuclear

  16. Active-Interrogation Measurements of Induced-Fission Neutrons from Low-Enriched Uranium

    SciTech Connect (OSTI)

    J. L. Dolan; M. J. Marcath; M. Flaska; S. A. Pozzi; D. L. Chichester; A. Tomanin; P. Peerani; G. Nebbia

    2012-07-01

    Protection and control of nuclear fuels is paramount for nuclear security and safeguards; therefore, it is important to develop fast and robust controlling mechanisms to ensure the safety of nuclear fuels. Through both passive- and active-interrogation methods we can use fast-neutron detection to perform real-time measurements of fission neutrons for process monitoring. Active interrogation allows us to use different ranges of incident neutron energy to probe for different isotopes of uranium. With fast-neutron detectors, such as organic liquid scintillation detectors, we can detect the induced-fission neutrons and photons and work towards quantifying a samples mass and enrichment. Using MCNPX-PoliMi, a system was designed to measure induced-fission neutrons from U-235 and U-238. Measurements were then performed in the summer of 2010 at the Joint Research Centre in Ispra, Italy. Fissions were induced with an associated particle D-T generator and an isotopic Am-Li source. The fission neutrons, as well as neutrons from (n, 2n) and (n, 3n) reactions, were measured with five 5 by 5 EJ-309 organic liquid scintillators. The D-T neutron generator was available as part of a measurement campaign in place by Padova University. The measurement and data-acquisition systems were developed at the University of Michigan utilizing a CAEN V1720 digitizer and pulse-shape discrimination algorithms to differentiate neutron and photon detections. Low-enriched uranium samples of varying mass and enrichment were interrogated. Acquired time-of-flight curves and cross-correlation curves are currently analyzed to draw relationships between detected neutrons and sample mass and enrichment. In the full paper, the promise of active-interrogation measurements and fast-neutron detection will be assessed through the example of this proof-of-concept measurement campaign. Additionally, MCNPX-PoliMi simulation results will be compared to the measured data to validate the MCNPX-PoliMi code when used for active-interrogation simulations.

  17. Measurement/Evaluation Techniques and Nuclear Data Associated with Fission of 239Pu by Fission Spectrum Neutrons

    SciTech Connect (OSTI)

    Baisden, P; Bauge, E; Ferguson, J; Gilliam, D; Granier, T; Jeanloz, R; McMillan, C; Robertson, D; Thompson, P; Verdon, C; Wilkerson, C; Young, P

    2010-03-16

    This Panel was chartered to review and assess new evaluations of work on fission product data, as well as the evaluation process used by the two U.S. nuclear weapons physics laboratories. The work focuses on fission product yields resulting from fission spectrum neutrons incident on plutonium, and includes data from measurements that had not been previously published as well as new or revised fission product cumulative yield data, and related quantities such as Q values and R values. This report documents the Panel's assessment of the work presented by Los Alamos National Laboratory (LANL) and Lawrence Livermore National Laboratory (LLNL). Based on the work presented we have seven key observations: (1) Experiments conducted in the 1970s at LANL, some of which were performed in association with a larger, NIST-led, program, have recently been documented. A preliminary assessment of this work, which will be referred to in this document as ILRR-LANL, shows it to be technically sound. (2) LLNL has done a thorough, unbiased review and evaluation of the available literature and is in the process of incorporating the previously unavailable LANL data into its evaluation of key fission product yields. The results of the LLNL effort, which includes a preliminary evaluation of the ILRR-LANL data, have been documented. (3) LANL has also conducted an evaluation of fission product yields for fission spectrum neutrons on plutonium including a meta-analysis of benchmark data as part of a planned upgrade to the ENDF/B compilation. We found that the approach of using meta-analysis provides valuable additional insight for evaluating the sparse data sets involved in this assessment. (4) Both laboratories have provided convincing evidence for energy dependence in the fission product yield of {sup 147}Nd produced from the bombardment of {sup 239}Pu with fission spectrum neutrons over an incident neutron energy range of 0.2 to 1.9 MeV. (5) Consistent, complete, and explicit treatment of both systematic and statistical uncertainties, including correlations, are critical to the assessment of both the experimental measurements (due to variations between experimental techniques, irradiation conditions, calibration procedures, etc.), and the evaluation of those experiments to extract fundamental nuclear data. A clear example of the importance of uncertainty analysis is in the justification for energy-dependent {sup 147}Nd fission product yield, where the magnitude of the effect is comparable to the uncertainties of the individual fission product yield measurements. Both LANL and LLNL are committed to the inclusion of full uncertainty analysis in their evaluations. (6) The Panel reviewed in detail two methods for determining/evaluating fission product yields from which fission assessments can be made: the K factor method and high-resolution gamma spectroscopy (both described more fully in Sections 3 and 4). The panel concluded that fission product yields, and thus fission assessments, derived using either approach are equally valid, provided that the data were obtained from well understood, direct fission measurements and that the key underlying calibrations and/or data are valid for each technique. (7) The Panel found the process of peer review of the two complementary but independent methods to be an extremely useful exercise. Although work is still ongoing and the numbers presented to the Panel may change slightly, both groups are now in much better agreement on not just one, but four key fission product yields. The groups also have a better appreciation of the strengths and weaknesses of each other's methods.

  18. Microscopic Theory of Nuclear Fission: Recent Highlights | Argonne...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    world, a predictive theory of fission should instead be based solely on quantum many-body methods and our best knowledge of nuclear forces. Today, there is a consensus that...

  19. New Type of Asymmetric Fission in Proton-Rich Nuclei

    SciTech Connect (OSTI)

    Andreyev, A. N.; Elseviers, J.; Huyse, M.; Van Duppen, P.; Bree, N.; Cocolios, T. E.; Diriken, J.; Ivanov, O.; Van den Bergh, P.; Antalic, S.; Barzakh, A.; Fedorov, D.; Comas, V. F.; Heredia, J. A.; Fedosseev, V.; Marsh, B. A.; Van De Walle, J.; Franchoo, S.; Nishio, K.

    2010-12-17

    A very exotic process of {beta}-delayed fission of {sup 180}Tl is studied in detail by using resonant laser ionization with subsequent mass separation at ISOLDE (CERN). In contrast to common expectations, the fission-fragment mass distribution of the post-{beta}-decay daughter nucleus {sup 180}Hg (N/Z=1.25) is asymmetric. This asymmetry is more surprising since a mass-symmetric split of this extremely neutron-deficient nucleus would lead to two {sup 90}Zr fragments, with magic N=50 and semimagic Z=40. This is a new type of asymmetric fission, not caused by large shell effects related to fragment magic proton and neutron numbers, as observed in the actinide region. The newly measured branching ratio for {beta}-delayed fission of {sup 180}Tl is 3.6(7)x10{sup -3}%, approximately 2 orders of magnitude larger than in an earlier study.

  20. Spontaneous fission half-lives for ground state nuclides

    SciTech Connect (OSTI)

    Holden, N.E. (Brookhaven National Lab., Upton, NY (United States)); Hoffman, D.C. (Lawrence Berkeley Lab., CA (United States))

    1991-01-01

    Measurements of the spontaneous fission half-lives of nuclides of elements Z = 90 to 107 have been compiled and evaluated. Recommended values are presented. 126 refs., 96 tabs.

  1. Modeling Correlations In Prompt Neutron Fission Spectra Uncertainties

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Modeling Correlations In Prompt Neutron Fission Spectra Uncertainties Citation Details In-Document Search Title: Modeling Correlations In Prompt Neutron Fission Spectra Uncertainties Authors: White, Morgan C. [1] ; Rising, Michael E. [1] ; Talou, Patrick [1] + Show Author Affiliations Los Alamos National Laboratory Publication Date: 2012-10-22 OSTI Identifier: 1053899 Report Number(s): LA-UR-12-25665 DOE Contract Number: AC52-06NA25396 Resource Type: Conference

  2. Recent advances in modeling fission cross sections over intermediate

    Office of Scientific and Technical Information (OSTI)

    structures (Conference) | SciTech Connect modeling fission cross sections over intermediate structures Citation Details In-Document Search Title: Recent advances in modeling fission cross sections over intermediate structures × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources in

  3. Microscopic Description of Induced Nuclear Fission (Conference) | SciTech

    Office of Scientific and Technical Information (OSTI)

    Connect Microscopic Description of Induced Nuclear Fission Citation Details In-Document Search Title: Microscopic Description of Induced Nuclear Fission Authors: Schunck, N Publication Date: 2012-12-13 OSTI Identifier: 1059062 Report Number(s): LLNL-PROC-608273 DOE Contract Number: W-7405-ENG-48 Resource Type: Conference Resource Relation: Conference: Presented at: 10th International Conference on Clustering Aspects of Nuclear Structure and Dynamics, Debrecen, Hungary, Sep 24 - Sep 28

  4. Microscopic description of fission dynamics: finite element method

    Office of Scientific and Technical Information (OSTI)

    resolution of the TDGCM+GOA equation (Conference) | SciTech Connect Conference: Microscopic description of fission dynamics: finite element method resolution of the TDGCM+GOA equation Citation Details In-Document Search Title: Microscopic description of fission dynamics: finite element method resolution of the TDGCM+GOA equation Authors: Regnier, D ; Dubray, N ; Schunck, N ; Verriere, M Publication Date: 2015-10-16 OSTI Identifier: 1239187 Report Number(s): LLNL-PROC-678472 DOE Contract

  5. Description of Induced Nuclear Fission with Skyrme Energy Functionals: II.

    Office of Scientific and Technical Information (OSTI)

    Finite Temperature Effects (Journal Article) | SciTech Connect Journal Article: Description of Induced Nuclear Fission with Skyrme Energy Functionals: II. Finite Temperature Effects Citation Details In-Document Search Title: Description of Induced Nuclear Fission with Skyrme Energy Functionals: II. Finite Temperature Effects Authors: Schunck, N ; Duke, D ; Carr, H Publication Date: 2013-11-06 OSTI Identifier: 1184748 Report Number(s): LLNL-JRNL-645837 DOE Contract Number: DE-AC52-07NA27344

  6. Excitation Energy Sorting Mechanisms in Fission (Conference) | SciTech

    Office of Scientific and Technical Information (OSTI)

    Connect Excitation Energy Sorting Mechanisms in Fission Citation Details In-Document Search Title: Excitation Energy Sorting Mechanisms in Fission Authors: Talou, Patrick [1] ; Kawano, Toshihiko [1] ; Stetcu, Ionel [1] ; Chadwick, Mark B. [1] + Show Author Affiliations Los Alamos National Laboratory Publication Date: 2012-10-02 OSTI Identifier: 1052791 Report Number(s): LA-UR-12-25155 DOE Contract Number: AC52-06NA25396 Resource Type: Conference Resource Relation: Conference: International

  7. Fifty years of nuclear fission: Nuclear data and measurements series

    Office of Scientific and Technical Information (OSTI)

    (Technical Report) | SciTech Connect Fifty years of nuclear fission: Nuclear data and measurements series Citation Details In-Document Search Title: Fifty years of nuclear fission: Nuclear data and measurements series × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources in energy

  8. Fission fragment rockets: A potential breakthrough (Conference) | SciTech

    Office of Scientific and Technical Information (OSTI)

    Connect Conference: Fission fragment rockets: A potential breakthrough Citation Details In-Document Search Title: Fission fragment rockets: A potential breakthrough × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources in energy science and technology. A paper copy of this document is

  9. Genetic and structural analysis of the essential fission yeast RNA

    Office of Scientific and Technical Information (OSTI)

    polymerase II CTD phosphatase Fcp1 (Journal Article) | SciTech Connect SciTech Connect Search Results Journal Article: Genetic and structural analysis of the essential fission yeast RNA polymerase II CTD phosphatase Fcp1 Citation Details In-Document Search Title: Genetic and structural analysis of the essential fission yeast RNA polymerase II CTD phosphatase Fcp1 Authors: Schwer, Beate ; Ghosh, Agnidipta ; Sanchez, Ana M. ; Lima, Christopher D. ; Shuman, Stewart [1] ; SKI) [2] + Show Author

  10. The Microscopic Theory of Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Conference: The Microscopic Theory of Fission Citation Details In-Document Search Title: The Microscopic Theory of Fission × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources in energy science and technology. A paper copy of this document is also available for sale to the public from

  11. Advancing the Fundamental Understanding of Fission: 2014 LDRD 20120077DR

    Office of Scientific and Technical Information (OSTI)

    Review (Technical Report) | SciTech Connect Advancing the Fundamental Understanding of Fission: 2014 LDRD 20120077DR Review Citation Details In-Document Search Title: Advancing the Fundamental Understanding of Fission: 2014 LDRD 20120077DR Review The following slides were presented as part of the LDRD 20120077DR Progress Appraisal Review held Tuesday, February 4, 2014. This is part of an ongoing project assessment the previous of which was documented in LA-UR-13-21182. This presentation

  12. Advancing the Fundamental Understanding of Fission: 2014 LDRD 20120077DR

    Office of Scientific and Technical Information (OSTI)

    Review (Technical Report) | SciTech Connect Advancing the Fundamental Understanding of Fission: 2014 LDRD 20120077DR Review Citation Details In-Document Search Title: Advancing the Fundamental Understanding of Fission: 2014 LDRD 20120077DR Review × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional

  13. Sequential Detection of Fission Processes for Harbor Defense (Conference) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Sequential Detection of Fission Processes for Harbor Defense Citation Details In-Document Search Title: Sequential Detection of Fission Processes for Harbor Defense With the large increase in terrorist activities throughout the world, the timely and accurate detection of special nuclear material (SNM) has become an extremely high priority for many countries concerned with national security. The detection of radionuclide contraband based on their γ-ray emissions has been

  14. Theory in evaluation of actinide fission and capture cross sections.

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Theory in evaluation of actinide fission and capture cross sections. Citation Details In-Document Search Title: Theory in evaluation of actinide fission and capture cross sections. × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources in energy science

  15. EXTENSION OF THE NUCLEAR REACTION MODEL CODE EMPIRE TO ACTINIDES NUCLEAR DATA EVALUATION.

    SciTech Connect (OSTI)

    CAPOTE,R.; SIN, M.; TRKOV, A.; HERMAN, M.; CARLSON, B.V.; OBLOZINSKY, P.

    2007-04-22

    Recent extensions and improvements of the EMPIRE code system are outlined. They add new capabilities to the code, such as prompt fission neutron spectra calculations using Hauser-Feshbach plus pre-equilibrium pre-fission spectra, cross section covariance matrix calculations by Monte Carlo method, fitting of optical model parameters, extended set of optical model potentials including new dispersive coupled channel potentials, parity-dependent level densities and transmission through numerically defined fission barriers. These features, along with improved and validated ENDF formatting, exclusive/inclusive spectra, and recoils make the current EMPIRE release a complete and well validated tool for evaluation of nuclear data at incident energies above the resonance region. The current EMPIRE release has been used in evaluations of neutron induced reaction files for {sup 232}Th and {sup 231,233}Pa nuclei in the fast neutron region at IAEA. Triple-humped fission barriers and exclusive pre-fission neutron spectra were considered for the fission data evaluation. Total, fission, capture and neutron emission cross section, average resonance parameters and angular distributions of neutron scattering are in excellent agreement with the available experimental data.

  16. Monte Carlo without chains

    SciTech Connect (OSTI)

    Chorin, Alexandre J.

    2007-12-12

    A sampling method for spin systems is presented. The spin lattice is written as the union of a nested sequence of sublattices, all but the last with conditionally independent spins, which are sampled in succession using their marginals. The marginals are computed concurrently by a fast algorithm; errors in the evaluation of the marginals are offset by weights. There are no Markov chains and each sample is independent of the previous ones; the cost of a sample is proportional to the number of spins (but the number of samples needed for good statistics may grow with array size). The examples include the Edwards-Anderson spin glass in three dimensions.

  17. Description of true and delayed ternary nuclear fission accompanied by the emission of various third particles

    SciTech Connect (OSTI)

    Kadmensky, S. G., E-mail: kadmensky@vsu.ru; Kadmensky, S. S.; Lyubashevsky, D. E. [Voronezh State University (Russian Federation)

    2010-08-15

    The mechanisms and the features of the main types of nuclear ternary fission (that is, true ternary fission, in which a third particle is emitted before the rupture of the fissioning nucleus into fragments, and delayed ternary fission, in which a third particle is emitted from fission fragments going apart) are investigated within quantum-mechanical fission theory. The features of T-odd asymmetry in true ternary nuclear fission induced by cold polarized neutrons are investigated for the cases where alpha particles, prescission neutrons, and photons appear as third particles emitted by fissioning nuclei, the Coriolis interaction of the spin of the polarized fissioning nucleus with the spin of the third particle and the interference between the fission amplitudes for neutron resonances excited in the fissioning nucleus in the case of projectile-neutron capture being taken into account. For the cases where third particles emitted by fission fragments are evaporated neutrons or photons, T-odd asymmetries in delayed ternary nuclear fission induced by cold polarized neutrons are analyzed with allowance for the mechanism of pumping of large fission-fragment spins oriented orthogonally to the fragment-emission direction and with allowance for the interference between the fission amplitudes for neutron resonances.

  18. New Fission-Product Waste Forms: Development and Characterization

    SciTech Connect (OSTI)

    Alexandra Navrotsky

    2010-07-30

    Research performed on the program New Fission Product Waste Forms: Development and Characterization, in the last three years has fulfilled the objectives of the proposal which were to 1) establish ceramic waste forms for disposing of Cs, Sr and minor actinides, 2) fully characterize the phase relationships, structures and thermodynamic and kinetic stabilities of promising waste forms, 3) establish a sound technical basis for understanding key waste form properties, such as melting temperatures and aqueous durability, based on an in-depth understanding of waste form structures and thermochemistry, and 4) establish synthesis, testing, scaleup and commercialization routes for wasteform implementation through out in-kind collaborations. In addition, since Cs and Sr form new elements by radioactive decay, the behavior and thermodynamics of waste forms containing different proportions of Cs, Sr and their decay products were discovered using non-radioactive analogues. Collaborations among researchers from three institutions, UC Davis, Sandia National Laboratories, and Shott Inc., were formed to perform the primary work on the program. The unique expertise of each of the members in the areas of waste form development, structure/property relationships, hydrothermal and high temperature synthesis, crystal/glass production, and thermochemistry was critical to program success. In addition, collaborations with the Brigham Young Univeristy, Ben Gurion University, and Los Alamos National Laboratory, were established for standard entropies of ceramic waste forms, sol-gel synthesis, and high temperature synthesis. This work has had a significant impact in a number of areas. First, the studies of the thermodynamic stability of the mineral analogues provided an important technical foundation for assessment the viability of multicomponent oxide phases for Cs and Sr removal. Moreover, the thermodynamic data discovered in this program established information on the reaction pathways for the potential reaction products. The phase equilibria and thermodynamics involving the intermediates in the decay process in this program will assist in selection of the best process for Cs or Sr immobilization. In addition, data from the study can be used to develop engineering solutions for potential process upsets. Second, the glass crystal stability of multicomponent oxide phases that were representative silicates on this program is highly distinguishable for mother compounds and decay products, thus providing a fundamental understanding on the separate effects from chemistry and from radiation. Finally, we have developed a foundation for understanding chemistry-structure-energetics relationships in titanosilicates that can be used to develop more effective materials.

  19. The Future of Energy from Nuclear Fission

    SciTech Connect (OSTI)

    Kim, Son H.; Taiwo, Temitope

    2013-04-13

    Nuclear energy is an important part of our current global energy system, and contributes to supplying the significant demand for electricity for many nations around the world. There are 433 commercial nuclear power reactors operating in 30 countries with an installed capacity of 367 GWe as of October 2011 (IAEA PRIS, 2011). Nuclear electricity generation totaled 2630 TWh in 2010 representing 14% the worlds electricity generation. The top five countries of total installed nuclear capacity are the US, France, Japan, Russia and South Korea at 102, 63, 45, 24, and 21 GWe, respectively (WNA, 2012a). The nuclear capacity of these five countries represents more than half, 68%, of the total global nuclear capacity. The role of nuclear power in the global energy system today has been motivated by several factors including the growing demand for electric power, the regional availability of fossil resources and energy security concerns, and the relative competitiveness of nuclear power as a source of base-load electricity. There is additional motivation for the use of nuclear power because it does not produce greenhouse gas (GHG) emissions or local air pollutants during its operation and contributes to low levels of emissions throughout the lifecycle of the nuclear energy system (Beerten, J. et. al., 2009). Energy from nuclear fission primarily in the form of electric power and potentially as a source of industrial heat could play a greater role for meeting the long-term growing demand for energy worldwide while addressing the concern for climate change from rising GHG emissions. However, the nature of nuclear fission as a tremendously compact and dense form of energy production with associated high concentrations of radioactive materials has particular and unique challenges as well as benefits. These challenges include not only the safety and cost of nuclear reactors, but proliferation concerns, safeguard and storage of nuclear materials associated with nuclear fuel cycles. In March of 2011, an unprecedented earthquake of 9 magnitude and ensuing tsunami off the east coast of Japan caused a severe nuclear accident in Fukushima, Japan (Prime Minister of Japan and His Cabinet, 2011). The severity of the nuclear accident in Japan has brought about a reinvestigation of nuclear energy policy and deployment activities for many nations around the world, most notably in Japan and Germany (BBC, 2011; Reuter, 2011). The response to the accident has been mixed and its full impact may not be realized for many years to come. The nuclear accident in Fukushima, Japan has not directly affected the significant on-going nuclear deployment activities in many countries. China, Russia, India, and South Korea, as well as others, are continuing with their deployment plans. As of October 2011, China had the most reactors under construction at 27, while Russia, India, and South Korea had 11, 6, and 5 reactors under construction, respectively (IAEA PRIS, 2011). Ten other nations have one or two reactors currently under construction. Many more reactors are planned for future deployment in China, Russia, and India, as well as in the US. Based on the World Nuclear Associations data, the realization of Chinas deployment plan implies that China will surpass the US in total nuclear capacity some time in the future.

  20. NNSA TRITIUM SUPPLY CHAIN

    SciTech Connect (OSTI)

    Wyrick, Steven; Cordaro, Joseph; Founds, Nanette; Chambellan, Curtis

    2013-08-21

    Savannah River Site plays a critical role in the Tritium Production Supply Chain for the National Nuclear Security Administration (NNSA). The entire process includes: Production of Tritium Producing Burnable Absorber Rods (TPBARs) at the Westinghouse WesDyne Nuclear Fuels Plant in Columbia, South Carolina Production of unobligated Low Enriched Uranium (LEU) at the United States Enrichment Corporation (USEC) in Portsmouth, Ohio Irradiation of TPBARs with the LEU at the Tennessee Valley Authority (TVA) Watts Bar Reactor Extraction of tritium from the irradiated TPBARs at the Tritium Extraction Facility (TEF) at Savannah River Site Processing the tritium at the Savannah River Site, which includes removal of nonhydrogen species and separation of the hydrogen isotopes of protium, deuterium and tritium.

  1. Kinetic energy deficit in the symmetric fission of /sup 259/Md. [Light particle emission in /sup 256/Fm fission

    SciTech Connect (OSTI)

    Hulet, E.K.; Wild, J.F.; Lougheed, R.W.; Baisden, P.A.; Dougan, R.J.; Mustafa, M.G.

    1980-10-01

    The fragment energies of about 725 coincidence events have now been observed in the spontaneous fission (SF) decay of 105-min /sup 259/Md since its discovery in 1977. The fission of /sup 259/Md is characterized by a symmetric mass distribution, similar to those of /sup 258/Fm and /sup 259/Fm, but with a broad total kinetic energy (anti TKE) distribution which peaks at about 195 MeV, in contrast to those of /sup 258/Fm and /sup 259/Fm, for which the anti TKE is about 240 MeV. This kinetic energy deficit, approx. 40 MeV, has been postulated to be due to the emission of hydrogen-like particles by /sup 259/Md at the scission point in a large fraction of the fissions, leaving the residual fissioning nucleus with 100 protons. The residual nucleus would then be able to divide into two ultrastable tin-like fission fragments, but with less kinetic energy than that observed in the SF of /sup 258/Fm and /sup 259/Fm, because of binding-energy losses and a reduction in the Coulomb repulsion of the major fragments. To test this hypothesis, counter-telescope experiments aimed at detecting and identifying these light particles were performed. In 439 SF events 3 + 3 protons of the appropriate energy were observed, too few to account for the kinetic energy deficit in the fission of /sup 259/Md. There seems to be no explanation for this problem within the framework of current fission theory. These results are discussed along with preliminary measurements of light-particle emission in the SF of /sup 256/Fm. 5 figures.

  2. Reference reactor module for NASA's lunar surface fission power system

    SciTech Connect (OSTI)

    Poston, David I; Kapernick, Richard J; Dixon, David D; Werner, James; Qualls, Louis; Radel, Ross

    2009-01-01

    Surface fission power systems on the Moon and Mars may provide the first US application of fission reactor technology in space since 1965. The Affordable Fission Surface Power System (AFSPS) study was completed by NASA/DOE to determine the cost of a modest performance, low-technical risk surface power system. The AFSPS concept is now being further developed within the Fission Surface Power (FSP) Project, which is a near-term technology program to demonstrate system-level TRL-6 by 2013. This paper describes the reference FSP reactor module concept, which is designed to provide a net power of 40 kWe for 8 years on the lunar surface; note, the system has been designed with technologies that are fully compatible with a Martian surface application. The reactor concept uses stainless-steel based. UO{sub 2}-fueled, pumped-NaK fission reactor coupled to free-piston Stirling converters. The reactor shielding approach utilizes both in-situ and launched shielding to keep the dose to astronauts much lower than the natural background radiation on the lunar surface. The ultimate goal of this work is to provide a 'workhorse' power system that NASA can utilize in near-term and future Lunar and Martian mission architectures, with the eventual capability to evolve to very high power, low mass systems, for either surface, deep space, and/or orbital missions.

  3. Fission gas release restrictor for breached fuel rod

    DOE Patents [OSTI]

    Kadambi, N. Prasad (Gaithersburg, MD); Tilbrook, Roger W. (Monroeville, PA); Spencer, Daniel R. (Unity Twp., PA); Schwallie, Ambrose L. (Greensburg, PA)

    1986-01-01

    In the event of a breach in the cladding of a rod in an operating liquid metal fast breeder reactor, the rapid release of high-pressure gas from the fission gas plenum may result in a gas blanketing of the breached rod and rods adjacent thereto which impairs the heat transfer to the liquid metal coolant. In order to control the release rate of fission gas in the event of a breached rod, the substantial portion of the conventional fission gas plenum is formed as a gas bottle means which includes a gas pervious means in a small portion thereof. During normal reactor operation, as the fission gas pressure gradually increases, the gas pressure interiorly of and exteriorly of the gas bottle means equalizes. In the event of a breach in the cladding, the gas pervious means in the gas bottle means constitutes a sufficient restriction to the rapid flow of gas therethrough that under maximum design pressure differential conditions, the fission gas flow through the breach will not significantly reduce the heat transfer from the affected rod and adjacent rods to the liquid metal heat transfer fluid flowing therebetween.

  4. The behavior of fission products during nuclear rocket reactor tests

    SciTech Connect (OSTI)

    Bokor, P.C.; Kirk, W.L.; Bohl, R.J.

    1991-01-01

    The experience base regarding fission product behavior developed during the Rover program, the nuclear rocket development program of 1955--1972, will be useful in planning a renewed nuclear rocket program. During the Rover program, 20 reactors were tested at the Nuclear Rocket Development Station in Nevada. Nineteen of these discharged effluent directly into the atmosphere; the last reactor tested, a non-flight-prototypic, fuel-element-testing reactor called the Nuclear Furnace (NF-1) was connected to an effluent cleanup system that removed fission products before the hydrogen coolant (propellant) was discharged to the atmosphere. In general, we are able to increase both test duration and fuel temperature during the test series. Therefore fission product data from the later part of the program are more interesting and more applicable to future reactors. We have collected fission product retention (and release) data reported in both formal and informal publications for six of the later reactor tests; five of these were Los Alamos reactors that were firsts of a kind in configuration or operating conditions. We have also, with the cooperation of Westinghouse, included fission product data from the NRX-A6 reactor, the final member of series of developmental reactors with the same basic geometry, but with significant design and fabrication improvements as the series continued. Table 1 lists the six selected reactors and the test parameters for each.

  5. Modeling of Fission Gas Release in UO2

    SciTech Connect (OSTI)

    MH Krohn

    2006-01-23

    A two-stage gas release model was examined to determine if it could provide a physically realistic and accurate model for fission gas release under Prometheus conditions. The single-stage Booth model [1], which is often used to calculate fission gas release, is considered to be oversimplified and not representative of the mechanisms that occur during fission gas release. Two-stage gas release models require saturation at the grain boundaries before gas is release, leading to a time delay in release of gases generated in the fuel. Two versions of a two-stage model developed by Forsberg and Massih [2] were implemented using Mathcad [3]. The original Forsbers and Massih model [2] and a modified version of the Forsberg and Massih model that is used in a commercially available fuel performance code (FRAPCON-3) [4] were examined. After an examination of these models, it is apparent that without further development and validation neither of these models should be used to calculate fission gas release under Prometheus-type conditions. There is too much uncertainty in the input parameters used in the models. In addition. the data used to tune the modified Forsberg and Massih model (FRAPCON-3) was collected under commercial reactor conditions, which will have higher fission rates relative to Prometheus conditions [4].

  6. Initial Back-to-Back Fission Chamber Testing in ATRC

    SciTech Connect (OSTI)

    Benjamin Chase; Troy Unruh; Joy Rempe

    2014-06-01

    Development and testing of in-pile, real-time neutron sensors for use in Materials Test Reactor experiments is an ongoing project at Idaho National Laboratory. The Advanced Test Reactor National Scientific User Facility has sponsored a series of projects to evaluate neutron detector options in the Advanced Test Reactor Critical Facility (ATRC). Special hardware was designed and fabricated to enable testing of the detectors in the ATRC. Initial testing of Self-Powered Neutron Detectors and miniature fission chambers produced promising results. Follow-on testing required more experiment hardware to be developed. The follow-on testing used a Back-to-Back fission chamber with the intent to provide calibration data, and a means of measuring spectral indices. As indicated within this document, this is the first time in decades that BTB fission chambers have been used in INL facilities. Results from these fission chamber measurements provide a baseline reference for future measurements with Back-to-Back fission chambers.

  7. Transport of triplet excitons along continuous 100 nm polyfluorene chains

    SciTech Connect (OSTI)

    Xi, Liang; Bird, Matthew; Mauro, Gina; Asaoka, Sadayuki; Cook, Andrew R.; Chen, Hung -Cheng; Miller, John R.

    2014-12-03

    Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trapped triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 s timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into segments, perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 s. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second set of polyfluorenes with 2-butyloctyl side chains was found to have a much lower completeness of end capping.

  8. Transport of triplet excitons along continuous 100 nm polyfluorene chains

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Xi, Liang; Bird, Matthew; Mauro, Gina; Asaoka, Sadayuki; Cook, Andrew R.; Chen, Hung -Cheng; Miller, John R.

    2014-12-03

    Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trappedmore » triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 µs timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into “segments,” perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 µs. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second set of polyfluorenes with 2-butyloctyl side chains was found to have a much lower completeness of end capping.« less

  9. Mathematical Model for Transmutation System with a Two-Member Chain and Variable Separation Coefficients

    SciTech Connect (OSTI)

    Ahn, Joonhong; Kurata, Masaki

    2007-07-01

    Mathematical models for mass flow in a fuel cycle have been established for a two-member chain in a reactor with reductive extraction for partitioning process. A sub-model for reductive extraction has been implemented into the mass flow model. Recursive solutions for the mass fractions of two actinide isotopes and fission products have been obtained as a function of cycle number. As a performance measure, the reduction ratios have been defined for two actinide isotopes. Effects of discharged fuel composition on the partitioning efficiency and on waste generation have been observed. The numerical results show that at early cycles the partitioning efficiency is relatively low because of large mass fractions of actinides in discharged fuel. With more cycles, fission products accumulate, and the partitioning efficiency becomes better, approaching asymptotic values. Consequently, waste generation at early cycles would be greater than at later cycles. (authors)

  10. Comparison of Fission Product Yields and Their Impact

    SciTech Connect (OSTI)

    S. Harrison

    2006-02-01

    This memorandum describes the Naval Reactors Prime Contractor Team (NRPCT) Space Nuclear Power Program (SNPP) interest in determining the expected fission product yields from a Prometheus-type reactor and assessing the impact of these species on materials found in the fuel element and balance of plant. Theoretical yield calculations using ORIGEN-S and RACER computer models are included in graphical and tabular form in Attachment, with focus on the desired fast neutron spectrum data. The known fission product interaction concerns are the corrosive attack of iron- and nickel-based alloys by volatile fission products, such as cesium, tellurium, and iodine, and the radiological transmutation of krypton-85 in the coolant to rubidium-85, a potentially corrosive agent to the coolant system metal piping.

  11. Calculated fission-fragment yield systematics in the region 74

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Möller, Peter; Randrup, Jørgen

    2015-04-01

    Background: In the seminal experiment by Schmidt et al. [Nucl. Phys. A 665, 221 (2000)] in which fission-fragment charge distributions were obtained for 70 nuclides, asymmetric distributions were seen above nucleon number A ≈ 226 and symmetric ones below. Because asymmetric fission had often loosely been explained as a preference for the nucleus to always exploit the extra binding of fragments near ¹³²Sn it was assumed that all systems below A ≈ 226 would fission symmetrically because available isotopes do not have a proton-to-neutron Z/N ratio that allows division into fragments near ¹³²Sn. But the finding by Andreyev et al.more »[Phys. Rev. Lett. 105, 252502 (2010)] did not conform to this expectation because the compound system ¹⁸⁰Hg was shown to fission asymmetrically. It was suggested that this was a new type of asymmetric fission, because no strong shell effects occur for any possible fragment division. Purpose: We calculate a reference database for fission-fragment mass yields for a large region of the nuclear chart comprising 987 nuclides. A particular aim is to establish whether ¹⁸⁰Hg is part of a contiguous region of asymmetric fission, and if so, its extent, or if not, in contrast to the actinides, there are scattered smaller groups of nuclei that fission asymmetrically in this area of the nuclear chart. Methods: We use the by now well benchmarked Brownian shape-motion method and perform random walks on the previously calculated five-dimensional potential-energy surfaces. The calculated shell corrections are damped out with energy according to a prescription developed earlier. Results: We have obtained a theoretical reference database of fission-fragment mass yields for 987 nuclides. These results show an extended region of asymmetric fission with approximate extension 74 ≤ Z ≤ 85 and 100 ≤ N ≤ 120. The calculated yields are highly variable. We show 20 representative plots of these variable features and summarize the main aspects of our results in terms of “nuclear-chart” plots showing calculated degrees of asymmetry versus N and Z. Conclusions: Experimental data in this region are rare: only ten or so yield distributions have been measured, some with very limited statistics. We agree with several measurements with higher statistics. Regions where there might be differences between our calculated results and measurements lie near the calculated transition line between symmetric and asymmetric fission. To draw more definite conclusions about the accuracy of the present implementation of the Brownian shape-motion approach in this region experimental data, with reliable statistics, for a fair number of suitably located additional nuclides are clearly needed. Because the nuclear potential-energy structure is so different in this region compared to the actinide region, additional experimental data together with fission theory studies that incorporate additional, dynamical aspects should provide much new insight.« less

  12. Impact of nuclear fission on r-process nucleosynthesis and origin of solar r-process elements

    SciTech Connect (OSTI)

    Shibagaki, Shota; Kajino, Toshitaka; Mathews, Grant J.; Chiba, Satoshi

    2015-02-24

    Binary neutron star mergers (NSMs) are expected to be main production sites of r-process elements. Their ejecta are extremely neutron-rich (Y{sub e}<0.1), and the r-process path proceeds along the neutron drip line and enters the region of fissile nuclei. In this situation, although superheavy nuclei may be synthesized and the r-process path may reach the island of stability, those are sensitive to theoretical models of nuclear masses and nuclear fission. In this study, we carry out r-process nucleosynthesis simulations in the NSMs. Our new nuclear reaction network code include new theoretical models of nuclear masses and nuclear fission. Our r-process simulation of a binary NSM shows that the final r-process elemental abundances exhibit flat pattern for A?110-160, and several fission cycling operate in extremely neutron-rich conditions of the NSM. We find that the combination of the NSMs and the magnetorotational supernovae can reproduce the solar r-process elements. We discuss the validity of this interpretation.

  13. Fission product release from irradiated LWR fuel under accident conditions

    SciTech Connect (OSTI)

    Strain, R.V.; Sanecki, J.E.; Osborne, M.F.

    1984-01-01

    Fission product release from irradiated LWR fuel is being studied by heating fuel rod segments in flowing steam and an inert carrier gas to simulate accident conditions. Fuels with a range of irradiation histories are being subjected to several steam flow rates over a wide range of temperatures. Fission product release during each test is measured by gamma spectroscopy and by detailed examination of the collection apparatus after the test has been completed. These release results are complemented by a detailed posttest examination of samples of the fuel rod segment. Results of release measurements and fuel rod characterizations for tests at 1400 through 2000/sup 0/C are presented in this paper.

  14. Energy Dependence of Fission Product Yields for 239Pu, 235U,...

    Office of Scientific and Technical Information (OSTI)

    Energy Dependence of Fission Product Yields for 239Pu, 235U, and 238U Citation Details In-Document Search Title: Energy Dependence of Fission Product Yields for 239Pu, 235U, and...

  15. Recent advances in nuclear fission theory: pre- and post-scission...

    Office of Scientific and Technical Information (OSTI)

    nuclear fission theory: pre- and post-scission physics Citation Details In-Document Search Title: Recent advances in nuclear fission theory: pre- and post-scission physics You ...

  16. Liquid-Metal Technology Options for A Lunar-Based Fission Surface...

    Office of Scientific and Technical Information (OSTI)

    Liquid-Metal Technology Options for A Lunar-Based Fission Surface Power System Citation Details In-Document Search Title: Liquid-Metal Technology Options for A Lunar-Based Fission...

  17. Methods to Collect, Compile, and Analyze Observed Short-lived Fission Product Gamma Data

    SciTech Connect (OSTI)

    Finn, Erin C.; Metz, Lori A.; Payne, Rosara F.; Friese, Judah I.; Greenwood, Lawrence R.; Kephart, Jeremy D.; Pierson, Bruce D.; Ellis, Tere A.

    2011-09-29

    A unique set of fission product gamma spectra was collected at short times (4 minutes to 1 week) on various fissionable materials. Gamma spectra were collected from the neutron-induced fission of uranium, neptunium, and plutonium isotopes at thermal, epithermal, fission spectrum, and 14-MeV neutron energies. This report describes the experimental methods used to produce and collect the gamma data, defines the experimental parameters for each method, and demonstrates the consistency of the measurements.

  18. A Model for Water Factor Measurements With Fission-Neutron Logging Tools

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    (May 1983) | Department of Energy A Model for Water Factor Measurements With Fission-Neutron Logging Tools (May 1983) A Model for Water Factor Measurements With Fission-Neutron Logging Tools (May 1983) A Model for Water Factor Measurements With Fission-Neutron Logging Tools (May 1983) PDF icon A Model for Water Factor Measurements With Fission-Neutron Logging Tools (May 1983) More Documents & Publications Field Calibration Facilities for Environmental Measurement of Radium, Thorium, and

  19. Recent advances in nuclear fission theory: pre- and post-scission physics

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Conference: Recent advances in nuclear fission theory: pre- and post-scission physics Citation Details In-Document Search Title: Recent advances in nuclear fission theory: pre- and post-scission physics Recent advances in the modeling of the nuclear fission process for data evaluation purposes are reviewed. In particular, it is stressed that a more comprehensive approach to fission data is needed if predictive capability is to be achieved. The link between pre-

  20. Fission barriers at the end of the chart of the nuclides

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Möller, Peter; Sierk, Arnold J.; Ichikawa, Takatoshi; Iwamoto, Akira; Mumpower, Matthew

    2015-02-12

    We present calculated fission-barrier heights for 5239 nuclides for all nuclei between the proton and neutron drip lines with 171 ≤ A ≤ 330. The barriers are calculated in the macroscopic-microscopic finite-range liquid-drop (FRLDM) with a 2002 set of macroscopic-model parameters. The saddle-point energies are determined from potential-energy surfaces based on more than five million different shapes, defined by five deformation parameters in the three-quadratic-surface shape parametrization: elongation, neck diameter, left-fragment spheroidal deformation, right-fragment spheroidal deformation, and nascent-fragment mass asymmetry. The energy of the ground state is determined by calculating the lowest-energy configuration in both the Nilsson perturbed-spheroid (ϵ) andmore » the spherical-harmonic (β) parametrizations, including axially asymmetric deformations. The lower of the two results (correcting for zero-point motion) is defined as the ground-state energy. The effect of axial asymmetry on the inner barrier peak is calculated in the (ϵ,γ) parametrization. We have earlier benchmarked our calculated barrier heights to experimentally extracted barrier parameters and found average agreement to about one MeV for known data across the nuclear chart. Here we do additional benchmarks and investigate the qualitative and, when possible, quantitative agreement and/or consistency with data on β-delayed fission, isotope generation along prompt-neutron-capture chains in nuclear-weapons tests, and superheavy-element stability. In addition these studies all indicate that the model is realistic at considerable distances in Z and N from the region of nuclei where its parameters were determined.« less

  1. Fission barriers at the end of the chart of the nuclides

    SciTech Connect (OSTI)

    Mller, Peter; Sierk, Arnold J.; Ichikawa, Takatoshi; Iwamoto, Akira; Mumpower, Matthew

    2015-02-12

    We present calculated fission-barrier heights for 5239 nuclides for all nuclei between the proton and neutron drip lines with 171 ? A ? 330. The barriers are calculated in the macroscopic-microscopic finite-range liquid-drop (FRLDM) with a 2002 set of macroscopic-model parameters. The saddle-point energies are determined from potential-energy surfaces based on more than five million different shapes, defined by five deformation parameters in the three-quadratic-surface shape parametrization: elongation, neck diameter, left-fragment spheroidal deformation, right-fragment spheroidal deformation, and nascent-fragment mass asymmetry. The energy of the ground state is determined by calculating the lowest-energy configuration in both the Nilsson perturbed-spheroid (?) and the spherical-harmonic (?) parametrizations, including axially asymmetric deformations. The lower of the two results (correcting for zero-point motion) is defined as the ground-state energy. The effect of axial asymmetry on the inner barrier peak is calculated in the (?,?) parametrization. We have earlier benchmarked our calculated barrier heights to experimentally extracted barrier parameters and found average agreement to about one MeV for known data across the nuclear chart. Here we do additional benchmarks and investigate the qualitative and, when possible, quantitative agreement and/or consistency with data on ?-delayed fission, isotope generation along prompt-neutron-capture chains in nuclear-weapons tests, and superheavy-element stability. In addition these studies all indicate that the model is realistic at considerable distances in Z and N from the region of nuclei where its parameters were determined.

  2. Quantum mechanical method of fragment's angular and energy distribution calculation for binary and ternary fission

    SciTech Connect (OSTI)

    Kadmensky, S. G., E-mail: kadmensky@phys.vsu.ru; Titova, L. V.; Pen'kov, N. V. [Voronezh State University (Russian Federation)

    2006-08-15

    In the framework of quantum-mechanical fission theory, the method of calculation for partial fission width amplitudes and asymptotic behavior of the fissile nucleus wave function with strong channel coupling taken into account has been suggested. The method allows one to solve the calculation problem of angular and energy distribution countation for binary and ternary fission.

  3. Fission-suppressed hybrid reactor: the fusion breeder

    SciTech Connect (OSTI)

    Moir, R.W.; Lee, J.D.; Coops, M.S.

    1982-12-01

    Results of a conceptual design study of a /sup 233/U-producing fusion breeder are presented. The majority of the study was devoted to conceptual design and evaluation of a fission-suppressed blanket and to fuel cycle issues such as fuel reprocessing, fuel handling, and fuel management. Studies in the areas of fusion engineering, reactor safety, and economics were also performed.

  4. MCNP6. Simulating Correlated Data in Fission Events

    SciTech Connect (OSTI)

    Rising, Michael Evan; Sood, Avneet

    2015-12-03

    This report is a series of slides discussing the MCNP6 code and its status in simulating fission. Applications of interest include global security and nuclear nonproliferation, detection of special nuclear material (SNM), passive and active interrogation techniques, and coincident neutron and photon leakage.

  5. Fission gas retention and axial expansion of irradiated metallic fuel

    SciTech Connect (OSTI)

    Fenske, G.R.; Emerson, J.E.; Savoie, F.E.; Johanson, E.W.

    1986-05-01

    Out-of-reactor experiments utilizing direct electrical heating and infrared heating techniques were performed on irradiated metallic fuel. The results indicate accelerated expansion can occur during thermal transients and that the accelerated expansion is driven by retained fission gases. The results also demonstrate gas retention and, hence, expansion behavior is a function of axial position within the pin.

  6. Browse by Discipline -- E-print Network Subject Pathways: Fission...

    Office of Scientific and Technical Information (OSTI)

    Fission and Nuclear Technologies Go to Research Groups Preprints Provided by Individual Scientists: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Go back to Individual ...

  7. Fission properties and production mechanisms for the heaviest known elements

    SciTech Connect (OSTI)

    Hoffman, D.C.

    1981-01-01

    Mass yields of the spontaneous fission of Fm isotopes, Cf isotopes, and /sup 259/Md are discussed. Actinide yields were measured for bombardments of /sup 248/Cm with /sup 16/O, /sup 18/O, /sup 20/Ne, and /sup 22/Ne. A superheavy product might be produced by bombarding /sup 248/Cm with /sup 48/Ca ions. 12 figures. (DLC)

  8. Fission matrix capability for MCNP, Part I - Theory

    SciTech Connect (OSTI)

    Brown, F. B.; Carney, S. E.; Kiedrowski, B. C.; Martin, W. R.

    2013-07-01

    The theory underlying the fission matrix method is derived using a rigorous Green's function approach. The method is then used to investigate fundamental properties of the transport equation for a continuous-energy physics treatment. We provide evidence that an infinite set of discrete, real eigenvalues and eigenfunctions exist for the continuous-energy problem, and that the eigenvalue spectrum converges smoothly as the spatial mesh for the fission matrix is refined. We also derive equations for the adjoint solution. We show that if the mesh is sufficiently refined so that both forward and adjoint solutions are valid, then the adjoint fission matrix is identical to the transpose of the forward matrix. While the energy-dependent transport equation is strictly bi-orthogonal, we provide surprising results that the forward modes are very nearly self-adjoint for a variety of continuous-energy problems. A companion paper (Part II - Applications) describes the initial experience and results from implementing this fission matrix capability into the MCNP Monte Carlo code. (authors)

  9. Nuclear Design of the HOMER-15 Mars Surface Fission Reactor

    SciTech Connect (OSTI)

    Poston, David I.

    2002-07-01

    The next generation of robotic missions to Mars will most likely require robust power sources in the range of 3 to 20 kWe. Fission systems are well suited to provide safe, reliable, and economic power within this range. The goal of this study is to design a compact, low-mass fission system that meets Mars surface power requirements, while maintaining a high level of safety and reliability at a relatively low cost. The Heat pipe Power System (HPS) is one possible approach for producing near-term, low-cost, space fission power. The goal of the HPS project is to devise an attractive space fission system that can be developed quickly and affordably. The primary ways of doing this are by using existing technology and by designing the system for inexpensive testing. If the system can be designed to allow highly prototypic testing with electrical heating, then an exhaustive test program can be carried out quickly and inexpensively, and thorough testing of the actual flight unit can be performed - which is a major benefit to reliability. Over the past 4 years, three small HPS proof-of-concept technology demonstrations have been conducted, and each has been highly successful. The Heat pipe-Operated Mars Exploration Reactor (HOMER) is a derivative of the HPS designed especially for producing power on the surface of Mars. The HOMER-15 is a 15-kWt reactor that couples with a 3-kWe Stirling engine power system. The reactor contains stainless-steel (SS)-clad uranium nitride (UN) fuel pins that are structurally and thermally bonded to SS/sodium heat pipes. Fission energy is conducted from the fuel pins to the heat pipes, which then carry the heat to the Stirling engine. This paper describes conceptual design and nuclear performance the HOMER-15 reactor. (author)

  10. Chemical Supply Chain Analysis | NISAC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NISACCapabilitiesChemical Supply Chain Analysis content top Chemical Supply Chain Analysis NISAC has developed a range of capabilities for analyzing the consequences of disruptions to the chemical manufacturing industry. Each capability provides a different but complementary perspective on the questions of interest-questions like Given an event, will the entire chemical sector be impacted or just parts? Which chemicals, plants, and complexes could be impacted? In which regions of the country?

  11. Bulk and surface controlled diffusion of fission gas atoms

    SciTech Connect (OSTI)

    Andersson, Anders D.

    2012-08-09

    Fission gas retention and release impact nuclear fuel performance by, e.g., causing fuel swelling leading to mechanical interaction with the clad, increasing the plenum pressure and reducing the gap thermal conductivity. All of these processes are important to understand in order to optimize operating conditions of nuclear reactors and to simulate accident scenarios. Most fission gases have low solubility in the fuel matrix, which is especially pronounced for large fission gas atoms such as Xe and Kr, and as a result there is a significant driving force for segregation of gas atoms to extended defects such as grain boundaries or dislocations and subsequently for nucleation of gas bubbles at these sinks. Several empirical or semi-empirical models have been developed for fission gas release in nuclear fuels, e.g. [1-6]. One of the most commonly used models in fuel performance codes was published by Massih and Forsberg [3,4,6]. This model is similar to the early Booth model [1] in that it applies an equivalent sphere to separate bulk UO{sub 2} from grain boundaries represented by the sphere circumference. Compared to the Booth model, it also captures trapping at grain boundaries, fission gas resolution and it describes release from the boundary by applying timedependent boundary conditions to the circumference. In this work we focus on the step where fission gas atoms diffuse from the grain interior to the grain boundaries. The original Massih-Forsberg model describes this process by applying an effective diffusivity divided into three temperature regimes. In this report we present results from density functional theory calculations (DFT) that are relevant for the high (D{sub 3}) and intermediate (D{sub 2}) temperature diffusivities of fission gases. The results are validated by making a quantitative comparison to Turnbull's [8-10] and Matzke's data [12]. For the intrinsic or high temperature regime we report activation energies for both Xe and Kr diffusion in UO{sub 2{+-}x}, which compare favorably to available experiments. This is an extension of previous work [13]. In particular, it applies improved chemistry models for the UO{sub 2{+-}x} nonstoichiometry and its impact on the fission gas activation energies. The derivation of these models follows the approach that used in our recent study of uranium vacancy diffusion in UO{sub 2} [14]. Also, based on the calculated DFT data we analyze vacancy enhanced diffusion mechanisms in the intermediate temperature regime. In addition to vacancy enhanced diffusion we investigate species transport on the (111) UO{sub 2} surface. This is motivated by the formation of small voids partially filled with fission gas atoms (bubbles) in UO{sub 2} under irradiation, for which surface diffusion could be the rate-limiting transport step. Diffusion of such bubbles constitutes an alternative mechanism for mass transport in these materials.

  12. Molten salt extraction of transuranic and reactive fission products from used uranium oxide fuel

    DOE Patents [OSTI]

    Herrmann, Steven Douglas

    2014-05-27

    Used uranium oxide fuel is detoxified by extracting transuranic and reactive fission products into molten salt. By contacting declad and crushed used uranium oxide fuel with a molten halide salt containing a minor fraction of the respective uranium trihalide, transuranic and reactive fission products partition from the fuel to the molten salt phase, while uranium oxide and non-reactive, or noble metal, fission products remain in an insoluble solid phase. The salt is then separated from the fuel via draining and distillation. By this method, the bulk of the decay heat, fission poisoning capacity, and radiotoxicity are removed from the used fuel. The remaining radioactivity from the noble metal fission products in the detoxified fuel is primarily limited to soft beta emitters. The extracted transuranic and reactive fission products are amenable to existing technologies for group uranium/transuranic product recovery and fission product immobilization in engineered waste forms.

  13. MEASUREMENT OF THE AVERAGE ENERGY AND MULTIPLICITY OF PROMPT-FISSION-NEUTRONS FROM 238U(n,f) AND 237 Np(n,f) FROM 1 TO 200 MeV.

    SciTech Connect (OSTI)

    TAIEB,J.; GRANIER, T.; ETHVIGNOT, T.; DEVLIN, M.; HAIGHT, R.C.; NELSON, R.O.; ODONNELL, J.M.; ROCHMAN, D.

    2007-06-28

    Taking advantage of the neutron source of the LANCSE, it has been possible to obtain a measure of the velocity distribution and the number of prompt-neutrons emitted in the neutron-induced fission of {sup 238}U and {sup 237}Np over a broad incident neutron energy range. The mean kinetic energy was extracted and is shown as the function of the incident-neutron energy. We confirm here the observation, for both reactions, of a dip around the second chance fission which is explained by the lower kinetic energy of the pre-fission neutrons. Such a observation is reproduced by Los Alamos model as implemented at Bruyeres le Chatel and by the Maslov model. As far as the neutron multiplicity is concerned, a similar dip is observed. However, such a behavior is not present in data measured by other groups.

  14. Advanced fission and fossil plant economics-implications for fusion

    SciTech Connect (OSTI)

    Delene, J.G.

    1994-09-01

    In order for fusion energy to be a viable option for electric power generation, it must either directly compete with future alternatives or serve as a reasonable backup if the alternatives become unacceptable. This paper discusses projected costs for the most likely competitors with fusion power for baseload electric capacity and what these costs imply for fusion economics. The competitors examined include advanced nuclear fission and advanced fossil-fired plants. The projected costs and their basis are discussed. The estimates for these technologies are compared with cost estimates for magnetic and inertial confinement fusion plants. The conclusion of the analysis is that fusion faces formidable economic competition. Although the cost level for fusion appears greater than that for fission or fossil, the costs are not so high as to preclude fusion`s potential competitiveness.

  15. Advanced fission and fossil plant economics-implications for fusion

    SciTech Connect (OSTI)

    Delene, J.G.

    1994-11-01

    In order for fusion energy to be a viable option for electric power generation, it must either directly compete with future alternatives or serve as a reasonable backup if the alternatives become unacceptable. This paper discusses projected costs for the most likely competitors with fusion power for base-load electric capacity and what these costs imply for fusion economics. The competitors examined include advanced nuclear fission and advanced fossil-fired plants. The projected costs and their basis are discussed. The estimates for these technologies are compared with cost estimates for magnetic and inertial confinement fusion plants. The conclusion of the analysis is that fusion faces formidable economic competition. Although the cost level for fusion appears greater than that for fission or fossil, the costs are not so high as to preclude fusion`s potential competitiveness.

  16. Method of fission heat flux determination from experimental data

    DOE Patents [OSTI]

    Paxton, Frank A.

    1999-01-01

    A method is provided for determining the fission heat flux of a prime specimen inserted into a specimen of a test reactor. A pair of thermocouple test specimens are positioned at the same level in the holder and a determination is made of various experimental data including the temperature of the thermocouple test specimens, the temperature of bulk water channels located in the test holder, the gamma scan count ratios for the thermocouple test specimens and the prime specimen, and the thicknesses of the outer clads, the fuel fillers, and the backclad of the thermocouple test specimen. Using this experimental data, the absolute value of the fission heat flux for the thermocouple test specimens and prime specimen can be calculated.

  17. Basic Physics Data: Measurement of Neutron Multiplicity from Induced Fission

    SciTech Connect (OSTI)

    Pozzi, Sara; Haight, Robert

    2015-05-04

    From October 1 to October 17 a team of researchers from UM visited the LANSCE facility for an experiment during beam-time allotted from October 4 to October 17. A total of 24 detectors were used at LANSCE including liquid organic scintillation detectors (EJ-309), NaI scintillation detectors, and Li-6 enriched glass detectors. It is a double time-offlight (TOF) measurement using spallation neutrons generated by a target bombarded with pulsed high-energy protons. The neutrons travel to an LLNL-manufactured parallel plate avalanche chamber (PPAC) loaded with thin U-235 foils in which fission events are induced. The generated fission neutrons and photons are then detected in a detector array designed and built at UM and shipped to LANSCE. Preparations were made at UM, where setup and proposed detectors were tested. The UM equipment was then shipped to LANSCE for use at the 15L beam of the weapons neutron research (WNR) facility.

  18. Fission Fragment Angular Distributions measured with a Time Projection Chamber

    SciTech Connect (OSTI)

    Kleinrath, Verena

    2015-04-28

    The subject is presented in a series of slides with the following organization: Introduction (What is anisotropy? Relevance (Theory and ratio cross section), Previous measurements); Experiment (Particle tracking in the fissionTPC, Neutron time of flight, Data analysis & uncertainty calculation, Preliminary result for 235U); and Future Work (Refine 235U result, Process 239Pu data).

  19. FUEL ELEMENTS FOR THERMAL-FISSION NUCLEAR REACTORS

    DOE Patents [OSTI]

    Flint, O.

    1961-01-10

    Fuel elements for thermal-fission nuclear reactors are described. The fuel element is comprised of a core of alumina, a film of a metal of the class consisting of copper, silver, and nickel on the outer face of the core, and a coating of an oxide of a metal isotope of the class consisting of Un/sup 235/, U/ sup 233/, and Pu/sup 239/ on the metal f ilm.

  20. September 2013 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy, Office of Scientific and Technical Information September 2013 Most Viewed Documents for Fission And Nuclear Technologies Science Subject Feed Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 133 /> Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank radwaste] Rezvani, M.A.; Ziada, H.H. (Westinghouse

  1. September 2015 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy, Office of Scientific and Technical Information September 2015 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 444 System Definition and Analysis: Power Plant Design and Layout NONE (1996) 273 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank

  2. Description of induced nuclear fission with Skyrme energy functionals. II.

    Office of Scientific and Technical Information (OSTI)

    Finite temperature effects (Journal Article) | SciTech Connect functionals. II. Finite temperature effects Citation Details In-Document Search This content will become publicly available on March 24, 2016 Title: Description of induced nuclear fission with Skyrme energy functionals. II. Finite temperature effects Authors: Schunck, N. ; Duke, D. ; Carr, H. Publication Date: 2015-03-25 OSTI Identifier: 1180645 Grant/Contract Number: AC52-07NA27344 Type: Publisher's Accepted Manuscript Journal

  3. December 2015 Most Viewed Documents for Fission And Nuclear Technologies |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    OSTI, US Dept of Energy, Office of Scientific and Technical Information Fission And Nuclear Technologies Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 432 System Definition and Analysis: Power Plant Design and Layout NONE (1996) 323 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank radwaste] Rezvani, M.A.; Ziada, H.H.

  4. June 2015 Most Viewed Documents for Fission And Nuclear Technologies |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    OSTI, US Dept of Energy, Office of Scientific and Technical Information June 2015 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 305 System Definition and Analysis: Power Plant Design and Layout NONE (1996) 296 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank radwaste]

  5. Most Viewed Documents for Fission And Nuclear Technologies: September 2014

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    | OSTI, US Dept of Energy, Office of Scientific and Technical Information for Fission And Nuclear Technologies: September 2014 Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 71 Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 68 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank radwaste] Rezvani,

  6. Most Viewed Documents for Fission and Nuclear Technologies: December 2014 |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    OSTI, US Dept of Energy, Office of Scientific and Technical Information Most Viewed Documents for Fission and Nuclear Technologies: December 2014 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank radwaste] Rezvani, M.A.; Ziada, H.H. (Westinghouse Hanford Co., Richland, WA (United States)); Shurrab, M.S. (Westinghouse Savannah River Co., Aiken, SC (United States)) (1992) 67 Behavior of spent nuclear fuel in water pool storage Johnson,

  7. March 2015 Most Viewed Documents for Fission And Nuclear Technologies |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    OSTI, US Dept of Energy, Office of Scientific and Technical Information 5 Most Viewed Documents for Fission And Nuclear Technologies Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank radwaste] Rezvani, M.A.; Ziada, H.H. (Westinghouse Hanford Co., Richland, WA (United States)); Shurrab, M.S. (Westinghouse Savannah River Co., Aiken, SC (United States)) (1992) 223 Estimation of gas leak rates through very small orifices and channels. [From

  8. Fission Fragment Mass Distributions and Total Kinetic Energy Release of 235-Uranium and 238-Uranium in Neutron-Induced Fission at Intermediate and Fast Neutron Energies

    SciTech Connect (OSTI)

    Duke, Dana Lynn

    2015-11-12

    This Ph.D. dissertation describes a measurement of the change in mass distributions and average total kinetic energy (TKE) release with increasing incident neutron energy for fission of 235U and 238U. Although fission was discovered over seventy-five years ago, open questions remain about the physics of the fission process. The energy of the incident neutron, En, changes the division of energy release in the resulting fission fragments, however, the details of energy partitioning remain ambiguous because the nucleus is a many-body quantum system. Creating a full theoretical model is difficult and experimental data to validate existing models are lacking. Additional fission measurements will lead to higher-quality models of the fission process, therefore improving applications such as the development of next-generation nuclear reactors and defense. This work also paves the way for precision experiments such as the Time Projection Chamber (TPC) for fission cross section measurements and the Spectrometer for Ion Determination in Fission (SPIDER) for precision mass yields.

  9. Novette chain design and performance

    SciTech Connect (OSTI)

    Hunt, J.T.; Speck, D.R.

    1980-12-11

    The design and performance of the Novette laser system, which is a two-beam, two-wavelength (1.05 ..mu.. and 0.53 ..mu..) target irradiation facility using phosphate glass laser chains, are discussed with information on the glass properties, controlling factors in the design selection, and projected performance with varying operating conditions. (LCL)

  10. Microstructural Characterization of Irradiated U-7Mo/Al-5Si Dispersion to High Fission Density

    SciTech Connect (OSTI)

    J. Gan; B. D. Miller; D. D. Keiser, Jr.; A. B. Robinson; J. W. Madden; P. G. Medvedev; D. M. Wachs

    2014-11-01

    The fuel development program for research and test reactors calls for improved knowledge on the effect of microstructure on fuel performance in reactors. This work summarizes the recent TEM microstructural characterization of an irradiated U-7Mo/Al-5Si dispersion fuel plate (R3R050) irradiated in the Advanced Test Reactor (ATR) at Idaho National Laboratory to 5.21021 fissions/cm3. While a large fraction of the fuel grains is decorated with large bubbles, there is no evidence showing interlinking of these large bubbles at the specified fission density. The attachment of solid fission product precipitates to the bubbles is likely the result of fission product diffusion into these bubbles. The process of fission gas bubble superlattice collapse appears through bubble coalescence. The results are compared with the previous TEM work of the dispersion fuels irradiated to lower fission density from the same fuel plate.

  11. Neutron-induced fission measurements at the time-of-flight facility nELBE

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kögler, T.; Beyer, R.; Junghans, A. R.; Massarczyk, R.; Schwengner, R.; Wagner, A.

    2015-05-18

    Neutron-induced fission of ²⁴²Pu is studied at the photoneutron source nELBE. The relative fast neutron fission cross section was determined using actinide fission chambers in a time-of-flight experiment. A good agreement of present nuclear data with evalua- tions has been achieved in the range of 100 keV to 10 MeV.

  12. Neutron-flux profile monitor for use in a fission reactor

    DOE Patents [OSTI]

    Kopp, M.K.; Valentine, K.H.

    1981-09-15

    A neutron flux monitor is provided which consists of a plurality of fission counters arranged as spaced-apart point detectors along a delay line. As a fission event occurs in any one of the counters, two delayed current pulses are generated at the output of the delay line. The time separation of the pulses identifies the counter in which the particular fission event occurred. Neutron flux profiles of reactor cores can be more accurately measured as a result.

  13. Assessment of fission product yields data needs in nuclear reactor applications

    SciTech Connect (OSTI)

    Kern, K.; Becker, M.; Broeders, C.

    2012-07-01

    Studies on the build-up of fission products in fast reactors have been performed, with particular emphasis on the effects related to the physics of the nuclear fission process. Fission product yields, which are required for burn-up calculations, depend on the proton and neutron number of the target nucleus as well as on the incident neutron energy. Evaluated nuclear data on fission product yields are available for all relevant target nuclides in reactor applications. However, the description of their energy dependence in evaluated data is still rather rudimentary, which is due to the lack of experimental fast fission data and reliable physical models. Additionally, physics studies of evaluated JEFF-3.1.1 fission yields data have shown potential improvements, especially for various fast fission data sets of this evaluation. In recent years, important progress in the understanding of the fission process has been made, and advanced model codes are currently being developed. This paper deals with the semi-empirical approach to the description of the fission process, which is used in the GEF code being developed by K.-H. Schmidt and B. Jurado on behalf of the OECD Nuclear Energy Agency, and with results from the corresponding author's diploma thesis. An extended version of the GEF code, supporting the calculation of spectrum weighted fission product yields, has been developed. It has been applied to the calculation of fission product yields in the fission rate spectra of a MOX fuelled sodium-cooled fast reactor. Important results are compared to JEFF-3.1.1 data and discussed in this paper. (authors)

  14. Observation of new spontaneous fission activities from elements 100 to 105

    SciTech Connect (OSTI)

    Somerville, L.P.

    1982-03-01

    Several new Spontaneous Fission (SF) activities have been found. No definite identification could be made for any of the new SF activities; however, half-lives and possible assignments to element-104 isotopes consistent with several cross bombardments include /sup 257/Rf(3.8 s, 14% SF), /sup 258/Rf(13 ms), /sup 259/Rf(approx. 3 s, 8% SF), /sup 260/Rf(approx. 20 ms), and /sup 262/Rf(approx. 50 ms). The 80-ms SF activity claimed by the Dubna group for the discovery of element 104 (/sup 260/104) was not observed. A difficulty exists in the interpretation that /sup 260/Rf is a approx. 20-ms SF activity: in order to be correct, for example, the SF activities with half-lives between 14 and 24 ms produced in the reactions 109- to 119-MeV /sup 18/O + /sup 248/Cm, 88- to 100-MeV /sup 15/N + /sup 249/Bk, and 96-MeV /sup 18/O + /sup 249/Cf must be other nuclides due to their large production cross sections, or the cross sections for production of /sup 260/Rf must be enhanced by unknown mechanisms. Based on calculated total production cross sections a possible approx. 1% electron-capture branch in /sup 258/Lr(4.5 s) to the SF emitter /sup 258/No(1.2 ms) and an upper limit of 0.05% for SF branching in /sup 254/No(55 s) were determined. Other measured half-lives from unknown nuclides produced in respective reactions include approx. 1.6 s (/sup 18/O + /sup 248/CM), indications of a approx. 47-s SF activity (75-MeV /sup 12/C + /sup 249/Cf), and two or more SF activities with 3 s less than or equal to T/sub 1/2/ less than or equal to 60 s (/sup 18/O + /sup 249/Bk). The most exciting conclusion of this work is that if the tentative assignments to even-even element 104 isotopes are correct, there would be a sudden change in the SF half-life systematics at element 104 which has been predicted theoretically and attributed to the disappearance of the second hump of the double-humped fission barrier.

  15. Accelerator spallation reactors for breeding of fissile fuel and transmuting fission products. Status and prospects

    SciTech Connect (OSTI)

    Steinberg, M.

    1981-01-01

    This report constitutes a summary review of the status and prospects of the development of accelerator spallation reactors for breeding fissile fuel and for transmuting fission products.

  16. Fission yeast RNA triphosphatase reads an Spt5 CTD code (Journal...

    Office of Scientific and Technical Information (OSTI)

    Title: Fission yeast RNA triphosphatase reads an Spt5 CTD code Authors: Doamekpor, Selom K. ; Schwer, Beate ; Sanchez, Ana M. ; Shuman, Stewart ; Lima, Christopher D. 1 ; ...

  17. Heavy-element fission barriers (Journal Article) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Search Results Journal Article: Heavy-element fission barriers Citation ... OSTI Identifier: 21289903 Resource Type: Journal Article Resource Relation: Journal Name: ...

  18. From laser particle acceleration to the synthesis of extremely neutron rich isotopes via the novel fission-fusion mechanism

    SciTech Connect (OSTI)

    Thirolf, P. G.

    2015-02-24

    High-power, short pulse lasers have emerged in the last decade as attractive tools for accelerating charged particles (electrons, ions) to high energies over mm-scale acceleration lengths, thus promising to rival conventional acceleration techniques in the years ahead. In the first part of the article, the principles of laser-plasma interaction as well as the techniques and the current status of the acceleration of electron and ion beams will be briefly introduced. In particular with the upcoming next generation of multi-PW class laser systems, such as the one under construction for the ELI-Nuclear Physics project in Bucharest (ELI-NP), very efficient acceleration mechanisms for brilliant ion beams like radiation pressure acceleration (RPA) come into reach. Here, ultra-dense ion beams reaching solid-state density can be accelerated from thin target foils, exceeding the density of conventionally accelerated ion beams by about 14 orders of magnitude. This unique property of laser-accelerated ion beams can be exploited to explore the scenario of a new reaction mechanism called fission-fusion, which will be introduced in the second part of the article. Accelerating fissile species (e.g. {sup 232}Th) towards a second layer of the same material will lead to fission both of the beam-like and target-like particles. Due to the close to solid-state density of the accelerated ion bunches, fusion may occur between neutron-rich (light) fission products. This may open an access path towards extremely neutron-rich nuclides in the vicinity of the N=126 waiting point of the astrophysical r process. Waiting points at closed nucleon shells play a crucial role in controlling the reaction rates. However, since most of the pathway of heavy-element formation via the rapid-neutron capture process (r-process) runs in terra incognita of the nuclear landscape, in particular the waiting point at N=126 is yet unexplored and will remain largely inaccessible to conventional nuclear reaction schemes even at next-generation radioactive beam facilities, underlining the attractive perspectives offered, e.g., by ELI-NP.

  19. Energy dependence of fission product yields from 235U, 238U and 239Pu for incident neutron energies between 0.5 and 14.8 MeV

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Gooden, M. E.; Arnold, C. W.; Becker, J. A.; Bhatia, C.; Bhike, M.; Bond, E. M.; Bredeweg, T. A.; Fallin, B.; Fowler, M. M.; Howell, C. R.; et al

    2016-01-06

    In this study, Fission Product Yields (FPY) have historically been one of the most observable features of the fission process. They are known to have strong variations that are dependent on the fissioning species, the excitation energy, and the angular momentum of the compound system. However, consistent and systematic studies of the variation of these FPY with energy have proved challenging. This is caused primarily by the nature of the experiments that have traditionally relied on radiochemical procedures to isolate specific fission products. Although radiochemical procedures exist that can isolate all products, each element presents specific challenges and introduces varyingmore » degrees of systematic errors that can make inter-comparison of FPY uncertain. Although of high importance in fields such as nuclear forensics and Stockpile Stewardship, accurate information about the energy dependence of neutron induced FPY are sparse, due primarily to the lack of suitable monoenergetic neutron sources. There is a clear need for improved data, and to address this issue, a collaboration was formed between Los Alamos National Laboratory (LANL), Lawrence Livermore National Laboratory (LLNL) and the Triangle Universities Nuclear Laboratory (TUNL) to measure the energy dependence of FPY for 235U, 238U and 239Pu. The measurements have been performed at TUNL, using a 10 MV Tandem Van de Graaff accelerator to produce monoenergetic neutrons at energies between 0.6 MeV to 14.8 MeV through a variety of reactions. The measurements have utilized a dual-fission chamber, with thin (10-100 μg/cm2) reference foils of similar material to a thick (100-400 mg) activation target held in the center between the chambers. This method allows for the accurate determination of the number of fissions that occurred in the thick target without requiring knowledge of the fission cross section or neutron fluence on target. Following activation, the thick target was removed from the dual-fission chamber and gamma-ray counted using shielded HPGe detectors for a period of 1-2 months to determine the yield of various fission products. To the extent possible all irradiation and counting procedures were kept the same to minimize sources of systematic errors. FPY have been determined at incident neutron energies of 0.6, 1.4, 2.4, 3.5, 4.6, 5.5, 8.9 and 14.8 MeV.« less

  20. Analysis of Fission Products on the AGR-1 Capsule Components

    SciTech Connect (OSTI)

    Paul A. Demkowicz; Jason M. Harp; Philip L. Winston; Scott A. Ploger

    2013-03-01

    The components of the AGR-1 irradiation capsules were analyzed to determine the retained inventory of fission products in order to determine the extent of in-pile fission product release from the fuel compacts. This includes analysis of (i) the metal capsule components, (ii) the graphite fuel holders, (iii) the graphite spacers, and (iv) the gas exit lines. The fission products most prevalent in the components were Ag-110m, Cs 134, Cs 137, Eu-154, and Sr 90, and the most common location was the metal capsule components and the graphite fuel holders. Gamma scanning of the graphite fuel holders was also performed to determine spatial distribution of Ag-110m and radiocesium. Silver was released from the fuel components in significant fractions. The total Ag-110m inventory found in the capsules ranged from 1.210 2 (Capsule 3) to 3.810 1 (Capsule 6). Ag-110m was not distributed evenly in the graphite fuel holders, but tended to concentrate at the axial ends of the graphite holders in Capsules 1 and 6 (located at the top and bottom of the test train) and near the axial center in Capsules 2, 3, and 5 (in the center of the test train). The Ag-110m further tended to be concentrated around fuel stacks 1 and 3, the two stacks facing the ATR reactor core and location of higher burnup, neutron fluence, and temperatures compared with Stack 2. Detailed correlation of silver release with fuel type and irradiation temperatures is problematic at the capsule level due to the large range of temperatures experienced by individual fuel compacts in each capsule. A comprehensive Ag 110m mass balance for the capsules was performed using measured inventories of individual compacts and the inventory on the capsule components. For most capsules, the mass balance was within 11% of the predicted inventory. The Ag-110m release from individual compacts often exhibited a very large range within a particular capsule.

  1. Radiolysis Concerns for Water Shielding in Fission Surface Power Applications

    SciTech Connect (OSTI)

    Schoenfeld, Michael P.; Anghaie, Samim

    2008-01-21

    This paper presents an overview of radiolysis concerns with regard to water shields for fission surface power. A review of the radiolysis process is presented and key parameters and trends are identified. From this understanding of the radiolytic decomposition of water, shield pressurization and corrosion are identified as the primary concerns. Existing experimental and modeling data addressing concerns are summarized. It was found that radiolysis of pure water in a closed volume results in minimal, if any net decomposition, and therefore reduces the potential for shield pressurization and corrosion.

  2. Introducing Nuclear Data Evaluations of Prompt Fission Neutron Spectra

    SciTech Connect (OSTI)

    Neudecker, Denise

    2015-06-17

    Nuclear data evaluations provide recommended data sets for nuclear data applications such as reactor physics, stockpile stewardship or nuclear medicine. The evaluated data are often based on information from multiple experimental data sets and nuclear theory using statistical methods. Therefore, they are collaborative efforts of evaluators, theoreticians, experimentalists, benchmark experts, statisticians and application area scientists. In this talk, an introductions is given to the field of nuclear data evaluation at the specific example of a recent evaluation of the outgoing neutron energy spectrum emitted promptly after fission from 239Pu and induced by neutrons from thermal to 30 MeV.

  3. Cryogenic method for measuring nuclides and fission gases

    DOE Patents [OSTI]

    Perdue, P.T.; Haywood, F.F.

    1980-05-02

    A cryogenic method is provided for determining airborne gases and particulates from which gamma rays are emitted. A special dewar counting vessel is filled with the contents of the sampling flask which is immersed in liquid nitrogen. A vertically placed sodium-iodide or germanium-lithium gamma-ray detector is used. The device and method are of particular use in measuring and identifying the radioactive noble gases including emissions from coal-fired power plants, as well as fission gases released or escaping from nuclear power plants.

  4. Fission meter and neutron detection using poisson distribution comparison

    DOE Patents [OSTI]

    Rowland, Mark S; Snyderman, Neal J

    2014-11-18

    A neutron detector system and method for discriminating fissile material from non-fissile material wherein a digital data acquisition unit collects data at high rate, and in real-time processes large volumes of data directly into information that a first responder can use to discriminate materials. The system comprises counting neutrons from the unknown source and detecting excess grouped neutrons to identify fission in the unknown source. Comparison of the observed neutron count distribution with a Poisson distribution is performed to distinguish fissile material from non-fissile material.

  5. April 2013 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy, Office of Scientific and Technical Information April 2013 Most Viewed Documents for Fission And Nuclear Technologies Science Subject Feed Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (null) 298 /> Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (null) 292 /> Graphite design handbook Ho, F.H. (1988) 216 /> System Definition and

  6. January 2013 Most Viewed Documents for Fission And Nuclear Technologies |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    OSTI, US Dept of Energy, Office of Scientific and Technical Information January 2013 Most Viewed Documents for Fission And Nuclear Technologies Laboratory studies of shear/leach processing of zircaloy clad metallic uranium reactor fuel Swanson, J.L.; Bray, L.A.; Kjarmo, H.E.; Ryan, J.L.; Matsuzaki, C.L.; Pitman, S.G.; Haberman, J.H. Working session 3: Tubing integrity Cueto-Felgueroso, C. [Tecnatom, S.A., San Sebastian de los Reyes, Madrid (Spain)]; Strosnider, J. [NRC, Washington, DC

  7. NEET Micro-Pocket Fission Detector Final Project report

    SciTech Connect (OSTI)

    Joy Rempe; Douglas McGregor; Philip Ugorowski; Michael Reichenberger; Takashi Ito

    2014-09-01

    A collaboration between the Idaho National Laboratory (INL), the Kansas State University (KSU), and the French Alternative Energies and Atomic Energy Commission, Commissariat l'nergie Atomique et aux Energies Alternatives, (CEA), is fundedby the Nuclear Energy Enabling Technologies (NEET) program to develop and test Micro-Pocket Fission Detectors (MPFDs), which are compact fission chambers capable of simultaneously measuring thermal neutron flux, fast neutron flux and temperature within a single package. When deployed, these sensors will significantly advance flux detection capabilities for irradiation tests in US Material Test Reactors (MTRs). Ultimately, evaluations may lead to a more compact, more accurate, and longer lifetime flux sensor for critical mock-ups, and high performance reactors, allowing several Department of Energy Office of Nuclear Energy (DOE-NE) programs to obtain higher accuracy/higher resolution data from irradiation tests of candidate new fuels and materials. Specifically, deployment of MPFDs will address several challenges faced in irradiations performed at MTRs: Current fission chamber technologies do not offer the ability to measure fast flux, thermal flux and temperature within a single compact probe; MPFDs offer this option. MPFD construction is very different than current fission chamber construction; the use of high temperature materials allow MPFDs to be specifically tailored to survive harsh conditions encountered in-core of high performance MTRs. The higher accuracy, high fidelity data available from the compact MPFD will significantly enhance efforts to validate new high-fidelity reactor physics codes and new multi-scale, multi-physics codes. MPFDs can be built with variable sensitivities to survive the lifetime of an experiment or fuel assembly in some MTRs, allowing for more efficient and cost effective power monitoring. The small size of the MPFDs allows multiple sensors to be deployed, offering the potential to accurately measure the flux and temperature profiles in the reactor. This report summarizes the status at the end of year two of this three year project. As documented in this report, all planned accomplishments for developing this unique new, compact, multipurpose sensor have been completed.

  8. NEET Micro-Pocket Fission Detector -- FY 2012 Status Report

    SciTech Connect (OSTI)

    Troy Unruh; Joy Rempe; Douglas McGregor; Philip Ugorowski; Michael Reichenberger

    2012-09-01

    A research program has been initiated by the NEET program for developing and testing compact miniature fission chambers capable of simultaneously measuring thermal neutron flux, fast neutron flux and temperature within a single package. When implemented, these sensors will significantly advance flux detection capabilities for irradiation tests in US Materials Test Reactors (MTRs).Ultimately, evaluations may lead to a more compact, more accurate, and longer lifetime flux sensor for critical mock-ups, high performance reactors and commercial nuclear power plants. Deployment of Micro-Pocket Fission Detectors (MPFDs) in US DOE-NE program irradiation tests will address several challenges: Current fission chamber technologies do not offer the ability to measure fast flux, thermal flux and temperature within a single compact probe, MPFDs offer this option. MPFD construction is very different then current fission chamber construction; the use of high temperature materials allow MPFDs to be specifically tailored to survive harsh conditions in typical high performance MTR irradiation tests. New high-fidelity reactor physics codes will need a small, accurate, multipurpose in-core sensor to validate the codes without perturbing the validation experiment; MPFDs fill this requirement. MPFDs can be built with variable sensitivities to survive the lifetime of an experiment or fuel assembly in some MTRs; allowing for more efficient and cost effective power monitoring. The small size of the MPFDs allows multiple sensors to be simultaneously deployed; obtaining data required to visualize the reactor flux and temperature profiles. This report summarizes the research progress for year 1 of this 3 year project. An updated design of the MPFD has been developed, materials and tools to support the new design have been procured, construction methods to support the new design have been initiated at INLs HTTL and KSUs SMART Laboratory, plating methods are being updated at KSU, new detector electronics have been designed, built and tested at KSU. In addition, a project meeting was held at KSU and a detector evaluation plan has been initiated between INL and KSU. Once NEET program evaluations are completed, the final MPFD will be deployed in MTR irradiations, enabling DOE-NE programs evaluating the performance of candidate new fuels and materials to better characterize irradiation test conditions.

  9. July 2013 Most Viewed Documents for Fission And Nuclear Technologies |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    OSTI, US Dept of Energy, Office of Scientific and Technical Information July 2013 Most Viewed Documents for Fission And Nuclear Technologies Science Subject Feed Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 286 /> Graphite design handbook Ho, F.H. (1988) 136 /> Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 123 /> Stress analysis and

  10. June 2014 Most Viewed Documents for Fission And Nuclear Technologies |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    OSTI, US Dept of Energy, Office of Scientific and Technical Information June 2014 Most Viewed Documents for Fission And Nuclear Technologies Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 78 Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 71 Review of thorium fuel reprocessing experience Brooksbank, R.E.; McDuffee, W.T.; Rainey, R.H. (1978) 70 Stress

  11. More on the term FissionŽ continued

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    continued To continue the details of the origin of the term "fission," here is more of the William (Bill) Arnold story. Bill was someone who came to live and work in Oak Ridge after having already achieved significant accomplishments in his chosen field. He is fondly remembered by Elias Greenbaum, Ph.D., Oak Ridge National Laboratory Corporate Fellow and UT-Battelle Distinguished Inventor, who continues to work in the same field that Bill Arnold worked in for so many years,

  12. March 2014 Most Viewed Documents for Fission And Nuclear Technologies |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    OSTI, US Dept of Energy, Office of Scientific and Technical Information 4 Most Viewed Documents for Fission And Nuclear Technologies Science Subject Feed Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 72 /> Peer-review study of the draft handbook for human-reliability analysis with emphasis on nuclear-power-plant applications, NUREG/CR-1278 Brune, R.L.; Weinstein, M.; Fitzwater, M.E. (1983) 67 /> Stress analysis and evaluation of a rectangular pressure

  13. Uncertainty quantification in fission cross section measurements at LANSCE

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Tovesson, F.

    2015-01-09

    Neutron-induced fission cross sections have been measured for several isotopes of uranium and plutonium at the Los Alamos Neutron Science Center (LANSCE) over a wide range of incident neutron energies. The total uncertainties in these measurements are in the range 3–5% above 100 keV of incident neutron energy, which results from uncertainties in the target, neutron source, and detector system. The individual sources of uncertainties are assumed to be uncorrelated, however correlation in the cross section across neutron energy bins are considered. The quantification of the uncertainty contributions will be described here.

  14. An innovative acoustic sensor for first in-pile fission gas release determination - REMORA 3 experiment

    SciTech Connect (OSTI)

    Rosenkrantz, E.; Ferrandis, J. Y.; Augereau, F.; Lambert, T.; Fourmentel, D.; Tiratay, X.

    2011-07-01

    A fuel rod has been instrumented with a new design of an acoustic resonator used to measure in a non destructive way the internal rod plenum gas mixture composition. This ultrasonic sensor has demonstrated its ability to operate in pile during REMORA 3 irradiation experiment carried out in the OSIRIS Material Testing Reactor (CEA Saclay, France). Due to very severe experimental conditions such as temperature rising up to 150 deg.C and especially, high thermal fluence level up to 3.5 10{sup 19} n.cm{sup 2}, the initial sensor gas speed of sound efficiency measurement was strongly reduced due to the irradiation effects on the piezo-ceramic properties. Nevertheless, by adding a differential signal processing method to the initial data analysis procedure validated before irradiation, the gas resonance peaks were successfully extracted from the output signal. From these data, the molar fractions variations of helium and fission gas were measured from an adapted Virial state equation. Thus, with this sensor, the kinetics of gas release inside fuel rods could be deduced from the in-pile measurements and specific calculations. These data will also give information about nuclear reaction effect on piezo-ceramics sensor under high neutron and gamma flux. (authors)

  15. Quantum and Thermodynamic Properties of Spontaneous and Low-Energy Induced Fission of Nuclei

    SciTech Connect (OSTI)

    Kadmensky, S.G. [Voronezh State University, Universitetskaya pl. 1, Voronezh, 394693 (Russian Federation)

    2005-12-01

    It is shown that A. Bohr's concept of transition fission states can be matched with the properties of Coriolis interaction if an axisymmetric fissile nucleus near the scission point remains cold despite a nonadiabatic character of nuclear collective deformation motion. The quantum and thermodynamic properties of various stages of binary and ternary fission after the descent of a fissile nucleus from the outer saddle point are studied within quantum-mechanical fission theory. It is shown that two-particle nucleon-nucleon correlations--in particular, superfluid correlations--play an important role in the formation of fission products and in the classification of fission transitions. The distributions of thermalized primary fission fragments with respect to spins and their projections onto the symmetry axis of the fissile nucleus and fission fragments are constructed, these distributions determining the properties of prompt neutrons and gamma rays emitted by these fragments. A new nonevaporation mechanism of third-particle production in ternary fission is proposed. This mechanism involves transitions of third particles from the cluster states of the fissile-nucleus neck to high-energy states under effects of the shake-off type that are due to the nonadiabatic character of nuclear collective deformation motion.

  16. Dispersion of the Neutron Emission in U{sup 235} Fission

    DOE R&D Accomplishments [OSTI]

    Feynman, R. P.; de Hoffmann, F.; Serber, R.

    1955-01-01

    Equations are developed which allow the calculation of the average number of neutrons per U{sup235} fission from experimental measurements. Experimental methods are described, the results of which give a value of (7.8 + 0.6){sup ½} neutrons per U{sup 235} thermal fission.

  17. Report on Fission Time Projection Chamber M3FT-12IN0210052

    SciTech Connect (OSTI)

    James K. Jewell

    2012-08-01

    The Time Projection Chamber is a collaborative effort to implement an innovative approach and deliver unprecedented fission measurements to DOE programs. This 4?-detector system will provide unrivaled 3-D data about the fission process. Shown here is a half populated TPC (2?) at the LLNL TPC laboratory as it undergoes testing before being shipped to LANSCE for beam experiments.

  18. SPEAR-BETA fuel-performance code system: fission-gas-release module. Final report. [PWR; BWR

    SciTech Connect (OSTI)

    Christensen, R.

    1983-03-01

    The original SPEAR-BETA general description manual covers both mechanistic and statistical models for fuel reliability, but only mechanistic modeling of fission gas release. This addendum covers the SPEAR-BETA statistical model for fission gas release.

  19. Microfluidic chemical reaction circuits

    DOE Patents [OSTI]

    Lee, Chung-cheng (Irvine, CA); Sui, Guodong (Los Angeles, CA); Elizarov, Arkadij (Valley Village, CA); Kolb, Hartmuth C. (Playa del Rey, CA); Huang, Jiang (San Jose, CA); Heath, James R. (South Pasadena, CA); Phelps, Michael E. (Los Angeles, CA); Quake, Stephen R. (Stanford, CA); Tseng, Hsian-rong (Los Angeles, CA); Wyatt, Paul (Tipperary, IE); Daridon, Antoine (Mont-Sur-Rolle, CH)

    2012-06-26

    New microfluidic devices, useful for carrying out chemical reactions, are provided. The devices are adapted for on-chip solvent exchange, chemical processes requiring multiple chemical reactions, and rapid concentration of reagents.

  20. Radiation re-solution of fission gas in non-oxide nuclear fuel

    SciTech Connect (OSTI)

    Matthews, Christopher; Schwen, Daniel; Klein, Andrew C.

    2015-02-01

    Renewed interest in fast nuclear reactors is creating a need for better understanding of fission gas bubble behavior in non-oxide fuels to support very long fuel lifetimes. Collisions between fission fragments and their subsequent cascades can knock fission gas atoms out of bubbles and back into the fuel lattice. We showed that these collisions can be treated as using the so-called homogenous atom-by-atom re-solution theory and calculated using the Binary Collision Approximation code 3DOT. The calculations showed that there is a decrease in the re-solution parameter as bubble radius increases until about 50 nm, at which the re-solution parameter stays nearly constant. Furthermore, our model shows ion cascades created in the fuel result in many more implanted fission gas atoms than collisions directly with fission fragments. This calculated re-solution parameter can be used to find a re-solution rate for future bubble simulations.

  1. P-odd and P-even correlations for third particles in ternary fission

    SciTech Connect (OSTI)

    Bunakov, V. E., E-mail: bunakov@vb13190.spbu.edu; Kadmensky, S. G., E-mail: kadmensky@phys.vsu.ru; Titova, L. V. [Russian Academy of Sciences, Petersburg Nuclear Physics Institute (Russian Federation)

    2008-12-15

    Within quantum-mechanical fission theory, P-odd and P-even correlations in angular distributions of products of the ternary fission of nuclei that is induced by polarized cold and thermal neutrons are investigated on the basis of a nonevaporative mechanism of third-particle emission and under the assumption that a two-humped fission barrier exists. It is shown that these correlations for third particles are induced by the analogous correlations for ternary-fission fragments, the latter being transferred to the third particle because of the kinematical conditions of third-particle emission that are associated with the charge and mass asymmetry of fragments. Optimum methods for observing the above correlations for third particles are discussed. The possibility of discovering the emission of prescission neutrons in the fission process against the background of evaporated neutrons by means of studying P-odd and P-even correlations is explored.

  2. Angular distribution of products of ternary nuclear fission induced by cold polarized neutrons

    SciTech Connect (OSTI)

    Bunakov, V. E. Kadmensky, S. G. Kadmensky, S. S.

    2008-11-15

    Within quantum fission theory, angular distributions of products originating from the ternary fission of nuclei that is induced by polarized cold and thermal neutrons are investigated on the basis of a non-evaporative mechanism of third-particle emission and a consistent description of fission-channel coupling. It is shown that the inclusion of Coriolis interaction both in the region of the discrete and in the region of the continuous spectrum of states of the system undergoing fission leads to T-odd correlations in the aforementioned angular distributions. The properties of the TRI and ROT effects discovered recently, which are due to the interference between the fission amplitudes of neutron resonances, are explored. The results obtained here are compared with their counterparts from classic calculations based on the trajectory method.

  3. Microscopic modeling of mass and charge distributions in the spontaneous fission of 240Pu

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sandhukhan, Jhilam; Nazarewicz, Witold; Schunck, Nicolas

    2016-01-20

    We propose a methodology to calculate microscopically the mass and charge distributions of spontaneous fission yields. We combine the multidimensional minimization of collective action for fission with stochastic Langevin dynamics to track the relevant fission paths from the ground-state configuration up to scission. The nuclear potential energy and collective inertia governing the tunneling motion are obtained with nuclear density functional theory in the collective space of shape deformations and pairing. As a result, we obtain a quantitative agreement with experimental data and find that both the charge and mass distributions in the spontaneous fission of 240Pu are sensitive both tomore » the dissipation in collective motion and to adiabatic fission characteristics.« less

  4. Reaction coordinates for electron transfer reactions

    SciTech Connect (OSTI)

    Rasaiah, Jayendran C.; Zhu Jianjun

    2008-12-07

    The polarization fluctuation and energy gap formulations of the reaction coordinate for outer sphere electron transfer are linearly related to the constant energy constraint Lagrangian multiplier m in Marcus' theory of electron transfer. The quadratic dependence of the free energies of the reactant and product intermediates on m and m+1, respectively, leads to similar dependence of the free energies on the reaction coordinates and to the same dependence of the activation energy on the reorganization energy and the standard reaction free energy. Within the approximations of a continuum model of the solvent and linear response of the longitudinal polarization to the electric field in Marcus' theory, both formulations of the reaction coordinate are expected to lead to the same results.

  5. Method for correcting for isotope burn-in effects in fission neutron dosimeters

    DOE Patents [OSTI]

    Gold, Raymond (Richland, WA); McElroy, William N. (Richland, WA)

    1988-01-01

    A method is described for correcting for effect of isotope burn-in in fission neutron dosimeters. Two quantities are measured in order to quantify the "burn-in" contribution, namely P.sub.Z',A', the amount of (Z', A') isotope that is burned-in, and F.sub.Z', A', the fissions per unit volume produced in the (Z', A') isotope. To measure P.sub.Z', A', two solid state track recorder fission deposits are prepared from the very same material that comprises the fission neutron dosimeter, and the mass and mass density are measured. One of these deposits is exposed along with the fission neutron dosimeter, whereas the second deposit is subsequently used for observation of background. P.sub.Z', A' is then determined by conducting a second irradiation, wherein both the irradiated and unirradiated fission deposits are used in solid state track recorder dosimeters for observation of the absolute number of fissions per unit volume. The difference between the latter determines P.sub.Z', A' since the thermal neutron cross section is known. F.sub.Z', A' is obtained by using a fission neutron dosimeter for this specific isotope, which is exposed along with the original threshold fission neutron dosimeter to experience the same neutron flux-time history at the same location. In order to determine the fissions per unit volume produced in the isotope (Z', A') as it ingrows during the irradiation, B.sub.Z', A', from these observations, the neutron field must generally be either time independent or a separable function of time t and neutron energy E.

  6. Microscopic Theory of Fission Younes, W; Gogny, D 73 NUCLEAR...

    Office of Scientific and Technical Information (OSTI)

    Conference Conference: Presented at: Compound Nuclear Reactions and Related Topics, Fish Camp, CA, United States, Oct 22 - Oct 26, 2007 Medium: ED; Size: PDF-file: 6 pages;...

  7. Gamma-ray Output Spectra from 239 Pu Fission

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ullmann, John

    2015-05-25

    Gamma-ray multiplicities, individual gamma-ray energy spectra, and total gamma energy spectra following neutron-induced fission of 239Pu were measured using the DANCE detector at Los Alamos. Corrections for detector response were made using a forward-modeling technique based on propagating sets of gamma rays generated from a paramaterized model through a GEANT model of the DANCE array and adjusting the parameters for best fit to the measured spectra. The results for the gamma-ray spectrum and multiplicity are in general agreement with previous results, but the measured total gamma-ray energy is about 10% higher. A dependence of the gamma-ray spectrum on the gamma-raymore » multplicity was also observed. Global model calculations of the multiplicity and gamma energy distributions are in good agreement with the data, but predict a slightly softer total-energy distribution.« less

  8. Investigation of inconsistent ENDF/B-VII.1 independent and cumulative fission product yields with proposed revisions

    SciTech Connect (OSTI)

    Pigni, Marco T; Francis, Matthew W; Gauld, Ian C

    2015-01-01

    A recent implementation of ENDF/B-VII. independent fission product yields and nuclear decay data identified inconsistencies in the data caused by the use of updated nuclear scheme in the decay sub-library that is not reflected in legacy fission product yield data. Recent changes in the decay data sub-library, particularly the delayed neutron branching fractions, result in calculated fission product concentrations that are incompatible with the cumulative fission yields in the library, and also with experimental measurements. A comprehensive set of independent fission product yields was generated for thermal and fission spectrum neutron induced fission for 235,238U and 239,241Pu in order to provide a preliminary assessment of the updated fission product yield data consistency. These updated independent fission product yields were utilized in the ORIGEN code to evaluate the calculated fission product inventories with experimentally measured inventories, with particular attention given to the noble gases. An important outcome of this work is the development of fission product yield covariance data necessary for fission product uncertainty quantification. The evaluation methodology combines a sequential Bayesian method to guarantee consistency between independent and cumulative yields along with the physical constraints on the independent yields. This work was motivated to improve the performance of the ENDF/B-VII.1 library in the case of stable and long-lived cumulative yields due to the inconsistency of ENDF/B-VII.1 fission p;roduct yield and decay data sub-libraries. The revised fission product yields and the new covariance data are proposed as a revision to the fission yield data currently in ENDF/B-VII.1.

  9. Continuous chain bit with downhole cycling capability

    DOE Patents [OSTI]

    Ritter, Don F. (Albuquerque, NM); St. Clair, Jack A. (Albuquerque, NM); Togami, Henry K. (Albuquerque, NM)

    1983-01-01

    A continuous chain bit for hard rock drilling is capable of downhole cycling. A drill head assembly moves axially relative to a support body while the chain on the head assembly is held in position so that the bodily movement of the chain cycles the chain to present new composite links for drilling. A pair of spring fingers on opposite sides of the chain hold the chain against movement. The chain is held in tension by a spring-biased tensioning bar. A head at the working end of the chain supports the working links. The chain is centered by a reversing pawl and piston actuated by the pressure of the drilling mud. Detent pins lock the head assembly with respect to the support body and are also operated by the drilling mud pressure. A restricted nozzle with a divergent outlet sprays drilling mud into the cavity to remove debris. Indication of the centered position of the chain is provided by noting a low pressure reading indicating proper alignment of drilling mud slots on the links with the corresponding feed branches.

  10. Rapid disappearance of shell effects in the fission of transfermium nuclei

    SciTech Connect (OSTI)

    Hulet, E.K.

    1983-01-01

    In the last fifteen years we have learned that nuclear shells have a very broad and pervasive impact on the fission process. In the first few decades after the discovery of nuclear fission, the nucleus was treated as a drop of liquid with smoothly varying attractive and repulsive forces. Although this model still forms the underlying basis for fission, we also observe large effects from the superimposition of shell corrections derived from coupling the quantum states of individual nucleons. The consequences of single-particle coupling on the fission process can be striking and may often overshadow that originating from the intrinsic liquid-drop component. Here, we point out several major features attributable to shell effects in the spontaneous fission (SF) of the lighter actinides, the sudden transition to symmetric fission in the fermium isotopes, and finally new experimental information indicating another transition in the SF of transfermium nuclides due to the disappearance of shell perturbations. In each transition, the abruptness is surprising, and for the moment, such rapid changes in fission behavior lack a theoretical rationale.

  11. Uncertainty and sensitivity analysis of fission gas behavior in engineering-scale fuel modeling

    SciTech Connect (OSTI)

    G. Pastore; L.P. Swiler; J.D. Hales; S.R. Novascone; D.M. Perez; B.W. Spencer; L. Luzzi; P. Van Uffelen; R.L. Williamson

    2014-10-01

    The role of uncertainties in fission gas behavior calculations as part of engineering-scale nuclear fuel modeling is investigated using the BISON fuel performance code and a recently implemented physics-based model for the coupled fission gas release and swelling. Through the integration of BISON with the DAKOTA software, a sensitivity analysis of the results to selected model parameters is carried out based on UO2 single-pellet simulations covering different power regimes. The parameters are varied within ranges representative of the relative uncertainties and consistent with the information from the open literature. The study leads to an initial quantitative assessment of the uncertainty in fission gas behavior modeling with the parameter characterization presently available. Also, the relative importance of the single parameters is evaluated. Moreover, a sensitivity analysis is carried out based on simulations of a fuel rod irradiation experiment, pointing out a significant impact of the considered uncertainties on the calculated fission gas release and cladding diametral strain. The results of the study indicate that the commonly accepted deviation between calculated and measured fission gas release by a factor of 2 approximately corresponds to the inherent modeling uncertainty at high fission gas release. Nevertheless, higher deviations may be expected for values around 10% and lower. Implications are discussed in terms of directions of research for the improved modeling of fission gas behavior for engineering purposes.

  12. Uncertainty and sensitivity analysis of fission gas behavior in engineering-scale fuel modeling

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Pastore, Giovanni; Swiler, L. P.; Hales, Jason D.; Novascone, Stephen R.; Perez, Danielle M.; Spencer, Benjamin W.; Luzzi, Lelio; Uffelen, Paul Van; Williamson, Richard L.

    2014-10-12

    The role of uncertainties in fission gas behavior calculations as part of engineering-scale nuclear fuel modeling is investigated using the BISON fuel performance code and a recently implemented physics-based model for the coupled fission gas release and swelling. Through the integration of BISON with the DAKOTA software, a sensitivity analysis of the results to selected model parameters is carried out based on UO2 single-pellet simulations covering different power regimes. The parameters are varied within ranges representative of the relative uncertainties and consistent with the information from the open literature. The study leads to an initial quantitative assessment of the uncertaintymore » in fission gas behavior modeling with the parameter characterization presently available. Also, the relative importance of the single parameters is evaluated. Moreover, a sensitivity analysis is carried out based on simulations of a fuel rod irradiation experiment, pointing out a significant impact of the considered uncertainties on the calculated fission gas release and cladding diametral strain. The results of the study indicate that the commonly accepted deviation between calculated and measured fission gas release by a factor of 2 approximately corresponds to the inherent modeling uncertainty at high fission gas release. Nevertheless, higher deviations may be expected for values around 10% and lower. Implications are discussed in terms of directions of research for the improved modeling of fission gas behavior for engineering purposes.« less

  13. Determination of {sup 140}La fission product interference factor for INAA

    SciTech Connect (OSTI)

    Ribeiro Jr, Iber S.; Genezini, Frederico A.; Saiki, Mitiko; Zahn, Guilherme S.

    2014-11-11

    Instrumental Neutron Activation Analysis (INAA) is a technique widely used to determine the concentration of several elements in several kinds of matrices. However if the sample of interest has higher relative uranium concentration the obtained results can be interfered by the uranium fission products. One of these cases that is affected by interference due to U fission is the {sup 140}La, because this radioisotope used in INAA for the determination of concentration the La is also produced by the {sup ?}? of {sup 140}Ba, an uranium fission product. The {sup 140}La interference factor was studied in this work and a factor to describe its time dependence was obtained.

  14. Origin of the narrow, single peak in the fission-fragment mass distribution

    Office of Scientific and Technical Information (OSTI)

    for 258Fm (Journal Article) | SciTech Connect SciTech Connect Search Results Journal Article: Origin of the narrow, single peak in the fission-fragment mass distribution for 258Fm Citation Details In-Document Search Title: Origin of the narrow, single peak in the fission-fragment mass distribution for 258Fm We discuss the origin of the narrowness of the single peak at mass-symmetric division in the fragment mass-yield curve for spontaneous fission of {sup 258}Fm. For this purpose, we employ

  15. Detecting special nuclear materials in containers using high-energy gamma rays emitted by fission products

    DOE Patents [OSTI]

    Norman, Eric B.; Prussin, Stanley G.

    2007-10-02

    A method and a system for detecting the presence of special nuclear materials in a container. The system and its method include irradiating the container with an energetic beam, so as to induce a fission in the special nuclear materials, detecting the gamma rays that are emitted from the fission products formed by the fission, to produce a detector signal, comparing the detector signal with a threshold value to form a comparison, and detecting the presence of the special nuclear materials using the comparison.

  16. Background and Derivation of ANS-5.4 Standard Fission Product Release Model

    SciTech Connect (OSTI)

    Beyer, Carl E.; Turnbull, Andrew J.

    2010-01-29

    This background report describes the technical basis for the newly proposed American Nuclear Society (ANS) 5.4 standard, Methods for Calculating the Fractional Release of Volatile Fission Products from Oxide Fuels. The proposed ANS 5.4 standard provides a methodology for determining the radioactive fission product releases from the fuel for use in assessing radiological consequences of postulated accidents that do not involve abrupt power transients. When coupled with isotopic yields, this method establishes the 'gap activity,' which is the inventory of volatile fission products that are released from the fuel rod if the cladding are breached.

  17. Resonant thermonuclear reaction rate

    SciTech Connect (OSTI)

    Haubold, H.J.; Mathai, A.M.

    1986-08-01

    Basic physical principles for the resonant and nonresonant thermonuclear reaction rates are applied to find their standard representations for nuclear astrophysics. Closed-form representations for the resonant reaction rate are derived in terms of Meijer's G-italic-function. Analytic representations of the resonant and nonresonant nuclear reaction rates are compared and the appearance of Meijer's G-italic-function is discussed in physical terms.

  18. Better Plants Supply Chain Pilot Overview

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    SUPPLY CHAIN PILOT Learn more at energy.gov/eere/amo/better-plants The Department of Energy (DOE) is working with Better Plants Partners to improve energy efficiency throughout their supply chains. Around 40 to 60 percent of a manufacturing company's energy and carbon footprint can reside upstream in its supply chain-from raw materials, transport, and packaging to the energy consumed in manufacturing processes-but this number can be as high as 80 percent. 1 Coordinating energy management

  19. Analysis of the GSI A+p and A+A spallation, fission, and fragmentation measurements with the LANL CEMsk and LAQGSM codes

    SciTech Connect (OSTI)

    Mashnik, S. G.; Gudima, K. K.; Prael, R. E.; Sierk, A. J.

    2004-01-01

    The CEM2k and LAQGSM codes have been recently developed at Los Alamos National Laboratory to simulate nuclear reactions induced by particles and nuclei for a number of applications. They have benchmarked our codes against most available measured data at projectile energies from 10 MeV/A to 800 GeV/A and have compared their results with predictions of other current models used by the nuclear community. Here, they present a brief description of their codes and show illustrative results obtained with CEM2k and LAQGSM for A+p and A+A spallation, fission, and fragmentation reactions measured recently at GSI compared with predictions by other models. Further necessary work is outlined.

  20. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets,...

  1. Advanced modeling of prompt fission neutrons (Conference) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    and detailed information, beyond average quantities, can be inferred. This approach is applied to the following reactions: sup 252Cf (sf), nsub th + sup 239Pu, n (0.5...

  2. The LANL C-NR counting room and fission product yields

    SciTech Connect (OSTI)

    Jackman, Kevin Richard

    2015-09-21

    This PowerPoint presentation focused on the following areas: LANL C-NR counting room; Fission product yields; Los Alamos Neutron wheel experiments; Recent experiments ad NCERC; and Post-detonation nuclear forensics

  3. Thermal stability of fission gas bubble superlattice in irradiated U10Mo fuel

    SciTech Connect (OSTI)

    Gan, J.; Keiser, D. D.; Miller, B. D.; Robinson, A. B.; Wachs, D. M.; Meyer, M. K.

    2015-09-01

    To investigate the thermal stability of the fission gas bubble superlattice, a key microstructural feature in both irradiated U-7Mo dispersion and U-10Mo monolithic fuel plates, a FIB-TEM sample of the irradiated U-10Mo fuel with a local fission density of 3.51021 fissions/cm3 was used for an in-situ heating TEM experiment. The temperature of the heating holder was raised at a ramp rate of approximately 10 C/min up to ~700 C, kept at that temperature for about 34 min, continued to 850 C with a reduced rate of 5 C/min. The result shows a high thermal stability of the fission gas bubble superlattice. The implication of this observation on the fuel microstructural evolution and performance under irradiation is discussed.

  4. /sup 3/He-induced fission of nuclei 159

    SciTech Connect (OSTI)

    Becchetti, F.D.; Hicks, K.H.; Fields, C.A.; Peterson, R.J.; Raymond, R.S.; Ristinen, R.A.; Ullmann, J.L.; Zaidins, C.S.

    1983-09-01

    The fission of nuclei with 159< or =A< or =232 induced by the bombardment of 19.1 to 44.5 MeV /sup 3/He ions has been measured using solid-state detectors with time-of-flight measurements. Analysis with statistical fission theory, including precompound nucleon emission, indicates fission barriers which decrease only slightly relative to the liquid-drop model values with decreasing Z, approaching about 90% of the liquid-drop model barrier for Aroughly-equal160. These results are in contrast with measurements at higher angular momenta which indicate much lower fission barriers (60 to 70 % of the liquid-drop model) for this mass region. The angular correlations indicate complete, or slightly greater than complete momentum transfer to the compound system. This is in opposition to that observed using heavier projectiles where incomplete momentum transfer is probable.

  5. Molten salt considerations for accelerator-driven subcritical fission to close the nuclear fuel cycle

    SciTech Connect (OSTI)

    Sooby, Elizabeth; Baty, Austin; Gerity, James; McIntyre, Peter; Melconian, Karie; Pogue, Nathaniel; Sattarov, Akhdiyor; Adams, Marvin; Tsevkov, Pavel; Phongikaroon, Supathorn; Simpson, Michael; Tripathy, Prabhat

    2013-04-19

    The host salt selection, molecular modeling, physical chemistry, and processing chemistry are presented here for an accelerator-driven subcritical fission in a molten salt core (ADSMS). The core is fueled solely with the transuranics (TRU) and long-lived fission products (LFP) from used nuclear fuel. The neutronics and salt composition are optimized to destroy the transuranics by fission and the long-lived fission products by transmutation. The cores are driven by proton beams from a strong-focusing cyclotron stack. One such ADSMS system can destroy the transuranics in the used nuclear fuel produced by a 1GWe conventional reactor. It uniquely provides a method to close the nuclear fuel cycle for green nuclear energy.

  6. Origin of the narrow, single peak in the fission-fragment mass...

    Office of Scientific and Technical Information (OSTI)

    Origin of the narrow, single peak in the fission-fragment mass distribution for 258Fm Citation Details In-Document Search Title: Origin of the narrow, single peak in the...

  7. Single-Chain Antibody Library

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Baird, Cheryl

    Researchers at Pacific Northwest National Laboratory (PNNL) have constructed a nonimmune library consisting of 109 human antibody scFv fragments, which have been cloned and expressed on the surface of yeast. Nanomolar-affinity scFvs are routinely obtained by magnetic bead screening and flow cytometric sorting. The yeast library can be amplified 1010 fold without measurable loss of clonal diversity. This allows for indefinite expansion of the library. All scFv clones can be assessed directly on the yeast cell surface by immunofluorescent labeling and flow cytometry, obviating separate subcloning, expression, and purification steps. The ability to use multiplex library screening demonstrates the utility of this approach for high-throughput antibody isolation for proteomic applications. The yeast library may be used for research projects or teaching performed for U.S. Government purposes only. If you would like to request an aliquot of the single-chain antibody library for your research, please print and fill out the Materials Transfer Agreement (MTA) [PDF, 20K]. The website provides the contact information for mailing the MTA. [copied from http://www.sysbio.org/dataresources/singlechain.stm

  8. New Discoveries Bring us Closer to a Predictive Theory of Fission

    Office of Scientific and Technical Information (OSTI)

    (Technical Report) | SciTech Connect New Discoveries Bring us Closer to a Predictive Theory of Fission Citation Details In-Document Search Title: New Discoveries Bring us Closer to a Predictive Theory of Fission Authors: Younes, W Publication Date: 2011-08-29 OSTI Identifier: 1113446 Report Number(s): LLNL-TR-496495 DOE Contract Number: W-7405-ENG-48 Resource Type: Technical Report Research Org: Lawrence Livermore National Laboratory (LLNL), Livermore, CA Sponsoring Org: USDOE Country of

  9. Los Alamos National Laboratory fission basis (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    National Laboratory fission basis Citation Details In-Document Search Title: Los Alamos National Laboratory fission basis Authors: Keksis, August L [1] ; Chadwick, Mark B [1] + Show Author Affiliations Los Alamos National Laboratory Publication Date: 2011-05-06 OSTI Identifier: 1063939 Report Number(s): LA-UR-11-02744; LA-UR-11-2744 DOE Contract Number: AC52-06NA25396 Resource Type: Conference Resource Relation: Conference: 14th International Symposium on Reactor Dosimetry ; May 22, 2011 ;

  10. Flowsheet Testing of the Fission Product Extraction Process as Part of

    Office of Scientific and Technical Information (OSTI)

    Advanced Aqueous Reprocessing (Conference) | SciTech Connect Flowsheet Testing of the Fission Product Extraction Process as Part of Advanced Aqueous Reprocessing Citation Details In-Document Search Title: Flowsheet Testing of the Fission Product Extraction Process as Part of Advanced Aqueous Reprocessing As part of the Advanced Fuel Cycle Initiative (AFCI), the reduction in volume and heat generation of spent nuclear fuel requiring geologic disposal is currently being addressed. The goal is

  11. Hybrid Molten Salt Reactor (HMSR): Method and System to fully fission

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    actinides for electric power production without fuel enrichment, fabrication, or reprocessing | Princeton Plasma Physics Lab Hybrid Molten Salt Reactor (HMSR): Method and System to fully fission actinides for electric power production without fuel enrichment, fabrication, or reprocessing A method for integrating an external source of high-energy neutrons with a conventional moderated high conversion ratio molten salt reactor, thereby creating a self-contained hybrid system which fissions any

  12. Room-return scattering in fission neutron outputs (Conference) | SciTech

    Office of Scientific and Technical Information (OSTI)

    Connect Room-return scattering in fission neutron outputs Citation Details In-Document Search Title: Room-return scattering in fission neutron outputs Authors: Taddeucci, Terry N [1] + Show Author Affiliations Los Alamos National Laboratory Publication Date: 2011-07-27 OSTI Identifier: 1084596 Report Number(s): LA-UR-11-04357; LA-UR-11-4357 DOE Contract Number: AC52-06NA25396 Resource Type: Conference Resource Relation: Conference: Chi-Nu project level

  13. Method for polymer synthesis in a reaction well

    DOE Patents [OSTI]

    Brennan, Thomas M.

    1998-01-01

    A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

  14. Method for polymer synthesis in a reaction well

    DOE Patents [OSTI]

    Brennan, T.M.

    1998-09-29

    A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

  15. Engineering Report on the Fission Gas Getter Concept

    SciTech Connect (OSTI)

    Ecker, Lynne; Ghose, Sanjit; Gill, Simerjeet; Thallapally, Praveen K.; Strachan, Denis M.

    2012-11-01

    In 2010, the Department of Energy (DOE) requested that a Brookhaven National Laboratory (BNL)-led team research the possibility of using a getter material to reduce the pressure in the plenum region of a light water reactor fuel rod. During the first two years of the project, several candidate materials were identified and tested using a variety of experimental techniques, most with xenon as a simulant for fission products. Earlier promising results for candidate getter materials were found to be incorrect, caused by poor experimental techniques. In May 2012, it had become clear that none of the initial materials had demonstrated the ability to adsorb xenon in the quantities and under the conditions needed. Moreover, the proposed corrective action plan could not meet the schedule needed by the project manager. BNL initiated an internal project review which examined three questions: 1. Which materials, based on accepted materials models, might be capable of absorbing xenon? 2. Which experimental techniques are capable of not only detecting if xenon has been absorbed but also determine by what mechanism and the resulting molecular structure? 3. Are the results from the previous techniques useable now and in the future? As part of the second question, the project review team evaluated the previous experimental technique to determine why incorrect results were reported in early 2012. This engineering report is a summary of the current status of the project review, description of newly recommended experiments and results from feasibility studies at the National Synchrotron Light Source (NSLS).

  16. Baseline Glass Development for Combined Fission Products Waste Streams

    SciTech Connect (OSTI)

    Crum, Jarrod V.; Billings, Amanda Y.; Lang, Jesse B.; Marra, James C.; Rodriguez, Carmen P.; Ryan, Joseph V.; Vienna, John D.

    2009-06-29

    Borosilicate glass was selected as the baseline technology for immobilization of the Cs/Sr/Ba/Rb (Cs), lanthanide (Ln) and transition metal fission product (TM) waste steams as part of a cost benefit analysis study.[1] Vitrification of the combined waste streams have several advantages, minimization of the number of waste forms, a proven technology, and similarity to waste forms currently accepted for repository disposal. A joint study was undertaken by Pacific Northwest National Laboratory (PNNL) and Savannah River National Laboratory (SRNL) to develop acceptable glasses for the combined Cs + Ln + TM waste streams (Option 1) and Cs + Ln combined waste streams (Option 2) generated by the AFCI UREX+ set of processes. This study is aimed to develop baseline glasses for both combined waste stream options and identify key waste components and their impact on waste loading. The elemental compositions of the four-corners study were used along with the available separations data to determine the effect of burnup, decay, and separations variability on estimated waste stream compositions.[2-5] Two different components/scenarios were identified that could limit waste loading of the combined Cs + LN + TM waste streams, where as the combined Cs + LN waste stream has no single component that is perceived to limit waste loading. Combined Cs + LN waste stream in a glass waste form will most likely be limited by heat due to the high activity of Cs and Sr isotopes.

  17. Micro-Pocket Fission Detectors (MPFD) For Fuel Assembly Analysis

    SciTech Connect (OSTI)

    Troy Unruh; Michael Reichenberger; Phillip Ugorowski

    2013-09-01

    Neutron sensors capable of real-time measurement of thermal flux, fast flux, and temperature in a single miniaturized probe are needed in irradiation tests required to demonstrate the performance of candidate new fuels, and cladding materials. In-core ceramic-based miniature neutron detectors or Micro-Pocket Fission Detectors (MPFDs) have been studied at Kansas State University (KSU). The first MPFD prototypes were tested in various neutron fields at the KSU TRIGA research reactor with successful results. Currently, a United States Department of Energy-sponsored joint KSU/Idaho National Laboratory (INL) effort is underway to develop a high-temperature, high-pressure version of the MPFD using radiation-resistant, high temperature materials, which would be capable of withstanding irradiation test conditions in high performance material and test reactors (MTRs). Ultimately, this more compact, more accurate, and longer lifetime flux sensor for critical mock-ups, existing and advanced reactor designs, high performance MTRs, and transient test reactors has the potential to lead to higher accuracy and resolution data from irradiation testing, more detailed core flux measurements and enhanced fuel assembly processing. Prior evaluations by KSU indicate that these sensors could also be used to monitor burn-up of nuclear fuel. If integrated into nuclear fuel assemblies, MPFDs offer several advantages to current spent fuel management systems.

  18. Polymorphism influences singlet fission rates in tetracene thin films

    SciTech Connect (OSTI)

    Arias, Dylan H.; Ryerson, Joseph L.; Cook, Jasper D.; Damrauer, Niels H.; Johnson, Justin C.

    2015-11-06

    Here, we report the effect of crystal structure and crystallite grain size on singlet fission (SF) in polycrystalline tetracene, one of the most widely studied SF and organic semiconductor materials. SF has been comprehensively studied in one polymoprh (Tc I), but not in the other, less stable polymorph (Tc II). Using carefully controlled thermal evaporation deposition conditions and high sensitivity ultrafast transient absorption spectroscopy, we found that for large crystallite size samples, SF in nearly pure Tc II films is significantly faster than SF in Tc I films. We also discovered that crystallite size has a minimal impact on the SF rate in Tc II films, but a significant influence in Tc I films. Large crystallites exhibit SF times of 125 ps and 22 ps in Tc I and Tc II, respectively, whereas small crystallites have SF times of 31 ps and 33 ps. Our results demonstrate first, that attention must be paid to polymorphism in obtaining a self-consistent rate picture for SF in tetracene and second, that control of polymorphism can play a significant role towards achieving a mechanistic understanding of SF in polycrystalline systems. In this latter context we show that conventional theory based on non-covalent tetracene couplings is insufficient, thus highlighting the need for models that capture the delocalized and highly mobile nature of excited states in elucidating the full photophysical picture.

  19. Data summary report for fission product release Test VI-7

    SciTech Connect (OSTI)

    Osborne, M.F.; Lorentz, R.A.; Travis, J.R.; Collins, J.L.; Webster, C.S.

    1995-05-01

    Test VI-7 was the final test in the VI series conducted in the vertical furnace. The fuel specimen was a 15.2-cm-long section of a fuel rod from the Monticello boiling water reactor (BWR). The fuel had experienced a burnup of {approximately}-40 Mwd/kg U. It was heated in an induction furnace for successive 20-min periods at 2000 and 2300 K in a moist air-helium atmosphere. Integral releases were 69% for {sup 85}Kr, 52% for {sup 125}Sb, 71% for both {sup 134}Cs and {sup 137}Cs, and 0.04% for {sup 154}Eu. For the non-gamma-emitting species, release values for 42% for I, 4.1% for Ba, 5.3% for Mo, and 1.2% for Sr were determined. The total mass released from the furnace to the collection system, including fission products, fuel, and structural materials, was 0.89 g, with 37% being collected on the thermal gradient tubes and 63% downstream on filters. Posttest examination of the fuel specimen indicated that most of the cladding was completely oxidized to ZrO{sub 2}, but that oxidation was not quite complete at the upper end. The release behaviors for the most volatile elements, Kr and Cs, were in good agreement with the ORNL-Booth Model.

  20. Polymorphism influences singlet fission rates in tetracene thin films

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Arias, Dylan H.; Ryerson, Joseph L.; Cook, Jasper D.; Damrauer, Niels H.; Johnson, Justin C.

    2015-11-06

    Here, we report the effect of crystal structure and crystallite grain size on singlet fission (SF) in polycrystalline tetracene, one of the most widely studied SF and organic semiconductor materials. SF has been comprehensively studied in one polymoprh (Tc I), but not in the other, less stable polymorph (Tc II). Using carefully controlled thermal evaporation deposition conditions and high sensitivity ultrafast transient absorption spectroscopy, we found that for large crystallite size samples, SF in nearly pure Tc II films is significantly faster than SF in Tc I films. We also discovered that crystallite size has a minimal impact on themore » SF rate in Tc II films, but a significant influence in Tc I films. Large crystallites exhibit SF times of 125 ps and 22 ps in Tc I and Tc II, respectively, whereas small crystallites have SF times of 31 ps and 33 ps. Our results demonstrate first, that attention must be paid to polymorphism in obtaining a self-consistent rate picture for SF in tetracene and second, that control of polymorphism can play a significant role towards achieving a mechanistic understanding of SF in polycrystalline systems. In this latter context we show that conventional theory based on non-covalent tetracene couplings is insufficient, thus highlighting the need for models that capture the delocalized and highly mobile nature of excited states in elucidating the full photophysical picture.« less

  1. The Packing of Granular Polymer Chains

    SciTech Connect (OSTI)

    Zou, Ling-Nan; Cheng, Xiang; Rivers, Mark L.; Jaeger, Heinrich M.; Nagel, Sidney R.; UC

    2009-12-01

    Rigid particles pack into structures, such as sand dunes on the beach, whose overall stability is determined by the average number of contacts between particles. However, when packing spatially extended objects with flexible shapes, additional concepts must be invoked to understand the stability of the resulting structure. Here, we examine the disordered packing of chains constructed out of flexibly connected hard spheres. Using x-ray tomography, we find that long chains pack into a low-density structure whose mechanical rigidity is mainly provided by the backbone. On compaction, randomly oriented, semi-rigid loops form along the chain, and the packing of chains can be understood as the jamming of these elements. Finally, we uncover close similarities between the packing of chains and the glass transition in polymers.

  2. A comparison of radioactive waste from first generation fusion reactors and fast fission reactors with actinide recycling

    SciTech Connect (OSTI)

    Koch, M.; Kazimi, M.S.

    1991-04-01

    Limitations of the fission fuel resources will presumably mandate the replacement of thermal fission reactors by fast fission reactors that operate on a self-sufficient closed fuel cycle. This replacement might take place within the next one hundred years, so the direct competitors of fusion reactors will be fission reactors of the latter rather than the former type. Also, fast fission reactors, in contrast to thermal fission reactors, have the potential for transmuting long-lived actinides into short-lived fission products. The associated reduction of the long-term activation of radioactive waste due to actinides makes the comparison of radioactive waste from fast fission reactors to that from fusion reactors more rewarding than the comparison of radioactive waste from thermal fission reactors to that from fusion reactors. Radioactive waste from an experimental and a commercial fast fission reactor and an experimental and a commercial fusion reactor has been characterized. The fast fission reactors chosen for this study were the Experimental Breeder Reactor 2 and the Integral Fast Reactor. The fusion reactors chosen for this study were the International Thermonuclear Experimental Reactor and a Reduced Activation Ferrite Helium Tokamak. The comparison of radioactive waste parameters shows that radioactive waste from the experimental fast fission reactor may be less hazardous than that from the experimental fusion reactor. Inclusion of the actinides would reverse this conclusion only in the long-term. Radioactive waste from the commercial fusion reactor may always be less hazardous than that from the commercial fast fission reactor, irrespective of the inclusion or exclusion of the actinides. The fusion waste would even be far less hazardous, if advanced structural materials, like silicon carbide or vanadium alloy, were employed.

  3. Reactor for exothermic reactions

    DOE Patents [OSTI]

    Smith, Jr., Lawrence A. (Bellaire, TX); Hearn, Dennis (Houston, TX); Jones, Jr., Edward M. (Friendswood, TX)

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  4. Reactor for exothermic reactions

    DOE Patents [OSTI]

    Smith, L.A. Jr.; Hearn, D.; Jones, E.M. Jr.

    1993-03-02

    A liquid phase process is described for oligomerization of C[sub 4] and C[sub 5] isoolefins or the etherification thereof with C[sub 1] to C[sub 6] alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120 to 300 F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  5. Mechanistic prediction of fission-product release under normal and accident conditions: key uncertainties that need better resolution. [PWR; BWR

    SciTech Connect (OSTI)

    Rest, J.

    1983-09-01

    A theoretical model has been used for predicting the behavior of fission gas and volatile fission products (VFPs) in UO/sub 2/-base fuels during steady-state and transient conditions. This model represents an attempt to develop an efficient predictive capability for the full range of possible reactor operating conditions. Fission products released from the fuel are assumed to reach the fuel surface by successively diffusing (via atomic and gas-bubble mobility) from the grains to grain faces and then to the grain edges, where the fission products are released through a network of interconnected tunnels of fission-gas induced and fabricated porosity. The model provides for a multi-region calculation and uses only one size class to characterize a distribution of fission gas bubbles.

  6. P-odd, P-even, and T-odd asymmetries in true quaternary fission of nuclei

    SciTech Connect (OSTI)

    Kadmensky, S. G., E-mail: kadmensky@phys.vsu.ru; Titova, L. V. [Voronezh State University (Russian Federation)] [Voronezh State University (Russian Federation)

    2013-04-15

    The coefficients of P-odd, P-even, and T -odd asymmetries for a third and a fourth prescission particle emitted in the true quaternary fission of nuclei that was induced by polarized cold neutrons were studied on the basis of quantum-mechanical fission theory. By using non-evaporation (nonadiabatic) mechanisms of light-particle emission, these coefficients were compared with the analogous coefficients for prescission third particles emitted in the ternary fission of nuclei.

  7. DIRECT ENERGY CONVERSION FISSION REACTOR ANNUAL REPORT FOR THE PERIOD AUGUST 15,2000 THROUGH SEPTEMBER 30,2001

    SciTech Connect (OSTI)

    L.C. BROWN

    2002-02-01

    OAK-B135 DIRECT ENERGY CONVERSION FISSION REACTOR ANNUAL REPORT FOR THE PERIOD AUGUST 15,2000 THROUGH SEPTEMBER 30,2001

  8. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Signal Speed in Nanomagnetic Logic Chains Print Wednesday, 30 September 2015 00:00 The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated

  9. Method of fission product beta spectra measurements for predicting reactor anti-neutrino emission

    SciTech Connect (OSTI)

    Asner, David M.; Burns, Kimberly A.; Campbell, Luke W.; Greenfield, Bryce A.; Kos, Marek S.; Orrell, John L.; Schram, Malachi; VanDevender, Brent A.; Wood, Lynn S.; Wootan, David W.

    2015-03-01

    The nuclear fission process that occurs in the core of nuclear reactors results in unstable, neutron-rich fission products that subsequently beta decay and emit electron antineutrinos. These reactor neutrinos have served neutrino physics research from the initial discovery of the neutrino to today's precision measurements of neutrino mixing angles. The prediction of the absolute flux and energy spectrum of the emitted reactor neutrinos hinges upon a series of seminal papers based on measurements performed in the 1970s and 1980s. The steadily improving reactor neutrino measurement techniques and recent reconsiderations of the agreement between the predicted and observed reactor neutrino flux motivates revisiting the underlying beta spectra measurements. A method is proposed to use an accelerator proton beam delivered to an engineered target to yield a neutron field tailored to reproduce the neutron energy spectrum present in the core of an operating nuclear reactor. Foils of the primary reactor fissionable isotopes placed in this tailored neutron flux will ultimately emit beta particles from the resultant fission products. Measurement of these beta particles in a time projection chamber with a perpendicular magnetic field provides a distinctive set of systematic considerations for comparison to the original seminal beta spectra measurements. Ancillary measurements such as gamma-ray emission and post-irradiation radiochemical analysis will further constrain the absolute normalization of beta emissions per fission. The requirements for unfolding the beta spectra measured with this method into a predicted reactor neutrino spectrum are explored.

  10. Fission matrix-based Monte Carlo criticality analysis of fuel storage pools

    SciTech Connect (OSTI)

    Farlotti, M.; Larsen, E. W.

    2013-07-01

    Standard Monte Carlo transport procedures experience difficulties in solving criticality problems in fuel storage pools. Because of the strong neutron absorption between fuel assemblies, source convergence can be very slow, leading to incorrect estimates of the eigenvalue and the eigenfunction. This study examines an alternative fission matrix-based Monte Carlo transport method that takes advantage of the geometry of a storage pool to overcome this difficulty. The method uses Monte Carlo transport to build (essentially) a fission matrix, which is then used to calculate the criticality and the critical flux. This method was tested using a test code on a simple problem containing 8 assemblies in a square pool. The standard Monte Carlo method gave the expected eigenfunction in 5 cases out of 10, while the fission matrix method gave the expected eigenfunction in all 10 cases. In addition, the fission matrix method provides an estimate of the error in the eigenvalue and the eigenfunction, and it allows the user to control this error by running an adequate number of cycles. Because of these advantages, the fission matrix method yields a higher confidence in the results than standard Monte Carlo. We also discuss potential improvements of the method, including the potential for variance reduction techniques. (authors)

  11. Evaluation of fission gas release in high-burnup light water reactor fuel rods

    SciTech Connect (OSTI)

    Barner, J.O.; Cunningham, M.E.; Freshley, M.D.; Lanning, D.D. )

    1993-05-01

    Research to define the behavior of Zircaloy-clad light water reactor (LWR) UO[sub 2] fuel irradiated to high burnup levels was conducted as part of the High Burnup Effects Program (HBEP). The HBEP was a 12-yr program that ultimately acquired, characterized, irradiated, and examined after irradiation 82 LWR fuel rods ranging in rod-average fuel burnup from 22 to 69 MWd/kgM with a peak pellet burnup of 83 MWd/kg M. A principal emphasis of the HBEP was to evaluate the effect of high burnup on fission gas release. It was confirmed that fission gas release remained as dependent on design and irradiation history parameters at high burnup levels as at low to moderate burnup levels. One observed high-burnup effect was the development of a burnup-dependent microstructure at the fuel pellet surface when pellet-edge burnup exceeded 65 MWd/kgM. This low-temperature rim region' was characterized by a loss of optically definable grain structure, a high volume of porosity, and diffusion of fission gas from the UO[sub 2] matrix to the porosity. Although the rim region has the potential for enhanced fission gas release, it is concluded that no significant enhancement of rod-average fission gas release at high burnup levels was observed for the examined fuel rods.

  12. Reaction of hydrogen sulfide with oxygen in the presence of sulfite

    SciTech Connect (OSTI)

    Weres, O.; Tsao, L.

    1983-01-14

    Commonly, abatement of hydrogen sulfide emission from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. We studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDTA are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use. 33 figures, 9 tables.

  13. Reaction of Hydrogen Sulfide with Oxygen in the Presence ofSulfite

    SciTech Connect (OSTI)

    Weres, Oleh; Tsao, Leon

    1983-01-01

    Commonly, abatement of hydrogen sulfide emissions from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One Mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. The authors studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDT are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use.

  14. Velocity pump reaction turbine

    DOE Patents [OSTI]

    House, Palmer A. (Walnut Creek, CA)

    1984-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  15. Velocity pump reaction turbine

    DOE Patents [OSTI]

    House, Palmer A. (Walnut Creek, CA)

    1982-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  16. Supply Chain Sustainability Analysis of Fast Pyrolysis and Hydrotreati...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Supply Chain Sustainability Analysis of Fast Pyrolysis and Hydrotreating Bio-Oil to Produce Hydrocarbon Fuels Title Supply Chain Sustainability Analysis of Fast Pyrolysis and...

  17. Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology Plenary IV: Advances in Bioenergy ...

  18. Delayed Fission Gamma-ray Characteristics of Th-232 U-233 U-235 U-238 and Pu-239

    SciTech Connect (OSTI)

    Lane, Taylor; Parma, Edward J.

    2015-08-01

    Delayed fission gamma-rays play an important role in determining the time dependent ioniz- ing dose for experiments in the central irradiation cavity of the Annular Core Research Reactor (ACRR). Delayed gamma-rays are produced from both fission product decay and from acti- vation of materials in the core, such as cladding and support structures. Knowing both the delayed gamma-ray emission rate and the time-dependent gamma-ray energy spectrum is nec- essary in order to properly determine the dose contributions from delayed fission gamma-rays. This information is especially important when attempting to deconvolute the time-dependent neutron, prompt gamma-ray, and delayed gamma-ray contribution to the response of a diamond photo-conducting diode (PCD) or fission chamber in time frames of milliseconds to seconds following a reactor pulse. This work focused on investigating delayed gamma-ray character- istics produced from fission products from thermal, fast, and high energy fission of Th-232, U-233, U-235, U-238, and Pu-239. This work uses a modified version of CINDER2008, a transmutation code developed at Los Alamos National Laboratory, to model time and energy dependent photon characteristics due to fission. This modified code adds the capability to track photon-induced transmutations, photo-fission, and the subsequent radiation caused by fission products due to photo-fission. The data is compared against previous work done with SNL- modified CINDER2008 [ 1 ] and experimental data [ 2 , 3 ] and other published literature, includ- ing ENDF/B-VII.1 [ 4 ]. The ability to produce a high-fidelity (7,428 group) energy-dependent photon fluence at various times post-fission can improve the delayed photon characterization for radiation effects tests at research reactors, as well as other applications.

  19. Cumulative fission yields of short-lived isotopes under natural-abundance-boron-carbide-moderated neutron spectrum

    SciTech Connect (OSTI)

    Finn, Erin C.; Metz, Lori A.; Greenwood, Lawrence R.; Pierson, Bruce; Wittman, Richard S.; Friese, Judah I.; Kephart, Rosara F.

    2015-04-09

    The availability of gamma spectroscopy data on samples containing mixed fission products at short times after irradiation is limited. Due to this limitation, data interpretation methods for gamma spectra of mixed fission product samples, where the individual fission products have not been chemically isolated from interferences, are not well-developed. The limitation is particularly pronounced for fast pooled neutron spectra because of the lack of available fast reactors in the United States. Samples containing the actinide isotopes 233, 235, 238U, 237Np, and 239Pu individually were subjected to a 2$ pulse in the Washington State University 1 MW TRIGA reactor. To achieve a fission-energy neutron spectrum, the spectrum was tailored using a natural abundance boron carbide capsule to absorb neutrons in the thermal and epithermal region of the spectrum. Our tailored neutron spectrum is unique to the WSU reactor facility, consisting of a soft fission spectrum that contains some measurable flux in the resonance region. This results in a neutron spectrum at greater than 0.1 keV with an average energy of 70 keV, similar to fast reactor spectra and approaching that of 235U fission. Unique fission product gamma spectra were collected from 4 minutes to 1 week after fission using single-crystal high purity germanium detectors. Cumulative fission product yields measured in the current work generally agree with published fast pooled fission product yield values from ENDF/B-VII, though a bias was noted for 239Pu. The present work contributes to the compilation of energy-resolved fission product yield nuclear data for nuclear forensic purposes.

  20. Calculated fission-fragment yield systematics in the region 74 <=Z <= 94 and 90 <=N <= 150

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Möller, Peter; Randrup, Jørgen

    2015-04-01

    Background: In the seminal experiment by Schmidt et al. [Nucl. Phys. A 665, 221 (2000)] in which fission-fragment charge distributions were obtained for 70 nuclides, asymmetric distributions were seen above nucleon number A ≈ 226 and symmetric ones below. Because asymmetric fission had often loosely been explained as a preference for the nucleus to always exploit the extra binding of fragments near ¹³²Sn it was assumed that all systems below A ≈ 226 would fission symmetrically because available isotopes do not have a proton-to-neutron Z/N ratio that allows division into fragments near ¹³²Sn. But the finding by Andreyev et al.more » [Phys. Rev. Lett. 105, 252502 (2010)] did not conform to this expectation because the compound system ¹⁸⁰Hg was shown to fission asymmetrically. It was suggested that this was a new type of asymmetric fission, because no strong shell effects occur for any possible fragment division. Purpose: We calculate a reference database for fission-fragment mass yields for a large region of the nuclear chart comprising 987 nuclides. A particular aim is to establish whether ¹⁸⁰Hg is part of a contiguous region of asymmetric fission, and if so, its extent, or if not, in contrast to the actinides, there are scattered smaller groups of nuclei that fission asymmetrically in this area of the nuclear chart. Methods: We use the by now well benchmarked Brownian shape-motion method and perform random walks on the previously calculated five-dimensional potential-energy surfaces. The calculated shell corrections are damped out with energy according to a prescription developed earlier. Results: We have obtained a theoretical reference database of fission-fragment mass yields for 987 nuclides. These results show an extended region of asymmetric fission with approximate extension 74 ≤ Z ≤ 85 and 100 ≤ N ≤ 120. The calculated yields are highly variable. We show 20 representative plots of these variable features and summarize the main aspects of our results in terms of “nuclear-chart” plots showing calculated degrees of asymmetry versus N and Z. Conclusions: Experimental data in this region are rare: only ten or so yield distributions have been measured, some with very limited statistics. We agree with several measurements with higher statistics. Regions where there might be differences between our calculated results and measurements lie near the calculated transition line between symmetric and asymmetric fission. To draw more definite conclusions about the accuracy of the present implementation of the Brownian shape-motion approach in this region experimental data, with reliable statistics, for a fair number of suitably located additional nuclides are clearly needed. Because the nuclear potential-energy structure is so different in this region compared to the actinide region, additional experimental data together with fission theory studies that incorporate additional, dynamical aspects should provide much new insight.« less

  1. Multidimensional Skyrme-density-functional study of the spontaneous fission of 238U

    SciTech Connect (OSTI)

    Sadhukhan, J.; Mazurek, K.; Dobaczewski, J.; Nazarewicz, W.; Sheikh, J. A.; Baran, A.

    2015-01-01

    We determined the spontaneous fission lifetime of 238U by a minimization of the action integral in a three-dimensional space of collective variables. Apart from the mass-distribution multipole moments Q20 (elongation) and Q30 (leftright asymmetry), we also considered the pairing-fluctuation parameter ?2 as a collective coordinate. The collective potential was obtained self-consistently using the Skyrme energy density functional SkM*. The inertia tensor was obtained within the nonperturbative cranking approximation to the adiabatic time-dependent HartreeFockBogoliubov approach. As a result, the pairing-fluctuation parameter ?2 allowed us to control the pairing gap along the fission path, which significantly changed the spontaneous fission lifetime.

  2. Fission gas release from UO{sub 2+x} in defective light water reactor fuel rods

    SciTech Connect (OSTI)

    Skim, Y. S.

    1999-11-12

    A simplified semi-empirical model predicting fission gas release form UO{sub 2+x} fuel to the fuel rod plenum as a function of stoichiometry excess (x) is developed to apply to the fuel of a defective LWR fuel rod in operation. The effect of fuel oxidation in enhancing gas diffusion is included as a parabolic dependence of the stoichiometry excess. The increase of fission gas release in a defective BWR fuel rod is at the most 3 times higher than in an intact fuel rod because of small extent of UO{sub 2} oxidation. The major enhancement contributor in fission gas release of UO{sub 2+x} fuel is the increased diffusivity due to stoichiometry excess rather than the higher temperature caused by degraded fuel thermal conductivity.

  3. Calculated fission-fragment yield systematics in the region 74 <=Z <= 94 and 90 <=N <= 150

    SciTech Connect (OSTI)

    Mller, Peter; Randrup, Jrgen

    2015-04-01

    Background: In the seminal experiment by Schmidt et al. [Nucl. Phys. A 665, 221 (2000)] in which fission-fragment charge distributions were obtained for 70 nuclides, asymmetric distributions were seen above nucleon number A ? 226 and symmetric ones below. Because asymmetric fission had often loosely been explained as a preference for the nucleus to always exploit the extra binding of fragments near Sn it was assumed that all systems below A ? 226 would fission symmetrically because available isotopes do not have a proton-to-neutron Z/N ratio that allows division into fragments near Sn. But the finding by Andreyev et al. [Phys. Rev. Lett. 105, 252502 (2010)] did not conform to this expectation because the compound system ??Hg was shown to fission asymmetrically. It was suggested that this was a new type of asymmetric fission, because no strong shell effects occur for any possible fragment division. Purpose: We calculate a reference database for fission-fragment mass yields for a large region of the nuclear chart comprising 987 nuclides. A particular aim is to establish whether ??Hg is part of a contiguous region of asymmetric fission, and if so, its extent, or if not, in contrast to the actinides, there are scattered smaller groups of nuclei that fission asymmetrically in this area of the nuclear chart. Methods: We use the by now well benchmarked Brownian shape-motion method and perform random walks on the previously calculated five-dimensional potential-energy surfaces. The calculated shell corrections are damped out with energy according to a prescription developed earlier. Results: We have obtained a theoretical reference database of fission-fragment mass yields for 987 nuclides. These results show an extended region of asymmetric fission with approximate extension 74 ? Z ? 85 and 100 ? N ? 120. The calculated yields are highly variable. We show 20 representative plots of these variable features and summarize the main aspects of our results in terms of nuclear-chart plots showing calculated degrees of asymmetry versus N and Z. Conclusions: Experimental data in this region are rare: only ten or so yield distributions have been measured, some with very limited statistics. We agree with several measurements with higher statistics. Regions where there might be differences between our calculated results and measurements lie near the calculated transition line between symmetric and asymmetric fission. To draw more definite conclusions about the accuracy of the present implementation of the Brownian shape-motion approach in this region experimental data, with reliable statistics, for a fair number of suitably located additional nuclides are clearly needed. Because the nuclear potential-energy structure is so different in this region compared to the actinide region, additional experimental data together with fission theory studies that incorporate additional, dynamical aspects should provide much new insight.

  4. Multidimensional Skyrme-density-functional study of the spontaneous fission of 238U

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sadhukhan, J.; Mazurek, K.; Dobaczewski, J.; Nazarewicz, W.; Sheikh, J. A.; Baran, A.

    2015-01-01

    We determined the spontaneous fission lifetime of 238U by a minimization of the action integral in a three-dimensional space of collective variables. Apart from the mass-distribution multipole moments Q20 (elongation) and Q30 (left–right asymmetry), we also considered the pairing-fluctuation parameter λ2 as a collective coordinate. The collective potential was obtained self-consistently using the Skyrme energy density functional SkM*. The inertia tensor was obtained within the nonperturbative cranking approximation to the adiabatic time-dependent Hartree–Fock–Bogoliubov approach. As a result, the pairing-fluctuation parameter λ2 allowed us to control the pairing gap along the fission path, which significantly changed the spontaneous fission lifetime.

  5. On-chip real-time single-copy polymerase chain reaction in picoliter droplets

    SciTech Connect (OSTI)

    Beer, N R; Hindson, B; Wheeler, E; Hall, S B; Rose, K A; Kennedy, I; Colston, B

    2007-04-20

    The first lab-on-chip system for picoliter droplet generation and PCR amplification with real-time fluorescence detection has performed PCR in isolated droplets at volumes 10{sup 6} smaller than commercial real-time PCR systems. The system utilized a shearing T-junction in a silicon device to generate a stream of monodisperse picoliter droplets that were isolated from the microfluidic channel walls and each other by the oil phase carrier. An off-chip valving system stopped the droplets on-chip, allowing them to be thermal cycled through the PCR protocol without droplet motion. With this system a 10-pL droplet, encapsulating less than one copy of viral genomic DNA through Poisson statistics, showed real-time PCR amplification curves with a cycle threshold of {approx}18, twenty cycles earlier than commercial instruments. This combination of the established real-time PCR assay with digital microfluidics is ideal for isolating single-copy nucleic acids in a complex environment.

  6. Active-Interrogation Measurements of Fast Neutrons from Induced Fission in Low-Enriched Uranium

    SciTech Connect (OSTI)

    J. L. Dolan; M. J. Marcath; M. Flaska; S. A. Pozzi; D. L. Chichester; A. Tomanin; P. Peerani

    2014-02-01

    A detection system was designed with MCNPX-PoliMi to measure induced-fission neutrons from U-235 and U-238 using active interrogation. Measurements were then performed with this system at the Joint Research Centre (JRC) in Ispra, Italy on low-enriched uranium samples. Liquid scintillators measured induced fission neutron to characterize the samples in terms of their uranium mass and enrichment. Results are presented to investigate and support the use of organic liquid scintillators with active interrogation techniques to characterize uranium containing materials.

  7. Target and method for the production of fission product molybdenum-99

    DOE Patents [OSTI]

    Vandegrift, G.F.; Vissers, D.R.; Marshall, S.L.; Varma, R.

    1987-10-26

    A target for the reduction of fission product Mo-99 is prepared from uranium of low U-235 enrichment by coating a structural support member with a preparatory coating of a substantially oxide-free substrate metal. Uranium metal is electrodeposited from a molten halide electrolytic bath onto a substrate metal. The electrodeposition is performed at a predetermined direct current rate or by using pulsed plating techniques which permit relaxation of accumulated uranium ion concentrations within the melt. Layers of as much as to 600 mg/cm/sup 2/ of uranium can be prepared to provide a sufficient density to produce acceptable concentrations of fission product Mo-99. 2 figs.

  8. Fission yeast LAMMER kinase Lkh1 regulates the cell cycle by

    Office of Scientific and Technical Information (OSTI)

    phosphorylating the CDK-inhibitor Rum1 (Journal Article) | SciTech Connect Fission yeast LAMMER kinase Lkh1 regulates the cell cycle by phosphorylating the CDK-inhibitor Rum1 Citation Details In-Document Search Title: Fission yeast LAMMER kinase Lkh1 regulates the cell cycle by phosphorylating the CDK-inhibitor Rum1 Highlights: ► Deletion of lkh1{sup +} made cells pass the G1/S phase faster than the wild type. ► Lkh1 can interact with a cyclin-dependent kinase inhibitor (CKI) Rum1. ►

  9. Target and method for the production of fission product molybdenum-99

    DOE Patents [OSTI]

    Vandegrift, George F. (Bolingbrook, IL); Vissers, Donald R. (Naperville, IL); Marshall, Simon L. (Woodridge, IL); Varma, Ravi (Hinsdale, IL)

    1989-01-01

    A target for the reduction of fission product Mo-99 is prepared from uranium of low U-235 enrichment by coating a structural support member with a preparatory coating of a substantially oxide-free substrate metal. Uranium metal is electrodeposited from a molten halide electrolytic bath onto a substrate metal. The electrodeposition is performed at a predetermined direct current rate or by using pulsed plating techniques which permit relaxation of accumulated uranium ion concentrations within the melt. Layers of as much as to 600 mg/cm.sup.2 of uranium can be prepared to provide a sufficient density to produce acceptable concentrations of fission product Mo-99.

  10. Grain Boundary Percolation Modeling of Fission Gas Release in Oxide Fuels

    SciTech Connect (OSTI)

    Paul C. Millett; Michael R. Tonks; S. B. Biner

    2012-05-01

    We present a new approach to fission gas release modeling in oxide fuels based on grain boundary network percolation. The method accounts for variability in the bubble growth and coalescence rates on individual grain boundaries, and the resulting effect on macroscopic fission gas release. Two-dimensional representa- tions of fuel pellet microstructures are considered, and the resulting gas release rates are compared with traditional two-stage Booth models, which do not account for long-range percolation on grain boundary net- works. The results show that the requirement of percolation of saturated grain boundaries can considerably reduce the total gas release rates, particularly when gas resolution is considered.

  11. Gaseous fission product management for molten salt reactors and vented fuel systems

    SciTech Connect (OSTI)

    Messenger, S. J.; Forsberg, C.; Massie, M.

    2012-07-01

    Fission gas disposal is one of the unresolved difficulties for Molten Salt Reactors (MSRs) and advanced reactors with vented fuel systems. As these systems operate, they produce many radioactive isotopes of xenon and krypton (e.g. {sup 135}Xe t{sub 1/2} = 9.14 hours and {sup 85}Kr t{sub 1/2}= 10.73 years). Removing these gases proves vital to the success of such reactor designs for two reasons. First, the gases act as large neutron sinks which decrease reactivity and must be counterbalanced by increasing fuel loading. Second, for MSRs, inert fission product gases naturally separate quickly from high temperature salts, thus creating high vapor pressure which poses safety concerns. For advanced reactors with solid vented fuel, the gases are allowed to escape into an off-gas system and thus must be managed. Because of time delays in transport of fission product gases in vented fuel systems, some of the shorter-lived radionuclides will decay away thereby reducing the fission gas source term relative to an MSR. To calculate the fission gas source term of a typical molten salt reactor, we modeled a 1000 MWe graphite moderated thorium MSR similar to that detailed in Mathieu et al. [1]. The fuel salt used in these calculations was LiF (78 mole percent) - (HN)F 4 (22 mole percent) with a heavy nuclide composition of 3.86% {sup 233}U and 96.14% {sup 232}Th by mass. Before we can remove the fission product gases produced by this reactor configuration, we must first develop an appropriate storage mechanism. The gases could be stored in pressurized containers but then one must be concerned about bottle failure. Methods to trap noble gases in matrices are expensive and complex. Alternatively, there are direct storage/disposal options: direct injection into the Earth or injecting a grout-based product into the Earth. Advances in drilling technologies, hydro fracture technologies, and methods for the sequestration of carbon dioxide from fossil fuel plants are creating new options for disposal of fission gas wastes. In each option, lithostatic pressure, a kilometer or more underground, eliminates the pressure driving force for noble gas release and dissolves any untrapped gas in deep groundwater or into incorporated solid waste forms. The options, challenges, and potential for these methods to dispose of gaseous fission products are described. With this research, we hope to help both MSRs and other advanced reactors come one step closer to commercialization. (authors)

  12. An Engineering Study for a Fusion-Fission Hybrid Reactor | Princeton Plasma

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Physics Lab June 11, 2014, 2:00pm Colloquia MBG Auditorium An Engineering Study for a Fusion-Fission Hybrid Reactor Robert D Woolley Princeton Plasma Physics Laboratory Abstract: PDF icon Abstract Woolley.pdf In 2013 Bob Woolley completed his Nuclear Engineering PhD at the University of Tennessee, Knoxville, with a dissertation on a proposed conceptual design for a Fusion-Fission Hybrid Molten Salt Reactor (FFHMSR). This talk will review the background, present the design concept, explain

  13. SPIDER: A Predictive Theory For Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    SPIDER: A Predictive Theory For Fission Citation Details In-Document Search Title: SPIDER: A Predictive Theory For Fission Authors: White, Morgan C. [1] ; Sierk, Arnold John [1] ; Lestone, John P. [1] ; Moller, Peter [1] + Show Author Affiliations Los Alamos National Laboratory Publication Date: 2013-01-22 OSTI Identifier: 1060899 Report Number(s): LA-UR-13-20411 DOE Contract Number: AC52-06NA25396 Resource Type: Conference Resource Relation: Conference: LANL T-2 Seminar ; 2012-12-10 -

  14. Probabilities for the emission of light particles and their energy and angular distributions for true quaternary nuclear fission

    SciTech Connect (OSTI)

    Kadmensky, S. G., E-mail: kadmensky@phys.vsu.ru; Titova, L. V. [Voronezh State University (Russian Federation)] [Voronezh State University (Russian Federation)

    2013-01-15

    On the basis of quantum-mechanical fission theory, the features of true quaternary nuclear fission are studied by treating this fission process as a sequence of three processes following one another in the course of time. The first two processes are the escape of the first and then the second of the two light particles emitted from the neck of a fissioning nucleus because of a nonadiabatic character of the collective deformation motion of this nucleus. Finally, the third process is the separation of the fissioning nucleus into two rather heavy fission fragments. The differences that arise in the emission probabilities and in the angular and energy distributions upon going over from the first emitted to the second emitted prescission third and fourth particles are analyzed by invoking experimental data on the spontaneous and thermalneutron-induced fission of nuclei, and it is shown that these differences are caused by the changes both in the geometric configuration of the fissioning nucleus and in the shell structure of its neck after the first prescission particle is emitted from it.

  15. Derivation of effective fission gas diffusivities in UO2 from lower length scale simulations and implementation of fission gas diffusion models in BISON

    SciTech Connect (OSTI)

    Andersson, Anders David Ragnar; Pastore, Giovanni; Liu, Xiang-Yang; Perriot, Romain Thibault; Tonks, Michael; Stanek, Christopher Richard

    2014-11-07

    This report summarizes the development of new fission gas diffusion models from lower length scale simulations and assessment of these models in terms of annealing experiments and fission gas release simulations using the BISON fuel performance code. Based on the mechanisms established from density functional theory (DFT) and empirical potential calculations, continuum models for diffusion of xenon (Xe) in UO2 were derived for both intrinsic conditions and under irradiation. The importance of the large XeU3O cluster (a Xe atom in a uranium + oxygen vacancy trap site with two bound uranium vacancies) is emphasized, which is a consequence of its high mobility and stability. These models were implemented in the MARMOT phase field code, which is used to calculate effective Xe diffusivities for various irradiation conditions. The effective diffusivities were used in BISON to calculate fission gas release for a number of test cases. The results are assessed against experimental data and future directions for research are outlined based on the conclusions.

  16. Integrated separation scheme for measuring a suite of fission and activation products from a fresh mixed fission and activation product sample

    SciTech Connect (OSTI)

    Morley, Shannon M.; Seiner, Brienne N.; Finn, Erin C.; Greenwood, Lawrence R.; Smith, Steven C.; Gregory, Stephanie J.; Haney, Morgan M.; Lucas, Dawn D.; Arrigo, Leah M.; Beacham, Tere A.; Swearingen, Kevin J.; Friese, Judah I.; Douglas, Matthew; Metz, Lori A.

    2015-05-01

    Mixed fission and activation materials resulting from various nuclear processes and events contain a wide range of isotopes for analysis spanning almost the entire periodic table. In some applications such as environmental monitoring, nuclear waste management, and national security a very limited amount of material is available for analysis and characterization so an integrated analysis scheme is needed to measure multiple radionuclides from one sample. This work describes the production of a complex synthetic sample containing fission products, activation products, and irradiated soil and determines the percent recovery of select isotopes through the integrated chemical separation scheme. Results were determined using gamma energy analysis of separated fractions and demonstrate high yields of Ag (76 6%), Au (94 7%), Cd (59 2%), Co (93 5%), Cs (88 3%), Fe (62 1%), Mn (70 7%), Np (65 5%), Sr (73 2%) and Zn (72 3%). Lower yields (< 25%) were measured for Ga, Ir, Sc, and W. Based on the results of this experiment, a complex synthetic sample can be prepared with low atom/fission ratios and isotopes of interest accurately and precisely measured following an integrated chemical separation method.

  17. Peppytides: Interactive Models of Polypeptide Chains

    ScienceCinema (OSTI)

    Zuckermann, Ron; Chakraborty, Promita; Derisi, Joe

    2014-10-28

    Peppytides are scaled, 3D-printed models of polypeptide chains that can be folded into accurate protein structures. Designed and created by Berkeley Lab Researcher, Promita Chakraborty, and Berkeley Lab Senior Scientist, Dr. Ron Zuckermann, Peppytides are accurate physical models of polypeptide chains that anyone can interact with and fold intro various protein structures - proving to be a great educational tool, resulting in a deeper understanding of these fascinating structures and how they function. Build your own Peppytide model and learn about how nature's machines fold into their intricate architectures!

  18. Catalysts for synthesizing various short chain hydrocarbons

    DOE Patents [OSTI]

    Colmenares, Carlos (Alamo, CA)

    1991-01-01

    Method and apparatus (10), including novel photocatalysts, are disclosed for the synthesis of various short chain hydrocarbons. Light-transparent SiO.sub.2 aerogels doped with photochemically active uranyl ions (18) are fluidized in a fluidized-bed reactor (12) having a transparent window (16), by hydrogen and CO, C.sub.2 H.sub.4 or C.sub.2 H.sub.6 gas mixtures (20), and exposed to radiation (34) from a light source (32) external to the reactor (12), to produce the short chain hydrocarbons (36).

  19. Peppytides: Interactive Models of Polypeptide Chains

    SciTech Connect (OSTI)

    Zuckermann, Ron; Chakraborty, Promita; Derisi, Joe

    2014-01-21

    Peppytides are scaled, 3D-printed models of polypeptide chains that can be folded into accurate protein structures. Designed and created by Berkeley Lab Researcher, Promita Chakraborty, and Berkeley Lab Senior Scientist, Dr. Ron Zuckermann, Peppytides are accurate physical models of polypeptide chains that anyone can interact with and fold intro various protein structures - proving to be a great educational tool, resulting in a deeper understanding of these fascinating structures and how they function. Build your own Peppytide model and learn about how nature's machines fold into their intricate architectures!

  20. Nuclear Reactions X-Sections By Evaporation Model, Gamma-Cascades

    Energy Science and Technology Software Center (OSTI)

    2000-06-27

    Calculation of energy-averaged cross sections for nuclear reactions with emission of particles and gamma rays and fission. The models employed are the evaporation model with inclusion of pre-equilibrium decay and gamma ray cascade model. Angular momentum and parity conservation are accounted for. Major improvement to the 1976 STAPRE program (NEA 0461) relates to level density approach, implemwnted in subroutine ZSTDE. Generalized superfluid model is incorporated, Boltzman-gas modelling of intrinsic state density and semi-empirical modelling ofmore » a few quasiparticle effects in total level density in equilibrium and saddle deformations of actinide nuclei.« less

  1. Assessment of a mechanistic model in U-Pu-Zr metallic alloy fuel fission-gas behavior simulations

    SciTech Connect (OSTI)

    Yun, D.; Rest, J.; Yacout, A. M.

    2012-07-01

    A mechanistic kinetic rate theory model originally developed for the prediction of fission gas behavior in oxide nuclear fuels under steady-state and transient conditions has been assessed to look at its applicability to model fission gas behavior in U-Pu-Zr metallic alloy fuel. In order to capture and validate the underlying physics for irradiated U-Pu-Zr fuels, the mechanistic model was applied to the simulation of fission gas release, fission gas and fission product induced swelling, and the evolution of the gas bubble size distribution in three different fuel zones: the outer {alpha}-U, the intermediate, and the inner {gamma}-U zones. Due to its special microstructural features, the {alpha}-U zone in U-Pu-Zr fuels is believed to contribute the largest fraction of fission gas release among the different fuel zones. It is shown that with the use of small effective grain sizes, the mechanistic model can predict fission gas release that is consistent with (though slightly lower than) experimentally measured data. These simulation results are comparable to the experimentally measured fission gas release since the mechanism of fission gas transport through the densely distributed laminar porosity in the {alpha}-U zone is analogous to the mechanism of fission gas transport through the interconnected gas bubble porosity utilized in the mechanistic model. Detailed gas bubble size distributions predicted with the mechanistic model in both the intermediate zone and the high temperature {gamma}-U zone of U-Pu-Zr fuel are also compared to experimental measurements from available SEM micrographs. These comparisons show good agreements between the simulation results and experimental measurements, and therefore provide crucial guidelines for the selection of key physical parameters required for modeling these two zones. In addition, the results of parametric studies for several key parameters are presented for both the intermediate zone and the {gamma}-U zone simulations. (authors)

  2. Reaction chemistry of cerium

    SciTech Connect (OSTI)

    1997-01-01

    It is truly ironic that a synthetic organic chemist likely has far greater knowledge of the reaction chemistry of cerium(IV) than an inorganic colleague. Cerium(IV) reagents have long since been employed as oxidants in effecting a wide variety of organic transformations. Conversely, prior to the late 1980s, the number of well characterized cerium(IV) complexes did not extend past a handful of known species. Though in many other areas, interest in the molecular chemistry of the 4f-elements has undergone an explosive growth over the last twenty years, the chemistry of cerium(IV) has for the most part been overlooked. This report describes reactions of cerium complexes and structure.

  3. Charge separation in photoredox reactions. Final report

    SciTech Connect (OSTI)

    Kevan, L.

    1993-07-15

    The structural aspects controlling charge separation in molecular photoionization reactions in organized molecular assemblies involving micelles, reverse micelles and vesicles are being studied by optical and electron magnetic resonance techniques including the time domain technique of deuterium electron spin echo modulation (ESEM) and matrix proton electron nuclear double resonance (ENDOR) to measure weak electron-nuclear dipolar interactions. ESEM and matrix ENDOR are particularly well adapted to the study of disordered systems as exemplified by micelles and vesicles. The photoionization yields of alkylphenothiazines in micelles and vesicles have been shown to depend on the alkyl chain length and to correlate with relative distances from the surfactant assembly interface measured by deuterium ESEM and matrix proton ENDOR. The photoionization of alkylmethylviologens versus alkyl chain length has also been studied in vesicles, micelles and reverse micelles. Nitroxide spin probes have been used to study the degree of water penetration into mixed ionic/nonionic poly(ethylene oxide) and cationic/anionic micelles by using ESEM methods and selectively deuterated surfactants. The effect of urea interaction at micellar interfaces on the interface hydration has also been evaluated by studying nitroxide probes with ESEM.

  4. The reaction of hydroperoxy-propyl radicals with molecular oxygen

    SciTech Connect (OSTI)

    Bozzelli, J.W.; Pitz, W.J.

    1993-12-03

    Addition of hydroperoxy-alkyl radicals to molecular oxygen leads to chain branching in autoignition and engine knock, and in low temperature oxidation of paraffins. Rate constants and product channels for reaction of hydroperoxy-propyl radicals with O{sub 2} are estimated using thermodynamic properties, bimolecular quantum Kassel analysis and transition state theory. Thermochemistry of relevant molecules and radicals is estimated using group additivity and bond dissociation groups for radicals. Results show that rates of the hydroperoxy-propyl radical addition to O{sub 2} are near their high pressure limits at {ge} 1 atm. Main products at 1--15 atm are stabilization, reverse reaction to hydroperoxy-propyl + O{sub 2} and alkyl carbonyl + OH. Reactions of the stabilized adducts, dissociation rates and product channels are estimated using unimolecular quantum Kassel analysis, because stabilization is the most important hydroperoxy-propyl radical + O{sub 2} product channel. Below 700 K, the stabilized peroxy adducts react primarily to hydroperoxy-carbonyl + OH, products which lead to chain branching. Above 700K, the stabilized peroxy adducts react primarily to hydroperoxy-propyl radical + O{sub 2}, initial reactants, which inhibits the overall oxidation. This switchover in channels correlates well observed negative temperature coefficient behavior for propane oxidation. Rate expressions for reaction of each of the three hydroperoxy-alkyl isomers with O{sub 2} and for dissociation of the associated stabilized adducts are calculated for a series of pressures at 300--2100K.

  5. Using a Time Projection Chamber to Measure High Precision Neutron-Induced Fission Cross Sections

    SciTech Connect (OSTI)

    Manning, Brett

    2015-08-06

    2014 LANSCE run cycle data will provide a preliminary 239Pu(n,f) cross section and will quantify uncertainties: PID and Target/beam non-uniformities. Continued running during the 2015 LANSCE run cycle: Thin targets to see both fission fragments and 239Pu(n,f) cross section and fully quantified uncertainties

  6. Dating thermal events at Cerro Prieto using fission-track annealing

    SciTech Connect (OSTI)

    Sanford, S.J.; Elders, W.A.

    1981-01-01

    The duration of heating in the Cerro Prieto reservoir was estimated by relating the fading of spontaneous fission tracks in detrital apatite to observed temperatures. The rate of fading is a function of both time and temperature. The apparent fission track age of the detrital apatites then, is a function of both their source age and their time-temperature history. Data from laboratory experiments and geologic fading studies were compiled from published sources to produce lines of iso-annealing for apatite in time-temperature space. Fission track ages were calculated for samples from two wells at Cerro Prieto, one with an apparently simple and one with an apparently complex thermal history. Temperatures were estimated by empirical vitrinite reflectance geothermometry, fluid inclusion homogenization and oxygen isotope equilibrium. These estimates were compared with logs of measured borehole temperatures. The temperature in well T-366, where complete annealing first occurs, was estimated to be between 160 and 180{sup 0}C. Complete annealing at these temperatures requires 10{sup 4} and 10{sup 3} years, respectively. Well M-94 has an apparently complex thermal history. Geothermometers in this well indicate temperatures some 50 to 100{sup 0}C higher than those measured directly in the borehole. Fission tracks are partially preserved in M-94 where paleotemperatures were as high as 200{sup 0}C and are erased where geothermometers indicate temperatures of 250{sup 0}C. This implies a thermal event less than 10{sup 1} years and greater than 10{sup 0} years in duration.

  7. Fission signal detection using helium-4 gas fast neutron scintillation detectors

    SciTech Connect (OSTI)

    Lewis, J. M. Kelley, R. P.; Jordan, K. A.; Murer, D.

    2014-07-07

    We demonstrate the unambiguous detection of the fission neutron signal produced in natural uranium during active neutron interrogation using a deuterium-deuterium fusion neutron generator and a high pressure {sup 4}He gas fast neutron scintillation detector. The energy deposition by individual neutrons is quantified, and energy discrimination is used to differentiate the induced fission neutrons from the mono-energetic interrogation neutrons. The detector can discriminate between different incident neutron energies using pulse height discrimination of the slow scintillation component of the elastic scattering interaction between a neutron and the {sup 4}He atom. Energy histograms resulting from this data show the buildup of a detected fission neutron signal at higher energies. The detector is shown here to detect a unique fission neutron signal from a natural uranium sample during active interrogation with a (d, d) neutron generator. This signal path has a direct application to the detection of shielded nuclear material in cargo and air containers. It allows for continuous interrogation and detection while greatly minimizing the potential for false alarms.

  8. Comparison of fission product release predictions using PARFUME with results from the AGR-1 irradiation experiment

    SciTech Connect (OSTI)

    Blaise Collin

    2014-09-01

    This report documents comparisons between post-irradiation examination measurements and model predictions of silver (Ag), cesium (Cs), and strontium (Sr) release from selected tristructural isotropic (TRISO) fuel particles and compacts during the first irradiation test of the Advanced Gas Reactor program that occurred from December 2006 to November 2009 in the Advanced Test Reactor (ATR) at Idaho National Laboratory (INL). The modeling was performed using the particle fuel model computer code PARFUME (PARticle FUel ModEl) developed at INL. PARFUME is an advanced gas-cooled reactor fuel performance modeling and analysis code (Miller 2009). It has been developed as an integrated mechanistic code that evaluates the thermal, mechanical, and physico-chemical behavior of fuel particles during irradiation to determine the failure probability of a population of fuel particles given the particle-to-particle statistical variations in physical dimensions and material properties that arise from the fuel fabrication process, accounting for all viable mechanisms that can lead to particle failure. The code also determines the diffusion of fission products from the fuel through the particle coating layers, and through the fuel matrix to the coolant boundary. The subsequent release of fission products is calculated at the compact level (release of fission products from the compact) but it can be assessed at the particle level by adjusting the diffusivity in the fuel matrix to very high values. Furthermore, the diffusivity of each layer can be individually set to a high value (typically 10-6 m2/s) to simulate a failed layer with no capability of fission product retention. In this study, the comparison to PIE focused on fission product release and because of the lack of failure in the irradiation, the probability of particle failure was not calculated. During the AGR-1 irradiation campaign, the fuel kernel produced and released fission products, which migrated through the successive layers of the TRISO-coated particle and potentially through the compact matrix. The release of these fission products was measured in PIE and modeled with PARFUME.

  9. Validation of ATR Fission Power Deposition Fraction in HEU and LEU Fuel Plates

    SciTech Connect (OSTI)

    G. S. Chang

    2008-09-01

    The Advanced Test Reactor (ATR) is a high power (250 MW), high neutron flux research reactor operating in the United States. Powered with highly enriched uranium (HEU), the ATR has a maximum unperturbed thermal neutron flux rating of 1.0 x 1015 n/cm2s. Because of its high power and large test volumes located in high flux areas, the ATR is an ideal candidate for assessing the feasibility of converting an HEU driven reactor to a low-enriched core. A detailed plate-by-plate MCNP ATR full core model has been developed and validated for the low-enriched uranium (LEU) fuel conversion feasibility study. Using this model, an analysis has been performed to determine the LEU density and U-235 enrichment required in the fuel meat to yield equivalent K-eff versus effective full power days (EFPDs) between the HEU and LEU cores. This model has also been used to optimize U-235 content of the LEU core, minimizing the differences in K-eff and heat flux profile between the HEU and LEU cores at 115 MW total core power for 125 EFPDs. The LEU core conversion feasibility study evaluated foil type (U-10Mo) fuel with the LEU reference design of 19.7 wt% U-235 enrichment. The LEU reference design has a fixed fuel meat thickness of 0.330 mm and can sustain the same operating cycle length as the HEU fuel. Heat flux and fission power density are parameters that are proportional to the fraction of fission power deposited in fuel. Thus, the accurate determination of the fraction of fission power deposited in the fuel is important to ATR nuclear safety. In this work, a new approach was developed and validated, the Tally Fuel Cells Only (TFCO) method. This method calculates and compares the fission power deposition fraction between HEU and LEU fuel plates. Due to the high density of the U-10Mo LEU fuel, the fission ?-energy deposition fraction is 37.12%, which is larger than the HEUs ?-energy deposition fraction of 19.7%. As a result, the fuel decay heat cooling will need to be improved. During the power operation, the total fission energy (200 MeV per fission) deposition fraction of LEU and HEU are 90.9% and 89.1%, respectively.

  10. Building a More Efficient Industrial Supply Chain

    Broader source: Energy.gov [DOE]

    This infographic highlights some of the ways businesses can save money at each step of the energy supply chain. Many companies can identify low-cost ways to reduce energy costs in electricity generation, electricity transmission, industrial processes, product delivery, and retail sales.

  11. A Fission Gas Release Model for High-Burnup LWR ThO{sub 2}-UO{sub 2} Fuel

    SciTech Connect (OSTI)

    Long, Yun; Yi Yuan; Kazimi, Mujid S.; Ballinger, Ronald G.; Pilat, Edward E.

    2002-06-15

    Fission gas release in thoria-urania fuel has been investigated by creating a specially modified FRAPCON-3 code. Because of the reduced buildup of {sup 239}Pu and a flatter distribution of {sup 233}U, the new model THUPS (Thoria-Urania Power Shape) was developed to calculate the radial power distribution, including the effects of both plutonium and {sup 233}U. Additionally, a new porosity model for the rim region was introduced at high burnup. The mechanisms of fission gas release in ThO{sub 2}-UO{sub 2} fuel are expected to be essentially similar to those of UO{sub 2} fuel; therefore, the general formulations of the existing fission gas release models in FRAPCON-3 were retained. However, the gas diffusion coefficient was adjusted to a lower level to account for the smaller observed release fraction in the thoria-based fuel. To model the accelerated fission gas release at high burnup properly, a new athermal fission gas release model was introduced. The modified version of FRAPCON-3 was calibrated using the measured fission gas release data from the light water breeder reactor. Using the new model to calculate the gas release in typical pressurized water reactor hot pins gives data that indicate that the ThO{sub 2}-UO{sub 2} fuel will have considerably lower fission gas release above a burnup of 50 MWd/kg HM.

  12. Theoretical analyses of (n,xn) reactions on sup 235 U, sup 238 U, sup 237 Np, and sup 239 Pu for ENDF/B-VI

    SciTech Connect (OSTI)

    Young, P.G.; Arthur, E.D.

    1991-01-01

    Theoretical analyses were performed of neutron-induced reactions on {sup 235}U, {sup 238}U, {sup 237}Np, and {sup 239}Pu between 0.01 and 20 MeV in order to calculate neutron emission cross sections and spectra for ENDF/B-VI evaluations. Coupled-channel optical model potentials were obtained for each target nucleus by fitting total, elastic, and inelastic scattering cross section data, as well as low-energy average resonance data. The resulting deformed optical model potentials were used to calculate direct (n,n{prime}) cross sections and transmission coefficients for use in Hauser-Feshbach statistical theory analyses. A fission model with multiple barrier representation, width fluctuation corrections, and preequilibrium corrections were included in the analyses. Direct cross sections for higher-lying vibrational states were calculated using DWBA theory, normalized using B(E{ell}) values determined from (d,d{prime}) and Coulomb excitation data, where available, and from systematics otherwise. Initial fission barrier parameters and transition state density enhancements appropriate to the compound systems involved were obtained from previous analyses, especially fits to charged-particle fission probability data. The parameters for the fission model were adjusted for each target system to obtain optimum agreement with direct (n,f) cross section measurements, taking account of the various multichance fission channels, that is, the different compound systems involved. The results from these analyses were used to calculate most of the neutron (n,n), (n,n{prime}), and (n,xn) cross section data in the ENDF/B/VI evaluations for the above nuclei, and all of the energy-angle correlated spectra. The deformed optical model and fission model parameterizations are described. Comparisons are given between the results of these analyses and the previous ENDF/B-V evaluations as well as with the available experimental data. 14 refs., 3 figs., 1 tab.

  13. SECTION II: HEAVY ION REACTIONS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    II: HEAVY ION REACTIONS Experimental Determination of the Symmetry Energy of a Low Density Nuclear Gas ...II-1 S....

  14. Detecting special nuclear materials in suspect containers using high-energy gamma rays emitted by fission products

    DOE Patents [OSTI]

    Norman, Eric B.; Prussin, Stanley G.

    2009-01-27

    A method and a system for detecting the presence of special nuclear materials in a suspect container. The system and its method include irradiating the suspect container with a beam of neutrons, so as to induce a thermal fission in a portion of the special nuclear materials, detecting the gamma rays that are emitted from the fission products formed by the thermal fission, to produce a detector signal, comparing the detector signal with a threshold value to form a comparison, and detecting the presence of the special nuclear materials using the comparison.

  15. Detecting special nuclear materials in suspect containers using high-energy gamma rays emitted by fission products

    DOE Patents [OSTI]

    Norman, Eric B [Oakland, CA; Prussin, Stanley G [Kensington, CA

    2009-05-05

    A method and a system for detecting the presence of special nuclear materials in a suspect container. The system and its method include irradiating the suspect container with a beam of neutrons, so as to induce a thermal fission in a portion of the special nuclear materials, detecting the gamma rays that are emitted from the fission products formed by the thermal fission, to produce a detector signal, comparing the detector signal with a threshold value to form a comparison, and detecting the presence of the special nuclear materials using the comparison.

  16. Detecting special nuclear materials in suspect containers using high-energy gamma rays emitted by fission products

    DOE Patents [OSTI]

    Norman, Eric B.; Prussin, Stanley G.

    2009-01-06

    A method and a system for detecting the presence of special nuclear materials in a suspect container. The system and its method include irradiating the suspect container with a beam of neutrons, so as to induce a thermal fission in a portion of the special nuclear materials, detecting the gamma rays that are emitted from the fission products formed by the thermal fission, to produce a detector signal, comparing the detector signal with a threshold value to form a comparison, and detecting the presence of the special nuclear materials using the comparison.

  17. Development of odd-Z-projectile reactions for transactinide element synthesis

    SciTech Connect (OSTI)

    Folden III, Charles Marvin

    2004-11-04

    The development of new odd-Z-projectile reactions leading to the production of transactinide elements is described. The cross section of the even-Z-projectile 208Pb(64Ni, n)271Ds reaction was measured at two new energies using the Berkeley Gas-filled Separator at the Lawrence Berkeley National Laboratory 88-Inch Cyclotron. In total, seven decay chains attributable to 271Ds were observed. These data, combined with previous results, establish an excitation function for the production of 271Ds. The maximum cross section was 20 +15 -11 pb at a center-of-target energy of 311.5 MeV in the laboratory frame.The data from the 271Ds experiments were used to estimate the optimum beam energy for the new odd-Z-projectile 208Pb(65Cu, n)272-111 reaction using the Fusion by Diffusion theory proposed by Swiatecki, Siwek-Wilczynska, and Wilczynski. A cross section for this reaction was measured for the first time, at a center-of-target energy of 321.1 MeV in the laboratory frame. The excitation energy f or compound nuclei formed at the target center was 13.2 MeV. One decay chain was observed, resulting in a measured cross section of 1.7 +3.9 -1.4 pb. This decay chain is in good agreement with previously published data on the decay of 272-111.The new odd-Z-projectile 208Pb(55Mn, n)262Bh reaction was studied at three different projectile energies, and 33 decay chains of 262Bh were observed. The existence of a previously reported alpha-decaying isomeric state in this nuclide was confirmed. Production of the ground state was preferred at all three beam energies. The maximum cross section was 540 +180 -150 pb at a projectile center-of-target energy of 264.0 MeV. This cross section is much larger than that previously reported for the even-Z-projectile 209Bi(54Cr, n)262Bh reaction, which may be because the 54Cr projectile energies in the latter reaction were too high for optimum production of the 1n product. At the highest projectile energy of 268.0 MeV in the target center, two decay chains from 261Bh were observed as a result of the 208Pb(55Mn, 2n) reaction. In summary, this work shows that odd-Z-projectile reactions can have cross sections comparable to analogous even-Z-projectile reactions, and that the energy of the maximum cross section for 1n reactions can be estimated simply.

  18. Method for preparation of single chain antibodies

    DOE Patents [OSTI]

    Cheung, Nai-Kong V. (New York, NY); Guo, Hong-fen (New York, NY)

    2012-04-03

    This invention provides a method for identifying cells expressing a target single chain antibody (scFv) directed against a target antigen from a collection of cells that includes cells that do not express the target scFv, comprising the step of combining the collection of cells with an anti-idiotype directed to an antibody specific for the target antigen and detecting interaction, if any, of the anti-idiotype with the cells, wherein the occurrence of an interaction identifies the cell as one which expresses the target scFv. This invention also provides a method for making a single chain antibody (scFv) directed against an antigen, wherein the selection of clones is made based upon interaction of those clones with an appropriate anti-idiotype, and heretofore inaccessible scFv so made. This invention provides the above methods or any combination thereof. Finally, this invention provides various uses of these methods.

  19. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  20. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  1. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  2. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  3. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  4. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated to minimizing the energy required to perform computational operations and to

  5. supply chain | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    supply chain | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog

  6. maritime supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    maritime supply chain | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at

  7. Adsorption of polymer chains at penetrable interfaces

    SciTech Connect (OSTI)

    Gerasimchuk, I. V.; Sommer, J.-U.; Gerasimchuk, V. S.

    2011-03-15

    We investigate the problem of adsorption (localization) of polymer chains in the system of two penetrable interfaces within the mean-field approximation. The saturation of the polymer system in the limit case of zero bulk concentration is studied. We find the exact solution of this mean-field polymer adsorption problem that opens the possibility to treat various localization problems for polymer chains in such environments using appropriate boundary conditions. The exact solution is controlled by a single scaling variable that describes the coupling between the interfaces due to the polymer chains. We obtain a nonmonotonic behavior of the amount of adsorbed polymers as a function of the distance between the interfaces. This leads to a high-energy and a low-energy phase for the double layer with respect to the amount of polymers localized. At the saturation point, we find the total energy of the system and determine the force acting between the interfaces to be strictly attractive and to monotonically decay to zero when the interface distance increases.

  8. Kinetic simulations of plasmoid chain dynamics

    SciTech Connect (OSTI)

    Markidis, S. [High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden)] [High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden); Henri, P. [Universit de Nice Sophia Antipolis, CNRS, Observatoire de la Cte d'Azur, Nice (France)] [Universit de Nice Sophia Antipolis, CNRS, Observatoire de la Cte d'Azur, Nice (France); Lapenta, G. [Centrum voor Plasma-Astrofysica, Department Wiskunde, Katholieke Universiteit Leuven, Leuven (Belgium)] [Centrum voor Plasma-Astrofysica, Department Wiskunde, Katholieke Universiteit Leuven, Leuven (Belgium); Divin, A. [Swedish Institute of Space Physics, Uppsala (Sweden)] [Swedish Institute of Space Physics, Uppsala (Sweden); Goldman, M.; Newman, D. [Department of Physics and CIPS, University of Colorado, Boulder 80309-0390 (United States)] [Department of Physics and CIPS, University of Colorado, Boulder 80309-0390 (United States); Laure, E. [PDC and High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden)] [PDC and High Performance Computing and Visualization (HPCViz) Department, KTH Royal Institute of Technology, Stockholm (Sweden)

    2013-08-15

    The dynamics of a plasmoid chain is studied with three dimensional Particle-in-Cell simulations. The evolution of the system with and without a uniform guide field, whose strength is 1/3 the asymptotic magnetic field, is investigated. The plasmoid chain forms by spontaneous magnetic reconnection: the tearing instability rapidly disrupts the initial current sheet generating several small-scale plasmoids that rapidly grow in size coalescing and kinking. The plasmoid kink is mainly driven by the coalescence process. It is found that the presence of guide field strongly influences the evolution of the plasmoid chain. Without a guide field, a main reconnection site dominates and smaller reconnection regions are included in larger ones, leading to an hierarchical structure of the plasmoid-dominated current sheet. On the contrary in presence of a guide field, plasmoids have approximately the same size and the hierarchical structure does not emerge, a strong core magnetic field develops in the center of the plasmoid in the direction of the existing guide field, and bump-on-tail instability, leading to the formation of electron holes, is detected in proximity of the plasmoids.

  9. Duplex quantum communication through a spin chain

    SciTech Connect (OSTI)

    Wang Zhaoming; Gu Yongjian [Department of Physics, Ocean University of China, Qingdao 266100 (China); Bishop, C. Allen [Department of Physics, Southern Illinois University, Carbondale, Illinois 62901-4401 (United States); Shao Bin [Department of Physics, Beijing Institute of Technology, Beijing 100081 (China)

    2011-08-15

    Data multiplexing within a quantum computer can allow for the simultaneous transfer of multiple streams of information over a shared medium thereby minimizing the number of channels needed for requisite data transmission. Here, we investigate a two-way quantum communication protocol using a spin chain placed in an external magnetic field. In our scheme, Alice and Bob each play the role of a sender and a receiver as two states, cos(({theta}{sub 1}/2))0+sin(({theta}{sub 1}/2))e{sup i{phi}{sub 1}}1 and cos(({theta}{sub 2}/2))0+sin(({theta}{sub 2}/2))e{sup i{phi}{sub 2}}1, are transferred through one channel simultaneously. We find that the transmission fidelity at each end of a spin chain can usually be enhanced by the presence of a second party. This is an important result for establishing the viability of duplex quantum communication through spin chain networks.

  10. Method of assaying uranium with prompt fission and thermal neutron borehole logging adjusted by borehole physical characteristics. [Patient application

    DOE Patents [OSTI]

    Barnard, R.W.; Jensen, D.H.

    1980-11-05

    Uranium formations are assayed by prompt fission neutron logging techniques. The uranium in the formation is proportional to the ratio of epithermal counts to thermal or epithermal dieaway. Various calibration factors enhance the accuracy of the measurement.

  11. Method of assaying uranium with prompt fission and thermal neutron borehole logging adjusted by borehole physical characteristics

    DOE Patents [OSTI]

    Barnard, Ralston W. (Albuquerque, NM); Jensen, Dal H. (Albuquerque, NM)

    1982-01-01

    Uranium formations are assayed by prompt fission neutron logging techniques. The uranium in the formation is proportional to the ratio of epithermal counts to thermal or eqithermal dieaway. Various calibration factors enhance the accuracy of the measurement.

  12. Green Energy Supply Chain Franchise and Excise Tax Credit

    Broader source: Energy.gov [DOE]

    A certified green energy supply chain manufacturer and campus affiliate, integrated customer or integrated supplier of a green energy supply chain manufacturer is allowed a tax credit against their...

  13. Fusion-Fission Research Facility (FFRF) as a Practical Step Toward Hybrids

    SciTech Connect (OSTI)

    L. Zakharov, J. Li and Y. Wu

    2010-11-18

    The project of ASIPP (with PPPL participation), called FFRF, (R/a=4/1 m/m, Ipl=5 MA, Btor=4-6 T, PDT=50-100 MW, Pfission=80-4000 MW, 1 m thick blanket) is outlined. FFRF stands for the Fusion-Fission Research Facility with a unique fusion mission and a pioneering mission of merging fusion and fission for accumulation of design, experimental, and operational data for future hybrid applications. The design of FFRF will use as much as possible the EAST and ITER design experience. On the other hand, FFRF strongly relies on new, Lithium Wall Fusion plasma regimes, the development of which has already started in the US and China.

  14. Fundamental Studies of Irradiation-Induced Defect Formation and Fission Product Dynamics in Oxide Fuels

    SciTech Connect (OSTI)

    James Stubbins

    2012-12-19

    The objective of this research program is to address major nuclear fuels performance issues for the design and use of oxide-type fuels in the current and advanced nuclear reactor applications. Fuel performance is a major issue for extending fuel burn-up which has the added advantage of reducing the used fuel waste stream. It will also be a significant issue with respect to developing advanced fuel cycle processes where it may be possible to incorporate minor actinides in various fuel forms so that they can be 'burned' rather than join the used fuel waste stream. The potential to fission or transmute minor actinides and certain long-lived fission product isotopes would transform the high level waste storage strategy by removing the need to consider fuel storage on the millennium time scale.

  15. Transient fission-gas behavior in uranium nitride fuel under proposed space applications. Doctoral thesis

    SciTech Connect (OSTI)

    Deforest, D.L.

    1991-12-01

    In order to investigate whether fission gas swelling and release would be significant factors in a space based nuclear reactor operating under the Strategic Defense Initiative (SDI) program, the finite element program REDSTONE (Routine For Evaluating Dynamic Swelling in Transient Operational Nuclear Environments) was developed to model the 1-D, spherical geometry diffusion equations describing transient fission gas behavior in a single uranium nitride fuel grain. The equations characterized individual bubbles, rather than bubble groupings. This limits calculations to those scenarios where low temperatures, low burnups, or both were present. Instabilities in the bubble radii calculations forced the implementation of additional constraints limiting the bubble sizes to minimum and maximum (equilibrium) radii. The validity of REDSTONE calculations were checked against analytical solutions for internal consistency and against experimental studies for agreement with swelling and release results.

  16. Solid State NMR Investigations of Chain Dynamics and Network...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Presented at: Silicon containing polymers and composites ... AND ANALYTICAL CHEMISTRY; CHAINS; ELASTOMERS; POLYMERS; PROBES; SILICON; SILOXANES

  17. U.S. Offshore Wind Manufacturing and Supply Chain Development...

    Broader source: Energy.gov (indexed) [DOE]

    an organized, analytical approach to identifying and bounding uncertainties around offshore wind manufacturing and supply chain capabilities; projecting potential...

  18. Photovoltaic Supply Chain and Cross-Cutting Technologies Round 2 |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Technology to Market » Photovoltaic Supply Chain and Cross-Cutting Technologies Round 2 Photovoltaic Supply Chain and Cross-Cutting Technologies Round 2 Four projects are working to accelerate the development of revolutionary products or processes for the photovoltaic (PV) industry through the High Impact Supply Chain R&D for PV Technologies/Systems program, which represents the second round of PV Supply Chain and Cross-Cutting Technologies funding. These projects

  19. Tuesday Webcasts for Industry: Engaging Supply Chains in Energy Management

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Engaging Supply Chains in Energy Management April 10, 2012 2 | Advanced Manufacturing Office eere.energy.gov * Overview and Welcome * Engaging Supply Chains in Energy Management - Ron Reising, EUISSCA * 2012 Supplier Sustainability Outreach Program - Eric Battino, PepsiCo * Questions and Answers * Accessing Slides Agenda April 10, 2012 Engaging Supply Chains in Energy Management 4 Current members include 16 of the largest electric utilities in the U.S. Electric Utility Sustainable Supply Chain

  20. Supply Chain Risk Management (SCRM) Awareness Toolkit | Department of

    Energy Savers [EERE]

    Energy Supply Chain Risk Management (SCRM) Awareness Toolkit Supply Chain Risk Management (SCRM) Awareness Toolkit The Office of the Chief Information Officer (OCIO) Supply Chain Risk Management (SCRM) Resource Center developed the SCRM Awareness Toolkit to introduce DOE employees to the basic terms and concepts of the technology supply chain and associated threats. For additional information on the DOE Enterprise SCRM Resource Center and program initiatives, please contact Sue Farrand at

  1. The fiftieth anniversary of the first public announcement of the successful test of fission: Proceedings

    SciTech Connect (OSTI)

    Not Available

    1989-01-01

    This report contains comments and discussions on the history of fission. The following people comments and lectures are discussed in this report: Remarks and introduction of Maxine F. Singer; president's message, Maxine F. Singer; introduction of Stephen Joel Trachtenberg; President's message, Stephen Joel Trachtenberg; introduction of Frederick Seitz; lecture: Nuclear Science: Promises and Perceptions, '' Frederick Seitz; introduction of K. Alex Mueller; lecture: High Temperature Ferroelectricity and Superconductivity,'' introduction of Edward Teller; and lecture: Toward a More Secure World,'' Edward Teller.

  2. Theoretical investigation of the impact of grain boundaries and fission gases on UO2 thermal conductivity

    SciTech Connect (OSTI)

    Du, Shiyu; Andersson, Anders D.; Germann, Timothy C.; Stanek, Christopher R.

    2012-05-02

    Thermal conductivity is one of the most important metrics of nuclear fuel performance. Therefore, it is crucial to understand the impact of microstructure features on thermal conductivity, especially since the microstructure evolves with burn-up or time in the reactor. For example, UO{sub 2} fuels are polycrystalline and for high-burnup fuels the outer parts of the pellet experience grain sub-division leading to a very fine grain structure. This is known to impact important physical properties such as thermal conductivity as fission gas release. In a previous study, we calculated the effect of different types of {Sigma}5 grain boundaries on UO{sub 2} thermal conductivity and predicted the corresponding Kapitza resistances, i.e. the resistance of the grain boundary in relation to the bulk thermal resistance. There have been reports of pseudoanisotropic effects for the thermal conductivity in cubic polycrystalline materials, as obtained from molecular dynamics simulations, which means that the conductivity appears to be a function of the crystallographic direction of the temperature gradient. However, materials with cubic symmetry should have isotropic thermal conductivity. For this reason it is necessary to determine the cause of this apparent anisotropy and in this report we investigate this effect in context of our earlier simulations of UO{sub 2} Kapitza resistances. Another source of thermal resistance comes from fission products and fission gases. Xe is the main fission gas and when generated in sufficient quantity it dissolves from the lattice and forms gas bubbles inside the crystalline structure. We have performed studies of how Xe atoms dissolved in the UO{sub 2} matrix or precipitated as bubbles impact thermal conductivity, both in bulk UO{sub 2} and in the presence of grain boundaries.

  3. Fission Product Monitoring and Release Data for the Advanced Gas Reactor -1 Experiment

    SciTech Connect (OSTI)

    Dawn M. Scates; John B. Walter; Jason M. Harp; Mark W. Drigert; Edward L. Reber

    2010-10-01

    The AGR-1 experiment is a fueled multiple-capsule irradiation experiment that was irradiated in the Advanced Test Reactor (ATR) from December 26, 2006 until November 6, 2009 in support of the Very High Temperature Reactor (VHTR) Technology Development Office (TDO) Fuel Development and Qualification program. An important measure of the fuel performance is the quantification of the fission product releases over the duration of the experiment. To provide this data for the inert fission gasses(Kr and Xe), a fission product monitoring system (FPMS) was developed and implemented to monitor the individual capsule effluents for the radioactive species. The FPMS continuously measured the concentrations of various krypton and xenon isotopes in the sweep gas from each AGR-1 capsule to provide an indicator of fuel irradiation performance. Spectrometer systems quantified the concentrations of Kr-85m, Kr-87, Kr-88, Kr-89, Kr-90, Xe-131m, Xe-133, Xe 135, Xe 135m, Xe-137, Xe-138, and Xe-139 accumulated over repeated eight hour counting intervals.-. To determine initial fuel quality and fuel performance, release activity for each isotope of interest was derived from FPMS measurements and paired with a calculation of the corresponding isotopic production or birthrate. The release activities and birthrates were combined to determine Release-to-Birth ratios for the selected nuclides. R/B values provide indicators of initial fuel quality and fuel performance during irradiation. This paper presents a brief summary of the FPMS, the release to birth ratio data for the AGR-1 experiment and preliminary comparisons of AGR-1 experimental fuels data to fission gas release models.

  4. Shape Matters when Modeling Nuclear Fission | U.S. DOE Office of Science

    Office of Science (SC) Website

    (SC) Shape Matters when Modeling Nuclear Fission Advanced Scientific Computing Research (ASCR) ASCR Home About Research Facilities Science Highlights Benefits of ASCR Funding Opportunities Advanced Scientific Computing Advisory Committee (ASCAC) Community Resources Contact Information Advanced Scientific Computing Research U.S. Department of Energy SC-21/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-7486 F: (301) 903-4846 E: Email Us More Information »

  5. NUCLEAR ENERGY UNIVERSITY PROGRAMS Improved Fission Neutron Data Base for Active Interrogation of Actinides

    National Nuclear Security Administration (NNSA)

    NUCLEAR ENERGY UNIVERSITY PROGRAMS Improved Fission Neutron Data Base for Active Interrogation of Actinides PI: Pozzi, Sara - University of Michigan Project Number: 09-414 Initiative/Campaign: IRR Collaborators: Czirr, J. Bart - Photogenics Haight, Robert - Los Alamos National Laboratory Kovash, Michael - University of Kentucky Tsvetkov, Pavel - Texas A&M University Abstract This project will develop an innovative neutron detection system for active interrogation measurements. Many active

  6. Optical probe for the cytochrome P-450 cholesterol side chain cleavage enzyme

    DOE Patents [OSTI]

    Marrone, Babetta L. (Los Alamos, NM); Simpson, Daniel J. (Los Alamos, NM); Unkefer, Clifford J. (Los Alamos, NM); Whaley, Thomas W. (Santa Fe, NM)

    1992-01-01

    An optical probe enables the study of enzyme activity by absorbance spectroscopy or by sensitive fluorescence methods. In particular, the probe provides the ability to monitor the activity of cytochrome P-450.sub.scc enzyme, the rate limiting enzyme for steroid biosynthesis. Located on the inner mitochondrial membrane, P-450.sub.scc catalyzes the conversion of cholesterol to pregnenolone and isocapraldehyde by sequential oxidations of the cholesterol side chain. The fluorogenic probe includes a cholesterol-like steroid linked to a chromophore through a linking group. The chromophore is selected to have little optical response when linked to the steroid substrate and an enhanced optical response when cleaved from the substrate and linking group. Thus, a fluorescent anion that can be optically detected is generated by the side-chain cleavage reaction during steroidogenesis.

  7. Optical probe for the cytochrome P-450 cholesterol side chain cleavage enzyme

    DOE Patents [OSTI]

    Marrone, Babetta L. (Los Alamos, NM); Simpson, Daniel J. (Los Alamos, NM); Unkefer, Clifford J. (Los Alamos, NM); Whaley, Thomas W. (Santa Fe, NM)

    1993-01-01

    An optical probe enables the study of enzyme activity by absorbance spectroscopy or by sensitive fluorescence methods. In particular, the probe provides the ability to monitor the activity of cytochrome P-450.sub.scc enzyme, the rate limiting enzyme for steroid biosynthesis. Located on the inner mitochondrial membrane, P-450.sub.scc catalyzes the conversion of cholesterol to pregnenolone and isocapraldehyde by sequential oxidations of the cholesterol side chain. The fluorogenic probe includes a cholesterol-like steroid linked to a chromophore through a linking group. The chromophore is selected to have little optical response when linked to the steroid substrate and an enhanced optical response when cleaved from the substrate and linking group. Thus, a fluorescent anion that can be optically detected is generated by the side-chain cleavage reaction during steroidogenesis.

  8. Nucleus-nucleus cold fusion reactions analyzed with the l-dependent 'fusion by diffusion' model

    SciTech Connect (OSTI)

    Cap, T.; Siwek-Wilczynska, K.; Wilczynski, J.

    2011-05-15

    We present a modified version of the Fusion by Diffusion (FBD) model aimed at describing the synthesis of superheavy nuclei in cold fusion reactions, in which a low excited compound nucleus emits only one neutron. The modified FBD model accounts for the angular momentum dependence of three basic factors determining the evaporation residue cross section: the capture cross section {sigma}{sub cap}(l), the fusion probability P{sub fus}(l), and the survival probability P{sub surv}(l). The fusion hindrance factor, the inverse of P{sub fus}(l), is treated in terms of thermal fluctuations in the shape degrees of freedom and is expressed as a solution of the Smoluchowski diffusion equation. The l dependence of P{sub fus}(l) results from the l-dependent potential energy surface of the colliding system. A new parametrization of the distance of starting point of the diffusion process is introduced. An analysis of a complete set of 27 excitation functions for production of superheavy nuclei in cold fusion reactions, studied in experiments at GSI Darmstadt, RIKEN Tokyo, and LBNL Berkeley, is presented. The FBD model satisfactorily reproduces shapes and absolute cross sections of all the cold fusion excitation functions. It is shown that the peak position of the excitation function for a given 1n reaction is determined by the Q value of the reaction and the height of the fission barrier of the final nucleus. This fact could possibly be used in future experiments (with well-defined beam energy) for experimental determination of the fission barrier heights.

  9. Measurement of fission gas release from irradiated UMo monolithic fuel samples

    SciTech Connect (OSTI)

    Burkes, Douglas E.; Casella, Amanda J.; Casella, Andrew M.; Luscher, Walter G.; Rice, Francine J.; Pool, Karl N.

    2015-06-01

    The uraniummolybdenum (U-Mo) alloy in a monolithic form has been proposed as one fuel design capable of converting some of the worlds highest power research reactors from the use of high enriched uranium (HEU) to low enriched uranium (LEU). One aspect of the fuel development and qualification process is to demonstrate appropriate understanding of the extent of fission product release from the fuel under anticipated service environments. An apparatus capable of heating post-irradiated small-scale samples cut from larger fuel segments according to specified thermal profiles under a controlled atmosphere has been installed into a hot cell. Results show that optimized experimental parameters to investigate fission product release from small samples have been established. Initial measurements conducted on aluminum alloy clad uraniummolybdenum monolithic fuel samples reveal three clear fission gas release events over the temperature range of 30-1000 C. The mechanisms responsible for these events are discussed, and the results have been compared with available information in the literature.

  10. Measurement of Fission Gas Release from Irradiated U-Mo Monolithic Fuel Samples

    SciTech Connect (OSTI)

    Burkes, Douglas; Casella, Amanda J.; Casella, Andrew M.; Luscher, Walter G.; Rice, Francine; Pool, Karl N.

    2015-06-01

    The uranium-molybdenum (U-Mo) alloy in a monolithic form has been proposed as one fuel design capable of converting some of the worlds highest power research reactors from the use of high enriched uranium (HEU) to low enriched uranium (LEU). One aspect of the fuel development and qualification process is to demonstrate appropriate understanding of the extent of fission product release from the fuel under anticipated service environments. An apparatus capable of annealing post-irradiated small-scale samples cut from larger fuel segments according to specified thermal profiles under a controlled atmosphere has been installed into a hot cell. Results show that optimized experimental parameters to investigate fission product release from small samples have been established. Initial measurements conducted on aluminum alloy clad uranium-molybdenum monolithic fuel samples reveal three clear fission gas release events over the temperature range of 30-1050 C. The mechanisms responsible for these events are discussed, and the results have been compared with available information in literature.

  11. Fission Product Transport in TRISO Particle Layers under Operating and Off-Normal Conditions

    SciTech Connect (OSTI)

    Van der Ven, Anton; Was, Gary; Wang, Lumin; Taheri, Mitra

    2014-07-07

    The objective of this project is to determine the diffusivity and chemical behavior of key fission products (ag, Cs, I. Te, Eu and Sr) through SiC and PyC both thermally, under irradiation, and under stress using FP introduction techniques that avoid the pitfalls of past experiments. The experimental approach is to create thin PyC-SiC couples containing the fission product to be studied embedded in the PyC layer. These samples will then be subjected to high temperature exposures in a vacuum and also to irradiation at high temperature, and last, to irradiation under stress at high temperature. The PyC serves as a host layer, providing a means of placing the fission product close to the SiC without damaging the SiC layer by its introduction or losing the FP during heating. Experimental measurements of grain boundary structure and distribution (EBSD, HRTEM, APT) will be used in the modeling effort to determine the qualitative dependence of FP diffusion coefficients on grain boundary orientation, temperature and stress.

  12. Linear Free Energy Correlations for Fission Product Release from the Fukushima-Daiichi Nuclear Accident

    SciTech Connect (OSTI)

    Abrecht, David G.; Schwantes, Jon M.

    2015-03-03

    This paper extends the preliminary linear free energy correlations for radionuclide release performed by Schwantes, et al., following the Fukushima-Daiichi Nuclear Power Plant accident. Through evaluations of the molar fractionations of radionuclides deposited in the soil relative to modeled radionuclide inventories, we confirm the source of the radionuclides to be from active reactors rather than the spent fuel pool. Linear correlations of the form ln⁡Χ=-α (ΔG_rxn^° (T_C ))/(RT_C )+β were obtained between the deposited concentration and the reduction potential of the fission product oxide species using multiple reduction schemes to calculate ΔG_rxn^° (T_C ). These models allowed an estimate of the upper bound for the reactor temperatures of T_C between 2130 K and 2220 K, providing insight into the limiting factors to vaporization and release of fission products during the reactor accident. Estimates of the release of medium-lived fission products 90Sr, 121mSn, 147Pm, 144Ce, 152Eu, 154Eu, 155Eu, 151Sm through atmospheric venting and releases during the first month following the accident were performed, and indicate large quantities of 90Sr and radioactive lanthanides were likely to remain in the damaged reactor cores.

  13. Fission Product Separation from Pyrochemical Electrolyte by Cold Finger Melt Crystallization

    SciTech Connect (OSTI)

    Joshua R. Versey

    2013-08-01

    This work contributes to the development of pyroprocessing technology as an economically viable means of separating used nuclear fuel from fission products and cladding materials. Electrolytic oxide reduction is used as a head-end step before electrorefining to reduce oxide fuel to metallic form. The electrolytic medium used in this technique is molten LiCl-Li2O. Groups I and II fission products, such as cesium (Cs) and strontium (Sr), have been shown to partition from the fuel into the molten LiCl-Li2O. Various approaches of separating these fission products from the salt have been investigated by different research groups. One promising approach is based on a layer crystallization method studied at the Korea Atomic Energy Research Institute (KAERI). Despite successful demonstration of this basic approach, there are questions that remain, especially concerning the development of economical and scalable operating parameters based on a comprehensive understanding of heat and mass transfer. This research explores these parameters through a series of experiments in which LiCl is purified, by concentrating CsCl in a liquid phase as purified LiCl is crystallized and removed via an argon-cooled cold finger.

  14. Evaluation of prompt release of fission gas from a breached cladding. [PWR; BWR

    SciTech Connect (OSTI)

    El-Genk, M.S.; Kumar, R.M.

    1981-01-01

    It is a concern in the current safety analysis of nuclear reactors to understand the different release mechanisms of fission products to accurately determine the radiological source term for a wide variety of accidents. The mechanism which is least understood and which produces an uncertainty in determining the radiological source term during a reactor accident is the early release of fission gas present in the fuel-cladding gap through a cladding breach. In a loss-of-coolant type accident the fuel rods would be surrounded mainly by steam, therefore, the release of the gap gas can simply be treated as a discharge problem through an orifice. However, during reactor normal operation or in those accidents where the failed fuel rods are surrounded by liquid coolant, the release process of the gap gas would be strongly influenced by the coolant conditions (pressure, temperature and flow rate). The purpose of this work is to describe analytically the prompt escape of volatiles and gaseous fission products, present in the fuel-cladding gap through a cladding breach, where the fuel rod is surrounded by liquid coolant.

  15. Analysis of fission product revaporization in a BWR reactor cooling system during a station blackout accident

    SciTech Connect (OSTI)

    Yang, J.W.; Schmidt, E.; Cazzoli, E.; Khatib-Rahbar, M.

    1988-01-01

    This report presents a preliminary analysis of fission product revaporization in the Reactor Cooling System (RCS) after the vessel failure. The station blackout transient for BWR Mark I Power Plant is considered. The TRAPMELT3 models of evaporization, chemisorption, and the decay heating of RCS structures and gases are adopted in the analysis. The RCS flow models based on the density-difference between the RCS and containment pedestal region are developed to estimate the RCS outflow which carries the revaporized fission product to the containment. A computer code called REVAP is developed for the analysis. The REVAP is incorporated with the MARCH, TRAPMELT3 and NAUA codes of the Source Term Code Pack Package (STCP). The NAUA code is used to estimate the impact of revaporization on environmental release. The results show that the thermal-hydraulic conditions between the RCS and the pedestal region are important factors determining the magnitude of revaporization and subsequent release of the volatile fission product. 8 figs., 1 tab.

  16. U.S. Offshore Wind Manufacturing and Supply Chain Development

    SciTech Connect (OSTI)

    Hamilton, Bruce

    2013-02-22

    This report seeks to provide an organized, analytical approach to identifying and bounding uncertainties around offshore wind manufacturing and supply chain capabilities; projecting potential component-level supply chain needs under three demand scenarios; and identifying key supply chain challenges and opportunities facing the future U.S. market and current suppliers of the nation’s landbased wind market.

  17. Two chamber reaction furnace

    DOE Patents [OSTI]

    Blaugher, R.D.

    1998-05-05

    A vertical two chamber reaction furnace is described. The furnace comprises a lower chamber having an independently operable first heating means for heating the lower chamber and a gas inlet means for admitting a gas to create an ambient atmosphere, and an upper chamber disposed above the lower chamber and having an independently operable second heating means for heating the upper chamber. Disposed between the lower chamber and the upper chamber is a vapor permeable diffusion partition. The upper chamber has a conveyor means for conveying a reactant there through. Of particular importance is the thallinating of long-length thallium-barium-calcium-copper oxide (TBCCO) or barium-calcium-copper oxide (BCCO) precursor tapes or wires conveyed through the upper chamber to thereby effectuate the deposition of vaporized thallium (being so vaporized as the first reactant in the lower chamber at a temperature between about 700 C and 800 C) on TBCCO or BCCO tape or wire (the second reactant) at its simultaneous annealing temperature in the upper chamber of about 800 to 950 C to thereby replace thallium oxide lost from TBCCO tape or wire because of the high annealing temperature or to deposit thallium on BCCO tape or wire. Continuously moving the tape or wire provides a single-step process that effectuates production of long-length TBCCO superconducting product. 2 figs.

  18. Metal-Ion-Mediated Reactions

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Researchers from Patras (Greece), Nicosia (Cyprus), Karlsruhe (Germany), Zaragoza (Spain), and the ALS at Berkeley Lab have studied metal-ion-mediated reactions of...

  19. Analysis of fission gas release kinetics by on-line mass spectrometry

    SciTech Connect (OSTI)

    Zerega, Y.; Reynard-Carette, C.; Parrat, D.; Carette, M.; Brkic, B.; Lyoussi, A.; Bignan, G.; Janulyte, A.; Andre, J.; Pontillon, Y.; Ducros, G.; Taylor, S.

    2011-07-01

    The release of fission gas (Xe and Kr) and helium out of nuclear fuel materials in normal operation of a nuclear power reactor can constitute a strong limitation of the fuel lifetime. Moreover, radioactive isotopes of Xe and Kr contribute significantly to the global radiological source term released in the primary coolant circuit in case of accidental situations accompanied by fuel rod loss of integrity. As a consequence, fission gas release investigation is of prime importance for the nuclear fuel cycle economy, and is the driven force of numerous R and D programs. In this domain, for solving current fuel behavior understanding issues, preparing the development of new fuels (e.g. for Gen IV power systems) and for improving the modeling prediction capability, there is a marked need for innovations in the instrumentation field, mainly for: . Quantification of very low fission gas concentrations, released from fuel sample and routed in sweeping lines. Monitoring of quick gas release variations by quantification of elementary release during a short period of time. Detection of a large range of atomic masses (e.g. H{sub 2}, HT, He, CO, CO{sub 2}, Ne, Ar, Kr, Xe), together with a performing separation of isotopes for Xe and Kr elements. Coupling measurement of stable and radioactive gas isotopes, by using in parallel mass spectrometry and gamma spectrometry techniques. To fulfill these challenging needs, a common strategy for analysis equipment implementation has been set up thanks to a recently launched collaboration between the CEA and the Univ. of Provence, with the technological support of the Liverpool Univ.. It aims at developing a chronological series of mass spectrometer devices based upon mass filter and 2D/3D ion traps with Fourier transform operating mode and having increasing levels of performances to match the previous challenges for out-of pile and in-pile experiments. The final objective is to install a high performance online mass spectrometer coupled to a gamma spectrometer in the fission product laboratory of the future Jules Horowitz Material Test Reactor. An intermediate step will consist of testing first equipment on an existing experimental facility in the LECA-STAR Hot Cell Laboratory of the CEA Cadarache. This paper presents the scientific and operational stakes linked to fission gas issues, resumes the current state of art for analyzing them in nuclear facilities, then presents the skills gathered through this collaboration to overcome technological bottlenecks. Finally it describes the implementation strategy in nuclear research facilities of the CEA Cadarache. (authors)

  20. Experimental Observation of Nuclear Reactions in Palladium and Uranium - Possible Explanation by Hydrex Mode

    SciTech Connect (OSTI)

    Dufour, J.; Murat, D.; Dufour, X.; Foos, J

    2001-07-15

    Experiments with uranium are presented that show a highly exothermal reaction, which can only be of nuclear origin. One striking point of these results is that they clearly show that what is being observed is not some kind of fusion reaction of the deuterium present (only exceedingly small amounts of it are present). This is a strong indication that hydrogen can trigger nuclear reactions that seem to involve the nuclei of the lattice (which would yield a fission-like pattern of products). Confronted with a situation where some experiments in the field yield a fusion-like pattern of products (CF experiments) and others a fissionlike one (LENR experiments), one can reasonably wonder whether one is not observing two aspects of the same phenomenon. Thus, it is proposed to describe CF and LENR reactions as essentially the same phenomenon based on the possible existence of a still hypothetical proton/electron resonance, which would catalyze fissionlike reactions with a neutron sink. Finally, a series of experiments is proposed to assess this hypothesis.

  1. Numerical simulations for low energy nuclear reactions including...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Consultants Meeting on Recommended Input Parameters for Fission Cross-Section Calculation ; 2013-12-17 - 2013-12-18 ; Vienna, Austria Research Org: ...

  2. Surface-micromachined chain for use in microelectromechanical structures

    DOE Patents [OSTI]

    Vernon, Sr., George E. (Rio Rancho, NM)

    2001-01-01

    A surface-micromachined chain and a microelectromechanical (MEM) structure incorporating such a chain are disclosed. The surface-micromachined chain can be fabricated in place on a substrate (e.g. a silicon substrate) by depositing and patterning a plurality of alternating layers of a chain-forming material (e.g. polycrystalline silicon) and a sacrificial material (e.g. silicon dioxide or a silicate glass). The sacrificial material is then removed by etching to release the chain for movement. The chain has applications for forming various types of MEM devices which include a microengine (e.g. an electrostatic motor) connected to rotate a drive sprocket, with the surface-micromachined chain being connected between the drive sprocket and one or more driven sprockets.

  3. Computational studies of polysiloxanes : oxidation potentials and decomposition reactions.

    SciTech Connect (OSTI)

    Assary, R. S.; Curtiss, L. A.; Redfern, P. C.; Zhang, Z.; Amine, K.

    2011-06-23

    Silicon-containing solvents have tremendous potential for application as electrolytes for electrical energy storage devices such as lithium-ion (air) batteries and supercapacitors. Quantum chemical methods were employed to investigate trends in oxidation potentials and decomposition reactions of a series of polysiloxanes. Various electron-donating and -withdrawing substituents can be used to tune the oxidation potential in shorter chain siloxanes but not in longer ones. Decomposition reactions of siloxanes in their oxidized states were investigated and compared against their carbon analogues. These studies suggest that the Si-O group provides added stability for siloxanes over their carbon analogues. Computational studies have also been performed for various disiloxanes and siloxanes with spacer groups to understand their thermochemical stability and oxidation potentials.

  4. Investigation of the Feasibility of Utilizing Gamma Emission Computed Tomography in Evaluating Fission Product Migration in Irradiated TRISO Fuel Experiments

    SciTech Connect (OSTI)

    Jason M. Harp; Paul A. Demkowicz

    2014-10-01

    In the High Temperature Gas-Cooled Reactor (HTGR) the TRISO particle fuel serves as the primary fission product containment. However the large number of TRISO particles present in proposed HTGRs dictates that there will be a small fraction (~10-4 to 10-5) of as manufactured and in-pile particle failures that will lead to some fission product release. The matrix material surrounding the TRISO particles in fuel compacts and the structural graphite holding the TRISO particles in place can also serve as sinks for containing any released fission products. However data on the migration of solid fission products through these materials is lacking. One of the primary goals of the AGR-3/4 experiment is to study fission product migration from failed TRISO particles in prototypic HTGR components such as structural graphite and compact matrix material. In this work, the potential for a Gamma Emission Computed Tomography (GECT) technique to non-destructively examine the fission product distribution in AGR-3/4 components and other irradiation experiments is explored. Specifically, the feasibility of using the Idaho National Laboratory (INL) Hot Fuels Examination Facility (HFEF) Precision Gamma Scanner (PGS) system for this GECT application is considered. To test the feasibility, the response of the PGS system to idealized fission product distributions has been simulated using Monte Carlo radiation transport simulations. Previous work that applied similar techniques during the AGR-1 experiment will also be discussed as well as planned uses for the GECT technique during the post irradiation examination of the AGR-2 experiment. The GECT technique has also been applied to other irradiated nuclear fuel systems that were currently available in the HFEF hot cell including oxide fuel pins, metallic fuel pins, and monolithic plate fuel.

  5. Integrated Solar Thermochemical Reaction System

    Broader source: Energy.gov [DOE]

    This fact sheet describes an integrated solar thermochemical reaction system project awarded under the DOE's 2012 SunShot Concentrating Solar Power R&D award program. The team, led by the Pacific Northwest National Laboratory, is working to develop and demonstrate a high-performance solar thermochemical reaction system in an end-to-end demonstration that produces electricity. A highly efficient solar thermochemical reaction system would allow for 24-hour operation without the need for storage technology, and reductions in total system costs while providing a relatively low-risk deployment option for CSP systems.

  6. Fission Product Monitoring of TRISO Coated Fuel For The Advanced Gas Reactor -1 Experiment

    SciTech Connect (OSTI)

    Dawn M. Scates; John K. Hartwell; John b. Walter

    2010-10-01

    The US Department of Energy has embarked on a series of tests of TRISO-coated particle reactor fuel intended for use in the Very High Temperature Reactor (VHTR) as part of the Advanced Gas Reactor (AGR) program. The AGR-1 TRISO fuel experiment, currently underway, is the first in a series of eight fuel tests planned for irradiation in the Advanced Test Reactor (ATR) located at the Idaho National Laboratory (INL). The AGR-1 experiment reached a peak compact averaged burn up of 9% FIMA with no known TRISO fuel particle failures in March 2008. The burnup goal for the majority of the fuel compacts is to have a compact averaged burnup greater than 18% FIMA and a minimum compact averaged burnup of 14% FIMA. At the INL the TRISO fuel in the AGR-1 experiment is closely monitored while it is being irradiated in the ATR. The effluent monitoring system used for the AGR-1 fuel is the Fission Product Monitoring System (FPMS). The FPMS is a valuable tool that provides near real-time data indicative of the AGR-1 test fuel performance and incorporates both high-purity germanium (HPGe) gamma-ray spectrometers and sodium iodide [NaI(Tl)] scintillation detector-based gross radiation monitors. To quantify the fuel performance, release-to-birth ratios (R/Bs) of radioactive fission gases are computed. The gamma-ray spectra acquired by the AGR-1 FPMS are analyzed and used to determine the released activities of specific fission gases, while a dedicated detector provides near-real time count rate information. Isotopic build up and depletion calculations provide the associated isotopic birth rates. This paper highlights the features of the FPMS, encompassing the equipment, methods and measures that enable the calculation of the release-to-birth ratios. Some preliminary results from the AGR-1 experiment are also presented.

  7. Fuel Performance Experience, Analysis and Modeling: Deformations, Fission Gas Release and Pellet-Clad Interaction

    SciTech Connect (OSTI)

    Zhou, G.; Hallstadius, L.; Helmersson, S.; Massih, A.R.; Schrire, D.; Kaellstroem, R.; Wikmark, G.; Hellwig, C.

    2007-07-01

    Some basic attributes of light water reactor fuel performance, determined by measurements, are evaluated. In particular, data on fuel volume swelling, cladding creep/growth, fission product gas release and cladding deformation due to pellet-clad mechanical interaction of rods irradiated in power reactors to rod burnups up to about 70 MWd/kgU are presented and appraised. A thermal fuel matrix swelling caused by fission products shows a linear increase in the fuel volume fraction with burnup up to 70 MWd/kgU with a mean rate of 0.76% per 10 MWd/kgU at a best-estimate level. Cladding hoop strain data due to in-reactor creep as a function of burnup from 15 to 70 MWd/kgU for pressurized water reactor (PWR) rods and from 5 to 50 MWd/kgU for boiling water reactor (BWR) rods are presented. The maximum measured cladding creep-down hoop strain in the considered BWR rods is {epsilon}{sub {theta}} {approx_equal} -0.5% and in the PWR rods {epsilon}{sub {theta}} {approx_equal} -1.25%. Rod growth data on BWR and PWR rods as a function of burnup are presented and discussed. Rod internal free volume data, measured and calculated as a function of burnup, are presented. Recent high burnup (52-70 MWd/kgU) fission product gas release data obtained by destructive methods are evaluated with the STAV7 computer code. Finally, slow power ramp experiments conducted at the Studsvik R2 reactor are simulated with the STAV7 code and it is observed that by accounting the contribution of fuel thermal gaseous swelling, the code describes the clad diameter increase due to pellet-clad mechanical interaction under the power bump satisfactorily. (authors)

  8. FASTGRASS implementation in BISON and Fission gas behavior characterization in UO2 and connection to validating MARMOT

    SciTech Connect (OSTI)

    Yun, Di; Mo, Kun; Ye, Bei; Jamison, Laura M.; Miao, Yinbin; Lian, Jie; Yao, Tiankei

    2015-09-30

    This activity is supported by the US Nuclear Energy Advanced Modeling and Simulation (NEAMS) Fuels Product Line (FPL). Two major accomplishments in FY 15 are summarized in this report: (1) implementation of the FASTGRASS module in the BISON code; and (2) a Xe implantation experiment for large-grained UO2. Both BISON AND MARMOT codes have been developed by Idaho National Laboratory (INL) to enable next generation fuel performance modeling capability as part of the NEAMS Program FPL. To contribute to the development of the Moose-Bison-Marmot (MBM) code suite, we have implemented the FASTGRASS fission gas model as a module in the BISON code. Based on rate theory formulations, the coupled FASTGRASS module in BISON is capable of modeling LWR oxide fuel fission gas behavior and fission gas release. In addition, we conducted a Xe implantation experiment at the Argonne Tandem Linac Accelerator System (ATLAS) in order to produce the needed UO2 samples with desired bubble morphology. With these samples, further experiments to study the fission gas diffusivity are planned to provide validation data for the Fission Gas Release Model in MARMOT codes.

  9. Laser Intertial Fusion Energy: Neutronic Design Aspects of a Hybrid Fusion-Fission Nuclear Energy System

    SciTech Connect (OSTI)

    Kramer, K

    2010-04-08

    This study investigates the neutronics design aspects of a hybrid fusion-fission energy system called the Laser Fusion-Fission Hybrid (LFFH). A LFFH combines current Laser Inertial Confinement fusion technology with that of advanced fission reactor technology to produce a system that eliminates many of the negative aspects of pure fusion or pure fission systems. When examining the LFFH energy mission, a significant portion of the United States and world energy production could be supplied by LFFH plants. The LFFH engine described utilizes a central fusion chamber surrounded by multiple layers of multiplying and moderating media. These layers, or blankets, include coolant plenums, a beryllium (Be) multiplier layer, a fertile fission blanket and a graphite-pebble reflector. Each layer is separated by perforated oxide dispersion strengthened (ODS) ferritic steel walls. The central fusion chamber is surrounded by an ODS ferritic steel first wall. The first wall is coated with 250-500 {micro}m of tungsten to mitigate x-ray damage. The first wall is cooled by Li{sub 17}Pb{sub 83} eutectic, chosen for its neutron multiplication and good heat transfer properties. The {sub 17}Pb{sub 83} flows in a jacket around the first wall to an extraction plenum. The main coolant injection plenum is immediately behind the Li{sub 17}Pb{sub 83}, separated from the Li{sub 17}Pb{sub 83} by a solid ODS wall. This main system coolant is the molten salt flibe (2LiF-BeF{sub 2}), chosen for beneficial neutronics and heat transfer properties. The use of flibe enables both fusion fuel production (tritium) and neutron moderation and multiplication for the fission blanket. A Be pebble (1 cm diameter) multiplier layer surrounds the coolant injection plenum and the coolant flows radially through perforated walls across the bed. Outside the Be layer, a fission fuel layer comprised of depleted uranium contained in Tristructural-isotropic (TRISO) fuel particles having a packing fraction of 20% in 2 cm diameter fuel pebbles. The fission blanket is cooled by the same radial flibe flow that travels through perforated ODS walls to the reflector blanket. This reflector blanket is 75 cm thick comprised of 2 cm diameter graphite pebbles cooled by flibe. The flibe extraction plenum surrounds the reflector bed. Detailed neutronics designs studies are performed to arrive at the described design. The LFFH engine thermal power is controlled using a technique of adjusting the {sup 6}Li/{sup 7}Li enrichment in the primary and secondary coolants. The enrichment adjusts system thermal power in the design by increasing tritium production while reducing fission. To perform the simulations and design of the LFFH engine, a new software program named LFFH Nuclear Control (LNC) was developed in C++ to extend the functionality of existing neutron transport and depletion software programs. Neutron transport calculations are performed with MCNP5. Depletion calculations are performed using Monteburns 2.0, which utilizes ORIGEN 2.0 and MCNP5 to perform a burnup calculation. LNC supports many design parameters and is capable of performing a full 3D system simulation from initial startup to full burnup. It is able to iteratively search for coolant {sup 6}Li enrichments and resulting material compositions that meet user defined performance criteria. LNC is utilized throughout this study for time dependent simulation of the LFFH engine. Two additional methods were developed to improve the computation efficiency of LNC calculations. These methods, termed adaptive time stepping and adaptive mesh refinement were incorporated into a separate stand alone C++ library name the Adaptive Burnup Library (ABL). The ABL allows for other client codes to call and utilize its functionality. Adaptive time stepping is useful for automatically maximizing the size of the depletion time step while maintaining a desired level of accuracy. Adaptive meshing allows for analysis of fixed fuel configurations that would normally require a computationally burdensome number of depletion zones. Alternatively, Adaptive M

  10. The fiftieth anniversary of the first public announcement of the successful test of fission: Proceedings

    SciTech Connect (OSTI)

    Not Available

    1989-12-31

    This report contains comments and discussions on the history of fission. The following people comments and lectures are discussed in this report: Remarks and introduction of Maxine F. Singer; president`s message, Maxine F. Singer; introduction of Stephen Joel Trachtenberg; President`s message, Stephen Joel Trachtenberg; introduction of Frederick Seitz; lecture: ``Nuclear Science: Promises and Perceptions, `` Frederick Seitz; introduction of K. Alex Mueller; lecture: ``High Temperature Ferroelectricity and Superconductivity,`` introduction of Edward Teller; and lecture: ``Toward a More Secure World,`` Edward Teller.

  11. Fusion-fission hybrid as an alternative to the fast breeder reactor

    SciTech Connect (OSTI)

    Barrett, R.J.; Hardie, R.W.

    1980-09-01

    This report compares the fusion-fission hybrid on the plutonium cycle with the classical fast breeder reactor (FBR) cycle as a long-term nuclear energy source. For the purpose of comparison, the current light-water reactor once-through (LWR-OT) cycle was also analyzed. The methods and models used in this study were developed for use in a comparative analysis of conventional nuclear fuel cycles. Assessment areas considered in this study include economics, energy balance, proliferation resistance, technological status, public safety, and commercial viability. In every case the characteristics of all fuel cycle facilities were accounted for, rather than just those of the reactor.

  12. Fission theory of binary stars. III. The formulation of the bifurcation problem

    SciTech Connect (OSTI)

    Lebovitz, N.R.

    1983-12-01

    A family of compressible Riemann ellipsoids is taken as the known, unperturbed solution of the equations governing secular evolution of an inviscid fluid mass. The problem of the evolution of figures that depart slightly from the ellipsoidal family is discussed in perturbation form, with special attention to the bifurcation of a nonellipsoidal family from a critical Riemann ellipsoid. The similarities to and differences from the classical fission theory of incompressible liquids are discussed, as are physical assumptions and mathematical techniques needed in treating the present problem.

  13. Neutronics of accelerator-driven subcritical fission for burning transuranics in used nuclear fuel

    SciTech Connect (OSTI)

    Sattarov, A.; Assadi, S.; Badgley, K.; Baty, A.; Comeaux, J.; Gerity, J.; Kellams, J.; Mcintyre, P.; Pogue, N.; Sooby, E.; Tsvetkov, P.; Rosaire, G.; Mann, T.

    2013-04-19

    We report the development of a conceptual design for accelerator-driven subcritical fission in a molten salt core (ADSMS). ADSMS is capable of destroying all of the transuranics at the same rate and proportion as they are produced in a conventional nuclear power plant. The ADSMS core is fueled solely by transuranics extracted from used nuclear fuel and reduces its radiotoxicity by a factor 10,000. ADSMS offers a way to close the nuclear fuel cycle so that the full energy potential in the fertile fuels uranium and thorium can be recovered.

  14. Fission product source terms for the LWR loss-of-coolant accident

    SciTech Connect (OSTI)

    Lorenz, R.A.; Collins, J.L.; Malinauskas, A.P.

    1980-07-01

    Models for cesium and iodine release from light-water reactor (LWR) fuel rods failed in steam were formulated based on experimental fission product release data from several types of failed LWR fuel rods. The models were applied to a pressurized water reactor (PWR) undergoing a hypothetical loss-of-coolant accident (LOCA) temperature transient. Calculated total iodine and cesium releases from the fuel rods were 0.053 and 0.025% of the total reactor inventories of these elements, respectively, with most of the release occurring at the time of rupture. These values are approximately two orders of magnitude less than releases used in WASH-1400, the Reactor Safety Study.

  15. Most Viewed Documents - Fission and Nuclear Technologies | OSTI, US Dept of

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Energy, Office of Scientific and Technical Information - Fission and Nuclear Technologies Metals design handbook Betts, W.S. (1988) Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. () Graphite design handbook Ho, F.H. (1988) Motor-operated valve (MOV) actuator motor and gearbox testing DeWall, K.; Watkins, J.C.; Bramwell, D. [Lockheed Idaho Technologies Co., Idaho Falls, ID (United States)]

  16. Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology Plenary IV: Advances in Bioenergy Feedstocks-From Field to Fuel Addressing Biomass Supply Chain Challenges With AFEX(tm) Technology Allen Julian, Chief Business Officer, MBI PDF icon julian_biomass_2014.pdf More Documents & Publications 2015 Peer Review Presentations-Biochemical Conversion Process Design and Economics for Biochemical

  17. Engaging Supply Chains in Energy Management | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Engaging Supply Chains in Energy Management Engaging Supply Chains in Energy Management Featuring presenters from PepsiCo and EUISSICA, this presentation covers ways of engaging industrial suppliers involved in energy management. PDF icon Engaging Supply Chains in Energy Management (April 10, 2012) PDF icon Questions & Answers More Documents & Publications Energy Management and Financing From Shop Floor to Top Floor: Best Business Practices in Energy Efficiency CHP SYSTEM AT FOOD

  18. Photovoltaic Supply Chain and Cross-Cutting Technologies Round 1 |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Technology to Market » Photovoltaic Supply Chain and Cross-Cutting Technologies Round 1 Photovoltaic Supply Chain and Cross-Cutting Technologies Round 1 On June 11, 2009, DOE announced the first round of Photovoltaic (PV) Supply Chain and Cross-Cutting Technologies awardees. The funded projects target manufacturing and product cost reduction with the potential to have a near-term impact on a substantial segment of the PV industry. General Electric Global Research

  19. Better Plants Supply Chain Pilot - Overview | Department of Energy

    Office of Environmental Management (EM)

    Supply Chain Pilot - Overview Better Plants Supply Chain Pilot - Overview An Industrial Assessment Center (IAC) student examines pumps at an industrial facility. Photo courtesy of the San Francisco State University IAC. Around 40% to 60% of a manufacturing company's energy and carbon footprint can reside upstream in its supply chain-from raw materials, transport, and packaging to manufacturing processes-but this number can be as high as 80% for some sectors.[1] Manufacturing companies that

  20. Energy Department Announces $2 Million to Develop Supply Chain,

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Manufacturing Competitiveness Analysis for Hydrogen and Fuel Cell Technologies | Department of Energy $2 Million to Develop Supply Chain, Manufacturing Competitiveness Analysis for Hydrogen and Fuel Cell Technologies Energy Department Announces $2 Million to Develop Supply Chain, Manufacturing Competitiveness Analysis for Hydrogen and Fuel Cell Technologies May 21, 2014 - 3:05pm Addthis The Energy Department today announced up to $2 million to develop the domestic supply chain for hydrogen

  1. Method for conducting exothermic reactions

    DOE Patents [OSTI]

    Smith, Jr., Lawrence (Bellaire, TX); Hearn, Dennis (Houston, TX); Jones, Jr., Edward M. (Friendswood, TX)

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  2. Method for conducting exothermic reactions

    DOE Patents [OSTI]

    Smith, L. Jr.; Hearn, D.; Jones, E.M. Jr.

    1993-01-05

    A liquid phase process for oligomerization of C[sub 4] and C[sub 5] isoolefins or the etherification thereof with C[sub 1] to C[sub 6] alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120 to 300 F. wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  3. Solar-thermal reaction processing

    DOE Patents [OSTI]

    Weimer, Alan W; Dahl, Jaimee K; Lewandowski, Allan A; Bingham, Carl; Raska Buechler, Karen J; Grothe, Willy

    2014-03-18

    In an embodiment, a method of conducting a high temperature chemical reaction that produces hydrogen or synthesis gas is described. The high temperature chemical reaction is conducted in a reactor having at least two reactor shells, including an inner shell and an outer shell. Heat absorbing particles are included in a gas stream flowing in the inner shell. The reactor is heated at least in part by a source of concentrated sunlight. The inner shell is heated by the concentrated sunlight. The inner shell re-radiates from the inner wall and heats the heat absorbing particles in the gas stream flowing through the inner shell, and heat transfers from the heat absorbing particles to the first gas stream, thereby heating the reactants in the gas stream to a sufficiently high temperature so that the first gas stream undergoes the desired reaction(s), thereby producing hydrogen or synthesis gas in the gas stream.

  4. Rouse mode analysis of chain relaxation in homopolymer melts

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kalathi, Jagannathan T.; Kumar, Sanat K.; Rubinstein, Michael; Grest, Gary S.

    2014-09-15

    We use molecular dynamics simulations of the Kremer–Grest (KG) bead–spring model of polymer chains of length between 10 and 500, and a closely related analogue that allows for chain crossing, to clearly delineate the effects of entanglements on the length-scale-dependent chain relaxation in polymer melts. We analyze the resulting trajectories using the Rouse modes of the chains and find that entanglements strongly affect these modes. The relaxation rates of the chains show two limiting effective monomeric frictions, with the local modes experiencing much lower effective friction than the longer modes. The monomeric relaxation rates of longer modes vary approximately inverselymore » with chain length due to kinetic confinement effects. The time-dependent relaxation of Rouse modes has a stretched exponential character with a minimum of stretching exponent in the vicinity of the entanglement chain length. None of these trends are found in models that allow for chain crossing. As a result, these facts, in combination, argue for the confined motion of chains for time scales between the entanglement time and their ultimate free diffusion.« less

  5. Sr. Business Analyst - Supply Chain Mgmt. (Term Position) | Princeton...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Supply Chain Mgmt. (Term Position) Department: Business Operations Supervisor(s): Jaclyn Pursell Staff: AM 5 Requisition Number: 1500993 Princeton Plasma Physics Lab (PPPL) is...

  6. Microsoft Word - BP supply chain overview - draft v2.docx

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    http:energy.goveereamobetter-plant Supply Chain Initiative Overview BETTER BUILDINGS, ... by DOE, which track the energy performance improvements and cost savings ...

  7. Remarkable Effect of Molecular Architecture on Chain Exchange...

    Office of Scientific and Technical Information (OSTI)

    Remarkable Effect of Molecular Architecture on Chain Exchange in Triblock Copolymer Micelles Citation Details In-Document Search Title: Remarkable Effect of Molecular Architecture...

  8. Gold Nanoparticles Self-Similar Chain Structure Organized by...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Gold Nanoparticles Self-Similar Chain Structure Organized by DNA Origami Authors: Ding, B., Deng, Z., Yan, H., Cabrini, S., Zukerman, R., and Boker, J. Title: Gold Nanoparticles...

  9. NNSA Contract Reform in Action: Supply Chain Management Center...

    National Nuclear Security Administration (NNSA)

    Contract Reform in Action: Supply Chain Management Center | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile...

  10. Analysis of fission gas release measurements using the COMETHE IIIJ and FCODE-Alpha computer codes. Final report. [PWR; BWR

    SciTech Connect (OSTI)

    Leppert, G.; Rayes, L.; Rumble, E.; Stuart, R.

    1981-07-01

    Fission gas release predictions from FCODE-Alpha and COMETHE IIIJ were compared with experimental data from a representative group of light water reactor (LWR) fuel rods and with each other. In the first phase of the study, standard versions of the codes obtained from the Electric Power Software Center were compared with data from 36 rods. A modified version of COMETHE was used in the second phase of the study, which compared measurements from some of the same rods studied in the first phase, as well as with an additional 27 rods. Fission gas release predictions from both codes show substantial deviation from experimental measurements, and additional well-qualified data from LWR's is needed for comparison. Unpressurized rods experience significant degradation in heat transfer across the fuel-to-cladding gap as the lower thermal conductivity fission gases mix with the helium.

  11. The spectral irradiance traceability chain at PTB

    SciTech Connect (OSTI)

    Sperfeld, P.; Pape, S.; Nevas, S.

    2013-05-10

    Spectral irradiance is a fundamental radiometric unit. Its application to measurement results requires qualified traceability to basic units of the international system of units (Systeme international d'unites, SI). The Physikalisch-Technische Bundesanstalt (PTB) is amongst other national metrological institutes (NMIs) responsible for the realization, maintenance and dissemination of various radiometric and photometric units based on and traceable to national standards. The unit of spectral irradiance is realized and represented by a blackbody-radiator as the national primary standard of the PTB. Based on Planck's radiation law, the irradiance is calculated and realized for any wavelength taking into account the exact knowledge of the radiation temperature and the geometrical parameters. Using a double-monochromator-based spectroradiometer system, secondary standard lamps can be calibrated by direct comparison to the blackbody-radiator (substitution method). These secondary standard lamps are then used at the PTB to calibrate standard lamps of customers. The customers themselves use these so-called transfer standards to calibrate their working standard lamps. These working standards are then used to calibrate own spectroradiometers or sources. This rather complex calibration chain is a common procedural method that for the customers generally leads to satisfying measurement results on site. Nevertheless, the standard lamps in use have to fulfill highest requirements concerning stability and reproducibility. Only this allows achieving comparably low transfer measurement uncertainties, which occur at each calibration step. Thus, the PTB is constantly investigating the improvement and further development of transfer standards and measurement methods for various spectral regions. The realization and dissemination of the spectral irradiance using the blackbody-radiator at the PTB is accomplished with worldwide approved minimized measurement uncertainties confirmed by international intercomparisons among NMIs. Ultimately, the spectral irradiance can be realized with expanded measurement uncertainties of far less than 1 % over a wide spectral range. Thus, for customers with high demands on low measurement uncertainties, it is possible to calibrate their working standards directly against the blackbody-radiator, taking into account the higher necessary effort. In special cases it is possible to calibrate the customer's spectroradiometric facilities directly in front of the blackbody-radiator. In the context of the European Metrology Research Project Traceability for surface spectral solar ultraviolet radiation, the traceability chain will be improved and adapted.

  12. Electron microscopic evaluation and fission product identification of irradiated TRISO coated particles from the AGR-1 experiment: A preliminary Study

    SciTech Connect (OSTI)

    I J van Rooyen; D E Janney; B D Miller; J L Riesterer; P A Demkowicz

    2012-10-01

    ABSTRACT Post-irradiation examination of coated particle fuel from the AGR-1 experiment is in progress at Idaho National Laboratory and Oak Ridge National Laboratory. In this presentation a brief summary of results from characterization of microstructures in the coating layers of selected irradiated fuel particles with burnup of 11.3% and 19.3% FIMA will be given. The main objective of the characterization were to study irradiation effects, fuel kernel porosity, layer debonding, layer degradation or corrosion, fission-product precipitation, grain sizes, and transport of fission products from the kernels across the TRISO layers. Characterization techniques such as scanning electron microscopy, transmission electron microscopy, energy dispersive spectroscopy, and wavelength dispersive spectroscopy were used. A new approach to microscopic quantification of fission-product precipitates is also briefly demonstrated. The characterization emphasized fission-product precipitates in the SiC-IPyC interface, SiC layer and the fuel-buffer interlayer, and provided significant new insights into mechanisms of fission-product transport. Although Pd-rich precipitates were identified at the SiC-IPyC interlayer, no significant SiC-layer thinning was observed for the particles investigated. Characterization of these precipitates highlighted the difficulty of measuring low concentration Ag in precipitates with significantly higher concentrations of contain Pd and U. Different approaches to resolving this problem are discussed. Possible microstructural differences between particles with high and low releases of Ag particles are also briefly discussed, and an initial hypothesis is provided to explain fission-product precipitate compositions and locations. No SiC phase transformations or debonding of the SiC-IPyC interlayer as a result of irradiation were observed. Lessons learned from the post-irradiation examination are described and future actions are recommended.

  13. Extensibility of the fission surface power (FSP) system from the moon to Mars

    SciTech Connect (OSTI)

    Poston, David Irvin

    2011-01-28

    Fission reactors have great near-term potential to power human and robotic missions/outposts on the surface of the Moon and Mars (and potentially other planets, moons, and asteroids). The ability to provide a power-rich environment that is independent of solar intensity, nights, dust storms, etc., is of significant (perhaps enabling) importance to the further expansion of humans into our solar system. NASA's Reference Fission Surface Power (FSP) System is a 40 kWe system that has been primarily designed for lunar applications. This paper examines the extensibility of the FSP design and technology for potential missions on Mars. Possible impacts include the effects of changes in heat sink, gravity, day-night cycles, mission transit time, communication delay, and the chemistry of the regolith and atmosphere. One of the biggest impacts might be differences in the potential utilization of in-situ materials for shielding. Another major factor is that different missions will likely require different performance requirements, e.g. power, lifetime and mass. This paper concludes that the environmental differences between potential mission locations will not require significant changes in design and technologies, unless performance requirements for a specific mission are substantially different than those adopted for the FSP The primary basis for this conclusion is that the FSP has been designed with robust materials and design margins.

  14. Hybrid Technique in SCALE for Fission Source Convergence Applied to Used Nuclear Fuel Analysis

    SciTech Connect (OSTI)

    Ibrahim, Ahmad M; Peplow, Douglas E.; Bekar, Kursat B; Celik, Cihangir; Scaglione, John M; Ilas, Dan; Wagner, John C

    2013-01-01

    The new hybrid SOURCE ConveRgence accelERator (SOURCERER) sequence in SCALE deterministically computes a fission distribution and uses it as the starting source in a Monte Carlo eigenvalue criticality calculation. In addition to taking the guesswork out of defining an appropriate, problem-dependent starting source, the more accurate starting source provided by the deterministic calculation decreases the probability of producing inaccurate tally estimates associated with undersampling problems caused by inadequate source convergence. Furthermore, SOURCERER can increase the efficiency of the overall simulation by decreasing the number of cycles that has to be skipped before the keff accumulation. SOURCERER was applied to a representative example for a used nuclear fuel cask utilized at the Maine Yankee storage site {Scaglione and Ilas}. Because of the time constraints of the Used Fuel Research, Development, and Demonstration project, it was found that using more than 30,000 neutrons per cycle will lead to inaccurate Monte Carlo calculation of keff due to the inevitable decrease in the number of skipped and active cycles used with this problem. For a fixed uncertainty objective and by using 30,000 neutron per cycle, the use of SOURCERER increased the efficiency of the keff calculation by 60%compared to a Monte Carlo calculation that used a starting source distributed uniformly in fissionable regions, even with the inclusion of the extra computational time required by the deterministic calculation. Additionally, the use of SOURCERER increased the reliability of keff calculation using any number of skipped cycles below 350.

  15. Dynamical interpretation of average fission-fragment kinetic energy systematics and nuclear scission

    SciTech Connect (OSTI)

    Nadtochy, P.N. [GSI, Plankstrasse 1, D-64291 Darmstadt (Germany); Omsk State University, Department of Theoretical Physics, Mira Prospect 55-A, RU-644077 Omsk (Russian Federation); Adeev, G.D. [Omsk State University, Department of Theoretical Physics, Mira Prospect 55-A, RU-644077 Omsk (Russian Federation)

    2005-11-01

    A dynamical interpretation of the well-known systematics for average total kinetic energy of fission fragments over a wide range of the Coulomb parameter (600fission theory--at zero neck radius and at finite neck radius--have been applied in dynamical calculations. Both have resulted in a fairly good description of the dependence of on the Coulomb parameter. The results of dynamical calculations of within three-dimensional Langevin dynamics show that the mean distance between the centers of mass of nascent fragments at the scission configuration increases linearly with the parameter Z{sup 2}/A{sup 1/3}. This distance changes approximately from 2.35R{sub 0} for {sup 119}Xe to 2.6R{sub 0} for {sup 256}Fm. In spite of this increase in mean distance between future fragments at scission, the linear dependence of on the parameter Z{sup 2}/A{sup 1/3} remains approximately valid over a wide range of the Coulomb parameter Z{sup 2}/A{sup 1/3}.

  16. Data summary report for fission product release test HI-1. [PWR; BWR

    SciTech Connect (OSTI)

    Osborne, M.F.; lorenz, R.A.; Travis, J.R.; Webster, C.S.

    1982-12-01

    This first in a series of high-temperature fission product release tests was conducted for 30 min at 1400/sup 0/C, with the release taking place into flowing steam. The fuel specimen was a 20-cm-long section of H.B. Robinson fuel rod, irradiated to 28,000 MWd per metric ton (t). After the test, the Zircaloy cladding of the specimen was almost completely oxidized and was quite fragile. The fission product collection system included a thermal gradient tube (700-150/sup 0/C), filters, heated charcoal, and cooled charcoal. Gamma ray analysis of apparatus components and collectors showed that about 2.83% of the /sup 85/Kr and 1.75% of the /sup 137/Cs were released from the fuel. Activation analysis of leach solutions from these components indicated that 2.04% of the /sup 129/I was released. Other analyses revealed small but significant releases of the radionuclides /sup 125/Sb and /sup 106/Ru, and of the elements Br, Rb, Sr, Zr, Ag, Sn, Te, Ba, and La.

  17. Analysis of fission gas release in LWR fuel using the BISON code

    SciTech Connect (OSTI)

    G. Pastore; J.D. Hales; S.R. Novascone; D.M. Perez; B.W. Spencer; R.L. Williamson

    2013-09-01

    Recent advances in the development of the finite-element based, multidimensional fuel performance code BISON of Idaho National Laboratory are presented. Specifically, the development, implementation and testing of a new model for the analysis of fission gas behavior in LWR-UO2 fuel during irradiation are summarized. While retaining a physics-based description of the relevant mechanisms, the model is characterized by a level of complexity suitable for application to engineering-scale nuclear fuel analysis and consistent with the uncertainties pertaining to some parameters. The treatment includes the fundamental features of fission gas behavior, among which are gas diffusion and precipitation in fuel grains, growth and coalescence of gas bubbles at grain faces, grain growth and grain boundary sweeping effects, thermal, athermal, and transient gas release. The BISON code incorporating the new model is applied to the simulation of irradiation experiments from the OECD/NEA International Fuel Performance Experiments database, also included in the IAEA coordinated research projects FUMEX-II and FUMEX-III. The comparison of the results with the available experimental data at moderate burn-up is presented, pointing out an encouraging predictive accuracy, without any fitting applied to the model parameters.

  18. Fission-track tectonic studies of the Transantarctic Mountains, Beardmore Glacier area

    SciTech Connect (OSTI)

    Fitzgerald, P.G.

    1986-01-01

    The Transantarctic Mountains are a major transcontinental range stretching for some 4000 kilometers, varying from 200-400 kilometers in width, and having elevations up to 4500 meters. The uplift and formation of the Transantarctic Mountains have always been something of an enigma, but recent apatite fission-track analysis is providing important new information not only about their uplift history but also about the implications of that uplift history for the glacial history of Antarctica as a whole. The main field objective of this project was to collect samples for fission-track analysis to determine the timing and rate of uplift of the Transantarctic Mountains and measure relative vertical displacements across faults within the range. Results from southern Victoria Land indicate that uplift of the Transantarctic Mountains was initiated at about 50 million years ago and since that time the mountains have undergone some 5 kilometers of uplift at an average rate of 100 meters per million years. It is important to realize, however, that this is an average rate and may well conceal pulses of faster and slower uplift or even periods of subsidence. The amount of uplift across the mountain range is differential; from the axis of maximum uplift about 30 kilometers inland of the Victoria Land coast, the mountains dip gently westward under the polar ice cap. The study was extended to the Beardmore Glacier area to see whether the uplift history and tectonics varies from that observed in southern Victoria Land.

  19. Position reconstruction in fission fragment detection using the low pressure MWPC technique for the JLab experiment E02-017

    SciTech Connect (OSTI)

    Xi-Yu, Qiu; Tang, Liguang; Margaryan, Amur T.; Jin-Zhang, Xu; Bi-Tao, Hu; Xi-Meng, Chen

    2014-07-01

    When a lambda hyperon was embedded in a nucleus, it can form a hypernucleus. The lifetime and its mass dependence of stable hypernuclei provide information about the weak decay of lambda hyperon inside nuclear medium. This work will introduce the Jefferson Lab experiment (E02-017) which aims to study the lifetime of the heavy hypernuclei using a specially developed fission fragment detection technique, a multi-wire proportional chamber operated under low gas pressure (LPMWPC). Presented here are the method and performance of the reconstruction of fission position on the target foil, the separation of target materials at different regions and the comparison and verification with the Mote Carlo simulation.

  20. Accelerator-driven subcritical fission in molten salt core: Closing the nuclear fuel cycle for green nuclear energy

    SciTech Connect (OSTI)

    McIntyre, Peter; Assadi, Saeed; Badgley, Karie; Baker, William; Comeaux, Justin; Gerity, James; Kellams, Joshua; McInturff, Al; Pogue, Nathaniel; Sattarov, Akhdiyor; Sooby, Elizabeth; Tsvetkov, Pavel; Phongikaroon, Supathorn; Simpson, Michael

    2013-04-19

    A technology for accelerator-driven subcritical fission in a molten salt core (ADSMS) is being developed as a basis for the destruction of the transuranics in used nuclear fuel. The molten salt fuel is a eutectic mixture of NaCl and the chlorides of the transuranics and fission products. The core is driven by proton beams from a strong-focusing cyclotron stack. This approach uniquely provides an intrinsically safe means to drive a core fueled only with transuranics, thereby eliminating competing breeding terms.

  1. Evaluation of the ²³⁹Pu prompt fission neutron spectrum induced by neutrons of 500 keV and associated covariances

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Neudecker, D.; Talou, P.; Kawano, T.; Smith, D. L.; Capote, R.; Rising, M. E.; Kahler, A. C.

    2015-08-01

    We present evaluations of the prompt fission neutron spectrum (PFNS) of ²³⁹Pu induced by 500 keV neutrons, and associated covariances. In a previous evaluation by Talou et al. 2010, surprisingly low evaluated uncertainties were obtained, partly due to simplifying assumptions in the quantification of uncertainties from experiment and model. Therefore, special emphasis is placed here on a thorough uncertainty quantification of experimental data and of the Los Alamos model predicted values entering the evaluation. In addition, the Los Alamos model was extended and an evaluation technique was employed that takes into account the qualitative differences between normalized model predicted valuesmore » and experimental shape data. These improvements lead to changes in the evaluated PFNS and overall larger evaluated uncertainties than in the previous work. However, these evaluated uncertainties are still smaller than those obtained in a statistical analysis using experimental information only, due to strong model correlations. Hence, suggestions to estimate model defect uncertainties are presented, which lead to more reasonable evaluated uncertainties. The calculated keff of selected criticality benchmarks obtained with these new evaluations agree with each other within their uncertainties despite the different approaches to estimate model defect uncertainties. The keff one standard deviations overlap with some of those obtained using ENDF/B-VII.1, albeit their mean values are further away from unity. Spectral indexes for the Jezebel critical assembly calculated with the newly evaluated PFNS agree with the experimental data for selected (n,γ) and (n,f) reactions, and show improvements for high-energy threshold (n,2n) reactions compared to ENDF/B-VII.1.« less

  2. Combustion kinetics and reaction pathways

    SciTech Connect (OSTI)

    Klemm, R.B.; Sutherland, J.W.

    1993-12-01

    This project is focused on the fundamental chemistry of combustion. The overall objectives are to determine rate constants for elementary reactions and to elucidate the pathways of multichannel reactions. A multitechnique approach that features three independent experiments provides unique capabilities in performing reliable kinetic measurements over an exceptionally wide range in temperature, 300 to 2500 K. Recent kinetic work has focused on experimental studies and theoretical calculations of the methane dissociation system (CH{sub 4} + Ar {yields} CH{sub 3} + H + Ar and H + CH{sub 4} {yields} CH{sub 3} + H{sub 2}). Additionally, a discharge flow-photoionization mass spectrometer (DF-PIMS) experiment is used to determine branching fractions for multichannel reactions and to measure ionization thresholds of free radicals. Thus, these photoionization experiments generate data that are relevant to both reaction pathways studies (reaction dynamics) and fundamental thermochemical research. Two distinct advantages of performing PIMS with high intensity, tunable vacuum ultraviolet light at the National Synchrotron Light Source are high detection sensitivity and exceptional selectivity in monitoring radical species.

  3. Radiolabeled dimethyl branched long chain fatty acid for heart imaging

    DOE Patents [OSTI]

    Knapp, Jr., Furn F. (Oak Ridge, TN); Goodman, Mark M. (Knoxville, TN); Kirsch, Gilbert (Woippy, FR)

    1988-08-16

    A radiolabeled long chain fatty acid for heart imaging that has dimethyl branching at one of the carbons of the chain which inhibits the extent to which oxidation can occur. The closer to the carboxyl the branching is positioned, the more limited the oxidation, thereby resulting in prolonged retention of the radiolabeled compound in the heart.

  4. Platinum Monolayer Electrocatalysts for Oxygen Reduction Reaction...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Platinum Monolayer Electrocatalysts for Oxygen Reduction Reaction Platinum Monolayer Electrocatalysts for Oxygen Reduction Reaction Download presentation slides from the June 19,...

  5. Vision 2020. Reaction Engineering Roadmap

    SciTech Connect (OSTI)

    Klipstein, David H.; Robinson, Sharon

    2001-01-01

    The Reaction Engineering Roadmap is a part of an industry- wide effort to create a blueprint of the research and technology milestones that are necessary to achieve longterm industry goals. This report documents the results of a workshop focused on the research needs, technology barriers, and priorities of the chemical industry as they relate to reaction engineering viewed first by industrial use (basic chemicals; specialty chemicals; pharmaceuticals; and polymers) and then by technology segment (reactor system selection, design, and scale-up; chemical mechanism development and property estimation; dealing with catalysis; and new, nonstandard reactor types).

  6. Process and apparatus for recovery of fissionable materials from spent reactor fuel by anodic dissolution

    DOE Patents [OSTI]

    Tomczuk, Zygmunt (Orland Park, IL); Miller, William E. (Naperville, IL); Wolson, Raymond D. (Lockport, IL); Gay, Eddie C. (Park Forest, IL)

    1991-01-01

    An electrochemical process and apparatus for the recovery of uranium and plutonium from spent metal clad fuel pins is disclosed. The process uses secondary reactions between U.sup.+4 cations and elemental uranium at the anode to increase reaction rates and improve anodic efficiency compared to prior art processes. In another embodiment of the process, secondary reactions between Cd.sup.+2 cations and elemental uranium to form uranium cations and elemental cadmium also assists in oxidizing the uranium at the anode.

  7. Comparison of COMETHE-IIIJ and FCODE-BETA fission gas-release predictions with measurements. Final report. [PWR; BWR

    SciTech Connect (OSTI)

    Lee, S.; Rayes, L.; Rumble, E.; Wheeler, D.; Woods, A.

    1983-03-01

    This report describes a comparison of the Fission Product Gas Release (FGR) predictability of two LWR fuel rod modeling codes: COMETHE-IIIJ and FCODE-BETA. The comparison is made using 124 well characterized fuel rods with FGR measurements in the EPRI Fuel Performance Data Base.

  8. SECTION II: HEAVY ION REACTIONS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    REACTIONS Temperature dependence of the isospin distillation in nuclear fragmentation ................................ II-1 D. V. Shetty for the NIMROD Collaboration Midrapidity emission in nuclear fragmentation .................................................................................. II-2 D. V. Shetty for the NIMROD Collaboration Isospin dependence of the <N/Z> in nuclear fragmentation .............................................................. II-3 D. V. Shetty, for the

  9. Gamma-ray Output Spectra from 239 Pu Fission

    SciTech Connect (OSTI)

    Ullmann, John

    2015-05-25

    Gamma-ray multiplicities, individual gamma-ray energy spectra, and total gamma energy spectra following neutron-induced fission of 239Pu were measured using the DANCE detector at Los Alamos. Corrections for detector response were made using a forward-modeling technique based on propagating sets of gamma rays generated from a paramaterized model through a GEANT model of the DANCE array and adjusting the parameters for best fit to the measured spectra. The results for the gamma-ray spectrum and multiplicity are in general agreement with previous results, but the measured total gamma-ray energy is about 10% higher. A dependence of the gamma-ray spectrum on the gamma-ray multplicity was also observed. Global model calculations of the multiplicity and gamma energy distributions are in good agreement with the data, but predict a slightly softer total-energy distribution.

  10. Consideration of Grain Size Distribution in the Diffusion of Fission Gas to Grain Boundaries

    SciTech Connect (OSTI)

    Paul C. Millett; Yongfeng Zhang; Michael R. Tonks; S. B. Biner

    2013-09-01

    We analyze the accumulation of fission gas on grain boundaries in a polycrystalline microstructure with a distribution of grain sizes. The diffusion equation is solved throughout the microstructure to evolve the gas concentration in space and time. Grain boundaries are treated as infinite sinks for the gas concentration, and we monitor the cumulative gas inventory on each grain boundary throughout time. We consider two important cases: first, a uniform initial distribution of gas concentration without gas production (correlating with post-irradiation annealing), and second, a constant gas production rate with no initial gas concentration (correlating with in-reactor conditions). The results show that a single-grain-size model, such as the Booth model, over predicts the gas accumulation on grain boundaries compared with a polycrystal with a grain size distribution. Also, a considerable degree of scatter, or variability, exists in the grain boundary gas accumulation when comparing all of the grain boundaries in the microstructure.

  11. Fuel Performance Experiments and Modeling: Fission Gas Bubble Nucleation and Growth in Alloy Nuclear Fuels

    SciTech Connect (OSTI)

    McDeavitt, Sean; Shao, Lin; Tsvetkov, Pavel; Wirth, Brian; Kennedy, Rory

    2014-04-07

    Advanced fast reactor systems being developed under the DOE's Advanced Fuel Cycle Initiative are designed to destroy TRU isotopes generated in existing and future nuclear energy systems. Over the past 40 years, multiple experiments and demonstrations have been completed using U-Zr, U-Pu-Zr, U-Mo and other metal alloys. As a result, multiple empirical and semi-empirical relationships have been established to develop empirical performance modeling codes. Many mechanistic questions about fission as mobility, bubble coalescience, and gas release have been answered through industrial experience, research, and empirical understanding. The advent of modern computational materials science, however, opens new doors of development such that physics-based multi-scale models may be developed to enable a new generation of predictive fuel performance codes that are not limited by empiricism.

  12. PERCOLATION ON GRAIN BOUNDARY NETWORKS: APPLICATION TO FISSION GAS RELEASE IN NUCLEAR FUELS

    SciTech Connect (OSTI)

    Paul C. Millett

    2012-02-01

    The percolation behavior of grain boundary networks is characterized in two- and three-dimensional lattices with circular macroscale cross-sections that correspond to nuclear fuel elements. The percolation of gas bubbles on grain boundaries, and the subsequent percolation of grain boundary networks is the primary mechanism of fission gas release from nuclear fuels. Both radial cracks and radial gradients in grain boundary property distributions are correlated with the fraction of grain boundaries vented to the free surfaces. Our results show that cracks surprisingly do not significantly increase the percolation of uniform grain boundary networks. However, for networks with radial gradients in boundary properties, the cracks can considerably raise the vented grain boundary content.

  13. Modeling the influence of bubble pressure on grain boundary separation and fission gas release

    SciTech Connect (OSTI)

    Pritam Chakraborty; Michael R. Tonks; Giovanni Pastore

    2014-09-01

    Grain boundary (GB) separation as a mechanism for fission gas release (FGR), complementary to gas bubble interlinkage, has been experimentally observed in irradiated light water reactor fuel. However there has been limited effort to develop physics-based models incorporating this mechanism for the analysis of FGR. In this work, a computational study is carried out to investigate GB separation in UO2 fuel under the effect of gas bubble pressure and hydrostatic stress. A non-dimensional stress intensity factor formula is obtained through 2D axisymmetric analyses considering lenticular bubbles and Mode-I crack growth. The obtained functional form can be used in higher length-scale models to estimate the contribution of GB separation to FGR.

  14. IMPACT OF FISSION PRODUCTS IMPURITY ON THE PLUTONIUM CONTENT IN PWR MOX FUELS

    SciTech Connect (OSTI)

    Gilles Youinou; Andrea Alfonsi

    2012-03-01

    This report presents the results of a neutronics analysis done in response to the charter IFCA-SAT-2 entitled 'Fuel impurity physics calculations'. This charter specifies that the separation of the fission products (FP) during the reprocessing of UOX spent nuclear fuel assemblies (UOX SNF) is not perfect and that, consequently, a certain amount of FP goes into the Pu stream used to fabricate PWR MOX fuel assemblies. Only non-gaseous FP have been considered (see the list of 176 isotopes considered in the calculations in Appendix 1). This mixture of Pu and FP is called PuFP. Note that, in this preliminary analysis, the FP losses are considered element-independent, i.e., for example, 1% of FP losses mean that 1% of all non-gaseous FP leak into the Pu stream.

  15. Method and device for fabricating dispersion fuel comprising fission product collection spaces

    DOE Patents [OSTI]

    Shaber, Eric L; Fielding, Randall S

    2015-05-05

    A method of fabricating a nuclear fuel comprising a fissile material, one or more hollow microballoons, a phenolic resin, and metal matrix. The fissile material, phenolic resin and the one or more hollow microballoons are combined. The combined fissile material, phenolic resin and the hollow microballoons are heated sufficiently to form at least some fissile material carbides creating a nuclear fuel particle. The resulting nuclear fuel particle comprises one or more fission product collection spaces. In a preferred embodiment, the fissile material, phenolic resin and the one or more hollow microballoons are combined by forming the fissile material into microspheres. The fissile material microspheres are then overcoated with the phenolic resin and microballoon. In another preferred embodiment, the fissile material, phenolic resin and the one or more hollow microballoons are combined by overcoating the microballoon with the fissile material, and phenolic resin.

  16. Transport-reaction model for defect and carrier behavior within displacement cascades in gallium arsenide

    SciTech Connect (OSTI)

    Wampler, William R.; Myers, Samuel M.

    2014-02-01

    A model is presented for recombination of charge carriers at displacement damage in gallium arsenide, which includes clustering of the defects in atomic displacement cascades produced by neutron or ion irradiation. The carrier recombination model is based on an atomistic description of capture and emission of carriers by the defects with time evolution resulting from the migration and reaction of the defects. The physics and equations on which the model is based are presented, along with details of the numerical methods used for their solution. The model uses a continuum description of diffusion, field-drift and reaction of carriers and defects within a representative spherically symmetric cluster. The initial radial defect profiles within the cluster were chosen through pair-correlation-function analysis of the spatial distribution of defects obtained from the binary-collision code MARLOWE, using recoil energies for fission neutrons. Charging of the defects can produce high electric fields within the cluster which may influence transport and reaction of carriers and defects, and which may enhance carrier recombination through band-to-trap tunneling. Properties of the defects are discussed and values for their parameters are given, many of which were obtained from density functional theory. The model provides a basis for predicting the transient response of III-V heterojunction bipolar transistors to pulsed neutron irradiation.

  17. Optimizing moderation of He-3 neutron detectors for shielded fission sources

    SciTech Connect (OSTI)

    Rees, Lawrence B. [Brigham Young University, Provo, UT (United States); Czirr, J. Bart [Brigham Young University, Provo, UT (United States)

    2012-11-01

    Abstract: The response of 3-He neutron detectors is highly dependent on the amount of moderator incorporated into the detector system. If there is too little moderation, neutrons will not react with the 3-He. If there is too much moderation, neutrons will not reach the 3-He. In applications for portal or border monitors where 3He detectors are used to interdict illicit Importation of plutonium, the fission source is always shielded to some extent. Since the energy distribution of neutrons emitted from the source depends on the amount and type of shielding present, the optimum placement of moderating material around 3-He tubes is a function of shielding. In this paper, we use Monte Carlo techniques to model the response of 3-He tubes placed in polyethylene boxes for moderation. To model the shielded fission neutron source, we use a 252-Cf source placed in the center of spheres of water of varying radius. Detector efficiency as a function of box geometry and shielding are explored. We find that increasing the amount of moderator behind and to the sides of the detector generally improves the detector response, but that benefits are limited if the thickness of the polyethylene moderator is greater than about 5-7 cm. The thickness of the moderator in front of the 3He tubes, however, is very important. For bare sources, about 5-6 cm of moderator is optimum, but as the shielding increases, the optimum thickness of this moderator decreases to 0-1 cm. A two-tube box with a moderator thickness of 5 cm in front of the first tube and a thickness of 1 cm in front of the second tube is proposed to improve the detector's sensitivity to lower-energy neutrons.

  18. Optimizing moderation of He-3 neutron detectors for shielded fission sources

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Rees, Lawrence B.; Czirr, J. Bart

    2012-07-10

    Abstract: The response of 3-He neutron detectors is highly dependent on the amount of moderator incorporated into the detector system. If there is too little moderation, neutrons will not react with the 3-He. If there is too much moderation, neutrons will not reach the 3-He. In applications for portal or border monitors where 3He detectors are used to interdict illicit Importation of plutonium, the fission source is always shielded to some extent. Since the energy distribution of neutrons emitted from the source depends on the amount and type of shielding present, the optimum placement of moderating material around 3-He tubesmore » is a function of shielding. In this paper, we use Monte Carlo techniques to model the response of 3-He tubes placed in polyethylene boxes for moderation. To model the shielded fission neutron source, we use a 252-Cf source placed in the center of spheres of water of varying radius. Detector efficiency as a function of box geometry and shielding are explored. We find that increasing the amount of moderator behind and to the sides of the detector generally improves the detector response, but that benefits are limited if the thickness of the polyethylene moderator is greater than about 5-7 cm. The thickness of the moderator in front of the 3He tubes, however, is very important. For bare sources, about 5-6 cm of moderator is optimum, but as the shielding increases, the optimum thickness of this moderator decreases to 0-1 cm. A two-tube box with a moderator thickness of 5 cm in front of the first tube and a thickness of 1 cm in front of the second tube is proposed to improve the detector's sensitivity to lower-energy neutrons.« less

  19. Studies of heavy ion reactions and transuranic nuclei. Progress report, August 1, 1979-July 31, 1980. [Univ. of Rochester, New York, 8/1/79-7/31/80

    SciTech Connect (OSTI)

    Huizenga, J.R.

    1980-07-01

    The study of heavy-ion reaction mechanisms at the SuperHILAC and LAMPF is reported. Preprints of five articles and manuscripts of four recent conference papers are given, along with complete citations of publications and a list of personnel. Significant work was performed in the following areas: the bombarding energy dependence of the /sup 209/Bi + /sup 136/Xe reaction; the fragment yields for specific Z and A for projectile-like fragments produced in the reaction of 8.3-MeV/u /sup 56/Fe ions with targets of /sup 56/Fe, /sup 165/Ho, /sup 209/Bi, and /sup 238/U; and time distributions of fragments from delayed fission after muon capture for muonic /sup 235/U, /sup 238/U, /sup 237/Np, /sup 239/Pu, and /sup 242/Pu. (RWR)

  20. Effects of T-odd asymmetry of the emission of light charged particles and photons during fission of heavy nuclei by polarized neutrons

    SciTech Connect (OSTI)

    Gagarskii, A. M.; Guseva, I. S.; Goennenwein, F.; Kopach, Yu. N.; Mutterer, M.; Kuz'mina, T. E.; Petrov, G. A.; Tyurin, G.; Nesvizhevsky, V.

    2011-12-15

    The new physical effects of T-odd asymmetry of the emission of light charged particles (LCPs) during the ternary fission of some heavy nuclei by cold polarized neutrons have been experimentally studied. The coefficients of triple scalar and vector correlation of the pulses of light particles and fission fragments (TRI effect) and the fivefold correlation of the same vectors (ROT effect) have been measured. These effects are believed to be caused by the rotation of polarized fissioning system around its polarization direction. The treatment of the experimental data for LCPs in the framework of this hypothesis leads to a good agreement between the calculation results and experimental data. The calculated value of the angle of rotation of the fission axis in the ternary fission of the polarized fissioning {sup 236}U* compound nucleus was used to process the results of measuring the ROT effect for {gamma} photons from binary-fission fragments of the same nucleus. A satisfactory description of these experimental data is obtained which serves a convincing confirmation of the rotation hypothesis.

  1. T-odd angular correlations in the emission of prompt gamma rays and neutrons in nuclear fission induced by polarized neutrons

    SciTech Connect (OSTI)

    Danilyan, G. V.; Klenke, J.; Krakhotin, V. A.; Kopach, Yu. N.; Novitsky, V. V.; Pavlov, V. S.; Shatalov, P. B.

    2011-05-15

    Study of the T-odd three-vector correlation in the emission of prompt neutrons from {sup 235}U fission by polarized cold neutrons has been continued at the facility MEPHISTO of the FRM II reactor (Technical University of Munich). The sought correlation was not found within experimental error of 2.3 Multiplication-Sign 10{sup -5}. The upper limit for the asymmetry coefficient has been set to vertical bar D{sub n} vertical bar < 6 Multiplication-Sign 10{sup -5} at 99% confidence level, whereas for ternary fission correlation coefficient D{sub {alpha}} = (170{+-}20) Multiplication-Sign 10{sup -5}. This limit casts doubt on a model that explains the three-vector correlation in ternary fission by the Coriolis mechanism. At the same time, five-vector correlation in the emission of prompt fission neutrons has been measured, which describes the rotation of the fissioning nucleus at the moment it breaks (ROT effect). At the angle 22.5 Degree-Sign to the fission axis, the correlation coefficient was found to be (1.57 {+-} 0.20) Multiplication-Sign 10{sup -4}, while at the angle of 67.5 Degree-Sign it is zero within the experimental uncertainty. The existence of ROT effect in the emission of prompt fission neutrons can be explained by the anisotropy of neutron emission in the rest frame of the fragment (fission fragments are aligned with respect to the axis of deformation of the fissioning nucleus), similar to the mechanism of ROT effect in the emission of prompt {gamma}-rays.

  2. A porous metal-organic framework with helical chain building...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    porous metal-organic framework with helical chain building units exhibiting facile transition from micro- to meso-porosity Previous Next List Jinhee Park , Jian-Rong Li , E....

  3. Energy Department Announces $2 Million to Develop Supply Chain...

    Broader source: Energy.gov (indexed) [DOE]

    develop the domestic supply chain for hydrogen and fuel cell technologies and study the competitiveness of U.S. hydrogen and fuel cell system and component manufacturing. As a part...

  4. Structural and optical properties of self-assembled chains of...

    Office of Scientific and Technical Information (OSTI)

    characteristics. Predominant face-to-face assembly of large NCs coated with short polymer ligands led to a larger volume of hot spots in the chains, a nearly uniform E-field...

  5. Primary system fission product release and transport: A state-of-the-art report to the committee on the safety of nuclear installations

    SciTech Connect (OSTI)

    Wright, A.L.

    1994-06-01

    This report presents a summary of the status of research activities associated with fission product behavior (release and transport) under severe accident conditions within the primary systems of water-moderated and water-cooled nuclear reactors. For each of the areas of fission product release and fission product transport, the report summarizes relevant information on important phenomena, major experiments performed, relevant computer models and codes, comparisons of computer code calculations with experimental results, and general conclusions on the overall state of the art. Finally, the report provides an assessment of the overall importance and knowledge of primary system release and transport phenomena and presents major conclusions on the state of the art.

  6. U.S. Offshore Wind Manufacturing and Supply Chain Development

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    U.S. Offshore Wind Manufacturing and Supply Chain Development Prepared for: U.S. Department of Energy Navigant Consulting, Inc. 77 Bedford Street Suite 400 Burlington, MA 01803-5154 781.270.8314 www.navigant.com February 22, 2013 U.S. Offshore Wind Manufacturing and Supply Chain Development Document Number DE-EE0005364 Prepared for: U.S. Department of Energy Michael Hahn Cash Fitzpatrick Gary Norton Prepared by: Navigant Consulting, Inc. Bruce Hamilton, Principal Investigator Lindsay Battenberg

  7. Supply Chain Sustainability Analysis of Three Biofuel Pathways (Technical

    Office of Scientific and Technical Information (OSTI)

    Report) | SciTech Connect Supply Chain Sustainability Analysis of Three Biofuel Pathways Citation Details In-Document Search Title: Supply Chain Sustainability Analysis of Three Biofuel Pathways The Department of Energy's (DOE) Bioenergy Technologies Office (BETO) collaborates with industrial, agricultural, and non-profit partners to develop and deploy biofuels and other biologically-derived products. As part of this effort, BETO and its national laboratory teams conduct in-depth

  8. Supply Chain Sustainability Analysis of Three Biofuel Pathways (Technical

    Office of Scientific and Technical Information (OSTI)

    Report) | SciTech Connect Supply Chain Sustainability Analysis of Three Biofuel Pathways Citation Details In-Document Search Title: Supply Chain Sustainability Analysis of Three Biofuel Pathways × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources in energy science and technology. A

  9. Wind Manufacturing and Supply Chain | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    You are here Home » Research & Development » Wind Manufacturing and Supply Chain Wind Manufacturing and Supply Chain The U.S. Department of Energy (DOE) works with wind technology suppliers to promote advanced manufacturing capabilities. Its goals are to increase reliability while lowering production costs, and to promote an industry that can meet all demands domestically while competing in the global market. The Wind Program supports industry partnerships and targeted R&D investments

  10. Reaction Selectivity in Heterogeneous Catalysis

    SciTech Connect (OSTI)

    Somorjai, Gabor A.; Kliewer, Christopher J.

    2009-02-02

    The understanding of selectivity in heterogeneous catalysis is of paramount importance to our society today. In this review we outline the current state of the art in research on selectivity in heterogeneous catalysis. Current in-situ surface science techniques have revealed several important features of catalytic selectivity. Sum frequency generation vibrational spectroscopy has shown us the importance of understanding the reaction intermediates and mechanism of a heterogeneous reaction, and can readily yield information as to the effect of temperature, pressure, catalyst geometry, surface promoters, and catalyst composition on the reaction mechanism. DFT calculations are quickly approaching the ability to assist in the interpretation of observed surface spectra, thereby making surface spectroscopy an even more powerful tool. HP-STM has revealed three vitally important parameters in heterogeneous selectivity: adsorbate mobility, catalyst mobility, and selective site-blocking. The development of size controlled nanoparticles from 0.8 to 10 nm, of controlled shape, and of controlled bimetallic composition has revealed several important variables for catalytic selectivity. Lastly, DFT calculations may be paving the way to guiding the composition choice for multi-metallic heterogeneous catalysis for the intelligent design of catalysts incorporating the many factors of selectivity we have learned.

  11. The role of cellular structure on increasing the detonability limits of three-step chain-branching detonations

    SciTech Connect (OSTI)

    Short, Mark; Kiyanda, Charles B; Quirk, James J; Sharpe, Gary J

    2011-01-27

    In [1], the dynamics of a pulsating three-step chain-branching detonation were studied. The reaction model consists of, sequentially, chain-initiation, chain-branching and chain-termination steps. The chain-initiation and chain-branching steps are taken to be thermally neutral, with chemical energy release occuring in the chain-termination stage. The purpose of the present study is to examine whether cellular detonation structure can increase the value of the chain-branching cross-over temperature T{sub b} at which fully coupled detonation solutions are observed over those in 1 D. The basic concept is straightforward and has been discussed in [1] and [3]; if T{sub s} drops below T{sub b} at the lead shock, the passage of a transverse shock can increase both the lead shock temperature and the temperature behind the transverse wave back above T{sub b}, thus sustaining an unstable cellular detonation for values of T{sub b} for which a one-dimensional pulsating detonation will fail. Experiments potentially supporting this hypothesis with irregular detonations have been shown in [3] in a shock tube with acoustically absorbing walls. Removal of the transverse waves results in detonation failure, giving way to a decoupled shock-flame complex. A number of questions remain to be addressed regarding the possibility of such a mechanism, and, if so, about the precise mechanisms driving the cellular structure for large T{sub b}. For instance, one might ask what sets the cell size in a chain-branching detonation, particularly could the characteristic cell size be set by the chain-branching cross-over temperature T{sub b}: after a transverse wave shock collision, the strength of the transverse wave weakens as it propagates along the front. If the spacing between shock collisions is too large (cell size), then the transverse shocks may weaken to the extent that the lead shock temperature or that behind the transverse waves is not raised above T{sub b}, losing chemical energy to drive the front in those regions. Failure may result if less than sufficient of the lead shock be driven above n to sustain reaction. Our starting point for generating cellular solutions is as in [I], consisting of an initial ZND wave in the channel, but perturbed here by a density non-uniformity to generate a cellular structure. Exactly how far the detonability limits (value of T{sub b}) can be extended is not addressed here, as such issues relate in part to the way the cellular structure is generated [6]. Our concern here is to investigate the mechanisms of self-sustained cellular detonation for values of T{sub b} above those that lead to 1D pulsating wave failure that can be generated from the initial ZND wave. Finally, we do not consider cellular propagation driven by a process of apparent thermal ignition of hot-spots downstream that tends to appear close to the 20 detonability limit. Such events are subject to the lack of correct thermal diffusive physics in the model and thus to the form of numerical dissipation in the underlying flow algorithm.

  12. Photoinduced electron transfer double fragmentation. An oxygen-mediated radical chain process in the cofragmentation of aminopinacol donors with organic halides

    SciTech Connect (OSTI)

    Chen, L.; Farahat, M.S.; Gan, H.; Whitten, D.G.; Farid, S. |

    1995-06-14

    We reprot an investigation in which excited states of amino pinacols 1-3 are reacted with the halides CCl{sub 4}, benzyl bromide, and p-cyanobenzyl bromide. Interesting results from this study include the finding that low-to-moderate quantum efficiencies for reaction are observed when the reactions are carried out under degassed conditions, indicating that the halide radical anions must survive long enough within the initial ion pair formed in the quenching step to undergo considerable return electron transfer. More strikingly we find that for certain pinacol-halide combinations reaction in aerared solutions leads to much higher efficiencies, which can be attributed to a chain reaction involving oxygen capture of a primary radical product. 25 refs., 1 fig., 1 tab.

  13. Low-energy RI beam technology and nuclear clusters in the explosive pp-chain breakout process

    SciTech Connect (OSTI)

    Kubono, S. [Institute of Modern Physics, Chinese Academy of Sciences, Nanchang Road 509, Lanzhou 73000 (China); RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Center for Nuclear Study, University of Tokyo, 2-1 Hirosawa, Wako, Saitama 351-0 (Japan); Yamaguchi, H.; Kahl, D. M.; Ohshiro, Y.; Watanabe, S.; Yamazaki, N. [Center for Nuclear Study, University of Tokyo, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Teranishi, T. [Department of Physics, Kyushu University, 6-10-1 Hakozaki, Fukuoka 812-858 (Japan); Yanagisawa, Y.; Wakabayashi, Y.; Kase, M. [RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Hayakawa, S. [Laboratori Nazionali del Sud, Istituto Nazionale di Fisica Nucleare, Via S. Sofia 62, 95125 Catania (Italy); Kwon, Y. K. [Institute for Basic Science, 70, Yuseong-daero 1689-gil, Yuseong-gu, Daejeon 305-81 (Korea, Republic of); Hashimoto, T.; Fukuda, Y. [Research Center for Nuclear Physics, Osaka University, 10-1 Mihogaoka, Ibaraki, Osaka 567-0047 (Japan); He, J. J. [Institute of Modern Physics, Chinese Academy of Sciences, Nanchang Road 509, Lanzhou 73000 (China); Goto, A. [Faculty of Medcine, Yamagata University, Yamagata 990-2331 (Japan); Muto, H. [Center of General Education, Tokyo University of Science at Suwa, Chino, Nagano 391-0292 (Japan)

    2014-05-09

    The lecture includes two parts: One is a discussion on the technology for developing RIB beam facility based on the in-flight method and relevant experimental technology. The second part is a discussion on experimental efforts for studying the breakout process from the pp-chain region based on recent works with low energy RI beams. The discussion of the second part specifically covers the problem of the vp-process in type II supernovae in terms of alpha cluster nature for the reactions.

  14. Comparison of fission product release predictions using PARFUME with results from the AGR-1 safety tests

    SciTech Connect (OSTI)

    Blaise Collin

    2014-09-01

    Safety tests were conducted on fourteen fuel compacts from AGR-1, the first irradiation experiment of the Advanced Gas Reactor (AGR) Fuel Development and Qualification program, at temperatures ranging from 1600 to 1800C to determine fission product release at temperatures that bound reactor accident conditions. The PARFUME (PARticle FUel ModEl) code was used to predict the release of fission products silver, cesium, strontium, and krypton from fuel compacts containing tristructural isotropic (TRISO) coated particles during the safety tests, and the predicted values were compared with experimental results. Preliminary comparisons between PARFUME predictions and post-irradiation examination (PIE) results of the safety tests show different trends in the prediction of the fractional release depending on the species, and it leads to different conclusions regarding the diffusivities used in the modeling of fission product transport in TRISO-coated particles: For silver, the diffusivity in silicon carbide (SiC) might be over-estimated by a factor of at least 102 to 103 at 1600C and 1700C, and at least 10 to 102 at 1800C. The diffusivity of silver in uranium oxy-carbide (UCO) might also be over-estimated, but the available data are insufficient to allow definitive conclusions to be drawn. For cesium, the diffusivity in UCO might be over-estimated by a factor of at least 102 to 103 at 1600C, 105 at 1700C, and 103 at 1800C. The diffusivity of cesium in SiC might also over-estimated, by a factor of 10 at 1600C and 103 at 1700C, based upon the comparisons between calculated and measured release fractions from intact particles. There is no available estimate at 1800C since all the compacts heated up at 1800C contain particles with failed SiC layers whose release dominates the release from intact particles. For strontium, the diffusivity in SiC might be over-estimated by a factor of 10 to 102 at 1600 and 1700C, and 102 to 103 at 1800C. These values might be somewhat over-estimated because the strontium retention during irradiation cannot be assessed a priori, which affects the magnitude of the calculated release during safety testing. The diffusivity of strontium in UCO cannot be derived from these heating tests, but it is assumed to be modeled correctly using the IAEA recommended value for kernel diffusivity. For krypton, there is no reliable release data for compacts heated up at 1600C, which includes all the compacts containing only intact particles. At 1700 and 1800C, comparisons show an over-prediction of the release from compacts containing particles with failed SiC by 1 to 1.5 orders of magnitude. The available data from these heating tests do not allow to determine which of the TRISO-coatings layers diffusivities are under or over-estimated.

  15. Molten Salt Fuel Version of Laser Inertial Fusion Fission Energy (LIFE)

    SciTech Connect (OSTI)

    Moir, R W; Shaw, H F; Caro, A; Kaufman, L; Latkowski, J F; Powers, J; Turchi, P A

    2008-10-24

    Molten salt with dissolved uranium is being considered for the Laser Inertial Confinement Fusion Fission Energy (LIFE) fission blanket as a backup in case a solid-fuel version cannot meet the performance objectives, for example because of radiation damage of the solid materials. Molten salt is not damaged by radiation and therefore could likely achieve the desired high burnup (>99%) of heavy atoms of {sup 238}U. A perceived disadvantage is the possibility that the circulating molten salt could lend itself to misuse (proliferation) by making separation of fissile material easier than for the solid-fuel case. The molten salt composition being considered is the eutectic mixture of 73 mol% LiF and 27 mol% UF{sub 4}, whose melting point is 490 C. The use of {sup 232}Th as a fuel is also being studied. ({sup 232}Th does not produce Pu under neutron irradiation.) The temperature of the molten salt would be {approx}550 C at the inlet (60 C above the solidus temperature) and {approx}650 C at the outlet. Mixtures of U and Th are being considered. To minimize corrosion of structural materials, the molten salt would also contain a small amount ({approx}1 mol%) of UF{sub 3}. The same beryllium neutron multiplier could be used as in the solid fuel case; alternatively, a liquid lithium or liquid lead multiplier could be used. Insuring that the solubility of Pu{sup 3+} in the melt is not exceeded is a design criterion. To mitigate corrosion of the steel, a refractory coating such as tungsten similar to the first wall facing the fusion source is suggested in the high-neutron-flux regions; and in low-neutron-flux regions, including the piping and heat exchangers, a nickel alloy, Hastelloy, would be used. These material choices parallel those made for the Molten Salt Reactor Experiment (MSRE) at ORNL. The nuclear performance is better than the solid fuel case. At the beginning of life, the tritium breeding ratio is unity and the plutonium plus {sup 233}U production rate is {approx}0.6 atoms per 14.1 MeV neutron.

  16. Phase-field simulations of intragranular fission gas bubble evolution in UO2 under post-irradiation thermal annealing

    SciTech Connect (OSTI)

    Li, Yulan; Hu, Shenyang Y.; Montgomery, Robert O.; Gao, Fei; Sun, Xin

    2013-05-15

    Fission gas bubble is one of evolving microstructures, which affect thermal mechanical properties such as thermo-conductivity, gas release, volume swelling, and cracking, in operating nuclear fuels. Therefore, fundamental understanding of gas bubble evolution kinetics is essential to predict the thermodynamic property and performance changes of fuels. In this work, a generic phasefield model was developed to describe the evolution kinetics of intra-granular fission gas bubbles in UO2 fuels under post-irradiation thermal annealing conditions. Free energy functional and model parameters are evaluated from atomistic simulations and experiments. Critical nuclei size of the gas bubble and gas bubble evolution were simulated. A linear relationship between logarithmic bubble number density and logarithmic mean bubble diameter is predicted which is in a good agreement with experimental data.

  17. Purification, crystallization and preliminary X-ray diffraction analysis of the histone chaperone cia1 from fission yeast

    SciTech Connect (OSTI)

    Umehara, Takashi; Otta, Yumi; Tsuganezawa, Keiko; Matsumoto, Takehisa; Tanaka, Akiko; Horikoshi, Masami; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki

    2005-11-01

    The histone chaperone cia1 from fission yeast has been overexpressed in E. coli, purified and crystallized using the vapour-diffusion method. In fission yeast, cia1{sup +} is an essential gene that encodes a histone chaperone, a homologue of human CIA (CCG1-interacting factor A) and budding yeast Asf1p (anti-silencing function-1), which both facilitate nucleosome assembly by interacting with the core histones H3/H4. The conserved domain (residues 1161) of the cia1{sup +}-encoded protein was expressed in Escherichia coli, purified to near-homogeneity and crystallized by the sitting-drop vapour-diffusion method. The protein was crystallized in the monoclinic space group C2, with unit-cell parameters a = 79.16, b = 40.53, c = 69.79 , ? = 115.93 and one molecule per asymmetric unit. The crystal diffracted to beyond 2.10 resolution using synchrotron radiation.

  18. Neutronics Design of a Thorium-Fueled Fission Blanket for LIFE (Laser Inertial Fusion-based Energy)

    SciTech Connect (OSTI)

    Powers, J; Abbott, R; Fratoni, M; Kramer, K; Latkowski, J; Seifried, J; Taylor, J

    2010-03-08

    The Laser Inertial Fusion-based Energy (LIFE) project at LLNL includes development of hybrid fusion-fission systems for energy generation. These hybrid LIFE engines use high-energy neutrons from laser-based inertial confinement fusion to drive a subcritical blanket of fission fuel that surrounds the fusion chamber. The fission blanket contains TRISO fuel particles packed into pebbles in a flowing bed geometry cooled by a molten salt (flibe). LIFE engines using a thorium fuel cycle provide potential improvements in overall fuel cycle performance and resource utilization compared to using depleted uranium (DU) and may minimize waste repository and proliferation concerns. A preliminary engine design with an initial loading of 40 metric tons of thorium can maintain a power level of 2000 MW{sub th} for about 55 years, at which point the fuel reaches an average burnup level of about 75% FIMA. Acceptable performance was achieved without using any zero-flux environment 'cooling periods' to allow {sup 233}Pa to decay to {sup 233}U; thorium undergoes constant irradiation in this LIFE engine design to minimize proliferation risks and fuel inventory. Vast reductions in end-of-life (EOL) transuranic (TRU) inventories compared to those produced by a similar uranium system suggest reduced proliferation risks. Decay heat generation in discharge fuel appears lower for a thorium LIFE engine than a DU engine but differences in radioactive ingestion hazard are less conclusive. Future efforts on development of thorium-fueled LIFE fission blankets engine development will include design optimization, fuel performance analysis work, and further waste disposal and nonproliferation analyses.

  19. FORIG: a computer code for calculating radionuclide generation and depletion in fusion and fission reactors. User's manual

    SciTech Connect (OSTI)

    Blink, J.A.

    1985-03-01

    In this manual we describe the use of the FORIG computer code to solve isotope-generation and depletion problems in fusion and fission reactors. FORIG runs on a Cray-1 computer and accepts more extensive activation cross sections than ORIGEN2 from which it was adapted. This report is an updated and a combined version of the previous ORIGEN2 and FORIG manuals. 7 refs., 15 figs., 13 tabs.

  20. Dudley Herschbach: Chemical Reactions and Molecular Beams

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Dudley Herschbach: Chemical Reactions and Molecular Beams Resources with Additional Information Dudley Herschbach Courtesy of Texas A&M University As a co-recipient of the 1986 Nobel Prize in Chemistry, 'Dudley Herschbach was cited for "providing a much more detailed understanding of how chemical reactions take place". Using molecular beams, he studied elementary reactions such as K + CH3I and K + Br2, where it became possible to correlate reaction dynamics with the electronic