National Library of Energy BETA

Sample records for fission chain reaction

  1. Lesson 5 - Fission and Chain Reactions | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    5 - Fission and Chain Reactions Lesson 5 - Fission and Chain Reactions Lesson Four showed how the nuclei of atoms store energy and how unstable atoms decay and release energy. How do nuclear engineers use this knowledge to help them harness energy to make electricity? The answer lies in being able to start a nuclear chain reaction in fuel inside a nuclear power plant and keep it going. This lesson examines nuclear reactions called fission as well as how uranium is processed from ore to fuel.

  2. On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment

    SciTech Connect (OSTI)

    Anghaie, S.; Froelich, P.; Monkhorst, H.J. )

    1990-05-01

    In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, {sup 6}Li nd {sup 7}Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur.

  3. Supplement to Theory of Neutron Chain Reactions

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1952-05-26

    General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

  4. NUCLEAR FISSION CHAIN REACTING SYSTEM

    DOE Patents [OSTI]

    Anderson, H.L.; Brown, H.S.

    1961-06-27

    The patent describes a reactor consisting of a plurality of tubes passing through a body of heavy water or graphite, a heat exchanger, means for flowing UF/sub 6/ through the tubes and the heat exchangar, and means for bleeding off some of the UF/sub 6/ and separating plutonium therefrom. A specific suggestion contained is that the amount of the UF/sub 6/ outside the reaction unit be a multiple of that within it.

  5. Polymerase chain reaction system

    DOE Patents [OSTI]

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  6. Polyneutron Chain Reactions

    SciTech Connect (OSTI)

    John C. Fisher

    2000-11-12

    Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of {approx}60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N{>=}12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between {sup 16}O and {sup A}Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound {sup 16}O {sup A}Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the {sup 16}O and {sup A}Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of {sup A}Nt is prevented by the buildup of Coulomb energy associated with transforming {sup A}Nt into {sup A}H in close proximity to {sup 16}O. Thus, it is possible that {sup 16}O {sup A}Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the {sup A}Nt component can

  7. Chain Reaction Innovations: Innovation Applicant Information | Argonne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    National Laboratory Innovation Applicant Information Information for Innovation Applicants in the Chain Reaction Innovations program PDF icon CRI_innovation_applicant_info

  8. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction...

    National Nuclear Security Administration (NNSA)

    Self Sustain Nuclear Chain Reaction Chicago, IL Metallurgical Laboratory scientists led by Enrico Fermi achieve the first self-sustained nuclear chain reaction in pile...

  9. Dual phase multiplex polymerase chain reaction

    DOE Patents [OSTI]

    Pemov, Alexander; Bavykin, Sergei

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  10. OSTIblog Articles in the nuclear chain reaction Topic | OSTI...

    Office of Scientific and Technical Information (OSTI)

    amount of neutron reduction needed for a safe and controlled sustained nuclear reaction. ... Manhattan Project, nuclear chain reaction, plutonium, uranium, World War II Read more... ...

  11. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction | National

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration | (NNSA) Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction Chicago, IL Metallurgical Laboratory scientists led by Enrico Fermi achieve the first self-sustained nuclear chain reaction in pile constructed under the west grandstand at Stagg field in Chicago

  12. Integrated polymerase chain reaction/electrophoresis instrument

    DOE Patents [OSTI]

    Andresen, Brian D.

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  13. Angular momentum effects in fusion-fission and fusion-evaporation reactions

    SciTech Connect (OSTI)

    Plasil, F.

    1980-01-01

    The study of heavy-ion fusion reactions is complicated by the possible contributions of several mechanisms. The various types of heavy-ion-induced fission are discussed. Then compound-nucleus fission is considered with reference to fission barriers deduced from heavy-ion-induced fission. Next, the problems associated with measured values of evaporation-residue cross sections and the angular momentum dependence of incomplete fusion are examined. Finally, the de-excitation of compound nuclei is again taken up, this time with reference to the greatly enhanced ..cap alpha.. emission predicted on the basis of the rotating liquid drop model. 24 figures. (RWR)

  14. Chain Reaction Innovation is DOE's Newest Investment in the Clean...

    Office of Environmental Management (EM)

    in the Clean Energy Innovation Ecosystem Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem June 1, 2016 - 4:00pm Addthis Ribbon ...

  15. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  16. Fission-Fusion: A new reaction mechanism for nuclear astrophysics based on laser-ion acceleration

    SciTech Connect (OSTI)

    Thirolf, P. G.; Gross, M.; Allinger, K.; Bin, J.; Henig, A.; Kiefer, D.; Habs, D.; Ma, W.; Schreiber, J.

    2011-10-28

    We propose to produce neutron-rich nuclei in the range of the astrophysical r-process around the waiting point N = 126 by fissioning a dense laser-accelerated thorium ion bunch in a thorium target (covered by a CH{sub 2} layer), where the light fission fragments of the beam fuse with the light fission fragments of the target. Via the 'hole-boring' mode of laser Radiation Pressure Acceleration using a high-intensity, short pulse laser, very efficiently bunches of {sup 232}Th with solid-state density can be generated from a Th target and a deuterated CD{sub 2} foil, both forming the production target assembly. Laser-accelerated Th ions with about 7 MeV/u will pass through a thin CH{sub 2} layer placed in front of a thicker second Th foil (both forming the reaction target) closely behind the production target and disintegrate into light and heavy fission fragments. In addition, light ions (d,C) from the CD{sub 2} layer of the production target will be accelerated as well, inducing the fission process of {sup 232}Th also in the second Th layer. The laser-accelerated ion bunches with solid-state density, which are about 10{sup 14} times more dense than classically accelerated ion bunches, allow for a high probability that generated fission products can fuse again. The high ion beam density may lead to a strong collective modification of the stopping power, leading to significant range and thus yield enhancement. Using a high-intensity laser as envisaged for the ELI-Nuclear Physics project in Bucharest (ELI-NP), order-of-magnitude estimates promise a fusion yield of about 10{sup 3} ions per laser pulse in the mass range of A = 180-190, thus enabling to approach the r-process waiting point at N = 126.

  17. Chain Reaction Innovations: A More Powerful Incubator for Energy and

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Science Technology | Argonne National Laboratory A More Powerful Incubator for Energy and Science Technology Chain Reaction Innovations (CRI) is a two-year program for innovators focusing on energy and science technologies. Through an annual application call, four to six teams will be selected to join CRI. Program participants will receive the financial and technical support needed to mature nascent technologies that face long development cycles to the proof-of-concept level, thus getting

  18. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Patents [OSTI]

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  19. Chain Reaction Innovations Opens Call for First Startup Cohort of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Innovators | Department of Energy Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators July 20, 2016 - 3:29pm Addthis Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators Earlier this year, we announced the launch of Chain Reaction Innovations (CRI), the newest addition to the Department of Energy's (DOE) Lab-Embedded Entrepreneurship Programs

  20. Fusion-fission and quasifission in the reactions with heavy ions leading to the formation of Hs

    SciTech Connect (OSTI)

    Itkis, I. M.; Itkis, M. G.; Knyazheva, G. N.; Kozulin, E. M.

    2012-10-20

    Mass and energy distributions of binary reaction products obtained in the reactions {sup 22}Ne+{sup 249}Cf,{sup 26}Mg+{sup 248}Cm,{sup 36}S+{sup 238}U and {sup 58}Fe+{sup 208}Pb leading to Hs isotopes have been measured. At energies below the Coulomb barrier the bimodal fission of Hs*, formed in the reaction {sup 26}Mg+{sup 248}Cm, is observed. In the reaction {sup 36}S+{sup 238}U the considerable part of the symmetric fragments arises from the quasifission process. At energies above the Coulomb barrier the symmetric fragments originate mainly from fusion-fission process for both reactions with Mg and S ions. In the case of the {sup 58}Fe+{sup 208}Pb reaction the quasifission process dominates at all measured energies. The pre- and post-scission neutron multiplicities as a function of the fragment mass have been obtained for the reactions studied.

  1. Fission and quasifission modes in heavy-ion-induced reactions leading to the formation of Hs{sup *}

    SciTech Connect (OSTI)

    Itkis, I. M.; Kozulin, E. M.; Itkis, M. G.; Knyazheva, G. N.; Bogachev, A. A.; Chernysheva, E. V.; Krupa, L.; Oganessian, Yu. Ts.; Zagrebaev, V. I.; Rusanov, A. Ya.; Goennenwein, F.; Dorvaux, O.; Stuttge, L.; Hanappe, F.; Vardaci, E.; Goes Brennand, E. de

    2011-06-15

    Mass and energy distributions of binary reaction products obtained in the reactions {sup 22}Ne+{sup 249}Cf,{sup 26}Mg+{sup 248}Cm, {sup 36}S+{sup 238}U, and {sup 58}Fe+{sup 208}Pb have been measured. All reactions lead to Hs isotopes. At energies below the Coulomb barrier the bimodal fission of Hs{sup *}, formed in the reaction {sup 26}Mg+{sup 248}Cm, is observed. In the reaction {sup 36}S+{sup 238}U, leading to the formation of a similar compound nucleus, the main part of the symmetric fragments arises from the quasifission process. At energies above the Coulomb barrier fusion-fission is the main process leading to the formation of symmetric fragments for both reactions with Mg and S ions. In the case of the {sup 58}Fe+{sup 208}Pb reaction the quasifission process dominates at all measured energies.

  2. Nested methylation-specific polymerase chain reaction cancer detection method

    DOE Patents [OSTI]

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  3. Rotation of Nuclei as Observed in Ternary Fission of the Reaction 235U(nth,f) Induced by Polarized Neutron

    SciTech Connect (OSTI)

    Goennenwein, F.; Gagarski, A.; Guseva, I.; Petrov, G.; Sokolov, V.; Zavarukhkina, T.; Mutterer, M.; Nesvizhevski, V.; Bunakov, V.; Kadmensky, S.

    2007-05-22

    Ternary fission of the standard reaction 235U(nth,f) induced by cold polarized neutrons has been investigated. Fission fragments and light charged particles were recorded in coincidence. Following cold neutron capture the compound nucleus 236U* has spin 3- or 4-. At the saddle point of the fissioning 236U* nucleus these states are collective. They are expected to retain a sizable collectivity down to the scission point. In fact, a collective rotation has been sensed by the shift in the angular distribution of the light charged particles which depends on the orientation of neutron polarization. Direct observation of the rotation of 236U* excited in a cold neutron reaction is reported here for the first time. It is proposed to call the new phenomenon the 'ROT-effect'.

  4. The fusion-fission process in the reaction {sup 34}S+{sup 186}W near the interaction barrier

    SciTech Connect (OSTI)

    Harca, I. M.; Dmitriev, S.; Itkis, J.; Kozulin, E. M.; Knyazheva, G.; Loktev, T.; Novikov, K.; Azaiez, F.; Gottardo, A.; Matea, I.; Verney, D.; Hanappe, F.; Piot, J.; Schmitt, C.; Vardaci, E.

    2015-02-24

    The reaction {sup 34}S+{sup 186}W at E{sub lab}=160 MeV was investigated with the aim of diving into the features of the fusion-fission process. Gamma rays in coincidence with binary reaction fragments were measured using the high efficiency gamma-ray spectrometer ORGAM at the TANDEM Accelerator facility of I.P.N., Orsay, and the time-of-flight spectrometer for fission fragments (FF) registration CORSET of the Flerov Laboratory of Nuclear Reactions (FLNR), Dubna. The coupling of the ORGAM and CORSET setups offers the unique opportunity of extracting details for characterizing the fusion-fission process and gives information regarding production of neutron-rich heavy nuclei. The FF–γ coincidence method is of better use then the γ – γ coincidence method when dealing with low statistic measurements and also offers the opportunity to precisely correct the Dopler shift for in-flight emitted gamma rays. Evidence of symmetric and asymmetric fission modes were observed in the mass and TKE distributions, occurring due to shell effects in the fragments. Coincident measurements allow for discrimination between the gamma rays by accepting a specific range within the mass distribution of the reaction products. Details regarding the experimental setup, methods of processing the acquisitioned data and preliminary results are presented.

  5. Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Innovation Ecosystem | Department of Energy Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem June 1, 2016 - 4:00pm Addthis Ribbon cutting ceremony for the Chain Reaction Innovations program launch. From left to right: Dr. David Danielson, Assistant Secretary for Energy Efficiency and Renewable Energy; Dr. Peter Littlewood, Director of Argonne National

  6. Chain Reaction Innovations Opens the Call for its First Startup Cohort |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Chain Reaction Innovations Opens the Call for its First Startup Cohort Chain Reaction Innovations Opens the Call for its First Startup Cohort July 12, 2016 - 11:52am Addthis Announcement from Argonne National Laboratory Argonne National Laboratory has opened a new innovation incubator called Chain Reaction Innovations (CRI), which wants to ensure that innovators who are pursuing transformational technologies thrive by giving them an unparalleled level of support that

  7. Dynamical Dipole Mode in Heavy-Ion Fusion-Evaporation and Fission Reactions in the {sup 192}Pb Mass Region

    SciTech Connect (OSTI)

    Silvestri, R.; Inglima, G.; La Commara, M.; Martin, B.; Sandoli, M.; Pierroutsakou, D.; Parascandolo, C.; Boiano, A.; Romoli, M.; Agodi, C.; Alba, R.; Colonna, M.; Coniglione, R.; Del Zoppo, A.; Maiolino, C.; Santonocito, D.; Baran, V.; De Filippo, E.; Di Toro, M.; Rizzo, C.

    2011-10-28

    The prompt {gamma}-ray emission related with the dynamical dipole mode decay was investigated in the {sup 192}Pb mass region by means of the {sup 40}Ca+{sup 152}Sm and {sup 48}Ca+{sup 144}Sm fusion-evaporation and fission reactions at E{sub lab} = 11 and 10.1 MeV/nucleon, respectively. The two reactions populate, through entrance channel having different charge asymmetries, the {sup 192}Pb compound nucleus at an excitation energy of 236 MeV with identical spin distribution. Preliminary results of this experiment show that the dynamical dipole mode survives in collisions involving heavier mass reaction partners than those studied previously. As a fast cooling mechanism on the fusion path, the prompt dipole {gamma} radiation could be of interest for the synthesis of super-heavy elements through ''hot'' fusion reactions.

  8. A Multigroup Reaction Cross-Section Collapsing Code and Library of 154-Group Fission-Product Cross Sections.

    Energy Science and Technology Software Center (OSTI)

    1983-03-23

    Version 01/02 The code reads multigroup cross sections from a compatible data file and collapses user-selected reaction cross sections to any few-group structure using one of a variety of user neutron flux spectrum options given below: Option Flux description 1 Built-in function including Maxwellian, fission, fusion and slowing-down regions and requiring user-specified parameters and energy-region boundaries. 2 Set of log-log flux-energy interpolation points read from input cross-section data file. 3 Set of log-log flux-energy interpolationmore » points read from user-supplied card input. 4 - 6 Histogram flux values read from user-supplied card input in arbitrary group structure in units of flux-per unit-energy, flux-per-unit lethargy, or integral group flux. LAFPX-E may be used to collapse any set of multigroup reaction cross sections furnished in the required format. However, the code was developed for, and is furnished with, a library of 154-group fission-product cross sections processed from ENDF/B-IV with a typical light water reactor (LWR) flux spectrum and temperature. Four-group radiative capture cross sections produced for LWR calculations are tabulated in the code documentation and are incorporated in the EPRI-CINDER data library, RSIC Code Package CCC-309.« less

  9. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  10. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hanson, Susan Kloek

    2013-07-30

    Method of producing C.sub.8-C.sub.15 hydrocarbons. comprising providing a ketone starting material; providing an aldol starting material comprising chloromethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.3, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  11. Enrico Fermi and the First Self-Sustaining Nuclear Chain Reaction

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Fermi and the First Self-Sustaining Nuclear Chain Reaction Resources with Additional Information * Fermi Honored * Atoms for Peace * Centennial of Birth * Stamp Patents * Audio/Video Clips * Selected by NSTA for SciLinks "The President of the United States of America ... for especially meritorious contributions to the development, use, or control of atomic energy, grant[s] an award of merit to Enrico Fermi for his contributions to basic neutron physics and the achievement of the controlled

  12. OSTIblog Articles in the nuclear chain reaction Topic | OSTI, US Dept of

    Office of Scientific and Technical Information (OSTI)

    Energy Office of Scientific and Technical Information chain reaction Topic The Manhattan Project -- Its Operations by Mary Schorn 29 Nov, 2012 in Science Communications 4236 ManhattanProjectMap320.jpg The Manhattan Project -- Its Operations Read more about 4236 Major operations for the Manhattan Engineer District (Manhattan Project) took place in remote site locations in the states of Tennessee, New Mexico, and Washington, with additional research being conducted in university laboratories

  13. Fission Spectrum

    DOE R&D Accomplishments [OSTI]

    Bloch, F.; Staub, H.

    1943-08-18

    Measurements of the spectrum of the fission neutrons of 25 are described, in which the energy of the neutrons is determined from the ionization produced by individual hydrogen recoils. The slow neutrons producing fission are obtained by slowing down the fast neutrons from the Be-D reaction of the Stanford cyclotron. In order to distinguish between fission neutrons and the remaining fast cyclotron neutrons both the cyclotron current and the pusle amplifier are modulated. A hollow neutron container, in which slow neutrons have a lifetime of about 2 milliseconds, avoids the use of large distances. This method results in much higher intensities than the usual modulation arrangement. The results show a continuous distribution of neutrons with a rather wide maximum at about 0.8 MV falling off to half of its maximum value at 2.0 MV. The total number of netrons is determined by comparison with the number of fission fragments. The result seems to indicate that only about 30% of the neutrons have energies below .8 MV. Various tests are described which were performed in order to rule out modification of the spectrum by inelastic scattering. Decl. May 4, 1951

  14. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  15. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    SciTech Connect (OSTI)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  16. Theory of Neutron Chain Reactions. Volume II, Part I. Homogeneous Nuclear Chain Reactions. Chapter V. Neutron Chain Reactions. Chapter VI. Pile Equations. Chapter VII. Theory of Reflectors And The Method Of Groups

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1951-08-10

    The previous section of this book deals with the general problem of neutron diffusion. In this sequel we shall apply the results obtained already to the theory of slow neutron chain reacting systems.

  17. Investigation of the reaction {sup 208}Pb({sup 18}O, f): Fragment spins and phenomenological analysis of the angular anisotropy of fission fragments

    SciTech Connect (OSTI)

    Rusanov, A. Ya. Adeev, G. D.; Itkis, M. G.; Karpov, A. V.; Nadtochy, P. N.; Pashkevich, V. V.; Pokrovsky, I. V.; Salamatin, V. S.; Chubarian, G. G.

    2007-10-15

    The average multiplicity of gamma rays emitted by fragments originating from the fission of {sup 226}Th nuclei formed via a complete fusion of {sup 18}O and {sup 208}Pb nuclei at laboratory energies of {sup 18}O projectile ions in the range E{sub lab} = 78-198.5 MeV is measured and analyzed. The total spins of fission fragments are found and used in an empirical analysis of the energy dependence of the anisotropy of these fragments under the assumption that their angular distributions are formed in the vicinity of the scission point. The average temperature of compound nuclei at the scission point and their average angular momenta in the entrance channel are found for this analysis. Also, the moments of inertia are calculated for this purpose for the chain of fissile thorium nuclei at the scission point. All of these parameters are determined at the scission point by means of three-dimensional dynamical calculations based on Langevin equations. A strong alignment of fragment spins is assumed in analyzing the anisotropy in question. In that case, the energy dependence of the anisotropy of fission fragments is faithfully reproduced at energies in excess of the Coulomb barrier (E{sub c.m.} - E{sub B} {>=} 30 MeV). It is assumed that, as the excitation energy and the angular momentum of a fissile nucleus are increased, the region where the angular distributions of fragments are formed is gradually shifted from the region of nuclear deformations in the vicinity of the saddle point to the region of nuclear deformations in the vicinity of the scission point, the total angular momentum of the nucleus undergoing fission being split into the orbital component, which is responsible for the anisotropy of fragments, and the spin component. This conclusion can be qualitatively explained on the basis of linear-response theory.

  18. Interplay between compound and fragments aspects of nuclear fission...

    Office of Scientific and Technical Information (OSTI)

    aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments aspects of nuclear fission and ...

  19. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOE Patents [OSTI]

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  20. Extended optical model for fission

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sin, M.; Capote, R.; Herman, M. W.; Trkov, A.

    2016-03-07

    A comprehensive formalism to calculate fission cross sections based on the extension of the optical model for fission is presented. It can be used for description of nuclear reactions on actinides featuring multi-humped fission barriers with partial absorption in the wells and direct transmission through discrete and continuum fission channels. The formalism describes the gross fluctuations observed in the fission probability due to vibrational resonances, and can be easily implemented in existing statistical reaction model codes. The extended optical model for fission is applied for neutron induced fission cross-section calculations on 234,235,238U and 239Pu targets. A triple-humped fission barrier ismore » used for 234,235U(n,f), while a double-humped fission barrier is used for 238U(n,f) and 239Pu(n,f) reactions as predicted by theoretical barrier calculations. The impact of partial damping of class-II/III states, and of direct transmission through discrete and continuum fission channels, is shown to be critical for a proper description of the measured fission cross sections for 234,235,238U(n,f) reactions. The 239Pu(n,f) reaction can be calculated in the complete damping approximation. Calculated cross sections for 235,238U(n,f) and 239Pu(n,f) reactions agree within 3% with the corresponding cross sections derived within the Neutron Standards least-squares fit of available experimental data. Lastly, the extended optical model for fission can be used for both theoretical fission studies and nuclear data evaluation.« less

  1. Fission fragment driven neutron source

    DOE Patents [OSTI]

    Miller, Lowell G.; Young, Robert C.; Brugger, Robert M.

    1976-01-01

    Fissionable uranium formed into a foil is bombarded with thermal neutrons in the presence of deuterium-tritium gas. The resulting fission fragments impart energy to accelerate deuterium and tritium particles which in turn provide approximately 14 MeV neutrons by the reactions t(d,n).sup.4 He and d(t,n).sup.4 He.

  2. First-Hand Recollections of the First Self-Sustaining Chain Reaction

    Broader source: Energy.gov [DOE]

    Seventy years later, two of the men present at the first nuclear reaction recall the events of the memorable day.

  3. Spontaneous Fission

    DOE R&D Accomplishments [OSTI]

    Segre, Emilio

    1950-11-22

    The first attempt to discover spontaneous fission in uranium was made by [Willard] Libby, who, however, failed to detect it on account of the smallness of effect. In 1940, [K. A.] Petrzhak and [G. N.] Flerov, using more sensitive methods, discovered spontaneous fission in uranium and gave some rough estimates of the spontaneous fission decay constant of this substance. Subsequently, extensive experimental work on the subject has been performed by several investigators and will be quoted in the various sections. [N.] Bohr and [A.] Wheeler have given a theory of the effect based on the usual ideas of penetration of potential barriers. On this project spontaneous fission has been studied for the past several years in an effort to obtain a complete picture of the phenomenon. For this purpose the spontaneous fission decay constants {lambda} have been measured for separated isotopes of the heavy elements wherever possible. Moreover, the number {nu} of neutrons emitted per fission has been measured wherever feasible, and other characteristics of the spontaneous fission process have been studied. This report summarizes the spontaneous fission work done at Los Alamos up to January 1, 1945. A chronological record of the work is contained in the Los Alamos monthly reports.

  4. Investigation of the {sup 208}Pb({sup 18}O, f) fission reaction: Mass-energy distributions of fission fragments and their correlation with the gamma-ray multiplicity

    SciTech Connect (OSTI)

    Rusanov, A. Ya.; Itkis, M. G.; Kondratiev, N. A.; Pashkevich, V. V.; Pokrovsky, I. V.; Salamatin, V. S.; Chubarian, G. G.

    2008-06-15

    The mass-energy distributions of fragments originating from the fission of the compound nucleus {sup 226}Th and their correlations with the multiplicity of gamma rays emitted from these fragments are measured and analyzed in {sup 18}O + {sup 208}Pb interaction induced by projectile oxygen ions of energy in the range E{sub lab} = 78-198.5 MeV. Manifestations of an asymmetric fission mode, which is damped exponentially with increasing E{sub lab}, are demonstrated. Theoretical calculations of fission valleys reveal that only two independent valleys, symmetric and asymmetric, exist in the vicinity of the scission point. The dependence of the multiplicity of gamma rays emitted from both fission fragments on their mass, M{sub {gamma}}(M), has a complicated structure and is highly sensitive to shell effects in both primary and final fragments. A two-component analysis of the dependence M{sub {gamma}}(M) shows that the asymmetric mode survives in fission only at low partial-wave orbital angular momenta of compound nuclei. It is found that, for all E{sub lab}, the gamma-ray multiplicity M{sub {gamma}}as a function of the total kinetic energy (TKE) of fragments, M{sub {gamma}}(TKE), decreases linearly with increasing TKE. An analysis of the energy balance in the fission process at the laboratory energy of E{sub lab} = 78 MeV revealed the region of cold fission of fragments whose total kinetic energy is TKE {approx}Q{sub max}.

  5. Investigation of the reaction {sup 208}Pb({sup 18}O, f): Folding angular distributions of fission fragments and gamma-ray multiplicity

    SciTech Connect (OSTI)

    Rusanov, A. Ya. Itkis, M. G.; Kondratiev, N. A.; Pokrovsky, I. V.; Salamatin, V. S.; Chubarian, G. G.

    2007-10-15

    Correlations between folding angular distributions of fission fragments and the gamma-ray multiplicity are studied for {sup 18}O + {sup 208}Pb interactions at energies of the beam of {sup 18}O ions in the range E{sub lab} = 78-198.5 MeV. The probabilities are determined for complete-and incomplete-fusion processes inevitably followed by the fission of nuclei formed in these processes. It is found that the probability of incomplete fusion followed by fission increases with increasing energy of bombarding ions. It is shown that, for the incomplete-fusion process, folding angular distributions of fission fragments have a two-component structure. The width of folding angular distributions (FWHM) for complete fusion grows linearly with increasing energy of {sup 18}O ions. The multiplicity of gamma rays from fission fragments as a function of the linear-momentum transfer behaves differently for different energies of projectile ions. This circumstance is explained here by the distinction between the average angular momenta of participant nuclei in the fusion and fission channels, which is due to the difference in the probabilities of fission in the cases where different numbers of nucleons are captured by the target nucleus.

  6. Monte Carlo Hauser-Feshbach Calculations of Prompt Fission Neutrons...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Monte Carlo Hauser-Feshbach Calculations of Prompt Fission Neutrons and Gamma Rays: Application to Thermal Neutron-Induced Fission Reactions on U-235 and Pu-239 ...

  7. Benchmarking nuclear fission theory

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Bertsch, G. F.; Loveland, W.; Nazarewicz, W.; Talou, P.

    2015-05-14

    We suggest a small set of fission observables to be used as test cases for validation of theoretical calculations. Thus, the purpose is to provide common data to facilitate the comparison of different fission theories and models. The proposed observables are chosen from fission barriers, spontaneous fission lifetimes, fission yield characteristics, and fission isomer excitation energies.

  8. METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

    DOE Patents [OSTI]

    Fermi, E.; Leverett, M.C.

    1957-11-12

    This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

  9. MODELING AND FISSION CROSS SECTIONS FOR AMERICIUM.

    SciTech Connect (OSTI)

    ROCHMAN, D.; HERMAN, M.; OBLOZINSKY, P.

    2005-05-01

    This is the final report of the work performed under the LANL contract on the modeling and fission cross section for americium isotopes (May 2004-June 2005). The purpose of the contract was to provide fission cross sections for americium isotopes with the nuclear reaction model code EMPIRE 2.19. The following work was performed: (1) Fission calculations capability suitable for americium was implemented to the EMPIRE-2.19 code. (2) Calculations of neutron-induced fission cross sections for {sup 239}Am to {sup 244g}Am were performed with EMPIRE-2.19 for energies up to 20 MeV. For the neutron-induced reaction of {sup 240}Am, fission cross sections were predicted and uncertainties were assessed. (3) Set of fission barrier heights for each americium isotopes was chosen so that the new calculations fit the experimental data and follow the systematics found in the literature.

  10. Fission meter

    DOE Patents [OSTI]

    Rowland, Mark S.; Snyderman, Neal J.

    2012-04-10

    A neutron detector system for discriminating fissile material from non-fissile material wherein a digital data acquisition unit collects data at high rate, and in real-time processes large volumes of data directly into information that a first responder can use to discriminate materials. The system comprises counting neutrons from the unknown source and detecting excess grouped neutrons to identify fission in the unknown source.

  11. Fission theory: Its relevance to the nuclear cross section data base

    SciTech Connect (OSTI)

    Lynn, J.E.

    1989-01-01

    The development of fission reaction theory in relation to its predictive power in the calculation of neutron cross-sections is reviewed. The topics covered include the transition state spectrum and the channel theory; the discovery of complex topography in the fission barrier and the consequences of intermediate structure in fission cross-sections; the evidence of experimental data in parameterizing the fission barrier; and the role of other aspects of collective nuclear motion in controlling fission reaction rates. 51 refs., 6 figs.

  12. Microscopic Calculation of Fission Fragment Energies for the...

    Office of Scientific and Technical Information (OSTI)

    for the 239Pu(nth,f) Reaction Citation Details In-Document Search Title: Microscopic Calculation of Fission Fragment Energies for the 239Pu(nth,f) Reaction We calculate the ...

  13. Interplay between compound and fragments aspects of nuclear fission and

    Office of Scientific and Technical Information (OSTI)

    heavy-ion reaction (Conference) | SciTech Connect Conference: Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction The scission point in nuclear fission plays a special role where one-body system changes to two-body system. Inverse of this situation is realized in heavy-ion fusion reaction where two-body system changes to

  14. Reexamination of fission fragment angular distributions and the fission process: Formalism

    SciTech Connect (OSTI)

    Bond, P.D.

    1985-08-01

    The theory of fission fragment angular distributions is examined and the universally used expression is found to be valid only under restrictive assumptions. A more general angular distribution formula is derived and applied to recent data of high spin systems. At the same time it is shown that the strong anisotropies observed from such systems can be understood without changing the essential basis of standard fission theory. The effects of reaction mechanisms other than complete fusion on fission fragment angular distributions are discussed and possible angular distribution signatures of noncompound nucleus formation are mentioned.

  15. Microscopic Description of Nuclear Fission: Fission Barrier Heights...

    Office of Scientific and Technical Information (OSTI)

    Conference: Microscopic Description of Nuclear Fission: Fission Barrier Heights of Even-Even Actinides Citation Details In-Document Search Title: Microscopic Description of Nuclear ...

  16. Interplay between compound and fragments aspects of nuclear fission...

    Office of Scientific and Technical Information (OSTI)

    The scission point in nuclear fission plays a special role where one-body system changes to two-body system. Inverse of this situation is realized in heavy-ion fusion reaction ...

  17. Our 50-year odyssey with fission: Summary

    SciTech Connect (OSTI)

    Nix, J.R.

    1989-01-01

    On the occasion of this International Conference on Fifty Years Research in Nuclear Fission, we summarize our present understanding of the fission process and the challenges that lie ahead. The basic properties of fission arise from a delicate competition between disruptive Coulomb forces, cohesive nuclear forces, and fluctuating shell and pairing forces. These static forces are primarily responsible for such experimental phenomena as deformed ground-state nuclear shapes, fission into fragments of unequal size, sawtooth neutron yields, spontaneously fissioning isomers, broad resonances and narrow intermediate structure in fission cross sections, and cluster radioactivity. However, inertial and dissipative forces also play decisive roles in the dynamical evolution of a fissioning nucleus. The energy dissipated between the saddle and scission points is small for low initial excitation energy at the saddle point and increases with increasing excitation energy. At moderate excitation energies, the dissipation of collective energy into internal single-particle excitation energy proceeds largely through the interaction of nucleons with the mean field and with each other in the vicinity of the nuclear surface, as well as through the transfer of nucleons between the two portions of the evolving dumbell-like system. These unique dissipation mechanisms arise from the Pauli exclusion principle for fermions and the details of the nucleon-nucleon interaction, which make the mean free path of a nucleon near the Fermi surface at low excitation energy longer than the nuclear radius. With its inverse process of heavy-ion fusion reactions, fission continues to yield surprises in the study of large-amplitude collective nuclear motion. 87 refs., 12 figs.

  18. Fission gas detection system

    DOE Patents [OSTI]

    Colburn, Richard P. (Pasco, WA)

    1985-01-01

    A device for collecting fission gas released by a failed fuel rod which device uses a filter to pass coolant but which filter blocks fission gas bubbles which cannot pass through the filter due to the surface tension of the bubble.

  19. Biomodal spontaneous fission

    SciTech Connect (OSTI)

    Hulet, E.K. )

    1989-09-26

    Investigations of mass and kinetic-energy distributions from spontaneous fission have been extended in recent years to an isotope of element 104 and, for half-lives, to an isotope of element 108. The results have been surprising in that spontaneous fission half-lives have turned out to be much longer than expected and mass and kinetic- energy distributions were found to abruptly shift away from those of the lighter actinides, showing two modes of fission. These new developments have caused a re-evaluation of our understanding of the fission process, bringing an even deeper appreciation of the role played by nuclear shell effects upon spontaneous fission properties. 16 refs., 10 figs.

  20. Liquid uranium alloy-helium fission reactor

    DOE Patents [OSTI]

    Minkov, Vladimir (Skokie, IL)

    1986-01-01

    This invention teaches a nuclear fission reactor having a core vessel and at least one tandem heat exchanger vessel coupled therewith across upper and lower passages to define a closed flow loop. Nuclear fuel such as a uranium alloy in its liquid phase fills these vessels and flow passages. Solid control elements in the reactor core vessel are adapted to be adjusted relative to one another to control fission reaction of the liquid fuel therein. Moderator elements in the other vessel and flow passages preclude fission reaction therein. An inert gas such as helium is bubbled upwardly through the heat exchanger vessel operable to move the liquid fuel upwardly therein and unidirectionally around the closed loop and downwardly through the core vessel. This helium gas is further directed to heat conversion means outside of the reactor vessels to utilize the heat from the fission reaction to generate useful output. The nuclear fuel operates in the 1200.degree.-1800.degree. C. range, and even higher to 2500.degree. C., limited only by the thermal effectiveness of the structural materials, increasing the efficiency of power generation from the normal 30-35% with 300.degree.-500.degree. C. upper limit temperature to 50-65%. Irradiation of the circulating liquid fuel, as contrasted to only localized irradiation of a solid fuel, provides improved fuel utilization.

  1. Liquid uranium alloy-helium fission reactor

    DOE Patents [OSTI]

    Minkov, V.

    1984-06-13

    This invention describes a nuclear fission reactor which has a core vessel and at least one tandem heat exchanger vessel coupled therewith across upper and lower passages to define a closed flow loop. Nuclear fuel such as a uranium alloy in its liquid phase fills these vessels and flow passages. Solid control elements in the reactor core vessel are adapted to be adjusted relative to one another to control fission reaction of the liquid fuel therein. Moderator elements in the other vessel and flow passages preclude fission reaction therein. An inert gas such as helium is bubbled upwardly through the heat exchanger vessel operable to move the liquid fuel upwardly therein and unidirectionally around the closed loop and downwardly through the core vessel. This helium gas is further directed to heat conversion means outside of the reactor vessels to utilize the heat from the fission reaction to generate useful output. The nuclear fuel operates in the 1200 to 1800/sup 0/C range, and even higher to 2500/sup 0/C.

  2. Attempt to confirm superheavy element production in the 48Ca +238U reaction

    SciTech Connect (OSTI)

    Gregorich, K.E.; Loveland, W.; Peterson, D.; Zielinski, P.M.; Nelson, S.L.; Chung, Y.H.; Dullmann, Ch.E.; Folden III, C.M.; Aleklett,K.; Eichler, R.; Hoffman D.C.; Omtvedt, J.P.; Pang, G.K.; Schwantes,J.M.; Soverna, S.; Sprunger, P.; Sudowe, R.; Wilson, R.E.; Nitsche, H.

    2005-03-24

    An attempt to confirm production of superheavy elements in the reaction of 48Ca beams with actinide targets has been performed using the 238U(48Ca,3n)283112 reaction. Two 48Ca projectile energies were used, that spanned the energy range where the largest cross sections have been reported for this reaction. No spontaneous fission events were observed. No alpha decay chains consistent with either reported or theoretically predicted element 112 decay properties were observed. The cross section limits reached are significantly smaller than the recently reported cross sections.

  3. Attempt to confirm superheavy element production in the {sup 48}Ca+{sup 238}U reaction

    SciTech Connect (OSTI)

    Gregorich, K.E.; Sudowe, R.; Loveland, W.; Sprunger, P.; Peterson, D.; Zielinski, P.M.; Nelson, S.L.; Duellmann, Ch.E.; Folden III, C.M.; Hoffman, D.C.; Wilson, R.E.; Nitsche, H.; Chung, Y.H.; Aleklett, K.; Eichler, R.; Soverna, S.; Omtvedt, J.P.; Pang, G.K.; Schwantes, J.M.

    2005-07-01

    An attempt to confirm production of superheavy elements in the reaction of {sup 48}Ca beams with actinide targets has been performed using the {sup 238}U({sup 48}Ca,3n){sup 283}112 reaction. Two {sup 48}Ca projectile energies were used that spanned the energy range where the largest cross sections have been reported for this reaction. No spontaneous fission events were observed. No {alpha} decay chains consistent with either reported or theoretically predicted element 112 decay properties were observed. The cross-section limits reached are significantly smaller than the recently reported cross sections.

  4. Fission Barriers of Compound Superheavy Nuclei

    SciTech Connect (OSTI)

    Pei, Junchen; Nazarewicz, Witold; Sheikh, J. A.; Kerman, A. K.

    2009-01-01

    The dependence of fission barriers on the excitation energy of the compound nucleus impacts the survival probability of superheavy nuclei synthesized in heavy-ion fusion reactions. We study the temperature-dependent fission barriers by means of the self-consistent nuclear density functional theory. The equivalence of isothermal and isentropic descriptions is demonstrated. The effect of the particle gas is found to be negligible in the range of temperatures studied. Calculations have been carried out for ^{264}Fm, ^{272}Ds, ^{278}112, ^{292}114, and ^{312}124. For nuclei around ^{278}112 produced in "cold fusion" reactions, we predict a more rapid decrease of fission barriers with temperature as compared to the nuclei around ^{292}114 synthesized in "hot fusion" experiments. This is explained in terms of the difference between the ground-state and fission-barrier temperatures. Our calculations are consistent with the long survival probabilities of the superheavy elements produced in Dubna with the ^{48}Ca beam.

  5. Microscopic Theory of Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Microscopic Theory of Fission Citation Details In-Document Search Title: Microscopic Theory of Fission Authors: Younes, W ; Gogny, D Publication Date: 2008-01-03 OSTI Identifier: 924187 Report Number(s): LLNL-PROC-400347 DOE Contract Number: W-7405-ENG-48 Resource Type: Conference Resource Relation: Conference: Presented at: Compound Nuclear Reactions and Related Topics, Fish Camp, CA, United States, Oct 22 - Oct 26, 2007 Research Org: Lawrence Livermore National Laboratory (LLNL), Livermore, CA

  6. Process for treating fission waste

    DOE Patents [OSTI]

    Rohrmann, Charles A.; Wick, Oswald J.

    1983-01-01

    A method is described for the treatment of fission waste. A glass forming agent, a metal oxide, and a reducing agent are mixed with the fission waste and the mixture is heated. After melting, the mixture separates into a glass phase and a metal phase. The glass phase may be used to safely store the fission waste, while the metal phase contains noble metals recovered from the fission waste.

  7. Fire extinguishant for fissionable material

    DOE Patents [OSTI]

    Schmitt, Charles R.

    1976-01-01

    Carbon microspheres impregnated with a neutron poison are used as an extinguishant for radioactive and fissionable metal fires.

  8. Flow cytometric detection of human immunodeficiency virus type 1 proviral DNA by the polymerase chain reaction incorporating digoxigenin- or fluorescein-labeled dUTP

    SciTech Connect (OSTI)

    Yang, Gang; Olson, J.C.; Pu, R.; Vyas, G.N.

    1995-10-01

    Serological assays are routinely used in the laboratory diagnosis of human immunodeficiency virus type-1 (HrV-1) infection, but the polymerase chain reaction (PCR) is ultimately the most sensitive and direct method for establishing definitive diagnosis. As an alternative to the conventional radioactive PCR procedure we have developed and evaluated a pair of rapid nonradioisotopic flow cytometric detection methods. Using heminested PCR we directly incorporated fluorescein-12-dUTP (fluo-dUTP) or digoxigenin-11-dUTP (dig-dUTP) into the PCR-amplicons. The labeled amplicons were hybridized with biotinylated antisense and sense probes, followed by capture of the hybrid DNA using streptavidin-coated beads which were finally analyzed in a flow cytometer by (1) direct detection of the fluorescence intensity of the amplicons incorporating fluo-dUTP and (2) immunodetection of the amplicons incorporating dig-dUTP by anti-digoxigenin IgG labeled with fluorescein isothiocyanate (FITC). Although both assays were functionally comparable with radiolabeled probe in reliably detecting as low as five copies of HIV-1 proviral DNA sequences, the immunodetection of dig-dUTP consistently yielded higher mean channel fluorescence and gave a stable signal over an extended period of 12-14 weeks. In testing a panel of 20 pedigreed PBMC specimens from blood donors with or without HIV-1 infection, the results of both flow cytometric assays were identical with those of the conventional radioactive procedure. Therefore, we conclude that the dig-dUTP incorporation in amplicons, hybridization with a pair of sense-antisense biotinylated probes and immunodetection of hybrids by flow cytometric analyses is the nonisotopic method of choice for PCR-diagnosis of HIV-1 infection. 21 refs., 2 figs., 4 tabs.

  9. Measurements of delayed neutron decay constants and fission yields from {sup 235}U, {sup 237}Np, {sup 241}Am, and {sup 243}Am

    SciTech Connect (OSTI)

    Saleh, H.H.; Parish, T.A.; Raman, S.; Shinohara, Nobuo

    1997-01-01

    Isotopes of the higher actinide elements are produced as a result of successive radiative capture reactions in the uranium fuel of nuclear reactors. Typically, these transuranic isotopes decay through long chains, have long half-lives, and dominate the long-term toxicity of spent reactor fuel. One of the options for high level waste management is to remove the higher actinide elements from spent fuel by chemical processing, to load them into new special fuel elements, and to transmute them by neutron-induced fission into shorter-lived fission fragments. Reactors designed to achieve high actinide fission (transmutation) rates are called actinide burners. In such reactors, the actinide wastes would constitute much of the fissionable fuel. Due to the high transuranic isotope loadings in the fuel of actinide burners, the neutronic properties of the higher actinide isotopes will have a significant effect on the criticality and safety characteristics of such reactors. While there is an extensive operational database for reactors fueled with uranium and plutonium, operating experience with fuel containing large amounts of actinide wastes is quite limited. Two important neutronic properties of actinide burner cores are their reactivity and their delayed neutron fraction. Both of these properties will be strongly influenced by the neutronic characteristics of the actinide waste isotopes. Here, delayed neutron yields and decay constants for {sup 235}U, {sup 237}Np, {sup 241}Am, and {sup 243}Am were measured at the Texas A and M University TRIGA reactor using a fast pneumatic transfer system. The detection system consisted of an array of BF{sub 3} proportional counters embedded in a polyethylene cylinder. The measured values of the total delayed neutron yield per 100 fissions from thermal neutron-induced fission of {sup 235}U, {sup 237}Np, {sup 241}Am, and {sup 243}Am were determined to be 1.59 {+-} 0.04, 1.29 {+-} 0.04, 0.49 {+-} 0.02, and 0.84 {+-} 0.04, respectively.

  10. Feasibility of an antiproton catalyzed fission fragment rocket

    SciTech Connect (OSTI)

    Hdinger, D.S.

    1992-03-01

    The purpose of this project was to investigate the feasibility of an antiproton catalyzed fission fragment rocket (FFR). The FFR is characterized by the extraction of fission fragments from the fissile fuel, and the utilization of their kinetic energy for thrust generation. A significant drawback to previous FFR designs was the requirement to maintain a critical nuclear pile as the fission fragment source. The author examined the possibility of replacing the critical pile with a sub-critical pile driven by antiprotons. Recent experiments have revealed that antiprotons stimulate highly energetic fissions in {sup 238}U, with a neutron multiplicity of 13.7 neutrons per fission. This interaction was used as a throttled neutron source. The pile consisted of layers of fissile coated fibers which are designed to allow fission fragments to escape them, where the fragments collide with a fluid. The heated fluid is then ejected from the rocket to provide thrust. The calculations performed indicate that each antiproton injected into the pile can stimulate 8 or more fissions while maintaining a neutron multiplication of less than 0.4. Based on the results seen, the engine design presented is inadequate. Limitations introduced by the reaction fluid far outweigh the simplicity-of-design gained. Despite this, the basic idea of using the antiproton-U interaction as a source of spacecraft propulsion warrants further study.

  11. A New Method of Prompt Fission Neutron Energy Spectrum Unfolding

    SciTech Connect (OSTI)

    Zeynalova, O. V. [Moscow State Institute of Radioengineering, Electronics and Automation, Moscow (Russian Federation); Joint Institute for Nuclear Research, Dubna (Russian Federation); Zeynalov, Sh. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Hambsch, F.-J.; Oberstedt, S. [EC-JRC-Institute for Reference Materials and Measurements, Geel (Belgium)

    2010-11-25

    The prompt neutron emission in spontaneous fission of {sup 252}Cf has been investigated applying digital signal electronics along with associated digital signal processing algorithms. The goal was to find out the reasons of a long time existing discrepancy between theoretical calculations and the measurements of prompt fission neutron (PFN) emission dependence on the total kinetic energy (TKE) of fission fragments (FF). On the one hand the {sup 252}Cf(sf) reaction is one of the main references for nuclear data, on the other hand the understanding of PFN emission mechanism is very important for nuclear fission theory. Using a twin Frisch-grid ionization chamber for fission fragment (FF) detection and a NE213-equivalent neutron detector in total about 10{sup 7} fission fragment-neutron coincidences have been registered. Fission fragment kinetic energy, mass and angular distribution, neutron time-of-flight and pulse shape have been investigated using a 12 bit waveform digitizer. The signal waveforms have been analyzed using digital signal processing algorithms. For the first time the dependence of the number of emitted neutrons as a function of total kinetic energy (TKE) of the fragments is in very good agreement with theoretical calculations in the range of TKE from 140-220 MeV.

  12. Measurements of actinide-fission product yields in Caliban and Prospero metallic core reactor fission neutron fields

    SciTech Connect (OSTI)

    Casoli, P.; Authier, N. [CEA, Centre de Valduc, 21120 Is-sur-Tille (France); Laurec, J.; Bauge, E.; Granier, T. [CEA, Centre DIF, 91297 Arpajon (France)

    2011-07-01

    In the 1970's and early 1980's, an experimental program was performed on the facilities of the CEA Valduc Research Center to measure several actinide-fission product yields. Experiments were, in particular, completed on the Caliban and Prospero metallic core reactors to study fission-neutron-induced reactions on {sup 233}U, {sup 235}U, and {sup 239}Pu. Thick actinide samples were irradiated and the number of nuclei of each fission product was determined by gamma spectrometry. Fission chambers were irradiated simultaneously to measure the numbers of fissions in thin deposits of the same actinides. The masses of the thick samples and the thin deposits were determined by mass spectrometry and alpha spectrometry. The results of these experiments will be fully presented in this paper for the first time. A description of the Caliban and Prospero reactors, their characteristics and performances, and explanations about the experimental approach will also be given in the article. A recent work has been completed to analyze and reinterpret these measurements and particularly to evaluate the associated uncertainties. In this context, calculations have also been carried out with the Monte Carlo transport code Tripoli-4, using the published benchmarked Caliban description and a three-dimensional model of Prospero, to determine the average neutron energy causing fission. Simulation results will be discussed in this paper. Finally, new fission yield measurements will be proposed on Caliban and Prospero reactors to strengthen the results of the first experiments. (authors)

  13. Fusion-fission hybrid studies in the United States

    SciTech Connect (OSTI)

    Moir, R.W.; Lee, J.D.; Berwald, D.H.; Cheng, E.T.; Delene, J.G.; Jassby, D.L.

    1986-05-20

    Systems and conceptual design studies have been carried out on the following three hybrid types: (1) The fission-suppressed hybrid, which maximizes fissile material produced (Pu or /sup 233/U) per unit of total nuclear power by suppressing the fission process and multiplying neutrons by (n,2n) reactions in materials like beryllium. (2) The fast-fission hybrid, which maximizes fissile material produced per unit of fusion power by maximizing fission of /sup 238/U (Pu is produced) in which twice the fissile atoms per unit of fusion power (but only a third per unit of nuclear power) are made. (3) The power hybrid, which amplifies power in the blanket for power production but does not produce fuel to sell. All three types must sell electrical power to be economical.

  14. Event-by-Event Simulation of Induced Fission

    SciTech Connect (OSTI)

    Vogt, R; Randrup, J

    2007-12-13

    We are developing a novel code that treats induced fission by statistical (or Monte-Carlo) simulation of individual decay chains. After its initial excitation, the fissionable compound nucleus may either deexcite by evaporation or undergo binary fission into a large number of fission channels each with different energetics involving both energy dissipation and deformed scission prefragments. After separation and Coulomb acceleration, each fission fragment undergoes a succession of individual (neutron) evaporations, leading to two bound but still excited fission products (that may further decay electromagnetically and, ultimately, weakly), as well as typically several neutrons. (The inclusion of other possible ejectiles is planned.) This kind of approach makes it possible to study more detailed observables than could be addressed with previous treatments which have tended to focus on average quantities. In particular, any type of correlation observable can readily be extracted from a generated set of events. With a view towards making the code practically useful in a variety of applications, emphasis is being put on making it numerically efficient so that large event samples can be generated quickly. In its present form, the code can generate one million full events in about 12 seconds on a MacBook laptop computer. The development of this qualitatively new tool is still at an early stage and quantitative reproduction of existing data should not be expected until a number of detailed refinement have been implemented.

  15. SHAPED FISSIONABLE METAL BODIES

    DOE Patents [OSTI]

    Wigner, E.P.; Williamson, R.R.; Young, G.J.

    1958-10-14

    A technique is presented for grooving the surface of fissionable fuel elements so that expansion can take place without damage to the interior structure of the fuel element. The fissionable body tends to develop internal stressing when it is heated internally by the operation of the nuclear reactor and at the same time is subjected to surface cooling by the circulating coolant. By producing a grooved or waffle-like surface texture, the annular lines of tension stress are disrupted at equally spaced intervals by the grooves, thereby relieving the tension stresses in the outer portions of the body while also facilitating the removal of accumulated heat from the interior portion of the fuel element.

  16. Microscopic Description of Nuclear Fission: Fission Barrier Heights...

    Office of Scientific and Technical Information (OSTI)

    Resource Type: Conference Resource Relation: Conference: Presented at: 5th International Conference on Fission and properties of neutron-rich nuclei, Sanibel Island, FL, United ...

  17. Science based stockpile stewardship, uncertainty quantification, and fission fragment beams

    SciTech Connect (OSTI)

    Stoyer, M A; McNabb, D; Burke, J; Bernstein, L A; Wu, C Y

    2009-09-14

    Stewardship of this nation's nuclear weapons is predicated on developing a fundamental scientific understanding of the physics and chemistry required to describe weapon performance without the need to resort to underground nuclear testing and to predict expected future performance as a result of intended or unintended modifications. In order to construct more reliable models, underground nuclear test data is being reanalyzed in novel ways. The extent to which underground experimental data can be matched with simulations is one measure of the credibility of our capability to predict weapon performance. To improve the interpretation of these experiments with quantified uncertainties, improved nuclear data is required. As an example, the fission yield of a device was often determined by measuring fission products. Conversion of the measured fission products to yield was accomplished through explosion code calculations (models) and a good set of nuclear reaction cross-sections. Because of the unique high-fluence environment of an exploding nuclear weapon, many reactions occurred on radioactive nuclides, for which only theoretically calculated cross-sections are available. Inverse kinematics reactions at CARIBU offer the opportunity to measure cross-sections on unstable neutron-rich fission fragments and thus improve the quality of the nuclear reaction cross-section sets. One of the fission products measured was {sup 95}Zr, the accumulation of all mass 95 fission products of Y, Sr, Rb and Kr (see Fig. 1). Subsequent neutron-induced reactions on these short lived fission products were assumed to cancel out - in other words, the destruction of mass 95 nuclides was more or less equal to the production of mass 95 nuclides. If a {sup 95}Sr was destroyed by an (n,2n) reaction it was also produced by (n,2n) reactions on {sup 96}Sr, for example. However, since these nuclides all have fairly short half-lives (seconds to minutes or even less), no experimental nuclear reaction

  18. Benchmarking the LAHET fission models

    SciTech Connect (OSTI)

    Prael, R.E.

    1995-12-31

    There has been considerable interest in improving the fission models in the LAHET Monte Carlo code for the transport and interaction of nucleons, pions, muons, fight ions, and antinucleons. Although subactinide fission contributes little to neutron production in lead or tungsten targets, it can be significant for simulation of target activation and fission product contamination. The availability of new data permits new comparisons to be made between experiment and calculation.

  19. Testing actinide fission yield treatment in CINDER90 for use in MCNP6 burnup calculations

    SciTech Connect (OSTI)

    Fensin, Michael Lorne; Umbel, Marissa

    2015-09-18

    Most of the development of the MCNPX/6 burnup capability focused on features that were applied to the Boltzman transport or used to prepare coefficients for use in CINDER90, with little change to CINDER90 or the CINDER90 data. Though a scheme exists for best solving the coupled Boltzman and Bateman equations, the most significant approximation is that the employed nuclear data are correct and complete. Thus, the CINDER90 library file contains 60 different actinide fission yields encompassing 36 fissionable actinides (thermal, fast, high energy and spontaneous fission). Fission reaction data exists for more than 60 actinides and as a result, fission yield data must be approximated for actinides that do not possess fission yield information. Several types of approximations are used for estimating fission yields for actinides which do not possess explicit fission yield data. The objective of this study is to test whether or not certain approximations of fission yield selection have any impact on predictability of major actinides and fission products. Further we assess which other fission products, available in MCNP6 Tier 3, result in the largest difference in production. Because the CINDER90 library file is in ASCII format and therefore easily amendable, we assess reasons for choosing, as well as compare actinide and major fission product prediction for the H. B. Robinson benchmark for, three separate fission yield selection methods: (1) the current CINDER90 library file method (Base); (2) the element method (Element); and (3) the isobar method (Isobar). Results show that the three methods tested result in similar prediction of major actinides, Tc-99 and Cs-137; however, certain fission products resulted in significantly different production depending on the method of choice.

  20. Fission Product Data Measured at Los Alamos for Fission Spectrum and Thermal Neutrons on {sup 239}Pu, {sup 235}U, {sup 238}U

    SciTech Connect (OSTI)

    Selby, H.D.; Mac Innes, M.R.; Barr, D.W.; Keksis, A.L.; Meade, R.A.; Burns, C.J.; Chadwick, M.B.; Wallstrom, T.C.

    2010-12-15

    We describe measurements of fission product data at Los Alamos that are important for determining the number of fissions that have occurred when neutrons are incident on plutonium and uranium isotopes. The fission-spectrum measurements were made using a fission chamber designed by the National Institute for Standards and Technology (NIST) in the BIG TEN critical assembly, as part of the Inter-laboratory Liquid Metal Fast Breeder Reactor (LMFBR) Reaction Rate (ILRR) collaboration. The thermal measurements were made at Los Alamos' Omega West Reactor. A related set of measurements were made of fission-product ratios (so-called R-values) in neutron environments provided by a number of Los Alamos critical assemblies that range from having average energies causing fission of 400-600 keV (BIG TEN and the outer regions of the Flattop-25 assembly) to higher energies (1.4-1.9 MeV) in the Jezebel, and in the central regions of the Flattop-25 and Flattop-Pu, critical assemblies. From these data we determine ratios of fission product yields in different fuel and neutron environments (Q-values) and fission product yields in fission spectrum neutron environments for {sup 99}Mo, {sup 95}Zr, {sup 137}Cs, {sup 140}Ba, {sup 141,143}Ce, and {sup 147}Nd. Modest incident-energy dependence exists for the {sup 147}Nd fission product yield; this is discussed in the context of models for fission that include thermal and dynamical effects. The fission product data agree with measurements by Maeck and other authors using mass-spectrometry methods, and with the ILRR collaboration results that used gamma spectroscopy for quantifying fission products. We note that the measurements also contradict earlier 1950s historical Los Alamos estimates by {approx}5-7%, most likely owing to self-shielding corrections not made in the early thermal measurements. Our experimental results provide a confirmation of the England-Rider ENDF/B-VI evaluated fission-spectrum fission product yields that were carried

  1. The series of carbon-chain complexes {Ru(dppe)Cp*}?{?-(C?C)x} (x = 48, 11): Synthesis, structures, properties and some reactions

    SciTech Connect (OSTI)

    Bruce, Michael I.; Cole, Marcus L.; Ellis, Benjamin G.; Gaudio, Maryka; Nicholson, Brian K.; Parker, Christian R.; Skelton, Brian W.; White, Allan H.

    2015-01-28

    The construction of a series of compounds {Ru(dppe)Cp*}2(?-C2x) (Ru*-C2x-Ru*, x = 48, 11)) is described. A direct reaction between RuCl(dppe)Cp* and Me3Si(Ctriple bond; length of mdashC)4SiMe3 afforded Ru*-C8-Ru* in 89% yield. The Pd(0)/Cu(I)-catalysed coupling of Ru{Ctriple bond; length of mdashCCtriple bond; length of mdashCAu(PPh3)}(dppe)Cp*Ru*-C4-Au (2 equiv.) with diiodoethyne gave Ru*-C10-Ru* (64%), or of 1 equiv. with I(Ctriple bond; length of mdashC)3I gave Ru*-C14-Ru* (36%); similarly, Ru{(Ctriple bond; length of mdashC)4Au(PPh3)}(dppe)Cp*Ru*-C8-Au and I(Ctriple bond; length of mdashC)3I gave Ru*-C22-Ru* (12%). Desilylation (TBAF) of Ru{(Ctriple bond; length of mdashC)xSiMe3}(dppe)Cp*Ru*-C2x-Si (x = 3, 4) followed by oxidative coupling [Cu(OAc)2/py] gave Ru*-C12-Ru* (82%) and Ru*-C16-Ru* (58%), respectively. Similar oxidative coupling of Ru(Ctriple bond; length of mdashCCtriple bond; length of mdashCH)(dppe)Cp* was a second route to Ru*-C8-Ru* (82%). Appropriate precursors are already known, or obtained by coupling of Ru*-C2x-Si (x = 2, 4) with AuCl(PPh3)/NaOMe [Ru*-C4-Au, 95%; Ru*-C8-Au, 74%] or from Pd(0)/Cu(I) catalysed coupling of Ru*-C2x-Au (x = 2, 3) with I(Ctriple bond; length of mdashC)2SiMe3 (Ru*-C8-Si, 64%; Ru*-C10-Si, 2%). Reactions between Ru*-C2x-Ru* (x = 3, 4) and Fe2(CO)9 gave {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}2Fe(C3-Ru*)2 and {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}{?3-C(Ctriple bond; length of mdashC)2[Ru(dppe)Cp*]} Fe(C3-Ru*)(C5-Ru*), respectively. The redox properties of the series of complexes with 2x = 216 were measured and showed a diminution of the separation of

  2. Post-scission fission theory: Neutron emission in fission

    SciTech Connect (OSTI)

    Madland, D.G.

    1997-11-01

    A survey of theoretical representations of two of the observables in neutron emission in fission is given, namely, the prompt fission neutron spectrum N (E) and the average prompt neutron multiplicity {bar {nu}}{sub p}. Early representations of the two observables are presented and their deficiencies are discussed. This is followed by summaries and examples of recent theoretical models for the calculation of these quantities. Emphasis is placed upon the predictability and accuracy of the recent models. In particular, the dependencies of N (E) and {bar {nu}}{sub p} upon the fissioning nucleus and its excitation energy are treated. Recent work in the calculation of the prompt fission neutron spectrum matrix N (E, E{sub n}), where E{sub n} is the energy of the neutron inducing fission, is then discussed. Concluding remarks address the current status of our ability to calculate these observables with confidence, the direction of future theoretical efforts, and limitations to current (and future) approaches.

  3. Fission-suppressed fusion breeder on the thorium cycle and nonprolifer...

    Office of Scientific and Technical Information (OSTI)

    Each fusion reaction can produce typically 0.6 fissile atoms and release about 1.6 times the 14 MeV neutron's energy in the blanket in the fission-suppressed design. This ...

  4. Average and effective Q-values for fission product average (n...

    Office of Scientific and Technical Information (OSTI)

    Average and effective Q-values for fission product average (n,2n) and (n,3n) reaction cross sections Citation Details In-Document Search Title: Average and effective Q-values for ...

  5. Average and effective Q-values for fission product average (n...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Average and effective Q-values for fission product average (n,2n) and (n,3n) reaction cross sections Citation Details In-Document Search Title: Average and ...

  6. TREATMENT OF FISSION PRODUCT WASTE

    DOE Patents [OSTI]

    Huff, J.B.

    1959-07-28

    A pyrogenic method of separating nuclear reactor waste solutions containing aluminum and fission products as buring petroleum coke in an underground retort, collecting the easily volatile gases resulting as the first fraction, he uminum chloride as the second fraction, permitting the coke bed to cool and ll contain all the longest lived radioactive fission products in greatly reduced volume.

  7. Fission Particle Emission Multiplicity Simulation

    Energy Science and Technology Software Center (OSTI)

    2006-09-27

    Simulates discrete neutron and gamma-ray emission from the fission of heavy nuclei that is either spontaneous or neutron induced. This is a function library that encapsulates the fission physics and is intended to be called Monte Carlo transport code.

  8. Fission throughout the periodic table

    SciTech Connect (OSTI)

    Moretto, L.G.; Wozniak, G.J.

    1989-04-01

    The dualistic view of fission and evaporation as two distinct compound nucleus processes is substituted with a unified view in which fission, complex fragment emission, and light particle evaporation are seen as different aspects of a single process. 47 refs., 22 figs.

  9. Microscopic Description of Induced Nuclear Fission (Conference...

    Office of Scientific and Technical Information (OSTI)

    Microscopic Description of Induced Nuclear Fission Citation Details In-Document Search Title: Microscopic Description of Induced Nuclear Fission You are accessing a document ...

  10. Excitation Energy Sorting Mechanisms in Fission (Conference)...

    Office of Scientific and Technical Information (OSTI)

    Excitation Energy Sorting Mechanisms in Fission Citation Details In-Document Search Title: Excitation Energy Sorting Mechanisms in Fission You are accessing a document from the ...

  11. Testing actinide fission yield treatment in CINDER90 for use in MCNP6 burnup calculations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Fensin, Michael Lorne; Umbel, Marissa

    2015-09-18

    Most of the development of the MCNPX/6 burnup capability focused on features that were applied to the Boltzman transport or used to prepare coefficients for use in CINDER90, with little change to CINDER90 or the CINDER90 data. Though a scheme exists for best solving the coupled Boltzman and Bateman equations, the most significant approximation is that the employed nuclear data are correct and complete. Thus, the CINDER90 library file contains 60 different actinide fission yields encompassing 36 fissionable actinides (thermal, fast, high energy and spontaneous fission). Fission reaction data exists for more than 60 actinides and as a result, fissionmore » yield data must be approximated for actinides that do not possess fission yield information. Several types of approximations are used for estimating fission yields for actinides which do not possess explicit fission yield data. The objective of this study is to test whether or not certain approximations of fission yield selection have any impact on predictability of major actinides and fission products. Further we assess which other fission products, available in MCNP6 Tier 3, result in the largest difference in production. Because the CINDER90 library file is in ASCII format and therefore easily amendable, we assess reasons for choosing, as well as compare actinide and major fission product prediction for the H. B. Robinson benchmark for, three separate fission yield selection methods: (1) the current CINDER90 library file method (Base); (2) the element method (Element); and (3) the isobar method (Isobar). Results show that the three methods tested result in similar prediction of major actinides, Tc-99 and Cs-137; however, certain fission products resulted in significantly different production depending on the method of choice.« less

  12. Localization of human elav-like neuronal protein 1 (Hel-N1) on chromosome 9p21 by chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization

    SciTech Connect (OSTI)

    Han, Jian; Knops, J.F.; Longshore, J.W.; King, P.H.

    1996-08-15

    Hel-N1 is a member of the highly conserved elav family of neuronal genes. It shares considerable sequence homology with HuD, another human member, and both genes are expressed in brain. HuD was recently mapped to chromosome 1p34. Here, we have utilized chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization to map Hel-N1 to chromosome 9p21. The different chromosomal locations of these homologous genes underscore their distinct identities. 10 refs., 2 figs.

  13. Spontaneous Fission Modes and Lifetimes of Superheavy Elements in the Nuclear Density Functional Theory

    SciTech Connect (OSTI)

    Staszczak, A,

    2013-01-01

    Background: The reactions with the neutron-rich 48Ca beam and actinide targets resulted in the detection of new superheavy (SH) nuclides with Z=104 118. The unambiguous identification of the new isotopes, however, still poses a problem because their -decay chains terminate by spontaneous fission (SF) before reaching the known region of the nuclear chart. The understanding of the competition between -decay and SF channels in SH nuclei is, therefore, of crucial importance for our ability to map the SH region and to assess its extent.

    Purpose: We perform self-consistent calculations of the competing decay modes of even-even SH isotopes with 108 Z 126 and 148 N 188.

    Methods: We use the state-of-the-art computational framework based on self-consistent symmetry-unrestricted nuclear density functional theory capable of describing the competition between nuclear attraction and electrostatic repulsion. We apply the SkM* Skyrme energy density functional. The collective mass tensor of the fissioning superfluid nucleus is computed by means of the cranking approximation to the adiabatic time-dependent Hartree-Fock-Bogoliubov (HFB) approach. This paper constitutes a systematic self-consistent study of spontaneous fission in the SH region, carried out at a full HFB level, that simultaneously takes into account both triaxiality and reflection asymmetry.

    Results: Breaking axial symmetry and parity turns out to be crucial for a realistic estimate of collective action; it results in lowering SF lifetimes by more than 7 orders of magnitude in some cases. We predict two competing SF modes: reflection symmetric modes and reflection asymmetric modes.

    Conclusions: The shortest-lived SH isotopes decay by SF; they are expected to lie in a narrow corridor formed by 280Hs, 284Fl, and 118284Uuo that separates the regions of SH nuclei synthesized in cold-fusion and hot-fusion reactions. The region of long-lived SH nuclei is expected to be centered on 294Ds with a total half-life of

  14. supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    supply chain

  15. Control system for a small fission reactor

    DOE Patents [OSTI]

    Burelbach, J.P.; Kann, W.J.; Saiveau, J.G.

    1985-02-08

    A system for controlling the reactivity of a small fission reactor includes an elongated, flexible hollow tube in the general form of a helical coiled spring axially positioned around and outside of the reactor vessel in an annular space between the reactor vessel and a surrounding cylindrical-shaped neutron reflector. A neutron absorbing material is provided within the hollow tube with the rate of the reaction controlled by the extension and compression of the hollow tube, e.g., extension of the tube increases reactivity while its compression reduces reactivity, in varying the amount of neutron absorbing material disposed between the reactor vessel and the neutron reflector. Conventional mechanical displacement means may be employed to control the coil density of the hollow tube as desired.

  16. Search for Singlet Fission Chromophores

    SciTech Connect (OSTI)

    Havlas, Z.; Akdag, A.; Smith, M. B.; Dron, P.; Johnson, J. C.; Nozik, A. J.; Michl, J.

    2012-01-01

    Singlet fission, in which a singlet excited chromophore shares its energy with a ground-state neighbor and both end up in their triplet states, is of potential interest for solar cells. Only a handful of compounds, mostly alternant hydrocarbons, are known to perform efficiently. In view of the large number of conditions that a successful candidate for a practical cell has to meet, it appears desirable to extend the present list of high performers to additional classes of compounds. We have (i) identified design rules for new singlet fission chromophores and for their coupling to covalent dimers, (ii) synthesized them, and (iii) evaluated their performance as neat solids or covalent dimers.

  17. Process for treating fission waste. [Patent application

    DOE Patents [OSTI]

    Rohrmann, C.A.; Wick, O.J.

    1981-11-17

    A method is described for the treatment of fission waste. A glass forming agent, a metal oxide, and a reducing agent are mixed with the fission waste and the mixture is heated. After melting, the mixture separates into a glass phase and a metal phase. The glass phase may be used to safely store the fission waste, while the metal phase contains noble metals recovered from the fission waste.

  18. Formation of Heavy Compound Nuclei, Their Survival and Correlation with Longtime-Scale Fission

    SciTech Connect (OSTI)

    Karamian, S. A.; Yakushev, A.-B.

    2007-05-22

    Fusion of two massive nuclei with formation of super-heavy compound nucleus (CN) is driven by the potential energy gradient, as follows from the analysis of nuclear reaction cross-sections. The conservative energy of the system is deduced in simple approximation using regularized nuclear mass and interaction barrier values. Different reaction for the synthesis of Zc (110-118) nuclei are compared and the favourable conditions are found for fusion of the stable (W-Pt) isotopes with radioactive fission fragment projectiles, like 94Kr or 100Sr. Thus, the cold fusion method can be extended for a synthesis of elements with Z > 113. Survival of the evaporation residue is defined by the neutron-to-fission probability ratio and by the successful emission of gammas at final step of the reaction. Numerical estimates are presented. Fixation of evaporation residue products must correlate with longtime-scale fission and available experimental results are discussed.

  19. Suppressed-fission ICF hybrid reactor

    SciTech Connect (OSTI)

    Hogan, W.J.; Meier, W.R.

    1986-05-20

    A suppressed-fission ICF hybrid reactor has been designed to maximize the production of /sup 233/U. In this design, Be is used as a neutron multiplier. An annular array of Be columns surrounds the fusion pulse inside the reaction chember. The Be columns consist of short cylinders of Be joined together with steel snap rings. Vertical holes in the Be carry liquid lithium coolant and steel-clad thorium fuel pins. The lithium coolant is supplied at the top of the chamber, traverses through the Be columns and exits at the bottom. The columns are attached to top and bottom plates in such a way as to tolerate radiation-induced swelling and the vibrations resulting from each fusion pulse. A thin (10 cm) liquid Li fall region protects the Be columns from direct exposure to the X-rays and debris emitted by the fuel capsule. A neutronics study of this design indicates that the specific production of /sup 233/U fuel is increased by operating at relatively large thorium volume fractions. A design at a fertile fuel fraction of 30 vol % produces a total breeding ratio of over 2.1. The /sup 6/Li to /sup 7/Li ratio is adjusted to keep the tritium breeding ratio at about 1.0. In such a reactor, about 3400 kg of /sup 233/U can be produced per full power year at a fusion power level of 800 MW. Reactor support ratios greater than 13 can be achieved, leading to beneficial results even if the fusion reactor cost is significantly greater than that of a fission reactor.

  20. Chain Reaction Innovations | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Unparalleled access to an innovation ecosystem Advisory network of business mentors ... A Fertile Ecosystem to Seed Complex Science Innovators in CRI can leverage the unique ...

  1. Fission Product Yields of {sup 233}U, {sup 235}U, {sup 238}U and {sup 239}Pu in Fields of Thermal Neutrons, Fission Neutrons and 14.7-MeV Neutrons

    SciTech Connect (OSTI)

    Laurec, J.; Adam, A.; Bruyne, T. de [Commissariat a l'Energie Atomique, Centre DAM-Ile de France (CEA DAM DIF), 91297 Arpajon (France); Bauge, E., E-mail: eric.bauge@cea.f [Commissariat a l'Energie Atomique, Centre DAM-Ile de France (CEA DAM DIF), 91297 Arpajon (France); Granier, T.; Aupiais, J.; Bersillon, O.; Le Petit, G. [Commissariat a l'Energie Atomique, Centre DAM-Ile de France (CEA DAM DIF), 91297 Arpajon (France); Authier, N.; Casoli, P. [Commissariat a l'Energie Atomique, Centre de Valduc, 21120 Is-sur-Tille (France)

    2010-12-15

    The yields of more than fifteen fission products have been carefully measured using radiochemical techniques, for {sup 235}U(n,f), {sup 239}Pu(n,f) in a thermal spectrum, for {sup 233}U(n,f), {sup 235}U(n,f), and {sup 239}Pu(n,f) reactions in a fission neutron spectrum, and for {sup 233}U(n,f), {sup 235}U(n,f), {sup 238}U(n,f), and {sup 239}Pu(n,f) for 14.7 MeV monoenergetic neutrons. Irradiations were performed at the EL3 reactor, at the Caliban and Prospero critical assemblies, and at the Lancelot electrostatic accelerator in CEA-Valduc. Fissions were counted in thin deposits using fission ionization chambers. The number of fission products of each species were measured by gamma spectrometry of co-located thick deposits.

  2. RECOVERY OF ALUMINUM FROM FISSION PRODUCTS

    DOE Patents [OSTI]

    Blanco, R.E.; Higgins, I.R.

    1962-11-20

    A method is given for recovertng aluminum values from aqueous solutions containing said values together with fission products. A mixture of Fe/sub 2/O/ sub 3/ and MnO/sub 2/ is added to a solution containing aluminum and fission products. The resulting aluminum-containing supernatant is then separated from the fission product-bearing metal oxide precipitate and is contacted with a cation exchange resin. The aluminum sorbed on the resin is then eluted and recovered. (AEC)

  3. Small Self-Regulating Fission Reactor System

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Small Self-Regulating Fission Reactor System ANTICIPATED IMPACT PATH FORWARD DESCRIPTION BACKGROUND & MOTIVATION INNOVATION A power system for special government applications Point of Contact: Patrick McClure, NEN-5, pmcclure@lanl.gov (505)667-9534 Small Self-Regulating Fission Reactor System A small self- regulating fission reactor made with U 235 . LANL and NASA with the support of NSTec performed a proof of concept test at the Nevada Test Site. Test apparatus - Nuclear material on left

  4. Fission barriers and half-lives

    SciTech Connect (OSTI)

    Moeller, P.; Nix, J.R.; Swiatecki, W.J.

    1989-01-01

    We briefly review the development of theoretical models for the calculation of fission barriers and half-lives. We focus on how results of actual calculations in a unified macroscopic-microscopic approach provide an interpretation of the mechanisms behind some of the large number of phenomena observed in fission. As instructive examples we choose studies of the rapidly varying fission properties of elements at the end of the periodic system. 31 refs., 10 figs.

  5. FISSION PRODUCT REMOVAL FROM ORGANIC SOLUTIONS

    DOE Patents [OSTI]

    Moore, R.H.

    1960-05-10

    The decontamination of organic solvents from fission products and in particular the treatment of solvents that were used for the extraction of uranium and/or plutonium from aqueous acid solutions of neutron-irradiated uranium are treated. The process broadly comprises heating manganese carbonate in air to a temperature of between 300 and 500 deg C whereby manganese dioxide is formed; mixing the manganese dioxide with the fission product-containing organic solvent to be treated whereby the fission products are precipitated on the manganese dioxide; and separating the fission product-containing manganese dioxide from the solvent.

  6. Control of a laser inertial confinement fusion-fission power plant

    SciTech Connect (OSTI)

    Moses, Edward L; Latkowski, Jeffrey F; Kramer, Kevin J

    2015-11-05

    A laser inertial-confinement fusion-fission energy power plant is described. The fusion-fission hybrid system uses inertial confinement fusion to produce neutrons from a fusion reaction of deuterium and tritium. The fusion neutrons drive a sub-critical blanket of fissile or fertile fuel. A coolant circulated through the fuel extracts heat from the fuel that is used to generate electricity. The inertial confinement fusion reaction can be implemented using central hot spot or fast ignition fusion, and direct or indirect drive. The fusion neutrons result in ultra-deep burn-up of the fuel in the fission blanket, thus enabling the burning of nuclear waste. Fuels include depleted uranium, natural uranium, enriched uranium, spent nuclear fuel, thorium, and weapons grade plutonium. LIFE engines can meet worldwide electricity needs in a safe and sustainable manner, while drastically shrinking the highly undesirable stockpiles of depleted uranium, spent nuclear fuel and excess weapons materials.

  7. Control of a laser inertial confinement fusion-fission power plant

    SciTech Connect (OSTI)

    Moses, Edward I.; Latkowski, Jeffery F.; Kramer, Kevin J.

    2015-10-27

    A laser inertial-confinement fusion-fission energy power plant is described. The fusion-fission hybrid system uses inertial confinement fusion to produce neutrons from a fusion reaction of deuterium and tritium. The fusion neutrons drive a sub-critical blanket of fissile or fertile fuel. A coolant circulated through the fuel extracts heat from the fuel that is used to generate electricity. The inertial confinement fusion reaction can be implemented using central hot spot or fast ignition fusion, and direct or indirect drive. The fusion neutrons result in ultra-deep burn-up of the fuel in the fission blanket, thus enabling the burning of nuclear waste. Fuels include depleted uranium, natural uranium, enriched uranium, spent nuclear fuel, thorium, and weapons grade plutonium. LIFE engines can meet worldwide electricity needs in a safe and sustainable manner, while drastically shrinking the highly undesirable stockpiles of depleted uranium, spent nuclear fuel and excess weapons materials.

  8. Comparative studies of actinide and sub-actinide fission cross section calculation from MCNP6 and TALYS

    SciTech Connect (OSTI)

    Perkasa, Y. S.; Waris, A. Kurniadi, R. Su'ud, Z.

    2014-09-30

    Comparative studies of actinide and sub-actinide fission cross section calculation from MCNP6 and TALYS have been conducted. In this work, fission cross section resulted from MCNP6 prediction will be compared with result from TALYS calculation. MCNP6 with its event generator CEM03.03 and LAQGSM03.03 have been validated and verified for several intermediate and heavy nuclides fission reaction data and also has a good agreement with experimental data for fission reaction that induced by photons, pions, and nucleons at energy from several ten of MeV to about 1 TeV. The calculation that induced within TALYS will be focused mainly to several hundred MeV for actinide and sub-actinide nuclides and will be compared with MCNP6 code and several experimental data from other evaluator.

  9. Fission fragment excited laser system

    DOE Patents [OSTI]

    McArthur, David A.; Tollefsrud, Philip B.

    1976-01-01

    A laser system and method for exciting lasing action in a molecular gas lasing medium which includes cooling the lasing medium to a temperature below about 150 K and injecting fission fragments through the lasing medium so as to preferentially excite low lying vibrational levels of the medium and to cause population inversions therein. The cooled gas lasing medium should have a mass areal density of about 5 .times. 10.sup.-.sup.3 grams/square centimeter, relaxation times of greater than 50 microseconds, and a broad range of excitable vibrational levels which are excitable by molecular collisions.

  10. Monitoring system for a liquid-cooled nuclear fission reactor

    DOE Patents [OSTI]

    DeVolpi, Alexander

    1987-01-01

    A monitoring system for detecting changes in the liquid levels in various regions of a water-cooled nuclear power reactor, viz., in the downcomer, in the core, in the inlet and outlet plenums, at the head, and elsewhere; and also for detecting changes in the density of the liquid in these regions. A plurality of gamma radiation detectors are used, arranged vertically along the outside of the reactor vessel, and collimator means for each detector limits the gamma-radiation it receives as emitting from only isolated regions of the vessel. Excess neutrons produced by the fission reaction will be captured by the water coolant, by the steel reactor walls, or by the fuel or control structures in the vessel. Neutron capture by steel generates gamma radiation having an energy level of the order of 5-12 MeV, whereas neutron capture by water provides an energy level of approximately 2.2 MeV, and neutron capture by the fission fuel or its cladding provides an energy level of 1 MeV or less. The intensity of neutron capture thus changes significantly at any water-metal interface. Comparative analysis of adjacent gamma detectors senses changes from the normal condition with liquid coolant present to advise of changes in the presence and/or density of the coolant at these specific regions. The gamma detectors can also sense fission-product gas accumulation at the reactor head to advise of a failure of fuel-pin cladding.

  11. Control system for a small fission reactor

    DOE Patents [OSTI]

    Burelbach, James P.; Kann, William J.; Saiveau, James G.

    1986-01-01

    A system for controlling the reactivity of a small fission reactor includes an elongated, flexible hollow tube in the general form of a helical coiled spring axially positioned around and outside of the reactor vessel in an annular space between the reactor vessel and a surrounding cylindrical-shaped neutron reflector. A neutron absorbing material is provided within the hollow tube with the rate of the reaction controlled by the extension and compression of the hollow tube, e.g., extension of the tube increases reactivity while its compression reduces reactivity, in varying the amount of neutron absorbing material disposed between the reactor vessel and the neutron reflector. Conventional mechanical displacement means may be employed to control the coil density of the hollow tube as desired. In another embodiment, a plurality of flexible hollow tubes each containing a neutron absorber are positioned adjacent to one another in spaced relation around the periphery of the reactor vessel and inside the outer neutron reflector with reactivity controlled by the extension and compression of all or some of the coiled hollow tubes. Yet another embodiment of the invention envisions the neutron reflector in the form of an expandable coil spring positioned in an annular space between the reactor vessel and an outer neutron absorbing structure for controlling the neutron flux reflected back into the reactor vessel.

  12. Fission Product Transmutation in Mixed Radiation Fields

    SciTech Connect (OSTI)

    Harmon, Frank; Burgett, Erick; Starovoitova, Valeriia; Tsveretkov, Pavel

    2015-01-15

    Work under this grant addressed a part of the challenge facing the closure of the nuclear fuel cycle; reducing the radiotoxicity of lived fission products (LLFP). It was based on the possibility that partitioning of isotopes and accelerator-based transmutation on particular LLFP combined with geological disposal may lead to an acceptable societal solution to the problem of management. The feasibility of using photonuclear processes based on the excitation of the giant dipole resonance (GDR) by bremsstrahlung radiation as a cost effective transmutation method was accessed. The nuclear reactions of interest: (γ,xn), (n,γ), (γ,p) can be induced by bremsstrahlung radiation produced by high power electron accelerators. The driver of these processes would be an accelerator that produces a high energy and high power electron beam of ~ 100 MeV. The major advantages of such accelerators for this purpose are that they are essentially available “off the shelf” and potentially would be of reasonable cost for this application. Methods were examined that used photo produced neutrons or the bremsstrahlung photons only, or use both photons and neutrons in combination for irradiations of selected LLFP. Extrapolating the results to plausible engineering scale transmuters it was found that the energy cost for 129I and 99Tc transmutation by these methods are about 2 and 4%, respectively, of the energy produced from 1000MWe.

  13. SOURCE OF PRODUCTS OF NUCLEAR FISSION

    DOE Patents [OSTI]

    Harteck, P.; Dondes, S.

    1960-03-15

    A source of fission product recoil energy suitable for use in radiation chemistry is reported. The source consists of thermal neutron irradiated glass wool having a diameter of 1 to 5 microns and containing an isotope fissionable by thermal neutrons, such as U/sup 235/.

  14. PROCESS FOR SEPARATING URANIUM FISSION PRODUCTS

    DOE Patents [OSTI]

    Spedding, F.H.; Butler, T.A.; Johns, I.B.

    1959-03-10

    The removal of fission products such as strontium, barium, cesium, rubidium, or iodine from neutronirradiated uranium is described. Uranium halide or elemental halogen is added to melted irradiated uranium to convert the fission products to either more volatile compositions which vaporize from the melt or to higher melting point compositions which separate as solids.

  15. Prompt fission neutron spectra of actinides

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Capote, R.; Chen, Y. -J.; Hambsch, F. -J.; Kornilov, N. V.; Lestone, J. P.; Litaize, O.; Morillon, B.; Neudecker, D.; Oberstedt, S.; Ohsawa, T.; et al

    2016-01-06

    Here, the energy spectrum of prompt neutrons emitted in fission (PFNS) plays a very important role in nuclear science and technology. A Coordinated Research Project (CRP) "Evaluation of Prompt Fission Neutron Spectra of Actinides" was established by the IAEA Nuclear Data Section in 2009, with the major goal to produce new PFNS evaluations with uncertainties for actinide nuclei.

  16. DOE Science Showcase - Fission Theory | OSTI, US Dept of Energy...

    Office of Scientific and Technical Information (OSTI)

    Fission Theory A predictive theory of nuclear fission has eluded physicists since 1939. ... Additional Links of Interest Office of Nuclear Energy, DOE Nuclear Physics, DOE Office ...

  17. Fifty years of nuclear fission: Nuclear data and measurements...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Fifty years of nuclear fission: Nuclear data and measurements series Citation Details In-Document Search Title: Fifty years of nuclear fission: Nuclear data and ...

  18. Fifty years of nuclear fission: Nuclear data and measurements...

    Office of Scientific and Technical Information (OSTI)

    Fifty years of nuclear fission: Nuclear data and measurements series Citation Details In-Document Search Title: Fifty years of nuclear fission: Nuclear data and measurements series ...

  19. Error estimates for fission neutron outputs (Conference) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    Error estimates for fission neutron outputs Citation Details In-Document Search Title: Error estimates for fission neutron outputs You are accessing a document from the...

  20. NUCLEAR ENERGY UNIVERSITY PROGRAMS Improved Fission Neutron Data...

    National Nuclear Security Administration (NNSA)

    NUCLEAR ENERGY UNIVERSITY PROGRAMS Improved Fission Neutron Data Base for Active ... the detection of neutrons from fission induced by fast neutrons or high-energy gamma rays. ...

  1. Future challenges for nuclear data research in fission (u) (Journal...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Future challenges for nuclear data research in fission (u) Citation Details In-Document Search Title: Future challenges for nuclear data research in fission (u) I ...

  2. Fission Product Separation/Extraction Techniques (Book) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    Book: Fission Product SeparationExtraction Techniques Citation Details In-Document Search Title: Fission Product SeparationExtraction Techniques No abstract prepared. Authors: ...

  3. Density Functional Theory Approach to Nuclear Fission (Conference...

    Office of Scientific and Technical Information (OSTI)

    Density Functional Theory Approach to Nuclear Fission Citation Details In-Document Search Title: Density Functional Theory Approach to Nuclear Fission You are accessing a document ...

  4. Overview of Fusion-Fission Hybrid Blankets for Laser Inertial...

    Office of Scientific and Technical Information (OSTI)

    Conference: Overview of Fusion-Fission Hybrid Blankets for Laser Inertial Fusion Energy (LIFE) Engine Citation Details In-Document Search Title: Overview of Fusion-Fission Hybrid ...

  5. Control of a laser inertial confinement fusion-fission power...

    Office of Scientific and Technical Information (OSTI)

    Control of a laser inertial confinement fusion-fission power plant Title: Control of a laser inertial confinement fusion-fission power plant A laser inertial-confinement ...

  6. Time dependent particle emission from fission products (Conference...

    Office of Scientific and Technical Information (OSTI)

    Time dependent particle emission from fission products Citation Details In-Document Search Title: Time dependent particle emission from fission products Decay heating following ...

  7. Description of induced nuclear fission with Skyrme energy functionals...

    Office of Scientific and Technical Information (OSTI)

    Citation Details In-Document Search Title: Description of induced nuclear fission with Skyrme energy functionals: Static potential energy surfaces and fission fragment properties ...

  8. Los Alamos National Laboratory fission basis (Conference) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    Los Alamos National Laboratory fission basis Citation Details In-Document Search Title: Los Alamos National Laboratory fission basis You are accessing a document from the ...

  9. Fusion-Fission Hybrid for Fissile Fuel Production without Processing...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Fusion-Fission Hybrid for Fissile Fuel Production without Processing Citation Details In-Document Search Title: Fusion-Fission Hybrid for Fissile Fuel Production ...

  10. Future challenges for nuclear data research in fission (u) (Journal...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Future challenges for nuclear data research in fission (u) Citation Details In-Document Search Title: Future challenges for nuclear data research in fission (u) ...

  11. Axisymmetric Magnetic Mirror Fusion-Fission Hybrid (Technical...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Axisymmetric Magnetic Mirror Fusion-Fission Hybrid Citation Details In-Document Search Title: Axisymmetric Magnetic Mirror Fusion-Fission Hybrid Authors: Moir, R ...

  12. Nuclear Fission and Fission{minus}Product Spectroscopy: Second International Workshop. Proceedings

    SciTech Connect (OSTI)

    Fioni, G.; Faust, H.; Oberstedt, S.; Hambsch, F.

    1998-10-01

    These proceedings represent papers presented at the Second International Workshop on Nuclear Fission and Fission{minus}Product Spectroscopy held in Seyssins, France in April, 1998. The objective was to bring together the specialists in the field to overview the situation and to assess our present understanding of the fission process. The topics presented at the conference included nuclear waste management, incineration, neutron driven transmutation, leakage etc., radioactive beams, neutron{minus}rich nuclei, neutron{minus}induced and spontaneous fission, ternary fission phenomena, angular momentum, parity and time{minus}reversal phenomena, and nuclear fission at higher excitation energy. Modern spectroscopic tools for gamma spectroscopy as applied to fission were also discussed. There were 53 papers presented at the conference,out of which 3 have been abstracted for the Energy,Science and Technology database.(AIP)

  13. Theoretical Description of the Fission Process

    SciTech Connect (OSTI)

    Witold Nazarewicz

    2009-10-25

    Advanced theoretical methods and high-performance computers may finally unlock the secrets of nuclear fission, a fundamental nuclear decay that is of great relevance to society. In this work, we studied the phenomenon of spontaneous fission using the symmetry-unrestricted nuclear density functional theory (DFT). Our results show that many observed properties of fissioning nuclei can be explained in terms of pathways in multidimensional collective space corresponding to different geometries of fission products. From the calculated collective potential and collective mass, we estimated spontaneous fission half-lives, and good agreement with experimental data was found. We also predicted a new phenomenon of trimodal spontaneous fission for some transfermium isotopes. Our calculations demonstrate that fission barriers of excited superheavy nuclei vary rapidly with particle number, pointing to the importance of shell effects even at large excitation energies. The results are consistent with recent experiments where superheavy elements were created by bombarding an actinide target with 48-calcium; yet even at high excitation energies, sizable fission barriers remained. Not only does this reveal clues about the conditions for creating new elements, it also provides a wider context for understanding other types of fission. Understanding of the fission process is crucial for many areas of science and technology. Fission governs existence of many transuranium elements, including the predicted long-lived superheavy species. In nuclear astrophysics, fission influences the formation of heavy elements on the final stages of the r-process in a very high neutron density environment. Fission applications are numerous. Improved understanding of the fission process will enable scientists to enhance the safety and reliability of the nations nuclear stockpile and nuclear reactors. The deployment of a fleet of safe and efficient advanced reactors, which will also minimize radiotoxic

  14. Development of position-sensitive time-of-flight spectrometer for fission fragment research

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Arnold, C. W.; Tovesson, F.; Meierbachtol, K.; Bredeweg, T.; Jandel, M.; Jorgenson, H. J.; Laptev, A.; Rusev, G.; Shields, D. W.; White, M.; et al

    2014-07-09

    A position-sensitive, high-resolution time-of-flight detector for fission fragments has been developed. The SPectrometer for Ion DEtermination in fission Research (SPIDER) is a 2E–2v spectrometer designed to measure the mass of light fission fragments to a single mass unit. The time pick-off detector pairs to be used in SPIDER have been tested with α-particles from 229Th and its decay chain and α-particles and spontaneous fission fragments from 252Cf. Each detector module is comprised of thin electron conversion foil, electrostatic mirror, microchannel plates, and delay-line anodes. Particle trajectories on the order of 700 mm are determined accurately to within 0.7 mm. Flightmore » times were measured with 250 ps resolution FWHM. Computed particle velocities are accurate to within 0.06 mm/ns corresponding to a precision of 0.5%. As a result, an ionization chamber capable of 400 keV energy resolution coupled with the velocity measurements described here will pave the way for modestly efficient measurements of light fission fragments with unit mass resolution.« less

  15. Fission-suppressed fusion breeder on the thorium cycle and nonproliferation

    SciTech Connect (OSTI)

    Moir, R. W.

    2012-06-19

    Fusion reactors could be designed to breed fissile material while suppressing fissioning thereby enhancing safety. The produced fuel could be used to startup and makeup fuel for fission reactors. Each fusion reaction can produce typically 0.6 fissile atoms and release about 1.6 times the 14 MeV neutron's energy in the blanket in the fission-suppressed design. This production rate is 2660 kg/1000 MW of fusion power for a year. The revenues would be doubled from such a plant by selling fuel at a price of 60/g and electricity at $0.05/kWh for Q=P{sub fusion}/P{sub input}=4. Fusion reactors could be designed to destroy fission wastes by transmutation and fissioning but this is not a natural use of fusion whereas it is a designed use of fission reactors. Fusion could supply makeup fuel to fission reactors that were dedicated to fissioning wastes with some of their neutrons. The design for safety and heat removal and other items is already accomplished with fission reactors. Whereas fusion reactors have geometry that compromises safety with a complex and thin wall separating the fusion zone from the blanket zone where wastes could be destroyed. Nonproliferation can be enhanced by mixing {sup 233}U with {sup 238}U. Also nonproliferation is enhanced in typical fission-suppressed designs by generating up to 0.05 {sup 232}U atoms for each {sup 233}U atom produced from thorium, about twice the IAEA standards of 'reduced protection' or 'self protection.' With 2.4%{sup 232}U, high explosive material is predicted to degrade owing to ionizing radiation after a little over 1/2 year and the heat rate is 77 W just after separation and climbs to over 600 W ten years later. The fissile material can be used to fuel most any fission reactor but is especially appropriate for molten salt reactors (MSR) also called liquid fluoride thorium reactors (LFTR) because of the molten fuel does not need hands on fabrication and handling.

  16. Quantum nature of ROT and TRI asymmetries in the ternary fission of nuclei

    SciTech Connect (OSTI)

    Bunakov, V. E.; Kadmensky, S. G.; Kadmensky, S. S.

    2010-08-15

    Effects of T-odd asymmetry in ternary-nuclear-fission reactions induced by polarized cold neutrons are considered within quantum theory. It is shown that the asymmetry coefficient can be expressed in terms of experimental angular distributions of third particles in reactions induced by unpolarized neutrons. The explicit form of this coefficient makes it possible to explain the difference in the magnitudes and signs of the TRI and ROT effects observed experimentally for different targets.

  17. Sleeve reaction chamber system

    SciTech Connect (OSTI)

    Northrup, M. Allen; Beeman, Barton V.; Benett, William J.; Hadley, Dean R.; Landre, Phoebe; Lehew, Stacy L.; Krulevitch, Peter A.

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  18. Tri And Rot Effects In Ternary Fission: What Can Be Learned?

    SciTech Connect (OSTI)

    Goennenwein, F.; Gagarski, A.; Petrov, G.; Guseva, I.; Zavarukhina, T.; Mutterer, M.; Kalben, J. von; Kopatch, Yu.; Tiourine, G.; Trzaska, W.; Sillanpaea, M.; Soldner, T.; Nesvizhevsky, V.

    2010-04-30

    Inducing fission by polarized neutrons allows studying subtle effects of the dynamics of the process. In the present experiments ternary fission of {sup 235}U and {sup 239}Pu was investigated with cold neutrons in the (n,f) reaction at the Institut Laue-Langevin, Grenoble. Asymmetries in the emission of ternary particles were discovered by making use of the neutron spin flipping. It was found that two effects are interfering. There is first an asymmetry in the total yields of ternary particles having been called the TRI-effect. Second, it was observed that the angular distributions of ternary particles are shifted back and forth when flipping the neutron spin. This shift was named ROT effect. Guided by trajectory calculations of the three-body decay, the signs and sizes of the ROT effect are interpreted in terms of the K-numbers of the transition states at the saddle point of fission.

  19. A New Facility for High-Energy Neutron-Induced Fission Studies

    SciTech Connect (OSTI)

    Prokofiev, A.; Carlsson, M.; Einarsson, L.; Haag, N.; Pomp, S.; Bergenwall, B.; Blomgren, J.; Hildebrand, A.; Johansson, C.; Mermod, P.; Oesterlund, M.; Tippawan, U.; Dangtip, S.

    2005-05-24

    A new facility is constructed for measurements of neutron-induced fission cross sections in the 20-180 MeV energy region versus the np scattering cross section, which is adopted as the primary neutron standard. The advantage of the experiment compared to earlier studies is that the fission-fragment detection and the neutron-flux measurement via np scattering are performed simultaneously and at the same position in the beam, and, therefore, many sources of systematic errors cancel out. Further reduction of systematic errors is achieved due to 'embedded' determination of effective solid angle of particle detectors using {alpha}-particles from the radioactive decay of the target nuclei. The performance of the facility is illustrated by first data obtained for angular distributions of fission fragments in the 238U(n,f) reaction.

  20. Chemical behavior of fission products in the ORNL fission product release program. Supplement. [PWR; BWR

    SciTech Connect (OSTI)

    Collins, J.L.; Osborne, M.F.; Lorenz, R.A.

    1983-01-01

    Tests data are presented for BWR and PWR rods in test HI-4 and test HI-5. Operating conditions fission product release data are included.

  1. Realistic fission models, new beta-decay half-lives and the r-process in neutron star mergers

    SciTech Connect (OSTI)

    Shibagaki, S.; Kajino, T. [Department of Astronomy, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Chiba, S. [Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology, Ookayama, Meguro-ku, Tokyo, 152-8850 (Japan); Lorusso, G.; Nishimura, S. [RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Mathews, G. J. [Center for Astrophysics, Department of Physics, University of Notre Dame, IN 46556 (United States)

    2014-05-02

    Almost half of heavy nuclei beyond iron are considered to be produced by rapid neutron capture process (r-process). This process occurs in the neutron-rich environment such as core-collapse supernovae or neutron star mergers, but the main production site is still unknown. In the r-process of neutron star mergers, nuclear fission reactions play an important role. Also beta-decay half-lives of magic nuclei are crucial for the r-process. We have carried out r-process nucleosynthesis calculations based upon new theoretical estimates of fission fragment distributions and new beta-decay half-lives for N=82 nuclei measured at RIBF-RIKEN. We investigate the effect of nuclear fission on abundance patterns in the matter ejected from neutron star mergers with two different fission fragment mass distributions. We also discuss how the new experimental beta-decay half-lives affect the r-process.

  2. On the belated discovery of fission

    SciTech Connect (OSTI)

    Pearson, J. Michael

    2015-06-15

    A remarkable sequence of missteps, misfortune, and oversights delayed the discovery of nuclear fission until the eve of World War II—and likely altered history’s course.

  3. Fission barrier properties, resonance fluctuations and isomer...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Submitted to: Proceedings of the 3rd International Conference on Fission and Properties of Neutron-Rich Nuclei, Nov. 3-9, 2002, Sanibel Island, FL ...

  4. Aqueous cutting fluid for machining fissionable materials

    DOE Patents [OSTI]

    Duerksen, Walter K.; Googin, John M.; Napier, Jr., Bradley

    1984-01-01

    The present invention is directed to a cutting fluid for machining fissionable material. The cutting fluid is formed of glycol, water and boron compound in an adequate concentration for effective neutron attenuation so as to inhibit criticality incidents during machining.

  5. MCNP6 Fission Multiplicity with FMULT Card

    SciTech Connect (OSTI)

    Wilcox, Trevor; Fensin, Michael Lorne; Hendricks, John S.; James, Michael R.; McKinney, Gregg W.

    2012-06-18

    With the merger of MCNPX and MCNP5 into MCNP6, MCNP6 now provides all the capabilities of both codes allowing the user to access all the fission multiplicity data sets. Detailed in this paper is: (1) the new FMULT card capabilities for accessing these different data sets; (2) benchmark calculations, as compared to experiment, detailing the results of selecting these separate data sets for thermal neutron induced fission on U-235.

  6. Modeling Fission Product Sorption in Graphite Structures

    SciTech Connect (OSTI)

    Szlufarska, Izabela; Morgan, Dane; Allen, Todd

    2013-04-08

    The goal of this project is to determine changes in adsorption and desorption of fission products to/from nuclear-grade graphite in response to a changing chemical environment. First, the project team will employ principle calculations and thermodynamic analysis to predict stability of fission products on graphite in the presence of structural defects commonly observed in very high- temperature reactor (VHTR) graphites. Desorption rates will be determined as a function of partial pressure of oxygen and iodine, relative humidity, and temperature. They will then carry out experimental characterization to determine the statistical distribution of structural features. This structural information will yield distributions of binding sites to be used as an input for a sorption model. Sorption isotherms calculated under this project will contribute to understanding of the physical bases of the source terms that are used in higher-level codes that model fission product transport and retention in graphite. The project will include the following tasks: Perform structural characterization of the VHTR graphite to determine crystallographic phases, defect structures and their distribution, volume fraction of coke, and amount of sp2 versus sp3 bonding. This information will be used as guidance for ab initio modeling and as input for sorptivity models; Perform ab initio calculations of binding energies to determine stability of fission products on the different sorption sites present in nuclear graphite microstructures. The project will use density functional theory (DFT) methods to calculate binding energies in vacuum and in oxidizing environments. The team will also calculate stability of iodine complexes with fission products on graphite sorption sites; Model graphite sorption isotherms to quantify concentration of fission products in graphite. The binding energies will be combined with a Langmuir isotherm statistical model to predict the sorbed concentration of fission

  7. Event-by-event fission simulation code, generates complete fission events

    Energy Science and Technology Software Center (OSTI)

    2013-04-01

    FREYA is a computer code that generates complete fission events. The output includes the energy and momentum of these final state particles: fission products, prompt neutrons and prompt photons. The version of FREYA that is to be released is a module for MCNP6.

  8. Heavy Element Synthesis Reactions W. Loveland Oregon State University

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reactions W. Loveland Oregon State University The role of ATLAS in helping us understand heavy element synthesis reactions and heavy element properties * Hot (E*=35-60 MeV) and Cold (E*=15 MeV) fusion reactions * Multi-nucleon transfer reactions * Fission * Atomic physics and chemistry of the heaviest elements * Structure of the heaviest nuclei The challenge of studying the heaviest elements at ATLAS * ATLAS beam time is oversubscribed * Low cross section studies - High luminosity - ATLAS has

  9. Statistics at work in heavy-ion reactions

    SciTech Connect (OSTI)

    Moretto, L.G.

    1982-07-01

    In the first part special aspects of the compound nucleus decay are considered. The evaporation of particles intermediate between nucleons and fission fragments is explored both theoretically and experimentally. The limitations of the fission decay width expression obtained with the transition state method are discussed, and a more general approach is proposed. In the second part the process of angular momentum transfer in deep inelastic reactions is considered. The limit of statistical equilibrium is studied and specifically applied to the estimation of the degree of alignment of the fragment spins. The magnitude and alignment of the transferred angular momentum is experimentally determined from sequentially emitted alpha, gamma, and fission fragments.

  10. Tests of the fission-evaporation competition in the deexcitation of heavy nuclei

    SciTech Connect (OSTI)

    Siwek-Wilczynska, K.; Skwira, I.; Wilczynski, J.

    2005-09-01

    In order to verify methods of calculating the fission-evaporation competition in reactions used to synthesize new super-heavy nuclei in 'cold' (1n) and 'hot' (3n,4n) fusion reactions, we present an analysis of existing experimental data on the evaporation-residue cross sections in two selected reactions, {sup 208}Pb({sup 16}O, xn) and {sup 236}U({sup 12}C, xn), for which complementary experimental information necessary to unambiguously calculate the survival probabilities is available: precisely measured fusion excitation functions and saddle-point energies of the fissioning nuclei, deduced from experiments. Standard statistical model calculations, with shell effects accounted for by the Ignatyuk formula, were carried out assuming the ground state shell corrections of Moeller et al., and zero shell correction at the saddle configuration (resulting from the presented systematics). Good agreement of the calculated evaporation-residue cross sections with experimental data for different xn reaction channels at low excitation energies leaves no room for modifications of the conventional way of calculating the {gamma}{sub n}/{gamma}{sub f} ratio, particularly for including into this ratio an additional preexponential factor (such as the Kramers fission hindrance factor or an effective collective factor) significantly different from 1.

  11. Prospects for further studies of effects of T-odd asymmetry in the emission of light particles in the polarized-neutron-induced ternary fission of heavy nuclei

    SciTech Connect (OSTI)

    Petrov, G. A. Gagarskii, A. M.; Guseva, I. S.; Kopatch, Yu. N.; Goennenwein, F.; Mutterer, M.

    2008-07-15

    Prospects for further studies of TRI and ROT effects of T-odd asymmetry in the emission of light particles in the ternary and binary fission of heavy nuclei that is induced by slow polarized neutrons are considered with a view to studying the mechanism for the formation of these effects and using them to get new information about fission dynamics. It is planned to investigate the dependence of the corresponding T-odd-asymmetry coefficients on the main characteristics of the fission reaction.

  12. Interference of fission amplitudes of neutron resonances and T-odd asymmetry for various prescission third particles in the ternary fission of nuclei

    SciTech Connect (OSTI)

    Kadmensky, S. G.; Bunakov, V. E.; Kadmensky, S. S.

    2011-12-15

    Differential cross sections for reactions of the true ternary fission of nuclei that was induced by cold polarized neutrons were constructed with allowance of the effect that Coriolis interaction and the interference between fission amplitudes of neutron resonances excited in fissile nuclei upon incidentneutron capture by target nuclei exerted on angular distributions of prescission third particles (alpha particles, neutrons, or photons). It is shown that T -odd TRI- and ROT-type asymmetries for prescission alpha particles are associated with, respectively, the odd and even components of the Coriolis interaction-perturbed amplitude of angular distributions of particles belonging to the types indicated above. These asymmetries have angular distributions differing from each other and stemming from a nontrivial dependence of these components on the neutron-resonance spins J{sub s} and their projections K{sub s} onto the symmetry axis of the nucleus involved. It is shown that angular distributions of prescission photons and neutrons from reactions of the ternary fission of nuclei that is induced by cold polarized neutrons are determined by the effect of Coriolis forces exclusively. Therefore, the emerging T-odd asymmetries have a character of a ROT-type asymmetry and are universal for all target nuclei.

  13. METHOD OF MAKING JACKETED FISSIONABLE SLUG

    DOE Patents [OSTI]

    Young, G.J.; Ohlinger, L.A.

    1959-02-10

    BS>A method is described for fabricating a jacketed fissionable body or slug to provide an effective leak-proof seal between the jacket and the end closure. A housing for the fissionable slug is first formed and then tinned on the interior. The fissionable slug is coated on its exterior surface with the same material used to tin the interior of the housing. The coated slug is then inserted into the housing. A disc shaped end closure for the housing, coated with the tinning material, is inserted into the open end of the housing while the tinning material is still liquid. The end of the housing is then swaged into good contact with the periphery of the closure.

  14. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, R.P.

    1992-10-20

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain. 6 figs.

  15. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, Richard P.

    1992-01-01

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain.

  16. Fission-reactor experiments for fusion-materials research

    SciTech Connect (OSTI)

    Grossbeck, M.L.; Bloom, E.E.; Woods, J.W.; Vitek, J.M.; Thomas, K.R.

    1982-01-01

    The US Fusion Materials Program makes extensive use of fission reactors to study the effects of simulated fusion environments on materials and to develop improved alloys for fusion reactor service. The fast reactor, EBR-II, and the mixed spectrum reactors, HFIR and ORR, are all used in the fusion program. The HFIR and ORR produce helium from transmutations of nickel in a two-step thermal neutron absorption reaction beginning with /sup 58/Ni, and the fast neutrons in these reactors produce atomic displacements. The simultaneous effects of these phenomena produce damage similar to the very high energy neutrons of a fusion reactor. This paper describes irradiation capsules for mechanical property specimens used in the HFIR and the ORR. A neutron spectral tailoring experiment to achieve the fusion reactor He:dpa ratio will be discussed.

  17. T invariance and T-odd asymmetries for the cold-polarized-neutron-induced fission of nonoriented nuclei

    SciTech Connect (OSTI)

    Kadmensky, S. G., E-mail: kadmensky@phys.vsu.ru [Voronezh State University (Russian Federation); Bunakov, V. E. [National Research Center Kurchatov Institute, Petersburg Nuclear Physics Institute (Russian Federation); Titova, L. V. [Voronezh State University (Russian Federation)

    2014-12-15

    It is shown that the coefficients D{sup exp} for all T-odd asymmetries observed experimentally in the cross sections for the reactions of cold-polarized-neutron-induced fission of nonoriented target nuclei (which involves the emission of prescission and evaporated particles) comply in shape and scale with the coefficients D{sup theor} calculated for the analogous asymmetries on the basis of quantum-mechanical nuclear-fission theory for T-invariant Hamiltonians of fissile systems. It is also shown that the asymmetries in question arise upon taking into account the effect of (i) the interference between the fission amplitudes of s- and p-wave resonances of a polarized fissile compound nucleus formed in the aforementioned reactions; (ii) the collective rotation of the compound nucleus in question (this rotation entails a change in the angular distributions of fission fragments and third particles); and (iii) the wriggling vibrations of this compound nucleus in the vicinity of its scission point, which lead to the appearance of high aligned spins of fission fragments, with the result that the emission of neutrons and photons evaporated from these fragments becomes anisotropic. The possible contribution of T-noninvariant interactions to the formation of the T-odd asymmetries under analysis is estimated by using the results obtained in experimentally testing the detailed-balance principle, (P-A) theorem, and T invariance of cross sections for elastic proton-proton and proton-neutron scattering.

  18. Microscopic Theory of Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Microscopic Theory of Fission Citation Details In-Document Search Title: Microscopic Theory of Fission You are accessing a document from the Department of Energy's (DOE) SciTech ...

  19. Room-return scattering in fission neutron outputs (Conference...

    Office of Scientific and Technical Information (OSTI)

    Room-return scattering in fission neutron outputs Citation Details In-Document Search Title: Room-return scattering in fission neutron outputs You are accessing a document from...

  20. Impact of Fission Products Impurity on the Plutonium Content...

    Office of Scientific and Technical Information (OSTI)

    Impact of Fission Products Impurity on the Plutonium Content of Metal- and Oxide- Fuels in Sodium Cooled Fast Reactors Citation Details In-Document Search Title: Impact of Fission ...

  1. Optimally moderated nuclear fission reactor and fuel source therefor

    DOE Patents [OSTI]

    Ougouag, Abderrafi M.; Terry, William K.; Gougar, Hans D.

    2008-07-22

    An improved nuclear fission reactor of the continuous fueling type involves determining an asymptotic equilibrium state for the nuclear fission reactor and providing the reactor with a moderator-to-fuel ratio that is optimally moderated for the asymptotic equilibrium state of the nuclear fission reactor; the fuel-to-moderator ratio allowing the nuclear fission reactor to be substantially continuously operated in an optimally moderated state.

  2. The Microscopic Theory of Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Conference: The Microscopic Theory of Fission Citation Details In-Document Search Title: The Microscopic Theory of Fission Fission-fragment properties have been calculated for thermal neutron-induced fission on a {sup 239}Pu target, using constrained Hartree-Fock-Bogoliubov calculations with a finite-range effective interaction. A quantitative criterion based on the interaction energy between the nascent fragments is introduced to define the scission configurations. The validity of this

  3. Recent advances in modeling fission cross sections over intermediate...

    Office of Scientific and Technical Information (OSTI)

    Country of Publication: United States Language: English Subject: 73; APPROXIMATIONS; CROSS SECTIONS; DECAY AMPLITUDES; DEFORMATION; FISSION; FLUCTUATIONS; INTERMEDIATE STRUCTURE; ...

  4. Interlaboratory reaction rate program. 12th progress report, November 1976-October 1979

    SciTech Connect (OSTI)

    Lippincott, E.P.; McElroy, W.N.; Preston, C.C.

    1980-09-01

    The Interlaboratory Reaction Rate UILRR) program is establishing the capability to accurately measure neutron-induced reactions and reaction rates for reactor fuels and materials development programs. The goal for the principal fission reactions, /sup 235/U, /sup 238/U and /sup 239/Pu, is an accuracy to within +- 5% at the 95% confidence level. Accurate measurement of other fission and nonfission reactions is also required, but to a lesser accuracy, between +- 5% and 10% at the 95% confidence level. A secondary program objective is improvement in knowledge of the nuclear parameters involved in the standarization of fuels and materials dosimetry measurements of neutron flux, spectra, fluence and burnup.

  5. Fission Product Sorptivity in Graphite

    SciTech Connect (OSTI)

    Tompson, Jr., Robert V.; Loyalka, Sudarshan; Ghosh, Tushar; Viswanath, Dabir; Walton, Kyle; Haffner, Robert

    2015-04-01

    Both adsorption and absorption (sorption) of fission product (FP) gases on/into graphite are issues of interest in very high temperature reactors (VHTRs). In the original proposal, we proposed to use packed beds of graphite particles to measure sorption at a variety of temperatures and to use an electrodynamic balance (EDB) to measure sorption onto single graphite particles (a few ?m in diameter) at room temperature. The use of packed beds at elevated temperature is not an issue. However, the TPOC requested revision of this initial proposal to included single particle measurements at elevated temperatures up to 1100 C. To accommodate the desire of NEUP to extend the single particle EDB measurements to elevated temperatures it was necessary to significantly revise the plan and the budget. These revisions were approved. In the EDB method, we levitate a single graphite particle (the size, surface characteristics, morphology, purity, and composition of the particle can be varied) or agglomerate in the balance and measure the sorption of species by observing the changes in mass. This process involves the use of an electron stepping technique to measure the total charge on a particle which, in conjunction with the measured suspension voltages for the particle, allows for determinations of mass and, hence, of mass changes which then correspond to measurements of sorption. Accommodating elevated temperatures with this type of system required a significant system redesign and required additional time that ultimately was not available. These constraints also meant that the grant had to focus on fewer species as a result. Overall, the extension of the original proposed single particle work to elevated temperatures added greatly to the complexity of the proposed project and added greatly to the time that would eventually be required as well. This means that the bulk of the experimental progress was made using the packed bed sorption systems. Only being able to recruit one

  6. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOE Patents [OSTI]

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  7. Fission rate measurements in fuel plate type assembly reactor cores

    SciTech Connect (OSTI)

    Rogers, J.W.

    1988-01-01

    The methods, materials and equipment have been developed to allow extensive and precise measurement of fission rate distributions in water moderated, U-Al fuel plate assembly type reactor cores. Fission rate monitors are accurately positioned in the reactor core, the reactor is operated at a low power for a short time, the fission rate monitors are counted with detectors incorporating automated sample changers and the measurements are converted to fission rate distributions. These measured fission rate distributions have been successfully used as baseline information related to the operation of test and experimental reactors with respect to fission power and distribution, fuel loading and fission experiments for approximately twenty years at the Idaho National Engineering Laboratory (INEL). 7 refs., 8 figs.

  8. Studies of the /sup 32/S + /sup 182/W reaction

    SciTech Connect (OSTI)

    Back, B.B.; Keller, J.G.; Worsham, A.; Glagola, B.G.; Henderson, D.; Kaufman, S.; Sanders, S.J.; Siemssen, R.; Videbaek, F.; Wilkins, B.D.

    1986-01-01

    Fission-like products from the reaction /sup 32/S + /sup 182/W were measured over the entire angular range from theta = 10-170/sup 0/ and for bombarding energies of E/sub lab/ = 166, 177, 222, and 260 MeV using an array of eight Si detectors. From the measured energy and flight time the product mass was determined event-by-event by performing the appropriate corrections for the plasma delay and pulse height defect associated with Si detectors. The mass, angular, and total kinetic energy distributions of fission-like fragments are obtained by assuming two-body kinematics. The angular distributions indicate that a fraction of the observed cross section is associated with quasi-fission reactions as observed previously in several other reactions involving /sup 32/S projectiles. Furthermore, we observe an angular dependence of the fragment mass distributions, a feature which is strictly incompatible with compound nucleus decay. Both of these observations indicate that a fraction of fission-like products originate from quasi-fission, a process in which a large degree of mass transfer occurs between the two interaction nuclei in a short time scale. 14 refs., 4 figs., 1 tab.

  9. Fusion-fission energy systems evaluation

    SciTech Connect (OSTI)

    Teofilo, V.L.; Aase, D.T.; Bickford, W.E.

    1980-01-01

    This report serves as the basis for comparing the fusion-fission (hybrid) energy system concept with other advanced technology fissile fuel breeding concepts evaluated in the Nonproliferation Alternative Systems Assessment Program (NASAP). As such, much of the information and data provided herein is in a form that meets the NASAP data requirements. Since the hybrid concept has not been studied as extensively as many of the other fission concepts being examined in NASAP, the provided data and information are sparse relative to these more developed concepts. Nevertheless, this report is intended to provide a perspective on hybrids and to summarize the findings of the rather limited analyses made to date on this concept.

  10. Emilio Segrè and Spontaneous Fission

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Emilio Segrè and Spontaneous Fission As the staff at Los Alamos began research in the spring of 1943, the most formidable problems it confronted were related to the new materials that would be used in atomic bombs. These materials, uranium-235 and plutonium, were largely unknown. Uranium-235 formed only a tiny fraction of natural uranium (less than 1 percent) and plutonium had been discovered only two years earlier at the University of California, Berkeley, Radiation Laboratory by chemistry

  11. Capture and fission with DANCE and NEUANCE

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jandel, M.; Baramsai, B.; Bond, E.; Rusev, G.; Walker, C.; Bredeweg, T. A.; Chadwick, M. B.; Couture, A.; Fowler, M. M.; Hayes, A.; et al

    2015-12-23

    A summary of the current and future experimental program at DANCE is presented. Measurements of neutron capture cross sections are planned for many actinide isotopes with the goal to reduce the present uncertainties in nuclear data libraries. Detailed studies of capture gamma rays in the neutron resonance region will be performed in order to derive correlated data on the de-excitation of the compound nucleus. New approaches on how to remove the DANCE detector response from experimental data and retain the correlations between the cascade gamma rays are presented. Studies on 235U are focused on quantifying the population of short-lived isomericmore » states in 236U after neutron capture. For this purpose, a new neutron detector array NEUANCE is under construction. It will be installed in the central cavity of the DANCE array and enable the highly efficient tagging of fission and capture events. In addition, developments of fission fragment detectors are also underway to expand DANCE capabilities to measurements of fully correlated data on fission observables.« less

  12. Undergraduate Measurements For Fission Reactor Applications

    SciTech Connect (OSTI)

    Hicks, S. F.; Kersting, L. J.; Lueck, C. J.; McDonough, P.; Crider, B. P.; McEllistrem, M. T.; Peters, E. E.; Vanhoy, J. R.

    2011-06-01

    Undergraduate students at the University of Dallas (UD) have investigated elastic and inelastic neutron scattering cross sections on structural materials important for criticality considerations in nuclear fission processes. Neutrons scattered off of {sup 23}Na and {sup Nat}Fe were detected using neutron time-of-flight techniques at the University of Kentucky Low-Energy Nuclear Accelerator Facility. These measurements are part of an effort to increase the efficiency of power generation from existing fission reactors in the US and in the design of new fission systems. Students have learned the basics of how to operate the Model CN Van de Graaff generator at the laboratory, setup detectors and electronics, use data acquisition systems, and they are currently analyzing the angular dependence of the scattered neutrons for incident neutron energies of 3.57 and 3.80 MeV. Most students participating in the project will use the research experience as the material for their undergraduate research thesis required for all Bachelor of Science students at the University of Dallas. The first student projects on this topic were completed during the summer of 2010; an overview of student participation in this investigation and their preliminary results will be presented.

  13. Capture and fission with DANCE and NEUANCE

    SciTech Connect (OSTI)

    Jandel, M.; Baramsai, B.; Bond, E.; Rusev, G.; Walker, C.; Bredeweg, T. A.; Chadwick, M. B.; Couture, A.; Fowler, M. M.; Hayes, A.; Kawano, T.; Mosby, S.; Stetcu, I.; Taddeucci, T. N.; Talou, P.; Ullmann, J. L.; Vieira, D. J.; Wilhelmy, J. B.

    2015-12-23

    A summary of the current and future experimental program at DANCE is presented. Measurements of neutron capture cross sections are planned for many actinide isotopes with the goal to reduce the present uncertainties in nuclear data libraries. Detailed studies of capture gamma rays in the neutron resonance region will be performed in order to derive correlated data on the de-excitation of the compound nucleus. New approaches on how to remove the DANCE detector response from experimental data and retain the correlations between the cascade gamma rays are presented. Studies on 235U are focused on quantifying the population of short-lived isomeric states in 236U after neutron capture. For this purpose, a new neutron detector array NEUANCE is under construction. It will be installed in the central cavity of the DANCE array and enable the highly efficient tagging of fission and capture events. In addition, developments of fission fragment detectors are also underway to expand DANCE capabilities to measurements of fully correlated data on fission observables.

  14. Calculated fission properties of the heaviest elements

    SciTech Connect (OSTI)

    Moeller, P.; Nix, J.R.; Swiatecki, W.J.

    1986-09-01

    A quantitative calculation is presented that shows where high-kinetic-energy symmetric fission occurs and why it is associated with a sudden and large decrease in fission half-lives. The study is based on calculations of potential-energy surfaces in the macroscopic-microscopic model and a semi-empirical model for the nuclear inertia. For the macroscopic part a Yukawa-plus-exponential model is used and for the microscopic part a folded-Yukawa single-particle potential is used. The three-quadratic-surface parameterization generates shapes for which the potential-energy surfaces are calculated. The use of this parameterization and the use of the finite-range macroscopic model allows for the study of two touching spheres and similar shapes. The results of the calculations in terms of potential-energy surfaces and fission half-lives are presented for heavy even nuclei. The surfaces are displayed in the form of contour diagrams as functions of two moments of the shape. 53 refs., 15 figs., 1 tab.

  15. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  16. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  17. HYPERFUSE: a hypervelocity inertial confinement system for fusion energy production and fission waste transmutation

    SciTech Connect (OSTI)

    Makowitz, H.; Powell, J.R.; Wiswall, R.

    1980-01-01

    Parametric system studies of an inertial confinement fusion (ICF) reactor system to transmute fission products from a LWR economy have been carried out. The ICF reactors would produce net power in addition to transmuting fission products. The particular ICF concept examined is an impact fusion approach termed HYPERFUSE, in which hypervelocity pellets, traveling on the order of 100 to 300 km/sec, collide with each other or a target block in a reactor chamber and initiate a thermonuclear reaction. The DT fusion fuel is contained in a shell of the material to be transmuted, e.g., /sup 137/Cs, /sup 90/Sr, /sup 129/I, /sup 99/Tc, etc. The 14-MeV fusion neutrons released during the pellet burn cause transmutation reactions (e.g., (n,2n), (n,..cap alpha..), (n,..gamma..), etc.) that convert the long-lived fission products (FP's) either to stable products or to species that decay with a short half-life to a stable product. The transmutation parametric studies conclude that the design of the hypervelocity projectiles should emphasize the achievement of high densities in the transmutation regions (greater than the DT fusion fuel density), as well as the DT ignition and burn criterion (rho R = 1.0 to 3.0) requirements. These studies also indicate that masses on the order of 1.0 g at densities of rho greater than or equal to 500.0 g/cm/sup 3/ are required for a practical fusion-based fission product transmutation system.

  18. Impacts to the ethylene supply chain from a hurricane disruption.

    SciTech Connect (OSTI)

    Sun, Amy Cha-Tien; Downes, Paula Sue; Heinen, Russell; Welk, Margaret Ellen

    2010-03-01

    Analysis of chemical supply chains is an inherently complex task, given the dependence of these supply chains on multiple infrastructure systems (e.g., the petroleum sector, transportation, etc.). This effort requires data and information at various levels of resolution, ranging from network-level distribution systems to individual chemical reactions. Sandia National Laboratories (Sandia) has integrated its existing simulation and infrastructure analysis capabilities with chemical data models to analyze the chemical supply chains of several nationally critical chemical commodities. This paper describes how Sandia models the ethylene supply chain; that is, the supply chain for the most widely used raw material for plastics production including a description of the types of data and modeling capabilities that are required to represent the ethylene supply chain. The paper concludes with a description of Sandia's use the model to project how the supply chain would be affected by and adapt to a disruptive scenario hurricane.

  19. Time dependent particle emission from fission products (Conference) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Time dependent particle emission from fission products Citation Details In-Document Search Title: Time dependent particle emission from fission products Decay heating following nuclear fission is an important factor in the design of nuclear facilities; impacting a variety of aspects ranging from cooling requirements to shielding design. Calculations of decay heat, often assumed to be a simple product of activity and average decay product energy, are complicated by the so

  20. A microscopic theory of low energy fission: fragment properties

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Conference: A microscopic theory of low energy fission: fragment properties Citation Details In-Document Search Title: A microscopic theory of low energy fission: fragment properties Authors: Younes, W ; Gogny, D ; Schunck, N Publication Date: 2013-01-11 OSTI Identifier: 1062214 Report Number(s): LLNL-PROC-609985 DOE Contract Number: W-7405-ENG-48 Resource Type: Conference Resource Relation: Conference: Presented at: Fifth International Conference on Fission

  1. Fifty years of nuclear fission: Nuclear data and measurements series

    Office of Scientific and Technical Information (OSTI)

    (Technical Report) | SciTech Connect Fifty years of nuclear fission: Nuclear data and measurements series Citation Details In-Document Search Title: Fifty years of nuclear fission: Nuclear data and measurements series This report is the written version of a colloquium first presented at Argonne National Laboratory in January 1989. The paper begins with an historical preamble about the events leading to the discovery of nuclear fission. This leads naturally to an account of early results and

  2. Neutron flux profile monitor for use in a fission reactor

    DOE Patents [OSTI]

    Kopp, Manfred K.; Valentine, Kenneth H.

    1983-01-01

    A neutron flux monitor is provided which consists of a plurality of fission counters arranged as spaced-apart point detectors along a delay line. As a fission event occurs in any one of the counters, two delayed current pulses are generated at the output of the delay line. The time separation of the pulses identifies the counter in which the particular fission event occured. Neutron flux profiles of reactor cores can be more accurately measured as a result.

  3. September 2013 Most Viewed Documents for Fission And Nuclear...

    Office of Scientific and Technical Information (OSTI)

    September 2013 Most Viewed Documents for Fission And Nuclear Technologies Estimation of ... Tianfu; Pruess, Karsten (2001) 45 LWR nuclear fuel bundle data for use in fuel bundle ...

  4. June 2015 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    June 2015 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas ... MIGRATION IN SOILS OF THE CHERNOBYL NUCLEAR POWER PLANT EXCLUSION ZONE Farfan, E ...

  5. Most Viewed Documents for Fission and Nuclear Technologies: December...

    Office of Scientific and Technical Information (OSTI)

    Most Viewed Documents for Fission and Nuclear Technologies: December 2014 Stress analysis ... States)) (1992) 67 Behavior of spent nuclear fuel in water pool storage Johnson, A.B. ...

  6. March 2016 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    March 2016 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas ... methods and test results utilized for nuclear core applications (LWBR Development ...

  7. December 2015 Most Viewed Documents for Fission And Nuclear Technologi...

    Office of Scientific and Technical Information (OSTI)

    December 2015 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas ... methods and test results utilized for nuclear core applications (LWBR Development ...

  8. Singlet Exciton Fission in Polyacenes: Photophysics and Photovoltaic...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Exciton Fission in Polyacenes: Photophysics and Photovoltaic Applications December 13, ... However, the efficiency of any single-bandgap photovoltaic device under solar irradiation ...

  9. Description of Induced Nuclear Fission with Skyrme Energy Functionals...

    Office of Scientific and Technical Information (OSTI)

    Fragment Properties Citation Details In-Document Search Title: Description of Induced Nuclear Fission with Skyrme Energy Functionals: I. Static Potential Energy Surfaces and...

  10. Microscopic description of fission dynamics: finite element method...

    Office of Scientific and Technical Information (OSTI)

    Title: Microscopic description of fission dynamics: finite element method resolution of ... This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and ...

  11. Multiple scattering effects in fission neutron outputs (Conference...

    Office of Scientific and Technical Information (OSTI)

    Los Alamos National Laboratory Publication Date: 2011-02-24 OSTI Identifier: 1053153 ... Resource Relation: Conference: Fission fprogram Review, ; February 28, 2011 ; Livermore, ...

  12. Sequential Detection of Fission Processes for Harbor Defense...

    Office of Scientific and Technical Information (OSTI)

    with some interesting and feasible results; however, the fission process of SNM has not received as much attention due to its inherent complexity and required predictive nature. ...

  13. SEPARATION OF PLUTONIUM FROM URANIUM AND FISSION PRODUCTS

    DOE Patents [OSTI]

    Boyd, G.E.; Adamson, A.W.; Schubert, J.; Russell, E.R.

    1958-10-01

    A chromatographic adsorption process is presented for the separation of plutonium from other fission products formed by the irradiation of uranium. The plutonium and the lighter element fission products are adsorbed on a sulfonated phenol-formaldehyde resin bed from a nitric acid solution containing the dissolved uranium. Successive washes of sulfuric, phosphoric, and nitric acids remove the bulk of the fission products, then an eluate of dilute phosphoric and nitric acids removes the remaining plutonium and fission products. The plutonium is selectively removed by passing this solution through zirconium phosphate, from which the plutonium is dissolved with nitric acid. This process provides a convenient and efficient means for isolating plutonium.

  14. IMPACT OF FISSION PRODUCTS IMPURITY ON THE PLUTONIUM CONTENT...

    Office of Scientific and Technical Information (OSTI)

    This charter specifies that the separation of the fission products (FP) during the reprocessing of UOX spent nuclear fuel assemblies (UOX SNF) is not perfect and that, ...

  15. Flowsheet Testing of the Fission Product Extraction Process as...

    Office of Scientific and Technical Information (OSTI)

    Citation Details In-Document Search Title: Flowsheet Testing of the Fission Product ... generation of spent nuclear fuel requiring geologic disposal is currently being addressed. ...

  16. Fission Younes, W; Gogny, D 73 NUCLEAR PHYSICS AND RADIATION...

    Office of Scientific and Technical Information (OSTI)

    in a Time-Dependent Microscopic Theory of Fission Younes, W; Gogny, D 73 NUCLEAR PHYSICS AND RADIATION PHYSICS Abstract not provided Lawrence Livermore National Laboratory...

  17. Logging Calibration Models for Fission Neutron Sondes (September...

    Energy Savers [EERE]

    A Model for Water Factor Measurements With Fission-Neutron Logging Tools (May 1983) Field Calibration Facilities for Environmental Measurement of Radium, Thorium, and Potassium ...

  18. Yields of fission products from various actinide targets (Conference...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Fourth International Conference on Fission and Properties of Neutron-Rich Nuclei, Sanibel Island, FL, USA, 20071111, 20071117 Research Org: Oak Ridge ...

  19. A microscopic theory of low energy fission: fragment properties...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Presented at: Fifth International Conference on Fission and Properties of Neutron Rich Nuclei, Sanibel Island, FL, United States, Nov 04 - Nov 10, ...

  20. Axisymmetric Magnetic Mirror Fusion-Fission Hybrid (Conference...

    Office of Scientific and Technical Information (OSTI)

    Conference: Axisymmetric Magnetic Mirror Fusion-Fission Hybrid Citation Details ... Visit OSTI to utilize additional information resources in energy science and technology. A ...

  1. Axisymmetric Magnetic Mirror Fusion-Fission Hybrid (Technical...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Axisymmetric Magnetic Mirror Fusion-Fission Hybrid Citation Details ... Visit OSTI to utilize additional information resources in energy science and technology. A ...

  2. Accelerator-driven subcritical fission in molten salt core: Closing...

    Office of Scientific and Technical Information (OSTI)

    Accelerator-driven subcritical fission in molten salt core: Closing the nuclear fuel cycle for green nuclear energy Citation Details In-Document Search Title: Accelerator-driven ...

  3. Fission fragment charge and mass distributions in Pu 239 ( n...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Fission fragment charge and mass distributions in Pu 239 ( n , f ) in the adiabatic nuclear energy density functional theory Citation Details In-Document Search ...

  4. Spontaneous fission half-lives for ground state nuclides

    SciTech Connect (OSTI)

    Holden, N.E. [Brookhaven National Lab., Upton, NY (United States); Hoffman, D.C. [Lawrence Berkeley Lab., CA (United States)

    1993-08-01

    Measurements of the spontaneous fission half-lives of nuclides of elements Z = 90 to 108 have been compiled and evaluated. Recommended values are presented.

  5. January 2013 Most Viewed Documents for Fission And Nuclear Technologie...

    Office of Scientific and Technical Information (OSTI)

    January 2013 Most Viewed Documents for Fission And Nuclear Technologies Laboratory studies of shearleach processing of zircaloy clad metallic uranium reactor fuel Swanson, J.L.; ...

  6. Overview of Fusion-Fission Hybrid Blankets for Laser Inertial...

    Office of Scientific and Technical Information (OSTI)

    Hybrid Blankets for Laser Inertial Fusion Energy (LIFE) Engine Citation Details In-Document Search Title: Overview of Fusion-Fission Hybrid Blankets for Laser Inertial Fusion ...

  7. Description of Induced Nuclear Fission with Skyrme Energy Functionals...

    Office of Scientific and Technical Information (OSTI)

    Description of Induced Nuclear Fission with Skyrme Energy Functionals: II. Finite Temperature Effects Citation Details In-Document Search Title: Description of Induced Nuclear ...

  8. Nuclear fission and transuranium elements: Fifty years ago

    SciTech Connect (OSTI)

    Seaborg, G.T.

    1988-09-01

    This paper reviews some historical aspects of the knowledge and discovery of transuranium elements. This fission of plutonium is discussed also. 12 refs., 6 figs.

  9. ENDF/B-VII.1 Nuclear Data for Science and Technology: Cross Sections, Covariances, Fission Product Yields and Decay Data

    SciTech Connect (OSTI)

    G. Palmiotti

    2011-12-01

    The ENDF/B-VII.1 library is our latest recommended evaluated nuclear data file for use in nuclear science and technology applications, and incorporates advances made in the five years since the release of ENDF/B-VII.0. These advances focus on neutron cross sections, covariances, fission product yields and decay data, and represent work by the US Cross Section Evaluation Working Group (CSEWG) in nuclear data evaluation that utilizes developments in nuclear theory, modeling, simulation, and experiment. The principal advances in the new library are: (1) An increase in the breadth of neutron reaction cross section coverage, extending from 393 nuclides to 418 nuclides; (2) Covariance uncertainty data for 185 of the most important nuclides, as documented in companion papers in this edition; (3) R-matrix analyses of neutron reactions on light nuclei, including isotopes of He, Li, and Be; (4) Resonance parameter analyses at lower energies and statistical high energy reactions at higher energies for isotopes of F, Cl, K, Ti, V, Mn, Cr, Ni, Zr and W; (5) Modifications to thermal neutron reactions on fission products (isotopes of Mo, Tc, Rh, Ag, Cs, Nd, Sm, Eu) and neutron absorber materials (Cd, Gd); (6) Improved minor actinide evaluations for isotopes of U, Np, Pu, and Am (we are not making changes to the major actinides 235,238U and 239Pu at this point, except for delayed neutron data, and instead we intend to update them after a further period of research in experiment and theory), and our adoption of JENDL-4.0 evaluations for isotopes of Cm, Bk, Cf, Es, Fm, and some other minor actinides; (7) Fission energy release evaluations; (8) Fission product yield advances for fission-spectrum neutrons and 14 MeV neutrons incident on 239Pu; and (9) A new Decay Data sublibrary. Integral validation testing of the ENDF/B-VII.1 library is provided for a variety of quantities: For nuclear criticality, the VII.1 library maintains the generally-good performance seen for VII.0 for a wide

  10. Finite Element Solver for Fission Dynamics

    Energy Science and Technology Software Center (OSTI)

    2015-01-30

    FELIX is a physics computer code used to model fission fragment mass distributions in a fully quantum-mechanical, misroscopic framework that only relies on our current knowledge of nuclear forces. It is an implementation of the time-dependent generator coordinate method (TDGCM), which simulates the dynamics of a collective quantum wave-packet assuming the motion is adiabatic. In typical applications of the TDGCM, the nuclear collective wavepacket is obtained as a superposition of wavefunctions obtained by solving themore » Hartree-Fock-Bogoliubov equations of nuclear density functional theory (DFT). The program calculates at each time step the coefficients of that superposition.« less

  11. Fission gas retention in irradiated metallic fuel

    SciTech Connect (OSTI)

    Fenske, G.R.; Gruber, E.E.; Kramer, J.M.

    1987-01-01

    Theoretical calculations and experimental measurements of the quantity of retained fission gas in irradiated metallic fuel (U-5Fs) are presented. The calculations utilize the Booth method to model the steady-state release of gases from fuel grains and a simplified grain-boundary gas model to predict the gas release from intergranular regions. The quantity of gas retained in as-irradiated fuel was determined by collecting the gases released from short segments of EBR-II driver fuel that were melted in a gas-tight furnace. Comparison of the calculations to the measurements shows quantitative agreement with both the magnitude and the axial variation of the retained gas content.

  12. SEPARATION OF URANIUM, PLUTONIUM AND FISSION PRODUCTS

    DOE Patents [OSTI]

    Nicholls, C.M.; Wells, I.; Spence, R.

    1959-10-13

    The separation of uranium and plutonium from neutronirradiated uranium is described. The neutron-irradiated uranium is dissolved in nitric acid to provide an aqueous solution 3N in nitric acid. The fission products of the solution are extruded by treating the solution with dibutyl carbitol substantially 1.8N in nitric acid. The organic solvent phase is separated and neutralized with ammonium hydroxide and the plutonium reduced with hydroxylamine base to the trivalent state. Treatment of the mixture with saturated ammonium nitrate extracts the reduced plutonium and leaves the uranium in the organic solvent.

  13. Pairing-induced speedup of nuclear spontaneous fission

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sadhukhan, Jhilam; Dobaczewski, J.; Nazarewicz, W.; Sheikh, J. A.; Baran, A.

    2014-12-22

    Collective inertia is strongly influenced at the level crossing at which the quantum system changes its microscopic configuration diabatically. Pairing correlations tend to make the large-amplitude nuclear collective motion more adiabatic by reducing the effect of these configuration changes. Competition between pairing and level crossing is thus expected to have a profound impact on spontaneous fission lifetimes. To elucidate the role of nucleonic pairing on spontaneous fission, we study the dynamic fission trajectories of 264Fm and 240Pu using the state-of-the-art self-consistent framework. We employ the superfluid nuclear density functional theory with the Skyrme energy density functional SkM* and a density-dependentmore » pairing interaction. Along with shape variables, proton and neutron pairing correlations are taken as collective coordinates. The collective inertia tensor is calculated within the nonperturbative cranking approximation. The fission paths are obtained by using the least action principle in a four-dimensional collective space of shape and pairing coordinates. Pairing correlations are enhanced along the minimum-action fission path. For the symmetric fission of 264Fm, where the effect of triaxiality on the fission barrier is large, the geometry of the fission pathway in the space of the shape degrees of freedom is weakly impacted by pairing. This is not the case for 240Pu, where pairing fluctuations restore the axial symmetry of the dynamic fission trajectory. The minimum-action fission path is strongly impacted by nucleonic pairing. In some cases, the dynamical coupling between shape and pairing degrees of freedom can lead to a dramatic departure from the static picture. As a result, in the dynamical description of nuclear fission, particle-particle correlations should be considered on the same footing as those associated with shape degrees of freedom.« less

  14. Pairing-induced speedup of nuclear spontaneous fission

    SciTech Connect (OSTI)

    Sadhukhan, Jhilam; Dobaczewski, J.; Nazarewicz, W.; Sheikh, J. A.; Baran, A.

    2014-12-22

    Collective inertia is strongly influenced at the level crossing at which the quantum system changes its microscopic configuration diabatically. Pairing correlations tend to make the large-amplitude nuclear collective motion more adiabatic by reducing the effect of these configuration changes. Competition between pairing and level crossing is thus expected to have a profound impact on spontaneous fission lifetimes. To elucidate the role of nucleonic pairing on spontaneous fission, we study the dynamic fission trajectories of 264Fm and 240Pu using the state-of-the-art self-consistent framework. We employ the superfluid nuclear density functional theory with the Skyrme energy density functional SkM* and a density-dependent pairing interaction. Along with shape variables, proton and neutron pairing correlations are taken as collective coordinates. The collective inertia tensor is calculated within the nonperturbative cranking approximation. The fission paths are obtained by using the least action principle in a four-dimensional collective space of shape and pairing coordinates. Pairing correlations are enhanced along the minimum-action fission path. For the symmetric fission of 264Fm, where the effect of triaxiality on the fission barrier is large, the geometry of the fission pathway in the space of the shape degrees of freedom is weakly impacted by pairing. This is not the case for 240Pu, where pairing fluctuations restore the axial symmetry of the dynamic fission trajectory. The minimum-action fission path is strongly impacted by nucleonic pairing. In some cases, the dynamical coupling between shape and pairing degrees of freedom can lead to a dramatic departure from the static picture. As a result, in the dynamical description of nuclear fission, particle-particle correlations should be considered on the same footing as those associated with shape degrees of freedom.

  15. Supply Chain | NISAC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NISACSupply Chain content top National Transportation Fuels Model Posted by tmanzan on Oct 3, 2012 in | Comments 0 comments National Transportation Fuels Model This model informs analyses of the availability of transportation fuel in the event the fuel supply chain is disrupted. The portion of the fuel supply system represented by the network model (see figure) spans from oil fields to fuel distribution terminals. Different components of this system (e.g., crude oil import terminals, refineries,

  16. Feasibility study of a fission-suppressed tokamak fusion breeder

    SciTech Connect (OSTI)

    Moir, R.W.; Lee, J.D.; Neef, W.S.; Berwald, D.H.; Garner, J.K.; Whitley, R.H.; Ghoniem, N.; Wong, C.P.C.; Maya, I.; Schultz, K.R.

    1984-12-01

    The preliminary conceptual design of a tokamak fissile fuel producer is described. The blanket technology is based on the fission suppressed breeding concept where neutron multiplication occurs in a bed of 2 cm diameter beryllium pebbles which are cooled by helium at 50 atmospheres pressure. Uranium-233 is bred in thorium metal fuel elements which are in the form of snap rings attached to each beryllium pebble. Tritium is bred in lithium bearing material contained in tubes immersed in the pebble bed and is recovered by a purge flow of helium. The neutron wall load is 3 MW/m/sup 2/ and the blanket material is ferritic steel. The net fissile breeding ratio is 0.54 +- 30% per fusion reaction. This results in the production of 4900 kg of /sup 233/U per year from 3000 MW of fusion power. This quantity of fuel will provide makeup fuel for about 12 LWRs of equal thermal power or about 18 1 GW/sub e/ LWRs. The calculated cost of the produced uranium-233 is between $23/g and $53/g or equivalent to $10/kg to $90/kg of U/sub 3/O/sub 8/ depending on government financing or utility financing assumptions. Additional topics discussed in the report include the tokamak operating mode (both steady state and long pulse considered), the design and breeding implications of using a poloidal divertor for impurity control, reactor safety, the choice of a tritium breeder, and fuel management.

  17. Microfabricated sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  18. Supply Chain Management Center | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Supply Chain Management Center

  19. Electroplating method for producing ultralow-mass fissionable deposits

    DOE Patents [OSTI]

    Ruddy, Francis H.

    1989-01-01

    A method for producing ultralow-mass fissionable deposits for nuclear reactor dosimetry is described, including the steps of holding a radioactive parent until the radioactive parent reaches secular equilibrium with a daughter isotope, chemically separating the daughter from the parent, electroplating the daughter on a suitable substrate, and holding the electroplated daughter until the daughter decays to the fissionable deposit.

  20. SEPARATION OF FISSION PRODUCTS FROM PLUTONIUM BY PRECIPITATION

    DOE Patents [OSTI]

    Seaborg, G.T.; Thompson, S.G.; Davidson, N.R.

    1959-09-01

    Fission product separation from hexavalent plutonium by bismuth phosphate precipitation of the fission products is described. The precipitation, according to this invention, is improved by coprecipitating ceric and zirconium phosphates (0.05 to 2.5 grams/liter) with the bismuth phosphate.

  1. REGENERATION OF FISSION-PRODUCT-CONTAINING MAGNESIUM-THORIUM ALLOYS

    DOE Patents [OSTI]

    Chiotti, P.

    1964-02-01

    A process of regenerating a magnesium-thorium alloy contaminated with fission products, protactinium, and uranium is presented. A molten mixture of KCl--LiCl-MgCl/sub 2/ is added to the molten alloy whereby the alkali, alkaline parth, and rare earth fission products (including yttrium) and some of the thorium and uranium are chlorinated and

  2. Direct reactions for nuclear structure and nuclear astrophysics

    SciTech Connect (OSTI)

    Jones, Katherine Louise

    2014-12-18

    Direct reactions are powerful probes for studying the atomic nucleus. Modern direct reaction studies are illuminating both the fundamental nature of the nucleus and its role in nucleosynthetic processes occurring in the cosmos. This report covers experiments using knockout reactions on neutron-deficient fragmentation beams, transfer reactions on fission fragment beams, and theoretical sensitivity studies relating to the astrophysical r-process. Results from experiments on 108,106Sn at the NSCL, and on 131Sn at HRIBF are presented as well as the results from the nucleosynthesis study.

  3. Recent advances in nuclear fission theory: pre- and post-scission...

    Office of Scientific and Technical Information (OSTI)

    Recent advances in nuclear fission theory: pre- and post-scission physics Citation Details In-Document Search Title: Recent advances in nuclear fission theory: pre- and ...

  4. Fission energy program of the US Department of Energy, FY 1981

    SciTech Connect (OSTI)

    Ferguson, Robert L.

    1980-03-01

    Information is presented concerning the National Energy Plan and fission energy policy; fission energy program management; converter reactor systems; breeder reactor systems; and special nuclear evaluations and systems.

  5. Fission matrix capability for MCNP, Part II - Applications

    SciTech Connect (OSTI)

    Carney, S. E.; Brown, F. B.; Kiedrowski, B. C.; Martin, W. R.

    2013-07-01

    This paper describes the initial experience and results from implementing a fission matrix capability into the MCNP Monte Carlo code. The fission matrix is obtained at essentially no cost during the normal simulation for criticality calculations. It can be used to provide estimates of the fundamental mode power distribution, the reactor dominance ratio, the eigenvalue spectrum, and higher mode spatial eigenfunctions. It can also be used to accelerate the convergence of the power method iterations. Past difficulties and limitations of the fission matrix approach are overcome with a new sparse representation of the matrix, permitting much larger and more accurate fission matrix representations. Numerous examples are presented. A companion paper (Part I - Theory) describes the theoretical basis for the fission matrix method. (authors)

  6. The MAP kinase Pmk1 and protein kinase A are required for rotenone resistance in the fission yeast, Schizosaccharomyces pombe

    SciTech Connect (OSTI)

    Wang, Yiwei; Gulis, Galina; Buckner, Scott; Johnson, P. Connor; Sullivan, Daniel; Busenlehner, Laura; Marcus, Stevan

    2010-08-20

    Research highlights: {yields} Rotenone induces generation of ROS and mitochondrial fragmentation in fission yeast. {yields} The MAPK Pmk1 and PKA are required for rotenone resistance in fission yeast. {yields} Pmk1 and PKA are required for ROS clearance in rotenone treated fission yeast cells. {yields} PKA plays a role in ROS clearance under normal growth conditions in fission yeast. -- Abstract: Rotenone is a widely used pesticide that induces Parkinson's disease-like symptoms in rats and death of dopaminergic neurons in culture. Although rotenone is a potent inhibitor of complex I of the mitochondrial electron transport chain, it can induce death of dopaminergic neurons independently of complex I inhibition. Here we describe effects of rotenone in the fission yeast, Schizosaccharomyces pombe, which lacks complex I and carries out rotenone-insensitive cellular respiration. We show that rotenone induces generation of reactive oxygen species (ROS) as well as fragmentation of mitochondrial networks in treated S. pombe cells. While rotenone is only modestly inhibitory to growth of wild type S. pombe cells, it is strongly inhibitory to growth of mutants lacking the ERK-type MAP kinase, Pmk1, or protein kinase A (PKA). In contrast, cells lacking the p38 MAP kinase, Spc1, exhibit modest resistance to rotenone. Consistent with these findings, we provide evidence that Pmk1 and PKA, but not Spc1, are required for clearance of ROS in rotenone treated S. pombe cells. Our results demonstrate the usefulness of S. pombe for elucidating complex I-independent molecular targets of rotenone as well as mechanisms conferring resistance to the toxin.

  7. Improved Fission Neutron Data Base for Active Interrogation of Actinides

    SciTech Connect (OSTI)

    Pozzi, Sara; Czirr, J. Bart; Haight, Robert; Kovash, Michael; Tsvetkov, Pavel

    2013-11-06

    This project will develop an innovative neutron detection system for active interrogation measurements. Many active interrogation methods to detect fissionable material are based on the detection of neutrons from fission induced by fast neutrons or high-energy gamma rays. The energy spectrum of the fission neutrons provides data to identify the fissionable isotopes and materials such as shielding between the fissionable material and the detector. The proposed path for the project is as follows. First, the team will develop new neutron detection systems and algorithms by Monte Carlo simulations and bench-top experiments. Next, They will characterize and calibrate detection systems both with monoenergetic and white neutron sources. Finally, high-fidelity measurements of neutron emission from fissions induced by fast neutrons will be performed. Several existing fission chambers containing U-235, Pu-239, U-238, or Th-232 will be used to measure the neutron-induced fission neutron emission spectra. The challenge for making confident measurements is the detection of neutrons in the energy ranges of 0.01 1 MeV and above 8 MeV, regions where the basic data on the neutron energy spectrum emitted from fission is least well known. In addition, improvements in the specificity of neutron detectors are required throughout the complete energy range: they must be able to clearly distinguish neutrons from other radiations, in particular gamma rays and cosmic rays. The team believes that all of these challenges can be addressed successfully with emerging technologies under development by this collaboration. In particular, the collaboration will address the area of fission neutron emission spectra for isotopes of interest in the advanced fuel cycle initiative (AFCI).

  8. On the competition between hydrogen abstraction versus C-O bond fission in initiating dimethyl ether combustion

    SciTech Connect (OSTI)

    Francisco, J.

    1999-07-01

    There has been a growing interest in the potential use of dimethyl ether (DME) as a diesel fuel in compression ignition engines. There are two initiation steps involved in the combustion of DME, one involving C-O bond fission and the other involving hydrogen abstraction by molecular oxygen. The kinetics and thermodynamics of C-O bond fission were explored computationally in a previous paper. The present paper addresses the competing process--hydrogen abstraction by molecular oxygen. Ab initio molecular orbital calculations are used to study the structures and energetics of the reactants, products, and the transition state for the CH{sub 3}OCH{sub 3} + O{sub 2} reaction. The calculations predict a barrier for hydrogen abstraction from CH{sub 3}OCH{sub 3} by O{sub 2} of 47.4 kcal/mol. This is lower than the barrier height for C-O bond fission previously calculated to be 81.1 kcal/mol. The results support values used in current models for the combustion of DME. Moreover, an examination of rates for C-O bond fission versus hydrogen abstraction by O{sub 2} suggests that the bimolecular process is the dominant pathway.

  9. Detecting fission from special nuclear material sources

    DOE Patents [OSTI]

    Rowland, Mark S.; Snyderman, Neal J.

    2012-06-05

    A neutron detector system for discriminating fissile material from non-fissile material wherein a digital data acquisition unit collects data at high rate, and in real-time processes large volumes of data directly into information that a first responder can use to discriminate materials. The system comprises counting neutrons from the unknown source and detecting excess grouped neutrons to identify fission in the unknown source. The system includes a graphing component that displays the plot of the neutron distribution from the unknown source over a Poisson distribution and a plot of neutrons due to background or environmental sources. The system further includes a known neutron source placed in proximity to the unknown source to actively interrogate the unknown source in order to accentuate differences in neutron emission from the unknown source from Poisson distributions and/or environmental sources.

  10. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Presented at: Transport Phenomena in Micro and Nano Devices, Kona Coast, HI (US), 10172004--10212004; Other Information: PBD: 28 Sep 2004 ...

  11. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Errormore » rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  12. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference...

    Office of Scientific and Technical Information (OSTI)

    compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum ...

  13. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction...

    Office of Scientific and Technical Information (OSTI)

    square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct ...

  14. METHOD AND APPARATUS FOR CONDUCTING A NUCLEAR CHAIN REACTION

    DOE Patents [OSTI]

    Wigner, E.P.; Ohlinger, L.A.; Young, G.J.; Weinberg, A.M.

    1962-09-01

    A nuclear reactor is designed incorporating a slurry of uranium- containing particles in heavy water and including means for circulating the slurry and for cooling the slurry. (AEC)

  15. Chain Reaction Innovations Business Mentor Solicitation | Argonne National

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Laboratory Innovations Business Mentor Solicitation PDF icon 2016_05_24_CRI_Business_Mentor_Solicitation_JWW_5bd

  16. Electron-capture delayed fission properties of neutron-deficient einsteinium nuclei

    SciTech Connect (OSTI)

    Shaughnessy, Dawn A.

    2000-01-05

    Electron-capture delayed fission (ECDF) properties of neutron-deficient einsteinium isotopes were investigated using a combination of chemical separations and on-line radiation detection methods. {sup 242}Es was produced via the {sup 233}U({sup 14}N,5n){sup 242}Es reaction at a beam energy of 87 MeV (on target) in the lab system, and was found to decay with a half-life of 11 {+-} 3 seconds. The ECDF of {sup 242}Es showed a highly asymmetric mass distribution with an average pre-neutron emission total kinetic energy (TKE) of 183 {+-} 18 MeV. The probability of delayed fission (P{sub DF}) was measured to be 0.006 {+-} 0.002. In conjunction with this experiment, the excitation functions of the {sup 233}U({sup 14}N,xn){sup 247{minus}x}Es and {sup 233}U({sup 15}N,xn){sup 248{minus}x}Es reactions were measured for {sup 243}Es, {sup 244}Es and {sup 245}Es at projectile energies between 80 MeV and 100 MeV.

  17. Cluster expression in fission and fusion in high-dimensional macroscopic-microscopic calculations

    SciTech Connect (OSTI)

    Iwamoto, A.; Ichikawa, T.; Moller, P.; Sierk, A. J.

    2004-01-01

    We discuss the relation between the fission-fusion potential-energy surfaces of very heavy nuclei and the formation process of these nuclei in cold-fusion reactions. In the potential-energy surfaces, we find a pronounced valley structure, with one valley corresponding to the cold-fusion reaction, the other to fission. As the touching point is approached in the cold-fusion entrance channel, an instability towards dynamical deformation of the projectile occurs, which enhances the fusion cross section. These two 'cluster effects' enhance the production of superheavy nuclei in cold-fusion reactions, in addition to the effect of the low compound-system excitation energy in these reactions. Heavy-ion fusion reactions have been used extensively to synthesize heavy elements beyond actinide nuclei. In order to proceed further in this direction, we need to understand the formation process more precisely, not just the decay process. The dynamics of the formation process are considerably more complex than the dynamics necessary to interpret the spontaneous-fission decay of heavy elements. However, before implementing a full dynamical description it is useful to understand the basic properties of the potential-energy landscape encountered in the initial stages of the collision. The collision process and entrance-channel landscape can conveniently be separated into two parts, namely the early-stage separated system before touching and the late-stage composite system after touching. The transition between these two stages is particularly important, but not very well understood until now. To understand better the transition between the two stages we analyze here in detail the potential energy landscape or 'collision surface' of the system both outside and inside the touching configuration of the target and projectile. In Sec. 2, we discuss calculated five-dimensional potential-energy landscapes inside touching and identify major features. In Sec. 3, we present calculated

  18. Sensitivity analysis of the fission gas behavior model in BISON.

    SciTech Connect (OSTI)

    Swiler, Laura Painton; Pastore, Giovanni; Perez, Danielle; Williamson, Richard

    2013-05-01

    This report summarizes the result of a NEAMS project focused on sensitivity analysis of a new model for the fission gas behavior (release and swelling) in the BISON fuel performance code of Idaho National Laboratory. Using the new model in BISON, the sensitivity of the calculated fission gas release and swelling to the involved parameters and the associated uncertainties is investigated. The study results in a quantitative assessment of the role of intrinsic uncertainties in the analysis of fission gas behavior in nuclear fuel.

  19. Active-Interrogation Measurements of Induced-Fission Neutrons from Low-Enriched Uranium

    SciTech Connect (OSTI)

    J. L. Dolan; M. J. Marcath; M. Flaska; S. A. Pozzi; D. L. Chichester; A. Tomanin; P. Peerani; G. Nebbia

    2012-07-01

    Protection and control of nuclear fuels is paramount for nuclear security and safeguards; therefore, it is important to develop fast and robust controlling mechanisms to ensure the safety of nuclear fuels. Through both passive- and active-interrogation methods we can use fast-neutron detection to perform real-time measurements of fission neutrons for process monitoring. Active interrogation allows us to use different ranges of incident neutron energy to probe for different isotopes of uranium. With fast-neutron detectors, such as organic liquid scintillation detectors, we can detect the induced-fission neutrons and photons and work towards quantifying a samples mass and enrichment. Using MCNPX-PoliMi, a system was designed to measure induced-fission neutrons from U-235 and U-238. Measurements were then performed in the summer of 2010 at the Joint Research Centre in Ispra, Italy. Fissions were induced with an associated particle D-T generator and an isotopic Am-Li source. The fission neutrons, as well as neutrons from (n, 2n) and (n, 3n) reactions, were measured with five 5 by 5 EJ-309 organic liquid scintillators. The D-T neutron generator was available as part of a measurement campaign in place by Padova University. The measurement and data-acquisition systems were developed at the University of Michigan utilizing a CAEN V1720 digitizer and pulse-shape discrimination algorithms to differentiate neutron and photon detections. Low-enriched uranium samples of varying mass and enrichment were interrogated. Acquired time-of-flight curves and cross-correlation curves are currently analyzed to draw relationships between detected neutrons and sample mass and enrichment. In the full paper, the promise of active-interrogation measurements and fast-neutron detection will be assessed through the example of this proof-of-concept measurement campaign. Additionally, MCNPX-PoliMi simulation results will be compared to the measured data to validate the MCNPX-PoliMi code when

  20. Preliminary design studies for a (D-D) or (D-T) driven cold fusion-fission (hybrid) reactor with metallic uranium

    SciTech Connect (OSTI)

    Sahin, S. ); Baltacioglu, E.; Yapici, H. )

    1991-01-01

    Based on the possibility of (D,D) fusion at room temperature in a heavy metal (palladium) matrix, a cold fusion-fission (hybrid) reactor design has been evaluated in this paper. The reactor is composed of a number of modular and uniform fuel lattices. The cold fusion neutrons induce fission reactions in the natural metallic uranium fuel, imbedded in the lattice. The neutron spectrum, and consequently the fission power density are nearly constant in the reactor core so that the rector performance becomes almost independent on the reactor size. The energy multiplication for each fusion neutron production in the (D,T) and (D,D) reactors are about 3.3 and 7.0, respectively. The (D,T) reactor mode is self-sufficient in respect to tritium breeding ratio (TBR = 1.2).

  1. EXTENSION OF THE NUCLEAR REACTION MODEL CODE EMPIRE TO ACTINIDES NUCLEAR DATA EVALUATION.

    SciTech Connect (OSTI)

    CAPOTE,R.; SIN, M.; TRKOV, A.; HERMAN, M.; CARLSON, B.V.; OBLOZINSKY, P.

    2007-04-22

    Recent extensions and improvements of the EMPIRE code system are outlined. They add new capabilities to the code, such as prompt fission neutron spectra calculations using Hauser-Feshbach plus pre-equilibrium pre-fission spectra, cross section covariance matrix calculations by Monte Carlo method, fitting of optical model parameters, extended set of optical model potentials including new dispersive coupled channel potentials, parity-dependent level densities and transmission through numerically defined fission barriers. These features, along with improved and validated ENDF formatting, exclusive/inclusive spectra, and recoils make the current EMPIRE release a complete and well validated tool for evaluation of nuclear data at incident energies above the resonance region. The current EMPIRE release has been used in evaluations of neutron induced reaction files for {sup 232}Th and {sup 231,233}Pa nuclei in the fast neutron region at IAEA. Triple-humped fission barriers and exclusive pre-fission neutron spectra were considered for the fission data evaluation. Total, fission, capture and neutron emission cross section, average resonance parameters and angular distributions of neutron scattering are in excellent agreement with the available experimental data.

  2. Measurement/Evaluation Techniques and Nuclear Data Associated with Fission of 239Pu by Fission Spectrum Neutrons

    SciTech Connect (OSTI)

    Baisden, P; Bauge, E; Ferguson, J; Gilliam, D; Granier, T; Jeanloz, R; McMillan, C; Robertson, D; Thompson, P; Verdon, C; Wilkerson, C; Young, P

    2010-03-16

    This Panel was chartered to review and assess new evaluations of work on fission product data, as well as the evaluation process used by the two U.S. nuclear weapons physics laboratories. The work focuses on fission product yields resulting from fission spectrum neutrons incident on plutonium, and includes data from measurements that had not been previously published as well as new or revised fission product cumulative yield data, and related quantities such as Q values and R values. This report documents the Panel's assessment of the work presented by Los Alamos National Laboratory (LANL) and Lawrence Livermore National Laboratory (LLNL). Based on the work presented we have seven key observations: (1) Experiments conducted in the 1970s at LANL, some of which were performed in association with a larger, NIST-led, program, have recently been documented. A preliminary assessment of this work, which will be referred to in this document as ILRR-LANL, shows it to be technically sound. (2) LLNL has done a thorough, unbiased review and evaluation of the available literature and is in the process of incorporating the previously unavailable LANL data into its evaluation of key fission product yields. The results of the LLNL effort, which includes a preliminary evaluation of the ILRR-LANL data, have been documented. (3) LANL has also conducted an evaluation of fission product yields for fission spectrum neutrons on plutonium including a meta-analysis of benchmark data as part of a planned upgrade to the ENDF/B compilation. We found that the approach of using meta-analysis provides valuable additional insight for evaluating the sparse data sets involved in this assessment. (4) Both laboratories have provided convincing evidence for energy dependence in the fission product yield of {sup 147}Nd produced from the bombardment of {sup 239}Pu with fission spectrum neutrons over an incident neutron energy range of 0.2 to 1.9 MeV. (5) Consistent, complete, and explicit treatment of

  3. Selected spectroscopic results on element 115 decay chains

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Rudolph, D.; Forsberg, U.; Golubev, P.; Sarmiento, L. G.; Yakushev, A.; Andersson, L. -L.; Di Nitto, A.; Düllmann, Ch. E.; Gates, J. M.; Gregorich, K. E.; et al

    2014-08-24

    We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

  4. Selected spectroscopic results on element 115 decay chains

    SciTech Connect (OSTI)

    Rudolph, D.; Forsberg, U.; Golubev, P.; Sarmiento, L. G.; Yakushev, A.; Andersson, L. -L.; Di Nitto, A.; Düllmann, Ch. E.; Gates, J. M.; Gregorich, K. E.; Gross, C. J.; Herzberg, R. -D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Schädel, M.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Eberhardt, K.; Even, J.; Fahlander, C.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

    2014-08-24

    We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

  5. September 2015 Most Viewed Documents for Fission And Nuclear...

    Office of Scientific and Technical Information (OSTI)

    September 2015 Most Viewed Documents for Fission And Nuclear Technologies Estimation of ... structures Chen, S.S. (1985) 167 LWR nuclear fuel bundle data for use in fuel bundle ...

  6. March 2015 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    5 Most Viewed Documents for Fission And Nuclear Technologies Stress analysis and ... Maimoni, A. (1980) 101 Behavior of spent nuclear fuel in water pool storage Johnson, A.B. ...

  7. Most Viewed Documents for Fission And Nuclear Technologies: September...

    Office of Scientific and Technical Information (OSTI)

    Most Viewed Documents for Fission And Nuclear Technologies: September 2014 Estimation of ... H.J. (1977) 71 Behavior of spent nuclear fuel in water pool storage Johnson, A.B. ...

  8. March 2014 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    4 Most Viewed Documents for Fission And Nuclear Technologies Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 72 Peer-review study of the draft ...

  9. July 2013 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    July 2013 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas ... Ho, F.H. (1988) 136 Behavior of spent nuclear fuel in water pool storage Johnson, A.B. ...

  10. June 2014 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    June 2014 Most Viewed Documents for Fission And Nuclear Technologies Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 78 Estimation of gas leak rates ...