National Library of Energy BETA

Sample records for fission chain reaction

  1. Lesson 5 - Fission and Chain Reactions | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    5 - Fission and Chain Reactions Lesson 5 - Fission and Chain Reactions Lesson Four showed how the nuclei of atoms store energy and how unstable atoms decay and release energy. How do nuclear engineers use this knowledge to help them harness energy to make electricity? The answer lies in being able to start a nuclear chain reaction in fuel inside a nuclear power plant and keep it going. This lesson examines nuclear reactions called fission as well as how uranium is processed from ore to fuel.

  2. On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment

    SciTech Connect (OSTI)

    Anghaie, S.; Froelich, P.; Monkhorst, H.J. )

    1990-05-01

    In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, {sup 6}Li nd {sup 7}Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur.

  3. Supplement to Theory of Neutron Chain Reactions

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1952-05-26

    General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

  4. NUCLEAR FISSION CHAIN REACTING SYSTEM

    DOE Patents [OSTI]

    Anderson, H.L.; Brown, H.S.

    1961-06-27

    The patent describes a reactor consisting of a plurality of tubes passing through a body of heavy water or graphite, a heat exchanger, means for flowing UF/sub 6/ through the tubes and the heat exchangar, and means for bleeding off some of the UF/sub 6/ and separating plutonium therefrom. A specific suggestion contained is that the amount of the UF/sub 6/ outside the reaction unit be a multiple of that within it.

  5. Polymerase chain reaction system

    DOE Patents [OSTI]

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  6. Polyneutron Chain Reactions

    SciTech Connect (OSTI)

    John C. Fisher

    2000-11-12

    Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of {approx}60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N{>=}12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between {sup 16}O and {sup A}Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound {sup 16}O {sup A}Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the {sup 16}O and {sup A}Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of {sup A}Nt is prevented by the buildup of Coulomb energy associated with transforming {sup A}Nt into {sup A}H in close proximity to {sup 16}O. Thus, it is possible that {sup 16}O {sup A}Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the {sup A}Nt component can

  7. Chain Reaction Innovations: Innovation Applicant Information | Argonne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    National Laboratory Innovation Applicant Information Information for Innovation Applicants in the Chain Reaction Innovations program PDF icon CRI_innovation_applicant_info

  8. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction...

    National Nuclear Security Administration (NNSA)

    Self Sustain Nuclear Chain Reaction Chicago, IL Metallurgical Laboratory scientists led by Enrico Fermi achieve the first self-sustained nuclear chain reaction in pile...

  9. Dual phase multiplex polymerase chain reaction

    DOE Patents [OSTI]

    Pemov, Alexander; Bavykin, Sergei

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  10. OSTIblog Articles in the nuclear chain reaction Topic | OSTI...

    Office of Scientific and Technical Information (OSTI)

    amount of neutron reduction needed for a safe and controlled sustained nuclear reaction. ... Manhattan Project, nuclear chain reaction, plutonium, uranium, World War II Read more... ...

  11. Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction | National

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration | (NNSA) Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction Enrico Fermi Achieves First Self Sustain Nuclear Chain Reaction Chicago, IL Metallurgical Laboratory scientists led by Enrico Fermi achieve the first self-sustained nuclear chain reaction in pile constructed under the west grandstand at Stagg field in Chicago

  12. Integrated polymerase chain reaction/electrophoresis instrument

    DOE Patents [OSTI]

    Andresen, Brian D.

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  13. Angular momentum effects in fusion-fission and fusion-evaporation reactions

    SciTech Connect (OSTI)

    Plasil, F.

    1980-01-01

    The study of heavy-ion fusion reactions is complicated by the possible contributions of several mechanisms. The various types of heavy-ion-induced fission are discussed. Then compound-nucleus fission is considered with reference to fission barriers deduced from heavy-ion-induced fission. Next, the problems associated with measured values of evaporation-residue cross sections and the angular momentum dependence of incomplete fusion are examined. Finally, the de-excitation of compound nuclei is again taken up, this time with reference to the greatly enhanced ..cap alpha.. emission predicted on the basis of the rotating liquid drop model. 24 figures. (RWR)

  14. Chain Reaction Innovation is DOE's Newest Investment in the Clean...

    Office of Environmental Management (EM)

    in the Clean Energy Innovation Ecosystem Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem June 1, 2016 - 4:00pm Addthis Ribbon ...

  15. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  16. Fission-Fusion: A new reaction mechanism for nuclear astrophysics based on laser-ion acceleration

    SciTech Connect (OSTI)

    Thirolf, P. G.; Gross, M.; Allinger, K.; Bin, J.; Henig, A.; Kiefer, D.; Habs, D.; Ma, W.; Schreiber, J.

    2011-10-28

    We propose to produce neutron-rich nuclei in the range of the astrophysical r-process around the waiting point N = 126 by fissioning a dense laser-accelerated thorium ion bunch in a thorium target (covered by a CH{sub 2} layer), where the light fission fragments of the beam fuse with the light fission fragments of the target. Via the 'hole-boring' mode of laser Radiation Pressure Acceleration using a high-intensity, short pulse laser, very efficiently bunches of {sup 232}Th with solid-state density can be generated from a Th target and a deuterated CD{sub 2} foil, both forming the production target assembly. Laser-accelerated Th ions with about 7 MeV/u will pass through a thin CH{sub 2} layer placed in front of a thicker second Th foil (both forming the reaction target) closely behind the production target and disintegrate into light and heavy fission fragments. In addition, light ions (d,C) from the CD{sub 2} layer of the production target will be accelerated as well, inducing the fission process of {sup 232}Th also in the second Th layer. The laser-accelerated ion bunches with solid-state density, which are about 10{sup 14} times more dense than classically accelerated ion bunches, allow for a high probability that generated fission products can fuse again. The high ion beam density may lead to a strong collective modification of the stopping power, leading to significant range and thus yield enhancement. Using a high-intensity laser as envisaged for the ELI-Nuclear Physics project in Bucharest (ELI-NP), order-of-magnitude estimates promise a fusion yield of about 10{sup 3} ions per laser pulse in the mass range of A = 180-190, thus enabling to approach the r-process waiting point at N = 126.

  17. Chain Reaction Innovations: A More Powerful Incubator for Energy and

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Science Technology | Argonne National Laboratory A More Powerful Incubator for Energy and Science Technology Chain Reaction Innovations (CRI) is a two-year program for innovators focusing on energy and science technologies. Through an annual application call, four to six teams will be selected to join CRI. Program participants will receive the financial and technical support needed to mature nascent technologies that face long development cycles to the proof-of-concept level, thus getting

  18. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Patents [OSTI]

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  19. Chain Reaction Innovations Opens Call for First Startup Cohort of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Innovators | Department of Energy Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators July 20, 2016 - 3:29pm Addthis Chain Reaction Innovations Opens Call for First Startup Cohort of Energy Innovators Earlier this year, we announced the launch of Chain Reaction Innovations (CRI), the newest addition to the Department of Energy's (DOE) Lab-Embedded Entrepreneurship Programs

  20. Fusion-fission and quasifission in the reactions with heavy ions leading to the formation of Hs

    SciTech Connect (OSTI)

    Itkis, I. M.; Itkis, M. G.; Knyazheva, G. N.; Kozulin, E. M.

    2012-10-20

    Mass and energy distributions of binary reaction products obtained in the reactions {sup 22}Ne+{sup 249}Cf,{sup 26}Mg+{sup 248}Cm,{sup 36}S+{sup 238}U and {sup 58}Fe+{sup 208}Pb leading to Hs isotopes have been measured. At energies below the Coulomb barrier the bimodal fission of Hs*, formed in the reaction {sup 26}Mg+{sup 248}Cm, is observed. In the reaction {sup 36}S+{sup 238}U the considerable part of the symmetric fragments arises from the quasifission process. At energies above the Coulomb barrier the symmetric fragments originate mainly from fusion-fission process for both reactions with Mg and S ions. In the case of the {sup 58}Fe+{sup 208}Pb reaction the quasifission process dominates at all measured energies. The pre- and post-scission neutron multiplicities as a function of the fragment mass have been obtained for the reactions studied.

  1. Fission and quasifission modes in heavy-ion-induced reactions leading to the formation of Hs{sup *}

    SciTech Connect (OSTI)

    Itkis, I. M.; Kozulin, E. M.; Itkis, M. G.; Knyazheva, G. N.; Bogachev, A. A.; Chernysheva, E. V.; Krupa, L.; Oganessian, Yu. Ts.; Zagrebaev, V. I.; Rusanov, A. Ya.; Goennenwein, F.; Dorvaux, O.; Stuttge, L.; Hanappe, F.; Vardaci, E.; Goes Brennand, E. de

    2011-06-15

    Mass and energy distributions of binary reaction products obtained in the reactions {sup 22}Ne+{sup 249}Cf,{sup 26}Mg+{sup 248}Cm, {sup 36}S+{sup 238}U, and {sup 58}Fe+{sup 208}Pb have been measured. All reactions lead to Hs isotopes. At energies below the Coulomb barrier the bimodal fission of Hs{sup *}, formed in the reaction {sup 26}Mg+{sup 248}Cm, is observed. In the reaction {sup 36}S+{sup 238}U, leading to the formation of a similar compound nucleus, the main part of the symmetric fragments arises from the quasifission process. At energies above the Coulomb barrier fusion-fission is the main process leading to the formation of symmetric fragments for both reactions with Mg and S ions. In the case of the {sup 58}Fe+{sup 208}Pb reaction the quasifission process dominates at all measured energies.

  2. Nested methylation-specific polymerase chain reaction cancer detection method

    DOE Patents [OSTI]

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  3. Rotation of Nuclei as Observed in Ternary Fission of the Reaction 235U(nth,f) Induced by Polarized Neutron

    SciTech Connect (OSTI)

    Goennenwein, F.; Gagarski, A.; Guseva, I.; Petrov, G.; Sokolov, V.; Zavarukhkina, T.; Mutterer, M.; Nesvizhevski, V.; Bunakov, V.; Kadmensky, S.

    2007-05-22

    Ternary fission of the standard reaction 235U(nth,f) induced by cold polarized neutrons has been investigated. Fission fragments and light charged particles were recorded in coincidence. Following cold neutron capture the compound nucleus 236U* has spin 3- or 4-. At the saddle point of the fissioning 236U* nucleus these states are collective. They are expected to retain a sizable collectivity down to the scission point. In fact, a collective rotation has been sensed by the shift in the angular distribution of the light charged particles which depends on the orientation of neutron polarization. Direct observation of the rotation of 236U* excited in a cold neutron reaction is reported here for the first time. It is proposed to call the new phenomenon the 'ROT-effect'.

  4. The fusion-fission process in the reaction {sup 34}S+{sup 186}W near the interaction barrier

    SciTech Connect (OSTI)

    Harca, I. M.; Dmitriev, S.; Itkis, J.; Kozulin, E. M.; Knyazheva, G.; Loktev, T.; Novikov, K.; Azaiez, F.; Gottardo, A.; Matea, I.; Verney, D.; Hanappe, F.; Piot, J.; Schmitt, C.; Vardaci, E.

    2015-02-24

    The reaction {sup 34}S+{sup 186}W at E{sub lab}=160 MeV was investigated with the aim of diving into the features of the fusion-fission process. Gamma rays in coincidence with binary reaction fragments were measured using the high efficiency gamma-ray spectrometer ORGAM at the TANDEM Accelerator facility of I.P.N., Orsay, and the time-of-flight spectrometer for fission fragments (FF) registration CORSET of the Flerov Laboratory of Nuclear Reactions (FLNR), Dubna. The coupling of the ORGAM and CORSET setups offers the unique opportunity of extracting details for characterizing the fusion-fission process and gives information regarding production of neutron-rich heavy nuclei. The FF–γ coincidence method is of better use then the γ – γ coincidence method when dealing with low statistic measurements and also offers the opportunity to precisely correct the Dopler shift for in-flight emitted gamma rays. Evidence of symmetric and asymmetric fission modes were observed in the mass and TKE distributions, occurring due to shell effects in the fragments. Coincident measurements allow for discrimination between the gamma rays by accepting a specific range within the mass distribution of the reaction products. Details regarding the experimental setup, methods of processing the acquisitioned data and preliminary results are presented.

  5. Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Innovation Ecosystem | Department of Energy Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem Chain Reaction Innovation is DOE's Newest Investment in the Clean Energy Innovation Ecosystem June 1, 2016 - 4:00pm Addthis Ribbon cutting ceremony for the Chain Reaction Innovations program launch. From left to right: Dr. David Danielson, Assistant Secretary for Energy Efficiency and Renewable Energy; Dr. Peter Littlewood, Director of Argonne National

  6. Chain Reaction Innovations Opens the Call for its First Startup Cohort |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Chain Reaction Innovations Opens the Call for its First Startup Cohort Chain Reaction Innovations Opens the Call for its First Startup Cohort July 12, 2016 - 11:52am Addthis Announcement from Argonne National Laboratory Argonne National Laboratory has opened a new innovation incubator called Chain Reaction Innovations (CRI), which wants to ensure that innovators who are pursuing transformational technologies thrive by giving them an unparalleled level of support that

  7. Dynamical Dipole Mode in Heavy-Ion Fusion-Evaporation and Fission Reactions in the {sup 192}Pb Mass Region

    SciTech Connect (OSTI)

    Silvestri, R.; Inglima, G.; La Commara, M.; Martin, B.; Sandoli, M.; Pierroutsakou, D.; Parascandolo, C.; Boiano, A.; Romoli, M.; Agodi, C.; Alba, R.; Colonna, M.; Coniglione, R.; Del Zoppo, A.; Maiolino, C.; Santonocito, D.; Baran, V.; De Filippo, E.; Di Toro, M.; Rizzo, C.

    2011-10-28

    The prompt {gamma}-ray emission related with the dynamical dipole mode decay was investigated in the {sup 192}Pb mass region by means of the {sup 40}Ca+{sup 152}Sm and {sup 48}Ca+{sup 144}Sm fusion-evaporation and fission reactions at E{sub lab} = 11 and 10.1 MeV/nucleon, respectively. The two reactions populate, through entrance channel having different charge asymmetries, the {sup 192}Pb compound nucleus at an excitation energy of 236 MeV with identical spin distribution. Preliminary results of this experiment show that the dynamical dipole mode survives in collisions involving heavier mass reaction partners than those studied previously. As a fast cooling mechanism on the fusion path, the prompt dipole {gamma} radiation could be of interest for the synthesis of super-heavy elements through ''hot'' fusion reactions.

  8. A Multigroup Reaction Cross-Section Collapsing Code and Library of 154-Group Fission-Product Cross Sections.

    Energy Science and Technology Software Center (OSTI)

    1983-03-23

    Version 01/02 The code reads multigroup cross sections from a compatible data file and collapses user-selected reaction cross sections to any few-group structure using one of a variety of user neutron flux spectrum options given below: Option Flux description 1 Built-in function including Maxwellian, fission, fusion and slowing-down regions and requiring user-specified parameters and energy-region boundaries. 2 Set of log-log flux-energy interpolation points read from input cross-section data file. 3 Set of log-log flux-energy interpolationmore » points read from user-supplied card input. 4 - 6 Histogram flux values read from user-supplied card input in arbitrary group structure in units of flux-per unit-energy, flux-per-unit lethargy, or integral group flux. LAFPX-E may be used to collapse any set of multigroup reaction cross sections furnished in the required format. However, the code was developed for, and is furnished with, a library of 154-group fission-product cross sections processed from ENDF/B-IV with a typical light water reactor (LWR) flux spectrum and temperature. Four-group radiative capture cross sections produced for LWR calculations are tabulated in the code documentation and are incorporated in the EPRI-CINDER data library, RSIC Code Package CCC-309.« less

  9. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hanson, Susan Kloek

    2013-07-30

    Method of producing C.sub.8-C.sub.15 hydrocarbons. comprising providing a ketone starting material; providing an aldol starting material comprising chloromethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.3, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  10. Method of carbon chain extension using novel aldol reaction

    DOE Patents [OSTI]

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  11. Enrico Fermi and the First Self-Sustaining Nuclear Chain Reaction

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Fermi and the First Self-Sustaining Nuclear Chain Reaction Resources with Additional Information * Fermi Honored * Atoms for Peace * Centennial of Birth * Stamp Patents * Audio/Video Clips * Selected by NSTA for SciLinks "The President of the United States of America ... for especially meritorious contributions to the development, use, or control of atomic energy, grant[s] an award of merit to Enrico Fermi for his contributions to basic neutron physics and the achievement of the controlled

  12. OSTIblog Articles in the nuclear chain reaction Topic | OSTI, US Dept of

    Office of Scientific and Technical Information (OSTI)

    Energy Office of Scientific and Technical Information chain reaction Topic The Manhattan Project -- Its Operations by Mary Schorn 29 Nov, 2012 in Science Communications 4236 ManhattanProjectMap320.jpg The Manhattan Project -- Its Operations Read more about 4236 Major operations for the Manhattan Engineer District (Manhattan Project) took place in remote site locations in the states of Tennessee, New Mexico, and Washington, with additional research being conducted in university laboratories

  13. Fission Spectrum

    DOE R&D Accomplishments [OSTI]

    Bloch, F.; Staub, H.

    1943-08-18

    Measurements of the spectrum of the fission neutrons of 25 are described, in which the energy of the neutrons is determined from the ionization produced by individual hydrogen recoils. The slow neutrons producing fission are obtained by slowing down the fast neutrons from the Be-D reaction of the Stanford cyclotron. In order to distinguish between fission neutrons and the remaining fast cyclotron neutrons both the cyclotron current and the pusle amplifier are modulated. A hollow neutron container, in which slow neutrons have a lifetime of about 2 milliseconds, avoids the use of large distances. This method results in much higher intensities than the usual modulation arrangement. The results show a continuous distribution of neutrons with a rather wide maximum at about 0.8 MV falling off to half of its maximum value at 2.0 MV. The total number of netrons is determined by comparison with the number of fission fragments. The result seems to indicate that only about 30% of the neutrons have energies below .8 MV. Various tests are described which were performed in order to rule out modification of the spectrum by inelastic scattering. Decl. May 4, 1951

  14. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  15. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    SciTech Connect (OSTI)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  16. Theory of Neutron Chain Reactions. Volume II, Part I. Homogeneous Nuclear Chain Reactions. Chapter V. Neutron Chain Reactions. Chapter VI. Pile Equations. Chapter VII. Theory of Reflectors And The Method Of Groups

    DOE R&D Accomplishments [OSTI]

    Weinberg, Alvin M.; Noderer, L. C.

    1951-08-10

    The previous section of this book deals with the general problem of neutron diffusion. In this sequel we shall apply the results obtained already to the theory of slow neutron chain reacting systems.

  17. Investigation of the reaction {sup 208}Pb({sup 18}O, f): Fragment spins and phenomenological analysis of the angular anisotropy of fission fragments

    SciTech Connect (OSTI)

    Rusanov, A. Ya. Adeev, G. D.; Itkis, M. G.; Karpov, A. V.; Nadtochy, P. N.; Pashkevich, V. V.; Pokrovsky, I. V.; Salamatin, V. S.; Chubarian, G. G.

    2007-10-15

    The average multiplicity of gamma rays emitted by fragments originating from the fission of {sup 226}Th nuclei formed via a complete fusion of {sup 18}O and {sup 208}Pb nuclei at laboratory energies of {sup 18}O projectile ions in the range E{sub lab} = 78-198.5 MeV is measured and analyzed. The total spins of fission fragments are found and used in an empirical analysis of the energy dependence of the anisotropy of these fragments under the assumption that their angular distributions are formed in the vicinity of the scission point. The average temperature of compound nuclei at the scission point and their average angular momenta in the entrance channel are found for this analysis. Also, the moments of inertia are calculated for this purpose for the chain of fissile thorium nuclei at the scission point. All of these parameters are determined at the scission point by means of three-dimensional dynamical calculations based on Langevin equations. A strong alignment of fragment spins is assumed in analyzing the anisotropy in question. In that case, the energy dependence of the anisotropy of fission fragments is faithfully reproduced at energies in excess of the Coulomb barrier (E{sub c.m.} - E{sub B} {>=} 30 MeV). It is assumed that, as the excitation energy and the angular momentum of a fissile nucleus are increased, the region where the angular distributions of fragments are formed is gradually shifted from the region of nuclear deformations in the vicinity of the saddle point to the region of nuclear deformations in the vicinity of the scission point, the total angular momentum of the nucleus undergoing fission being split into the orbital component, which is responsible for the anisotropy of fragments, and the spin component. This conclusion can be qualitatively explained on the basis of linear-response theory.

  18. Interplay between compound and fragments aspects of nuclear fission...

    Office of Scientific and Technical Information (OSTI)

    aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments aspects of nuclear fission and ...

  19. Extended optical model for fission

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sin, M.; Capote, R.; Herman, M. W.; Trkov, A.

    2016-03-07

    A comprehensive formalism to calculate fission cross sections based on the extension of the optical model for fission is presented. It can be used for description of nuclear reactions on actinides featuring multi-humped fission barriers with partial absorption in the wells and direct transmission through discrete and continuum fission channels. The formalism describes the gross fluctuations observed in the fission probability due to vibrational resonances, and can be easily implemented in existing statistical reaction model codes. The extended optical model for fission is applied for neutron induced fission cross-section calculations on 234,235,238U and 239Pu targets. A triple-humped fission barrier ismore » used for 234,235U(n,f), while a double-humped fission barrier is used for 238U(n,f) and 239Pu(n,f) reactions as predicted by theoretical barrier calculations. The impact of partial damping of class-II/III states, and of direct transmission through discrete and continuum fission channels, is shown to be critical for a proper description of the measured fission cross sections for 234,235,238U(n,f) reactions. The 239Pu(n,f) reaction can be calculated in the complete damping approximation. Calculated cross sections for 235,238U(n,f) and 239Pu(n,f) reactions agree within 3% with the corresponding cross sections derived within the Neutron Standards least-squares fit of available experimental data. Lastly, the extended optical model for fission can be used for both theoretical fission studies and nuclear data evaluation.« less

  20. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOE Patents [OSTI]

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  1. Fission fragment driven neutron source

    DOE Patents [OSTI]

    Miller, Lowell G.; Young, Robert C.; Brugger, Robert M.

    1976-01-01

    Fissionable uranium formed into a foil is bombarded with thermal neutrons in the presence of deuterium-tritium gas. The resulting fission fragments impart energy to accelerate deuterium and tritium particles which in turn provide approximately 14 MeV neutrons by the reactions t(d,n).sup.4 He and d(t,n).sup.4 He.

  2. First-Hand Recollections of the First Self-Sustaining Chain Reaction

    Broader source: Energy.gov [DOE]

    Seventy years later, two of the men present at the first nuclear reaction recall the events of the memorable day.

  3. Spontaneous Fission

    DOE R&D Accomplishments [OSTI]

    Segre, Emilio

    1950-11-22

    The first attempt to discover spontaneous fission in uranium was made by [Willard] Libby, who, however, failed to detect it on account of the smallness of effect. In 1940, [K. A.] Petrzhak and [G. N.] Flerov, using more sensitive methods, discovered spontaneous fission in uranium and gave some rough estimates of the spontaneous fission decay constant of this substance. Subsequently, extensive experimental work on the subject has been performed by several investigators and will be quoted in the various sections. [N.] Bohr and [A.] Wheeler have given a theory of the effect based on the usual ideas of penetration of potential barriers. On this project spontaneous fission has been studied for the past several years in an effort to obtain a complete picture of the phenomenon. For this purpose the spontaneous fission decay constants {lambda} have been measured for separated isotopes of the heavy elements wherever possible. Moreover, the number {nu} of neutrons emitted per fission has been measured wherever feasible, and other characteristics of the spontaneous fission process have been studied. This report summarizes the spontaneous fission work done at Los Alamos up to January 1, 1945. A chronological record of the work is contained in the Los Alamos monthly reports.

  4. Investigation of the {sup 208}Pb({sup 18}O, f) fission reaction: Mass-energy distributions of fission fragments and their correlation with the gamma-ray multiplicity

    SciTech Connect (OSTI)

    Rusanov, A. Ya.; Itkis, M. G.; Kondratiev, N. A.; Pashkevich, V. V.; Pokrovsky, I. V.; Salamatin, V. S.; Chubarian, G. G.

    2008-06-15

    The mass-energy distributions of fragments originating from the fission of the compound nucleus {sup 226}Th and their correlations with the multiplicity of gamma rays emitted from these fragments are measured and analyzed in {sup 18}O + {sup 208}Pb interaction induced by projectile oxygen ions of energy in the range E{sub lab} = 78-198.5 MeV. Manifestations of an asymmetric fission mode, which is damped exponentially with increasing E{sub lab}, are demonstrated. Theoretical calculations of fission valleys reveal that only two independent valleys, symmetric and asymmetric, exist in the vicinity of the scission point. The dependence of the multiplicity of gamma rays emitted from both fission fragments on their mass, M{sub {gamma}}(M), has a complicated structure and is highly sensitive to shell effects in both primary and final fragments. A two-component analysis of the dependence M{sub {gamma}}(M) shows that the asymmetric mode survives in fission only at low partial-wave orbital angular momenta of compound nuclei. It is found that, for all E{sub lab}, the gamma-ray multiplicity M{sub {gamma}}as a function of the total kinetic energy (TKE) of fragments, M{sub {gamma}}(TKE), decreases linearly with increasing TKE. An analysis of the energy balance in the fission process at the laboratory energy of E{sub lab} = 78 MeV revealed the region of cold fission of fragments whose total kinetic energy is TKE {approx}Q{sub max}.

  5. Investigation of the reaction {sup 208}Pb({sup 18}O, f): Folding angular distributions of fission fragments and gamma-ray multiplicity

    SciTech Connect (OSTI)

    Rusanov, A. Ya. Itkis, M. G.; Kondratiev, N. A.; Pokrovsky, I. V.; Salamatin, V. S.; Chubarian, G. G.

    2007-10-15

    Correlations between folding angular distributions of fission fragments and the gamma-ray multiplicity are studied for {sup 18}O + {sup 208}Pb interactions at energies of the beam of {sup 18}O ions in the range E{sub lab} = 78-198.5 MeV. The probabilities are determined for complete-and incomplete-fusion processes inevitably followed by the fission of nuclei formed in these processes. It is found that the probability of incomplete fusion followed by fission increases with increasing energy of bombarding ions. It is shown that, for the incomplete-fusion process, folding angular distributions of fission fragments have a two-component structure. The width of folding angular distributions (FWHM) for complete fusion grows linearly with increasing energy of {sup 18}O ions. The multiplicity of gamma rays from fission fragments as a function of the linear-momentum transfer behaves differently for different energies of projectile ions. This circumstance is explained here by the distinction between the average angular momenta of participant nuclei in the fusion and fission channels, which is due to the difference in the probabilities of fission in the cases where different numbers of nucleons are captured by the target nucleus.

  6. Monte Carlo Hauser-Feshbach Calculations of Prompt Fission Neutrons...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Monte Carlo Hauser-Feshbach Calculations of Prompt Fission Neutrons and Gamma Rays: Application to Thermal Neutron-Induced Fission Reactions on U-235 and Pu-239 ...

  7. Benchmarking nuclear fission theory

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Bertsch, G. F.; Loveland, W.; Nazarewicz, W.; Talou, P.

    2015-05-14

    We suggest a small set of fission observables to be used as test cases for validation of theoretical calculations. Thus, the purpose is to provide common data to facilitate the comparison of different fission theories and models. The proposed observables are chosen from fission barriers, spontaneous fission lifetimes, fission yield characteristics, and fission isomer excitation energies.

  8. METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

    DOE Patents [OSTI]

    Fermi, E.; Leverett, M.C.

    1957-11-12

    This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

  9. MODELING AND FISSION CROSS SECTIONS FOR AMERICIUM.

    SciTech Connect (OSTI)

    ROCHMAN, D.; HERMAN, M.; OBLOZINSKY, P.

    2005-05-01

    This is the final report of the work performed under the LANL contract on the modeling and fission cross section for americium isotopes (May 2004-June 2005). The purpose of the contract was to provide fission cross sections for americium isotopes with the nuclear reaction model code EMPIRE 2.19. The following work was performed: (1) Fission calculations capability suitable for americium was implemented to the EMPIRE-2.19 code. (2) Calculations of neutron-induced fission cross sections for {sup 239}Am to {sup 244g}Am were performed with EMPIRE-2.19 for energies up to 20 MeV. For the neutron-induced reaction of {sup 240}Am, fission cross sections were predicted and uncertainties were assessed. (3) Set of fission barrier heights for each americium isotopes was chosen so that the new calculations fit the experimental data and follow the systematics found in the literature.

  10. Fission meter

    DOE Patents [OSTI]

    Rowland, Mark S.; Snyderman, Neal J.

    2012-04-10

    A neutron detector system for discriminating fissile material from non-fissile material wherein a digital data acquisition unit collects data at high rate, and in real-time processes large volumes of data directly into information that a first responder can use to discriminate materials. The system comprises counting neutrons from the unknown source and detecting excess grouped neutrons to identify fission in the unknown source.

  11. Fission theory: Its relevance to the nuclear cross section data base

    SciTech Connect (OSTI)

    Lynn, J.E.

    1989-01-01

    The development of fission reaction theory in relation to its predictive power in the calculation of neutron cross-sections is reviewed. The topics covered include the transition state spectrum and the channel theory; the discovery of complex topography in the fission barrier and the consequences of intermediate structure in fission cross-sections; the evidence of experimental data in parameterizing the fission barrier; and the role of other aspects of collective nuclear motion in controlling fission reaction rates. 51 refs., 6 figs.

  12. Microscopic Calculation of Fission Fragment Energies for the...

    Office of Scientific and Technical Information (OSTI)

    for the 239Pu(nth,f) Reaction Citation Details In-Document Search Title: Microscopic Calculation of Fission Fragment Energies for the 239Pu(nth,f) Reaction We calculate the ...

  13. Interplay between compound and fragments aspects of nuclear fission and

    Office of Scientific and Technical Information (OSTI)

    heavy-ion reaction (Conference) | SciTech Connect Conference: Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction Citation Details In-Document Search Title: Interplay between compound and fragments aspects of nuclear fission and heavy-ion reaction The scission point in nuclear fission plays a special role where one-body system changes to two-body system. Inverse of this situation is realized in heavy-ion fusion reaction where two-body system changes to

  14. Reexamination of fission fragment angular distributions and the fission process: Formalism

    SciTech Connect (OSTI)

    Bond, P.D.

    1985-08-01

    The theory of fission fragment angular distributions is examined and the universally used expression is found to be valid only under restrictive assumptions. A more general angular distribution formula is derived and applied to recent data of high spin systems. At the same time it is shown that the strong anisotropies observed from such systems can be understood without changing the essential basis of standard fission theory. The effects of reaction mechanisms other than complete fusion on fission fragment angular distributions are discussed and possible angular distribution signatures of noncompound nucleus formation are mentioned.

  15. Microscopic Description of Nuclear Fission: Fission Barrier Heights...

    Office of Scientific and Technical Information (OSTI)

    Conference: Microscopic Description of Nuclear Fission: Fission Barrier Heights of Even-Even Actinides Citation Details In-Document Search Title: Microscopic Description of Nuclear ...

  16. Interplay between compound and fragments aspects of nuclear fission...

    Office of Scientific and Technical Information (OSTI)

    The scission point in nuclear fission plays a special role where one-body system changes to two-body system. Inverse of this situation is realized in heavy-ion fusion reaction ...

  17. Our 50-year odyssey with fission: Summary

    SciTech Connect (OSTI)

    Nix, J.R.

    1989-01-01

    On the occasion of this International Conference on Fifty Years Research in Nuclear Fission, we summarize our present understanding of the fission process and the challenges that lie ahead. The basic properties of fission arise from a delicate competition between disruptive Coulomb forces, cohesive nuclear forces, and fluctuating shell and pairing forces. These static forces are primarily responsible for such experimental phenomena as deformed ground-state nuclear shapes, fission into fragments of unequal size, sawtooth neutron yields, spontaneously fissioning isomers, broad resonances and narrow intermediate structure in fission cross sections, and cluster radioactivity. However, inertial and dissipative forces also play decisive roles in the dynamical evolution of a fissioning nucleus. The energy dissipated between the saddle and scission points is small for low initial excitation energy at the saddle point and increases with increasing excitation energy. At moderate excitation energies, the dissipation of collective energy into internal single-particle excitation energy proceeds largely through the interaction of nucleons with the mean field and with each other in the vicinity of the nuclear surface, as well as through the transfer of nucleons between the two portions of the evolving dumbell-like system. These unique dissipation mechanisms arise from the Pauli exclusion principle for fermions and the details of the nucleon-nucleon interaction, which make the mean free path of a nucleon near the Fermi surface at low excitation energy longer than the nuclear radius. With its inverse process of heavy-ion fusion reactions, fission continues to yield surprises in the study of large-amplitude collective nuclear motion. 87 refs., 12 figs.

  18. Fission gas detection system

    DOE Patents [OSTI]

    Colburn, Richard P. (Pasco, WA)

    1985-01-01

    A device for collecting fission gas released by a failed fuel rod which device uses a filter to pass coolant but which filter blocks fission gas bubbles which cannot pass through the filter due to the surface tension of the bubble.

  19. Biomodal spontaneous fission

    SciTech Connect (OSTI)

    Hulet, E.K. )

    1989-09-26

    Investigations of mass and kinetic-energy distributions from spontaneous fission have been extended in recent years to an isotope of element 104 and, for half-lives, to an isotope of element 108. The results have been surprising in that spontaneous fission half-lives have turned out to be much longer than expected and mass and kinetic- energy distributions were found to abruptly shift away from those of the lighter actinides, showing two modes of fission. These new developments have caused a re-evaluation of our understanding of the fission process, bringing an even deeper appreciation of the role played by nuclear shell effects upon spontaneous fission properties. 16 refs., 10 figs.

  20. Liquid uranium alloy-helium fission reactor

    DOE Patents [OSTI]

    Minkov, V.

    1984-06-13

    This invention describes a nuclear fission reactor which has a core vessel and at least one tandem heat exchanger vessel coupled therewith across upper and lower passages to define a closed flow loop. Nuclear fuel such as a uranium alloy in its liquid phase fills these vessels and flow passages. Solid control elements in the reactor core vessel are adapted to be adjusted relative to one another to control fission reaction of the liquid fuel therein. Moderator elements in the other vessel and flow passages preclude fission reaction therein. An inert gas such as helium is bubbled upwardly through the heat exchanger vessel operable to move the liquid fuel upwardly therein and unidirectionally around the closed loop and downwardly through the core vessel. This helium gas is further directed to heat conversion means outside of the reactor vessels to utilize the heat from the fission reaction to generate useful output. The nuclear fuel operates in the 1200 to 1800/sup 0/C range, and even higher to 2500/sup 0/C.

  1. Liquid uranium alloy-helium fission reactor

    DOE Patents [OSTI]

    Minkov, Vladimir (Skokie, IL)

    1986-01-01

    This invention teaches a nuclear fission reactor having a core vessel and at least one tandem heat exchanger vessel coupled therewith across upper and lower passages to define a closed flow loop. Nuclear fuel such as a uranium alloy in its liquid phase fills these vessels and flow passages. Solid control elements in the reactor core vessel are adapted to be adjusted relative to one another to control fission reaction of the liquid fuel therein. Moderator elements in the other vessel and flow passages preclude fission reaction therein. An inert gas such as helium is bubbled upwardly through the heat exchanger vessel operable to move the liquid fuel upwardly therein and unidirectionally around the closed loop and downwardly through the core vessel. This helium gas is further directed to heat conversion means outside of the reactor vessels to utilize the heat from the fission reaction to generate useful output. The nuclear fuel operates in the 1200.degree.-1800.degree. C. range, and even higher to 2500.degree. C., limited only by the thermal effectiveness of the structural materials, increasing the efficiency of power generation from the normal 30-35% with 300.degree.-500.degree. C. upper limit temperature to 50-65%. Irradiation of the circulating liquid fuel, as contrasted to only localized irradiation of a solid fuel, provides improved fuel utilization.

  2. Attempt to confirm superheavy element production in the 48Ca +238U reaction

    SciTech Connect (OSTI)

    Gregorich, K.E.; Loveland, W.; Peterson, D.; Zielinski, P.M.; Nelson, S.L.; Chung, Y.H.; Dullmann, Ch.E.; Folden III, C.M.; Aleklett,K.; Eichler, R.; Hoffman D.C.; Omtvedt, J.P.; Pang, G.K.; Schwantes,J.M.; Soverna, S.; Sprunger, P.; Sudowe, R.; Wilson, R.E.; Nitsche, H.

    2005-03-24

    An attempt to confirm production of superheavy elements in the reaction of 48Ca beams with actinide targets has been performed using the 238U(48Ca,3n)283112 reaction. Two 48Ca projectile energies were used, that spanned the energy range where the largest cross sections have been reported for this reaction. No spontaneous fission events were observed. No alpha decay chains consistent with either reported or theoretically predicted element 112 decay properties were observed. The cross section limits reached are significantly smaller than the recently reported cross sections.

  3. Attempt to confirm superheavy element production in the {sup 48}Ca+{sup 238}U reaction

    SciTech Connect (OSTI)

    Gregorich, K.E.; Sudowe, R.; Loveland, W.; Sprunger, P.; Peterson, D.; Zielinski, P.M.; Nelson, S.L.; Duellmann, Ch.E.; Folden III, C.M.; Hoffman, D.C.; Wilson, R.E.; Nitsche, H.; Chung, Y.H.; Aleklett, K.; Eichler, R.; Soverna, S.; Omtvedt, J.P.; Pang, G.K.; Schwantes, J.M.

    2005-07-01

    An attempt to confirm production of superheavy elements in the reaction of {sup 48}Ca beams with actinide targets has been performed using the {sup 238}U({sup 48}Ca,3n){sup 283}112 reaction. Two {sup 48}Ca projectile energies were used that spanned the energy range where the largest cross sections have been reported for this reaction. No spontaneous fission events were observed. No {alpha} decay chains consistent with either reported or theoretically predicted element 112 decay properties were observed. The cross-section limits reached are significantly smaller than the recently reported cross sections.

  4. Fission Barriers of Compound Superheavy Nuclei

    SciTech Connect (OSTI)

    Pei, Junchen; Nazarewicz, Witold; Sheikh, J. A.; Kerman, A. K.

    2009-01-01

    The dependence of fission barriers on the excitation energy of the compound nucleus impacts the survival probability of superheavy nuclei synthesized in heavy-ion fusion reactions. We study the temperature-dependent fission barriers by means of the self-consistent nuclear density functional theory. The equivalence of isothermal and isentropic descriptions is demonstrated. The effect of the particle gas is found to be negligible in the range of temperatures studied. Calculations have been carried out for ^{264}Fm, ^{272}Ds, ^{278}112, ^{292}114, and ^{312}124. For nuclei around ^{278}112 produced in "cold fusion" reactions, we predict a more rapid decrease of fission barriers with temperature as compared to the nuclei around ^{292}114 synthesized in "hot fusion" experiments. This is explained in terms of the difference between the ground-state and fission-barrier temperatures. Our calculations are consistent with the long survival probabilities of the superheavy elements produced in Dubna with the ^{48}Ca beam.

  5. Microscopic Theory of Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Microscopic Theory of Fission Citation Details In-Document Search Title: Microscopic Theory of Fission Authors: Younes, W ; Gogny, D Publication Date: 2008-01-03 OSTI Identifier: 924187 Report Number(s): LLNL-PROC-400347 DOE Contract Number: W-7405-ENG-48 Resource Type: Conference Resource Relation: Conference: Presented at: Compound Nuclear Reactions and Related Topics, Fish Camp, CA, United States, Oct 22 - Oct 26, 2007 Research Org: Lawrence Livermore National Laboratory (LLNL), Livermore, CA

  6. Process for treating fission waste

    DOE Patents [OSTI]

    Rohrmann, Charles A.; Wick, Oswald J.

    1983-01-01

    A method is described for the treatment of fission waste. A glass forming agent, a metal oxide, and a reducing agent are mixed with the fission waste and the mixture is heated. After melting, the mixture separates into a glass phase and a metal phase. The glass phase may be used to safely store the fission waste, while the metal phase contains noble metals recovered from the fission waste.

  7. Fire extinguishant for fissionable material

    DOE Patents [OSTI]

    Schmitt, Charles R.

    1976-01-01

    Carbon microspheres impregnated with a neutron poison are used as an extinguishant for radioactive and fissionable metal fires.

  8. Flow cytometric detection of human immunodeficiency virus type 1 proviral DNA by the polymerase chain reaction incorporating digoxigenin- or fluorescein-labeled dUTP

    SciTech Connect (OSTI)

    Yang, Gang; Olson, J.C.; Pu, R.; Vyas, G.N.

    1995-10-01

    Serological assays are routinely used in the laboratory diagnosis of human immunodeficiency virus type-1 (HrV-1) infection, but the polymerase chain reaction (PCR) is ultimately the most sensitive and direct method for establishing definitive diagnosis. As an alternative to the conventional radioactive PCR procedure we have developed and evaluated a pair of rapid nonradioisotopic flow cytometric detection methods. Using heminested PCR we directly incorporated fluorescein-12-dUTP (fluo-dUTP) or digoxigenin-11-dUTP (dig-dUTP) into the PCR-amplicons. The labeled amplicons were hybridized with biotinylated antisense and sense probes, followed by capture of the hybrid DNA using streptavidin-coated beads which were finally analyzed in a flow cytometer by (1) direct detection of the fluorescence intensity of the amplicons incorporating fluo-dUTP and (2) immunodetection of the amplicons incorporating dig-dUTP by anti-digoxigenin IgG labeled with fluorescein isothiocyanate (FITC). Although both assays were functionally comparable with radiolabeled probe in reliably detecting as low as five copies of HIV-1 proviral DNA sequences, the immunodetection of dig-dUTP consistently yielded higher mean channel fluorescence and gave a stable signal over an extended period of 12-14 weeks. In testing a panel of 20 pedigreed PBMC specimens from blood donors with or without HIV-1 infection, the results of both flow cytometric assays were identical with those of the conventional radioactive procedure. Therefore, we conclude that the dig-dUTP incorporation in amplicons, hybridization with a pair of sense-antisense biotinylated probes and immunodetection of hybrids by flow cytometric analyses is the nonisotopic method of choice for PCR-diagnosis of HIV-1 infection. 21 refs., 2 figs., 4 tabs.

  9. Measurements of delayed neutron decay constants and fission yields from {sup 235}U, {sup 237}Np, {sup 241}Am, and {sup 243}Am

    SciTech Connect (OSTI)

    Saleh, H.H.; Parish, T.A.; Raman, S.; Shinohara, Nobuo

    1997-01-01

    Isotopes of the higher actinide elements are produced as a result of successive radiative capture reactions in the uranium fuel of nuclear reactors. Typically, these transuranic isotopes decay through long chains, have long half-lives, and dominate the long-term toxicity of spent reactor fuel. One of the options for high level waste management is to remove the higher actinide elements from spent fuel by chemical processing, to load them into new special fuel elements, and to transmute them by neutron-induced fission into shorter-lived fission fragments. Reactors designed to achieve high actinide fission (transmutation) rates are called actinide burners. In such reactors, the actinide wastes would constitute much of the fissionable fuel. Due to the high transuranic isotope loadings in the fuel of actinide burners, the neutronic properties of the higher actinide isotopes will have a significant effect on the criticality and safety characteristics of such reactors. While there is an extensive operational database for reactors fueled with uranium and plutonium, operating experience with fuel containing large amounts of actinide wastes is quite limited. Two important neutronic properties of actinide burner cores are their reactivity and their delayed neutron fraction. Both of these properties will be strongly influenced by the neutronic characteristics of the actinide waste isotopes. Here, delayed neutron yields and decay constants for {sup 235}U, {sup 237}Np, {sup 241}Am, and {sup 243}Am were measured at the Texas A and M University TRIGA reactor using a fast pneumatic transfer system. The detection system consisted of an array of BF{sub 3} proportional counters embedded in a polyethylene cylinder. The measured values of the total delayed neutron yield per 100 fissions from thermal neutron-induced fission of {sup 235}U, {sup 237}Np, {sup 241}Am, and {sup 243}Am were determined to be 1.59 {+-} 0.04, 1.29 {+-} 0.04, 0.49 {+-} 0.02, and 0.84 {+-} 0.04, respectively.

  10. A New Method of Prompt Fission Neutron Energy Spectrum Unfolding

    SciTech Connect (OSTI)

    Zeynalova, O. V. [Moscow State Institute of Radioengineering, Electronics and Automation, Moscow (Russian Federation); Joint Institute for Nuclear Research, Dubna (Russian Federation); Zeynalov, Sh. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Hambsch, F.-J.; Oberstedt, S. [EC-JRC-Institute for Reference Materials and Measurements, Geel (Belgium)

    2010-11-25

    The prompt neutron emission in spontaneous fission of {sup 252}Cf has been investigated applying digital signal electronics along with associated digital signal processing algorithms. The goal was to find out the reasons of a long time existing discrepancy between theoretical calculations and the measurements of prompt fission neutron (PFN) emission dependence on the total kinetic energy (TKE) of fission fragments (FF). On the one hand the {sup 252}Cf(sf) reaction is one of the main references for nuclear data, on the other hand the understanding of PFN emission mechanism is very important for nuclear fission theory. Using a twin Frisch-grid ionization chamber for fission fragment (FF) detection and a NE213-equivalent neutron detector in total about 10{sup 7} fission fragment-neutron coincidences have been registered. Fission fragment kinetic energy, mass and angular distribution, neutron time-of-flight and pulse shape have been investigated using a 12 bit waveform digitizer. The signal waveforms have been analyzed using digital signal processing algorithms. For the first time the dependence of the number of emitted neutrons as a function of total kinetic energy (TKE) of the fragments is in very good agreement with theoretical calculations in the range of TKE from 140-220 MeV.

  11. Feasibility of an antiproton catalyzed fission fragment rocket

    SciTech Connect (OSTI)

    Hdinger, D.S.

    1992-03-01

    The purpose of this project was to investigate the feasibility of an antiproton catalyzed fission fragment rocket (FFR). The FFR is characterized by the extraction of fission fragments from the fissile fuel, and the utilization of their kinetic energy for thrust generation. A significant drawback to previous FFR designs was the requirement to maintain a critical nuclear pile as the fission fragment source. The author examined the possibility of replacing the critical pile with a sub-critical pile driven by antiprotons. Recent experiments have revealed that antiprotons stimulate highly energetic fissions in {sup 238}U, with a neutron multiplicity of 13.7 neutrons per fission. This interaction was used as a throttled neutron source. The pile consisted of layers of fissile coated fibers which are designed to allow fission fragments to escape them, where the fragments collide with a fluid. The heated fluid is then ejected from the rocket to provide thrust. The calculations performed indicate that each antiproton injected into the pile can stimulate 8 or more fissions while maintaining a neutron multiplication of less than 0.4. Based on the results seen, the engine design presented is inadequate. Limitations introduced by the reaction fluid far outweigh the simplicity-of-design gained. Despite this, the basic idea of using the antiproton-U interaction as a source of spacecraft propulsion warrants further study.

  12. Measurements of actinide-fission product yields in Caliban and Prospero metallic core reactor fission neutron fields

    SciTech Connect (OSTI)

    Casoli, P.; Authier, N. [CEA, Centre de Valduc, 21120 Is-sur-Tille (France); Laurec, J.; Bauge, E.; Granier, T. [CEA, Centre DIF, 91297 Arpajon (France)

    2011-07-01

    In the 1970's and early 1980's, an experimental program was performed on the facilities of the CEA Valduc Research Center to measure several actinide-fission product yields. Experiments were, in particular, completed on the Caliban and Prospero metallic core reactors to study fission-neutron-induced reactions on {sup 233}U, {sup 235}U, and {sup 239}Pu. Thick actinide samples were irradiated and the number of nuclei of each fission product was determined by gamma spectrometry. Fission chambers were irradiated simultaneously to measure the numbers of fissions in thin deposits of the same actinides. The masses of the thick samples and the thin deposits were determined by mass spectrometry and alpha spectrometry. The results of these experiments will be fully presented in this paper for the first time. A description of the Caliban and Prospero reactors, their characteristics and performances, and explanations about the experimental approach will also be given in the article. A recent work has been completed to analyze and reinterpret these measurements and particularly to evaluate the associated uncertainties. In this context, calculations have also been carried out with the Monte Carlo transport code Tripoli-4, using the published benchmarked Caliban description and a three-dimensional model of Prospero, to determine the average neutron energy causing fission. Simulation results will be discussed in this paper. Finally, new fission yield measurements will be proposed on Caliban and Prospero reactors to strengthen the results of the first experiments. (authors)

  13. Fusion-fission hybrid studies in the United States

    SciTech Connect (OSTI)

    Moir, R.W.; Lee, J.D.; Berwald, D.H.; Cheng, E.T.; Delene, J.G.; Jassby, D.L.

    1986-05-20

    Systems and conceptual design studies have been carried out on the following three hybrid types: (1) The fission-suppressed hybrid, which maximizes fissile material produced (Pu or /sup 233/U) per unit of total nuclear power by suppressing the fission process and multiplying neutrons by (n,2n) reactions in materials like beryllium. (2) The fast-fission hybrid, which maximizes fissile material produced per unit of fusion power by maximizing fission of /sup 238/U (Pu is produced) in which twice the fissile atoms per unit of fusion power (but only a third per unit of nuclear power) are made. (3) The power hybrid, which amplifies power in the blanket for power production but does not produce fuel to sell. All three types must sell electrical power to be economical.

  14. Event-by-Event Simulation of Induced Fission

    SciTech Connect (OSTI)

    Vogt, R; Randrup, J

    2007-12-13

    We are developing a novel code that treats induced fission by statistical (or Monte-Carlo) simulation of individual decay chains. After its initial excitation, the fissionable compound nucleus may either deexcite by evaporation or undergo binary fission into a large number of fission channels each with different energetics involving both energy dissipation and deformed scission prefragments. After separation and Coulomb acceleration, each fission fragment undergoes a succession of individual (neutron) evaporations, leading to two bound but still excited fission products (that may further decay electromagnetically and, ultimately, weakly), as well as typically several neutrons. (The inclusion of other possible ejectiles is planned.) This kind of approach makes it possible to study more detailed observables than could be addressed with previous treatments which have tended to focus on average quantities. In particular, any type of correlation observable can readily be extracted from a generated set of events. With a view towards making the code practically useful in a variety of applications, emphasis is being put on making it numerically efficient so that large event samples can be generated quickly. In its present form, the code can generate one million full events in about 12 seconds on a MacBook laptop computer. The development of this qualitatively new tool is still at an early stage and quantitative reproduction of existing data should not be expected until a number of detailed refinement have been implemented.

  15. SHAPED FISSIONABLE METAL BODIES

    DOE Patents [OSTI]

    Wigner, E.P.; Williamson, R.R.; Young, G.J.

    1958-10-14

    A technique is presented for grooving the surface of fissionable fuel elements so that expansion can take place without damage to the interior structure of the fuel element. The fissionable body tends to develop internal stressing when it is heated internally by the operation of the nuclear reactor and at the same time is subjected to surface cooling by the circulating coolant. By producing a grooved or waffle-like surface texture, the annular lines of tension stress are disrupted at equally spaced intervals by the grooves, thereby relieving the tension stresses in the outer portions of the body while also facilitating the removal of accumulated heat from the interior portion of the fuel element.

  16. Microscopic Description of Nuclear Fission: Fission Barrier Heights...

    Office of Scientific and Technical Information (OSTI)

    Resource Type: Conference Resource Relation: Conference: Presented at: 5th International Conference on Fission and properties of neutron-rich nuclei, Sanibel Island, FL, United ...

  17. Science based stockpile stewardship, uncertainty quantification, and fission fragment beams

    SciTech Connect (OSTI)

    Stoyer, M A; McNabb, D; Burke, J; Bernstein, L A; Wu, C Y

    2009-09-14

    Stewardship of this nation's nuclear weapons is predicated on developing a fundamental scientific understanding of the physics and chemistry required to describe weapon performance without the need to resort to underground nuclear testing and to predict expected future performance as a result of intended or unintended modifications. In order to construct more reliable models, underground nuclear test data is being reanalyzed in novel ways. The extent to which underground experimental data can be matched with simulations is one measure of the credibility of our capability to predict weapon performance. To improve the interpretation of these experiments with quantified uncertainties, improved nuclear data is required. As an example, the fission yield of a device was often determined by measuring fission products. Conversion of the measured fission products to yield was accomplished through explosion code calculations (models) and a good set of nuclear reaction cross-sections. Because of the unique high-fluence environment of an exploding nuclear weapon, many reactions occurred on radioactive nuclides, for which only theoretically calculated cross-sections are available. Inverse kinematics reactions at CARIBU offer the opportunity to measure cross-sections on unstable neutron-rich fission fragments and thus improve the quality of the nuclear reaction cross-section sets. One of the fission products measured was {sup 95}Zr, the accumulation of all mass 95 fission products of Y, Sr, Rb and Kr (see Fig. 1). Subsequent neutron-induced reactions on these short lived fission products were assumed to cancel out - in other words, the destruction of mass 95 nuclides was more or less equal to the production of mass 95 nuclides. If a {sup 95}Sr was destroyed by an (n,2n) reaction it was also produced by (n,2n) reactions on {sup 96}Sr, for example. However, since these nuclides all have fairly short half-lives (seconds to minutes or even less), no experimental nuclear reaction

  18. Benchmarking the LAHET fission models

    SciTech Connect (OSTI)

    Prael, R.E.

    1995-12-31

    There has been considerable interest in improving the fission models in the LAHET Monte Carlo code for the transport and interaction of nucleons, pions, muons, fight ions, and antinucleons. Although subactinide fission contributes little to neutron production in lead or tungsten targets, it can be significant for simulation of target activation and fission product contamination. The availability of new data permits new comparisons to be made between experiment and calculation.

  19. Testing actinide fission yield treatment in CINDER90 for use in MCNP6 burnup calculations

    SciTech Connect (OSTI)

    Fensin, Michael Lorne; Umbel, Marissa

    2015-09-18

    Most of the development of the MCNPX/6 burnup capability focused on features that were applied to the Boltzman transport or used to prepare coefficients for use in CINDER90, with little change to CINDER90 or the CINDER90 data. Though a scheme exists for best solving the coupled Boltzman and Bateman equations, the most significant approximation is that the employed nuclear data are correct and complete. Thus, the CINDER90 library file contains 60 different actinide fission yields encompassing 36 fissionable actinides (thermal, fast, high energy and spontaneous fission). Fission reaction data exists for more than 60 actinides and as a result, fission yield data must be approximated for actinides that do not possess fission yield information. Several types of approximations are used for estimating fission yields for actinides which do not possess explicit fission yield data. The objective of this study is to test whether or not certain approximations of fission yield selection have any impact on predictability of major actinides and fission products. Further we assess which other fission products, available in MCNP6 Tier 3, result in the largest difference in production. Because the CINDER90 library file is in ASCII format and therefore easily amendable, we assess reasons for choosing, as well as compare actinide and major fission product prediction for the H. B. Robinson benchmark for, three separate fission yield selection methods: (1) the current CINDER90 library file method (Base); (2) the element method (Element); and (3) the isobar method (Isobar). Results show that the three methods tested result in similar prediction of major actinides, Tc-99 and Cs-137; however, certain fission products resulted in significantly different production depending on the method of choice.

  20. Fission Product Data Measured at Los Alamos for Fission Spectrum and Thermal Neutrons on {sup 239}Pu, {sup 235}U, {sup 238}U

    SciTech Connect (OSTI)

    Selby, H.D.; Mac Innes, M.R.; Barr, D.W.; Keksis, A.L.; Meade, R.A.; Burns, C.J.; Chadwick, M.B.; Wallstrom, T.C.

    2010-12-15

    We describe measurements of fission product data at Los Alamos that are important for determining the number of fissions that have occurred when neutrons are incident on plutonium and uranium isotopes. The fission-spectrum measurements were made using a fission chamber designed by the National Institute for Standards and Technology (NIST) in the BIG TEN critical assembly, as part of the Inter-laboratory Liquid Metal Fast Breeder Reactor (LMFBR) Reaction Rate (ILRR) collaboration. The thermal measurements were made at Los Alamos' Omega West Reactor. A related set of measurements were made of fission-product ratios (so-called R-values) in neutron environments provided by a number of Los Alamos critical assemblies that range from having average energies causing fission of 400-600 keV (BIG TEN and the outer regions of the Flattop-25 assembly) to higher energies (1.4-1.9 MeV) in the Jezebel, and in the central regions of the Flattop-25 and Flattop-Pu, critical assemblies. From these data we determine ratios of fission product yields in different fuel and neutron environments (Q-values) and fission product yields in fission spectrum neutron environments for {sup 99}Mo, {sup 95}Zr, {sup 137}Cs, {sup 140}Ba, {sup 141,143}Ce, and {sup 147}Nd. Modest incident-energy dependence exists for the {sup 147}Nd fission product yield; this is discussed in the context of models for fission that include thermal and dynamical effects. The fission product data agree with measurements by Maeck and other authors using mass-spectrometry methods, and with the ILRR collaboration results that used gamma spectroscopy for quantifying fission products. We note that the measurements also contradict earlier 1950s historical Los Alamos estimates by {approx}5-7%, most likely owing to self-shielding corrections not made in the early thermal measurements. Our experimental results provide a confirmation of the England-Rider ENDF/B-VI evaluated fission-spectrum fission product yields that were carried

  1. The series of carbon-chain complexes {Ru(dppe)Cp*}?{?-(C?C)x} (x = 48, 11): Synthesis, structures, properties and some reactions

    SciTech Connect (OSTI)

    Bruce, Michael I.; Cole, Marcus L.; Ellis, Benjamin G.; Gaudio, Maryka; Nicholson, Brian K.; Parker, Christian R.; Skelton, Brian W.; White, Allan H.

    2015-01-28

    The construction of a series of compounds {Ru(dppe)Cp*}2(?-C2x) (Ru*-C2x-Ru*, x = 48, 11)) is described. A direct reaction between RuCl(dppe)Cp* and Me3Si(Ctriple bond; length of mdashC)4SiMe3 afforded Ru*-C8-Ru* in 89% yield. The Pd(0)/Cu(I)-catalysed coupling of Ru{Ctriple bond; length of mdashCCtriple bond; length of mdashCAu(PPh3)}(dppe)Cp*Ru*-C4-Au (2 equiv.) with diiodoethyne gave Ru*-C10-Ru* (64%), or of 1 equiv. with I(Ctriple bond; length of mdashC)3I gave Ru*-C14-Ru* (36%); similarly, Ru{(Ctriple bond; length of mdashC)4Au(PPh3)}(dppe)Cp*Ru*-C8-Au and I(Ctriple bond; length of mdashC)3I gave Ru*-C22-Ru* (12%). Desilylation (TBAF) of Ru{(Ctriple bond; length of mdashC)xSiMe3}(dppe)Cp*Ru*-C2x-Si (x = 3, 4) followed by oxidative coupling [Cu(OAc)2/py] gave Ru*-C12-Ru* (82%) and Ru*-C16-Ru* (58%), respectively. Similar oxidative coupling of Ru(Ctriple bond; length of mdashCCtriple bond; length of mdashCH)(dppe)Cp* was a second route to Ru*-C8-Ru* (82%). Appropriate precursors are already known, or obtained by coupling of Ru*-C2x-Si (x = 2, 4) with AuCl(PPh3)/NaOMe [Ru*-C4-Au, 95%; Ru*-C8-Au, 74%] or from Pd(0)/Cu(I) catalysed coupling of Ru*-C2x-Au (x = 2, 3) with I(Ctriple bond; length of mdashC)2SiMe3 (Ru*-C8-Si, 64%; Ru*-C10-Si, 2%). Reactions between Ru*-C2x-Ru* (x = 3, 4) and Fe2(CO)9 gave {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}2Fe(C3-Ru*)2 and {Fe3(CO)9}{?3-CCtriple bond; length of mdashC[Ru(dppe)Cp*]}{?3-C(Ctriple bond; length of mdashC)2[Ru(dppe)Cp*]} Fe(C3-Ru*)(C5-Ru*), respectively. The redox properties of the series of complexes with 2x = 216 were measured and showed a diminution of the separation of

  2. Post-scission fission theory: Neutron emission in fission

    SciTech Connect (OSTI)

    Madland, D.G.

    1997-11-01

    A survey of theoretical representations of two of the observables in neutron emission in fission is given, namely, the prompt fission neutron spectrum N (E) and the average prompt neutron multiplicity {bar {nu}}{sub p}. Early representations of the two observables are presented and their deficiencies are discussed. This is followed by summaries and examples of recent theoretical models for the calculation of these quantities. Emphasis is placed upon the predictability and accuracy of the recent models. In particular, the dependencies of N (E) and {bar {nu}}{sub p} upon the fissioning nucleus and its excitation energy are treated. Recent work in the calculation of the prompt fission neutron spectrum matrix N (E, E{sub n}), where E{sub n} is the energy of the neutron inducing fission, is then discussed. Concluding remarks address the current status of our ability to calculate these observables with confidence, the direction of future theoretical efforts, and limitations to current (and future) approaches.

  3. Fission-suppressed fusion breeder on the thorium cycle and nonprolifer...

    Office of Scientific and Technical Information (OSTI)

    Each fusion reaction can produce typically 0.6 fissile atoms and release about 1.6 times the 14 MeV neutron's energy in the blanket in the fission-suppressed design. This ...

  4. Average and effective Q-values for fission product average (n...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Average and effective Q-values for fission product average (n,2n) and (n,3n) reaction cross sections Citation Details In-Document Search Title: Average and ...

  5. Average and effective Q-values for fission product average (n...

    Office of Scientific and Technical Information (OSTI)

    Average and effective Q-values for fission product average (n,2n) and (n,3n) reaction cross sections Citation Details In-Document Search Title: Average and effective Q-values for ...

  6. Fission Particle Emission Multiplicity Simulation

    Energy Science and Technology Software Center (OSTI)

    2006-09-27

    Simulates discrete neutron and gamma-ray emission from the fission of heavy nuclei that is either spontaneous or neutron induced. This is a function library that encapsulates the fission physics and is intended to be called Monte Carlo transport code.

  7. Fission throughout the periodic table

    SciTech Connect (OSTI)

    Moretto, L.G.; Wozniak, G.J.

    1989-04-01

    The dualistic view of fission and evaporation as two distinct compound nucleus processes is substituted with a unified view in which fission, complex fragment emission, and light particle evaporation are seen as different aspects of a single process. 47 refs., 22 figs.

  8. TREATMENT OF FISSION PRODUCT WASTE

    DOE Patents [OSTI]

    Huff, J.B.

    1959-07-28

    A pyrogenic method of separating nuclear reactor waste solutions containing aluminum and fission products as buring petroleum coke in an underground retort, collecting the easily volatile gases resulting as the first fraction, he uminum chloride as the second fraction, permitting the coke bed to cool and ll contain all the longest lived radioactive fission products in greatly reduced volume.

  9. Microscopic Description of Induced Nuclear Fission (Conference...

    Office of Scientific and Technical Information (OSTI)

    Microscopic Description of Induced Nuclear Fission Citation Details In-Document Search Title: Microscopic Description of Induced Nuclear Fission You are accessing a document ...

  10. Excitation Energy Sorting Mechanisms in Fission (Conference)...

    Office of Scientific and Technical Information (OSTI)

    Excitation Energy Sorting Mechanisms in Fission Citation Details In-Document Search Title: Excitation Energy Sorting Mechanisms in Fission You are accessing a document from the ...

  11. Testing actinide fission yield treatment in CINDER90 for use in MCNP6 burnup calculations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Fensin, Michael Lorne; Umbel, Marissa

    2015-09-18

    Most of the development of the MCNPX/6 burnup capability focused on features that were applied to the Boltzman transport or used to prepare coefficients for use in CINDER90, with little change to CINDER90 or the CINDER90 data. Though a scheme exists for best solving the coupled Boltzman and Bateman equations, the most significant approximation is that the employed nuclear data are correct and complete. Thus, the CINDER90 library file contains 60 different actinide fission yields encompassing 36 fissionable actinides (thermal, fast, high energy and spontaneous fission). Fission reaction data exists for more than 60 actinides and as a result, fissionmore » yield data must be approximated for actinides that do not possess fission yield information. Several types of approximations are used for estimating fission yields for actinides which do not possess explicit fission yield data. The objective of this study is to test whether or not certain approximations of fission yield selection have any impact on predictability of major actinides and fission products. Further we assess which other fission products, available in MCNP6 Tier 3, result in the largest difference in production. Because the CINDER90 library file is in ASCII format and therefore easily amendable, we assess reasons for choosing, as well as compare actinide and major fission product prediction for the H. B. Robinson benchmark for, three separate fission yield selection methods: (1) the current CINDER90 library file method (Base); (2) the element method (Element); and (3) the isobar method (Isobar). Results show that the three methods tested result in similar prediction of major actinides, Tc-99 and Cs-137; however, certain fission products resulted in significantly different production depending on the method of choice.« less

  12. Localization of human elav-like neuronal protein 1 (Hel-N1) on chromosome 9p21 by chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization

    SciTech Connect (OSTI)

    Han, Jian; Knops, J.F.; Longshore, J.W.; King, P.H.

    1996-08-15

    Hel-N1 is a member of the highly conserved elav family of neuronal genes. It shares considerable sequence homology with HuD, another human member, and both genes are expressed in brain. HuD was recently mapped to chromosome 1p34. Here, we have utilized chromosome microdissection polymerase chain reaction and fluorescence in situ hybridization to map Hel-N1 to chromosome 9p21. The different chromosomal locations of these homologous genes underscore their distinct identities. 10 refs., 2 figs.

  13. Spontaneous Fission Modes and Lifetimes of Superheavy Elements in the Nuclear Density Functional Theory

    SciTech Connect (OSTI)

    Staszczak, A,

    2013-01-01

    Background: The reactions with the neutron-rich 48Ca beam and actinide targets resulted in the detection of new superheavy (SH) nuclides with Z=104 118. The unambiguous identification of the new isotopes, however, still poses a problem because their -decay chains terminate by spontaneous fission (SF) before reaching the known region of the nuclear chart. The understanding of the competition between -decay and SF channels in SH nuclei is, therefore, of crucial importance for our ability to map the SH region and to assess its extent.

    Purpose: We perform self-consistent calculations of the competing decay modes of even-even SH isotopes with 108 Z 126 and 148 N 188.

    Methods: We use the state-of-the-art computational framework based on self-consistent symmetry-unrestricted nuclear density functional theory capable of describing the competition between nuclear attraction and electrostatic repulsion. We apply the SkM* Skyrme energy density functional. The collective mass tensor of the fissioning superfluid nucleus is computed by means of the cranking approximation to the adiabatic time-dependent Hartree-Fock-Bogoliubov (HFB) approach. This paper constitutes a systematic self-consistent study of spontaneous fission in the SH region, carried out at a full HFB level, that simultaneously takes into account both triaxiality and reflection asymmetry.

    Results: Breaking axial symmetry and parity turns out to be crucial for a realistic estimate of collective action; it results in lowering SF lifetimes by more than 7 orders of magnitude in some cases. We predict two competing SF modes: reflection symmetric modes and reflection asymmetric modes.

    Conclusions: The shortest-lived SH isotopes decay by SF; they are expected to lie in a narrow corridor formed by 280Hs, 284Fl, and 118284Uuo that separates the regions of SH nuclei synthesized in cold-fusion and hot-fusion reactions. The region of long-lived SH nuclei is expected to be centered on 294Ds with a total half-life of

  14. supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    supply chain

  15. Control system for a small fission reactor

    DOE Patents [OSTI]

    Burelbach, J.P.; Kann, W.J.; Saiveau, J.G.

    1985-02-08

    A system for controlling the reactivity of a small fission reactor includes an elongated, flexible hollow tube in the general form of a helical coiled spring axially positioned around and outside of the reactor vessel in an annular space between the reactor vessel and a surrounding cylindrical-shaped neutron reflector. A neutron absorbing material is provided within the hollow tube with the rate of the reaction controlled by the extension and compression of the hollow tube, e.g., extension of the tube increases reactivity while its compression reduces reactivity, in varying the amount of neutron absorbing material disposed between the reactor vessel and the neutron reflector. Conventional mechanical displacement means may be employed to control the coil density of the hollow tube as desired.

  16. Search for Singlet Fission Chromophores

    SciTech Connect (OSTI)

    Havlas, Z.; Akdag, A.; Smith, M. B.; Dron, P.; Johnson, J. C.; Nozik, A. J.; Michl, J.

    2012-01-01

    Singlet fission, in which a singlet excited chromophore shares its energy with a ground-state neighbor and both end up in their triplet states, is of potential interest for solar cells. Only a handful of compounds, mostly alternant hydrocarbons, are known to perform efficiently. In view of the large number of conditions that a successful candidate for a practical cell has to meet, it appears desirable to extend the present list of high performers to additional classes of compounds. We have (i) identified design rules for new singlet fission chromophores and for their coupling to covalent dimers, (ii) synthesized them, and (iii) evaluated their performance as neat solids or covalent dimers.

  17. Process for treating fission waste. [Patent application

    DOE Patents [OSTI]

    Rohrmann, C.A.; Wick, O.J.

    1981-11-17

    A method is described for the treatment of fission waste. A glass forming agent, a metal oxide, and a reducing agent are mixed with the fission waste and the mixture is heated. After melting, the mixture separates into a glass phase and a metal phase. The glass phase may be used to safely store the fission waste, while the metal phase contains noble metals recovered from the fission waste.

  18. Formation of Heavy Compound Nuclei, Their Survival and Correlation with Longtime-Scale Fission

    SciTech Connect (OSTI)

    Karamian, S. A.; Yakushev, A.-B.

    2007-05-22

    Fusion of two massive nuclei with formation of super-heavy compound nucleus (CN) is driven by the potential energy gradient, as follows from the analysis of nuclear reaction cross-sections. The conservative energy of the system is deduced in simple approximation using regularized nuclear mass and interaction barrier values. Different reaction for the synthesis of Zc (110-118) nuclei are compared and the favourable conditions are found for fusion of the stable (W-Pt) isotopes with radioactive fission fragment projectiles, like 94Kr or 100Sr. Thus, the cold fusion method can be extended for a synthesis of elements with Z > 113. Survival of the evaporation residue is defined by the neutron-to-fission probability ratio and by the successful emission of gammas at final step of the reaction. Numerical estimates are presented. Fixation of evaporation residue products must correlate with longtime-scale fission and available experimental results are discussed.

  19. Suppressed-fission ICF hybrid reactor

    SciTech Connect (OSTI)

    Hogan, W.J.; Meier, W.R.

    1986-05-20

    A suppressed-fission ICF hybrid reactor has been designed to maximize the production of /sup 233/U. In this design, Be is used as a neutron multiplier. An annular array of Be columns surrounds the fusion pulse inside the reaction chember. The Be columns consist of short cylinders of Be joined together with steel snap rings. Vertical holes in the Be carry liquid lithium coolant and steel-clad thorium fuel pins. The lithium coolant is supplied at the top of the chamber, traverses through the Be columns and exits at the bottom. The columns are attached to top and bottom plates in such a way as to tolerate radiation-induced swelling and the vibrations resulting from each fusion pulse. A thin (10 cm) liquid Li fall region protects the Be columns from direct exposure to the X-rays and debris emitted by the fuel capsule. A neutronics study of this design indicates that the specific production of /sup 233/U fuel is increased by operating at relatively large thorium volume fractions. A design at a fertile fuel fraction of 30 vol % produces a total breeding ratio of over 2.1. The /sup 6/Li to /sup 7/Li ratio is adjusted to keep the tritium breeding ratio at about 1.0. In such a reactor, about 3400 kg of /sup 233/U can be produced per full power year at a fusion power level of 800 MW. Reactor support ratios greater than 13 can be achieved, leading to beneficial results even if the fusion reactor cost is significantly greater than that of a fission reactor.

  20. Chain Reaction Innovations | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Unparalleled access to an innovation ecosystem Advisory network of business mentors ... A Fertile Ecosystem to Seed Complex Science Innovators in CRI can leverage the unique ...

  1. Fission Product Yields of {sup 233}U, {sup 235}U, {sup 238}U and {sup 239}Pu in Fields of Thermal Neutrons, Fission Neutrons and 14.7-MeV Neutrons

    SciTech Connect (OSTI)

    Laurec, J.; Adam, A.; Bruyne, T. de [Commissariat a l'Energie Atomique, Centre DAM-Ile de France (CEA DAM DIF), 91297 Arpajon (France); Bauge, E., E-mail: eric.bauge@cea.f [Commissariat a l'Energie Atomique, Centre DAM-Ile de France (CEA DAM DIF), 91297 Arpajon (France); Granier, T.; Aupiais, J.; Bersillon, O.; Le Petit, G. [Commissariat a l'Energie Atomique, Centre DAM-Ile de France (CEA DAM DIF), 91297 Arpajon (France); Authier, N.; Casoli, P. [Commissariat a l'Energie Atomique, Centre de Valduc, 21120 Is-sur-Tille (France)

    2010-12-15

    The yields of more than fifteen fission products have been carefully measured using radiochemical techniques, for {sup 235}U(n,f), {sup 239}Pu(n,f) in a thermal spectrum, for {sup 233}U(n,f), {sup 235}U(n,f), and {sup 239}Pu(n,f) reactions in a fission neutron spectrum, and for {sup 233}U(n,f), {sup 235}U(n,f), {sup 238}U(n,f), and {sup 239}Pu(n,f) for 14.7 MeV monoenergetic neutrons. Irradiations were performed at the EL3 reactor, at the Caliban and Prospero critical assemblies, and at the Lancelot electrostatic accelerator in CEA-Valduc. Fissions were counted in thin deposits using fission ionization chambers. The number of fission products of each species were measured by gamma spectrometry of co-located thick deposits.

  2. RECOVERY OF ALUMINUM FROM FISSION PRODUCTS

    DOE Patents [OSTI]

    Blanco, R.E.; Higgins, I.R.

    1962-11-20

    A method is given for recovertng aluminum values from aqueous solutions containing said values together with fission products. A mixture of Fe/sub 2/O/ sub 3/ and MnO/sub 2/ is added to a solution containing aluminum and fission products. The resulting aluminum-containing supernatant is then separated from the fission product-bearing metal oxide precipitate and is contacted with a cation exchange resin. The aluminum sorbed on the resin is then eluted and recovered. (AEC)

  3. Fission barriers and half-lives

    SciTech Connect (OSTI)

    Moeller, P.; Nix, J.R.; Swiatecki, W.J.

    1989-01-01

    We briefly review the development of theoretical models for the calculation of fission barriers and half-lives. We focus on how results of actual calculations in a unified macroscopic-microscopic approach provide an interpretation of the mechanisms behind some of the large number of phenomena observed in fission. As instructive examples we choose studies of the rapidly varying fission properties of elements at the end of the periodic system. 31 refs., 10 figs.

  4. Small Self-Regulating Fission Reactor System

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Small Self-Regulating Fission Reactor System ANTICIPATED IMPACT PATH FORWARD DESCRIPTION BACKGROUND & MOTIVATION INNOVATION A power system for special government applications Point of Contact: Patrick McClure, NEN-5, pmcclure@lanl.gov (505)667-9534 Small Self-Regulating Fission Reactor System A small self- regulating fission reactor made with U 235 . LANL and NASA with the support of NSTec performed a proof of concept test at the Nevada Test Site. Test apparatus - Nuclear material on left

  5. FISSION PRODUCT REMOVAL FROM ORGANIC SOLUTIONS

    DOE Patents [OSTI]

    Moore, R.H.

    1960-05-10

    The decontamination of organic solvents from fission products and in particular the treatment of solvents that were used for the extraction of uranium and/or plutonium from aqueous acid solutions of neutron-irradiated uranium are treated. The process broadly comprises heating manganese carbonate in air to a temperature of between 300 and 500 deg C whereby manganese dioxide is formed; mixing the manganese dioxide with the fission product-containing organic solvent to be treated whereby the fission products are precipitated on the manganese dioxide; and separating the fission product-containing manganese dioxide from the solvent.

  6. Control of a laser inertial confinement fusion-fission power plant

    SciTech Connect (OSTI)

    Moses, Edward I.; Latkowski, Jeffery F.; Kramer, Kevin J.

    2015-10-27

    A laser inertial-confinement fusion-fission energy power plant is described. The fusion-fission hybrid system uses inertial confinement fusion to produce neutrons from a fusion reaction of deuterium and tritium. The fusion neutrons drive a sub-critical blanket of fissile or fertile fuel. A coolant circulated through the fuel extracts heat from the fuel that is used to generate electricity. The inertial confinement fusion reaction can be implemented using central hot spot or fast ignition fusion, and direct or indirect drive. The fusion neutrons result in ultra-deep burn-up of the fuel in the fission blanket, thus enabling the burning of nuclear waste. Fuels include depleted uranium, natural uranium, enriched uranium, spent nuclear fuel, thorium, and weapons grade plutonium. LIFE engines can meet worldwide electricity needs in a safe and sustainable manner, while drastically shrinking the highly undesirable stockpiles of depleted uranium, spent nuclear fuel and excess weapons materials.

  7. Control of a laser inertial confinement fusion-fission power plant

    SciTech Connect (OSTI)

    Moses, Edward L; Latkowski, Jeffrey F; Kramer, Kevin J

    2015-11-05

    A laser inertial-confinement fusion-fission energy power plant is described. The fusion-fission hybrid system uses inertial confinement fusion to produce neutrons from a fusion reaction of deuterium and tritium. The fusion neutrons drive a sub-critical blanket of fissile or fertile fuel. A coolant circulated through the fuel extracts heat from the fuel that is used to generate electricity. The inertial confinement fusion reaction can be implemented using central hot spot or fast ignition fusion, and direct or indirect drive. The fusion neutrons result in ultra-deep burn-up of the fuel in the fission blanket, thus enabling the burning of nuclear waste. Fuels include depleted uranium, natural uranium, enriched uranium, spent nuclear fuel, thorium, and weapons grade plutonium. LIFE engines can meet worldwide electricity needs in a safe and sustainable manner, while drastically shrinking the highly undesirable stockpiles of depleted uranium, spent nuclear fuel and excess weapons materials.

  8. Comparative studies of actinide and sub-actinide fission cross section calculation from MCNP6 and TALYS

    SciTech Connect (OSTI)

    Perkasa, Y. S.; Waris, A. Kurniadi, R. Su'ud, Z.

    2014-09-30

    Comparative studies of actinide and sub-actinide fission cross section calculation from MCNP6 and TALYS have been conducted. In this work, fission cross section resulted from MCNP6 prediction will be compared with result from TALYS calculation. MCNP6 with its event generator CEM03.03 and LAQGSM03.03 have been validated and verified for several intermediate and heavy nuclides fission reaction data and also has a good agreement with experimental data for fission reaction that induced by photons, pions, and nucleons at energy from several ten of MeV to about 1 TeV. The calculation that induced within TALYS will be focused mainly to several hundred MeV for actinide and sub-actinide nuclides and will be compared with MCNP6 code and several experimental data from other evaluator.

  9. Fission fragment excited laser system

    DOE Patents [OSTI]

    McArthur, David A.; Tollefsrud, Philip B.

    1976-01-01

    A laser system and method for exciting lasing action in a molecular gas lasing medium which includes cooling the lasing medium to a temperature below about 150 K and injecting fission fragments through the lasing medium so as to preferentially excite low lying vibrational levels of the medium and to cause population inversions therein. The cooled gas lasing medium should have a mass areal density of about 5 .times. 10.sup.-.sup.3 grams/square centimeter, relaxation times of greater than 50 microseconds, and a broad range of excitable vibrational levels which are excitable by molecular collisions.

  10. Monitoring system for a liquid-cooled nuclear fission reactor

    DOE Patents [OSTI]

    DeVolpi, Alexander

    1987-01-01

    A monitoring system for detecting changes in the liquid levels in various regions of a water-cooled nuclear power reactor, viz., in the downcomer, in the core, in the inlet and outlet plenums, at the head, and elsewhere; and also for detecting changes in the density of the liquid in these regions. A plurality of gamma radiation detectors are used, arranged vertically along the outside of the reactor vessel, and collimator means for each detector limits the gamma-radiation it receives as emitting from only isolated regions of the vessel. Excess neutrons produced by the fission reaction will be captured by the water coolant, by the steel reactor walls, or by the fuel or control structures in the vessel. Neutron capture by steel generates gamma radiation having an energy level of the order of 5-12 MeV, whereas neutron capture by water provides an energy level of approximately 2.2 MeV, and neutron capture by the fission fuel or its cladding provides an energy level of 1 MeV or less. The intensity of neutron capture thus changes significantly at any water-metal interface. Comparative analysis of adjacent gamma detectors senses changes from the normal condition with liquid coolant present to advise of changes in the presence and/or density of the coolant at these specific regions. The gamma detectors can also sense fission-product gas accumulation at the reactor head to advise of a failure of fuel-pin cladding.

  11. Control system for a small fission reactor

    DOE Patents [OSTI]

    Burelbach, James P.; Kann, William J.; Saiveau, James G.

    1986-01-01

    A system for controlling the reactivity of a small fission reactor includes an elongated, flexible hollow tube in the general form of a helical coiled spring axially positioned around and outside of the reactor vessel in an annular space between the reactor vessel and a surrounding cylindrical-shaped neutron reflector. A neutron absorbing material is provided within the hollow tube with the rate of the reaction controlled by the extension and compression of the hollow tube, e.g., extension of the tube increases reactivity while its compression reduces reactivity, in varying the amount of neutron absorbing material disposed between the reactor vessel and the neutron reflector. Conventional mechanical displacement means may be employed to control the coil density of the hollow tube as desired. In another embodiment, a plurality of flexible hollow tubes each containing a neutron absorber are positioned adjacent to one another in spaced relation around the periphery of the reactor vessel and inside the outer neutron reflector with reactivity controlled by the extension and compression of all or some of the coiled hollow tubes. Yet another embodiment of the invention envisions the neutron reflector in the form of an expandable coil spring positioned in an annular space between the reactor vessel and an outer neutron absorbing structure for controlling the neutron flux reflected back into the reactor vessel.

  12. Fission Product Transmutation in Mixed Radiation Fields

    SciTech Connect (OSTI)

    Harmon, Frank; Burgett, Erick; Starovoitova, Valeriia; Tsveretkov, Pavel

    2015-01-15

    Work under this grant addressed a part of the challenge facing the closure of the nuclear fuel cycle; reducing the radiotoxicity of lived fission products (LLFP). It was based on the possibility that partitioning of isotopes and accelerator-based transmutation on particular LLFP combined with geological disposal may lead to an acceptable societal solution to the problem of management. The feasibility of using photonuclear processes based on the excitation of the giant dipole resonance (GDR) by bremsstrahlung radiation as a cost effective transmutation method was accessed. The nuclear reactions of interest: (γ,xn), (n,γ), (γ,p) can be induced by bremsstrahlung radiation produced by high power electron accelerators. The driver of these processes would be an accelerator that produces a high energy and high power electron beam of ~ 100 MeV. The major advantages of such accelerators for this purpose are that they are essentially available “off the shelf” and potentially would be of reasonable cost for this application. Methods were examined that used photo produced neutrons or the bremsstrahlung photons only, or use both photons and neutrons in combination for irradiations of selected LLFP. Extrapolating the results to plausible engineering scale transmuters it was found that the energy cost for 129I and 99Tc transmutation by these methods are about 2 and 4%, respectively, of the energy produced from 1000MWe.

  13. SOURCE OF PRODUCTS OF NUCLEAR FISSION

    DOE Patents [OSTI]

    Harteck, P.; Dondes, S.

    1960-03-15

    A source of fission product recoil energy suitable for use in radiation chemistry is reported. The source consists of thermal neutron irradiated glass wool having a diameter of 1 to 5 microns and containing an isotope fissionable by thermal neutrons, such as U/sup 235/.

  14. PROCESS FOR SEPARATING URANIUM FISSION PRODUCTS

    DOE Patents [OSTI]

    Spedding, F.H.; Butler, T.A.; Johns, I.B.

    1959-03-10

    The removal of fission products such as strontium, barium, cesium, rubidium, or iodine from neutronirradiated uranium is described. Uranium halide or elemental halogen is added to melted irradiated uranium to convert the fission products to either more volatile compositions which vaporize from the melt or to higher melting point compositions which separate as solids.

  15. Prompt fission neutron spectra of actinides

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Capote, R.; Chen, Y. -J.; Hambsch, F. -J.; Kornilov, N. V.; Lestone, J. P.; Litaize, O.; Morillon, B.; Neudecker, D.; Oberstedt, S.; Ohsawa, T.; et al

    2016-01-06

    Here, the energy spectrum of prompt neutrons emitted in fission (PFNS) plays a very important role in nuclear science and technology. A Coordinated Research Project (CRP) "Evaluation of Prompt Fission Neutron Spectra of Actinides" was established by the IAEA Nuclear Data Section in 2009, with the major goal to produce new PFNS evaluations with uncertainties for actinide nuclei.

  16. Density Functional Theory Approach to Nuclear Fission (Conference...

    Office of Scientific and Technical Information (OSTI)

    Density Functional Theory Approach to Nuclear Fission Citation Details In-Document Search Title: Density Functional Theory Approach to Nuclear Fission You are accessing a document ...

  17. Overview of Fusion-Fission Hybrid Blankets for Laser Inertial...

    Office of Scientific and Technical Information (OSTI)

    Conference: Overview of Fusion-Fission Hybrid Blankets for Laser Inertial Fusion Energy (LIFE) Engine Citation Details In-Document Search Title: Overview of Fusion-Fission Hybrid ...

  18. Control of a laser inertial confinement fusion-fission power...

    Office of Scientific and Technical Information (OSTI)

    Control of a laser inertial confinement fusion-fission power plant Title: Control of a laser inertial confinement fusion-fission power plant A laser inertial-confinement ...

  19. Time dependent particle emission from fission products (Conference...

    Office of Scientific and Technical Information (OSTI)

    Time dependent particle emission from fission products Citation Details In-Document Search Title: Time dependent particle emission from fission products Decay heating following ...

  20. Description of induced nuclear fission with Skyrme energy functionals...

    Office of Scientific and Technical Information (OSTI)

    Citation Details In-Document Search Title: Description of induced nuclear fission with Skyrme energy functionals: Static potential energy surfaces and fission fragment properties ...

  1. NUCLEAR ENERGY UNIVERSITY PROGRAMS Improved Fission Neutron Data...

    National Nuclear Security Administration (NNSA)

    NUCLEAR ENERGY UNIVERSITY PROGRAMS Improved Fission Neutron Data Base for Active ... the detection of neutrons from fission induced by fast neutrons or high-energy gamma rays. ...

  2. Future challenges for nuclear data research in fission (u) (Journal...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Future challenges for nuclear data research in fission (u) Citation Details In-Document Search Title: Future challenges for nuclear data research in fission (u) I ...

  3. Future challenges for nuclear data research in fission (u) (Journal...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Future challenges for nuclear data research in fission (u) Citation Details In-Document Search Title: Future challenges for nuclear data research in fission (u) ...

  4. DOE Science Showcase - Fission Theory | OSTI, US Dept of Energy...

    Office of Scientific and Technical Information (OSTI)

    Fission Theory A predictive theory of nuclear fission has eluded physicists since 1939. ... Additional Links of Interest Office of Nuclear Energy, DOE Nuclear Physics, DOE Office ...

  5. Fifty years of nuclear fission: Nuclear data and measurements...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Fifty years of nuclear fission: Nuclear data and measurements series Citation Details In-Document Search Title: Fifty years of nuclear fission: Nuclear data and ...

  6. Fifty years of nuclear fission: Nuclear data and measurements...

    Office of Scientific and Technical Information (OSTI)

    Fifty years of nuclear fission: Nuclear data and measurements series Citation Details In-Document Search Title: Fifty years of nuclear fission: Nuclear data and measurements series ...

  7. Fusion-Fission Hybrid for Fissile Fuel Production without Processing...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Fusion-Fission Hybrid for Fissile Fuel Production without Processing Citation Details In-Document Search Title: Fusion-Fission Hybrid for Fissile Fuel Production ...

  8. Los Alamos National Laboratory fission basis (Conference) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    Los Alamos National Laboratory fission basis Citation Details In-Document Search Title: Los Alamos National Laboratory fission basis You are accessing a document from the ...

  9. Error estimates for fission neutron outputs (Conference) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    Error estimates for fission neutron outputs Citation Details In-Document Search Title: Error estimates for fission neutron outputs You are accessing a document from the...

  10. Fission Product Separation/Extraction Techniques (Book) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    Book: Fission Product SeparationExtraction Techniques Citation Details In-Document Search Title: Fission Product SeparationExtraction Techniques No abstract prepared. Authors: ...

  11. Axisymmetric Magnetic Mirror Fusion-Fission Hybrid (Technical...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Axisymmetric Magnetic Mirror Fusion-Fission Hybrid Citation Details In-Document Search Title: Axisymmetric Magnetic Mirror Fusion-Fission Hybrid Authors: Moir, R ...

  12. Nuclear Fission and Fission{minus}Product Spectroscopy: Second International Workshop. Proceedings

    SciTech Connect (OSTI)

    Fioni, G.; Faust, H.; Oberstedt, S.; Hambsch, F.

    1998-10-01

    These proceedings represent papers presented at the Second International Workshop on Nuclear Fission and Fission{minus}Product Spectroscopy held in Seyssins, France in April, 1998. The objective was to bring together the specialists in the field to overview the situation and to assess our present understanding of the fission process. The topics presented at the conference included nuclear waste management, incineration, neutron driven transmutation, leakage etc., radioactive beams, neutron{minus}rich nuclei, neutron{minus}induced and spontaneous fission, ternary fission phenomena, angular momentum, parity and time{minus}reversal phenomena, and nuclear fission at higher excitation energy. Modern spectroscopic tools for gamma spectroscopy as applied to fission were also discussed. There were 53 papers presented at the conference,out of which 3 have been abstracted for the Energy,Science and Technology database.(AIP)

  13. Theoretical Description of the Fission Process

    SciTech Connect (OSTI)

    Witold Nazarewicz

    2009-10-25

    Advanced theoretical methods and high-performance computers may finally unlock the secrets of nuclear fission, a fundamental nuclear decay that is of great relevance to society. In this work, we studied the phenomenon of spontaneous fission using the symmetry-unrestricted nuclear density functional theory (DFT). Our results show that many observed properties of fissioning nuclei can be explained in terms of pathways in multidimensional collective space corresponding to different geometries of fission products. From the calculated collective potential and collective mass, we estimated spontaneous fission half-lives, and good agreement with experimental data was found. We also predicted a new phenomenon of trimodal spontaneous fission for some transfermium isotopes. Our calculations demonstrate that fission barriers of excited superheavy nuclei vary rapidly with particle number, pointing to the importance of shell effects even at large excitation energies. The results are consistent with recent experiments where superheavy elements were created by bombarding an actinide target with 48-calcium; yet even at high excitation energies, sizable fission barriers remained. Not only does this reveal clues about the conditions for creating new elements, it also provides a wider context for understanding other types of fission. Understanding of the fission process is crucial for many areas of science and technology. Fission governs existence of many transuranium elements, including the predicted long-lived superheavy species. In nuclear astrophysics, fission influences the formation of heavy elements on the final stages of the r-process in a very high neutron density environment. Fission applications are numerous. Improved understanding of the fission process will enable scientists to enhance the safety and reliability of the nations nuclear stockpile and nuclear reactors. The deployment of a fleet of safe and efficient advanced reactors, which will also minimize radiotoxic

  14. Development of position-sensitive time-of-flight spectrometer for fission fragment research

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Arnold, C. W.; Tovesson, F.; Meierbachtol, K.; Bredeweg, T.; Jandel, M.; Jorgenson, H. J.; Laptev, A.; Rusev, G.; Shields, D. W.; White, M.; et al

    2014-07-09

    A position-sensitive, high-resolution time-of-flight detector for fission fragments has been developed. The SPectrometer for Ion DEtermination in fission Research (SPIDER) is a 2E–2v spectrometer designed to measure the mass of light fission fragments to a single mass unit. The time pick-off detector pairs to be used in SPIDER have been tested with α-particles from 229Th and its decay chain and α-particles and spontaneous fission fragments from 252Cf. Each detector module is comprised of thin electron conversion foil, electrostatic mirror, microchannel plates, and delay-line anodes. Particle trajectories on the order of 700 mm are determined accurately to within 0.7 mm. Flightmore » times were measured with 250 ps resolution FWHM. Computed particle velocities are accurate to within 0.06 mm/ns corresponding to a precision of 0.5%. As a result, an ionization chamber capable of 400 keV energy resolution coupled with the velocity measurements described here will pave the way for modestly efficient measurements of light fission fragments with unit mass resolution.« less

  15. Fission-suppressed fusion breeder on the thorium cycle and nonproliferation

    SciTech Connect (OSTI)

    Moir, R. W.

    2012-06-19

    Fusion reactors could be designed to breed fissile material while suppressing fissioning thereby enhancing safety. The produced fuel could be used to startup and makeup fuel for fission reactors. Each fusion reaction can produce typically 0.6 fissile atoms and release about 1.6 times the 14 MeV neutron's energy in the blanket in the fission-suppressed design. This production rate is 2660 kg/1000 MW of fusion power for a year. The revenues would be doubled from such a plant by selling fuel at a price of 60/g and electricity at $0.05/kWh for Q=P{sub fusion}/P{sub input}=4. Fusion reactors could be designed to destroy fission wastes by transmutation and fissioning but this is not a natural use of fusion whereas it is a designed use of fission reactors. Fusion could supply makeup fuel to fission reactors that were dedicated to fissioning wastes with some of their neutrons. The design for safety and heat removal and other items is already accomplished with fission reactors. Whereas fusion reactors have geometry that compromises safety with a complex and thin wall separating the fusion zone from the blanket zone where wastes could be destroyed. Nonproliferation can be enhanced by mixing {sup 233}U with {sup 238}U. Also nonproliferation is enhanced in typical fission-suppressed designs by generating up to 0.05 {sup 232}U atoms for each {sup 233}U atom produced from thorium, about twice the IAEA standards of 'reduced protection' or 'self protection.' With 2.4%{sup 232}U, high explosive material is predicted to degrade owing to ionizing radiation after a little over 1/2 year and the heat rate is 77 W just after separation and climbs to over 600 W ten years later. The fissile material can be used to fuel most any fission reactor but is especially appropriate for molten salt reactors (MSR) also called liquid fluoride thorium reactors (LFTR) because of the molten fuel does not need hands on fabrication and handling.

  16. Quantum nature of ROT and TRI asymmetries in the ternary fission of nuclei

    SciTech Connect (OSTI)

    Bunakov, V. E.; Kadmensky, S. G.; Kadmensky, S. S.

    2010-08-15

    Effects of T-odd asymmetry in ternary-nuclear-fission reactions induced by polarized cold neutrons are considered within quantum theory. It is shown that the asymmetry coefficient can be expressed in terms of experimental angular distributions of third particles in reactions induced by unpolarized neutrons. The explicit form of this coefficient makes it possible to explain the difference in the magnitudes and signs of the TRI and ROT effects observed experimentally for different targets.

  17. Sleeve reaction chamber system

    SciTech Connect (OSTI)

    Northrup, M. Allen; Beeman, Barton V.; Benett, William J.; Hadley, Dean R.; Landre, Phoebe; Lehew, Stacy L.; Krulevitch, Peter A.

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  18. Tri And Rot Effects In Ternary Fission: What Can Be Learned?

    SciTech Connect (OSTI)

    Goennenwein, F.; Gagarski, A.; Petrov, G.; Guseva, I.; Zavarukhina, T.; Mutterer, M.; Kalben, J. von; Kopatch, Yu.; Tiourine, G.; Trzaska, W.; Sillanpaea, M.; Soldner, T.; Nesvizhevsky, V.

    2010-04-30

    Inducing fission by polarized neutrons allows studying subtle effects of the dynamics of the process. In the present experiments ternary fission of {sup 235}U and {sup 239}Pu was investigated with cold neutrons in the (n,f) reaction at the Institut Laue-Langevin, Grenoble. Asymmetries in the emission of ternary particles were discovered by making use of the neutron spin flipping. It was found that two effects are interfering. There is first an asymmetry in the total yields of ternary particles having been called the TRI-effect. Second, it was observed that the angular distributions of ternary particles are shifted back and forth when flipping the neutron spin. This shift was named ROT effect. Guided by trajectory calculations of the three-body decay, the signs and sizes of the ROT effect are interpreted in terms of the K-numbers of the transition states at the saddle point of fission.

  19. A New Facility for High-Energy Neutron-Induced Fission Studies

    SciTech Connect (OSTI)

    Prokofiev, A.; Carlsson, M.; Einarsson, L.; Haag, N.; Pomp, S.; Bergenwall, B.; Blomgren, J.; Hildebrand, A.; Johansson, C.; Mermod, P.; Oesterlund, M.; Tippawan, U.; Dangtip, S.

    2005-05-24

    A new facility is constructed for measurements of neutron-induced fission cross sections in the 20-180 MeV energy region versus the np scattering cross section, which is adopted as the primary neutron standard. The advantage of the experiment compared to earlier studies is that the fission-fragment detection and the neutron-flux measurement via np scattering are performed simultaneously and at the same position in the beam, and, therefore, many sources of systematic errors cancel out. Further reduction of systematic errors is achieved due to 'embedded' determination of effective solid angle of particle detectors using {alpha}-particles from the radioactive decay of the target nuclei. The performance of the facility is illustrated by first data obtained for angular distributions of fission fragments in the 238U(n,f) reaction.

  20. Chemical behavior of fission products in the ORNL fission product release program. Supplement. [PWR; BWR

    SciTech Connect (OSTI)

    Collins, J.L.; Osborne, M.F.; Lorenz, R.A.

    1983-01-01

    Tests data are presented for BWR and PWR rods in test HI-4 and test HI-5. Operating conditions fission product release data are included.

  1. Realistic fission models, new beta-decay half-lives and the r-process in neutron star mergers

    SciTech Connect (OSTI)

    Shibagaki, S.; Kajino, T. [Department of Astronomy, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Chiba, S. [Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology, Ookayama, Meguro-ku, Tokyo, 152-8850 (Japan); Lorusso, G.; Nishimura, S. [RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Mathews, G. J. [Center for Astrophysics, Department of Physics, University of Notre Dame, IN 46556 (United States)

    2014-05-02

    Almost half of heavy nuclei beyond iron are considered to be produced by rapid neutron capture process (r-process). This process occurs in the neutron-rich environment such as core-collapse supernovae or neutron star mergers, but the main production site is still unknown. In the r-process of neutron star mergers, nuclear fission reactions play an important role. Also beta-decay half-lives of magic nuclei are crucial for the r-process. We have carried out r-process nucleosynthesis calculations based upon new theoretical estimates of fission fragment distributions and new beta-decay half-lives for N=82 nuclei measured at RIBF-RIKEN. We investigate the effect of nuclear fission on abundance patterns in the matter ejected from neutron star mergers with two different fission fragment mass distributions. We also discuss how the new experimental beta-decay half-lives affect the r-process.

  2. On the belated discovery of fission

    SciTech Connect (OSTI)

    Pearson, J. Michael

    2015-06-15

    A remarkable sequence of missteps, misfortune, and oversights delayed the discovery of nuclear fission until the eve of World War II—and likely altered history’s course.

  3. Fission barrier properties, resonance fluctuations and isomer...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Submitted to: Proceedings of the 3rd International Conference on Fission and Properties of Neutron-Rich Nuclei, Nov. 3-9, 2002, Sanibel Island, FL ...

  4. Aqueous cutting fluid for machining fissionable materials

    DOE Patents [OSTI]

    Duerksen, Walter K.; Googin, John M.; Napier, Jr., Bradley

    1984-01-01

    The present invention is directed to a cutting fluid for machining fissionable material. The cutting fluid is formed of glycol, water and boron compound in an adequate concentration for effective neutron attenuation so as to inhibit criticality incidents during machining.

  5. Modeling Fission Product Sorption in Graphite Structures

    SciTech Connect (OSTI)

    Szlufarska, Izabela; Morgan, Dane; Allen, Todd

    2013-04-08

    The goal of this project is to determine changes in adsorption and desorption of fission products to/from nuclear-grade graphite in response to a changing chemical environment. First, the project team will employ principle calculations and thermodynamic analysis to predict stability of fission products on graphite in the presence of structural defects commonly observed in very high- temperature reactor (VHTR) graphites. Desorption rates will be determined as a function of partial pressure of oxygen and iodine, relative humidity, and temperature. They will then carry out experimental characterization to determine the statistical distribution of structural features. This structural information will yield distributions of binding sites to be used as an input for a sorption model. Sorption isotherms calculated under this project will contribute to understanding of the physical bases of the source terms that are used in higher-level codes that model fission product transport and retention in graphite. The project will include the following tasks: Perform structural characterization of the VHTR graphite to determine crystallographic phases, defect structures and their distribution, volume fraction of coke, and amount of sp2 versus sp3 bonding. This information will be used as guidance for ab initio modeling and as input for sorptivity models; Perform ab initio calculations of binding energies to determine stability of fission products on the different sorption sites present in nuclear graphite microstructures. The project will use density functional theory (DFT) methods to calculate binding energies in vacuum and in oxidizing environments. The team will also calculate stability of iodine complexes with fission products on graphite sorption sites; Model graphite sorption isotherms to quantify concentration of fission products in graphite. The binding energies will be combined with a Langmuir isotherm statistical model to predict the sorbed concentration of fission

  6. MCNP6 Fission Multiplicity with FMULT Card

    SciTech Connect (OSTI)

    Wilcox, Trevor; Fensin, Michael Lorne; Hendricks, John S.; James, Michael R.; McKinney, Gregg W.

    2012-06-18

    With the merger of MCNPX and MCNP5 into MCNP6, MCNP6 now provides all the capabilities of both codes allowing the user to access all the fission multiplicity data sets. Detailed in this paper is: (1) the new FMULT card capabilities for accessing these different data sets; (2) benchmark calculations, as compared to experiment, detailing the results of selecting these separate data sets for thermal neutron induced fission on U-235.

  7. Event-by-event fission simulation code, generates complete fission events

    Energy Science and Technology Software Center (OSTI)

    2013-04-01

    FREYA is a computer code that generates complete fission events. The output includes the energy and momentum of these final state particles: fission products, prompt neutrons and prompt photons. The version of FREYA that is to be released is a module for MCNP6.

  8. Heavy Element Synthesis Reactions W. Loveland Oregon State University

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reactions W. Loveland Oregon State University The role of ATLAS in helping us understand heavy element synthesis reactions and heavy element properties * Hot (E*=35-60 MeV) and Cold (E*=15 MeV) fusion reactions * Multi-nucleon transfer reactions * Fission * Atomic physics and chemistry of the heaviest elements * Structure of the heaviest nuclei The challenge of studying the heaviest elements at ATLAS * ATLAS beam time is oversubscribed * Low cross section studies - High luminosity - ATLAS has

  9. Statistics at work in heavy-ion reactions

    SciTech Connect (OSTI)

    Moretto, L.G.

    1982-07-01

    In the first part special aspects of the compound nucleus decay are considered. The evaporation of particles intermediate between nucleons and fission fragments is explored both theoretically and experimentally. The limitations of the fission decay width expression obtained with the transition state method are discussed, and a more general approach is proposed. In the second part the process of angular momentum transfer in deep inelastic reactions is considered. The limit of statistical equilibrium is studied and specifically applied to the estimation of the degree of alignment of the fragment spins. The magnitude and alignment of the transferred angular momentum is experimentally determined from sequentially emitted alpha, gamma, and fission fragments.

  10. Tests of the fission-evaporation competition in the deexcitation of heavy nuclei

    SciTech Connect (OSTI)

    Siwek-Wilczynska, K.; Skwira, I.; Wilczynski, J.

    2005-09-01

    In order to verify methods of calculating the fission-evaporation competition in reactions used to synthesize new super-heavy nuclei in 'cold' (1n) and 'hot' (3n,4n) fusion reactions, we present an analysis of existing experimental data on the evaporation-residue cross sections in two selected reactions, {sup 208}Pb({sup 16}O, xn) and {sup 236}U({sup 12}C, xn), for which complementary experimental information necessary to unambiguously calculate the survival probabilities is available: precisely measured fusion excitation functions and saddle-point energies of the fissioning nuclei, deduced from experiments. Standard statistical model calculations, with shell effects accounted for by the Ignatyuk formula, were carried out assuming the ground state shell corrections of Moeller et al., and zero shell correction at the saddle configuration (resulting from the presented systematics). Good agreement of the calculated evaporation-residue cross sections with experimental data for different xn reaction channels at low excitation energies leaves no room for modifications of the conventional way of calculating the {gamma}{sub n}/{gamma}{sub f} ratio, particularly for including into this ratio an additional preexponential factor (such as the Kramers fission hindrance factor or an effective collective factor) significantly different from 1.

  11. Prospects for further studies of effects of T-odd asymmetry in the emission of light particles in the polarized-neutron-induced ternary fission of heavy nuclei

    SciTech Connect (OSTI)

    Petrov, G. A. Gagarskii, A. M.; Guseva, I. S.; Kopatch, Yu. N.; Goennenwein, F.; Mutterer, M.

    2008-07-15

    Prospects for further studies of TRI and ROT effects of T-odd asymmetry in the emission of light particles in the ternary and binary fission of heavy nuclei that is induced by slow polarized neutrons are considered with a view to studying the mechanism for the formation of these effects and using them to get new information about fission dynamics. It is planned to investigate the dependence of the corresponding T-odd-asymmetry coefficients on the main characteristics of the fission reaction.

  12. Interference of fission amplitudes of neutron resonances and T-odd asymmetry for various prescission third particles in the ternary fission of nuclei

    SciTech Connect (OSTI)

    Kadmensky, S. G.; Bunakov, V. E.; Kadmensky, S. S.

    2011-12-15

    Differential cross sections for reactions of the true ternary fission of nuclei that was induced by cold polarized neutrons were constructed with allowance of the effect that Coriolis interaction and the interference between fission amplitudes of neutron resonances excited in fissile nuclei upon incidentneutron capture by target nuclei exerted on angular distributions of prescission third particles (alpha particles, neutrons, or photons). It is shown that T -odd TRI- and ROT-type asymmetries for prescission alpha particles are associated with, respectively, the odd and even components of the Coriolis interaction-perturbed amplitude of angular distributions of particles belonging to the types indicated above. These asymmetries have angular distributions differing from each other and stemming from a nontrivial dependence of these components on the neutron-resonance spins J{sub s} and their projections K{sub s} onto the symmetry axis of the nucleus involved. It is shown that angular distributions of prescission photons and neutrons from reactions of the ternary fission of nuclei that is induced by cold polarized neutrons are determined by the effect of Coriolis forces exclusively. Therefore, the emerging T-odd asymmetries have a character of a ROT-type asymmetry and are universal for all target nuclei.

  13. METHOD OF MAKING JACKETED FISSIONABLE SLUG

    DOE Patents [OSTI]

    Young, G.J.; Ohlinger, L.A.

    1959-02-10

    BS>A method is described for fabricating a jacketed fissionable body or slug to provide an effective leak-proof seal between the jacket and the end closure. A housing for the fissionable slug is first formed and then tinned on the interior. The fissionable slug is coated on its exterior surface with the same material used to tin the interior of the housing. The coated slug is then inserted into the housing. A disc shaped end closure for the housing, coated with the tinning material, is inserted into the open end of the housing while the tinning material is still liquid. The end of the housing is then swaged into good contact with the periphery of the closure.

  14. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, R.P.

    1992-10-20

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain. 6 figs.

  15. Laser amplifier chain

    DOE Patents [OSTI]

    Hackel, Richard P.

    1992-01-01

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain.

  16. Fission-reactor experiments for fusion-materials research

    SciTech Connect (OSTI)

    Grossbeck, M.L.; Bloom, E.E.; Woods, J.W.; Vitek, J.M.; Thomas, K.R.

    1982-01-01

    The US Fusion Materials Program makes extensive use of fission reactors to study the effects of simulated fusion environments on materials and to develop improved alloys for fusion reactor service. The fast reactor, EBR-II, and the mixed spectrum reactors, HFIR and ORR, are all used in the fusion program. The HFIR and ORR produce helium from transmutations of nickel in a two-step thermal neutron absorption reaction beginning with /sup 58/Ni, and the fast neutrons in these reactors produce atomic displacements. The simultaneous effects of these phenomena produce damage similar to the very high energy neutrons of a fusion reactor. This paper describes irradiation capsules for mechanical property specimens used in the HFIR and the ORR. A neutron spectral tailoring experiment to achieve the fusion reactor He:dpa ratio will be discussed.

  17. T invariance and T-odd asymmetries for the cold-polarized-neutron-induced fission of nonoriented nuclei

    SciTech Connect (OSTI)

    Kadmensky, S. G., E-mail: kadmensky@phys.vsu.ru [Voronezh State University (Russian Federation); Bunakov, V. E. [National Research Center Kurchatov Institute, Petersburg Nuclear Physics Institute (Russian Federation); Titova, L. V. [Voronezh State University (Russian Federation)

    2014-12-15

    It is shown that the coefficients D{sup exp} for all T-odd asymmetries observed experimentally in the cross sections for the reactions of cold-polarized-neutron-induced fission of nonoriented target nuclei (which involves the emission of prescission and evaporated particles) comply in shape and scale with the coefficients D{sup theor} calculated for the analogous asymmetries on the basis of quantum-mechanical nuclear-fission theory for T-invariant Hamiltonians of fissile systems. It is also shown that the asymmetries in question arise upon taking into account the effect of (i) the interference between the fission amplitudes of s- and p-wave resonances of a polarized fissile compound nucleus formed in the aforementioned reactions; (ii) the collective rotation of the compound nucleus in question (this rotation entails a change in the angular distributions of fission fragments and third particles); and (iii) the wriggling vibrations of this compound nucleus in the vicinity of its scission point, which lead to the appearance of high aligned spins of fission fragments, with the result that the emission of neutrons and photons evaporated from these fragments becomes anisotropic. The possible contribution of T-noninvariant interactions to the formation of the T-odd asymmetries under analysis is estimated by using the results obtained in experimentally testing the detailed-balance principle, (P-A) theorem, and T invariance of cross sections for elastic proton-proton and proton-neutron scattering.

  18. Room-return scattering in fission neutron outputs (Conference...

    Office of Scientific and Technical Information (OSTI)

    Room-return scattering in fission neutron outputs Citation Details In-Document Search Title: Room-return scattering in fission neutron outputs You are accessing a document from...

  19. Impact of Fission Products Impurity on the Plutonium Content...

    Office of Scientific and Technical Information (OSTI)

    Impact of Fission Products Impurity on the Plutonium Content of Metal- and Oxide- Fuels in Sodium Cooled Fast Reactors Citation Details In-Document Search Title: Impact of Fission ...

  20. Microscopic Theory of Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Microscopic Theory of Fission Citation Details In-Document Search Title: Microscopic Theory of Fission You are accessing a document from the Department of Energy's (DOE) SciTech ...

  1. Recent advances in modeling fission cross sections over intermediate...

    Office of Scientific and Technical Information (OSTI)

    Country of Publication: United States Language: English Subject: 73; APPROXIMATIONS; CROSS SECTIONS; DECAY AMPLITUDES; DEFORMATION; FISSION; FLUCTUATIONS; INTERMEDIATE STRUCTURE; ...

  2. Optimally moderated nuclear fission reactor and fuel source therefor

    DOE Patents [OSTI]

    Ougouag, Abderrafi M.; Terry, William K.; Gougar, Hans D.

    2008-07-22

    An improved nuclear fission reactor of the continuous fueling type involves determining an asymptotic equilibrium state for the nuclear fission reactor and providing the reactor with a moderator-to-fuel ratio that is optimally moderated for the asymptotic equilibrium state of the nuclear fission reactor; the fuel-to-moderator ratio allowing the nuclear fission reactor to be substantially continuously operated in an optimally moderated state.

  3. The Microscopic Theory of Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Conference: The Microscopic Theory of Fission Citation Details In-Document Search Title: The Microscopic Theory of Fission Fission-fragment properties have been calculated for thermal neutron-induced fission on a {sup 239}Pu target, using constrained Hartree-Fock-Bogoliubov calculations with a finite-range effective interaction. A quantitative criterion based on the interaction energy between the nascent fragments is introduced to define the scission configurations. The validity of this

  4. Interlaboratory reaction rate program. 12th progress report, November 1976-October 1979

    SciTech Connect (OSTI)

    Lippincott, E.P.; McElroy, W.N.; Preston, C.C.

    1980-09-01

    The Interlaboratory Reaction Rate UILRR) program is establishing the capability to accurately measure neutron-induced reactions and reaction rates for reactor fuels and materials development programs. The goal for the principal fission reactions, /sup 235/U, /sup 238/U and /sup 239/Pu, is an accuracy to within +- 5% at the 95% confidence level. Accurate measurement of other fission and nonfission reactions is also required, but to a lesser accuracy, between +- 5% and 10% at the 95% confidence level. A secondary program objective is improvement in knowledge of the nuclear parameters involved in the standarization of fuels and materials dosimetry measurements of neutron flux, spectra, fluence and burnup.

  5. Fission Product Sorptivity in Graphite

    SciTech Connect (OSTI)

    Tompson, Jr., Robert V.; Loyalka, Sudarshan; Ghosh, Tushar; Viswanath, Dabir; Walton, Kyle; Haffner, Robert

    2015-04-01

    Both adsorption and absorption (sorption) of fission product (FP) gases on/into graphite are issues of interest in very high temperature reactors (VHTRs). In the original proposal, we proposed to use packed beds of graphite particles to measure sorption at a variety of temperatures and to use an electrodynamic balance (EDB) to measure sorption onto single graphite particles (a few ?m in diameter) at room temperature. The use of packed beds at elevated temperature is not an issue. However, the TPOC requested revision of this initial proposal to included single particle measurements at elevated temperatures up to 1100 C. To accommodate the desire of NEUP to extend the single particle EDB measurements to elevated temperatures it was necessary to significantly revise the plan and the budget. These revisions were approved. In the EDB method, we levitate a single graphite particle (the size, surface characteristics, morphology, purity, and composition of the particle can be varied) or agglomerate in the balance and measure the sorption of species by observing the changes in mass. This process involves the use of an electron stepping technique to measure the total charge on a particle which, in conjunction with the measured suspension voltages for the particle, allows for determinations of mass and, hence, of mass changes which then correspond to measurements of sorption. Accommodating elevated temperatures with this type of system required a significant system redesign and required additional time that ultimately was not available. These constraints also meant that the grant had to focus on fewer species as a result. Overall, the extension of the original proposed single particle work to elevated temperatures added greatly to the complexity of the proposed project and added greatly to the time that would eventually be required as well. This means that the bulk of the experimental progress was made using the packed bed sorption systems. Only being able to recruit one

  6. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOE Patents [OSTI]

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  7. Fission rate measurements in fuel plate type assembly reactor cores

    SciTech Connect (OSTI)

    Rogers, J.W.

    1988-01-01

    The methods, materials and equipment have been developed to allow extensive and precise measurement of fission rate distributions in water moderated, U-Al fuel plate assembly type reactor cores. Fission rate monitors are accurately positioned in the reactor core, the reactor is operated at a low power for a short time, the fission rate monitors are counted with detectors incorporating automated sample changers and the measurements are converted to fission rate distributions. These measured fission rate distributions have been successfully used as baseline information related to the operation of test and experimental reactors with respect to fission power and distribution, fuel loading and fission experiments for approximately twenty years at the Idaho National Engineering Laboratory (INEL). 7 refs., 8 figs.

  8. Studies of the /sup 32/S + /sup 182/W reaction

    SciTech Connect (OSTI)

    Back, B.B.; Keller, J.G.; Worsham, A.; Glagola, B.G.; Henderson, D.; Kaufman, S.; Sanders, S.J.; Siemssen, R.; Videbaek, F.; Wilkins, B.D.

    1986-01-01

    Fission-like products from the reaction /sup 32/S + /sup 182/W were measured over the entire angular range from theta = 10-170/sup 0/ and for bombarding energies of E/sub lab/ = 166, 177, 222, and 260 MeV using an array of eight Si detectors. From the measured energy and flight time the product mass was determined event-by-event by performing the appropriate corrections for the plasma delay and pulse height defect associated with Si detectors. The mass, angular, and total kinetic energy distributions of fission-like fragments are obtained by assuming two-body kinematics. The angular distributions indicate that a fraction of the observed cross section is associated with quasi-fission reactions as observed previously in several other reactions involving /sup 32/S projectiles. Furthermore, we observe an angular dependence of the fragment mass distributions, a feature which is strictly incompatible with compound nucleus decay. Both of these observations indicate that a fraction of fission-like products originate from quasi-fission, a process in which a large degree of mass transfer occurs between the two interaction nuclei in a short time scale. 14 refs., 4 figs., 1 tab.

  9. Fusion-fission energy systems evaluation

    SciTech Connect (OSTI)

    Teofilo, V.L.; Aase, D.T.; Bickford, W.E.

    1980-01-01

    This report serves as the basis for comparing the fusion-fission (hybrid) energy system concept with other advanced technology fissile fuel breeding concepts evaluated in the Nonproliferation Alternative Systems Assessment Program (NASAP). As such, much of the information and data provided herein is in a form that meets the NASAP data requirements. Since the hybrid concept has not been studied as extensively as many of the other fission concepts being examined in NASAP, the provided data and information are sparse relative to these more developed concepts. Nevertheless, this report is intended to provide a perspective on hybrids and to summarize the findings of the rather limited analyses made to date on this concept.

  10. Emilio Segrè and Spontaneous Fission

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Emilio Segrè and Spontaneous Fission As the staff at Los Alamos began research in the spring of 1943, the most formidable problems it confronted were related to the new materials that would be used in atomic bombs. These materials, uranium-235 and plutonium, were largely unknown. Uranium-235 formed only a tiny fraction of natural uranium (less than 1 percent) and plutonium had been discovered only two years earlier at the University of California, Berkeley, Radiation Laboratory by chemistry

  11. Capture and fission with DANCE and NEUANCE

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jandel, M.; Baramsai, B.; Bond, E.; Rusev, G.; Walker, C.; Bredeweg, T. A.; Chadwick, M. B.; Couture, A.; Fowler, M. M.; Hayes, A.; et al

    2015-12-23

    A summary of the current and future experimental program at DANCE is presented. Measurements of neutron capture cross sections are planned for many actinide isotopes with the goal to reduce the present uncertainties in nuclear data libraries. Detailed studies of capture gamma rays in the neutron resonance region will be performed in order to derive correlated data on the de-excitation of the compound nucleus. New approaches on how to remove the DANCE detector response from experimental data and retain the correlations between the cascade gamma rays are presented. Studies on 235U are focused on quantifying the population of short-lived isomericmore » states in 236U after neutron capture. For this purpose, a new neutron detector array NEUANCE is under construction. It will be installed in the central cavity of the DANCE array and enable the highly efficient tagging of fission and capture events. In addition, developments of fission fragment detectors are also underway to expand DANCE capabilities to measurements of fully correlated data on fission observables.« less

  12. Undergraduate Measurements For Fission Reactor Applications

    SciTech Connect (OSTI)

    Hicks, S. F.; Kersting, L. J.; Lueck, C. J.; McDonough, P.; Crider, B. P.; McEllistrem, M. T.; Peters, E. E.; Vanhoy, J. R.

    2011-06-01

    Undergraduate students at the University of Dallas (UD) have investigated elastic and inelastic neutron scattering cross sections on structural materials important for criticality considerations in nuclear fission processes. Neutrons scattered off of {sup 23}Na and {sup Nat}Fe were detected using neutron time-of-flight techniques at the University of Kentucky Low-Energy Nuclear Accelerator Facility. These measurements are part of an effort to increase the efficiency of power generation from existing fission reactors in the US and in the design of new fission systems. Students have learned the basics of how to operate the Model CN Van de Graaff generator at the laboratory, setup detectors and electronics, use data acquisition systems, and they are currently analyzing the angular dependence of the scattered neutrons for incident neutron energies of 3.57 and 3.80 MeV. Most students participating in the project will use the research experience as the material for their undergraduate research thesis required for all Bachelor of Science students at the University of Dallas. The first student projects on this topic were completed during the summer of 2010; an overview of student participation in this investigation and their preliminary results will be presented.

  13. Calculated fission properties of the heaviest elements

    SciTech Connect (OSTI)

    Moeller, P.; Nix, J.R.; Swiatecki, W.J.

    1986-09-01

    A quantitative calculation is presented that shows where high-kinetic-energy symmetric fission occurs and why it is associated with a sudden and large decrease in fission half-lives. The study is based on calculations of potential-energy surfaces in the macroscopic-microscopic model and a semi-empirical model for the nuclear inertia. For the macroscopic part a Yukawa-plus-exponential model is used and for the microscopic part a folded-Yukawa single-particle potential is used. The three-quadratic-surface parameterization generates shapes for which the potential-energy surfaces are calculated. The use of this parameterization and the use of the finite-range macroscopic model allows for the study of two touching spheres and similar shapes. The results of the calculations in terms of potential-energy surfaces and fission half-lives are presented for heavy even nuclei. The surfaces are displayed in the form of contour diagrams as functions of two moments of the shape. 53 refs., 15 figs., 1 tab.

  14. Capture and fission with DANCE and NEUANCE

    SciTech Connect (OSTI)

    Jandel, M.; Baramsai, B.; Bond, E.; Rusev, G.; Walker, C.; Bredeweg, T. A.; Chadwick, M. B.; Couture, A.; Fowler, M. M.; Hayes, A.; Kawano, T.; Mosby, S.; Stetcu, I.; Taddeucci, T. N.; Talou, P.; Ullmann, J. L.; Vieira, D. J.; Wilhelmy, J. B.

    2015-12-23

    A summary of the current and future experimental program at DANCE is presented. Measurements of neutron capture cross sections are planned for many actinide isotopes with the goal to reduce the present uncertainties in nuclear data libraries. Detailed studies of capture gamma rays in the neutron resonance region will be performed in order to derive correlated data on the de-excitation of the compound nucleus. New approaches on how to remove the DANCE detector response from experimental data and retain the correlations between the cascade gamma rays are presented. Studies on 235U are focused on quantifying the population of short-lived isomeric states in 236U after neutron capture. For this purpose, a new neutron detector array NEUANCE is under construction. It will be installed in the central cavity of the DANCE array and enable the highly efficient tagging of fission and capture events. In addition, developments of fission fragment detectors are also underway to expand DANCE capabilities to measurements of fully correlated data on fission observables.

  15. HYPERFUSE: a hypervelocity inertial confinement system for fusion energy production and fission waste transmutation

    SciTech Connect (OSTI)

    Makowitz, H.; Powell, J.R.; Wiswall, R.

    1980-01-01

    Parametric system studies of an inertial confinement fusion (ICF) reactor system to transmute fission products from a LWR economy have been carried out. The ICF reactors would produce net power in addition to transmuting fission products. The particular ICF concept examined is an impact fusion approach termed HYPERFUSE, in which hypervelocity pellets, traveling on the order of 100 to 300 km/sec, collide with each other or a target block in a reactor chamber and initiate a thermonuclear reaction. The DT fusion fuel is contained in a shell of the material to be transmuted, e.g., /sup 137/Cs, /sup 90/Sr, /sup 129/I, /sup 99/Tc, etc. The 14-MeV fusion neutrons released during the pellet burn cause transmutation reactions (e.g., (n,2n), (n,..cap alpha..), (n,..gamma..), etc.) that convert the long-lived fission products (FP's) either to stable products or to species that decay with a short half-life to a stable product. The transmutation parametric studies conclude that the design of the hypervelocity projectiles should emphasize the achievement of high densities in the transmutation regions (greater than the DT fusion fuel density), as well as the DT ignition and burn criterion (rho R = 1.0 to 3.0) requirements. These studies also indicate that masses on the order of 1.0 g at densities of rho greater than or equal to 500.0 g/cm/sup 3/ are required for a practical fusion-based fission product transmutation system.

  16. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  17. Silicon-based sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  18. Impacts to the ethylene supply chain from a hurricane disruption.

    SciTech Connect (OSTI)

    Sun, Amy Cha-Tien; Downes, Paula Sue; Heinen, Russell; Welk, Margaret Ellen

    2010-03-01

    Analysis of chemical supply chains is an inherently complex task, given the dependence of these supply chains on multiple infrastructure systems (e.g., the petroleum sector, transportation, etc.). This effort requires data and information at various levels of resolution, ranging from network-level distribution systems to individual chemical reactions. Sandia National Laboratories (Sandia) has integrated its existing simulation and infrastructure analysis capabilities with chemical data models to analyze the chemical supply chains of several nationally critical chemical commodities. This paper describes how Sandia models the ethylene supply chain; that is, the supply chain for the most widely used raw material for plastics production including a description of the types of data and modeling capabilities that are required to represent the ethylene supply chain. The paper concludes with a description of Sandia's use the model to project how the supply chain would be affected by and adapt to a disruptive scenario hurricane.

  19. A microscopic theory of low energy fission: fragment properties

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Conference: A microscopic theory of low energy fission: fragment properties Citation Details In-Document Search Title: A microscopic theory of low energy fission: fragment properties Authors: Younes, W ; Gogny, D ; Schunck, N Publication Date: 2013-01-11 OSTI Identifier: 1062214 Report Number(s): LLNL-PROC-609985 DOE Contract Number: W-7405-ENG-48 Resource Type: Conference Resource Relation: Conference: Presented at: Fifth International Conference on Fission

  20. Fifty years of nuclear fission: Nuclear data and measurements series

    Office of Scientific and Technical Information (OSTI)

    (Technical Report) | SciTech Connect Fifty years of nuclear fission: Nuclear data and measurements series Citation Details In-Document Search Title: Fifty years of nuclear fission: Nuclear data and measurements series This report is the written version of a colloquium first presented at Argonne National Laboratory in January 1989. The paper begins with an historical preamble about the events leading to the discovery of nuclear fission. This leads naturally to an account of early results and

  1. Time dependent particle emission from fission products (Conference) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Time dependent particle emission from fission products Citation Details In-Document Search Title: Time dependent particle emission from fission products Decay heating following nuclear fission is an important factor in the design of nuclear facilities; impacting a variety of aspects ranging from cooling requirements to shielding design. Calculations of decay heat, often assumed to be a simple product of activity and average decay product energy, are complicated by the so

  2. Neutron flux profile monitor for use in a fission reactor

    DOE Patents [OSTI]

    Kopp, Manfred K.; Valentine, Kenneth H.

    1983-01-01

    A neutron flux monitor is provided which consists of a plurality of fission counters arranged as spaced-apart point detectors along a delay line. As a fission event occurs in any one of the counters, two delayed current pulses are generated at the output of the delay line. The time separation of the pulses identifies the counter in which the particular fission event occured. Neutron flux profiles of reactor cores can be more accurately measured as a result.

  3. Fission Younes, W; Gogny, D 73 NUCLEAR PHYSICS AND RADIATION...

    Office of Scientific and Technical Information (OSTI)

    in a Time-Dependent Microscopic Theory of Fission Younes, W; Gogny, D 73 NUCLEAR PHYSICS AND RADIATION PHYSICS Abstract not provided Lawrence Livermore National Laboratory...

  4. Logging Calibration Models for Fission Neutron Sondes (September...

    Energy Savers [EERE]

    A Model for Water Factor Measurements With Fission-Neutron Logging Tools (May 1983) Field Calibration Facilities for Environmental Measurement of Radium, Thorium, and Potassium ...

  5. Yields of fission products from various actinide targets (Conference...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Fourth International Conference on Fission and Properties of Neutron-Rich Nuclei, Sanibel Island, FL, USA, 20071111, 20071117 Research Org: Oak Ridge ...

  6. A microscopic theory of low energy fission: fragment properties...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Presented at: Fifth International Conference on Fission and Properties of Neutron Rich Nuclei, Sanibel Island, FL, United States, Nov 04 - Nov 10, ...

  7. Axisymmetric Magnetic Mirror Fusion-Fission Hybrid (Conference...

    Office of Scientific and Technical Information (OSTI)

    Conference: Axisymmetric Magnetic Mirror Fusion-Fission Hybrid Citation Details ... Visit OSTI to utilize additional information resources in energy science and technology. A ...

  8. Axisymmetric Magnetic Mirror Fusion-Fission Hybrid (Technical...

    Office of Scientific and Technical Information (OSTI)

    Technical Report: Axisymmetric Magnetic Mirror Fusion-Fission Hybrid Citation Details ... Visit OSTI to utilize additional information resources in energy science and technology. A ...

  9. Accelerator-driven subcritical fission in molten salt core: Closing...

    Office of Scientific and Technical Information (OSTI)

    Accelerator-driven subcritical fission in molten salt core: Closing the nuclear fuel cycle for green nuclear energy Citation Details In-Document Search Title: Accelerator-driven ...

  10. Fission fragment charge and mass distributions in Pu 239 ( n...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Fission fragment charge and mass distributions in Pu 239 ( n , f ) in the adiabatic nuclear energy density functional theory Citation Details In-Document Search ...

  11. Spontaneous fission half-lives for ground state nuclides

    SciTech Connect (OSTI)

    Holden, N.E. [Brookhaven National Lab., Upton, NY (United States); Hoffman, D.C. [Lawrence Berkeley Lab., CA (United States)

    1993-08-01

    Measurements of the spontaneous fission half-lives of nuclides of elements Z = 90 to 108 have been compiled and evaluated. Recommended values are presented.

  12. January 2013 Most Viewed Documents for Fission And Nuclear Technologie...

    Office of Scientific and Technical Information (OSTI)

    January 2013 Most Viewed Documents for Fission And Nuclear Technologies Laboratory studies of shearleach processing of zircaloy clad metallic uranium reactor fuel Swanson, J.L.; ...

  13. Singlet Exciton Fission in Polyacenes: Photophysics and Photovoltaic...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Exciton Fission in Polyacenes: Photophysics and Photovoltaic Applications December 13, ... However, the efficiency of any single-bandgap photovoltaic device under solar irradiation ...

  14. Description of Induced Nuclear Fission with Skyrme Energy Functionals...

    Office of Scientific and Technical Information (OSTI)

    Fragment Properties Citation Details In-Document Search Title: Description of Induced Nuclear Fission with Skyrme Energy Functionals: I. Static Potential Energy Surfaces and...

  15. Microscopic description of fission dynamics: finite element method...

    Office of Scientific and Technical Information (OSTI)

    Title: Microscopic description of fission dynamics: finite element method resolution of ... This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and ...

  16. Multiple scattering effects in fission neutron outputs (Conference...

    Office of Scientific and Technical Information (OSTI)

    Los Alamos National Laboratory Publication Date: 2011-02-24 OSTI Identifier: 1053153 ... Resource Relation: Conference: Fission fprogram Review, ; February 28, 2011 ; Livermore, ...

  17. Sequential Detection of Fission Processes for Harbor Defense...

    Office of Scientific and Technical Information (OSTI)

    with some interesting and feasible results; however, the fission process of SNM has not received as much attention due to its inherent complexity and required predictive nature. ...

  18. Description of Induced Nuclear Fission with Skyrme Energy Functionals...

    Office of Scientific and Technical Information (OSTI)

    Description of Induced Nuclear Fission with Skyrme Energy Functionals: II. Finite Temperature Effects Citation Details In-Document Search Title: Description of Induced Nuclear ...

  19. Overview of Fusion-Fission Hybrid Blankets for Laser Inertial...

    Office of Scientific and Technical Information (OSTI)

    Hybrid Blankets for Laser Inertial Fusion Energy (LIFE) Engine Citation Details In-Document Search Title: Overview of Fusion-Fission Hybrid Blankets for Laser Inertial Fusion ...

  20. September 2013 Most Viewed Documents for Fission And Nuclear...

    Office of Scientific and Technical Information (OSTI)

    September 2013 Most Viewed Documents for Fission And Nuclear Technologies Estimation of ... Tianfu; Pruess, Karsten (2001) 45 LWR nuclear fuel bundle data for use in fuel bundle ...

  1. June 2015 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    June 2015 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas ... MIGRATION IN SOILS OF THE CHERNOBYL NUCLEAR POWER PLANT EXCLUSION ZONE Farfan, E ...

  2. Most Viewed Documents for Fission and Nuclear Technologies: December...

    Office of Scientific and Technical Information (OSTI)

    Most Viewed Documents for Fission and Nuclear Technologies: December 2014 Stress analysis ... States)) (1992) 67 Behavior of spent nuclear fuel in water pool storage Johnson, A.B. ...

  3. March 2016 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    March 2016 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas ... methods and test results utilized for nuclear core applications (LWBR Development ...

  4. December 2015 Most Viewed Documents for Fission And Nuclear Technologi...

    Office of Scientific and Technical Information (OSTI)

    December 2015 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas ... methods and test results utilized for nuclear core applications (LWBR Development ...

  5. SEPARATION OF PLUTONIUM FROM URANIUM AND FISSION PRODUCTS

    DOE Patents [OSTI]

    Boyd, G.E.; Adamson, A.W.; Schubert, J.; Russell, E.R.

    1958-10-01

    A chromatographic adsorption process is presented for the separation of plutonium from other fission products formed by the irradiation of uranium. The plutonium and the lighter element fission products are adsorbed on a sulfonated phenol-formaldehyde resin bed from a nitric acid solution containing the dissolved uranium. Successive washes of sulfuric, phosphoric, and nitric acids remove the bulk of the fission products, then an eluate of dilute phosphoric and nitric acids removes the remaining plutonium and fission products. The plutonium is selectively removed by passing this solution through zirconium phosphate, from which the plutonium is dissolved with nitric acid. This process provides a convenient and efficient means for isolating plutonium.

  6. IMPACT OF FISSION PRODUCTS IMPURITY ON THE PLUTONIUM CONTENT...

    Office of Scientific and Technical Information (OSTI)

    This charter specifies that the separation of the fission products (FP) during the reprocessing of UOX spent nuclear fuel assemblies (UOX SNF) is not perfect and that, ...

  7. Flowsheet Testing of the Fission Product Extraction Process as...

    Office of Scientific and Technical Information (OSTI)

    Citation Details In-Document Search Title: Flowsheet Testing of the Fission Product ... generation of spent nuclear fuel requiring geologic disposal is currently being addressed. ...

  8. Nuclear fission and transuranium elements: Fifty years ago

    SciTech Connect (OSTI)

    Seaborg, G.T.

    1988-09-01

    This paper reviews some historical aspects of the knowledge and discovery of transuranium elements. This fission of plutonium is discussed also. 12 refs., 6 figs.

  9. ENDF/B-VII.1 Nuclear Data for Science and Technology: Cross Sections, Covariances, Fission Product Yields and Decay Data

    SciTech Connect (OSTI)

    G. Palmiotti

    2011-12-01

    The ENDF/B-VII.1 library is our latest recommended evaluated nuclear data file for use in nuclear science and technology applications, and incorporates advances made in the five years since the release of ENDF/B-VII.0. These advances focus on neutron cross sections, covariances, fission product yields and decay data, and represent work by the US Cross Section Evaluation Working Group (CSEWG) in nuclear data evaluation that utilizes developments in nuclear theory, modeling, simulation, and experiment. The principal advances in the new library are: (1) An increase in the breadth of neutron reaction cross section coverage, extending from 393 nuclides to 418 nuclides; (2) Covariance uncertainty data for 185 of the most important nuclides, as documented in companion papers in this edition; (3) R-matrix analyses of neutron reactions on light nuclei, including isotopes of He, Li, and Be; (4) Resonance parameter analyses at lower energies and statistical high energy reactions at higher energies for isotopes of F, Cl, K, Ti, V, Mn, Cr, Ni, Zr and W; (5) Modifications to thermal neutron reactions on fission products (isotopes of Mo, Tc, Rh, Ag, Cs, Nd, Sm, Eu) and neutron absorber materials (Cd, Gd); (6) Improved minor actinide evaluations for isotopes of U, Np, Pu, and Am (we are not making changes to the major actinides 235,238U and 239Pu at this point, except for delayed neutron data, and instead we intend to update them after a further period of research in experiment and theory), and our adoption of JENDL-4.0 evaluations for isotopes of Cm, Bk, Cf, Es, Fm, and some other minor actinides; (7) Fission energy release evaluations; (8) Fission product yield advances for fission-spectrum neutrons and 14 MeV neutrons incident on 239Pu; and (9) A new Decay Data sublibrary. Integral validation testing of the ENDF/B-VII.1 library is provided for a variety of quantities: For nuclear criticality, the VII.1 library maintains the generally-good performance seen for VII.0 for a wide

  10. Fission gas retention in irradiated metallic fuel

    SciTech Connect (OSTI)

    Fenske, G.R.; Gruber, E.E.; Kramer, J.M.

    1987-01-01

    Theoretical calculations and experimental measurements of the quantity of retained fission gas in irradiated metallic fuel (U-5Fs) are presented. The calculations utilize the Booth method to model the steady-state release of gases from fuel grains and a simplified grain-boundary gas model to predict the gas release from intergranular regions. The quantity of gas retained in as-irradiated fuel was determined by collecting the gases released from short segments of EBR-II driver fuel that were melted in a gas-tight furnace. Comparison of the calculations to the measurements shows quantitative agreement with both the magnitude and the axial variation of the retained gas content.

  11. SEPARATION OF URANIUM, PLUTONIUM AND FISSION PRODUCTS

    DOE Patents [OSTI]

    Nicholls, C.M.; Wells, I.; Spence, R.

    1959-10-13

    The separation of uranium and plutonium from neutronirradiated uranium is described. The neutron-irradiated uranium is dissolved in nitric acid to provide an aqueous solution 3N in nitric acid. The fission products of the solution are extruded by treating the solution with dibutyl carbitol substantially 1.8N in nitric acid. The organic solvent phase is separated and neutralized with ammonium hydroxide and the plutonium reduced with hydroxylamine base to the trivalent state. Treatment of the mixture with saturated ammonium nitrate extracts the reduced plutonium and leaves the uranium in the organic solvent.

  12. Finite Element Solver for Fission Dynamics

    Energy Science and Technology Software Center (OSTI)

    2015-01-30

    FELIX is a physics computer code used to model fission fragment mass distributions in a fully quantum-mechanical, misroscopic framework that only relies on our current knowledge of nuclear forces. It is an implementation of the time-dependent generator coordinate method (TDGCM), which simulates the dynamics of a collective quantum wave-packet assuming the motion is adiabatic. In typical applications of the TDGCM, the nuclear collective wavepacket is obtained as a superposition of wavefunctions obtained by solving themore » Hartree-Fock-Bogoliubov equations of nuclear density functional theory (DFT). The program calculates at each time step the coefficients of that superposition.« less

  13. Pairing-induced speedup of nuclear spontaneous fission

    SciTech Connect (OSTI)

    Sadhukhan, Jhilam; Dobaczewski, J.; Nazarewicz, W.; Sheikh, J. A.; Baran, A.

    2014-12-22

    Collective inertia is strongly influenced at the level crossing at which the quantum system changes its microscopic configuration diabatically. Pairing correlations tend to make the large-amplitude nuclear collective motion more adiabatic by reducing the effect of these configuration changes. Competition between pairing and level crossing is thus expected to have a profound impact on spontaneous fission lifetimes. To elucidate the role of nucleonic pairing on spontaneous fission, we study the dynamic fission trajectories of 264Fm and 240Pu using the state-of-the-art self-consistent framework. We employ the superfluid nuclear density functional theory with the Skyrme energy density functional SkM* and a density-dependent pairing interaction. Along with shape variables, proton and neutron pairing correlations are taken as collective coordinates. The collective inertia tensor is calculated within the nonperturbative cranking approximation. The fission paths are obtained by using the least action principle in a four-dimensional collective space of shape and pairing coordinates. Pairing correlations are enhanced along the minimum-action fission path. For the symmetric fission of 264Fm, where the effect of triaxiality on the fission barrier is large, the geometry of the fission pathway in the space of the shape degrees of freedom is weakly impacted by pairing. This is not the case for 240Pu, where pairing fluctuations restore the axial symmetry of the dynamic fission trajectory. The minimum-action fission path is strongly impacted by nucleonic pairing. In some cases, the dynamical coupling between shape and pairing degrees of freedom can lead to a dramatic departure from the static picture. As a result, in the dynamical description of nuclear fission, particle-particle correlations should be considered on the same footing as those associated with shape degrees of freedom.

  14. Pairing-induced speedup of nuclear spontaneous fission

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sadhukhan, Jhilam; Dobaczewski, J.; Nazarewicz, W.; Sheikh, J. A.; Baran, A.

    2014-12-22

    Collective inertia is strongly influenced at the level crossing at which the quantum system changes its microscopic configuration diabatically. Pairing correlations tend to make the large-amplitude nuclear collective motion more adiabatic by reducing the effect of these configuration changes. Competition between pairing and level crossing is thus expected to have a profound impact on spontaneous fission lifetimes. To elucidate the role of nucleonic pairing on spontaneous fission, we study the dynamic fission trajectories of 264Fm and 240Pu using the state-of-the-art self-consistent framework. We employ the superfluid nuclear density functional theory with the Skyrme energy density functional SkM* and a density-dependentmore » pairing interaction. Along with shape variables, proton and neutron pairing correlations are taken as collective coordinates. The collective inertia tensor is calculated within the nonperturbative cranking approximation. The fission paths are obtained by using the least action principle in a four-dimensional collective space of shape and pairing coordinates. Pairing correlations are enhanced along the minimum-action fission path. For the symmetric fission of 264Fm, where the effect of triaxiality on the fission barrier is large, the geometry of the fission pathway in the space of the shape degrees of freedom is weakly impacted by pairing. This is not the case for 240Pu, where pairing fluctuations restore the axial symmetry of the dynamic fission trajectory. The minimum-action fission path is strongly impacted by nucleonic pairing. In some cases, the dynamical coupling between shape and pairing degrees of freedom can lead to a dramatic departure from the static picture. As a result, in the dynamical description of nuclear fission, particle-particle correlations should be considered on the same footing as those associated with shape degrees of freedom.« less

  15. Supply Chain | NISAC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NISACSupply Chain content top National Transportation Fuels Model Posted by tmanzan on Oct 3, 2012 in | Comments 0 comments National Transportation Fuels Model This model informs analyses of the availability of transportation fuel in the event the fuel supply chain is disrupted. The portion of the fuel supply system represented by the network model (see figure) spans from oil fields to fuel distribution terminals. Different components of this system (e.g., crude oil import terminals, refineries,

  16. Feasibility study of a fission-suppressed tokamak fusion breeder

    SciTech Connect (OSTI)

    Moir, R.W.; Lee, J.D.; Neef, W.S.; Berwald, D.H.; Garner, J.K.; Whitley, R.H.; Ghoniem, N.; Wong, C.P.C.; Maya, I.; Schultz, K.R.

    1984-12-01

    The preliminary conceptual design of a tokamak fissile fuel producer is described. The blanket technology is based on the fission suppressed breeding concept where neutron multiplication occurs in a bed of 2 cm diameter beryllium pebbles which are cooled by helium at 50 atmospheres pressure. Uranium-233 is bred in thorium metal fuel elements which are in the form of snap rings attached to each beryllium pebble. Tritium is bred in lithium bearing material contained in tubes immersed in the pebble bed and is recovered by a purge flow of helium. The neutron wall load is 3 MW/m/sup 2/ and the blanket material is ferritic steel. The net fissile breeding ratio is 0.54 +- 30% per fusion reaction. This results in the production of 4900 kg of /sup 233/U per year from 3000 MW of fusion power. This quantity of fuel will provide makeup fuel for about 12 LWRs of equal thermal power or about 18 1 GW/sub e/ LWRs. The calculated cost of the produced uranium-233 is between $23/g and $53/g or equivalent to $10/kg to $90/kg of U/sub 3/O/sub 8/ depending on government financing or utility financing assumptions. Additional topics discussed in the report include the tokamak operating mode (both steady state and long pulse considered), the design and breeding implications of using a poloidal divertor for impurity control, reactor safety, the choice of a tritium breeder, and fuel management.

  17. Microfabricated sleeve devices for chemical reactions

    DOE Patents [OSTI]

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  18. Supply Chain Management Center | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Supply Chain Management Center

  19. REGENERATION OF FISSION-PRODUCT-CONTAINING MAGNESIUM-THORIUM ALLOYS

    DOE Patents [OSTI]

    Chiotti, P.

    1964-02-01

    A process of regenerating a magnesium-thorium alloy contaminated with fission products, protactinium, and uranium is presented. A molten mixture of KCl--LiCl-MgCl/sub 2/ is added to the molten alloy whereby the alkali, alkaline parth, and rare earth fission products (including yttrium) and some of the thorium and uranium are chlorinated and

  20. Electroplating method for producing ultralow-mass fissionable deposits

    DOE Patents [OSTI]

    Ruddy, Francis H.

    1989-01-01

    A method for producing ultralow-mass fissionable deposits for nuclear reactor dosimetry is described, including the steps of holding a radioactive parent until the radioactive parent reaches secular equilibrium with a daughter isotope, chemically separating the daughter from the parent, electroplating the daughter on a suitable substrate, and holding the electroplated daughter until the daughter decays to the fissionable deposit.

  1. SEPARATION OF FISSION PRODUCTS FROM PLUTONIUM BY PRECIPITATION

    DOE Patents [OSTI]

    Seaborg, G.T.; Thompson, S.G.; Davidson, N.R.

    1959-09-01

    Fission product separation from hexavalent plutonium by bismuth phosphate precipitation of the fission products is described. The precipitation, according to this invention, is improved by coprecipitating ceric and zirconium phosphates (0.05 to 2.5 grams/liter) with the bismuth phosphate.

  2. Direct reactions for nuclear structure and nuclear astrophysics

    SciTech Connect (OSTI)

    Jones, Katherine Louise

    2014-12-18

    Direct reactions are powerful probes for studying the atomic nucleus. Modern direct reaction studies are illuminating both the fundamental nature of the nucleus and its role in nucleosynthetic processes occurring in the cosmos. This report covers experiments using knockout reactions on neutron-deficient fragmentation beams, transfer reactions on fission fragment beams, and theoretical sensitivity studies relating to the astrophysical r-process. Results from experiments on 108,106Sn at the NSCL, and on 131Sn at HRIBF are presented as well as the results from the nucleosynthesis study.

  3. Fission energy program of the US Department of Energy, FY 1981

    SciTech Connect (OSTI)

    Ferguson, Robert L.

    1980-03-01

    Information is presented concerning the National Energy Plan and fission energy policy; fission energy program management; converter reactor systems; breeder reactor systems; and special nuclear evaluations and systems.

  4. Recent advances in nuclear fission theory: pre- and post-scission...

    Office of Scientific and Technical Information (OSTI)

    Recent advances in nuclear fission theory: pre- and post-scission physics Citation Details In-Document Search Title: Recent advances in nuclear fission theory: pre- and ...

  5. Fission matrix capability for MCNP, Part II - Applications

    SciTech Connect (OSTI)

    Carney, S. E.; Brown, F. B.; Kiedrowski, B. C.; Martin, W. R.

    2013-07-01

    This paper describes the initial experience and results from implementing a fission matrix capability into the MCNP Monte Carlo code. The fission matrix is obtained at essentially no cost during the normal simulation for criticality calculations. It can be used to provide estimates of the fundamental mode power distribution, the reactor dominance ratio, the eigenvalue spectrum, and higher mode spatial eigenfunctions. It can also be used to accelerate the convergence of the power method iterations. Past difficulties and limitations of the fission matrix approach are overcome with a new sparse representation of the matrix, permitting much larger and more accurate fission matrix representations. Numerous examples are presented. A companion paper (Part I - Theory) describes the theoretical basis for the fission matrix method. (authors)

  6. The MAP kinase Pmk1 and protein kinase A are required for rotenone resistance in the fission yeast, Schizosaccharomyces pombe

    SciTech Connect (OSTI)

    Wang, Yiwei; Gulis, Galina; Buckner, Scott; Johnson, P. Connor; Sullivan, Daniel; Busenlehner, Laura; Marcus, Stevan

    2010-08-20

    Research highlights: {yields} Rotenone induces generation of ROS and mitochondrial fragmentation in fission yeast. {yields} The MAPK Pmk1 and PKA are required for rotenone resistance in fission yeast. {yields} Pmk1 and PKA are required for ROS clearance in rotenone treated fission yeast cells. {yields} PKA plays a role in ROS clearance under normal growth conditions in fission yeast. -- Abstract: Rotenone is a widely used pesticide that induces Parkinson's disease-like symptoms in rats and death of dopaminergic neurons in culture. Although rotenone is a potent inhibitor of complex I of the mitochondrial electron transport chain, it can induce death of dopaminergic neurons independently of complex I inhibition. Here we describe effects of rotenone in the fission yeast, Schizosaccharomyces pombe, which lacks complex I and carries out rotenone-insensitive cellular respiration. We show that rotenone induces generation of reactive oxygen species (ROS) as well as fragmentation of mitochondrial networks in treated S. pombe cells. While rotenone is only modestly inhibitory to growth of wild type S. pombe cells, it is strongly inhibitory to growth of mutants lacking the ERK-type MAP kinase, Pmk1, or protein kinase A (PKA). In contrast, cells lacking the p38 MAP kinase, Spc1, exhibit modest resistance to rotenone. Consistent with these findings, we provide evidence that Pmk1 and PKA, but not Spc1, are required for clearance of ROS in rotenone treated S. pombe cells. Our results demonstrate the usefulness of S. pombe for elucidating complex I-independent molecular targets of rotenone as well as mechanisms conferring resistance to the toxin.

  7. Improved Fission Neutron Data Base for Active Interrogation of Actinides

    SciTech Connect (OSTI)

    Pozzi, Sara; Czirr, J. Bart; Haight, Robert; Kovash, Michael; Tsvetkov, Pavel

    2013-11-06

    This project will develop an innovative neutron detection system for active interrogation measurements. Many active interrogation methods to detect fissionable material are based on the detection of neutrons from fission induced by fast neutrons or high-energy gamma rays. The energy spectrum of the fission neutrons provides data to identify the fissionable isotopes and materials such as shielding between the fissionable material and the detector. The proposed path for the project is as follows. First, the team will develop new neutron detection systems and algorithms by Monte Carlo simulations and bench-top experiments. Next, They will characterize and calibrate detection systems both with monoenergetic and white neutron sources. Finally, high-fidelity measurements of neutron emission from fissions induced by fast neutrons will be performed. Several existing fission chambers containing U-235, Pu-239, U-238, or Th-232 will be used to measure the neutron-induced fission neutron emission spectra. The challenge for making confident measurements is the detection of neutrons in the energy ranges of 0.01 1 MeV and above 8 MeV, regions where the basic data on the neutron energy spectrum emitted from fission is least well known. In addition, improvements in the specificity of neutron detectors are required throughout the complete energy range: they must be able to clearly distinguish neutrons from other radiations, in particular gamma rays and cosmic rays. The team believes that all of these challenges can be addressed successfully with emerging technologies under development by this collaboration. In particular, the collaboration will address the area of fission neutron emission spectra for isotopes of interest in the advanced fuel cycle initiative (AFCI).

  8. On the competition between hydrogen abstraction versus C-O bond fission in initiating dimethyl ether combustion

    SciTech Connect (OSTI)

    Francisco, J.

    1999-07-01

    There has been a growing interest in the potential use of dimethyl ether (DME) as a diesel fuel in compression ignition engines. There are two initiation steps involved in the combustion of DME, one involving C-O bond fission and the other involving hydrogen abstraction by molecular oxygen. The kinetics and thermodynamics of C-O bond fission were explored computationally in a previous paper. The present paper addresses the competing process--hydrogen abstraction by molecular oxygen. Ab initio molecular orbital calculations are used to study the structures and energetics of the reactants, products, and the transition state for the CH{sub 3}OCH{sub 3} + O{sub 2} reaction. The calculations predict a barrier for hydrogen abstraction from CH{sub 3}OCH{sub 3} by O{sub 2} of 47.4 kcal/mol. This is lower than the barrier height for C-O bond fission previously calculated to be 81.1 kcal/mol. The results support values used in current models for the combustion of DME. Moreover, an examination of rates for C-O bond fission versus hydrogen abstraction by O{sub 2} suggests that the bimolecular process is the dominant pathway.

  9. Detecting fission from special nuclear material sources

    DOE Patents [OSTI]

    Rowland, Mark S.; Snyderman, Neal J.

    2012-06-05

    A neutron detector system for discriminating fissile material from non-fissile material wherein a digital data acquisition unit collects data at high rate, and in real-time processes large volumes of data directly into information that a first responder can use to discriminate materials. The system comprises counting neutrons from the unknown source and detecting excess grouped neutrons to identify fission in the unknown source. The system includes a graphing component that displays the plot of the neutron distribution from the unknown source over a Poisson distribution and a plot of neutrons due to background or environmental sources. The system further includes a known neutron source placed in proximity to the unknown source to actively interrogate the unknown source in order to accentuate differences in neutron emission from the unknown source from Poisson distributions and/or environmental sources.

  10. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference...

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Presented at: Transport Phenomena in Micro and Nano Devices, Kona Coast, HI (US), 10172004--10212004; Other Information: PBD: 28 Sep 2004 ...

  11. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Errormore » rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  12. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices (Conference...

    Office of Scientific and Technical Information (OSTI)

    compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum ...

  13. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction...

    Office of Scientific and Technical Information (OSTI)

    square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct ...

  14. Chain Reaction Innovations Business Mentor Solicitation | Argonne National

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Laboratory Innovations Business Mentor Solicitation PDF icon 2016_05_24_CRI_Business_Mentor_Solicitation_JWW_5bd

  15. METHOD AND APPARATUS FOR CONDUCTING A NUCLEAR CHAIN REACTION

    DOE Patents [OSTI]

    Wigner, E.P.; Ohlinger, L.A.; Young, G.J.; Weinberg, A.M.

    1962-09-01

    A nuclear reactor is designed incorporating a slurry of uranium- containing particles in heavy water and including means for circulating the slurry and for cooling the slurry. (AEC)

  16. Electron-capture delayed fission properties of neutron-deficient einsteinium nuclei

    SciTech Connect (OSTI)

    Shaughnessy, Dawn A.

    2000-01-05

    Electron-capture delayed fission (ECDF) properties of neutron-deficient einsteinium isotopes were investigated using a combination of chemical separations and on-line radiation detection methods. {sup 242}Es was produced via the {sup 233}U({sup 14}N,5n){sup 242}Es reaction at a beam energy of 87 MeV (on target) in the lab system, and was found to decay with a half-life of 11 {+-} 3 seconds. The ECDF of {sup 242}Es showed a highly asymmetric mass distribution with an average pre-neutron emission total kinetic energy (TKE) of 183 {+-} 18 MeV. The probability of delayed fission (P{sub DF}) was measured to be 0.006 {+-} 0.002. In conjunction with this experiment, the excitation functions of the {sup 233}U({sup 14}N,xn){sup 247{minus}x}Es and {sup 233}U({sup 15}N,xn){sup 248{minus}x}Es reactions were measured for {sup 243}Es, {sup 244}Es and {sup 245}Es at projectile energies between 80 MeV and 100 MeV.

  17. Cluster expression in fission and fusion in high-dimensional macroscopic-microscopic calculations

    SciTech Connect (OSTI)

    Iwamoto, A.; Ichikawa, T.; Moller, P.; Sierk, A. J.

    2004-01-01

    We discuss the relation between the fission-fusion potential-energy surfaces of very heavy nuclei and the formation process of these nuclei in cold-fusion reactions. In the potential-energy surfaces, we find a pronounced valley structure, with one valley corresponding to the cold-fusion reaction, the other to fission. As the touching point is approached in the cold-fusion entrance channel, an instability towards dynamical deformation of the projectile occurs, which enhances the fusion cross section. These two 'cluster effects' enhance the production of superheavy nuclei in cold-fusion reactions, in addition to the effect of the low compound-system excitation energy in these reactions. Heavy-ion fusion reactions have been used extensively to synthesize heavy elements beyond actinide nuclei. In order to proceed further in this direction, we need to understand the formation process more precisely, not just the decay process. The dynamics of the formation process are considerably more complex than the dynamics necessary to interpret the spontaneous-fission decay of heavy elements. However, before implementing a full dynamical description it is useful to understand the basic properties of the potential-energy landscape encountered in the initial stages of the collision. The collision process and entrance-channel landscape can conveniently be separated into two parts, namely the early-stage separated system before touching and the late-stage composite system after touching. The transition between these two stages is particularly important, but not very well understood until now. To understand better the transition between the two stages we analyze here in detail the potential energy landscape or 'collision surface' of the system both outside and inside the touching configuration of the target and projectile. In Sec. 2, we discuss calculated five-dimensional potential-energy landscapes inside touching and identify major features. In Sec. 3, we present calculated

  18. Sensitivity analysis of the fission gas behavior model in BISON.

    SciTech Connect (OSTI)

    Swiler, Laura Painton; Pastore, Giovanni; Perez, Danielle; Williamson, Richard

    2013-05-01

    This report summarizes the result of a NEAMS project focused on sensitivity analysis of a new model for the fission gas behavior (release and swelling) in the BISON fuel performance code of Idaho National Laboratory. Using the new model in BISON, the sensitivity of the calculated fission gas release and swelling to the involved parameters and the associated uncertainties is investigated. The study results in a quantitative assessment of the role of intrinsic uncertainties in the analysis of fission gas behavior in nuclear fuel.

  19. Active-Interrogation Measurements of Induced-Fission Neutrons from Low-Enriched Uranium

    SciTech Connect (OSTI)

    J. L. Dolan; M. J. Marcath; M. Flaska; S. A. Pozzi; D. L. Chichester; A. Tomanin; P. Peerani; G. Nebbia

    2012-07-01

    Protection and control of nuclear fuels is paramount for nuclear security and safeguards; therefore, it is important to develop fast and robust controlling mechanisms to ensure the safety of nuclear fuels. Through both passive- and active-interrogation methods we can use fast-neutron detection to perform real-time measurements of fission neutrons for process monitoring. Active interrogation allows us to use different ranges of incident neutron energy to probe for different isotopes of uranium. With fast-neutron detectors, such as organic liquid scintillation detectors, we can detect the induced-fission neutrons and photons and work towards quantifying a samples mass and enrichment. Using MCNPX-PoliMi, a system was designed to measure induced-fission neutrons from U-235 and U-238. Measurements were then performed in the summer of 2010 at the Joint Research Centre in Ispra, Italy. Fissions were induced with an associated particle D-T generator and an isotopic Am-Li source. The fission neutrons, as well as neutrons from (n, 2n) and (n, 3n) reactions, were measured with five 5 by 5 EJ-309 organic liquid scintillators. The D-T neutron generator was available as part of a measurement campaign in place by Padova University. The measurement and data-acquisition systems were developed at the University of Michigan utilizing a CAEN V1720 digitizer and pulse-shape discrimination algorithms to differentiate neutron and photon detections. Low-enriched uranium samples of varying mass and enrichment were interrogated. Acquired time-of-flight curves and cross-correlation curves are currently analyzed to draw relationships between detected neutrons and sample mass and enrichment. In the full paper, the promise of active-interrogation measurements and fast-neutron detection will be assessed through the example of this proof-of-concept measurement campaign. Additionally, MCNPX-PoliMi simulation results will be compared to the measured data to validate the MCNPX-PoliMi code when

  20. Preliminary design studies for a (D-D) or (D-T) driven cold fusion-fission (hybrid) reactor with metallic uranium

    SciTech Connect (OSTI)

    Sahin, S. ); Baltacioglu, E.; Yapici, H. )

    1991-01-01

    Based on the possibility of (D,D) fusion at room temperature in a heavy metal (palladium) matrix, a cold fusion-fission (hybrid) reactor design has been evaluated in this paper. The reactor is composed of a number of modular and uniform fuel lattices. The cold fusion neutrons induce fission reactions in the natural metallic uranium fuel, imbedded in the lattice. The neutron spectrum, and consequently the fission power density are nearly constant in the reactor core so that the rector performance becomes almost independent on the reactor size. The energy multiplication for each fusion neutron production in the (D,T) and (D,D) reactors are about 3.3 and 7.0, respectively. The (D,T) reactor mode is self-sufficient in respect to tritium breeding ratio (TBR = 1.2).

  1. EXTENSION OF THE NUCLEAR REACTION MODEL CODE EMPIRE TO ACTINIDES NUCLEAR DATA EVALUATION.

    SciTech Connect (OSTI)

    CAPOTE,R.; SIN, M.; TRKOV, A.; HERMAN, M.; CARLSON, B.V.; OBLOZINSKY, P.

    2007-04-22

    Recent extensions and improvements of the EMPIRE code system are outlined. They add new capabilities to the code, such as prompt fission neutron spectra calculations using Hauser-Feshbach plus pre-equilibrium pre-fission spectra, cross section covariance matrix calculations by Monte Carlo method, fitting of optical model parameters, extended set of optical model potentials including new dispersive coupled channel potentials, parity-dependent level densities and transmission through numerically defined fission barriers. These features, along with improved and validated ENDF formatting, exclusive/inclusive spectra, and recoils make the current EMPIRE release a complete and well validated tool for evaluation of nuclear data at incident energies above the resonance region. The current EMPIRE release has been used in evaluations of neutron induced reaction files for {sup 232}Th and {sup 231,233}Pa nuclei in the fast neutron region at IAEA. Triple-humped fission barriers and exclusive pre-fission neutron spectra were considered for the fission data evaluation. Total, fission, capture and neutron emission cross section, average resonance parameters and angular distributions of neutron scattering are in excellent agreement with the available experimental data.

  2. Measurement/Evaluation Techniques and Nuclear Data Associated with Fission of 239Pu by Fission Spectrum Neutrons

    SciTech Connect (OSTI)

    Baisden, P; Bauge, E; Ferguson, J; Gilliam, D; Granier, T; Jeanloz, R; McMillan, C; Robertson, D; Thompson, P; Verdon, C; Wilkerson, C; Young, P

    2010-03-16

    This Panel was chartered to review and assess new evaluations of work on fission product data, as well as the evaluation process used by the two U.S. nuclear weapons physics laboratories. The work focuses on fission product yields resulting from fission spectrum neutrons incident on plutonium, and includes data from measurements that had not been previously published as well as new or revised fission product cumulative yield data, and related quantities such as Q values and R values. This report documents the Panel's assessment of the work presented by Los Alamos National Laboratory (LANL) and Lawrence Livermore National Laboratory (LLNL). Based on the work presented we have seven key observations: (1) Experiments conducted in the 1970s at LANL, some of which were performed in association with a larger, NIST-led, program, have recently been documented. A preliminary assessment of this work, which will be referred to in this document as ILRR-LANL, shows it to be technically sound. (2) LLNL has done a thorough, unbiased review and evaluation of the available literature and is in the process of incorporating the previously unavailable LANL data into its evaluation of key fission product yields. The results of the LLNL effort, which includes a preliminary evaluation of the ILRR-LANL data, have been documented. (3) LANL has also conducted an evaluation of fission product yields for fission spectrum neutrons on plutonium including a meta-analysis of benchmark data as part of a planned upgrade to the ENDF/B compilation. We found that the approach of using meta-analysis provides valuable additional insight for evaluating the sparse data sets involved in this assessment. (4) Both laboratories have provided convincing evidence for energy dependence in the fission product yield of {sup 147}Nd produced from the bombardment of {sup 239}Pu with fission spectrum neutrons over an incident neutron energy range of 0.2 to 1.9 MeV. (5) Consistent, complete, and explicit treatment of

  3. Harvesting Solar Energy from Singlet Fission Materials | MIT...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Harvesting Solar Energy from Singlet Fission Materials April 19, 2016 at 4:30pm 36-428 Sean Roberts Department of Chemistry, The University of Texas at Austin s.roberts.001 A loss ...

  4. New Type of Asymmetric Fission in Proton-Rich Nuclei

    SciTech Connect (OSTI)

    Andreyev, A. N.; Elseviers, J.; Huyse, M.; Van Duppen, P.; Bree, N.; Cocolios, T. E.; Diriken, J.; Ivanov, O.; Van den Bergh, P.; Antalic, S.; Barzakh, A.; Fedorov, D.; Comas, V. F.; Heredia, J. A.; Fedosseev, V.; Marsh, B. A.; Van De Walle, J.; Franchoo, S.; Nishio, K.

    2010-12-17

    A very exotic process of {beta}-delayed fission of {sup 180}Tl is studied in detail by using resonant laser ionization with subsequent mass separation at ISOLDE (CERN). In contrast to common expectations, the fission-fragment mass distribution of the post-{beta}-decay daughter nucleus {sup 180}Hg (N/Z=1.25) is asymmetric. This asymmetry is more surprising since a mass-symmetric split of this extremely neutron-deficient nucleus would lead to two {sup 90}Zr fragments, with magic N=50 and semimagic Z=40. This is a new type of asymmetric fission, not caused by large shell effects related to fragment magic proton and neutron numbers, as observed in the actinide region. The newly measured branching ratio for {beta}-delayed fission of {sup 180}Tl is 3.6(7)x10{sup -3}%, approximately 2 orders of magnitude larger than in an earlier study.

  5. Spontaneous fission half-lives for ground state nuclides

    SciTech Connect (OSTI)

    Holden, N.E. (Brookhaven National Lab., Upton, NY (United States)); Hoffman, D.C. (Lawrence Berkeley Lab., CA (United States))

    1991-01-01

    Measurements of the spontaneous fission half-lives of nuclides of elements Z = 90 to 107 have been compiled and evaluated. Recommended values are presented. 126 refs., 96 tabs.

  6. Reference reactor module for NASA's lunar surface fission power...

    Office of Scientific and Technical Information (OSTI)

    The reactor concept uses stainless-steel based. UOsub 2-fueled, pumped-NaK fission reactor coupled to free-piston Stirling converters. The reactor shielding approach utilizes ...

  7. September 2015 Most Viewed Documents for Fission And Nuclear...

    Office of Scientific and Technical Information (OSTI)

    September 2015 Most Viewed Documents for Fission And Nuclear Technologies Estimation of ... structures Chen, S.S. (1985) 167 LWR nuclear fuel bundle data for use in fuel bundle ...

  8. March 2015 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    5 Most Viewed Documents for Fission And Nuclear Technologies Stress analysis and ... Maimoni, A. (1980) 101 Behavior of spent nuclear fuel in water pool storage Johnson, A.B. ...

  9. Most Viewed Documents for Fission And Nuclear Technologies: September...

    Office of Scientific and Technical Information (OSTI)

    Most Viewed Documents for Fission And Nuclear Technologies: September 2014 Estimation of ... H.J. (1977) 71 Behavior of spent nuclear fuel in water pool storage Johnson, A.B. ...

  10. March 2014 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    4 Most Viewed Documents for Fission And Nuclear Technologies Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 72 Peer-review study of the draft ...

  11. July 2013 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    July 2013 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas ... Ho, F.H. (1988) 136 Behavior of spent nuclear fuel in water pool storage Johnson, A.B. ...

  12. June 2014 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    June 2014 Most Viewed Documents for Fission And Nuclear Technologies Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 78 Estimation of gas leak rates ...

  13. Most Viewed Documents - Fission and Nuclear Technologies | OSTI...

    Office of Scientific and Technical Information (OSTI)

    Fission and Nuclear Technologies Metals design handbook Betts, W.S. (1988) Estimation of gas leak rates through very small orifices and channels. From sealed PuOsub 2 containers ...

  14. April 2013 Most Viewed Documents for Fission And Nuclear Technologies...

    Office of Scientific and Technical Information (OSTI)

    April 2013 Most Viewed Documents for Fission And Nuclear Technologies Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (null) 298 Estimation of gas leak rates ...

  15. Advanced modeling of prompt fission neutrons (Conference) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    work are reviewed briefly, and a preliminary assessment of uncertainties associated with the evaluated prompt fission neutron spectrum for n (0.5 MeV)+sup 239Pu is discussed. ...

  16. Microscopic Theory of Nuclear Fission: Recent Highlights | Argonne...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    world, a predictive theory of fission should instead be based solely on quantum many-body methods and our best knowledge of nuclear forces. Today, there is a consensus that...

  17. Selected spectroscopic results on element 115 decay chains

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Rudolph, D.; Forsberg, U.; Golubev, P.; Sarmiento, L. G.; Yakushev, A.; Andersson, L. -L.; Di Nitto, A.; Düllmann, Ch. E.; Gates, J. M.; Gregorich, K. E.; et al

    2014-08-24

    We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

  18. Selected spectroscopic results on element 115 decay chains

    SciTech Connect (OSTI)

    Rudolph, D.; Forsberg, U.; Golubev, P.; Sarmiento, L. G.; Yakushev, A.; Andersson, L. -L.; Di Nitto, A.; Düllmann, Ch. E.; Gates, J. M.; Gregorich, K. E.; Gross, C. J.; Herzberg, R. -D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Schädel, M.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Eberhardt, K.; Even, J.; Fahlander, C.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

    2014-08-24

    We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

  19. Exciton Dynamics and Structural Investigations of Singlet Fission in

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Molecular Solids | MIT-Harvard Center for Excitonics Exciton Dynamics and Structural Investigations of Singlet Fission in Molecular Solids October 11, 2012 at 3pm/36-428 Michael R. Wasielewski Director, Argonne-Northwestern Solar Energy Research (ANSER) Center, Northwestern University Wasielewski-002 Abstract: We are examining new dye molecules, which undergo singlet fission (SF), using guidance from electronic structure calculations to assure the requisite relationships between molecular

  20. Advancing the Fundamental Understanding of Fission: 2014 LDRD 20120077DR

    Office of Scientific and Technical Information (OSTI)

    Review (Technical Report) | SciTech Connect Advancing the Fundamental Understanding of Fission: 2014 LDRD 20120077DR Review Citation Details In-Document Search Title: Advancing the Fundamental Understanding of Fission: 2014 LDRD 20120077DR Review The following slides were presented as part of the LDRD 20120077DR Progress Appraisal Review held Tuesday, February 4, 2014. This is part of an ongoing project assessment the previous of which was documented in LA-UR-13-21182. This presentation

  1. Evaluation and compilation of fission product yields 1993

    SciTech Connect (OSTI)

    England, T.R.; Rider, B.F.

    1995-12-31

    This document is the latest in a series of compilations of fission yield data. Fission yield measurements reported in the open literature and calculated charge distributions have been used to produce a recommended set of yields for the fission products. The original data with reference sources, and the recommended yields axe presented in tabular form. These include many nuclides which fission by neutrons at several energies. These energies include thermal energies (T), fission spectrum energies (F), 14 meV High Energy (H or HE), and spontaneous fission (S), in six sets of ten each. Set A includes U235T, U235F, U235HE, U238F, U238HE, Pu239T, Pu239F, Pu241T, U233T, Th232F. Set B includes U233F, U233HE, U236F, Pu239H, Pu240F, Pu241F, Pu242F, Th232H, Np237F, Cf252S. Set C includes U234F, U237F, Pu240H, U234HE, U236HE, Pu238F, Am241F, Am243F, Np238F, Cm242F. Set D includes Th227T, Th229T, Pa231F, Am241T, Am241H, Am242MT, Cm245T, Cf249T, Cf251T, Es254T. Set E includes Cf250S, Cm244S, Cm248S, Es253S, Fm254S, Fm255T, Fm256S, Np237H, U232T, U238S. Set F includes Cm243T, Cm246S, Cm243F, Cm244F, Cm246F, Cm248F, Pu242H, Np237T, Pu240T, and Pu242T to complete fission product yield evaluations for 60 fissioning systems in all. This report also serves as the primary documentation for the second evaluation of yields in ENDF/B-VI released in 1993.

  2. METHOD OF TESTING THERMAL NEUTRON FISSIONABLE MATERIAL FOR PURITY

    DOE Patents [OSTI]

    Fermi, E.; Anderson, H.L.

    1961-01-24

    A process is given for determining the neutronic purity of fissionable material by the so-called shotgun test. The effect of a standard neutron absorber of known characteristics and amounts on a neutronic field also of known characteristics is measured and compared with the effect which the impurities derived from a known quantity of fissionable material has on the same neutronic field. The two readings are then made the basis of calculation from which the amount of impurities can be computed.

  3. Description of true and delayed ternary nuclear fission accompanied by the emission of various third particles

    SciTech Connect (OSTI)

    Kadmensky, S. G., E-mail: kadmensky@vsu.ru; Kadmensky, S. S.; Lyubashevsky, D. E. [Voronezh State University (Russian Federation)

    2010-08-15

    The mechanisms and the features of the main types of nuclear ternary fission (that is, true ternary fission, in which a third particle is emitted before the rupture of the fissioning nucleus into fragments, and delayed ternary fission, in which a third particle is emitted from fission fragments going apart) are investigated within quantum-mechanical fission theory. The features of T-odd asymmetry in true ternary nuclear fission induced by cold polarized neutrons are investigated for the cases where alpha particles, prescission neutrons, and photons appear as third particles emitted by fissioning nuclei, the Coriolis interaction of the spin of the polarized fissioning nucleus with the spin of the third particle and the interference between the fission amplitudes for neutron resonances excited in the fissioning nucleus in the case of projectile-neutron capture being taken into account. For the cases where third particles emitted by fission fragments are evaporated neutrons or photons, T-odd asymmetries in delayed ternary nuclear fission induced by cold polarized neutrons are analyzed with allowance for the mechanism of pumping of large fission-fragment spins oriented orthogonally to the fragment-emission direction and with allowance for the interference between the fission amplitudes for neutron resonances.

  4. Prompt fission gamma-ray studies at DANCE

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jandel, M.; Rusev, G.; Bond, E. M.; Bredeweg, T. A.; Chadwick, M. B.; Couture, A.; Fowler, M.. M; Haight, R. C.; Kawano, T.; Keksis, A. L.; et al

    2014-11-26

    Measurements of correlated data on prompt-fission γ-rays (PFG) have been carried out for various actinide isotopes in recent years using the Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory (LANL). We have developed a model that conveniently parametrizes the correlated data of γ-ray multiplicity and energy. New results on two- dimensional prompt-fission γ-ray multiplicity versus energy distributions from spontaneous fission on ²⁵²Cf and neutron-induced fission on 242mAm are presented together with previously obtained results on 233,235U and ²³⁹Pu. Correlated PFG data from ²⁵²Cf are also compared to results of the detailed theoretical model developed at LANL,more » for different thresholds of PFG energies. Future plans to measure correlated data on fission fragments, prompt fission neutrons and γ-rays at DANCE are presented.« less

  5. New Fission-Product Waste Forms: Development and Characterization

    SciTech Connect (OSTI)

    Alexandra Navrotsky

    2010-07-30

    Research performed on the program New Fission Product Waste Forms: Development and Characterization, in the last three years has fulfilled the objectives of the proposal which were to 1) establish ceramic waste forms for disposing of Cs, Sr and minor actinides, 2) fully characterize the phase relationships, structures and thermodynamic and kinetic stabilities of promising waste forms, 3) establish a sound technical basis for understanding key waste form properties, such as melting temperatures and aqueous durability, based on an in-depth understanding of waste form structures and thermochemistry, and 4) establish synthesis, testing, scaleup and commercialization routes for wasteform implementation through out in-kind collaborations. In addition, since Cs and Sr form new elements by radioactive decay, the behavior and thermodynamics of waste forms containing different proportions of Cs, Sr and their decay products were discovered using non-radioactive analogues. Collaborations among researchers from three institutions, UC Davis, Sandia National Laboratories, and Shott Inc., were formed to perform the primary work on the program. The unique expertise of each of the members in the areas of waste form development, structure/property relationships, hydrothermal and high temperature synthesis, crystal/glass production, and thermochemistry was critical to program success. In addition, collaborations with the Brigham Young Univeristy, Ben Gurion University, and Los Alamos National Laboratory, were established for standard entropies of ceramic waste forms, sol-gel synthesis, and high temperature synthesis. This work has had a significant impact in a number of areas. First, the studies of the thermodynamic stability of the mineral analogues provided an important technical foundation for assessment the viability of multicomponent oxide phases for Cs and Sr removal. Moreover, the thermodynamic data discovered in this program established information on the reaction pathways

  6. A scintillating fission detector for neutron flux measurements

    SciTech Connect (OSTI)

    Stange, Sy; Esch, Ernst I; Burgett, Eric A; May, Iain; Muenchausen, Ross E; Taw, Felicia; Tovesson, Fredrik K

    2010-01-01

    Neutron flux monitors are commonly used for a variety of nuclear physics applications. A scintillating neutron detector, consisting of a liquid scintillator loaded with fissionable material, has been developed, characterized, and tested in the beam line at the Los Alamos Neutron Science Center, and shows a significant improvement in neutron sensitivity compared with a conventional fission chamber. Recent research on nanocomposite-based scintillators for gamma-ray detection indicates that this approach can be extended to load nanoparticles of fissionable material into a scintillating matrix, with up to three orders of magnitude higher loading than typical fission chambers. This will result in a rugged, cost-efficient detector with high efficiency, a short signal rise time, and the ability to be used in low neutron-flux environments. Initial efforts to utilize the luminescence of uranyl oxide to eliminate the need for wavelength-shifting dyes were unsuccessful. Excitation of uranyl compounds has been reported at wavelengths ranging from 266 nm to 532 nm. However, neither the 300 nm emission of toluene, nor the 350 nm emission of PPO, nor the 410 nm emission of POPOP resulted in significant excitation of and emission by uranyl oxide. As indicated by UV/visible spectroscopy, light emitted at these wavelengths was absorbed by the colored solution. {sup 235}U remains the most attractive candidate for a fissionable scintillator, due to its high fission cross-section and lack of a threshold fission energy, but all solutions containing molecular uranium compounds will be colored, most more highly than the U{sup 6+} compounds used here. Research is therefore continuing toward the fabrication of uranium nanoparticles, in which, due to Rayleigh scattering, the coloration should be less pronounced. The characterization of the thorium-loaded liquid scintillator and the fabrication of the 100 mL detectors for use at LANSCE demonstrated the feasibility of loading fissionable

  7. Monte Carlo without chains

    SciTech Connect (OSTI)

    Chorin, Alexandre J.

    2007-12-12

    A sampling method for spin systems is presented. The spin lattice is written as the union of a nested sequence of sublattices, all but the last with conditionally independent spins, which are sampled in succession using their marginals. The marginals are computed concurrently by a fast algorithm; errors in the evaluation of the marginals are offset by weights. There are no Markov chains and each sample is independent of the previous ones; the cost of a sample is proportional to the number of spins (but the number of samples needed for good statistics may grow with array size). The examples include the Edwards-Anderson spin glass in three dimensions.

  8. The Future of Energy from Nuclear Fission

    SciTech Connect (OSTI)

    Kim, Son H.; Taiwo, Temitope

    2013-04-13

    Nuclear energy is an important part of our current global energy system, and contributes to supplying the significant demand for electricity for many nations around the world. There are 433 commercial nuclear power reactors operating in 30 countries with an installed capacity of 367 GWe as of October 2011 (IAEA PRIS, 2011). Nuclear electricity generation totaled 2630 TWh in 2010 representing 14% the worlds electricity generation. The top five countries of total installed nuclear capacity are the US, France, Japan, Russia and South Korea at 102, 63, 45, 24, and 21 GWe, respectively (WNA, 2012a). The nuclear capacity of these five countries represents more than half, 68%, of the total global nuclear capacity. The role of nuclear power in the global energy system today has been motivated by several factors including the growing demand for electric power, the regional availability of fossil resources and energy security concerns, and the relative competitiveness of nuclear power as a source of base-load electricity. There is additional motivation for the use of nuclear power because it does not produce greenhouse gas (GHG) emissions or local air pollutants during its operation and contributes to low levels of emissions throughout the lifecycle of the nuclear energy system (Beerten, J. et. al., 2009). Energy from nuclear fission primarily in the form of electric power and potentially as a source of industrial heat could play a greater role for meeting the long-term growing demand for energy worldwide while addressing the concern for climate change from rising GHG emissions. However, the nature of nuclear fission as a tremendously compact and dense form of energy production with associated high concentrations of radioactive materials has particular and unique challenges as well as benefits. These challenges include not only the safety and cost of nuclear reactors, but proliferation concerns, safeguard and storage of nuclear materials associated with nuclear fuel cycles

  9. Kinetic energy deficit in the symmetric fission of /sup 259/Md. [Light particle emission in /sup 256/Fm fission

    SciTech Connect (OSTI)

    Hulet, E.K.; Wild, J.F.; Lougheed, R.W.; Baisden, P.A.; Dougan, R.J.; Mustafa, M.G.

    1980-10-01

    The fragment energies of about 725 coincidence events have now been observed in the spontaneous fission (SF) decay of 105-min /sup 259/Md since its discovery in 1977. The fission of /sup 259/Md is characterized by a symmetric mass distribution, similar to those of /sup 258/Fm and /sup 259/Fm, but with a broad total kinetic energy (anti TKE) distribution which peaks at about 195 MeV, in contrast to those of /sup 258/Fm and /sup 259/Fm, for which the anti TKE is about 240 MeV. This kinetic energy deficit, approx. 40 MeV, has been postulated to be due to the emission of hydrogen-like particles by /sup 259/Md at the scission point in a large fraction of the fissions, leaving the residual fissioning nucleus with 100 protons. The residual nucleus would then be able to divide into two ultrastable tin-like fission fragments, but with less kinetic energy than that observed in the SF of /sup 258/Fm and /sup 259/Fm, because of binding-energy losses and a reduction in the Coulomb repulsion of the major fragments. To test this hypothesis, counter-telescope experiments aimed at detecting and identifying these light particles were performed. In 439 SF events 3 + 3 protons of the appropriate energy were observed, too few to account for the kinetic energy deficit in the fission of /sup 259/Md. There seems to be no explanation for this problem within the framework of current fission theory. These results are discussed along with preliminary measurements of light-particle emission in the SF of /sup 256/Fm. 5 figures.

  10. Modeling of Fission Gas Release in UO2

    SciTech Connect (OSTI)

    MH Krohn

    2006-01-23

    A two-stage gas release model was examined to determine if it could provide a physically realistic and accurate model for fission gas release under Prometheus conditions. The single-stage Booth model [1], which is often used to calculate fission gas release, is considered to be oversimplified and not representative of the mechanisms that occur during fission gas release. Two-stage gas release models require saturation at the grain boundaries before gas is release, leading to a time delay in release of gases generated in the fuel. Two versions of a two-stage model developed by Forsberg and Massih [2] were implemented using Mathcad [3]. The original Forsbers and Massih model [2] and a modified version of the Forsberg and Massih model that is used in a commercially available fuel performance code (FRAPCON-3) [4] were examined. After an examination of these models, it is apparent that without further development and validation neither of these models should be used to calculate fission gas release under Prometheus-type conditions. There is too much uncertainty in the input parameters used in the models. In addition. the data used to tune the modified Forsberg and Massih model (FRAPCON-3) was collected under commercial reactor conditions, which will have higher fission rates relative to Prometheus conditions [4].

  11. The behavior of fission products during nuclear rocket reactor tests

    SciTech Connect (OSTI)

    Bokor, P.C.; Kirk, W.L.; Bohl, R.J.

    1991-01-01

    The experience base regarding fission product behavior developed during the Rover program, the nuclear rocket development program of 1955--1972, will be useful in planning a renewed nuclear rocket program. During the Rover program, 20 reactors were tested at the Nuclear Rocket Development Station in Nevada. Nineteen of these discharged effluent directly into the atmosphere; the last reactor tested, a non-flight-prototypic, fuel-element-testing reactor called the Nuclear Furnace (NF-1) was connected to an effluent cleanup system that removed fission products before the hydrogen coolant (propellant) was discharged to the atmosphere. In general, we are able to increase both test duration and fuel temperature during the test series. Therefore fission product data from the later part of the program are more interesting and more applicable to future reactors. We have collected fission product retention (and release) data reported in both formal and informal publications for six of the later reactor tests; five of these were Los Alamos reactors that were firsts of a kind in configuration or operating conditions. We have also, with the cooperation of Westinghouse, included fission product data from the NRX-A6 reactor, the final member of series of developmental reactors with the same basic geometry, but with significant design and fabrication improvements as the series continued. Table 1 lists the six selected reactors and the test parameters for each.

  12. Initial Back-to-Back Fission Chamber Testing in ATRC

    SciTech Connect (OSTI)

    Benjamin Chase; Troy Unruh; Joy Rempe

    2014-06-01

    Development and testing of in-pile, real-time neutron sensors for use in Materials Test Reactor experiments is an ongoing project at Idaho National Laboratory. The Advanced Test Reactor National Scientific User Facility has sponsored a series of projects to evaluate neutron detector options in the Advanced Test Reactor Critical Facility (ATRC). Special hardware was designed and fabricated to enable testing of the detectors in the ATRC. Initial testing of Self-Powered Neutron Detectors and miniature fission chambers produced promising results. Follow-on testing required more experiment hardware to be developed. The follow-on testing used a Back-to-Back fission chamber with the intent to provide calibration data, and a means of measuring spectral indices. As indicated within this document, this is the first time in decades that BTB fission chambers have been used in INL facilities. Results from these fission chamber measurements provide a baseline reference for future measurements with Back-to-Back fission chambers.

  13. Fission gas release restrictor for breached fuel rod

    DOE Patents [OSTI]

    Kadambi, N. Prasad; Tilbrook, Roger W.; Spencer, Daniel R.; Schwallie, Ambrose L.

    1986-01-01

    In the event of a breach in the cladding of a rod in an operating liquid metal fast breeder reactor, the rapid release of high-pressure gas from the fission gas plenum may result in a gas blanketing of the breached rod and rods adjacent thereto which impairs the heat transfer to the liquid metal coolant. In order to control the release rate of fission gas in the event of a breached rod, the substantial portion of the conventional fission gas plenum is formed as a gas bottle means which includes a gas pervious means in a small portion thereof. During normal reactor operation, as the fission gas pressure gradually increases, the gas pressure interiorly of and exteriorly of the gas bottle means equalizes. In the event of a breach in the cladding, the gas pervious means in the gas bottle means constitutes a sufficient restriction to the rapid flow of gas therethrough that under maximum design pressure differential conditions, the fission gas flow through the breach will not significantly reduce the heat transfer from the affected rod and adjacent rods to the liquid metal heat transfer fluid flowing therebetween.

  14. Impact of nuclear fission on r-process nucleosynthesis and origin of solar r-process elements

    SciTech Connect (OSTI)

    Shibagaki, Shota; Kajino, Toshitaka; Mathews, Grant J.; Chiba, Satoshi

    2015-02-24

    Binary neutron star mergers (NSMs) are expected to be main production sites of r-process elements. Their ejecta are extremely neutron-rich (Y{sub e}<0.1), and the r-process path proceeds along the neutron drip line and enters the region of fissile nuclei. In this situation, although superheavy nuclei may be synthesized and the r-process path may reach the island of stability, those are sensitive to theoretical models of nuclear masses and nuclear fission. In this study, we carry out r-process nucleosynthesis simulations in the NSMs. Our new nuclear reaction network code include new theoretical models of nuclear masses and nuclear fission. Our r-process simulation of a binary NSM shows that the final r-process elemental abundances exhibit flat pattern for A?110-160, and several fission cycling operate in extremely neutron-rich conditions of the NSM. We find that the combination of the NSMs and the magnetorotational supernovae can reproduce the solar r-process elements. We discuss the validity of this interpretation.

  15. NNSA TRITIUM SUPPLY CHAIN

    SciTech Connect (OSTI)

    Wyrick, Steven; Cordaro, Joseph; Founds, Nanette; Chambellan, Curtis

    2013-08-21

    Savannah River Site plays a critical role in the Tritium Production Supply Chain for the National Nuclear Security Administration (NNSA). The entire process includes: • Production of Tritium Producing Burnable Absorber Rods (TPBARs) at the Westinghouse WesDyne Nuclear Fuels Plant in Columbia, South Carolina • Production of unobligated Low Enriched Uranium (LEU) at the United States Enrichment Corporation (USEC) in Portsmouth, Ohio • Irradiation of TPBARs with the LEU at the Tennessee Valley Authority (TVA) Watts Bar Reactor • Extraction of tritium from the irradiated TPBARs at the Tritium Extraction Facility (TEF) at Savannah River Site • Processing the tritium at the Savannah River Site, which includes removal of nonhydrogen species and separation of the hydrogen isotopes of protium, deuterium and tritium.

  16. Comparison of Fission Product Yields and Their Impact

    SciTech Connect (OSTI)

    S. Harrison

    2006-02-01

    This memorandum describes the Naval Reactors Prime Contractor Team (NRPCT) Space Nuclear Power Program (SNPP) interest in determining the expected fission product yields from a Prometheus-type reactor and assessing the impact of these species on materials found in the fuel element and balance of plant. Theoretical yield calculations using ORIGEN-S and RACER computer models are included in graphical and tabular form in Attachment, with focus on the desired fast neutron spectrum data. The known fission product interaction concerns are the corrosive attack of iron- and nickel-based alloys by volatile fission products, such as cesium, tellurium, and iodine, and the radiological transmutation of krypton-85 in the coolant to rubidium-85, a potentially corrosive agent to the coolant system metal piping.

  17. Calculated fission-fragment yield systematics in the region 74

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Möller, Peter; Randrup, Jørgen

    2015-04-01

    Background: In the seminal experiment by Schmidt et al. [Nucl. Phys. A 665, 221 (2000)] in which fission-fragment charge distributions were obtained for 70 nuclides, asymmetric distributions were seen above nucleon number A ≈ 226 and symmetric ones below. Because asymmetric fission had often loosely been explained as a preference for the nucleus to always exploit the extra binding of fragments near ¹³²Sn it was assumed that all systems below A ≈ 226 would fission symmetrically because available isotopes do not have a proton-to-neutron Z/N ratio that allows division into fragments near ¹³²Sn. But the finding by Andreyev et al.more »[Phys. Rev. Lett. 105, 252502 (2010)] did not conform to this expectation because the compound system ¹⁸⁰Hg was shown to fission asymmetrically. It was suggested that this was a new type of asymmetric fission, because no strong shell effects occur for any possible fragment division. Purpose: We calculate a reference database for fission-fragment mass yields for a large region of the nuclear chart comprising 987 nuclides. A particular aim is to establish whether ¹⁸⁰Hg is part of a contiguous region of asymmetric fission, and if so, its extent, or if not, in contrast to the actinides, there are scattered smaller groups of nuclei that fission asymmetrically in this area of the nuclear chart. Methods: We use the by now well benchmarked Brownian shape-motion method and perform random walks on the previously calculated five-dimensional potential-energy surfaces. The calculated shell corrections are damped out with energy according to a prescription developed earlier. Results: We have obtained a theoretical reference database of fission-fragment mass yields for 987 nuclides. These results show an extended region of asymmetric fission with approximate extension 74 ≤ Z ≤ 85 and 100 ≤ N ≤ 120. The calculated yields are highly variable. We show 20 representative plots of these variable features and summarize the main

  18. Mathematical Model for Transmutation System with a Two-Member Chain and Variable Separation Coefficients

    SciTech Connect (OSTI)

    Ahn, Joonhong; Kurata, Masaki

    2007-07-01

    Mathematical models for mass flow in a fuel cycle have been established for a two-member chain in a reactor with reductive extraction for partitioning process. A sub-model for reductive extraction has been implemented into the mass flow model. Recursive solutions for the mass fractions of two actinide isotopes and fission products have been obtained as a function of cycle number. As a performance measure, the reduction ratios have been defined for two actinide isotopes. Effects of discharged fuel composition on the partitioning efficiency and on waste generation have been observed. The numerical results show that at early cycles the partitioning efficiency is relatively low because of large mass fractions of actinides in discharged fuel. With more cycles, fission products accumulate, and the partitioning efficiency becomes better, approaching asymptotic values. Consequently, waste generation at early cycles would be greater than at later cycles. (authors)

  19. Fission product release from irradiated LWR fuel under accident conditions

    SciTech Connect (OSTI)

    Strain, R.V.; Sanecki, J.E.; Osborne, M.F.

    1984-01-01

    Fission product release from irradiated LWR fuel is being studied by heating fuel rod segments in flowing steam and an inert carrier gas to simulate accident conditions. Fuels with a range of irradiation histories are being subjected to several steam flow rates over a wide range of temperatures. Fission product release during each test is measured by gamma spectroscopy and by detailed examination of the collection apparatus after the test has been completed. These release results are complemented by a detailed posttest examination of samples of the fuel rod segment. Results of release measurements and fuel rod characterizations for tests at 1400 through 2000/sup 0/C are presented in this paper.

  20. Sequential Detection of Fission Processes for Harbor Defense

    SciTech Connect (OSTI)

    Candy, J V; Walston, S E; Chambers, D H

    2015-02-12

    With the large increase in terrorist activities throughout the world, the timely and accurate detection of special nuclear material (SNM) has become an extremely high priority for many countries concerned with national security. The detection of radionuclide contraband based on their γ-ray emissions has been attacked vigorously with some interesting and feasible results; however, the fission process of SNM has not received as much attention due to its inherent complexity and required predictive nature. In this paper, on-line, sequential Bayesian detection and estimation (parameter) techniques to rapidly and reliably detect unknown fissioning sources with high statistical confidence are developed.

  1. Singlet Fission | MIT-Harvard Center for Excitonics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Fission April 3, 2012 at 3:00pm/36-428 Josef Michl Dept. of Chemistry and Biochemistry, University of Colorado, Boulder tramvajenka1_000 Abstract: Singlet fission is a process in which an excited singlet molecule shares some of its energy with a nearby ground state singlet molecule and both end up in their respective triplet excited states. By splitting one excitation into two, it has the potential for producing two electron-hole pairs from a single absorbed photon. A detailed analysis showed

  2. Next Generation Nuclear Plant Phenomena Identification and Ranking Tables (PIRTs) Volume 3: Fission-Product Transport and Dose PIRTs

    SciTech Connect (OSTI)

    Morris, Robert Noel

    2008-03-01

    This Fission Product Transport (FPT) Phenomena Identification and Ranking Technique (PIRT) report briefly reviews the high-temperature gas-cooled reactor (HTGR) FPT mechanisms and then documents the step-by-step PIRT process for FPT. The panel examined three FPT modes of operation: (1) Normal operation which, for the purposes of the FPT PIRT, established the fission product circuit loading and distribution for the accident phase. (2) Anticipated transients which were of less importance to the panel because a break in the pressure circuit boundary is generally necessary for the release of fission products. The transients can change the fission product distribution within the circuit, however, because temperature changes, flow perturbations, and mechanical vibrations or shocks can result in fission product movement. (3) Postulated accidents drew the majority of the panel's time because a breach in the pressure boundary is necessary to release fission products to the confinement. The accidents of interest involved a vessel or pipe break, a safety valve opening with or without sticking, or leak of some kind. Two generic scenarios were selected as postulated accidents: (1) the pressurized loss-of-forced circulation (P-LOFC) accident, and (2) the depressurized loss-of-forced circulation (D-LOFC) accidents. FPT is not an accident driver; it is the result of an accident, and the PIRT was broken down into a two-part task. First, normal operation was seen as the initial starting point for the analysis. Fission products will be released by the fuel and distributed throughout the reactor circuit in some fashion. Second, a primary circuit breach can then lead to their release. It is the magnitude of the release into and out of the confinement that is of interest. Depending on the design of a confinement or containment, the impact of a pressure boundary breach can be minimized if a modest, but not excessively large, fission product attenuation factor can be introduced into the

  3. Energy Dependence of Fission Product Yields for 239Pu, 235U,...

    Office of Scientific and Technical Information (OSTI)

    Energy Dependence of Fission Product Yields for 239Pu, 235U, and 238U Citation Details In-Document Search Title: Energy Dependence of Fission Product Yields for 239Pu, 235U, and ...

  4. Recent advances in nuclear fission theory: pre- and post-scission...

    Office of Scientific and Technical Information (OSTI)

    Recent advances in the modeling of the nuclear fission process for data evaluation ... Two examples are given: (i) the modeling of fission cross-sections in the R-matrix ...

  5. Liquid-Metal Technology Options for A Lunar-Based Fission Surface...

    Office of Scientific and Technical Information (OSTI)

    Liquid-Metal Technology Options for A Lunar-Based Fission Surface Power System Citation Details In-Document Search Title: Liquid-Metal Technology Options for A Lunar-Based Fission...

  6. Transport of triplet excitons along continuous 100 nm polyfluorene chains

    SciTech Connect (OSTI)

    Xi, Liang; Bird, Matthew; Mauro, Gina; Asaoka, Sadayuki; Cook, Andrew R.; Chen, Hung -Cheng; Miller, John R.

    2014-12-03

    Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trapped triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 s timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into segments, perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 s. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second

  7. Transport of triplet excitons along continuous 100 nm polyfluorene chains

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Xi, Liang; Bird, Matthew; Mauro, Gina; Asaoka, Sadayuki; Cook, Andrew R.; Chen, Hung -Cheng; Miller, John R.

    2014-12-03

    Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trappedmore » triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 µs timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into “segments,” perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 µs. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a

  8. Methods to Collect, Compile, and Analyze Observed Short-lived Fission Product Gamma Data

    SciTech Connect (OSTI)

    Finn, Erin C.; Metz, Lori A.; Payne, Rosara F.; Friese, Judah I.; Greenwood, Lawrence R.; Kephart, Jeremy D.; Pierson, Bruce D.; Ellis, Tere A.

    2011-09-29

    A unique set of fission product gamma spectra was collected at short times (4 minutes to 1 week) on various fissionable materials. Gamma spectra were collected from the neutron-induced fission of uranium, neptunium, and plutonium isotopes at thermal, epithermal, fission spectrum, and 14-MeV neutron energies. This report describes the experimental methods used to produce and collect the gamma data, defines the experimental parameters for each method, and demonstrates the consistency of the measurements.

  9. DIRECT ENERGY CONVERSION FISSION REACTOR FOR THE PERIOD JUNE 1, 2001 THROUGH SEPTEMBER 30, 2001

    SciTech Connect (OSTI)

    L.C. BROWN

    2001-09-30

    OAK-B135 DIRECT ENERGY CONVERSION FISSION REACTOR FOR THE PERIOD JUNE 1, 2001 THROUGH SEPTEMBER 30, 2001

  10. Recent advances in nuclear fission theory: pre- and post-scission physics

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Recent advances in nuclear fission theory: pre- and post-scission physics Citation Details In-Document Search Title: Recent advances in nuclear fission theory: pre- and post-scission physics Recent advances in the modeling of the nuclear fission process for data evaluation purposes are reviewed. In particular, it is stressed that a more comprehensive approach to fission data is needed if predictive capability is to be achieved. The link between pre- and

  11. DOE Science Showcase - Fission Theory | OSTI, US Dept of Energy Office of

    Office of Scientific and Technical Information (OSTI)

    Scientific and Technical Information Fission Theory A predictive theory of nuclear fission has eluded physicists since 1939. Because understanding the fission process is crucial for many areas of scientific research, including particle systems, the development of carbon-free energy and to national security, much work continues at the Department of Energy (DOE) to understand fission's inherent complexity. Today, scientists are performing new experiments and using both microscopic and

  12. Fission barriers at the end of the chart of the nuclides

    SciTech Connect (OSTI)

    Möller, Peter; Sierk, Arnold J.; Ichikawa, Takatoshi; Iwamoto, Akira; Mumpower, Matthew

    2015-02-12

    We present calculated fission-barrier heights for 5239 nuclides for all nuclei between the proton and neutron drip lines with 171 ≤ A ≤ 330. The barriers are calculated in the macroscopic-microscopic finite-range liquid-drop (FRLDM) with a 2002 set of macroscopic-model parameters. The saddle-point energies are determined from potential-energy surfaces based on more than five million different shapes, defined by five deformation parameters in the three-quadratic-surface shape parametrization: elongation, neck diameter, left-fragment spheroidal deformation, right-fragment spheroidal deformation, and nascent-fragment mass asymmetry. The energy of the ground state is determined by calculating the lowest-energy configuration in both the Nilsson perturbed-spheroid (ϵ) and the spherical-harmonic (β) parametrizations, including axially asymmetric deformations. The lower of the two results (correcting for zero-point motion) is defined as the ground-state energy. The effect of axial asymmetry on the inner barrier peak is calculated in the (ϵ,γ) parametrization. We have earlier benchmarked our calculated barrier heights to experimentally extracted barrier parameters and found average agreement to about one MeV for known data across the nuclear chart. Here we do additional benchmarks and investigate the qualitative and, when possible, quantitative agreement and/or consistency with data on β-delayed fission, isotope generation along prompt-neutron-capture chains in nuclear-weapons tests, and superheavy-element stability. In addition these studies all indicate that the model is realistic at considerable distances in Z and N from the region of nuclei where its parameters were determined.

  13. Fission barriers at the end of the chart of the nuclides

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Möller, Peter; Sierk, Arnold J.; Ichikawa, Takatoshi; Iwamoto, Akira; Mumpower, Matthew

    2015-02-12

    We present calculated fission-barrier heights for 5239 nuclides for all nuclei between the proton and neutron drip lines with 171 ≤ A ≤ 330. The barriers are calculated in the macroscopic-microscopic finite-range liquid-drop (FRLDM) with a 2002 set of macroscopic-model parameters. The saddle-point energies are determined from potential-energy surfaces based on more than five million different shapes, defined by five deformation parameters in the three-quadratic-surface shape parametrization: elongation, neck diameter, left-fragment spheroidal deformation, right-fragment spheroidal deformation, and nascent-fragment mass asymmetry. The energy of the ground state is determined by calculating the lowest-energy configuration in both the Nilsson perturbed-spheroid (ϵ) andmore » the spherical-harmonic (β) parametrizations, including axially asymmetric deformations. The lower of the two results (correcting for zero-point motion) is defined as the ground-state energy. The effect of axial asymmetry on the inner barrier peak is calculated in the (ϵ,γ) parametrization. We have earlier benchmarked our calculated barrier heights to experimentally extracted barrier parameters and found average agreement to about one MeV for known data across the nuclear chart. Here we do additional benchmarks and investigate the qualitative and, when possible, quantitative agreement and/or consistency with data on β-delayed fission, isotope generation along prompt-neutron-capture chains in nuclear-weapons tests, and superheavy-element stability. In addition these studies all indicate that the model is realistic at considerable distances in Z and N from the region of nuclei where its parameters were determined.« less

  14. Fission barriers at the end of the chart of the nuclides

    SciTech Connect (OSTI)

    Mller, Peter; Sierk, Arnold J.; Ichikawa, Takatoshi; Iwamoto, Akira; Mumpower, Matthew

    2015-02-12

    We present calculated fission-barrier heights for 5239 nuclides for all nuclei between the proton and neutron drip lines with 171 ? A ? 330. The barriers are calculated in the macroscopic-microscopic finite-range liquid-drop (FRLDM) with a 2002 set of macroscopic-model parameters. The saddle-point energies are determined from potential-energy surfaces based on more than five million different shapes, defined by five deformation parameters in the three-quadratic-surface shape parametrization: elongation, neck diameter, left-fragment spheroidal deformation, right-fragment spheroidal deformation, and nascent-fragment mass asymmetry. The energy of the ground state is determined by calculating the lowest-energy configuration in both the Nilsson perturbed-spheroid (?) and the spherical-harmonic (?) parametrizations, including axially asymmetric deformations. The lower of the two results (correcting for zero-point motion) is defined as the ground-state energy. The effect of axial asymmetry on the inner barrier peak is calculated in the (?,?) parametrization. We have earlier benchmarked our calculated barrier heights to experimentally extracted barrier parameters and found average agreement to about one MeV for known data across the nuclear chart. Here we do additional benchmarks and investigate the qualitative and, when possible, quantitative agreement and/or consistency with data on ?-delayed fission, isotope generation along prompt-neutron-capture chains in nuclear-weapons tests, and superheavy-element stability. In addition these studies all indicate that the model is realistic at considerable distances in Z and N from the region of nuclei where its parameters were determined.

  15. Quantum mechanical method of fragment's angular and energy distribution calculation for binary and ternary fission

    SciTech Connect (OSTI)

    Kadmensky, S. G., E-mail: kadmensky@phys.vsu.ru; Titova, L. V.; Pen'kov, N. V. [Voronezh State University (Russian Federation)

    2006-08-15

    In the framework of quantum-mechanical fission theory, the method of calculation for partial fission width amplitudes and asymptotic behavior of the fissile nucleus wave function with strong channel coupling taken into account has been suggested. The method allows one to solve the calculation problem of angular and energy distribution countation for binary and ternary fission.

  16. THERMAL FISSION REACTOR COMPOSITIONS AND METHOD OF FABRICATING SAME

    DOE Patents [OSTI]

    Blainey, A.

    1959-10-01

    A body is presented for use in a thermal fission reactor comprising a sintered compressed mass of a substance of the group consisting of uranium, thorium, and oxides and carbides of uranium and thorium, enclosed in an envelope of a sintered, compacted, heat-conductive material of the group consisting of beryllium, zirconium, and oxides and carbides of beryllium and zirconium.

  17. Fission gas retention and axial expansion of irradiated metallic fuel

    SciTech Connect (OSTI)

    Fenske, G.R.; Emerson, J.E.; Savoie, F.E.; Johanson, E.W.

    1986-05-01

    Out-of-reactor experiments utilizing direct electrical heating and infrared heating techniques were performed on irradiated metallic fuel. The results indicate accelerated expansion can occur during thermal transients and that the accelerated expansion is driven by retained fission gases. The results also demonstrate gas retention and, hence, expansion behavior is a function of axial position within the pin.

  18. Fission properties and production mechanisms for the heaviest known elements

    SciTech Connect (OSTI)

    Hoffman, D.C.

    1981-01-01

    Mass yields of the spontaneous fission of Fm isotopes, Cf isotopes, and /sup 259/Md are discussed. Actinide yields were measured for bombardments of /sup 248/Cm with /sup 16/O, /sup 18/O, /sup 20/Ne, and /sup 22/Ne. A superheavy product might be produced by bombarding /sup 248/Cm with /sup 48/Ca ions. 12 figures. (DLC)

  19. MCNP6. Simulating Correlated Data in Fission Events

    SciTech Connect (OSTI)

    Rising, Michael Evan; Sood, Avneet

    2015-12-03

    This report is a series of slides discussing the MCNP6 code and its status in simulating fission. Applications of interest include global security and nuclear nonproliferation, detection of special nuclear material (SNM), passive and active interrogation techniques, and coincident neutron and photon leakage.

  20. Browse by Discipline -- E-print Network Subject Pathways: Fission...

    Office of Scientific and Technical Information (OSTI)

    Fission and Nuclear Technologies Go to Research Groups Preprints Provided by Individual Scientists: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Go back to Individual ...

  1. SEPARATION OF PLUTONIUM FROM URANIUM AND FISSION PRODUCTS BY ADSORPTION

    DOE Patents [OSTI]

    Seaborg, G.T.; Willard, J.E.

    1958-01-01

    A method is presented for the separation of plutonium from solutions containing that element in a valence state not higher than 41 together with uranium ions and fission products. This separation is accomplished by contacting the solutions with diatomaceous earth which preferentially adsorbs the plutonium present. Also mentioned as effective for this adsorbtive separation are silica gel, filler's earth and alumina.

  2. Fission-suppressed hybrid reactor: the fusion breeder

    SciTech Connect (OSTI)

    Moir, R.W.; Lee, J.D.; Coops, M.S.

    1982-12-01

    Results of a conceptual design study of a /sup 233/U-producing fusion breeder are presented. The majority of the study was devoted to conceptual design and evaluation of a fission-suppressed blanket and to fuel cycle issues such as fuel reprocessing, fuel handling, and fuel management. Studies in the areas of fusion engineering, reactor safety, and economics were also performed.

  3. Fission matrix capability for MCNP, Part I - Theory

    SciTech Connect (OSTI)

    Brown, F. B.; Carney, S. E.; Kiedrowski, B. C.; Martin, W. R.

    2013-07-01

    The theory underlying the fission matrix method is derived using a rigorous Green's function approach. The method is then used to investigate fundamental properties of the transport equation for a continuous-energy physics treatment. We provide evidence that an infinite set of discrete, real eigenvalues and eigenfunctions exist for the continuous-energy problem, and that the eigenvalue spectrum converges smoothly as the spatial mesh for the fission matrix is refined. We also derive equations for the adjoint solution. We show that if the mesh is sufficiently refined so that both forward and adjoint solutions are valid, then the adjoint fission matrix is identical to the transpose of the forward matrix. While the energy-dependent transport equation is strictly bi-orthogonal, we provide surprising results that the forward modes are very nearly self-adjoint for a variety of continuous-energy problems. A companion paper (Part II - Applications) describes the initial experience and results from implementing this fission matrix capability into the MCNP Monte Carlo code. (authors)

  4. Nuclear Design of the HOMER-15 Mars Surface Fission Reactor

    SciTech Connect (OSTI)

    Poston, David I.

    2002-07-01

    The next generation of robotic missions to Mars will most likely require robust power sources in the range of 3 to 20 kWe. Fission systems are well suited to provide safe, reliable, and economic power within this range. The goal of this study is to design a compact, low-mass fission system that meets Mars surface power requirements, while maintaining a high level of safety and reliability at a relatively low cost. The Heat pipe Power System (HPS) is one possible approach for producing near-term, low-cost, space fission power. The goal of the HPS project is to devise an attractive space fission system that can be developed quickly and affordably. The primary ways of doing this are by using existing technology and by designing the system for inexpensive testing. If the system can be designed to allow highly prototypic testing with electrical heating, then an exhaustive test program can be carried out quickly and inexpensively, and thorough testing of the actual flight unit can be performed - which is a major benefit to reliability. Over the past 4 years, three small HPS proof-of-concept technology demonstrations have been conducted, and each has been highly successful. The Heat pipe-Operated Mars Exploration Reactor (HOMER) is a derivative of the HPS designed especially for producing power on the surface of Mars. The HOMER-15 is a 15-kWt reactor that couples with a 3-kWe Stirling engine power system. The reactor contains stainless-steel (SS)-clad uranium nitride (UN) fuel pins that are structurally and thermally bonded to SS/sodium heat pipes. Fission energy is conducted from the fuel pins to the heat pipes, which then carry the heat to the Stirling engine. This paper describes conceptual design and nuclear performance the HOMER-15 reactor. (author)

  5. SOURCES 4C : a code for calculating ([alpha],n), spontaneous fission, and delayed neutron sources and spectra.

    SciTech Connect (OSTI)

    Wilson, W. B.; Perry, R. T.; Shores, E. F.; Charlton, W. S.; Parish, Theodore A.; Estes, G. P.; Brown, T. H.; Arthur, Edward D. ,; Bozoian, Michael; England, T. R.; Madland, D. G.; Stewart, J. E.

    2002-01-01

    SOURCES 4C is a computer code that determines neutron production rates and spectra from ({alpha},n) reactions, spontaneous fission, and delayed neutron emission due to radionuclide decay. The code is capable of calculating ({alpha},n) source rates and spectra in four types of problems: homogeneous media (i.e., an intimate mixture of a-emitting source material and low-Z target material), two-region interface problems (i.e., a slab of {alpha}-emitting source material in contact with a slab of low-Z target material), three-region interface problems (i.e., a thin slab of low-Z target material sandwiched between {alpha}-emitting source material and low-Z target material), and ({alpha},n) reactions induced by a monoenergetic beam of {alpha}-particles incident on a slab of target material. Spontaneous fission spectra are calculated with evaluated half-life, spontaneous fission branching, and Watt spectrum parameters for 44 actinides. The ({alpha},n) spectra are calculated using an assumed isotropic angular distribution in the center-of-mass system with a library of 107 nuclide decay {alpha}-particle spectra, 24 sets of measured and/or evaluated ({alpha},n) cross sections and product nuclide level branching fractions, and functional {alpha}-particle stopping cross sections for Z < 106. The delayed neutron spectra are taken from an evaluated library of 105 precursors. The code provides the magnitude and spectra, if desired, of the resultant neutron source in addition to an analysis of the'contributions by each nuclide in the problem. LASTCALL, a graphical user interface, is included in the code package.

  6. CHAIN REACTING SYSTEM

    DOE Patents [OSTI]

    Fermi, E.; Leverett, M.C.

    1958-06-01

    A nuclear reactor of the gas-cooled, graphitemoderated type is described. In this design, graphite blocks are arranged in a substantially cylindrical lattice having vertically orienied coolant channels in which uranium fuel elements having through passages are disposed. The active lattice is contained within a hollow body. such as a steel shell, which, in turn, is surrounded by water and concrete shields. Helium is used as the primary coolant and is circulated under pressure through the coolant channels and fuel elements. The helium is then conveyed to heat exchangers, where its heat is used to produce steam for driving a prime mover, thence to filtering means where radioactive impurities are removed. From the filtering means the helium passes to a compressor and an after cooler and is ultimately returned to the reactor for recirculation. Control and safety rods are provided to stabilize or stop the reaction. A space is provided between the graphite lattice and the internal walls of the shell to allow for thermal expansion of the lattice during operation. This space is filled with a resilient packing, such as asbestos, to prevent the passage of helium.

  7. Molten salt extraction of transuranic and reactive fission products from used uranium oxide fuel

    DOE Patents [OSTI]

    Herrmann, Steven Douglas

    2014-05-27

    Used uranium oxide fuel is detoxified by extracting transuranic and reactive fission products into molten salt. By contacting declad and crushed used uranium oxide fuel with a molten halide salt containing a minor fraction of the respective uranium trihalide, transuranic and reactive fission products partition from the fuel to the molten salt phase, while uranium oxide and non-reactive, or noble metal, fission products remain in an insoluble solid phase. The salt is then separated from the fuel via draining and distillation. By this method, the bulk of the decay heat, fission poisoning capacity, and radiotoxicity are removed from the used fuel. The remaining radioactivity from the noble metal fission products in the detoxified fuel is primarily limited to soft beta emitters. The extracted transuranic and reactive fission products are amenable to existing technologies for group uranium/transuranic product recovery and fission product immobilization in engineered waste forms.

  8. Manhattan Project: Science

    Office of Scientific and Technical Information (OSTI)

    Nuclear Chain Reaction Critical Mass Cross Section Emc2 Fission Fusion Nucleus Uranium Plutonium Thorium and U-233 Particle Accelerators and Other Technologies Cockroft-Walton ...

  9. Bulk and surface controlled diffusion of fission gas atoms

    SciTech Connect (OSTI)

    Andersson, Anders D.

    2012-08-09

    Fission gas retention and release impact nuclear fuel performance by, e.g., causing fuel swelling leading to mechanical interaction with the clad, increasing the plenum pressure and reducing the gap thermal conductivity. All of these processes are important to understand in order to optimize operating conditions of nuclear reactors and to simulate accident scenarios. Most fission gases have low solubility in the fuel matrix, which is especially pronounced for large fission gas atoms such as Xe and Kr, and as a result there is a significant driving force for segregation of gas atoms to extended defects such as grain boundaries or dislocations and subsequently for nucleation of gas bubbles at these sinks. Several empirical or semi-empirical models have been developed for fission gas release in nuclear fuels, e.g. [1-6]. One of the most commonly used models in fuel performance codes was published by Massih and Forsberg [3,4,6]. This model is similar to the early Booth model [1] in that it applies an equivalent sphere to separate bulk UO{sub 2} from grain boundaries represented by the sphere circumference. Compared to the Booth model, it also captures trapping at grain boundaries, fission gas resolution and it describes release from the boundary by applying timedependent boundary conditions to the circumference. In this work we focus on the step where fission gas atoms diffuse from the grain interior to the grain boundaries. The original Massih-Forsberg model describes this process by applying an effective diffusivity divided into three temperature regimes. In this report we present results from density functional theory calculations (DFT) that are relevant for the high (D{sub 3}) and intermediate (D{sub 2}) temperature diffusivities of fission gases. The results are validated by making a quantitative comparison to Turnbull's [8-10] and Matzke's data [12]. For the intrinsic or high temperature regime we report activation energies for both Xe and Kr diffusion in UO

  10. MEASUREMENT OF THE AVERAGE ENERGY AND MULTIPLICITY OF PROMPT-FISSION-NEUTRONS FROM 238U(n,f) AND 237 Np(n,f) FROM 1 TO 200 MeV.

    SciTech Connect (OSTI)

    TAIEB,J.; GRANIER, T.; ETHVIGNOT, T.; DEVLIN, M.; HAIGHT, R.C.; NELSON, R.O.; ODONNELL, J.M.; ROCHMAN, D.

    2007-06-28

    Taking advantage of the neutron source of the LANCSE, it has been possible to obtain a measure of the velocity distribution and the number of prompt-neutrons emitted in the neutron-induced fission of {sup 238}U and {sup 237}Np over a broad incident neutron energy range. The mean kinetic energy was extracted and is shown as the function of the incident-neutron energy. We confirm here the observation, for both reactions, of a dip around the second chance fission which is explained by the lower kinetic energy of the pre-fission neutrons. Such a observation is reproduced by Los Alamos model as implemented at Bruyeres le Chatel and by the Maslov model. As far as the neutron multiplicity is concerned, a similar dip is observed. However, such a behavior is not present in data measured by other groups.

  11. Fusion-Fission Hybrid for Fissile Fuel Production without Processing

    SciTech Connect (OSTI)

    Fratoni, M; Moir, R W; Kramer, K J; Latkowski, J F; Meier, W R; Powers, J J

    2012-01-02

    Two scenarios are typically envisioned for thorium fuel cycles: 'open' cycles based on irradiation of {sup 232}Th and fission of {sup 233}U in situ without reprocessing or 'closed' cycles based on irradiation of {sup 232}Th followed by reprocessing, and recycling of {sup 233}U either in situ or in critical fission reactors. This study evaluates a third option based on the possibility of breeding fissile material in a fusion-fission hybrid reactor and burning the same fuel in a critical reactor without any reprocessing or reconditioning. This fuel cycle requires the hybrid and the critical reactor to use the same fuel form. TRISO particles embedded in carbon pebbles were selected as the preferred form of fuel and an inertial laser fusion system featuring a subcritical blanket was combined with critical pebble bed reactors, either gas-cooled or liquid-salt-cooled. The hybrid reactor was modeled based on the earlier, hybrid version of the LLNL Laser Inertial Fusion Energy (LIFE1) system, whereas the critical reactors were modeled according to the Pebble Bed Modular Reactor (PBMR) and the Pebble Bed Advanced High Temperature Reactor (PB-AHTR) design. An extensive neutronic analysis was carried out for both the hybrid and the fission reactors in order to track the fuel composition at each stage of the fuel cycle and ultimately determine the plant support ratio, which has been defined as the ratio between the thermal power generated in fission reactors and the fusion power required to breed the fissile fuel burnt in these fission reactors. It was found that the maximum attainable plant support ratio for a thorium fuel cycle that employs neither enrichment nor reprocessing is about 2. This requires tuning the neutron energy towards high energy for breeding and towards thermal energy for burning. A high fuel loading in the pebbles allows a faster spectrum in the hybrid blanket; mixing dummy carbon pebbles with fuel pebbles enables a softer spectrum in the critical reactors

  12. Chemical Supply Chain Analysis | NISAC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NISACCapabilitiesChemical Supply Chain Analysis content top Chemical Supply Chain Analysis NISAC has developed a range of capabilities for analyzing the consequences of disruptions to the chemical manufacturing industry. Each capability provides a different but complementary perspective on the questions of interest-questions like Given an event, will the entire chemical sector be impacted or just parts? Which chemicals, plants, and complexes could be impacted? In which regions of the country?

  13. Basic Physics Data: Measurement of Neutron Multiplicity from Induced Fission

    SciTech Connect (OSTI)

    Pozzi, Sara; Haight, Robert

    2015-05-04

    From October 1 to October 17 a team of researchers from UM visited the LANSCE facility for an experiment during beam-time allotted from October 4 to October 17. A total of 24 detectors were used at LANSCE including liquid organic scintillation detectors (EJ-309), NaI scintillation detectors, and Li-6 enriched glass detectors. It is a double time-offlight (TOF) measurement using spallation neutrons generated by a target bombarded with pulsed high-energy protons. The neutrons travel to an LLNL-manufactured parallel plate avalanche chamber (PPAC) loaded with thin U-235 foils in which fission events are induced. The generated fission neutrons and photons are then detected in a detector array designed and built at UM and shipped to LANSCE. Preparations were made at UM, where setup and proposed detectors were tested. The UM equipment was then shipped to LANSCE for use at the 15L beam of the weapons neutron research (WNR) facility.

  14. Method of fission heat flux determination from experimental data

    DOE Patents [OSTI]

    Paxton, Frank A.

    1999-01-01

    A method is provided for determining the fission heat flux of a prime specimen inserted into a specimen of a test reactor. A pair of thermocouple test specimens are positioned at the same level in the holder and a determination is made of various experimental data including the temperature of the thermocouple test specimens, the temperature of bulk water channels located in the test holder, the gamma scan count ratios for the thermocouple test specimens and the prime specimen, and the thicknesses of the outer clads, the fuel fillers, and the backclad of the thermocouple test specimen. Using this experimental data, the absolute value of the fission heat flux for the thermocouple test specimens and prime specimen can be calculated.

  15. Advanced fission and fossil plant economics-implications for fusion

    SciTech Connect (OSTI)

    Delene, J.G.

    1994-09-01

    In order for fusion energy to be a viable option for electric power generation, it must either directly compete with future alternatives or serve as a reasonable backup if the alternatives become unacceptable. This paper discusses projected costs for the most likely competitors with fusion power for baseload electric capacity and what these costs imply for fusion economics. The competitors examined include advanced nuclear fission and advanced fossil-fired plants. The projected costs and their basis are discussed. The estimates for these technologies are compared with cost estimates for magnetic and inertial confinement fusion plants. The conclusion of the analysis is that fusion faces formidable economic competition. Although the cost level for fusion appears greater than that for fission or fossil, the costs are not so high as to preclude fusion`s potential competitiveness.

  16. Advanced fission and fossil plant economics-implications for fusion

    SciTech Connect (OSTI)

    Delene, J.G.

    1994-11-01

    In order for fusion energy to be a viable option for electric power generation, it must either directly compete with future alternatives or serve as a reasonable backup if the alternatives become unacceptable. This paper discusses projected costs for the most likely competitors with fusion power for base-load electric capacity and what these costs imply for fusion economics. The competitors examined include advanced nuclear fission and advanced fossil-fired plants. The projected costs and their basis are discussed. The estimates for these technologies are compared with cost estimates for magnetic and inertial confinement fusion plants. The conclusion of the analysis is that fusion faces formidable economic competition. Although the cost level for fusion appears greater than that for fission or fossil, the costs are not so high as to preclude fusion`s potential competitiveness.

  17. Fission Fragment Mass Distributions and Total Kinetic Energy Release of 235-Uranium and 238-Uranium in Neutron-Induced Fission at Intermediate and Fast Neutron Energies

    SciTech Connect (OSTI)

    Duke, Dana Lynn

    2015-11-12

    This Ph.D. dissertation describes a measurement of the change in mass distributions and average total kinetic energy (TKE) release with increasing incident neutron energy for fission of 235U and 238U. Although fission was discovered over seventy-five years ago, open questions remain about the physics of the fission process. The energy of the incident neutron, En, changes the division of energy release in the resulting fission fragments, however, the details of energy partitioning remain ambiguous because the nucleus is a many-body quantum system. Creating a full theoretical model is difficult and experimental data to validate existing models are lacking. Additional fission measurements will lead to higher-quality models of the fission process, therefore improving applications such as the development of next-generation nuclear reactors and defense. This work also paves the way for precision experiments such as the Time Projection Chamber (TPC) for fission cross section measurements and the Spectrometer for Ion Determination in Fission (SPIDER) for precision mass yields.

  18. Fission Fragment Angular Distributions measured with a Time Projection Chamber

    SciTech Connect (OSTI)

    Kleinrath, Verena

    2015-04-28

    The subject is presented in a series of slides with the following organization: Introduction (What is anisotropy? Relevance (Theory and ratio cross section), Previous measurements); Experiment (Particle tracking in the fissionTPC, Neutron time of flight, Data analysis & uncertainty calculation, Preliminary result for 235U); and Future Work (Refine 235U result, Process 239Pu data).

  19. September 2013 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information September 2013 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 133 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank radwaste] Rezvani, M.A.; Ziada, H.H. (Westinghouse Hanford Co., Richland, WA (United

  20. September 2015 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information September 2015 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 444 System Definition and Analysis: Power Plant Design and Layout NONE (1996) 273 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank

  1. FUEL ELEMENTS FOR THERMAL-FISSION NUCLEAR REACTORS

    DOE Patents [OSTI]

    Flint, O.

    1961-01-10

    Fuel elements for thermal-fission nuclear reactors are described. The fuel element is comprised of a core of alumina, a film of a metal of the class consisting of copper, silver, and nickel on the outer face of the core, and a coating of an oxide of a metal isotope of the class consisting of Un/sup 235/, U/ sup 233/, and Pu/sup 239/ on the metal f ilm.

  2. Singlet Exciton Fission in Polyacenes: Photophysics and Photovoltaic

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Applications | MIT-Harvard Center for Excitonics Exciton Fission in Polyacenes: Photophysics and Photovoltaic Applications December 13, 2011 at 3pm/34-401A Mark Wilson Optoelectronics Group, University of Cambridge markwbwilson-headshot Abstract: The development of novel technologies for harvesting solar energy is a major contemporary research effort in the physical sciences. However, the efficiency of any single-bandgap photovoltaic device under solar irradiation has a fundamental limit

  3. June 2016 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information Fission And Nuclear Technologies Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 449 Forces in bolted joints: analysis methods and test results utilized for nuclear core applications (LWBR Development Program) Crescimanno, P.J.; Keller, K.L. (1981) 280 Stress analysis and evaluation of a rectangular pressure vessel.

  4. December 2015 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information December 2015 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 432 System Definition and Analysis: Power Plant Design and Layout NONE (1996) 323 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank

  5. June 2015 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information June 2015 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 305 System Definition and Analysis: Power Plant Design and Layout NONE (1996) 296 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank radwaste]

  6. March 2015 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information 5 Most Viewed Documents for Fission And Nuclear Technologies Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank radwaste] Rezvani, M.A.; Ziada, H.H. (Westinghouse Hanford Co., Richland, WA (United States)); Shurrab, M.S. (Westinghouse Savannah River Co., Aiken, SC (United States)) (1992) 223 Estimation of gas leak rates through very small orifices and channels. [From

  7. Most Viewed Documents for Fission and Nuclear Technologies: December 2014 |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information Most Viewed Documents for Fission and Nuclear Technologies: December 2014 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank radwaste] Rezvani, M.A.; Ziada, H.H. (Westinghouse Hanford Co., Richland, WA (United States)); Shurrab, M.S. (Westinghouse Savannah River Co., Aiken, SC (United States)) (1992) 67 Behavior of spent nuclear fuel in water pool storage Johnson,

  8. Fission gas bubble identification using MATLAB's image processing toolbox

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Collette, R.; King, J.; Keiser, Jr., D.; Miller, B.; Madden, J.; Schulthess, J.

    2016-06-08

    Automated image processing routines have the potential to aid in the fuel performance evaluation process by eliminating bias in human judgment that may vary from person-to-person or sample-to-sample. In addition, this study presents several MATLAB based image analysis routines designed for fission gas void identification in post-irradiation examination of uranium molybdenum (U–Mo) monolithic-type plate fuels. Frequency domain filtration, enlisted as a pre-processing technique, can eliminate artifacts from the image without compromising the critical features of interest. This process is coupled with a bilateral filter, an edge-preserving noise removal technique aimed at preparing the image for optimal segmentation. Adaptive thresholding provedmore » to be the most consistent gray-level feature segmentation technique for U–Mo fuel microstructures. The Sauvola adaptive threshold technique segments the image based on histogram weighting factors in stable contrast regions and local statistics in variable contrast regions. Once all processing is complete, the algorithm outputs the total fission gas void count, the mean void size, and the average porosity. The final results demonstrate an ability to extract fission gas void morphological data faster, more consistently, and at least as accurately as manual segmentation methods.« less

  9. (Fission product transport experiments (HFR-B1))

    SciTech Connect (OSTI)

    Myers, B.F.

    1989-12-05

    Travel to the JRC Petten was for the purpose of discussing the HFR-B1 experiment and post irradiation activities. Technical assessment of the experiment strongly supports the concept of enhanced fission gas release at temperatures above 1100{degree}C, the extensive release of stored fission gas at water vapor levels postulated in accident scenarios, an increase in the steady-state fission gas release under hydrolyzing conditions, and an increase in gas release during thermal cycling. Schedules were established for completion of the work and issuance of reports by September 1990. At the KFA Juelich agreement was reached on the PIE activities for HFR-B1 and a schedule established. The final PIE report is due June 1991. Choices of accident condition tests in the PIE have yet to be made by the US participants. A proposal for the establishment of a new cooperative effort on model and code development was presented at the Institut fuer Nukleare Sicherheitsforschung of KFA. The proposal was considered premature; discussions dealing with general principles, basic aims, and organization were requested; particular concerns about free exchange of information, overlap with the existing safety subprogram, and exclusive cooperation with ORNL were raised. A strong desire for cooperation and the opinion that the raised problems could be resolved were expressed. Technical discussions at the KFA were beneficial.

  10. Tetramethyl-1-silacycloprop-2-ene: its characterization and reactions

    SciTech Connect (OSTI)

    Cornett, B.J.

    1980-05-01

    The object of this research is to fully characterize and study some of the reactions of tetramethyl-1-silacycloprop-2-ene. The final characterization of this compound was accomplished by obtaining both Si29 and 13C nuclear magnetic resonance spectra. The reactions studied included those with fluorenone, acetone, styrene, phenylacetylene, acetonitrile, t-butylcyanide, methyl isocyanate, phenyl azide, and azobenzene. Product analyses suggest that aside from addition reactions tetramethylsilacyclopropene can react either via a radical chain polymerization or an anionic chain polymerization mechanism with the latter being the more prevalent. Other reactions studied included the photolysis of tetramethylsilacyclopropene and its reactions in the presence of Pd(PPh/sub 3/)/sub 2/Cl/sub 2/. An appendix includes a study of trimethylsilyl radical disproportionation in the liquid phase to a sila olefin. Trimethylsilyl radicals in solution undergo disproportionation as well as recombination in a 1:5 ratio. The sila olefin formed by disproportionation was trapped by alcohols.

  11. Microstructural Characterization of Irradiated U-7Mo/Al-5Si Dispersion to High Fission Density

    SciTech Connect (OSTI)

    J. Gan; B. D. Miller; D. D. Keiser, Jr.; A. B. Robinson; J. W. Madden; P. G. Medvedev; D. M. Wachs

    2014-11-01

    The fuel development program for research and test reactors calls for improved knowledge on the effect of microstructure on fuel performance in reactors. This work summarizes the recent TEM microstructural characterization of an irradiated U-7Mo/Al-5Si dispersion fuel plate (R3R050) irradiated in the Advanced Test Reactor (ATR) at Idaho National Laboratory to 5.21021 fissions/cm3. While a large fraction of the fuel grains is decorated with large bubbles, there is no evidence showing interlinking of these large bubbles at the specified fission density. The attachment of solid fission product precipitates to the bubbles is likely the result of fission product diffusion into these bubbles. The process of fission gas bubble superlattice collapse appears through bubble coalescence. The results are compared with the previous TEM work of the dispersion fuels irradiated to lower fission density from the same fuel plate.

  12. Neutron-flux profile monitor for use in a fission reactor

    DOE Patents [OSTI]

    Kopp, M.K.; Valentine, K.H.

    1981-09-15

    A neutron flux monitor is provided which consists of a plurality of fission counters arranged as spaced-apart point detectors along a delay line. As a fission event occurs in any one of the counters, two delayed current pulses are generated at the output of the delay line. The time separation of the pulses identifies the counter in which the particular fission event occurred. Neutron flux profiles of reactor cores can be more accurately measured as a result.

  13. PURIFICATION OF PLUTONIUM USING A CERIUM PRECIPITATE AS A CARRIER FOR FISSION PRODUCTS

    DOE Patents [OSTI]

    Faris, B.F.; Olson, C.M.

    1961-07-01

    Bismuth phosphate carrier precipitation processes are described for the separation of plutonium from fission products wherein in at least one step bismuth phosphate is precipitated in the presence of hexavalent plutonium thereby carrying a portion of the fission products from soluble plu tonium values. In this step, a cerium phosphate precipitate is formed in conjunction with the bismuth phosphate precipitate, thereby increasing the amount of fission products removed from solution.

  14. Neutron-Induced Fission Cross Section Measurements for Uranium Isotopes and

    Office of Scientific and Technical Information (OSTI)

    Other Actinides at LANSCE (Conference) | SciTech Connect Neutron-Induced Fission Cross Section Measurements for Uranium Isotopes and Other Actinides at LANSCE Citation Details In-Document Search Title: Neutron-Induced Fission Cross Section Measurements for Uranium Isotopes and Other Actinides at LANSCE A well established program of neutron-induced fission cross section measurement at Los Alamos Neutron Science Center (LANSCE) is supporting the Fuel Cycle Research program (FC R&D). The

  15. Assessment of fission product yields data needs in nuclear reactor applications

    SciTech Connect (OSTI)

    Kern, K.; Becker, M.; Broeders, C.

    2012-07-01

    Studies on the build-up of fission products in fast reactors have been performed, with particular emphasis on the effects related to the physics of the nuclear fission process. Fission product yields, which are required for burn-up calculations, depend on the proton and neutron number of the target nucleus as well as on the incident neutron energy. Evaluated nuclear data on fission product yields are available for all relevant target nuclides in reactor applications. However, the description of their energy dependence in evaluated data is still rather rudimentary, which is due to the lack of experimental fast fission data and reliable physical models. Additionally, physics studies of evaluated JEFF-3.1.1 fission yields data have shown potential improvements, especially for various fast fission data sets of this evaluation. In recent years, important progress in the understanding of the fission process has been made, and advanced model codes are currently being developed. This paper deals with the semi-empirical approach to the description of the fission process, which is used in the GEF code being developed by K.-H. Schmidt and B. Jurado on behalf of the OECD Nuclear Energy Agency, and with results from the corresponding author's diploma thesis. An extended version of the GEF code, supporting the calculation of spectrum weighted fission product yields, has been developed. It has been applied to the calculation of fission product yields in the fission rate spectra of a MOX fuelled sodium-cooled fast reactor. Important results are compared to JEFF-3.1.1 data and discussed in this paper. (authors)

  16. Neutron-induced fission measurements at the time-of-flight facility nELBE

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kögler, T.; Beyer, R.; Junghans, A. R.; Massarczyk, R.; Schwengner, R.; Wagner, A.

    2015-05-18

    Neutron-induced fission of ²⁴²Pu is studied at the photoneutron source nELBE. The relative fast neutron fission cross section was determined using actinide fission chambers in a time-of-flight experiment. A good agreement of present nuclear data with evalua- tions has been achieved in the range of 100 keV to 10 MeV.

  17. Observation of new spontaneous fission activities from elements 100 to 105

    SciTech Connect (OSTI)

    Somerville, L.P.

    1982-03-01

    Several new Spontaneous Fission (SF) activities have been found. No definite identification could be made for any of the new SF activities; however, half-lives and possible assignments to element-104 isotopes consistent with several cross bombardments include /sup 257/Rf(3.8 s, 14% SF), /sup 258/Rf(13 ms), /sup 259/Rf(approx. 3 s, 8% SF), /sup 260/Rf(approx. 20 ms), and /sup 262/Rf(approx. 50 ms). The 80-ms SF activity claimed by the Dubna group for the discovery of element 104 (/sup 260/104) was not observed. A difficulty exists in the interpretation that /sup 260/Rf is a approx. 20-ms SF activity: in order to be correct, for example, the SF activities with half-lives between 14 and 24 ms produced in the reactions 109- to 119-MeV /sup 18/O + /sup 248/Cm, 88- to 100-MeV /sup 15/N + /sup 249/Bk, and 96-MeV /sup 18/O + /sup 249/Cf must be other nuclides due to their large production cross sections, or the cross sections for production of /sup 260/Rf must be enhanced by unknown mechanisms. Based on calculated total production cross sections a possible approx. 1% electron-capture branch in /sup 258/Lr(4.5 s) to the SF emitter /sup 258/No(1.2 ms) and an upper limit of 0.05% for SF branching in /sup 254/No(55 s) were determined. Other measured half-lives from unknown nuclides produced in respective reactions include approx. 1.6 s (/sup 18/O + /sup 248/CM), indications of a approx. 47-s SF activity (75-MeV /sup 12/C + /sup 249/Cf), and two or more SF activities with 3 s less than or equal to T/sub 1/2/ less than or equal to 60 s (/sup 18/O + /sup 249/Bk). The most exciting conclusion of this work is that if the tentative assignments to even-even element 104 isotopes are correct, there would be a sudden change in the SF half-life systematics at element 104 which has been predicted theoretically and attributed to the disappearance of the second hump of the double-humped fission barrier.

  18. Energy dependence of fission product yields from 235U, 238U and 239Pu for incident neutron energies between 0.5 and 14.8 MeV

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Gooden, M. E.; Arnold, C. W.; Becker, J. A.; Bhatia, C.; Bhike, M.; Bond, E. M.; Bredeweg, T. A.; Fallin, B.; Fowler, M. M.; Howell, C. R.; et al

    2016-01-06

    In this study, Fission Product Yields (FPY) have historically been one of the most observable features of the fission process. They are known to have strong variations that are dependent on the fissioning species, the excitation energy, and the angular momentum of the compound system. However, consistent and systematic studies of the variation of these FPY with energy have proved challenging. This is caused primarily by the nature of the experiments that have traditionally relied on radiochemical procedures to isolate specific fission products. Although radiochemical procedures exist that can isolate all products, each element presents specific challenges and introduces varyingmore » degrees of systematic errors that can make inter-comparison of FPY uncertain. Although of high importance in fields such as nuclear forensics and Stockpile Stewardship, accurate information about the energy dependence of neutron induced FPY are sparse, due primarily to the lack of suitable monoenergetic neutron sources. There is a clear need for improved data, and to address this issue, a collaboration was formed between Los Alamos National Laboratory (LANL), Lawrence Livermore National Laboratory (LLNL) and the Triangle Universities Nuclear Laboratory (TUNL) to measure the energy dependence of FPY for 235U, 238U and 239Pu. The measurements have been performed at TUNL, using a 10 MV Tandem Van de Graaff accelerator to produce monoenergetic neutrons at energies between 0.6 MeV to 14.8 MeV through a variety of reactions. The measurements have utilized a dual-fission chamber, with thin (10-100 μg/cm2) reference foils of similar material to a thick (100-400 mg) activation target held in the center between the chambers. This method allows for the accurate determination of the number of fissions that occurred in the thick target without requiring knowledge of the fission cross section or neutron fluence on target. Following activation, the thick target was removed from the dual-fission

  19. Heavy-element fission barriers (Journal Article) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect Search Results Journal Article: Heavy-element fission barriers Citation ... OSTI Identifier: 21289903 Resource Type: Journal Article Resource Relation: Journal Name: ...

  20. Accelerator spallation reactors for breeding of fissile fuel and transmuting fission products. Status and prospects

    SciTech Connect (OSTI)

    Steinberg, M.

    1981-01-01

    This report constitutes a summary review of the status and prospects of the development of accelerator spallation reactors for breeding fissile fuel and for transmuting fission products.

  1. Fission yeast RNA triphosphatase reads an Spt5 CTD code (Journal...

    Office of Scientific and Technical Information (OSTI)

    Title: Fission yeast RNA triphosphatase reads an Spt5 CTD code Authors: Doamekpor, Selom K. ; Schwer, Beate ; Sanchez, Ana M. ; Shuman, Stewart ; Lima, Christopher D. 1 ; ...

  2. From laser particle acceleration to the synthesis of extremely neutron rich isotopes via the novel fission-fusion mechanism

    SciTech Connect (OSTI)

    Thirolf, P. G.

    2015-02-24

    High-power, short pulse lasers have emerged in the last decade as attractive tools for accelerating charged particles (electrons, ions) to high energies over mm-scale acceleration lengths, thus promising to rival conventional acceleration techniques in the years ahead. In the first part of the article, the principles of laser-plasma interaction as well as the techniques and the current status of the acceleration of electron and ion beams will be briefly introduced. In particular with the upcoming next generation of multi-PW class laser systems, such as the one under construction for the ELI-Nuclear Physics project in Bucharest (ELI-NP), very efficient acceleration mechanisms for brilliant ion beams like radiation pressure acceleration (RPA) come into reach. Here, ultra-dense ion beams reaching solid-state density can be accelerated from thin target foils, exceeding the density of conventionally accelerated ion beams by about 14 orders of magnitude. This unique property of laser-accelerated ion beams can be exploited to explore the scenario of a new reaction mechanism called fission-fusion, which will be introduced in the second part of the article. Accelerating fissile species (e.g. {sup 232}Th) towards a second layer of the same material will lead to fission both of the beam-like and target-like particles. Due to the close to solid-state density of the accelerated ion bunches, fusion may occur between neutron-rich (light) fission products. This may open an access path towards extremely neutron-rich nuclides in the vicinity of the N=126 waiting point of the astrophysical r process. Waiting points at closed nucleon shells play a crucial role in controlling the reaction rates. However, since most of the pathway of heavy-element formation via the rapid-neutron capture process (r-process) runs in terra incognita of the nuclear landscape, in particular the waiting point at N=126 is yet unexplored and will remain largely inaccessible to conventional nuclear

  3. PADLOC: a one-dimensional computer program for calculating coolant and plateout fission-product concentrations. Part 2

    SciTech Connect (OSTI)

    Hudritsch, W.W.

    1981-09-01

    The behavior of some of the prominent fission products along their convection pathways is dominated by the interaction of other species with them. This gave rise to the development of a plateout code capable of analyzing coupled species effects. The single species plateout computer program PADLOC is described in Part I of this report. The present Part II is concerned with the extension of PADLOC to MULTI*PADLOK, a multiple species version of PADLOC. MULTI*PADLOC is designed to analyze the time and one-dimensional spatial dependence of the concentrations of interacting (fission product) species in the carrier gas and on the surrounding wall surfaces on an arbitrary network of flow channels. The problem solved is one of mass transport of several impurity spceis in a gas, including the effects of sources in the gas and on the surface, convection along the flow paths, decay interaction, sorption interaction on the wall surfaces, and chemical reaction interactions in the gas and on the surfaces. These phenomena are governed by a system of coupled, nonlinear partial differential equations. The solution is achieved by: (a) linearizing the equations about an approximate solution and employing a Newton-Raphson iteration technique, (b) employing a finite difference solution method with an implicit time integration, and (c) employing a substructuring technique to logically organize the systems of equations for an abitrary flow network.

  4. Novette chain design and performance

    SciTech Connect (OSTI)

    Hunt, J.T.; Speck, D.R.

    1980-12-11

    The design and performance of the Novette laser system, which is a two-beam, two-wavelength (1.05 ..mu.. and 0.53 ..mu..) target irradiation facility using phosphate glass laser chains, are discussed with information on the glass properties, controlling factors in the design selection, and projected performance with varying operating conditions. (LCL)

  5. SECTION II. HEAVY ION REACTIONS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Probing Fission Dynamics With Neutrons and GDR Gamma Rays T. Botting, G.G. Chubarian, R.P. Schmitt, K.L. Wolf, M.J. Murray, B.J. Hurst, H. Jabs, M. Hamelin, A. Bacak, Yu.Ts. ...

  6. Analysis of Fission Products on the AGR-1 Capsule Components

    SciTech Connect (OSTI)

    Paul A. Demkowicz; Jason M. Harp; Philip L. Winston; Scott A. Ploger

    2013-03-01

    The components of the AGR-1 irradiation capsules were analyzed to determine the retained inventory of fission products in order to determine the extent of in-pile fission product release from the fuel compacts. This includes analysis of (i) the metal capsule components, (ii) the graphite fuel holders, (iii) the graphite spacers, and (iv) the gas exit lines. The fission products most prevalent in the components were Ag-110m, Cs 134, Cs 137, Eu-154, and Sr 90, and the most common location was the metal capsule components and the graphite fuel holders. Gamma scanning of the graphite fuel holders was also performed to determine spatial distribution of Ag-110m and radiocesium. Silver was released from the fuel components in significant fractions. The total Ag-110m inventory found in the capsules ranged from 1.210 2 (Capsule 3) to 3.810 1 (Capsule 6). Ag-110m was not distributed evenly in the graphite fuel holders, but tended to concentrate at the axial ends of the graphite holders in Capsules 1 and 6 (located at the top and bottom of the test train) and near the axial center in Capsules 2, 3, and 5 (in the center of the test train). The Ag-110m further tended to be concentrated around fuel stacks 1 and 3, the two stacks facing the ATR reactor core and location of higher burnup, neutron fluence, and temperatures compared with Stack 2. Detailed correlation of silver release with fuel type and irradiation temperatures is problematic at the capsule level due to the large range of temperatures experienced by individual fuel compacts in each capsule. A comprehensive Ag 110m mass balance for the capsules was performed using measured inventories of individual compacts and the inventory on the capsule components. For most capsules, the mass balance was within 11% of the predicted inventory. The Ag-110m release from individual compacts often exhibited a very large range within a particular capsule.

  7. Introducing Nuclear Data Evaluations of Prompt Fission Neutron Spectra

    SciTech Connect (OSTI)

    Neudecker, Denise

    2015-06-17

    Nuclear data evaluations provide recommended data sets for nuclear data applications such as reactor physics, stockpile stewardship or nuclear medicine. The evaluated data are often based on information from multiple experimental data sets and nuclear theory using statistical methods. Therefore, they are collaborative efforts of evaluators, theoreticians, experimentalists, benchmark experts, statisticians and application area scientists. In this talk, an introductions is given to the field of nuclear data evaluation at the specific example of a recent evaluation of the outgoing neutron energy spectrum emitted promptly after fission from 239Pu and induced by neutrons from thermal to 30 MeV.

  8. Radiolysis Concerns for Water Shielding in Fission Surface Power Applications

    SciTech Connect (OSTI)

    Schoenfeld, Michael P.; Anghaie, Samim

    2008-01-21

    This paper presents an overview of radiolysis concerns with regard to water shields for fission surface power. A review of the radiolysis process is presented and key parameters and trends are identified. From this understanding of the radiolytic decomposition of water, shield pressurization and corrosion are identified as the primary concerns. Existing experimental and modeling data addressing concerns are summarized. It was found that radiolysis of pure water in a closed volume results in minimal, if any net decomposition, and therefore reduces the potential for shield pressurization and corrosion.

  9. Cryogenic method for measuring nuclides and fission gases

    DOE Patents [OSTI]

    Perdue, P.T.; Haywood, F.F.

    1980-05-02

    A cryogenic method is provided for determining airborne gases and particulates from which gamma rays are emitted. A special dewar counting vessel is filled with the contents of the sampling flask which is immersed in liquid nitrogen. A vertically placed sodium-iodide or germanium-lithium gamma-ray detector is used. The device and method are of particular use in measuring and identifying the radioactive noble gases including emissions from coal-fired power plants, as well as fission gases released or escaping from nuclear power plants.

  10. NEET Micro-Pocket Fission Detector -- FY 2012 Status Report

    SciTech Connect (OSTI)

    Troy Unruh; Joy Rempe; Douglas McGregor; Philip Ugorowski; Michael Reichenberger

    2012-09-01

    A research program has been initiated by the NEET program for developing and testing compact miniature fission chambers capable of simultaneously measuring thermal neutron flux, fast neutron flux and temperature within a single package. When implemented, these sensors will significantly advance flux detection capabilities for irradiation tests in US Materials Test Reactors (MTRs).Ultimately, evaluations may lead to a more compact, more accurate, and longer lifetime flux sensor for critical mock-ups, high performance reactors and commercial nuclear power plants. Deployment of Micro-Pocket Fission Detectors (MPFDs) in US DOE-NE program irradiation tests will address several challenges: Current fission chamber technologies do not offer the ability to measure fast flux, thermal flux and temperature within a single compact probe, MPFDs offer this option. MPFD construction is very different then current fission chamber construction; the use of high temperature materials allow MPFDs to be specifically tailored to survive harsh conditions in typical high performance MTR irradiation tests. New high-fidelity reactor physics codes will need a small, accurate, multipurpose in-core sensor to validate the codes without perturbing the validation experiment; MPFDs fill this requirement. MPFDs can be built with variable sensitivities to survive the lifetime of an experiment or fuel assembly in some MTRs; allowing for more efficient and cost effective power monitoring. The small size of the MPFDs allows multiple sensors to be simultaneously deployed; obtaining data required to visualize the reactor flux and temperature profiles. This report summarizes the research progress for year 1 of this 3 year project. An updated design of the MPFD has been developed, materials and tools to support the new design have been procured, construction methods to support the new design have been initiated at INL’s HTTL and KSU’s SMART Laboratory, plating methods are being updated at KSU, new

  11. Fission meter and neutron detection using poisson distribution comparison

    DOE Patents [OSTI]

    Rowland, Mark S; Snyderman, Neal J

    2014-11-18

    A neutron detector system and method for discriminating fissile material from non-fissile material wherein a digital data acquisition unit collects data at high rate, and in real-time processes large volumes of data directly into information that a first responder can use to discriminate materials. The system comprises counting neutrons from the unknown source and detecting excess grouped neutrons to identify fission in the unknown source. Comparison of the observed neutron count distribution with a Poisson distribution is performed to distinguish fissile material from non-fissile material.

  12. Uncertainty quantification in fission cross section measurements at LANSCE

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Tovesson, F.

    2015-01-09

    Neutron-induced fission cross sections have been measured for several isotopes of uranium and plutonium at the Los Alamos Neutron Science Center (LANSCE) over a wide range of incident neutron energies. The total uncertainties in these measurements are in the range 3–5% above 100 keV of incident neutron energy, which results from uncertainties in the target, neutron source, and detector system. The individual sources of uncertainties are assumed to be uncorrelated, however correlation in the cross section across neutron energy bins are considered. The quantification of the uncertainty contributions will be described here.

  13. NEET Micro-Pocket Fission Detector. Final Project report

    SciTech Connect (OSTI)

    Unruh, T.; Rempe, Joy; McGregor, Douglas; Ugorowski, Philip; Reichenberger, Michael; Ito, Takashi; Villard, J.-F.

    2014-09-01

    A collaboration between the Idaho National Laboratory (INL), the Kansas State University (KSU), and the French Alternative Energies and Atomic Energy Commission, Commissariat à l'Énergie Atomique et aux Energies Alternatives, (CEA), is funded by the Nuclear Energy Enabling Technologies (NEET) program to develop and test Micro-Pocket Fission Detectors (MPFDs), which are compact fission chambers capable of simultaneously measuring thermal neutron flux, fast neutron flux and temperature within a single package. When deployed, these sensors will significantly advance flux detection capabilities for irradiation tests in US Material Test Reactors (MTRs). Ultimately, evaluations may lead to a more compact, more accurate, and longer lifetime flux sensor for critical mock-ups, and high performance reactors, allowing several Department of Energy Office of Nuclear Energy (DOE-NE) programs to obtain higher accuracy/higher resolution data from irradiation tests of candidate new fuels and materials. Specifically, deployment of MPFDs will address several challenges faced in irradiations performed at MTRs: Current fission chamber technologies do not offer the ability to measure fast flux, thermal flux and temperature within a single compact probe; MPFDs offer this option. MPFD construction is very different than current fission chamber construction; the use of high temperature materials allow MPFDs to be specifically tailored to survive harsh conditions encountered in-core of high performance MTRs. The higher accuracy, high fidelity data available from the compact MPFD will significantly enhance efforts to validate new high-fidelity reactor physics codes and new multi-scale, multi-physics codes. MPFDs can be built with variable sensitivities to survive the lifetime of an experiment or fuel assembly in some MTRs, allowing for more efficient and cost effective power monitoring. The small size of the MPFDs allows multiple sensors to be deployed, offering the potential to accurately

  14. April 2013 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information April 2013 Most Viewed Documents for Fission And Nuclear Technologies Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (null) 298 Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (null) 292 Graphite design handbook Ho, F.H. (1988) 216 System Definition and Analysis: Power Plant Design and Layout NONE

  15. January 2013 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information January 2013 Most Viewed Documents for Fission And Nuclear Technologies Laboratory studies of shear/leach processing of zircaloy clad metallic uranium reactor fuel Swanson, J.L.; Bray, L.A.; Kjarmo, H.E.; Ryan, J.L.; Matsuzaki, C.L.; Pitman, S.G.; Haberman, J.H. Working session 3: Tubing integrity Cueto-Felgueroso, C. [Tecnatom, S.A., San Sebastian de los Reyes, Madrid (Spain)]; Strosnider, J. [NRC, Washington, DC (United

  16. July 2013 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information July 2013 Most Viewed Documents for Fission And Nuclear Technologies Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 286 Graphite design handbook Ho, F.H. (1988) 136 Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 123 Stress analysis and evaluation of a rectangular pressure vessel. [For

  17. June 2014 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information June 2014 Most Viewed Documents for Fission And Nuclear Technologies Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 78 Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 71 Review of thorium fuel reprocessing experience Brooksbank, R.E.; McDuffee, W.T.; Rainey, R.H. (1978) 70 Stress

  18. March 2014 Most Viewed Documents for Fission And Nuclear Technologies |

    Office of Scientific and Technical Information (OSTI)

    OSTI, US Dept of Energy Office of Scientific and Technical Information 4 Most Viewed Documents for Fission And Nuclear Technologies Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 72 Peer-review study of the draft handbook for human-reliability analysis with emphasis on nuclear-power-plant applications, NUREG/CR-1278 Brune, R.L.; Weinstein, M.; Fitzwater, M.E. (1983) 67 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling

  19. Most Viewed Documents for Fission And Nuclear Technologies: September 2014

    Office of Scientific and Technical Information (OSTI)

    | OSTI, US Dept of Energy Office of Scientific and Technical Information for Fission And Nuclear Technologies: September 2014 Estimation of gas leak rates through very small orifices and channels. [From sealed PuO/sub 2/ containers under accident conditions] Bomelburg, H.J. (1977) 71 Behavior of spent nuclear fuel in water pool storage Johnson, A.B. Jr. (1977) 68 Stress analysis and evaluation of a rectangular pressure vessel. [For equipment for sampling Hanford tank radwaste] Rezvani, M.A.;

  20. Dynamical simulation of energy dissipation in asymmetric heavy-ion induced fission of {sup 200}Pb, {sup 213}Fr, and {sup 251}Es

    SciTech Connect (OSTI)

    Mirfathi, S. M.; Pahlavani, M. R.

    2008-12-15

    The dynamical model based on the asymmetric mass division has been applied to calculate pre-scission neutron multiplicity from heavy-ion induced fusion-fission reactions. Links between the pre-scission neutron multiplicity, excitation energy, and asymmetric mass distribution are clarified based on the Monte Carlo simulation and Langevin dynamics. The pre-scission neutron multiplicity is calculated and compared with the respective experimental data over a wide range of excitation energy and nonconstant viscosity. The analysis indicates a different effect for the application of asymmetric mass division in different energy regions of such processes.

  1. An innovative acoustic sensor for first in-pile fission gas release determination - REMORA 3 experiment

    SciTech Connect (OSTI)

    Rosenkrantz, E.; Ferrandis, J. Y.; Augereau, F.; Lambert, T.; Fourmentel, D.; Tiratay, X.

    2011-07-01

    A fuel rod has been instrumented with a new design of an acoustic resonator used to measure in a non destructive way the internal rod plenum gas mixture composition. This ultrasonic sensor has demonstrated its ability to operate in pile during REMORA 3 irradiation experiment carried out in the OSIRIS Material Testing Reactor (CEA Saclay, France). Due to very severe experimental conditions such as temperature rising up to 150 deg.C and especially, high thermal fluence level up to 3.5 10{sup 19} n.cm{sup 2}, the initial sensor gas speed of sound efficiency measurement was strongly reduced due to the irradiation effects on the piezo-ceramic properties. Nevertheless, by adding a differential signal processing method to the initial data analysis procedure validated before irradiation, the gas resonance peaks were successfully extracted from the output signal. From these data, the molar fractions variations of helium and fission gas were measured from an adapted Virial state equation. Thus, with this sensor, the kinetics of gas release inside fuel rods could be deduced from the in-pile measurements and specific calculations. These data will also give information about nuclear reaction effect on piezo-ceramics sensor under high neutron and gamma flux. (authors)

  2. (COMEDIE program review and fission product transport in MHTGR reactor)

    SciTech Connect (OSTI)

    Stansfield, O.M.

    1990-03-15

    The subcontract between Martin Marietta Energy Systems, Inc., and the CEA provides for the refurbishment of the high pressure COMEDIE test loop in the SILOE reactor and a series of experiments to characterize fission product lift-off from MHTGR heat exchanger surfaces under several depressurization accident scenarios. The data will contribute to the validation of models and codes used to predict fission product transport in the MHTGR. In the meeting at CEA headquarters in Paris the program schedule and preparation for the DCAA and Quality Assurance audits were discussed. Long-range interest in expanded participation in the gas-cooled reactor technology Umbrella Agreement was also expressed by the CEA. At the CENG, in Grenoble, technical details on the loop design, fabrication components, development of test procedures, and preparation for the DOE quality assurance (QA) audit in May were discussed. After significant delays in CY 1989 it appears that good progress is being made in CY 1990 and the first major test will be initiated by December. An extensive list of agreements and commitments was generated to facilitate the coordination and planning of future work. 2 figs., 2 tabs.

  3. Microfluidic chemical reaction circuits

    DOE Patents [OSTI]

    Lee, Chung-cheng; Sui, Guodong; Elizarov, Arkadij; Kolb, Hartmuth C.; Huang, Jiang; Heath, James R.; Phelps, Michael E.; Quake, Stephen R.; Tseng, Hsian-rong; Wyatt, Paul; Daridon, Antoine

    2012-06-26

    New microfluidic devices, useful for carrying out chemical reactions, are provided. The devices are adapted for on-chip solvent exchange, chemical processes requiring multiple chemical reactions, and rapid concentration of reagents.

  4. Quantum and Thermodynamic Properties of Spontaneous and Low-Energy Induced Fission of Nuclei

    SciTech Connect (OSTI)

    Kadmensky, S.G. [Voronezh State University, Universitetskaya pl. 1, Voronezh, 394693 (Russian Federation)

    2005-12-01

    It is shown that A. Bohr's concept of transition fission states can be matched with the properties of Coriolis interaction if an axisymmetric fissile nucleus near the scission point remains cold despite a nonadiabatic character of nuclear collective deformation motion. The quantum and thermodynamic properties of various stages of binary and ternary fission after the descent of a fissile nucleus from the outer saddle point are studied within quantum-mechanical fission theory. It is shown that two-particle nucleon-nucleon correlations--in particular, superfluid correlations--play an important role in the formation of fission products and in the classification of fission transitions. The distributions of thermalized primary fission fragments with respect to spins and their projections onto the symmetry axis of the fissile nucleus and fission fragments are constructed, these distributions determining the properties of prompt neutrons and gamma rays emitted by these fragments. A new nonevaporation mechanism of third-particle production in ternary fission is proposed. This mechanism involves transitions of third particles from the cluster states of the fissile-nucleus neck to high-energy states under effects of the shake-off type that are due to the nonadiabatic character of nuclear collective deformation motion.

  5. Dispersion of the Neutron Emission in U{sup 235} Fission

    DOE R&D Accomplishments [OSTI]

    Feynman, R. P.; de Hoffmann, F.; Serber, R.

    1955-01-01

    Equations are developed which allow the calculation of the average number of neutrons per U{sup235} fission from experimental measurements. Experimental methods are described, the results of which give a value of (7.8 + 0.6){sup ½} neutrons per U{sup 235} thermal fission.

  6. Report on Fission Time Projection Chamber M3FT-12IN0210052

    SciTech Connect (OSTI)

    James K. Jewell

    2012-08-01

    The Time Projection Chamber is a collaborative effort to implement an innovative approach and deliver unprecedented fission measurements to DOE programs. This 4?-detector system will provide unrivaled 3-D data about the fission process. Shown here is a half populated TPC (2?) at the LLNL TPC laboratory as it undergoes testing before being shipped to LANSCE for beam experiments.

  7. SEPARATION OF URANIUM, PLUTONIUM AND FISSION PRODUCTS FROM NEUTRON- BOMBARDED URANIUM

    DOE Patents [OSTI]

    Martin, A.E.; Johnson, I.; Burris, L. Jr.; Winsch, I.O.; Feder, H.M.

    1962-11-13

    A process is given for removing plutonium and/or fission products from uranium fuel. The fuel is dissolved in molten zinc--magnesium (10 to 18% Mg) alloy, more magnesium is added to obtain eutectic composition whereby uranium precipitates, and the uranium are separated from the Plutoniumand fission-product- containing eutectic. (AEC)

  8. Measuring Cross-Section and Estimating Uncertainties with the fissionTPC

    SciTech Connect (OSTI)

    Bowden, N.; Manning, B.; Sangiorgio, S.; Seilhan, B.

    2015-01-30

    The purpose of this document is to outline the prescription for measuring fission cross-sections with the NIFFTE fissionTPC and estimating the associated uncertainties. As such it will serve as a work planning guide for NIFFTE collaboration members and facilitate clear communication of the procedures used to the broader community.

  9. SPEAR-BETA fuel-performance code system: fission-gas-release module. Final report. [PWR; BWR

    SciTech Connect (OSTI)

    Christensen, R.

    1983-03-01

    The original SPEAR-BETA general description manual covers both mechanistic and statistical models for fuel reliability, but only mechanistic modeling of fission gas release. This addendum covers the SPEAR-BETA statistical model for fission gas release.

  10. Reaction coordinates for electron transfer reactions

    SciTech Connect (OSTI)

    Rasaiah, Jayendran C.; Zhu Jianjun

    2008-12-07

    The polarization fluctuation and energy gap formulations of the reaction coordinate for outer sphere electron transfer are linearly related to the constant energy constraint Lagrangian multiplier m in Marcus' theory of electron transfer. The quadratic dependence of the free energies of the reactant and product intermediates on m and m+1, respectively, leads to similar dependence of the free energies on the reaction coordinates and to the same dependence of the activation energy on the reorganization energy and the standard reaction free energy. Within the approximations of a continuum model of the solvent and linear response of the longitudinal polarization to the electric field in Marcus' theory, both formulations of the reaction coordinate are expected to lead to the same results.

  11. Angular distribution of products of ternary nuclear fission induced by cold polarized neutrons

    SciTech Connect (OSTI)

    Bunakov, V. E. Kadmensky, S. G. Kadmensky, S. S.

    2008-11-15

    Within quantum fission theory, angular distributions of products originating from the ternary fission of nuclei that is induced by polarized cold and thermal neutrons are investigated on the basis of a non-evaporative mechanism of third-particle emission and a consistent description of fission-channel coupling. It is shown that the inclusion of Coriolis interaction both in the region of the discrete and in the region of the continuous spectrum of states of the system undergoing fission leads to T-odd correlations in the aforementioned angular distributions. The properties of the TRI and ROT effects discovered recently, which are due to the interference between the fission amplitudes of neutron resonances, are explored. The results obtained here are compared with their counterparts from classic calculations based on the trajectory method.

  12. Microscopic modeling of mass and charge distributions in the spontaneous fission of 240Pu

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sandhukhan, Jhilam; Nazarewicz, Witold; Schunck, Nicolas

    2016-01-20

    We propose a methodology to calculate microscopically the mass and charge distributions of spontaneous fission yields. We combine the multidimensional minimization of collective action for fission with stochastic Langevin dynamics to track the relevant fission paths from the ground-state configuration up to scission. The nuclear potential energy and collective inertia governing the tunneling motion are obtained with nuclear density functional theory in the collective space of shape deformations and pairing. As a result, we obtain a quantitative agreement with experimental data and find that both the charge and mass distributions in the spontaneous fission of 240Pu are sensitive both tomore » the dissipation in collective motion and to adiabatic fission characteristics.« less

  13. P-odd and P-even correlations for third particles in ternary fission

    SciTech Connect (OSTI)

    Bunakov, V. E., E-mail: bunakov@vb13190.spbu.edu; Kadmensky, S. G., E-mail: kadmensky@phys.vsu.ru; Titova, L. V. [Russian Academy of Sciences, Petersburg Nuclear Physics Institute (Russian Federation)

    2008-12-15

    Within quantum-mechanical fission theory, P-odd and P-even correlations in angular distributions of products of the ternary fission of nuclei that is induced by polarized cold and thermal neutrons are investigated on the basis of a nonevaporative mechanism of third-particle emission and under the assumption that a two-humped fission barrier exists. It is shown that these correlations for third particles are induced by the analogous correlations for ternary-fission fragments, the latter being transferred to the third particle because of the kinematical conditions of third-particle emission that are associated with the charge and mass asymmetry of fragments. Optimum methods for observing the above correlations for third particles are discussed. The possibility of discovering the emission of prescission neutrons in the fission process against the background of evaporated neutrons by means of studying P-odd and P-even correlations is explored.

  14. A Computer Program To Evaluate The Dynamic Fission Product Inventories in the Multiple Compartment System of PWR's.

    Energy Science and Technology Software Center (OSTI)

    1990-12-01

    Version 00 SACHET evaluates the dynamic fission (FP) product inventories in the multiple compartment system of pressurized water reactor plants.

  15. Method for correcting for isotope burn-in effects in fission neutron dosimeters

    DOE Patents [OSTI]

    Gold, Raymond; McElroy, William N.

    1988-01-01

    A method is described for correcting for effect of isotope burn-in in fission neutron dosimeters. Two quantities are measured in order to quantify the "burn-in" contribution, namely P.sub.Z',A', the amount of (Z', A') isotope that is burned-in, and F.sub.Z', A', the fissions per unit volume produced in the (Z', A') isotope. To measure P.sub.Z', A', two solid state track recorder fission deposits are prepared from the very same material that comprises the fission neutron dosimeter, and the mass and mass density are measured. One of these deposits is exposed along with the fission neutron dosimeter, whereas the second deposit is subsequently used for observation of background. P.sub.Z', A' is then determined by conducting a second irradiation, wherein both the irradiated and unirradiated fission deposits are used in solid state track recorder dosimeters for observation of the absolute number of fissions per unit volume. The difference between the latter determines P.sub.Z', A' since the thermal neutron cross section is known. F.sub.Z', A' is obtained by using a fission neutron dosimeter for this specific isotope, which is exposed along with the original threshold fission neutron dosimeter to experience the same neutron flux-time history at the same location. In order to determine the fissions per unit volume produced in the isotope (Z', A') as it ingrows during the irradiation, B.sub.Z', A', from these observations, the neutron field must generally be either time independent or a separable function of time t and neutron energy E.

  16. Microscopic Theory of Fission Younes, W; Gogny, D 73 NUCLEAR...

    Office of Scientific and Technical Information (OSTI)

    Conference Conference: Presented at: Compound Nuclear Reactions and Related Topics, Fish Camp, CA, United States, Oct 22 - Oct 26, 2007 Medium: ED; Size: PDF-file: 6 pages;...

  17. Microscopic Theory of Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    Resource Relation: Conference: Presented at: Compound Nuclear Reactions and Related Topics, Fish Camp, CA, United States, Oct 22 - Oct 26, 2007 Research Org: Lawrence Livermore ...

  18. Investigation of inconsistent ENDF/B-VII.1 independent and cumulative fission product yields with proposed revisions

    SciTech Connect (OSTI)

    Pigni, Marco T; Francis, Matthew W; Gauld, Ian C

    2015-01-01

    A recent implementation of ENDF/B-VII. independent fission product yields and nuclear decay data identified inconsistencies in the data caused by the use of updated nuclear scheme in the decay sub-library that is not reflected in legacy fission product yield data. Recent changes in the decay data sub-library, particularly the delayed neutron branching fractions, result in calculated fission product concentrations that are incompatible with the cumulative fission yields in the library, and also with experimental measurements. A comprehensive set of independent fission product yields was generated for thermal and fission spectrum neutron induced fission for 235,238U and 239,241Pu in order to provide a preliminary assessment of the updated fission product yield data consistency. These updated independent fission product yields were utilized in the ORIGEN code to evaluate the calculated fission product inventories with experimentally measured inventories, with particular attention given to the noble gases. An important outcome of this work is the development of fission product yield covariance data necessary for fission product uncertainty quantification. The evaluation methodology combines a sequential Bayesian method to guarantee consistency between independent and cumulative yields along with the physical constraints on the independent yields. This work was motivated to improve the performance of the ENDF/B-VII.1 library in the case of stable and long-lived cumulative yields due to the inconsistency of ENDF/B-VII.1 fission p;roduct yield and decay data sub-libraries. The revised fission product yields and the new covariance data are proposed as a revision to the fission yield data currently in ENDF/B-VII.1.

  19. Investigation of inconsistent ENDF/B-VII.1 independent and cumulative fission product yields with proposed revisions

    SciTech Connect (OSTI)

    Pigni, Marco T; Francis, Matthew W; Gauld, Ian C

    2015-01-01

    A recent implementation of ENDF/B-VII. independent fission product yields and nuclear decay data identified inconsistencies in the data caused by the use of updated nuclear scheme in the decay sub-library that is not reflected in legacy fission product yield data. Recent changes in the decay data sub-library, particularly the delayed neutron branching fractions, result in calculated fission product concentrations that are incompatible with the cumulative fission yields in the library, and also with experimental measurements. A comprehensive set of independent fission product yields was generated for thermal and fission spectrum neutron induced fission for 235,238U and 239,241Pu in order to provide a preliminary assessment of the updated fission product yield data consistency. These updated independent fission product yields were utilized in the ORIGEN code to evaluate the calculated fission product inventories with experimentally measured inventories, with particular attention given to the noble gases. An important outcome of this work is the development of fission product yield covariance data necessary for fission product uncertainty quantification. The evaluation methodology combines a sequential Bayesian method to guarantee consistency between independent and cumulative yields along with the physical constraints on the independent yields. This work was motivated to improve the performance of the ENDF/B-VII.1 library in the case of stable and long-lived cumulative yields due to the inconsistency of ENDF/B-VII.1 fission p;roduct yield and decay data sub-libraries. The revised fission product yields and the new covariance data are proposed as a revision to the fission yield data currently in ENDF/B-VII.1.

  20. SEPARATION OF PLUTONIUM VALUES FROM URANIUM AND FISSION PRODUCT VALUES

    DOE Patents [OSTI]

    Maddock, A.G.; Booth, A.H.

    1960-09-13

    Separation of plutonium present in small amounts from neutron irradiated uranium by making use of the phenomenon of chemisorption is described. Plutonium in the tetravalent state is chemically absorbed on a fluoride in solid form. The steps for the separation comprise dissolving the irradiated uranium in nitric acid, oxidizing the plutonium in the resulting solution to the hexavalent state, adding to the solution a soluble calcium salt which by the common ion effect inhibits dissolution of the fluoride by the solution, passing the solution through a bed or column of subdivided calcium fluoride which has been sintered to about 8OO deg C to remove the chemisorbable fission products, reducing the plutonium in the solution thus obtained to the tetravalent state, and again passing the solution through a similar bed or column of calcium fluoride to selectively absorb the plutonium, which may then be recovered by treating the calcium fluoride with a solution of ammonium oxalate.

  1. Gamma-ray Output Spectra from 239 Pu Fission

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ullmann, John

    2015-05-25

    Gamma-ray multiplicities, individual gamma-ray energy spectra, and total gamma energy spectra following neutron-induced fission of 239Pu were measured using the DANCE detector at Los Alamos. Corrections for detector response were made using a forward-modeling technique based on propagating sets of gamma rays generated from a paramaterized model through a GEANT model of the DANCE array and adjusting the parameters for best fit to the measured spectra. The results for the gamma-ray spectrum and multiplicity are in general agreement with previous results, but the measured total gamma-ray energy is about 10% higher. A dependence of the gamma-ray spectrum on the gamma-raymore » multplicity was also observed. Global model calculations of the multiplicity and gamma energy distributions are in good agreement with the data, but predict a slightly softer total-energy distribution.« less

  2. Table of superdeformed nuclear bands and fission isomers

    SciTech Connect (OSTI)

    Firestone, R.B.; Singh, B.

    1994-06-01

    A minimum in the second potential well of deformed nuclei was predicted and the associated shell gaps are illustrated in the harmonic oscillator potential shell energy surface calculations shown in this report. A strong superdeformed minimum in {sup 152}Dy was predicted for {beta}{sub 2}-0.65. Subsequently, a discrete set of {gamma}-ray transitions in {sup 152}DY was observed and, assigned to the predicted superdeformed band. Extensive research at several laboratories has since focused on searching for other mass regions of large deformation. A new generation of {gamma}-ray detector arrays is already producing a wealth of information about the mechanisms for feeding and deexciting superdeformed bands. These bands have been found in three distinct regions near A=l30, 150, and 190. This research extends upon previous work in the actinide region near A=240 where fission isomers were identified and also associated with the second potential well. Quadrupole moment measurements for selected cases in each mass region are consistent with assigning the bands to excitations in the second local minimum. As part of our committment to maintain nuclear structure data as current as possible in the Evaluated Nuclear Structure Reference File (ENSDF) and the Table of Isotopes, we have updated the information on superdeformed nuclear bands. As of April 1994, we have complied data from 86 superdeformed bands and 46 fission isomers identified in 73 nuclides for this report. For each nuclide there is a complete level table listing both normal and superdeformed band assignments; level energy, spin, parity, half-life, magneto moments, decay branchings; and the energies, final levels, relative intensities, multipolarities, and mixing ratios for transitions deexciting each level. Mass excess, decay energies, and proton and neutron separation energies are also provided from the evaluation of Audi and Wapstra.

  3. Uncertainty and sensitivity analysis of fission gas behavior in engineering-scale fuel modeling

    SciTech Connect (OSTI)

    Pastore, Giovanni; Swiler, L. P.; Hales, Jason D.; Novascone, Stephen R.; Perez, Danielle M.; Spencer, Benjamin W.; Luzzi, Lelio; Uffelen, Paul Van; Williamson, Richard L.

    2014-10-12

    The role of uncertainties in fission gas behavior calculations as part of engineering-scale nuclear fuel modeling is investigated using the BISON fuel performance code and a recently implemented physics-based model for the coupled fission gas release and swelling. Through the integration of BISON with the DAKOTA software, a sensitivity analysis of the results to selected model parameters is carried out based on UO2 single-pellet simulations covering different power regimes. The parameters are varied within ranges representative of the relative uncertainties and consistent with the information from the open literature. The study leads to an initial quantitative assessment of the uncertainty in fission gas behavior modeling with the parameter characterization presently available. Also, the relative importance of the single parameters is evaluated. Moreover, a sensitivity analysis is carried out based on simulations of a fuel rod irradiation experiment, pointing out a significant impact of the considered uncertainties on the calculated fission gas release and cladding diametral strain. The results of the study indicate that the commonly accepted deviation between calculated and measured fission gas release by a factor of 2 approximately corresponds to the inherent modeling uncertainty at high fission gas release. Nevertheless, higher deviations may be expected for values around 10% and lower. Implications are discussed in terms of directions of research for the improved modeling of fission gas behavior for engineering purposes.

  4. Uncertainty and sensitivity analysis of fission gas behavior in engineering-scale fuel modeling

    SciTech Connect (OSTI)

    G. Pastore; L.P. Swiler; J.D. Hales; S.R. Novascone; D.M. Perez; B.W. Spencer; L. Luzzi; P. Van Uffelen; R.L. Williamson

    2014-10-01

    The role of uncertainties in fission gas behavior calculations as part of engineering-scale nuclear fuel modeling is investigated using the BISON fuel performance code and a recently implemented physics-based model for the coupled fission gas release and swelling. Through the integration of BISON with the DAKOTA software, a sensitivity analysis of the results to selected model parameters is carried out based on UO2 single-pellet simulations covering different power regimes. The parameters are varied within ranges representative of the relative uncertainties and consistent with the information from the open literature. The study leads to an initial quantitative assessment of the uncertainty in fission gas behavior modeling with the parameter characterization presently available. Also, the relative importance of the single parameters is evaluated. Moreover, a sensitivity analysis is carried out based on simulations of a fuel rod irradiation experiment, pointing out a significant impact of the considered uncertainties on the calculated fission gas release and cladding diametral strain. The results of the study indicate that the commonly accepted deviation between calculated and measured fission gas release by a factor of 2 approximately corresponds to the inherent modeling uncertainty at high fission gas release. Nevertheless, higher deviations may be expected for values around 10% and lower. Implications are discussed in terms of directions of research for the improved modeling of fission gas behavior for engineering purposes.

  5. Uncertainty and sensitivity analysis of fission gas behavior in engineering-scale fuel modeling

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Pastore, Giovanni; Swiler, L. P.; Hales, Jason D.; Novascone, Stephen R.; Perez, Danielle M.; Spencer, Benjamin W.; Luzzi, Lelio; Uffelen, Paul Van; Williamson, Richard L.

    2014-10-12

    The role of uncertainties in fission gas behavior calculations as part of engineering-scale nuclear fuel modeling is investigated using the BISON fuel performance code and a recently implemented physics-based model for the coupled fission gas release and swelling. Through the integration of BISON with the DAKOTA software, a sensitivity analysis of the results to selected model parameters is carried out based on UO2 single-pellet simulations covering different power regimes. The parameters are varied within ranges representative of the relative uncertainties and consistent with the information from the open literature. The study leads to an initial quantitative assessment of the uncertaintymore » in fission gas behavior modeling with the parameter characterization presently available. Also, the relative importance of the single parameters is evaluated. Moreover, a sensitivity analysis is carried out based on simulations of a fuel rod irradiation experiment, pointing out a significant impact of the considered uncertainties on the calculated fission gas release and cladding diametral strain. The results of the study indicate that the commonly accepted deviation between calculated and measured fission gas release by a factor of 2 approximately corresponds to the inherent modeling uncertainty at high fission gas release. Nevertheless, higher deviations may be expected for values around 10% and lower. Implications are discussed in terms of directions of research for the improved modeling of fission gas behavior for engineering purposes.« less

  6. Rapid disappearance of shell effects in the fission of transfermium nuclei

    SciTech Connect (OSTI)

    Hulet, E.K.

    1983-01-01

    In the last fifteen years we have learned that nuclear shells have a very broad and pervasive impact on the fission process. In the first few decades after the discovery of nuclear fission, the nucleus was treated as a drop of liquid with smoothly varying attractive and repulsive forces. Although this model still forms the underlying basis for fission, we also observe large effects from the superimposition of shell corrections derived from coupling the quantum states of individual nucleons. The consequences of single-particle coupling on the fission process can be striking and may often overshadow that originating from the intrinsic liquid-drop component. Here, we point out several major features attributable to shell effects in the spontaneous fission (SF) of the lighter actinides, the sudden transition to symmetric fission in the fermium isotopes, and finally new experimental information indicating another transition in the SF of transfermium nuclides due to the disappearance of shell perturbations. In each transition, the abruptness is surprising, and for the moment, such rapid changes in fission behavior lack a theoretical rationale.

  7. Resonant thermonuclear reaction rate

    SciTech Connect (OSTI)

    Haubold, H.J.; Mathai, A.M.

    1986-08-01

    Basic physical principles for the resonant and nonresonant thermonuclear reaction rates are applied to find their standard representations for nuclear astrophysics. Closed-form representations for the resonant reaction rate are derived in terms of Meijer's G-italic-function. Analytic representations of the resonant and nonresonant nuclear reaction rates are compared and the appearance of Meijer's G-italic-function is discussed in physical terms.

  8. Determination of {sup 140}La fission product interference factor for INAA

    SciTech Connect (OSTI)

    Ribeiro Jr, Iber S.; Genezini, Frederico A.; Saiki, Mitiko; Zahn, Guilherme S.

    2014-11-11

    Instrumental Neutron Activation Analysis (INAA) is a technique widely used to determine the concentration of several elements in several kinds of matrices. However if the sample of interest has higher relative uranium concentration the obtained results can be interfered by the uranium fission products. One of these cases that is affected by interference due to U fission is the {sup 140}La, because this radioisotope used in INAA for the determination of concentration the La is also produced by the {sup ?}? of {sup 140}Ba, an uranium fission product. The {sup 140}La interference factor was studied in this work and a factor to describe its time dependence was obtained.

  9. SEPARATION OF PLUTONIUM FROM FISSION PRODUCTS BY A COLLOID REMOVAL PROCESS

    DOE Patents [OSTI]

    Schubert, J.

    1960-05-24

    A method is given for separating plutonium from uranium fission products. An acidic aqueous solution containing plutonium and uranium fission products is subjected to a process for separating ionic values from colloidal matter suspended therein while the pH of the solution is maintained between 0 and 4. Certain of the fission products, and in particular, zirconium, niobium, lanthanum, and barium are in a colloidal state within this pH range, while plutonium remains in an ionic form, Dialysis, ultracontrifugation, and ultrafiltration are suitable methods of separating plutonium ions from the colloids.

  10. Background and Derivation of ANS-5.4 Standard Fission Product Release Model

    SciTech Connect (OSTI)

    Beyer, Carl E.; Turnbull, Andrew J.

    2010-01-29

    This background report describes the technical basis for the newly proposed American Nuclear Society (ANS) 5.4 standard, Methods for Calculating the Fractional Release of Volatile Fission Products from Oxide Fuels. The proposed ANS 5.4 standard provides a methodology for determining the radioactive fission product releases from the fuel for use in assessing radiological consequences of postulated accidents that do not involve abrupt power transients. When coupled with isotopic yields, this method establishes the 'gap activity,' which is the inventory of volatile fission products that are released from the fuel rod if the cladding are breached.

  11. Radiological Aspects of Deep-Burn Fusion-Fission Hybrid Waste in a Repository

    SciTech Connect (OSTI)

    Shaw, H F; Blink, J A; Farmer, J C; Karmer, K J; Latkowski, J F; Zhao, P

    2008-11-25

    The quantity, radioactivity, and isotopic characteristics of the spent fission fuel from a hybrid fusion-fission system capable of extremely high burnups are described. The waste generally has higher activity per unit mass of heavy metal, but much lower activity per unit energy generated. The very long-term radioactivity is dominated by fission products. Simple scaling calculations suggest that the dose from a repository containing such waste would be dominated by {sup 129}I, {sup 135}Cs, and {sup 242}Pu. Use of such a system for generating energy would greatly reduce the need for repository capacity.

  12. Detecting special nuclear materials in containers using high-energy gamma rays emitted by fission products

    DOE Patents [OSTI]

    Norman, Eric B.; Prussin, Stanley G.

    2007-10-02

    A method and a system for detecting the presence of special nuclear materials in a container. The system and its method include irradiating the container with an energetic beam, so as to induce a fission in the special nuclear materials, detecting the gamma rays that are emitted from the fission products formed by the fission, to produce a detector signal, comparing the detector signal with a threshold value to form a comparison, and detecting the presence of the special nuclear materials using the comparison.

  13. Origin of the narrow, single peak in the fission-fragment mass distribution

    Office of Scientific and Technical Information (OSTI)

    for 258Fm (Journal Article) | SciTech Connect Origin of the narrow, single peak in the fission-fragment mass distribution for 258Fm Citation Details In-Document Search Title: Origin of the narrow, single peak in the fission-fragment mass distribution for 258Fm We discuss the origin of the narrowness of the single peak at mass-symmetric division in the fragment mass-yield curve for spontaneous fission of {sup 258}Fm. For this purpose, we employ the macroscopic-microscopic model and calculate

  14. Analysis of the GSI A+p and A+A spallation, fission, and fragmentation measurements with the LANL CEMsk and LAQGSM codes

    SciTech Connect (OSTI)

    Mashnik, S. G.; Gudima, K. K.; Prael, R. E.; Sierk, A. J.

    2004-01-01

    The CEM2k and LAQGSM codes have been recently developed at Los Alamos National Laboratory to simulate nuclear reactions induced by particles and nuclei for a number of applications. They have benchmarked our codes against most available measured data at projectile energies from 10 MeV/A to 800 GeV/A and have compared their results with predictions of other current models used by the nuclear community. Here, they present a brief description of their codes and show illustrative results obtained with CEM2k and LAQGSM for A+p and A+A spallation, fission, and fragmentation reactions measured recently at GSI compared with predictions by other models. Further necessary work is outlined.

  15. Continuous chain bit with downhole cycling capability

    DOE Patents [OSTI]

    Ritter, Don F.; St. Clair, Jack A.; Togami, Henry K.

    1983-01-01

    A continuous chain bit for hard rock drilling is capable of downhole cycling. A drill head assembly moves axially relative to a support body while the chain on the head assembly is held in position so that the bodily movement of the chain cycles the chain to present new composite links for drilling. A pair of spring fingers on opposite sides of the chain hold the chain against movement. The chain is held in tension by a spring-biased tensioning bar. A head at the working end of the chain supports the working links. The chain is centered by a reversing pawl and piston actuated by the pressure of the drilling mud. Detent pins lock the head assembly with respect to the support body and are also operated by the drilling mud pressure. A restricted nozzle with a divergent outlet sprays drilling mud into the cavity to remove debris. Indication of the centered position of the chain is provided by noting a low pressure reading indicating proper alignment of drilling mud slots on the links with the corresponding feed branches.

  16. Studies of Neutron-Deficient Nuclei Near the Z = 82 Shell Closure via Cold Fusion Reactions

    SciTech Connect (OSTI)

    Carpenter, M. P.; Kondev, F. G.; Janssens, R. V. F.; Seweryniak, D.; Khoo, T. L.; Lauritsen, T.; Lister, C. J.; Zhu, S.; Camera, F.; Bracco, A.; Million, B.; Leoni, S.; Jenkins, D. G.; Wadsworth, R.

    2009-03-04

    Over the last decade, we have performed in-beam experiments using Gammasphere+FMA to measure excited states in proton-rich Au, Hg, Tl and Pb isotopes. In these studies, the use of the FMA is essential in order to differentiate evaporation residues from the large fission background which dominates the reaction cross-section. In addition, we have found that using near-symmetric reactions at bombarding energies near the Coloumb barrier is beneficial in performing these studies. By keeping the bombarding energy low, fission is minimized and the reaction products are concentrated in only a few channels. New results have recently been obtained using the {sup 90}Zr+{sup 92}Mo reaction to study shape co-existence in {sup 181}Tl via the lp evaporation channel. In addition, we have measured the total {gamma}-ray energy and multiplicity associated with the surviving compound system, {sup 179}Au, following the fusion reaction, {sup 90}Zr+{sup 89}Y.

  17. Hydrogen evolution reaction catalyst

    DOE Patents [OSTI]

    Subbaraman, Ram; Stamenkovic, Vojislav; Markovic, Nenad; Tripkovic, Dusan

    2016-02-09

    Systems and methods for a hydrogen evolution reaction catalyst are provided. Electrode material includes a plurality of clusters. The electrode exhibits bifunctionality with respect to the hydrogen evolution reaction. The electrode with clusters exhibits improved performance with respect to the intrinsic material of the electrode absent the clusters.

  18. Induced fission of Pu240 within a real-time microscopic framework

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Bulgac, Aurel; Magierski, Piotr; Roche, Kenneth J.; Stetcu, Ionel

    2016-03-25

    Here, we describe the fissioning dynamics of 240Pu from a configuration in the proximity of the outer fission barrier to full scission and the formation of the fragments within an implementation of density functional theory extended to superfluid systems and real-time dynamics. The fission fragments emerge with properties similar to those determined experimentally, while the fission dynamics appears to be quite complex, with many excited shape and pairing modes. The evolution is found to be much slower than previously expected, and the ultimate role of the collective inertia is found to be negligible in this fully nonadiabatic treatment of nuclearmore » dynamics, where all collective degrees of freedom (CDOF) are included (unlike adiabatic treatments with a small number of CDOF).« less

  19. New Discoveries Bring us Closer to a Predictive Theory of Fission...

    Office of Scientific and Technical Information (OSTI)

    New Discoveries Bring us Closer to a Predictive Theory of Fission Citation Details ... Word Cloud More Like This Full Text preview image File size NAView Full Text View Full ...

  20. Origin of the narrow, single peak in the fission-fragment mass...

    Office of Scientific and Technical Information (OSTI)

    fission-fragment mass distribution for 258Fm We discuss ... obtained from the single-particle wave-function densities. ... Full Text preview image File size NAView Full Text View ...

  1. Energy Dependence of Fission Product Yields for 239Pu, 235U,...

    Office of Scientific and Technical Information (OSTI)

    Title: Energy Dependence of Fission Product Yields for 239Pu, 235U, and 238U Authors: Tornow, Werner 1 ; Bredeweg, Todd Allen 2 ; Wilhelmy, Jerry B. 2 ; Vieira, David J. 2 ...

  2. Fission yeast LAMMER kinase Lkh1 regulates the cell cycle by...

    Office of Scientific and Technical Information (OSTI)

    regulates the cell cycle by phosphorylating the CDK-inhibitor Rum1 Citation Details In-Document Search Title: Fission yeast LAMMER kinase Lkh1 regulates the cell cycle by ...

  3. /sup 3/He-induced fission of nuclei 159

    SciTech Connect (OSTI)

    Becchetti, F.D.; Hicks, K.H.; Fields, C.A.; Peterson, R.J.; Raymond, R.S.; Ristinen, R.A.; Ullmann, J.L.; Zaidins, C.S.

    1983-09-01

    The fission of nuclei with 159< or =A< or =232 induced by the bombardment of 19.1 to 44.5 MeV /sup 3/He ions has been measured using solid-state detectors with time-of-flight measurements. Analysis with statistical fission theory, including precompound nucleon emission, indicates fission barriers which decrease only slightly relative to the liquid-drop model values with decreasing Z, approaching about 90% of the liquid-drop model barrier for Aroughly-equal160. These results are in contrast with measurements at higher angular momenta which indicate much lower fission barriers (60 to 70 % of the liquid-drop model) for this mass region. The angular correlations indicate complete, or slightly greater than complete momentum transfer to the compound system. This is in opposition to that observed using heavier projectiles where incomplete momentum transfer is probable.

  4. The LANL C-NR counting room and fission product yields

    SciTech Connect (OSTI)

    Jackman, Kevin Richard

    2015-09-21

    This PowerPoint presentation focused on the following areas: LANL C-NR counting room; Fission product yields; Los Alamos Neutron wheel experiments; Recent experiments ad NCERC; and Post-detonation nuclear forensics

  5. Thermal stability of fission gas bubble superlattice in irradiated U10Mo fuel

    SciTech Connect (OSTI)

    Gan, J.; Keiser, D. D.; Miller, B. D.; Robinson, A. B.; Wachs, D. M.; Meyer, M. K.

    2015-09-01

    To investigate the thermal stability of the fission gas bubble superlattice, a key microstructural feature in both irradiated U-7Mo dispersion and U-10Mo monolithic fuel plates, a FIB-TEM sample of the irradiated U-10Mo fuel with a local fission density of 3.51021 fissions/cm3 was used for an in-situ heating TEM experiment. The temperature of the heating holder was raised at a ramp rate of approximately 10 C/min up to ~700 C, kept at that temperature for about 34 min, continued to 850 C with a reduced rate of 5 C/min. The result shows a high thermal stability of the fission gas bubble superlattice. The implication of this observation on the fuel microstructural evolution and performance under irradiation is discussed.

  6. Hybrid fusion-fission reactor with a thorium blanket: Its potential...

    Office of Scientific and Technical Information (OSTI)

    cycle of nuclear reactors Citation Details In-Document Search Title: Hybrid fusion-fission reactor with a thorium blanket: Its potential in the fuel cycle of nuclear reactors ...

  7. In the OSTI Collections: Fission Theory | OSTI, US Dept of Energy...

    Office of Scientific and Technical Information (OSTI)

    at least a rough way almost as soon as nuclear fission was discovered in 1938. An atom's ... In particular, if the nucleon travels along the nuclear surface, the attraction can keep ...

  8. Recent advances in nuclear fission theory: pre- and post-scission...

    Office of Scientific and Technical Information (OSTI)

    pre- and post-scission physics Citation Details In-Document Search Title: Recent advances in nuclear fission theory: pre- and post-scission physics You are accessing a ...

  9. ARSENATE CARRIER PRECIPITATION METHOD OF SEPARATING PLUTONIUM FROM NEUTRON IRRADIATED URANIUM AND RADIOACTIVE FISSION PRODUCTS

    DOE Patents [OSTI]

    Thompson, S.G.; Miller, D.R.; James, R.A.

    1961-06-20

    A process is described for precipitating Pu from an aqueous solution as the arsenate, either per se or on a bismuth arsenate carrier, whereby a separation from uranium and fission products, if present in solution, is accomplished.

  10. Molten salt considerations for accelerator-driven subcritical fission to close the nuclear fuel cycle

    SciTech Connect (OSTI)

    Sooby, Elizabeth; Baty, Austin; Gerity, James; McIntyre, Peter; Melconian, Karie; Pogue, Nathaniel; Sattarov, Akhdiyor; Adams, Marvin; Tsevkov, Pavel; Phongikaroon, Supathorn; Simpson, Michael; Tripathy, Prabhat

    2013-04-19

    The host salt selection, molecular modeling, physical chemistry, and processing chemistry are presented here for an accelerator-driven subcritical fission in a molten salt core (ADSMS). The core is fueled solely with the transuranics (TRU) and long-lived fission products (LFP) from used nuclear fuel. The neutronics and salt composition are optimized to destroy the transuranics by fission and the long-lived fission products by transmutation. The cores are driven by proton beams from a strong-focusing cyclotron stack. One such ADSMS system can destroy the transuranics in the used nuclear fuel produced by a 1GWe conventional reactor. It uniquely provides a method to close the nuclear fuel cycle for green nuclear energy.

  11. RARE-EARTH METAL FISSION PRODUCTS FROM LIQUID U-Bi

    DOE Patents [OSTI]

    Wiswall, R.H.

    1960-05-10

    Fission product metals can be removed from solution in liquid bismuth without removal of an appreciable quantity of uranium by contacting the liquid metal solution with fused halides, as for example, the halides of sodium, potassium, and lithium and by adding to the contacted phases a quantity of a halide which is unstable relative to the halides of the fission products, a specific unstable halide being MgCl/sub 3/.

  12. Hybrid Molten Salt Reactor (HMSR): Method and System to fully fission

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    actinides for electric power production without fuel enrichment, fabrication, or reprocessing | Princeton Plasma Physics Lab Hybrid Molten Salt Reactor (HMSR): Method and System to fully fission actinides for electric power production without fuel enrichment, fabrication, or reprocessing A method for integrating an external source of high-energy neutrons with a conventional moderated high conversion ratio molten salt reactor, thereby creating a self-contained hybrid system which fissions any

  13. In the OSTI Collections: Fission Theory | OSTI, US Dept of Energy Office of

    Office of Scientific and Technical Information (OSTI)

    Scientific and Technical Information Fission Theory How do atoms split Interest in the details Macroscopic-microscopic approaches Microscopic approaches Improved theory and design References Additional References Research Organizations Reports available from OSTI's Information Bridge How do atoms split? The main influences on the splitting of atoms were understood in at least a rough way almost as soon as nuclear fission was discovered in 1938. An atom's nucleus is composed of two kinds of

  14. Method for polymer synthesis in a reaction well

    DOE Patents [OSTI]

    Brennan, Thomas M.

    1998-01-01

    A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

  15. Method for polymer synthesis in a reaction well

    DOE Patents [OSTI]

    Brennan, T.M.

    1998-09-29

    A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

  16. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Print The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets,...

  17. Better Plants Supply Chain Pilot Overview

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    SUPPLY CHAIN PILOT Learn more at energy.goveereamobetter-plants The Department of ... Partners will receive aggregated year-end metrics that demonstrate the energy performance ...

  18. Manufacturing Competitiveness and Supply Chain Analysis | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    chain of the heating and cooling (e.g., magnetocaloric or thermoelectric solid state heat pump) technologies, but also gain understanding of manufacturing location decisions. ...

  19. Enhancing chemical reactions

    DOE Patents [OSTI]

    Morrey, John R.

    1978-01-01

    Methods of enhancing selected chemical reactions. The population of a selected high vibrational energy state of a reactant molecule is increased substantially above its population at thermal equilibrium by directing onto the molecule a beam of radiant energy from a laser having a combination of frequency and intensity selected to pump the selected energy state, and the reaction is carried out with the temperature, pressure, and concentrations of reactants maintained at a combination of values selected to optimize the reaction in preference to thermal degradation by transforming the absorbed energy into translational motion. The reaction temperature is selected to optimize the reaction. Typically a laser and a frequency doubler emit radiant energy at frequencies of .nu. and 2.nu. into an optical dye within an optical cavity capable of being tuned to a wanted frequency .delta. or a parametric oscillator comprising a non-centrosymmetric crystal having two indices of refraction, to emit radiant energy at the frequencies of .nu., 2.nu., and .delta. (and, with a parametric oscillator, also at 2.nu.-.delta.). Each unwanted frequency is filtered out, and each desired frequency is focused to the desired radiation flux within a reaction chamber and is reflected repeatedly through the chamber while reactants are fed into the chamber and reaction products are removed therefrom.

  20. Fission track analysis, rift shoulder uplift, and tectonic modeling of the Norwegian Continental Margin

    SciTech Connect (OSTI)

    Andriessen, P.; Van Der Beek, P.; Cloetingh, S.; Rohrman, M. )

    1993-09-01

    Apatite fission track analysis from southern Norway and Sweden, across the Permian Carboniferous Oslo rift, are presented and discussed in relation to different rifting scenarios. Vertical and horizontal apatite fission tack profiles in middle and southern Norway unravel the post-Carboniferous history of the Fennoscandian shield. Fission track apatite ages range from 240 Ma in the south to 160 Ma in the north, and according to spontaneous fission track length measurements, they must be interpreted as mixed ages, indicating minor amounts of Paleozoic-Mesozoic sedimentary cover. Apatite fission track length and age modeling suggest rapid cooling and uplift in the Tertiary for the southernmost part of Norway, suggesting a differential uplift of the basement. the obtained data are important for the reconstruction of burial and thermal histories of Cenozoic sedimentary basins of the Norwegian continental margin in the northern North Sea, where diverse rifting events, intraplate stress regimes, and inversion tectonics are involved. Fission track analysis puts constraints on tectonic modeling of uplift of rift flanks and the Norwegian continental margin and yields information for these assessment of hydrocarbon potentials of the sedimentary basins.

  1. A comparison of radioactive waste from first generation fusion reactors and fast fission reactors with actinide recycling

    SciTech Connect (OSTI)

    Koch, M.; Kazimi, M.S.

    1991-04-01

    Limitations of the fission fuel resources will presumably mandate the replacement of thermal fission reactors by fast fission reactors that operate on a self-sufficient closed fuel cycle. This replacement might take place within the next one hundred years, so the direct competitors of fusion reactors will be fission reactors of the latter rather than the former type. Also, fast fission reactors, in contrast to thermal fission reactors, have the potential for transmuting long-lived actinides into short-lived fission products. The associated reduction of the long-term activation of radioactive waste due to actinides makes the comparison of radioactive waste from fast fission reactors to that from fusion reactors more rewarding than the comparison of radioactive waste from thermal fission reactors to that from fusion reactors. Radioactive waste from an experimental and a commercial fast fission reactor and an experimental and a commercial fusion reactor has been characterized. The fast fission reactors chosen for this study were the Experimental Breeder Reactor 2 and the Integral Fast Reactor. The fusion reactors chosen for this study were the International Thermonuclear Experimental Reactor and a Reduced Activation Ferrite Helium Tokamak. The comparison of radioactive waste parameters shows that radioactive waste from the experimental fast fission reactor may be less hazardous than that from the experimental fusion reactor. Inclusion of the actinides would reverse this conclusion only in the long-term. Radioactive waste from the commercial fusion reactor may always be less hazardous than that from the commercial fast fission reactor, irrespective of the inclusion or exclusion of the actinides. The fusion waste would even be far less hazardous, if advanced structural materials, like silicon carbide or vanadium alloy, were employed.

  2. Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; Popolan-Vaida, Denisia M.; Shankar, Vijai Shankar Bhavani; Lucassen, Arnas; Hemken, Christian; Taatjes, Craig A.; Leone, Stephen R.; Kohse-Hoinghaus, Katharina; et al

    2015-12-31

    Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C8H14O4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C8H16O5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C8H16O5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O2 addition, intramolecular isomerization, and OH release; C8H14O4 species are proposed to result from subsequent reactions of C8H16O5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

  3. Engineering Report on the Fission Gas Getter Concept

    SciTech Connect (OSTI)

    Ecker, Lynne; Ghose, Sanjit; Gill, Simerjeet; Thallapally, Praveen K.; Strachan, Denis M.

    2012-11-01

    In 2010, the Department of Energy (DOE) requested that a Brookhaven National Laboratory (BNL)-led team research the possibility of using a getter material to reduce the pressure in the plenum region of a light water reactor fuel rod. During the first two years of the project, several candidate materials were identified and tested using a variety of experimental techniques, most with xenon as a simulant for fission products. Earlier promising results for candidate getter materials were found to be incorrect, caused by poor experimental techniques. In May 2012, it had become clear that none of the initial materials had demonstrated the ability to adsorb xenon in the quantities and under the conditions needed. Moreover, the proposed corrective action plan could not meet the schedule needed by the project manager. BNL initiated an internal project review which examined three questions: 1. Which materials, based on accepted materials models, might be capable of absorbing xenon? 2. Which experimental techniques are capable of not only detecting if xenon has been absorbed but also determine by what mechanism and the resulting molecular structure? 3. Are the results from the previous techniques useable now and in the future? As part of the second question, the project review team evaluated the previous experimental technique to determine why incorrect results were reported in early 2012. This engineering report is a summary of the current status of the project review, description of newly recommended experiments and results from feasibility studies at the National Synchrotron Light Source (NSLS).

  4. Baseline Glass Development for Combined Fission Products Waste Streams

    SciTech Connect (OSTI)

    Crum, Jarrod V.; Billings, Amanda Y.; Lang, Jesse B.; Marra, James C.; Rodriguez, Carmen P.; Ryan, Joseph V.; Vienna, John D.

    2009-06-29

    Borosilicate glass was selected as the baseline technology for immobilization of the Cs/Sr/Ba/Rb (Cs), lanthanide (Ln) and transition metal fission product (TM) waste steams as part of a cost benefit analysis study.[1] Vitrification of the combined waste streams have several advantages, minimization of the number of waste forms, a proven technology, and similarity to waste forms currently accepted for repository disposal. A joint study was undertaken by Pacific Northwest National Laboratory (PNNL) and Savannah River National Laboratory (SRNL) to develop acceptable glasses for the combined Cs + Ln + TM waste streams (Option 1) and Cs + Ln combined waste streams (Option 2) generated by the AFCI UREX+ set of processes. This study is aimed to develop baseline glasses for both combined waste stream options and identify key waste components and their impact on waste loading. The elemental compositions of the four-corners study were used along with the available separations data to determine the effect of burnup, decay, and separations variability on estimated waste stream compositions.[2-5] Two different components/scenarios were identified that could limit waste loading of the combined Cs + LN + TM waste streams, where as the combined Cs + LN waste stream has no single component that is perceived to limit waste loading. Combined Cs + LN waste stream in a glass waste form will most likely be limited by heat due to the high activity of Cs and Sr isotopes.

  5. Micro-Pocket Fission Detectors (MPFD) For Fuel Assembly Analysis

    SciTech Connect (OSTI)

    Troy Unruh; Michael Reichenberger; Phillip Ugorowski

    2013-09-01

    Neutron sensors capable of real-time measurement of thermal flux, fast flux, and temperature in a single miniaturized probe are needed in irradiation tests required to demonstrate the performance of candidate new fuels, and cladding materials. In-core ceramic-based miniature neutron detectors or “Micro-Pocket Fission Detectors” (MPFDs) have been studied at Kansas State University (KSU). The first MPFD prototypes were tested in various neutron fields at the KSU TRIGA research reactor with successful results. Currently, a United States Department of Energy-sponsored joint KSU/Idaho National Laboratory (INL) effort is underway to develop a high-temperature, high-pressure version of the MPFD using radiation-resistant, high temperature materials, which would be capable of withstanding irradiation test conditions in high performance material and test reactors (MTRs). Ultimately, this more compact, more accurate, and longer lifetime flux sensor for critical mock-ups, existing and advanced reactor designs, high performance MTRs, and transient test reactors has the potential to lead to higher accuracy and resolution data from irradiation testing, more detailed core flux measurements and enhanced fuel assembly processing. Prior evaluations by KSU indicate that these sensors could also be used to monitor burn-up of nuclear fuel. If integrated into nuclear fuel assemblies, MPFDs offer several advantages to current spent fuel management systems.

  6. Polymorphism influences singlet fission rates in tetracene thin films

    SciTech Connect (OSTI)

    Arias, Dylan H.; Ryerson, Joseph L.; Cook, Jasper D.; Damrauer, Niels H.; Johnson, Justin C.

    2015-11-06

    Here, we report the effect of crystal structure and crystallite grain size on singlet fission (SF) in polycrystalline tetracene, one of the most widely studied SF and organic semiconductor materials. SF has been comprehensively studied in one polymoprh (Tc I), but not in the other, less stable polymorph (Tc II). Using carefully controlled thermal evaporation deposition conditions and high sensitivity ultrafast transient absorption spectroscopy, we found that for large crystallite size samples, SF in nearly pure Tc II films is significantly faster than SF in Tc I films. We also discovered that crystallite size has a minimal impact on the SF rate in Tc II films, but a significant influence in Tc I films. Large crystallites exhibit SF times of 125 ps and 22 ps in Tc I and Tc II, respectively, whereas small crystallites have SF times of 31 ps and 33 ps. Our results demonstrate first, that attention must be paid to polymorphism in obtaining a self-consistent rate picture for SF in tetracene and second, that control of polymorphism can play a significant role towards achieving a mechanistic understanding of SF in polycrystalline systems. In this latter context we show that conventional theory based on non-covalent tetracene couplings is insufficient, thus highlighting the need for models that capture the delocalized and highly mobile nature of excited states in elucidating the full photophysical picture.

  7. Data summary report for fission product release Test VI-7

    SciTech Connect (OSTI)

    Osborne, M.F.; Lorentz, R.A.; Travis, J.R.; Collins, J.L.; Webster, C.S.

    1995-05-01

    Test VI-7 was the final test in the VI series conducted in the vertical furnace. The fuel specimen was a 15.2-cm-long section of a fuel rod from the Monticello boiling water reactor (BWR). The fuel had experienced a burnup of {approximately}-40 Mwd/kg U. It was heated in an induction furnace for successive 20-min periods at 2000 and 2300 K in a moist air-helium atmosphere. Integral releases were 69% for {sup 85}Kr, 52% for {sup 125}Sb, 71% for both {sup 134}Cs and {sup 137}Cs, and 0.04% for {sup 154}Eu. For the non-gamma-emitting species, release values for 42% for I, 4.1% for Ba, 5.3% for Mo, and 1.2% for Sr were determined. The total mass released from the furnace to the collection system, including fission products, fuel, and structural materials, was 0.89 g, with 37% being collected on the thermal gradient tubes and 63% downstream on filters. Posttest examination of the fuel specimen indicated that most of the cladding was completely oxidized to ZrO{sub 2}, but that oxidation was not quite complete at the upper end. The release behaviors for the most volatile elements, Kr and Cs, were in good agreement with the ORNL-Booth Model.

  8. Design of pellet surface grooves for fission gas plenum

    SciTech Connect (OSTI)

    Carter, T.J.; Jones, L.R.; Macici, N.; Miller, G.C.

    1986-01-01

    In the Canada deuterium uranium pressurized heavy water reactor, short (50-cm) Zircaloy-4 clad bundles are fueled on-power. Although internal void volume within the fuel rods is adequate for the present once-through natural uranium cycle, the authors have investigated methods for increasing the internal gas storage volume needed in high-power, high-burnup, experimental ceramic fuels. This present work sought to prove the methodology for design of gas storage volume within the fuel pellets - specifically the use of grooves pressed or machined into the relatively cool pellet/cladding interface. Preanalysis and design of pellet groove shape and volume was accomplished using the TRUMP heat transfer code. Postirradiation examination (PIE) was used to check the initial design and heat transfer assumptions. Fission gas release was found to be higher for the grooved pellet rods than for the comparison rods with hollow or unmodified pellets. This had been expected from the initial TRUMP thermal analyses. The ELESIM fuel modeling code was used to check in-reactor performance, but some modifications were necessary to accommodate the loss of heat transfer surface to the grooves. It was concluded that for plenum design purposes, circumferential pellet grooves could be adequately modeled by the codes TRUMP and ELESIM.

  9. Polymorphism influences singlet fission rates in tetracene thin films

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Arias, Dylan H.; Ryerson, Joseph L.; Cook, Jasper D.; Damrauer, Niels H.; Johnson, Justin C.

    2015-11-06

    Here, we report the effect of crystal structure and crystallite grain size on singlet fission (SF) in polycrystalline tetracene, one of the most widely studied SF and organic semiconductor materials. SF has been comprehensively studied in one polymoprh (Tc I), but not in the other, less stable polymorph (Tc II). Using carefully controlled thermal evaporation deposition conditions and high sensitivity ultrafast transient absorption spectroscopy, we found that for large crystallite size samples, SF in nearly pure Tc II films is significantly faster than SF in Tc I films. We also discovered that crystallite size has a minimal impact on themore » SF rate in Tc II films, but a significant influence in Tc I films. Large crystallites exhibit SF times of 125 ps and 22 ps in Tc I and Tc II, respectively, whereas small crystallites have SF times of 31 ps and 33 ps. Our results demonstrate first, that attention must be paid to polymorphism in obtaining a self-consistent rate picture for SF in tetracene and second, that control of polymorphism can play a significant role towards achieving a mechanistic understanding of SF in polycrystalline systems. In this latter context we show that conventional theory based on non-covalent tetracene couplings is insufficient, thus highlighting the need for models that capture the delocalized and highly mobile nature of excited states in elucidating the full photophysical picture.« less

  10. Code System to Calculate Nuclear Reaction Cross Sections by Evaporation Model.

    Energy Science and Technology Software Center (OSTI)

    2000-11-27

    Version: 00 Both STAPRE and STAPREF are included in this package. STAPRE calculates energy-averaged cross sections for nuclear reactions with emission of particles and gamma rays and fission. The models employed are the evaporation model with inclusion of pre-equilibrium decay and a gamma-ray cascade model. Angular momentum and parity conservation are accounted for. Major improvement in the 1976 STAPRE program relates to level density approach, implemented in subroutine ZSTDE. Generalized superfluid model is incorporated, boltzman-gasmore » modeling of intrinsic state density and semi-empirical modeling of a few-quasiparticle effects in total level density at equilibrium and saddle deformations of actinide nuclei. In addition to the activation cross sections, particle and gamma-ray production spectra are calculated. Isomeric state populations and production cross sections for gamma rays from low excited levels are obtained, too. For fission a single or a double humped barrier may be chosen.« less

  11. Separation of Fission Products Based on Ionic Liquids: Anion Effect

    SciTech Connect (OSTI)

    Luo, Huimin; Dai, Sheng; Bonnesen, Peter V.

    2004-03-28

    The applications of ionic liquids (ILs) as new separation media have been actively investigated recently. The most commonly studied class of ILs for such applications is based on dialkyl imidazolium cations. In comparison with conventional molecular solvents, ILs exhibit enhanced distribution coefficients for a number of complexing neutral ligands in extraction of metal ions from aqueous solutions. The effect of the alkyl chain length of imidazolium cations on the distribution coefficients of solvent extraction using crown ethers was the subject of a number of the previous investigations. The distribution coefficients have been found to decrease with the alkyl chain length of the IL cations. This observation implies that the extraction process also involves the exchange of the IL cations with metal ions. The longer the alkyl chain lengths of the IL cations are, the more hydrophobic the IL cations are and the more difficult to be transported into aqueous phases via ion exchange. Accordingly, the ion-exchange process is another unique property of IL-based extractions involving charged species. Here, we report the investigation about the effect of the variation of IL anions on the solvent extraction of metal ions using crown ethers as extractants. The elucidation of different solvation effects involved in ionic liquids could lead to optimized separation media for these novel solvents.

  12. Reactor for exothermic reactions

    DOE Patents [OSTI]

    Smith, L.A. Jr.; Hearn, D.; Jones, E.M. Jr.

    1993-03-02

    A liquid phase process is described for oligomerization of C[sub 4] and C[sub 5] isoolefins or the etherification thereof with C[sub 1] to C[sub 6] alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120 to 300 F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  13. Reactor for exothermic reactions

    DOE Patents [OSTI]

    Smith, Jr., Lawrence A. (Bellaire, TX); Hearn, Dennis (Houston, TX); Jones, Jr., Edward M. (Friendswood, TX)

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  14. Single-Chain Antibody Library

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Baird, Cheryl

    Researchers at Pacific Northwest National Laboratory (PNNL) have constructed a nonimmune library consisting of 109 human antibody scFv fragments, which have been cloned and expressed on the surface of yeast. Nanomolar-affinity scFvs are routinely obtained by magnetic bead screening and flow cytometric sorting. The yeast library can be amplified 1010 fold without measurable loss of clonal diversity. This allows for indefinite expansion of the library. All scFv clones can be assessed directly on the yeast cell surface by immunofluorescent labeling and flow cytometry, obviating separate subcloning, expression, and purification steps. The ability to use multiplex library screening demonstrates the utility of this approach for high-throughput antibody isolation for proteomic applications. The yeast library may be used for research projects or teaching performed for U.S. Government purposes only. If you would like to request an aliquot of the single-chain antibody library for your research, please print and fill out the Materials Transfer Agreement (MTA) [PDF, 20K]. The website provides the contact information for mailing the MTA. [copied from http://www.sysbio.org/dataresources/singlechain.stm

  15. maritime supply chain | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    maritime supply chain NNSA Co-Hosts Nuclear Security Summit Workshop on Maritime Security with UK WASHINGTON - This week, the Department of Energy's National Nuclear Security Administration (DOE/NNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, United Kingdom, on the growing challenge of securing the global maritime supply chain. In

  16. Mechanistic prediction of fission-product release under normal and accident conditions: key uncertainties that need better resolution. [PWR; BWR

    SciTech Connect (OSTI)

    Rest, J.

    1983-09-01

    A theoretical model has been used for predicting the behavior of fission gas and volatile fission products (VFPs) in UO/sub 2/-base fuels during steady-state and transient conditions. This model represents an attempt to develop an efficient predictive capability for the full range of possible reactor operating conditions. Fission products released from the fuel are assumed to reach the fuel surface by successively diffusing (via atomic and gas-bubble mobility) from the grains to grain faces and then to the grain edges, where the fission products are released through a network of interconnected tunnels of fission-gas induced and fabricated porosity. The model provides for a multi-region calculation and uses only one size class to characterize a distribution of fission gas bubbles.

  17. The Packing of Granular Polymer Chains

    SciTech Connect (OSTI)

    Zou, Ling-Nan; Cheng, Xiang; Rivers, Mark L.; Jaeger, Heinrich M.; Nagel, Sidney R.; UC

    2009-12-01

    Rigid particles pack into structures, such as sand dunes on the beach, whose overall stability is determined by the average number of contacts between particles. However, when packing spatially extended objects with flexible shapes, additional concepts must be invoked to understand the stability of the resulting structure. Here, we examine the disordered packing of chains constructed out of flexibly connected hard spheres. Using x-ray tomography, we find that long chains pack into a low-density structure whose mechanical rigidity is mainly provided by the backbone. On compaction, randomly oriented, semi-rigid loops form along the chain, and the packing of chains can be understood as the jamming of these elements. Finally, we uncover close similarities between the packing of chains and the glass transition in polymers.

  18. P-odd, P-even, and T-odd asymmetries in true quaternary fission of nuclei

    SciTech Connect (OSTI)

    Kadmensky, S. G., E-mail: kadmensky@phys.vsu.ru; Titova, L. V. [Voronezh State University (Russian Federation)] [Voronezh State University (Russian Federation)

    2013-04-15

    The coefficients of P-odd, P-even, and T -odd asymmetries for a third and a fourth prescission particle emitted in the true quaternary fission of nuclei that was induced by polarized cold neutrons were studied on the basis of quantum-mechanical fission theory. By using non-evaporation (nonadiabatic) mechanisms of light-particle emission, these coefficients were compared with the analogous coefficients for prescission third particles emitted in the ternary fission of nuclei.

  19. DIRECT ENERGY CONVERSION FISSION REACTOR ANNUAL REPORT FOR THE PERIOD AUGUST 15,2000 THROUGH SEPTEMBER 30,2001

    SciTech Connect (OSTI)

    L.C. BROWN

    2002-02-01

    OAK-B135 DIRECT ENERGY CONVERSION FISSION REACTOR ANNUAL REPORT FOR THE PERIOD AUGUST 15,2000 THROUGH SEPTEMBER 30,2001

  20. A Computer Code To Analyze The Gas-Phase Transport of Fission Products In Reactor Cooling System Under Severe Accidents.

    Energy Science and Technology Software Center (OSTI)

    1990-12-06

    Version 00 HORN calculates the transport of volatile fission products in a dry primary cooling circuit under severe accidents of water reactors.

  1. Structure of Human Ferritin L Chain

    SciTech Connect (OSTI)

    Wang,Z.; Li, C.; Ellenburg, M.; Soistman, E.; Ruble, J.; Wright, B.; Ho, J.; Carter, D.

    2006-01-01

    Ferritin is the major iron-storage protein present in all cells. It generally contains 24 subunits, with different ratios of heavy chain (H) to light chain (L), in the shape of a hollow sphere hosting up to 4500 ferric Fe atoms inside. H-rich ferritins catalyze the oxidation of iron(II), while L-rich ferritins promote the nucleation and storage of iron(III). Several X-ray structures have been determined, including those of L-chain ferritins from horse spleen (HoSF), recombinant L-chain ferritins from horse (HoLF), mouse (MoLF) and bullfrog (BfLF) as well as recombinant human H-chain ferritin (HuHF). Here, structures have been determined of two crystal forms of recombinant human L-chain ferritin (HuLF) obtained from native and perdeuterated proteins. The structures show a cluster of acidic residues at the ferrihydrite nucleation site and at the iron channel along the threefold axis. An ordered Cd{sup 2+} structure is observed within the iron channel, offering further insight into the route and mechanism of iron transport into the capsid. The loop between helices D and E, which is disordered in many other L-chain structures, is clearly visible in these two structures. The crystals generated from perdeuterated HuLF will be used for neutron diffraction studies.

  2. Method of fission product beta spectra measurements for predicting reactor anti-neutrino emission

    SciTech Connect (OSTI)

    Asner, David M.; Burns, Kimberly A.; Campbell, Luke W.; Greenfield, Bryce A.; Kos, Marek S.; Orrell, John L.; Schram, Malachi; VanDevender, Brent A.; Wood, Lynn S.; Wootan, David W.

    2015-03-01

    The nuclear fission process that occurs in the core of nuclear reactors results in unstable, neutron-rich fission products that subsequently beta decay and emit electron antineutrinos. These reactor neutrinos have served neutrino physics research from the initial discovery of the neutrino to today's precision measurements of neutrino mixing angles. The prediction of the absolute flux and energy spectrum of the emitted reactor neutrinos hinges upon a series of seminal papers based on measurements performed in the 1970s and 1980s. The steadily improving reactor neutrino measurement techniques and recent reconsiderations of the agreement between the predicted and observed reactor neutrino flux motivates revisiting the underlying beta spectra measurements. A method is proposed to use an accelerator proton beam delivered to an engineered target to yield a neutron field tailored to reproduce the neutron energy spectrum present in the core of an operating nuclear reactor. Foils of the primary reactor fissionable isotopes placed in this tailored neutron flux will ultimately emit beta particles from the resultant fission products. Measurement of these beta particles in a time projection chamber with a perpendicular magnetic field provides a distinctive set of systematic considerations for comparison to the original seminal beta spectra measurements. Ancillary measurements such as gamma-ray emission and post-irradiation radiochemical analysis will further constrain the absolute normalization of beta emissions per fission. The requirements for unfolding the beta spectra measured with this method into a predicted reactor neutrino spectrum are explored.

  3. Fission matrix-based Monte Carlo criticality analysis of fuel storage pools

    SciTech Connect (OSTI)

    Farlotti, M.; Larsen, E. W.

    2013-07-01

    Standard Monte Carlo transport procedures experience difficulties in solving criticality problems in fuel storage pools. Because of the strong neutron absorption between fuel assemblies, source convergence can be very slow, leading to incorrect estimates of the eigenvalue and the eigenfunction. This study examines an alternative fission matrix-based Monte Carlo transport method that takes advantage of the geometry of a storage pool to overcome this difficulty. The method uses Monte Carlo transport to build (essentially) a fission matrix, which is then used to calculate the criticality and the critical flux. This method was tested using a test code on a simple problem containing 8 assemblies in a square pool. The standard Monte Carlo method gave the expected eigenfunction in 5 cases out of 10, while the fission matrix method gave the expected eigenfunction in all 10 cases. In addition, the fission matrix method provides an estimate of the error in the eigenvalue and the eigenfunction, and it allows the user to control this error by running an adequate number of cycles. Because of these advantages, the fission matrix method yields a higher confidence in the results than standard Monte Carlo. We also discuss potential improvements of the method, including the potential for variance reduction techniques. (authors)

  4. Radiation re-solution of fission gas in non-oxide nuclear fuel

    SciTech Connect (OSTI)

    Matthews, Christopher; Schwen, Daniel; Klein, Andrew C.

    2015-02-01

    Renewed interest in fast nuclear reactors is creating a need for better understanding of fission gas bubble behavior in non-oxide fuels to support very long fuel lifetimes. Collisions between fission fragments and their subsequent cascades can knock fission gas atoms out of bubbles and back into the fuel lattice. We showed that these collisions can be treated as using the so-called ‘‘homogenous’’ atom-by-atom re-solution theory and calculated using the Binary Collision Approximation code 3DOT. The calculations showed that there is a decrease in the re-solution parameter as bubble radius increases until about 50 nm, at which the re-solution parameter stays nearly constant. Furthermore, our model shows ion cascades created in the fuel result in many more implanted fission gas atoms than collisions directly with fission fragments. This calculated re-solution parameter can be used to find a re-solution rate for future bubble simulations.

  5. Evaluation of fission gas release in high-burnup light water reactor fuel rods

    SciTech Connect (OSTI)

    Barner, J.O.; Cunningham, M.E.; Freshley, M.D.; Lanning, D.D. )

    1993-05-01

    Research to define the behavior of Zircaloy-clad light water reactor (LWR) UO[sub 2] fuel irradiated to high burnup levels was conducted as part of the High Burnup Effects Program (HBEP). The HBEP was a 12-yr program that ultimately acquired, characterized, irradiated, and examined after irradiation 82 LWR fuel rods ranging in rod-average fuel burnup from 22 to 69 MWd/kgM with a peak pellet burnup of 83 MWd/kg M. A principal emphasis of the HBEP was to evaluate the effect of high burnup on fission gas release. It was confirmed that fission gas release remained as dependent on design and irradiation history parameters at high burnup levels as at low to moderate burnup levels. One observed high-burnup effect was the development of a burnup-dependent microstructure at the fuel pellet surface when pellet-edge burnup exceeded 65 MWd/kgM. This low-temperature rim region' was characterized by a loss of optically definable grain structure, a high volume of porosity, and diffusion of fission gas from the UO[sub 2] matrix to the porosity. Although the rim region has the potential for enhanced fission gas release, it is concluded that no significant enhancement of rod-average fission gas release at high burnup levels was observed for the examined fuel rods.

  6. Velocity pump reaction turbine

    DOE Patents [OSTI]

    House, P.A.

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  7. Velocity pump reaction turbine

    DOE Patents [OSTI]

    House, Palmer A.

    1982-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  8. Velocity pump reaction turbine

    DOE Patents [OSTI]

    House, Palmer A.

    1984-01-01

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  9. Reaction of Hydrogen Sulfide with Oxygen in the Presence ofSulfite

    SciTech Connect (OSTI)

    Weres, Oleh; Tsao, Leon

    1983-01-01

    Commonly, abatement of hydrogen sulfide emissions from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One Mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. The authors studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDT are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use.

  10. Reaction of hydrogen sulfide with oxygen in the presence of sulfite

    SciTech Connect (OSTI)

    Weres, O.; Tsao, L.

    1983-01-14

    Commonly, abatement of hydrogen sulfide emission from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. We studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDTA are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use. 33 figures, 9 tables.

  11. Cumulative fission yields of short-lived isotopes under natural-abundance-boron-carbide-moderated neutron spectrum

    SciTech Connect (OSTI)

    Finn, Erin C.; Metz, Lori A.; Greenwood, Lawrence R.; Pierson, Bruce; Wittman, Richard S.; Friese, Judah I.; Kephart, Rosara F.

    2015-04-09

    The availability of gamma spectroscopy data on samples containing mixed fission products at short times after irradiation is limited. Due to this limitation, data interpretation methods for gamma spectra of mixed fission product samples, where the individual fission products have not been chemically isolated from interferences, are not well-developed. The limitation is particularly pronounced for fast pooled neutron spectra because of the lack of available fast reactors in the United States. Samples containing the actinide isotopes 233, 235, 238U, 237Np, and 239Pu individually were subjected to a 2$ pulse in the Washington State University 1 MW TRIGA reactor. To achieve a fission-energy neutron spectrum, the spectrum was tailored using a natural abundance boron carbide capsule to absorb neutrons in the thermal and epithermal region of the spectrum. Our tailored neutron spectrum is unique to the WSU reactor facility, consisting of a soft fission spectrum that contains some measurable flux in the resonance region. This results in a neutron spectrum at greater than 0.1 keV with an average energy of 70 keV, similar to fast reactor spectra and approaching that of 235U fission. Unique fission product gamma spectra were collected from 4 minutes to 1 week after fission using single-crystal high purity germanium detectors. Cumulative fission product yields measured in the current work generally agree with published fast pooled fission product yield values from ENDF/B-VII, though a bias was noted for 239Pu. The present work contributes to the compilation of energy-resolved fission product yield nuclear data for nuclear forensic purposes.

  12. Delayed Fission Gamma-ray Characteristics of Th-232 U-233 U-235 U-238 and Pu-239

    SciTech Connect (OSTI)

    Lane, Taylor; Parma, Edward J.

    2015-08-01

    Delayed fission gamma-rays play an important role in determining the time dependent ioniz- ing dose for experiments in the central irradiation cavity of the Annular Core Research Reactor (ACRR). Delayed gamma-rays are produced from both fission product decay and from acti- vation of materials in the core, such as cladding and support structures. Knowing both the delayed gamma-ray emission rate and the time-dependent gamma-ray energy spectrum is nec- essary in order to properly determine the dose contributions from delayed fission gamma-rays. This information is especially important when attempting to deconvolute the time-dependent neutron, prompt gamma-ray, and delayed gamma-ray contribution to the response of a diamond photo-conducting diode (PCD) or fission chamber in time frames of milliseconds to seconds following a reactor pulse. This work focused on investigating delayed gamma-ray character- istics produced from fission products from thermal, fast, and high energy fission of Th-232, U-233, U-235, U-238, and Pu-239. This work uses a modified version of CINDER2008, a transmutation code developed at Los Alamos National Laboratory, to model time and energy dependent photon characteristics due to fission. This modified code adds the capability to track photon-induced transmutations, photo-fission, and the subsequent radiation caused by fission products due to photo-fission. The data is compared against previous work done with SNL- modified CINDER2008 [ 1 ] and experimental data [ 2 , 3 ] and other published literature, includ- ing ENDF/B-VII.1 [ 4 ]. The ability to produce a high-fidelity (7,428 group) energy-dependent photon fluence at various times post-fission can improve the delayed photon characterization for radiation effects tests at research reactors, as well as other applications.

  13. Reaction product imaging

    SciTech Connect (OSTI)

    Chandler, D.W.

    1993-12-01

    Over the past few years the author has investigated the photochemistry of small molecules using the photofragment imaging technique. Bond energies, spectroscopy of radicals, dissociation dynamics and branching ratios are examples of information obtained by this technique. Along with extending the technique to the study of bimolecular reactions, efforts to make the technique as quantitative as possible have been the focus of the research effort. To this end, the author has measured the bond energy of the C-H bond in acetylene, branching ratios in the dissociation of HI, the energetics of CH{sub 3}Br, CD{sub 3}Br, C{sub 2}H{sub 5}Br and C{sub 2}H{sub 5}OBr dissociation, and the alignment of the CD{sub 3} fragment from CD{sub 3}I photolysis. In an effort to extend the technique to bimolecular reactions the author has studied the reaction of H with HI and the isotopic exchange reaction between H and D{sub 2}.

  14. Addressing Fission Product Validation in MCNP Burnup Credit Criticality Calculations

    SciTech Connect (OSTI)

    Mueller, Don; Bowen, Douglas G; Marshall, William BJ J

    2015-01-01

    The US Nuclear Regulatory Commission (NRC) Division of Spent Fuel Storage and Transportation issued Interim Staff Guidance (ISG) 8, Revision 3 in September 2012. This ISG provides guidance for NRC staff members’ review of burnup credit (BUC) analyses supporting transport and dry storage of pressurized water reactor spent nuclear fuel (SNF) in casks. The ISG includes guidance for addressing validation of criticality (keff) calculations crediting the presence of a limited set of fission products and minor actinides (FP&MAs). Based on previous work documented in NRC Regulatory Guide (NUREG) Contractor Report (CR)-7109, the ISG recommends that NRC staff members accept the use of either 1.5 or 3% of the FP&MA worth—in addition to bias and bias uncertainty resulting from validation of keff calculations for the major actinides in SNF—to conservatively account for the bias and bias uncertainty associated with the specified unvalidated FP&MAs. The ISG recommends (1) use of 1.5% of the FP&MA worth if a modern version of SCALE and its nuclear data are used and (2) 3% of the FP&MA worth for well qualified, industry standard code systems other than SCALE with the Evaluated Nuclear Data Files, Part B (ENDF/B),-V, ENDF/B-VI, or ENDF/B-VII cross sections libraries. The work presented in this paper provides a basis for extending the use of the 1.5% of the FP&MA worth bias to BUC criticality calculations performed using the Monte Carlo N-Particle (MCNP) code. The extended use of the 1.5% FP&MA worth bias is shown to be acceptable by comparison of FP&MA worths calculated using SCALE and MCNP with ENDF/B-V, -VI, and -VII–based nuclear data. The comparison supports use of the 1.5% FP&MA worth bias when the MCNP code is used for criticality calculations, provided that the cask design is similar to the hypothetical generic BUC-32 cask model and that the credited FP&MA worth is no more than 0.1 Δkeff (ISG-8, Rev. 3, Recommendation 4).

  15. PROCESS USING BISMUTH PHOSPHATE AS A CARRIER PRECIPITATE FOR FISSION PRODUCTS AND PLUTONIUM VALUES

    DOE Patents [OSTI]

    Finzel, T.G.

    1959-03-10

    A process is described for separating plutonium from fission products carried therewith when plutonium in the reduced oxidation state is removed from a nitric acid solution of irradiated uranium by means of bismuth phosphate as a carrier precipitate. The bismuth phosphate carrier precipitate is dissolved by treatment with nitric acid and the plutonium therein is oxidized to the hexavalent oxidation state by means of potassium dichromate. Separation of the plutonium from the fission products is accomplished by again precipitating bismuth phosphate and removing the precipitate which now carries the fission products and a small percentage of the plutonium present. The amount of plutonium carried in this last step may be minimized by addition of sodium fluoride, so as to make the solution 0.03N in NaF, prior to the oxidation and prccipitation step.

  16. Calculated fission-fragment yield systematics in the region 74 <=Z <= 94 and 90 <=N <= 150

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Möller, Peter; Randrup, Jørgen

    2015-04-01

    Background: In the seminal experiment by Schmidt et al. [Nucl. Phys. A 665, 221 (2000)] in which fission-fragment charge distributions were obtained for 70 nuclides, asymmetric distributions were seen above nucleon number A ≈ 226 and symmetric ones below. Because asymmetric fission had often loosely been explained as a preference for the nucleus to always exploit the extra binding of fragments near ¹³²Sn it was assumed that all systems below A ≈ 226 would fission symmetrically because available isotopes do not have a proton-to-neutron Z/N ratio that allows division into fragments near ¹³²Sn. But the finding by Andreyev et al.more » [Phys. Rev. Lett. 105, 252502 (2010)] did not conform to this expectation because the compound system ¹⁸⁰Hg was shown to fission asymmetrically. It was suggested that this was a new type of asymmetric fission, because no strong shell effects occur for any possible fragment division. Purpose: We calculate a reference database for fission-fragment mass yields for a large region of the nuclear chart comprising 987 nuclides. A particular aim is to establish whether ¹⁸⁰Hg is part of a contiguous region of asymmetric fission, and if so, its extent, or if not, in contrast to the actinides, there are scattered smaller groups of nuclei that fission asymmetrically in this area of the nuclear chart. Methods: We use the by now well benchmarked Brownian shape-motion method and perform random walks on the previously calculated five-dimensional potential-energy surfaces. The calculated shell corrections are damped out with energy according to a prescription developed earlier. Results: We have obtained a theoretical reference database of fission-fragment mass yields for 987 nuclides. These results show an extended region of asymmetric fission with approximate extension 74 ≤ Z ≤ 85 and 100 ≤ N ≤ 120. The calculated yields are highly variable. We show 20 representative plots of these variable features and summarize the main

  17. Multidimensional Skyrme-density-functional study of the spontaneous fission of 238U

    SciTech Connect (OSTI)

    Sadhukhan, J.; Mazurek, K.; Dobaczewski, J.; Nazarewicz, W.; Sheikh, J. A.; Baran, A.

    2015-01-01

    We determined the spontaneous fission lifetime of 238U by a minimization of the action integral in a three-dimensional space of collective variables. Apart from the mass-distribution multipole moments Q20 (elongation) and Q30 (leftright asymmetry), we also considered the pairing-fluctuation parameter ?2 as a collective coordinate. The collective potential was obtained self-consistently using the Skyrme energy density functional SkM*. The inertia tensor was obtained within the nonperturbative cranking approximation to the adiabatic time-dependent HartreeFockBogoliubov approach. As a result, the pairing-fluctuation parameter ?2 allowed us to control the pairing gap along the fission path, which significantly changed the spontaneous fission lifetime.

  18. Fission gas release from UO{sub 2+x} in defective light water reactor fuel rods

    SciTech Connect (OSTI)

    Skim, Y. S.

    1999-11-12

    A simplified semi-empirical model predicting fission gas release form UO{sub 2+x} fuel to the fuel rod plenum as a function of stoichiometry excess (x) is developed to apply to the fuel of a defective LWR fuel rod in operation. The effect of fuel oxidation in enhancing gas diffusion is included as a parabolic dependence of the stoichiometry excess. The increase of fission gas release in a defective BWR fuel rod is at the most 3 times higher than in an intact fuel rod because of small extent of UO{sub 2} oxidation. The major enhancement contributor in fission gas release of UO{sub 2+x} fuel is the increased diffusivity due to stoichiometry excess rather than the higher temperature caused by degraded fuel thermal conductivity.

  19. Calculated fission-fragment yield systematics in the region 74 <=Z <= 94 and 90 <=N <= 150

    SciTech Connect (OSTI)

    Mller, Peter; Randrup, Jrgen

    2015-04-01

    Background: In the seminal experiment by Schmidt et al. [Nucl. Phys. A 665, 221 (2000)] in which fission-fragment charge distributions were obtained for 70 nuclides, asymmetric distributions were seen above nucleon number A ? 226 and symmetric ones below. Because asymmetric fission had often loosely been explained as a preference for the nucleus to always exploit the extra binding of fragments near Sn it was assumed that all systems below A ? 226 would fission symmetrically because available isotopes do not have a proton-to-neutron Z/N ratio that allows division into fragments near Sn. But the finding by Andreyev et al. [Phys. Rev. Lett. 105, 252502 (2010)] did not conform to this expectation because the compound system ??Hg was shown to fission asymmetrically. It was suggested that this was a new type of asymmetric fission, because no strong shell effects occur for any possible fragment division. Purpose: We calculate a reference database for fission-fragment mass yields for a large region of the nuclear chart comprising 987 nuclides. A particular aim is to establish whether ??Hg is part of a contiguous region of asymmetric fission, and if so, its extent, or if not, in contrast to the actinides, there are scattered smaller groups of nuclei that fission asymmetrically in this area of the nuclear chart. Methods: We use the by now well benchmarked Brownian shape-motion method and perform random walks on the previously calculated five-dimensional potential-energy surfaces. The calculated shell corrections are damped out with energy according to a prescription developed earlier. Results: We have obtained a theoretical reference database of fission-fragment mass yields for 987 nuclides. These results show an extended region of asymmetric fission with approximate extension 74 ? Z ? 85 and 100 ? N ? 120. The calculated yields are highly variable. We show 20 representative plots of these variable features and summarize the main aspects of our results

  20. Calculated fission-fragment yield systematics in the region 74 <=Z <= 94 and 90 <=N <= 150

    SciTech Connect (OSTI)

    Möller, Peter; Randrup, Jørgen

    2015-04-01

    Background: In the seminal experiment by Schmidt et al. [Nucl. Phys. A 665, 221 (2000)] in which fission-fragment charge distributions were obtained for 70 nuclides, asymmetric distributions were seen above nucleon number A ≈ 226 and symmetric ones below. Because asymmetric fission had often loosely been explained as a preference for the nucleus to always exploit the extra binding of fragments near ¹³²Sn it was assumed that all systems below A ≈ 226 would fission symmetrically because available isotopes do not have a proton-to-neutron Z/N ratio that allows division into fragments near ¹³²Sn. But the finding by Andreyev et al. [Phys. Rev. Lett. 105, 252502 (2010)] did not conform to this expectation because the compound system ¹⁸⁰Hg was shown to fission asymmetrically. It was suggested that this was a new type of asymmetric fission, because no strong shell effects occur for any possible fragment division. Purpose: We calculate a reference database for fission-fragment mass yields for a large region of the nuclear chart comprising 987 nuclides. A particular aim is to establish whether ¹⁸⁰Hg is part of a contiguous region of asymmetric fission, and if so, its extent, or if not, in contrast to the actinides, there are scattered smaller groups of nuclei that fission asymmetrically in this area of the nuclear chart. Methods: We use the by now well benchmarked Brownian shape-motion method and perform random walks on the previously calculated five-dimensional potential-energy surfaces. The calculated shell corrections are damped out with energy according to a prescription developed earlier. Results: We have obtained a theoretical reference database of fission-fragment mass yields for 987 nuclides. These results show an extended region of asymmetric fission with approximate extension 74 ≤ Z ≤ 85 and 100 ≤ N ≤ 120. The calculated yields are highly variable. We show 20 representative plots of these variable features and summarize the

  1. Multidimensional Skyrme-density-functional study of the spontaneous fission of 238U

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sadhukhan, J.; Mazurek, K.; Dobaczewski, J.; Nazarewicz, W.; Sheikh, J. A.; Baran, A.

    2015-01-01

    We determined the spontaneous fission lifetime of 238U by a minimization of the action integral in a three-dimensional space of collective variables. Apart from the mass-distribution multipole moments Q20 (elongation) and Q30 (left–right asymmetry), we also considered the pairing-fluctuation parameter λ2 as a collective coordinate. The collective potential was obtained self-consistently using the Skyrme energy density functional SkM*. The inertia tensor was obtained within the nonperturbative cranking approximation to the adiabatic time-dependent Hartree–Fock–Bogoliubov approach. As a result, the pairing-fluctuation parameter λ2 allowed us to control the pairing gap along the fission path, which significantly changed the spontaneous fission lifetime.

  2. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Signal Speed in Nanomagnetic Logic Chains Signal Speed in Nanomagnetic Logic Chains Print Wednesday, 30 September 2015 00:00 The miniaturization of computing architectures has paved the way for personal hand-held electronic devices (smartphones, tablets, etc.) that feature extraordinary computing power. For such battery-operated devices, keeping the power consumption low while continuing to add features is a major challenge. To address this issue, there is a worldwide research effort dedicated

  3. Grain Boundary Percolation Modeling of Fission Gas Release in Oxide Fuels

    SciTech Connect (OSTI)

    Paul C. Millett; Michael R. Tonks; S. B. Biner

    2012-05-01

    We present a new approach to fission gas release modeling in oxide fuels based on grain boundary network percolation. The method accounts for variability in the bubble growth and coalescence rates on individual grain boundaries, and the resulting effect on macroscopic fission gas release. Two-dimensional representa- tions of fuel pellet microstructures are considered, and the resulting gas release rates are compared with traditional two-stage Booth models, which do not account for long-range percolation on grain boundary net- works. The results show that the requirement of percolation of saturated grain boundaries can considerably reduce the total gas release rates, particularly when gas resolution is considered.

  4. SPIDER: A Predictive Theory For Fission (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    SPIDER: A Predictive Theory For Fission Citation Details In-Document Search Title: SPIDER: A Predictive Theory For Fission Authors: White, Morgan C. [1] ; Sierk, Arnold John [1] ; Lestone, John P. [1] ; Moller, Peter [1] + Show Author Affiliations Los Alamos National Laboratory Publication Date: 2013-01-22 OSTI Identifier: 1060899 Report Number(s): LA-UR-13-20411 DOE Contract Number: AC52-06NA25396 Resource Type: Conference Resource Relation: Conference: LANL T-2 Seminar ; 2012-12-10 -

  5. Active-Interrogation Measurements of Fast Neutrons from Induced Fission in Low-Enriched Uranium

    SciTech Connect (OSTI)

    J. L. Dolan; M. J. Marcath; M. Flaska; S. A. Pozzi; D. L. Chichester; A. Tomanin; P. Peerani

    2014-02-01

    A detection system was designed with MCNPX-PoliMi to measure induced-fission neutrons from U-235 and U-238 using active interrogation. Measurements were then performed with this system at the Joint Research Centre (JRC) in Ispra, Italy on low-enriched uranium samples. Liquid scintillators measured induced fission neutron to characterize the samples in terms of their uranium mass and enrichment. Results are presented to investigate and support the use of organic liquid scintillators with active interrogation techniques to characterize uranium containing materials.

  6. Target and method for the production of fission product molybdenum-99

    DOE Patents [OSTI]

    Vandegrift, George F.; Vissers, Donald R.; Marshall, Simon L.; Varma, Ravi

    1989-01-01

    A target for the reduction of fission product Mo-99 is prepared from uranium of low U-235 enrichment by coating a structural support member with a preparatory coating of a substantially oxide-free substrate metal. Uranium metal is electrodeposited from a molten halide electrolytic bath onto a substrate metal. The electrodeposition is performed at a predetermined direct current rate or by using pulsed plating techniques which permit relaxation of accumulated uranium ion concentrations within the melt. Layers of as much as to 600 mg/cm.sup.2 of uranium can be prepared to provide a sufficient density to produce acceptable concentrations of fission product Mo-99.

  7. Target and method for the production of fission product molybdenum-99

    DOE Patents [OSTI]

    Vandegrift, G.F.; Vissers, D.R.; Marshall, S.L.; Varma, R.

    1987-10-26

    A target for the reduction of fission product Mo-99 is prepared from uranium of low U-235 enrichment by coating a structural support member with a preparatory coating of a substantially oxide-free substrate metal. Uranium metal is electrodeposited from a molten halide electrolytic bath onto a substrate metal. The electrodeposition is performed at a predetermined direct current rate or by using pulsed plating techniques which permit relaxation of accumulated uranium ion concentrations within the melt. Layers of as much as to 600 mg/cm/sup 2/ of uranium can be prepared to provide a sufficient density to produce acceptable concentrations of fission product Mo-99. 2 figs.

  8. A method to calculate fission-fragment yields Y(Z,N) versus proton and

    Office of Scientific and Technical Information (OSTI)

    neutron number in the Brownian shape-motion model (Journal Article) | SciTech Connect A method to calculate fission-fragment yields Y(Z,N) versus proton and neutron number in the Brownian shape-motion model Citation Details In-Document Search This content will become publicly available on December 23, 2016 Title: A method to calculate fission-fragment yields Y(Z,N) versus proton and neutron number in the Brownian shape-motion model In this study, we propose a method to calculate the

  9. Hybrid fusion-fission reactor with a thorium blanket: Its potential in

    Office of Scientific and Technical Information (OSTI)

    the fuel cycle of nuclear reactors (Journal Article) | SciTech Connect Hybrid fusion-fission reactor with a thorium blanket: Its potential in the fuel cycle of nuclear reactors Citation Details In-Document Search Title: Hybrid fusion-fission reactor with a thorium blanket: Its potential in the fuel cycle of nuclear reactors Discussions are currently going on as to whether it is suitable to employ thorium in the nuclear fuel cycle. This work demonstrates that the {sup 231}Pa-{sup 232}U-{sup

  10. Singlet fission in tetracene and rubrene: evidence for the direct formation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of entangled triplet pairs | MIT-Harvard Center for Excitonics fission in tetracene and rubrene: evidence for the direct formation of entangled triplet pairs March 6, 2012 at 3pm/36-428 Christopher Bardeen Department of Chemistry, University of California, Riverside bardeen001 Abstract: Singlet fission is a process where an initially created singlet exciton spontaneously splits into a pair of triplet excitons. This spin-allowed process can be very rapid and is of interest as a way to make

  11. Gaseous fission product management for molten salt reactors and vented fuel systems

    SciTech Connect (OSTI)

    Messenger, S. J.; Forsberg, C.; Massie, M.

    2012-07-01

    Fission gas disposal is one of the unresolved difficulties for Molten Salt Reactors (MSRs) and advanced reactors with vented fuel systems. As these systems operate, they produce many radioactive isotopes of xenon and krypton (e.g. {sup 135}Xe t{sub 1/2} = 9.14 hours and {sup 85}Kr t{sub 1/2}= 10.73 years). Removing these gases proves vital to the success of such reactor designs for two reasons. First, the gases act as large neutron sinks which decrease reactivity and must be counterbalanced by increasing fuel loading. Second, for MSRs, inert fission product gases naturally separate quickly from high temperature salts, thus creating high vapor pressure which poses safety concerns. For advanced reactors with solid vented fuel, the gases are allowed to escape into an off-gas system and thus must be managed. Because of time delays in transport of fission product gases in vented fuel systems, some of the shorter-lived radionuclides will decay away thereby reducing the fission gas source term relative to an MSR. To calculate the fission gas source term of a typical molten salt reactor, we modeled a 1000 MWe graphite moderated thorium MSR similar to that detailed in Mathieu et al. [1]. The fuel salt used in these calculations was LiF (78 mole percent) - (HN)F 4 (22 mole percent) with a heavy nuclide composition of 3.86% {sup 233}U and 96.14% {sup 232}Th by mass. Before we can remove the fission product gases produced by this reactor configuration, we must first develop an appropriate storage mechanism. The gases could be stored in pressurized containers but then one must be concerned about bottle failure. Methods to trap noble gases in matrices are expensive and complex. Alternatively, there are direct storage/disposal options: direct injection into the Earth or injecting a grout-based product into the Earth. Advances in drilling technologies, hydro fracture technologies, and methods for the sequestration of carbon dioxide from fossil fuel plants are creating new options

  12. Probabilities for the emission of light particles and their energy and angular distributions for true quaternary nuclear fission

    SciTech Connect (OSTI)

    Kadmensky, S. G., E-mail: kadmensky@phys.vsu.ru; Titova, L. V. [Voronezh State University (Russian Federation)] [Voronezh State University (Russian Federation)

    2013-01-15

    On the basis of quantum-mechanical fission theory, the features of true quaternary nuclear fission are studied by treating this fission process as a sequence of three processes following one another in the course of time. The first two processes are the escape of the first and then the second of the two light particles emitted from the neck of a fissioning nucleus because of a nonadiabatic character of the collective deformation motion of this nucleus. Finally, the third process is the separation of the fissioning nucleus into two rather heavy fission fragments. The differences that arise in the emission probabilities and in the angular and energy distributions upon going over from the first emitted to the second emitted prescission third and fourth particles are analyzed by invoking experimental data on the spontaneous and thermalneutron-induced fission of nuclei, and it is shown that these differences are caused by the changes both in the geometric configuration of the fissioning nucleus and in the shell structure of its neck after the first prescission particle is emitted from it.

  13. Fission fragment charge and mass distributions in 239Pu(n, f ) in the adiabatic nuclear energy density functional theory

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Regnier, D.; Dubray, N.; Schunck, N.; Verriere, M.

    2016-05-13

    Here, accurate knowledge of fission fragment yields is an essential ingredient of numerous applications ranging from the formation of elements in the r process to fuel cycle optimization for nuclear energy. The need for a predictive theory applicable where no data are available, together with the variety of potential applications, is an incentive to develop a fully microscopic approach to fission dynamics.

  14. On-chip real-time single-copy polymerase chain reaction in picoliter droplets

    SciTech Connect (OSTI)

    Beer, N R; Hindson, B; Wheeler, E; Hall, S B; Rose, K A; Kennedy, I; Colston, B

    2007-04-20

    The first lab-on-chip system for picoliter droplet generation and PCR amplification with real-time fluorescence detection has performed PCR in isolated droplets at volumes 10{sup 6} smaller than commercial real-time PCR systems. The system utilized a shearing T-junction in a silicon device to generate a stream of monodisperse picoliter droplets that were isolated from the microfluidic channel walls and each other by the oil phase carrier. An off-chip valving system stopped the droplets on-chip, allowing them to be thermal cycled through the PCR protocol without droplet motion. With this system a 10-pL droplet, encapsulating less than one copy of viral genomic DNA through Poisson statistics, showed real-time PCR amplification curves with a cycle threshold of {approx}18, twenty cycles earlier than commercial instruments. This combination of the established real-time PCR assay with digital microfluidics is ideal for isolating single-copy nucleic acids in a complex environment.

  15. Enrico Fermi and the First Self-Sustaining Nuclear Chain Reaction

    Office of Scientific and Technical Information (OSTI)

    about Enrico Fermi and his work is available in full-text DOE reports and on the Web. ... FGST (Fermi Gamma-ray Space Telescope) Remembering Fermi (video) Top Additional Web Pages: ...

  16. Optimized nested Markov chain Monte Carlo sampling: theory (Conference...

    Office of Scientific and Technical Information (OSTI)

    Optimized nested Markov chain Monte Carlo sampling: theory Citation Details In-Document Search Title: Optimized nested Markov chain Monte Carlo sampling: theory Metropolis Monte ...

  17. Supply Chain Sustainability Analysis of Three Biofuel Pathways...

    Office of Scientific and Technical Information (OSTI)

    Supply Chain Sustainability Analysis of Three Biofuel Pathways Citation Details In-Document Search Title: Supply Chain Sustainability Analysis of Three Biofuel Pathways The ...

  18. Supply Chain Sustainability Analysis of Fast Pyrolysis and Hydrotreati...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Supply Chain Sustainability Analysis of Fast Pyrolysis and Hydrotreating Bio-Oil to Produce Hydrocarbon Fuels Title Supply Chain Sustainability Analysis of Fast Pyrolysis and...

  19. Nuclear Reactions X-Sections By Evaporation Model, Gamma-Cascades

    Energy Science and Technology Software Center (OSTI)

    2000-06-27

    Calculation of energy-averaged cross sections for nuclear reactions with emission of particles and gamma rays and fission. The models employed are the evaporation model with inclusion of pre-equilibrium decay and gamma ray cascade model. Angular momentum and parity conservation are accounted for. Major improvement to the 1976 STAPRE program (NEA 0461) relates to level density approach, implemwnted in subroutine ZSTDE. Generalized superfluid model is incorporated, Boltzman-gas modelling of intrinsic state density and semi-empirical modelling ofmore » a few quasiparticle effects in total level density in equilibrium and saddle deformations of actinide nuclei.« less

  20. Reaction chemistry of cerium

    SciTech Connect (OSTI)

    1997-01-01

    It is truly ironic that a synthetic organic chemist likely has far greater knowledge of the reaction chemistry of cerium(IV) than an inorganic colleague. Cerium(IV) reagents have long since been employed as oxidants in effecting a wide variety of organic transformations. Conversely, prior to the late 1980s, the number of well characterized cerium(IV) complexes did not extend past a handful of known species. Though in many other areas, interest in the molecular chemistry of the 4f-elements has undergone an explosive growth over the last twenty years, the chemistry of cerium(IV) has for the most part been overlooked. This report describes reactions of cerium complexes and structure.

  1. Derivation of effective fission gas diffusivities in UO2 from lower length scale simulations and implementation of fission gas diffusion models in BISON

    SciTech Connect (OSTI)

    Andersson, Anders David Ragnar; Pastore, Giovanni; Liu, Xiang-Yang; Perriot, Romain Thibault; Tonks, Michael; Stanek, Christopher Richard

    2014-11-07

    This report summarizes the development of new fission gas diffusion models from lower length scale simulations and assessment of these models in terms of annealing experiments and fission gas release simulations using the BISON fuel performance code. Based on the mechanisms established from density functional theory (DFT) and empirical potential calculations, continuum models for diffusion of xenon (Xe) in UO2 were derived for both intrinsic conditions and under irradiation. The importance of the large XeU3O cluster (a Xe atom in a uranium + oxygen vacancy trap site with two bound uranium vacancies) is emphasized, which is a consequence of its high mobility and stability. These models were implemented in the MARMOT phase field code, which is used to calculate effective Xe diffusivities for various irradiation conditions. The effective diffusivities were used in BISON to calculate fission gas release for a number of test cases. The results are assessed against experimental data and future directions for research are outlined based on the conclusions.

  2. Integrated separation scheme for measuring a suite of fission and activation products from a fresh mixed fission and activation product sample

    SciTech Connect (OSTI)

    Morley, Shannon M.; Seiner, Brienne N.; Finn, Erin C.; Greenwood, Lawrence R.; Smith, Steven C.; Gregory, Stephanie J.; Haney, Morgan M.; Lucas, Dawn D.; Arrigo, Leah M.; Beacham, Tere A.; Swearingen, Kevin J.; Friese, Judah I.; Douglas, Matthew; Metz, Lori A.

    2015-05-01

    Mixed fission and activation materials resulting from various nuclear processes and events contain a wide range of isotopes for analysis spanning almost the entire periodic table. In some applications such as environmental monitoring, nuclear waste management, and national security a very limited amount of material is available for analysis and characterization so an integrated analysis scheme is needed to measure multiple radionuclides from one sample. This work describes the production of a complex synthetic sample containing fission products, activation products, and irradiated soil and determines the percent recovery of select isotopes through the integrated chemical separation scheme. Results were determined using gamma energy analysis of separated fractions and demonstrate high yields of Ag (76 6%), Au (94 7%), Cd (59 2%), Co (93 5%), Cs (88 3%), Fe (62 1%), Mn (70 7%), Np (65 5%), Sr (73 2%) and Zn (72 3%). Lower yields (< 25%) were measured for Ga, Ir, Sc, and W. Based on the results of this experiment, a complex synthetic sample can be prepared with low atom/fission ratios and isotopes of interest accurately and precisely measured following an integrated chemical separation method.

  3. Photochemical reaction dynamics

    SciTech Connect (OSTI)

    Moore, B.C.

    1993-12-01

    The purpose of the program is to develop a fundamental understanding of unimolecular and bimolecular reaction dynamics with application in combustion and energy systems. The energy dependence in ketene isomerization, ketene dissociation dynamics, and carbonyl substitution on organometallic rhodium complexes in liquid xenon have been studied. Future studies concerning unimolecular processes in ketene as well as energy transfer and kinetic studies of methylene radicals are discussed.

  4. Assessment of a mechanistic model in U-Pu-Zr metallic alloy fuel fission-gas behavior simulations

    SciTech Connect (OSTI)

    Yun, D.; Rest, J.; Yacout, A. M.

    2012-07-01

    A mechanistic kinetic rate theory model originally developed for the prediction of fission gas behavior in oxide nuclear fuels under steady-state and transient conditions has been assessed to look at its applicability to model fission gas behavior in U-Pu-Zr metallic alloy fuel. In order to capture and validate the underlying physics for irradiated U-Pu-Zr fuels, the mechanistic model was applied to the simulation of fission gas release, fission gas and fission product induced swelling, and the evolution of the gas bubble size distribution in three different fuel zones: the outer {alpha}-U, the intermediate, and the inner {gamma}-U zones. Due to its special microstructural features, the {alpha}-U zone in U-Pu-Zr fuels is believed to contribute the largest fraction of fission gas release among the different fuel zones. It is shown that with the use of small effective grain sizes, the mechanistic model can predict fission gas release that is consistent with (though slightly lower than) experimentally measured data. These simulation results are comparable to the experimentally measured fission gas release since the mechanism of fission gas transport through the densely distributed laminar porosity in the {alpha}-U zone is analogous to the mechanism of fission gas transport through the interconnected gas bubble porosity utilized in the mechanistic model. Detailed gas bubble size distributions predicted with the mechanistic model in both the intermediate zone and the high temperature {gamma}-U zone of U-Pu-Zr fuel are also compared to experimental measurements from available SEM micrographs. These comparisons show good agreements between the simulation results and experimental measurements, and therefore provide crucial guidelines for the selection of key physical parameters required for modeling these two zones. In addition, the results of parametric studies for several key parameters are presented for both the intermediate zone and the {gamma}-U zone simulations

  5. Uncertainty evaluation for the matrix 'solidified state' of fissionable elements

    SciTech Connect (OSTI)

    Iliescu, Elena; Iancso, Georgeta

    2012-09-06

    fissionable elements (Thorium e.g.), of which, heavy charged particles, in this case the alpha radiations naturally emitted, were registered in the CR-39 track detectors. The density of alpha track from the obtained track micromaps was studied through common optic microscopy. Micromaps were studied counting the tracks on equal areas, in different measurement points. For the study of the foils prepared within the paper, the studied area was of 4.9 mm2, formed of 10 fields of 0.49 mm2 area each. The estimation of the uncertainty was carried out for all the sizes that were measured within the paper, no matter if they participate, directly or indirectly, in the estimation of the uncertainty regarding the homogeneity of the Thorium atoms distribution in the 'solidified state' foils of the standard solution calibrated in Thorium, such as: i) the weighted masses, ii) the dropped volumes of solution, iii) the alpha duration of exposure of the detectors, iv) the area studied on the surface of the micromap and v) the densities of alpha tracks. The procedure suggested allowed us to considerate that the homogeneity of alpha tracks distribution, on the surface and in thickness, is within the limits of 3.1%.

  6. Charge separation in photoredox reactions. Final report

    SciTech Connect (OSTI)

    Kevan, L.

    1993-07-15

    The structural aspects controlling charge separation in molecular photoionization reactions in organized molecular assemblies involving micelles, reverse micelles and vesicles are being studied by optical and electron magnetic resonance techniques including the time domain technique of deuterium electron spin echo modulation (ESEM) and matrix proton electron nuclear double resonance (ENDOR) to measure weak electron-nuclear dipolar interactions. ESEM and matrix ENDOR are particularly well adapted to the study of disordered systems as exemplified by micelles and vesicles. The photoionization yields of alkylphenothiazines in micelles and vesicles have been shown to depend on the alkyl chain length and to correlate with relative distances from the surfactant assembly interface measured by deuterium ESEM and matrix proton ENDOR. The photoionization of alkylmethylviologens versus alkyl chain length has also been studied in vesicles, micelles and reverse micelles. Nitroxide spin probes have been used to study the degree of water penetration into mixed ionic/nonionic poly(ethylene oxide) and cationic/anionic micelles by using ESEM methods and selectively deuterated surfactants. The effect of urea interaction at micellar interfaces on the interface hydration has also been evaluated by studying nitroxide probes with ESEM.

  7. Using Gagne`s Chain in OJT

    SciTech Connect (OSTI)

    Fetters, F.E.

    1993-11-01

    This report discusses Gagne`s Chain which is a taxonomy which can used as a tool to identify trainee deficiencies encountered during On-the-Job Training. It also assists in the development of effective training strategies for the training of deficient behaviors and knowledges. Gagne`s Chain presupposes three phases of acquisition for knowledges and skills identified as deficiencies: precondition, qualified acquisition, and unassisted demonstration. The hierarchy of the taxonomy identifies both the psychomotor and cognitive branches. At the ``Principles`` level, verbal and psychomotor activities are combined. Gagne`s Chain identifies the hierarchy as follows: Problem Solving [higher psychomotor and verbal combined level], Principles (lower psychomotor and verbal combined level), Association [highest verbal level], Discrimination [second highest verbal level], Signal Recognition [lowest verbal level], Operant Chain [higher psychomotor level], and Single Operant [lower psychomotor level]. A ``rule of thumb`` associated with the use of Gagne`s Chain is, if behavior or knowledge are not acquired at a higher level, the trainee should be trained at the next lower step. Then the knowledge or behavior acquired at this step becomes the precondition for the acquisition of the actual knowledge or skill identified at the original level.

  8. The reaction of hydroperoxy-propyl radicals with molecular oxygen

    SciTech Connect (OSTI)

    Bozzelli, J.W.; Pitz, W.J.

    1993-12-03

    Addition of hydroperoxy-alkyl radicals to molecular oxygen leads to chain branching in autoignition and engine knock, and in low temperature oxidation of paraffins. Rate constants and product channels for reaction of hydroperoxy-propyl radicals with O{sub 2} are estimated using thermodynamic properties, bimolecular quantum Kassel analysis and transition state theory. Thermochemistry of relevant molecules and radicals is estimated using group additivity and bond dissociation groups for radicals. Results show that rates of the hydroperoxy-propyl radical addition to O{sub 2} are near their high pressure limits at {ge} 1 atm. Main products at 1--15 atm are stabilization, reverse reaction to hydroperoxy-propyl + O{sub 2} and alkyl carbonyl + OH. Reactions of the stabilized adducts, dissociation rates and product channels are estimated using unimolecular quantum Kassel analysis, because stabilization is the most important hydroperoxy-propyl radical + O{sub 2} product channel. Below 700 K, the stabilized peroxy adducts react primarily to hydroperoxy-carbonyl + OH, products which lead to chain branching. Above 700K, the stabilized peroxy adducts react primarily to hydroperoxy-propyl radical + O{sub 2}, initial reactants, which inhibits the overall oxidation. This switchover in channels correlates well observed negative temperature coefficient behavior for propane oxidation. Rate expressions for reaction of each of the three hydroperoxy-alkyl isomers with O{sub 2} and for dissociation of the associated stabilized adducts are calculated for a series of pressures at 300--2100K.

  9. Report on the Behavior of Fission Products in the Co-decontamination Process

    SciTech Connect (OSTI)

    Martin, Leigh Robert; Riddle, Catherine Lynn

    2015-09-30

    This document was prepared to meet FCT level 3 milestone M3FT-15IN0302042, “Generate Zr, Ru, Mo and Tc data for the Co-decontamination Process.” This work was carried out under the auspices of the Lab-Scale Testing of Reference Processes FCT work package. This document reports preliminary work in identifying the behavior of important fission products in a Co-decontamination flowsheet. Current results show that Tc, in the presence of Zr alone, does not behave as the Argonne Model for Universal Solvent Extraction (AMUSE) code would predict. The Tc distribution is reproducibly lower than predicted, with Zr distributions remaining close to the AMUSE code prediction. In addition, it appears there may be an intricate relationship between multiple fission product metals, in different combinations, that will have a direct impact on U, Tc and other important fission products such as Zr, Mo, and Rh. More extensive testing is required to adequately predict flowsheet behavior for these variances within the fission products.

  10. Dating thermal events at Cerro Prieto using fission-track annealing

    SciTech Connect (OSTI)

    Sanford, S.J.; Elders, W.A.

    1981-01-01

    The duration of heating in the Cerro Prieto reservoir was estimated by relating the fading of spontaneous fission tracks in detrital apatite to observed temperatures. The rate of fading is a function of both time and temperature. The apparent fission track age of the detrital apatites then, is a function of both their source age and their time-temperature history. Data from laboratory experiments and geologic fading studies were compiled from published sources to produce lines of iso-annealing for apatite in time-temperature space. Fission track ages were calculated for samples from two wells at Cerro Prieto, one with an apparently simple and one with an apparently complex thermal history. Temperatures were estimated by empirical vitrinite reflectance geothermometry, fluid inclusion homogenization and oxygen isotope equilibrium. These estimates were compared with logs of measured borehole temperatures. The temperature in well T-366, where complete annealing first occurs, was estimated to be between 160 and 180{sup 0}C. Complete annealing at these temperatures requires 10{sup 4} and 10{sup 3} years, respectively. Well M-94 has an apparently complex thermal history. Geothermometers in this well indicate temperatures some 50 to 100{sup 0}C higher than those measured directly in the borehole. Fission tracks are partially preserved in M-94 where paleotemperatures were as high as 200{sup 0}C and are erased where geothermometers indicate temperatures of 250{sup 0}C. This implies a thermal event less than 10{sup 1} years and greater than 10{sup 0} years in duration.

  11. SEPARATION OF FISSION PRODUCT VALUES FROM THE HEXAVALENT PLUTONIUM BY CARRIER PRECIPITATION

    DOE Patents [OSTI]

    Davies, T.H.

    1959-12-15

    An improved precipitation of fission products on bismuth phosphate from an aqueous mineral acid solution also containing hexavalent plutonium by incorporating, prior to bismuth phosphate precipitation, from 0.05 to 2.5 grams/ liter of zirconium phosphate, niobium oxide. and/or lanthanum fluoride is described. The plutonium remains in solution.

  12. Fission signal detection using helium-4 gas fast neutron scintillation detectors

    SciTech Connect (OSTI)

    Lewis, J. M. Kelley, R. P.; Jordan, K. A.; Murer, D.

    2014-07-07

    We demonstrate the unambiguous detection of the fission neutron signal produced in natural uranium during active neutron interrogation using a deuterium-deuterium fusion neutron generator and a high pressure {sup 4}He gas fast neutron scintillation detector. The energy deposition by individual neutrons is quantified, and energy discrimination is used to differentiate the induced fission neutrons from the mono-energetic interrogation neutrons. The detector can discriminate between different incident neutron energies using pulse height discrimination of the slow scintillation component of the elastic scattering interaction between a neutron and the {sup 4}He atom. Energy histograms resulting from this data show the buildup of a detected fission neutron signal at higher energies. The detector is shown here to detect a unique fission neutron signal from a natural uranium sample during active interrogation with a (d, d) neutron generator. This signal path has a direct application to the detection of shielded nuclear material in cargo and air containers. It allows for continuous interrogation and detection while greatly minimizing the potential for false alarms.

  13. Using a Time Projection Chamber to Measure High Precision Neutron-Induced Fission Cross Sections

    SciTech Connect (OSTI)

    Manning, Brett

    2015-08-06

    2014 LANSCE run cycle data will provide a preliminary 239Pu(n,f) cross section and will quantify uncertainties: PID and Target/beam non-uniformities. Continued running during the 2015 LANSCE run cycle: Thin targets to see both fission fragments and 239Pu(n,f) cross section and fully quantified uncertainties

  14. Validation of ATR Fission Power Deposition Fraction in HEU and LEU Fuel Plates

    SciTech Connect (OSTI)

    G. S. Chang

    2008-09-01

    The Advanced Test Reactor (ATR) is a high power (250 MW), high neutron flux research reactor operating in the United States. Powered with highly enriched uranium (HEU), the ATR has a maximum unperturbed thermal neutron flux rating of 1.0 x 1015 n/cm2s. Because of its high power and large test volumes located in high flux areas, the ATR is an ideal candidate for assessing the feasibility of converting an HEU driven reactor to a low-enriched core. A detailed plate-by-plate MCNP ATR full core model has been developed and validated for the low-enriched uranium (LEU) fuel conversion feasibility study. Using this model, an analysis has been performed to determine the LEU density and U-235 enrichment required in the fuel meat to yield equivalent K-eff versus effective full power days (EFPDs) between the HEU and LEU cores. This model has also been used to optimize U-235 content of the LEU core, minimizing the differences in K-eff and heat flux profile between the HEU and LEU cores at 115 MW total core power for 125 EFPDs. The LEU core conversion feasibility study evaluated foil type (U-10Mo) fuel with the LEU reference design of 19.7 wt% U-235 enrichment. The LEU reference design has a fixed fuel meat thickness of 0.330 mm and can sustain the same operating cycle length as the HEU fuel. Heat flux and fission power density are parameters that are proportional to the fraction of fission power deposited in fuel. Thus, the accurate determination of the fraction of fission power deposited in the fuel is important to ATR nuclear safety. In this work, a new approach was developed and validated, the Tally Fuel Cells Only (TFCO) method. This method calculates and compares the fission power deposition fraction between HEU and LEU fuel plates. Due to the high density of the U-10Mo LEU fuel, the fission ?-energy deposition fraction is 37.12%, which is larger than the HEUs ?-energy deposition fraction of 19.7%. As a result, the fuel decay heat cooling will need to be improved. During

  15. Comparison of fission product release predictions using PARFUME with results from the AGR-1 irradiation experiment

    SciTech Connect (OSTI)

    Blaise Collin

    2014-09-01

    This report documents comparisons between post-irradiation examination measurements and model predictions of silver (Ag), cesium (Cs), and strontium (Sr) release from selected tristructural isotropic (TRISO) fuel particles and compacts during the first irradiation test of the Advanced Gas Reactor program that occurred from December 2006 to November 2009 in the Advanced Test Reactor (ATR) at Idaho National Laboratory (INL). The modeling was performed using the particle fuel model computer code PARFUME (PARticle FUel ModEl) developed at INL. PARFUME is an advanced gas-cooled reactor fuel performance modeling and analysis code (Miller 2009). It has been developed as an integrated mechanistic code that evaluates the thermal, mechanical, and physico-chemical behavior of fuel particles during irradiation to determine the failure probability of a population of fuel particles given the particle-to-particle statistical variations in physical dimensions and material properties that arise from the fuel fabrication process, accounting for all viable mechanisms that can lead to particle failure. The code also determines the diffusion of fission products from the fuel through the particle coating layers, and through the fuel matrix to the coolant boundary. The subsequent release of fission products is calculated at the compact level (release of fission products from the compact) but it can be assessed at the particle level by adjusting the diffusivity in the fuel matrix to very high values. Furthermore, the diffusivity of each layer can be individually set to a high value (typically 10-6 m2/s) to simulate a failed layer with no capability of fission product retention. In this study, the comparison to PIE focused on fission product release and because of the lack of failure in the irradiation, the probability of particle failure was not calculated. During the AGR-1 irradiation campaign, the fuel kernel produced and released fission products, which migrated through the successive

  16. Better Plants Supply Chain Pilot – Overview

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Department of Energy (DOE) is working with Better Plants Partners to improve energy efficiency throughout their supply chains. Around 40 to 60 percent of a manufacturing company’s energy and carbon footprint can reside upstream in its supply chain—from raw materials, transport, and packaging to the energy consumed in manufacturing processes—but this number can be as high as 80 percent. Coordinating energy management practices between companies and their supply chains has the potential to significantly improve industrial energy productivity and reduce the amount of energy embedded in manufactured products. Through this Supply Chain Pilot, DOE will work with a select group of Better Plants Partners to extend the benefits of energy efficiency to their suppliers. Partners will leverage existing Better Plants Program resources and encourage suppliers to collectively set, track, and meet energy savings goals.

  17. Theoretical analyses of (n,xn) reactions on sup 235 U, sup 238 U, sup 237 Np, and sup 239 Pu for ENDF/B-VI

    SciTech Connect (OSTI)

    Young, P.G.; Arthur, E.D.

    1991-01-01

    Theoretical analyses were performed of neutron-induced reactions on {sup 235}U, {sup 238}U, {sup 237}Np, and {sup 239}Pu between 0.01 and 20 MeV in order to calculate neutron emission cross sections and spectra for ENDF/B-VI evaluations. Coupled-channel optical model potentials were obtained for each target nucleus by fitting total, elastic, and inelastic scattering cross section data, as well as low-energy average resonance data. The resulting deformed optical model potentials were used to calculate direct (n,n{prime}) cross sections and transmission coefficients for use in Hauser-Feshbach statistical theory analyses. A fission model with multiple barrier representation, width fluctuation corrections, and preequilibrium corrections were included in the analyses. Direct cross sections for higher-lying vibrational states were calculated using DWBA theory, normalized using B(E{ell}) values determined from (d,d{prime}) and Coulomb excitation data, where available, and from systematics otherwise. Initial fission barrier parameters and transition state density enhancements appropriate to the compound systems involved were obtained from previous analyses, especially fits to charged-particle fission probability data. The parameters for the fission model were adjusted for each target system to obtain optimum agreement with direct (n,f) cross section measurements, taking account of the various multichance fission channels, that is, the different compound systems involved. The results from these analyses were used to calculate most of the neutron (n,n), (n,n{prime}), and (n,xn) cross section data in the ENDF/B/VI evaluations for the above nuclei, and all of the energy-angle correlated spectra. The deformed optical model and fission model parameterizations are described. Comparisons are given between the results of these analyses and the previous ENDF/B-V evaluations as well as with the available experimental data. 14 refs., 3 figs., 1 tab.

  18. Planetary Surface Power and Interstellar Propulsion Using Fission Fragment Magnetic Collimator Reactor

    SciTech Connect (OSTI)

    Tsvetkov, Pavel V.; Hart, Ron R.; King, Don B.; Rochau, Gary E.

    2006-01-20

    Fission energy can be used directly if the kinetic energy of fission fragments is converted to electricity and/or thrust before turning into heat. The completed US DOE NERI Direct Energy Conversion (DEC) Power Production project indicates that viable DEC systems are possible. The US DOE NERI DEC Proof of Principle project began in October of 2002 with the goal to demonstrate performance principles of DEC systems. One of the emerging DEC concepts is represented by fission fragment magnetic collimator reactors (FFMCR). Safety, simplicity, and high conversion efficiency are the unique advantages offered by these systems. In the FFMCR, the basic energy source is the kinetic energy of fission fragments. Following escape from thin fuel layers, they are captured on magnetic field lines and are directed out of the core and through magnetic collimators to produce electricity and thrust. The exiting flow of energetic fission fragments has a very high specific impulse that allows efficient planetary surface power and interstellar propulsion without carrying any conventional propellant onboard. The objective of this work was to determine technological feasibility of the concept. This objective was accomplished by producing the FFMCR design and by analysis of its performance characteristics. The paper presents the FFMCR concept, describes its development to a technologically feasible level and discusses obtained results. Performed studies offer efficiencies up to 90% and velocities approaching speed of light as potentially achievable. The unmanned 10-tons probe with 1000 MW FFMCR propulsion unit would attain mission velocity of about 2% of the speed of light. If the unit is designed for 4000 MW, then in 10 years the unmanned 10-tons probe would attain mission velocity of about 10% of the speed of light.

  19. Peppytides: Interactive Models of Polypeptide Chains

    ScienceCinema (OSTI)

    Zuckermann, Ron; Chakraborty, Promita; Derisi, Joe

    2014-10-28

    Peppytides are scaled, 3D-printed models of polypeptide chains that can be folded into accurate protein structures. Designed and created by Berkeley Lab Researcher, Promita Chakraborty, and Berkeley Lab Senior Scientist, Dr. Ron Zuckermann, Peppytides are accurate physical models of polypeptide chains that anyone can interact with and fold intro various protein structures - proving to be a great educational tool, resulting in a deeper understanding of these fascinating structures and how they function. Build your own Peppytide model and learn about how nature's machines fold into their intricate architectures!

  20. Peppytides: Interactive Models of Polypeptide Chains

    SciTech Connect (OSTI)

    Zuckermann, Ron; Chakraborty, Promita; Derisi, Joe

    2014-01-21

    Peppytides are scaled, 3D-printed models of polypeptide chains that can be folded into accurate protein structures. Designed and created by Berkeley Lab Researcher, Promita Chakraborty, and Berkeley Lab Senior Scientist, Dr. Ron Zuckermann, Peppytides are accurate physical models of polypeptide chains that anyone can interact with and fold intro various protein structures - proving to be a great educational tool, resulting in a deeper understanding of these fascinating structures and how they function. Build your own Peppytide model and learn about how nature's machines fold into their intricate architectures!