Sample records for fac mgmt sap

  1. SCH-MGMT 597LG Humanitarian Logistics Spring 2012

    E-Print Network [OSTI]

    Nagurney, Anna

    SCH-MGMT 597LG ­ Humanitarian Logistics and Healthcare Spring 2012 Class Time: Tuesdays of people affected by them. Logistics plays a central role in all phases of disaster management and supporting humanitarian operations. The fundamental task of a logistics system is to deliver the appropriate

  2. SCH-MGMT 597LG Humanitarian Logistics Spring 2014

    E-Print Network [OSTI]

    Nagurney, Anna

    SCH-MGMT 597LG ­ Humanitarian Logistics and Healthcare Spring 2014 Class Time: Tuesdays of people affected by them. Logistics plays a central role in all phases of disaster management and supporting humanitarian operations. The fundamental task of a logistics system is to deliver the appropriate

  3. Project Paper mySAP Portals

    E-Print Network [OSTI]

    1 Project Paper mySAP Portals: Concept - Architecture - Technology Submitted by: Rahila Zahir Matriculation Number: 17321 14.06.2002 Supervised by: Prof. Dr. Florian Matthes Software Technology Systems Introduction to SAP Portals..................................................................18 3.1 SAP ­ User

  4. FACS analysis using splenocytes 1. Introduction

    E-Print Network [OSTI]

    Fukai, Tomoki

    , and analyzed by FACS. 2. Materials FACSCalibur (BD Biosciences) Cell Strainer 70 m (BD FALCON_#352350) Plunger 3. Methods 1. Place the Cell Strainer on 50 ml tube 2. Put spleen on the Cell Strainer 3. Add 0.5 ml 1 X ACK lysing buffer to remove red blood

  5. Policy Flash 2014-38 Federal Acquisition Circular (FAC) 2005...

    Broader source: Energy.gov (indexed) [DOE]

    8 Federal Acquisition Circular (FAC) 2005-76 Policy Flash 2014-38 Federal Acquisition Circular (FAC) 2005-76 Questions concerning this policy flash should be directed to Jason...

  6. POLICY FLASH 2014-31 Federal Acquisition Circulars (FACs) 2005...

    Office of Environmental Management (EM)

    POLICY FLASH 2014-31 Federal Acquisition Circulars (FACs) 2005-73 and 2005-74 POLICY FLASH 2014-31 Federal Acquisition Circulars (FACs) 2005-73 and 2005-74 Questions concerning...

  7. accelerated corrosion fac: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (FAC) is the most prevalent material degradation mechanism for low carbon steel in steam-water flow systems. The band of uncertainty in predictions of wear rate due to FAC...

  8. Information Management Software Services SAP Migrations Service

    E-Print Network [OSTI]

    , customers worldwide have maximized their SAP systems by providing a streamlined migration path to DB2Assessment Prepare SAP migration project plan templates before the project starts to allow extra time to define the order in which your SAP landscape(s) and systems are migrated. Once the migration assessment phase

  9. FAC 04-08 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand JumpConceptual Model,DOEHazelPennsylvania: EnergyExolis Energy JumpFAC 04-08 Jump to: navigation,

  10. Microsoft Word - FAC2005-19.doc

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions forCheneyNovember S. DEPARTMENTtheStatus of theLiebherrMay 6,To0,FAC

  11. Welcome to MGMT 301.07 (CRN 10862) Management and Organizational Behavior

    E-Print Network [OSTI]

    Young, Paul Thomas

    1 Welcome to MGMT 301.07 (CRN 10862) Management and Organizational Behavior Fall 2013 Wednesday 5 to provide you with a basic theoretical and practical framework for understanding the field of organizational behavior. The field will be examined at different levels (individual, group, organizational

  12. FAC 04-08, Appendix B | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand JumpConceptual Model,DOEHazelPennsylvania: EnergyExolis Energy JumpFAC 04-08 Jump to: navigation,B

  13. FAC 04-08, Appendix C | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand JumpConceptual Model,DOEHazelPennsylvania: EnergyExolis Energy JumpFAC 04-08 Jump to: navigation,BFAC

  14. FAC 04-08, Appendix D | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand JumpConceptual Model,DOEHazelPennsylvania: EnergyExolis Energy JumpFAC 04-08 Jump to: navigation,BFACD

  15. Agriculture, Forestry expand outreach programs UBC's two renewable-resources fac-

    E-Print Network [OSTI]

    Farrell, Anthony P.

    Agriculture, Forestry expand outreach programs UBC's two renewable-resources fac- ulties by providing ad- ministrative services and classroom spaceforanexpandedagricultural sciences

  16. Detection and Prediction of Errors in EPCs of the SAP Reference Model

    E-Print Network [OSTI]

    van der Aalst, Wil

    as a blueprint for roll-out projects of SAP's ERP system. It reflects Version18 4.6 of SAP R/3 which was marketedDetection and Prediction of Errors in EPCs of the SAP Reference Model J. Mendling a, H.M.W. Verbeek provide empirical evidence for these questions based on the SAP reference model. This model collection

  17. Share this with To learn more about SAP Application Management Services,

    E-Print Network [OSTI]

    Fisher, Kathleen

    . Built around fixed costs and timelines, this offering jumpstarts your SAP projects and quickly moves you manner Product Brief Potential Benefits · Fast and efficient access to SAP systems and infrastructure Services for SAP Jumpstart your SAP projects with a rapid, flexible infrastructure at a predictable price

  18. assessment sap comments: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 21 SAP 3.4: Abrupt Climate Change Chapter 4. The Potential for Abrupt Change in the Atlantic Environmental Sciences and...

  19. Critical Success Factors In Implementing SAP ERP Software

    E-Print Network [OSTI]

    Bhagwani, Anil

    2009-12-18T23:59:59.000Z

    This project gives an overview of the Systems Applications and Products in Data Processing (SAP) Enterprise Resource Planning (ERP) implementation roadmap and tools that make up a complete implementation method to allow any organization to plan...

  20. arterial specimens intravaskulaere: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Mgmt. Resolution: 31 Fac. Mgmt. Resolution: If the refrigerator temperature falls out refrigerator. This record must be kept for one year and then destroyed per State...

  1. IT-gesttztes Investitionscontrolling Arno Edinger, SAP Deutschland AG & Co. KG

    E-Print Network [OSTI]

    Manstein, Dietmar J.

    Rechenwerke #12;Projektsystem (PS) Das PSP-Element als zentrales Stammdatum © SAP 2009 / Page 6 Das Projektsystem ist... eigenständiges Modul und integraler Bestandteil des SAP ERP Systems. der Abbildung Betrachtung aller beteiligten Geschäftsvorfälle. Das PSP-Element im SAP Projektsystem eignet sich als zentra

  2. University of Connecticut Daily Temperature Log Specimen Refrigerator Log

    E-Print Network [OSTI]

    Oliver, Douglas L.

    University of Connecticut Daily Temperature Log ­ Specimen Refrigerator Log Month / Year Clinical ___ Fac. Mgmt. Resolution: 31 ___ Fac. Mgmt. Resolution: If the refrigerator temperature falls out refrigerator. This record must be kept for one year and then destroyed per State requirement

  3. OBJECT ORIENTED PROGRAMMING TECHNIQUES AND FAC METHOD IN NUMERICAL RESERVOIR SIMULATION \\Lambda

    E-Print Network [OSTI]

    OBJECT ORIENTED PROGRAMMING TECHNIQUES AND FAC METHOD IN NUMERICAL RESERVOIR SIMULATION \\Lambda in numerical simulation of flow through hydrocarbon reservoirs within limitations in computing time and memory. These consist of solution of the conservation equations whichs govern the motion of fluid through the reservoir

  4. Implementation of Resource Adapter for SAP R/3 and generation of java-proxy class of BAPIs

    E-Print Network [OSTI]

    Moeller, Ralf

    SAP as their Enterprise Information System. Integrating the EIS with the existing Application Server-Oriented approach in accessing the data from the EIS. For the SAP system, java-proxy class of BAPIs can be generated to access the data from SAP R/3. My project work is concerned with developing a Resource Adapter for SAP

  5. The robotic fac?ade : a design solution for energy conservation in the CityHome of the future

    E-Print Network [OSTI]

    Lonergan, Ronan (Ronan Patrick)

    2011-01-01T23:59:59.000Z

    This project outlines a design for a fac?ade product that can potentially be used to simplify both the construction and operation of an apartment in an urban setting. Additionally, this fagade module has been conceptualized ...

  6. Flash2003-01fac2001-11.pdf | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,OfficeEnd ofEvaluations inCommittee |a Career in92 of3.pdf6.pdf3-01fac2001-11.pdf

  7. Microsoft Word - Flash2009dashxxFAC34.doc | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions forCheneyNovember S.Fluor-B&W (08-93)Flash2009dashxxFAC34.doc

  8. Microsoft Word - Flash2008-08attachmentFAC22.doc | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015of 2005 atthe DistrictIndependent ResearchFlash2008-08attachmentFAC22.doc More

  9. Financial Aid Standards for SAP Page 1 Financial Aid Standards for

    E-Print Network [OSTI]

    Leistikow, Bruce N.

    funding. If a student does not meet the standards of academic progress, he/she will not be eligibleFinancial Aid Standards for SAP Page 1 Financial Aid Standards for Satisfactory Academic Progress Affects Your Financial Aid Eligibility Updated February 2012 #12;Financial Aid Standards for SAP Page 2

  10. Summary We monitored the radial distribution of sap flux density (v; g H2O m2

    E-Print Network [OSTI]

    Teskey, Robert O.

    the use of stored water in the sap- wood (Whitehead and Jarvis 1981) and the need to account reported that the radial sap flux density profile in trees can vary with time (Swanson 1967, Mark and Crews

  11. Postsynaptic Density Scaffold SAP102 Regulates Cortical Synapse Development through EphB and PAK Signaling Pathway

    E-Print Network [OSTI]

    Murata, Yasunobu

    Membrane-associated guanylate kinases (MAGUKs), including SAP102, PSD-95, PSD-93, and SAP97, are scaffolding proteins for ionotropic glutamate receptors at excitatory synapses. MAGUKs play critical roles in synaptic ...

  12. SAP / Financial Program Sequence June 3, 2014 Johns Hopkins. All rights reserved.

    E-Print Network [OSTI]

    von der Heydt, Rüdiger

    SAP / Financial Program Sequence June 3, 2014 © Johns Hopkins. All rights reserved. Sponsored Projects E-Courses Intro to Sponsored Projects Business Ethics Training for Foreign Field Offices Effort Reporting System Admins Effort Reporting System Certifiers Effort Refresher for Certifiers

  13. Fuel Accident Condition Simulator (FACS) Furnace for Post-Irradiation Heating Tests of VHTR Fuel Compacts

    SciTech Connect (OSTI)

    Paul A Demkowicz; Paul Demkowicz; David V Laug

    2010-10-01T23:59:59.000Z

    Abstract –Fuel irradiation testing and post-irradiation examination are currently in progress as part of the Next Generation Nuclear Plant Fuels Development and Qualification Program. The PIE campaign will include extensive accident testing of irradiated very high temperature reactor fuel compacts to verify fission product retention characteristics at high temperatures. This work will be carried out at both the Idaho National Laboratory (INL) and the Oak Ridge National Laboratory, beginning with accident tests on irradiated fuel from the AGR-1 experiment in 2010. A new furnace system has been designed, built, and tested at INL to perform high temperature accident tests. The Fuel Accident Condition Simulator furnace system is designed to heat fuel specimens at temperatures up to 2000°C in helium while monitoring the release of volatile fission metals (e.g. Cs, Ag, Sr, Eu, and I) and fission gases (Kr, Xe). Fission gases released from the fuel to the sweep gas are monitored in real time using dual cryogenic traps fitted with high purity germanium detectors. Condensable fission products are collected on a plate attached to a water-cooled cold finger that can be exchanged periodically without interrupting the test. Analysis of fission products on the condensation plates involves dry gamma counting followed by chemical analysis of selected isotopes. This paper will describe design and operational details of the Fuel Accident Condition Simulator (FACS) furnace system, as well as preliminary system calibration results.

  14. UTILIZING SAP'S SYBASE UNWIRED PLATFORM AND MOBILE BUSINESS OBJECTS TO CREATE A MOBILE PLANT MAINTENANCE APPLICATION.

    E-Print Network [OSTI]

    ElAarag, Hala

    .......................................................... 12 #12;1 ABSTRACT The purpose of this project is to use System Analysis and Program DevelopmentUTILIZING SAP'S SYBASE UNWIRED PLATFORM AND MOBILE BUSINESS OBJECTS TO CREATE A MOBILE PLANT by System Analysis and Program Development and the server access they so graciously provided to both myself

  15. Page 1 of 6 MULTI-USE LIST FOR THE PROVISION OF SAP AND ENTERPRISE SYSTEMS

    E-Print Network [OSTI]

    Greenslade, Diana

    Page 1 of 6 MULTI-USE LIST FOR THE PROVISION OF SAP AND ENTERPRISE SYSTEMS RESOURCES Ref: 098 and implementation of business systems, including requirements specification, process analysis and design, business and metrics reporting, benchmarking, and surveying. Project and Program Management Including but not limited

  16. HOMOGENIZATION OF THE STEFAN PROBLEM, WITH APPLICATION TO MAPLE SAP EXUDATION

    E-Print Network [OSTI]

    Stockie, John

    are then applied to solve a much more complicated problem involving multi-phase flow and heat transport in trees that arises from multi-phase flow in a porous medium coupled with heat transport. In particular, we are motivated by the study of sap flow in a maple tree that is subject to both thawing and freezing [5]. We seek

  17. Last update: 3/22/2011 SYN COURSE SEC TITLE FAC ROOM TY DAY START END CR PREREQ NOTES

    E-Print Network [OSTI]

    Bogaerts, Steven

    201A 1W Inro to Afria and the Diaspora Bailey HOLL 315 CLS MSF 11:30AM 12:30PM 4 1449 AFDS 201C 1W of Chair/Director 1232 ENGL 190A 1W AfroCaribbean Studies Wilkerson HOLL 217 CLS MWF 01:50PM 02:50PM 4 ENGL 06:30PM 09:30PM 4 SYN COURSE SEC TITLE FAC ROOM TY DAY START END CR PREREQ NOTES 4406 ENGL 180A 1W

  18. Start-to-end global imaging as a sunward propagating, SAPS-associated giant undulation event

    SciTech Connect (OSTI)

    Henderson, Michael G [Los Alamos National Laboratory; Donovan, Eric F [U OF CALGARY; Foster, John C [MIT; Mann, Ian R [UNIV OF ALBERTA; Immel, Thomas J [UC/BERKELEY; Mende, Stephen B [UN/BERKELEY; Sigwarth, John B [NASA/GSFC

    2009-01-01T23:59:59.000Z

    We present high-time resolution global imaging of a sunward propagating giant undulation event from start to finish. The event occurred on November 24, 2001 during a very disturbed storm interval. The giant undulations began to develop at around 13UT and persisted for approximately 2 hours. The sunward propagation speed was on the order of 0.6 km/s (relative to SM coordinate system). The undulations had a wavelength of {approx} 750 km, amplitudes of {approx} 890 km and produced ULF pulsations on the ground with a period of {approx} 1108s. We show that the undulations were associated with SAPs flows that were caused by the proton plasma sheet penetrating substantially farther Earthward than the electron plasma sheet on the duskside. The observations appear to be consistent with the development of a shear flow and/or ballooning type of instability at the plasmapause driven by intense SAPS-associated shear flows.

  19. From: Human Resources To: faculty@ou.edu, staff@ou.edu, HSC-Faculty, HSC-Staff, Tulsa-COM-Resident, Tulsa-Fac-Staff

    E-Print Network [OSTI]

    Oklahoma, University of

    From: Human Resources To: faculty@ou.edu, staff@ou.edu, HSC-Faculty, HSC-Staff, Tulsa-COM-Resident, Tulsa-Fac-Staff ----------------------Email Content----------------------- Subject: OUMM: News from to OU employees at the HSC and Tulsa campuses. Bring your current employee ID to receive your free

  20. Deflation and Flexible SAP-Preconditioning of GMRES in Lattice QCD Simulation

    E-Print Network [OSTI]

    Andreas Frommer; Andrea Nobile; Paul Zingler

    2012-04-24T23:59:59.000Z

    The simulation of lattice QCD on massively parallel computers stimulated the development of scalable algorithms for the solution of sparse linear systems. We tackle the problem of the Wilson-Dirac operator inversion by combining a Schwarz alternating procedure (SAP) in multiplicative form with a flexible variant of the GMRES-DR algorithm. We show that restarted GMRES is not able to converge when the system is poorly conditioned. By adding deflation in the form of the FGMRES-DR algorithm, an important fraction of the information produced by the iterates is kept between successive restarts leading to convergence in cases in which FGMRES stagnates.

  1. Vice President for Enrollment Mgmt.

    E-Print Network [OSTI]

    Moore, Paul A.

    & Student Services Gail McRoberts International Student Services TBD Student Financial Aid Laura Emch Office of Assessment Julie Matuga Honors Program Paul Moore ROTC Army/Air Force Doug Mohler / Hien Nguyen

  2. Vice President for Enrollment Mgmt.

    E-Print Network [OSTI]

    Moore, Paul A.

    Annette Badik Graduate Enrollment Operations Gail McRoberts International Enrollment Operations StudentX / BG Perspective Neal Jesse Honors Program Paul Moore ROTC Army/Air Force Doug Mohler / Hien Nguyen

  3. R00475--FM Risk Mgmt

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring SolarNo. 195

  4. Summary We analyzed assumptions and measurement er-rors in estimating canopy transpiration (EL) from sap flux (JS)

    E-Print Network [OSTI]

    Ewers, Brent E.

    - tively. Sap flux measured in stems did not lag JS measured in branches, and time and frequency domain. Introduction Stomata respond to environmental variation, regulate water loss and carbon dioxide gain, and thus biosphere­atmosphere exchange of mass and energy. From porometry measure- ments, leaf conductance (gS) can

  5. The use of kelp sieve tube sap metal composition to characterize urban runoff in southern California coastal waters

    E-Print Network [OSTI]

    Manley, Steven L.

    The use of kelp sieve tube sap metal composition to characterize urban runoff in southern California a b s t r a c t This study introduces an innovative method for biomonitoring using giant kelp analyses indicate that polluted seawater may affect kelp uptake of metals essential for cellular function

  6. THE SAP3 COMPUTER PROGRAM FOR QUANTITATIVE MULTIELEMENT ANALYSIS BY ENERGY DISPERSIVE X-RAY FLUORESCENCE

    SciTech Connect (OSTI)

    Nielson,, K. K.; Sanders,, R. W.

    1982-04-01T23:59:59.000Z

    SAP3 is a dual-function FORTRAN computer program which performs peak analysis of energy-dispersive x-ray fluorescence spectra and then quantitatively interprets the results of the multielement analysis. It was written for mono- or bi-chromatic excitation as from an isotopic or secondary excitation source, and uses the separate incoherent and coherent backscatter intensities to define the bulk sample matrix composition. This composition is used in performing fundamental-parameter matrix corrections for self-absorption, enhancement, and particle-size effects, obviating the need for specific calibrations for a given sample matrix. The generalized calibration is based on a set of thin-film sensitivities, which are stored in a library disk file and used for all sample matrices and thicknesses. Peak overlap factors are also determined from the thin-film standards, and are stored in the library for calculating peak overlap corrections. A detailed description is given of the algorithms and program logic, and the program listing and flow charts are also provided. An auxiliary program, SPCAL, is also given for use in calibrating the backscatter intensities. SAP3 provides numerous analysis options via seventeen control switches which give flexibility in performing the calculations best suited to the sample and the user needs. User input may be limited to the name of the library, the analysis livetime, and the spectrum filename and location. Output includes all peak analysis information, matrix correction factors, and element concentrations, uncertainties and detection limits. Twenty-four elements are typically determined from a 1024-channel spectrum in one-to-two minutes using a PDP-11/34 computer operating under RSX-11M.

  7. New Combined FAC Application

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked QuestionsDepartment ofDepartment of Energy New AirDepartment of Washington,

  8. Strategic Plan Items & Projects Direct Report 1.1.1 Review and update university policies and SAPs Orkun Toros 08/31/14

    E-Print Network [OSTI]

    O'Toole, Alice J.

    and update university policies and SAPs Orkun Toros 08/31/14 1.1.2 Implement dynamic web based FAQ System.3 Improve Processes and Systems #12;Strategic Plan Items & Projects Direct Report Planned Completion ActualStrategic Plan Items & Projects Direct Report Planned Completion Actual Completion 1.1.1 Review

  9. Location Student Fac/Staff Disabled Special OLLI Reserved Electric Carpool Park and Pay 30 Minute Loading Maint/Service State Vehicle Motorcycle Control* S / L** P / T / LD*** Location Total Alumni House 1 1 17 D L P 19

    E-Print Network [OSTI]

    de Lijser, Peter

    Loading Maint/Service State Vehicle Motorcycle Control* S / L** P / T / LD*** Location Total Alumni House 1 1 17 D L P 19 A North 1,101 5 D L P 1,101 A South 280 D L P 280 A South Fac/Staff 166 2 8 14 3 D L P 190 Arts Drive 9 D L P 9 Byrnes Circle 12

  10. Microsoft Word - HQ prjct mgmt gde

    Broader source: Energy.gov (indexed) [DOE]

    of the PMP that the Project Manager develops for the taskproject. DEPARTMENT OF ENERGY INFORMATION MANAGEMENT PROJECT MANAGEMENT GUIDE PART IV PROJECT MANAGEMENT TRAINING...

  11. Source identification of lead pollution in the atmosphere of Shanghai City by analyzing single aerosol particles (SAP)

    SciTech Connect (OSTI)

    Wang, J.; Guo, P.; Li, X. [and others] [and others

    2000-05-15T23:59:59.000Z

    A new method combining the pattern recognition (PR) technique with micro-PIXE spectrum was used for direct assessment of lead pollution in the atmosphere of Shanghai City. Single aerosol particles (SAP) of PM{sub 10} (<10 {micro}m) were analyzed using the nuclear microprobe. Every particle is characterized with its micro-PICE spectrum, which can be considered its fingerprint. The PR technique was applied to trace a lead contaminated aerosol particle back to its source. The discrimination of different pollutant sources was enhanced with investigating the individual aerosol particles. The results showed that the lead contamination from automobile exhaust should not be neglected. The lead concentration with low level was detected in most unleaded gasoline particles; however, the highest lead level of 1,500 ppm was found in one of them. Furthermore, four other main pollutant sources contributing to the lead contamination in the Shanghai atmosphere were clearly identified by this method. They are the cement industry, the coal combustion, the oil combustion, and the metallurgic industry. Some other unidentified particles suggested that some more lead emitters might also exist in Shanghai.

  12. A statistical method for estimating wood thermal diffusivity and probe geometry using in situ heat response curves from sap flow measurements

    SciTech Connect (OSTI)

    Chen, Xingyuan; Miller, Gretchen R.; Rubin, Yoram; Baldocchi, Dennis

    2012-09-13T23:59:59.000Z

    The heat pulse method is widely used to measure water flux through plants; it works by inferring the velocity of water through a porous medium from the speed at which a heat pulse is propagated through the system. No systematic, non-destructive calibration procedure exists to determine the site-specific parameters necessary for calculating sap velocity, e.g., wood thermal diffusivity and probe spacing. Such parameter calibration is crucial to obtain the correct transpiration flux density from the sap flow measurements at the plant scale; and consequently, to up-scale tree-level water fluxes to canopy and landscape scales. The purpose of this study is to present a statistical framework for estimating the wood thermal diffusivity and probe spacing simutaneously from in-situ heat response curves collected by the implanted probes of a heat ratio apparatus. Conditioned on the time traces of wood temperature following a heat pulse, the parameters are inferred using a Bayesian inversion technique, based on the Markov chain Monte Carlo sampling method. The primary advantage of the proposed methodology is that it does not require known probe spacing or any further intrusive sampling of sapwood. The Bayesian framework also enables direct quantification of uncertainty in estimated sap flow velocity. Experiments using synthetic data show that repeated tests using the same apparatus are essential to obtain reliable and accurate solutions. When applied to field conditions, these tests are conducted during different seasons and automated using the existing data logging system. The seasonality of wood thermal diffusivity is obtained as a by-product of the parameter estimation process, and it is shown to be affected by both moisture content and temperature. Empirical factors are often introduced to account for the influence of non-ideal probe geometry on the estimation of heat pulse velocity, and they are estimated in this study as well. The proposed methodology can be applied for the calibration of existing heat ratio sap flow systems at other sites. It is especially useful when an alternative transpiration calibration device, such as a lysimeter, is not available.

  13. rfc:fac | NSAC Subcommittee 2012

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron4 Self-Scrubbing:,, ,Development of NovelHigh( (Improving9Facilities

  14. Microsoft Word - CPR DID-MGMT-81466 - Final _2_

    Energy Savers [EERE]

    Electronic History and Forecast File NA 7 1.0. USERELATIONSHIP: 1.1. The IPMR contains data for measuring cost and schedule performance on Department of Defense (DoD)...

  15. REVISED Sr. Business Analyst - Supply Chain Mgmt. (Term Position...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    business system. The BA will lead the functional team, including Subject Matter Experts (SME), in reviewing, defining, and recommending changes to business processes for...

  16. Strategic Management Journal Strat. Mgmt. J., 29: 10971115 (2008)

    E-Print Network [OSTI]

    Sharp, Kim

    2008-01-01T23:59:59.000Z

    a partial equity stake exhibit a more tolerant attitude. We also expect that as firms accumulate foreign long recognized that firms in such industries require specific theoretical and empirical analysis and technical change have altered their domestic competitive environ- ment in substantial ways. International

  17. DI-MGMT-81861 DOE Changes Version | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsNovember 13, 2014Contributing DataDepartment of EnergyC2M2D

  18. R00475--FM Risk Mgmt | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently20,000 RussianBy: ThomasDepartment ofThisHiTek logo HiTekLoans |DTE EnergyDr.

  19. Microsoft PowerPoint - Surash.AcquisitionProjectMgmt.042909

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_Cost Estimating Panel MicrosoftSeptember 15, September 15, Management

  20. Microsoft Word - CPR DID-MGMT-81466 - Final _2_

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015of 2005 atthe DistrictIndependent Research Assessment of Project CONTRACT AND

  1. Microsoft Word - CPR DID-MGMT-81466 - Final _2_

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015of 2005 atthe DistrictIndependent Research Assessment of Project CONTRACT AND

  2. Microsoft Word - Appendix G - Wildland Fire Mgmt Plan.docx

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA groupTuba City, Arizona, DisposalFourthNrr-osams ADMIN5510Old81Rocky FlatsDRockyG

  3. REVISED Sr. Business Analyst - Supply Chain Mgmt. (Term Position) |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's Possible forPortsmouth/Paducah47,193.70COMMUNITYResponses:December 11, 2014WD2 MAY2REVIEW

  4. Energy Mgmt. Systems/Building Controls | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489 No revision|LLC Place: Ketchum,SPARQL SPARQLMatters LLC

  5. Microsoft Word - S05725_SAP

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling7 August 2008 Office of Legacy Management

  6. Last First Ex Grad Maj TITLE Fac Last Fac First Dept Atkins Madeline May 2015 GNV

    E-Print Network [OSTI]

    Rollins, Andrew M.

    Image Analytics of Micro- Inverters used for PV Modules French Roger EMSE Fagerholm Cara May-17 EMS Degradation of UV Stabilized PET for Solar Films and PV Module Backsheets French Roger EMSE Flinn Timothy May

  7. Transmission Vegetation Management NERC Standard FAC-003-2 Technical...

    Open Energy Info (EERE)

    background to the requirements of the Standard. The intentions of the Standard Drafting Team in developing many key areas of this Revision are also explained in this document. The...

  8. POLICY FLASH 2015-21 - Federal Acquisition Circulars (FACs) 2005...

    Energy Savers [EERE]

    SUMMARY: Attached for your information is a brief summary of Federal Acquisition Regulation (FAR) amendments, published in the December 15, 2014 Federal Register at 79 FR...

  9. POLICY FLASH 2015-21 - Federal Acquisition Circulars (FACs) 2005...

    Energy Savers [EERE]

    1 interim rule. Other Flashes are available online at the following website: http:energy.govmanagementoffice-managementoperational-managementpr.... Questions concerning...

  10. POLICY FLASH 2013-67 FAC-68 | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2:Introduction toManagementOPAM PolicyOfEnergyOutreachPNNL

  11. Microsoft Word - FacAgreementand -Consent-Order_FINAL.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItemResearch > The EnergyCenterDioxide Capture in the PresenceEnergy Department2

  12. FAC2001-13.pdf | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Department of Energy 088: FederalEconomicEnergyExportand3.pdf

  13. FAC2001-14.pdf | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Department of Energy 088: FederalEconomicEnergyExportand3.pdf4.pdf

  14. FAC2003-01.pdf | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Department of Energy 088:

  15. POLICY FLASH 2013-67 FAC-68 | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the.pdfBreaking ofOilNEWResponse toOctoberMultifamilyDepartment ofBusiness (WOSB) Program7

  16. fac2001-26.pdf | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015ofDepartment of EnergyThePatricia2012) | DepartmentAs acompanies |6.pdf More

  17. fac2001-27.pdf | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015ofDepartment of EnergyThePatricia2012) | DepartmentAs acompanies |6.pdf

  18. Initial Application for FAC-C, Purchasing, Financial Assistance and

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the.pdfBreaking of BlytheDepartment ofEnergy Information for DepartmentofIngrid

  19. Microsoft Word - FAC2005-19.doc | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions forCheneyNovember S. DEPARTMENTtheStatus of theLiebherrMay

  20. Microsoft Word - FAC2005-27.doc | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions forCheneyNovember S. DEPARTMENTtheStatus of

  1. Miami Dade County Resource Recovery Fac Biomass Facility | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant JumpMarysville, Ohio:Menomonee| Open Energy Information

  2. Microsoft Word - FAC2005-19.doc | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2:Introduction to EnergyDepartmentOfficeNOTICE:Inspections andMicrosoft WordMemorandum

  3. Transmission Vegetation Management NERC Standard FAC-003-2 Technical

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTown of Ladoga, Indiana (Utility Company) JumpTradeWindPrepared as Information

  4. fac2001-27.pdf | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed off Energy.gov. Are you sure you want to follow this link? If so,MarchDEPARTMENT

  5. Initial Application for FAC-C, Purchasing, Financial Assistance and

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(Fact Sheet),EnergyImprovementINDIANManagement1, 2010 SmartProperty Management

  6. Running Greener: E-Mobility at SAP

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin ofEnergy at Waste-to-Energy usingofRetrofittingFundA l i

  7. Agro-environmental partnerships facilitate sustainable wine-grape production and assessment

    E-Print Network [OSTI]

    Broome, Janet C; Warner, Keith Douglass

    2008-01-01T23:59:59.000Z

    pest management, wine quality, energy efficiency, materialPest mgmt. Wine quality Ecosystem mgmt. Energy efficiency

  8. Microsoft Word - XX 14 Connolly named VP Gen - Asset Mgmt FINAL...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of Generation Scheduling, which includes hydroelectric duty scheduling of the 31 dams in the Federal Columbia River Power System, day-ahead system planning and policy issues...

  9. MGMT 350: Leadership & Social Responsibility Meeting times: M/W/F 10-10:50am

    E-Print Network [OSTI]

    Young, Paul Thomas

    ­ human, physical, technological, financial, legal, etc ­ but also how the organization impacts its environment socially, ethically, environmentally, as well as financially. B. OVERALL COURSE GOALS Students to address social, ethical, environmental and economic challenges at local, national and international levels

  10. Microsoft Word - Records Mgmt Blue Cover Report 9-1-10

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2:Introduction toManagement of the National NuclearRegulation;I I4-15Follow-up Audit on

  11. Microsoft Word - XX 14 Connolly named VP Gen - Asset Mgmt FINAL.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE625Data Show Filtration8,2 14 BONNEVILLE POWER0

  12. List of Energy Mgmt. Systems/Building Controls Incentives | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOf Kilauea Volcano,LakefrontLighthouse SolarIListsourceInformation

  13. Microsoft Word - 329174_DOE FY14 Non IT Mgmt Ltr v9.docx

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015of 2005 atthe District ofInstituteMicrosoft PowerPoint4:DepartmentAudit of the

  14. Microsoft Word - 2011O-02non-union,non-mgmt.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your HomeOverviewCleanupShipping Form3 -Rick AIKEN,Leckband

  15. Blackberries and Barnyards: Patent Trolls and the Perils of Innovation

    E-Print Network [OSTI]

    Magliocca, Gerard N

    2007-01-01T23:59:59.000Z

    Brief of Amicus Curiae Rembrandt IP Mgmt. , L.L.C. , forcefully); Brief of Rembrandt IP Mgmt. ,  Mercexchange, (

  16. Data:Cd66912f-ac4c-4a5f-ac64-750948dd9b7f | Open Energy Information

    Open Energy Info (EERE)

    1 2 3 Next >> Basic Information Utility name: Farmers' Electric Coop, Inc (New Mexico) Effective date: 20100501 End date if known: Rate name: Small Commercial Sector:...

  17. agudo simplificado saps: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    resource planning (ERP) system : governance model and process MIT - DSpace Summary: Raytheon produces a diverse range of defense products using a wide range of business systems...

  18. T-542: SAP Crystal Reports Server Multiple Vulnerabilities | Department of

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014,Zaleski -BlueprintThis

  19. The Fuel Accident Condition Simulator (FACS) furnace system for high temperature performance testing of VHTR fuel

    SciTech Connect (OSTI)

    Paul A. Demkowicz; David V. Laug; Dawn M. Scates; Edward L. Reber; Lyle G. Roybal; John B. Walter; Jason M. Harp; Robert N. Morris

    2012-10-01T23:59:59.000Z

    The AGR-1 irradiation of TRISO-coated particle fuel specimens was recently completed and represents the most successful such irradiation in US history, reaching peak burnups of greater than 19% FIMA with zero failures out of 300,000 particles. An extensive post-irradiation examination (PIE) campaign will be conducted on the AGR-1 fuel in order to characterize the irradiated fuel properties, assess the in-pile fuel performance in terms of coating integrity and fission metals release, and determine the fission product retention behavior during high temperature safety testing. A new furnace system has been designed, built, and tested to perform high temperature accident tests. The Fuel Accident Condition Simulator furnace system is designed to heat fuel specimens at temperatures up to 2000 degrees C in helium while monitoring the release of volatile fission metals (e.g. Cs, Ag, Sr, and Eu), iodine, and fission gases (Kr, Xe). Fission gases released from the fuel to the sweep gas are monitored in real time using dual cryogenic traps fitted with high purity germanium detectors. Condensable fission products are collected on a plate attached to a water-cooled cold finger that can be exchanged periodically without interrupting the test. Analysis of fission products on the condensation plates involves dry gamma counting followed by chemical analysis of selected isotopes. This paper will describe design and operational details of the Fuel Accident Condition Simulator furnace system and the associated fission gas monitoring system, as well as preliminary system calibration results.

  20. Cornell-developed systems that employ these abstractions are widespread. One example is CS fac-

    E-Print Network [OSTI]

    Keinan, Alon

    at Amazon.com. Distributed computing will play an increasingly critical role in the global cyber- ing the performance and security properties of the system. Sirer's work on the CoDoNS system has shown domain name space for all of China. Mission-critical distributed systems Mission-critical distributed

  1. Multi-touch Display using Combination of FTIR and HD KAI, Fac. of Mathematics

    E-Print Network [OSTI]

    Durikovic, Roman

    in the near infrared light spectrum. There are two known diffuse il- lumination methods, rear and front total internal reflection (FTIR) gives the best results. Categories and Subject Descriptors B.4.2 [Input total internal reflection 1. INTRODUCTION Natural interaction has been always the goal of Human computer

  2. Sociotechnical complexities associated with the development of Building Integrated Photovoltaic fac?ade systems

    E-Print Network [OSTI]

    Moreno, Jorge (Jorge Alejandro Moreno de la Carrera)

    2013-01-01T23:59:59.000Z

    Significant opportunities to improve the energy use in buildings open remarkable possibilities for innovation over the next two decades. Particularly in the United States, 41% of primary energy consumption in 2010 went ...

  3. POLICY FLASH 2015-21 - Federal Acquisition Circulars (FACs) 2005-79,

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2:Introduction toManagementOPAM PolicyOfEnergyOutreachPNNLIMPLEMENTATION

  4. Policy Flash 2013-27 Federal Acquisition Circular (FAC) 2005-65 |

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2:Introduction toManagementOPAM5ParabolicDepartment of Energy 27 Federal Acquisition

  5. Policy Flash 2013-37 Federal Acquisition Circular (FAC) 2005-66 |

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2:Introduction toManagementOPAM5ParabolicDepartment of Energy 27

  6. Policy Flash 2013-63 Federal Acquisition Circular (FAC) 2005-67 |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHA Administrative Judgea.Work Plan for FY7 DATE:14

  7. Policy Flash 2014-38 Federal Acquisition Circular (FAC) 2005-76 |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHA Administrative Judgea.Work Plan for FY7theReporting

  8. Policy Flash 2015-07 - FAC 2005-78 | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHA Administrative Judgea.Work Plan forand Special H Clause |DATE:

  9. Flash2003-01fac2001-11.pdf | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Departmentof OhioFirst Annual PostSmart Grid Progress

  10. Policy FLash 2014-36 FAC 2005-75 | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO Overview OCHCO Overview OCHCO OCHCOControlGuide to aEnergyPlanningPolicy BulletinFLash

  11. Policy Flash 2013-63 Federal Acquisition Circular (FAC) 2005-67 |

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T en YMedicineWhatAssistance Letter 2013-03 |and

  12. Policy Flash 2014-11 Federal Acquisition Circular (FAC) 2005-71 |

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T en YMedicineWhatAssistanceNotification of|10Department of

  13. Policy Flash 2014-38 FAC 2005-76 | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T enAmount for Individual Executive Salary4

  14. Policy Flash 2014-38 Federal Acquisition Circular (FAC) 2005-76 |

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T enAmount for Individual Executive Salary4Department of

  15. Policy Flash 2015-07 - FAC 2005-78 | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T enAmount for Individual Executive4 - Class Deviation:

  16. POLICY FLASH 2015-24 - Federal Acquisition Circular (FAC) 2005-82 |

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,39732onMakeEducation ProgramsTour Tracker PIADepartment ofDepartment

  17. POLICY FLASH 2015-32 - Federal Acquisition Circular (FAC) 2005-83 |

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,39732onMakeEducation ProgramsTour TrackerDepartment of Energy 2

  18. POLICY FLASH 2014-31 Federal Acquisition Circulars (FACs) 2005-73 and

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the.pdfBreaking ofOilNEWResponse toOctoberMultifamilyDepartmentBriefing Process |2005-74 |

  19. Policy Flash 2013-37 Federal Acquisition Circular (FAC) 2005-66 |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin of Contamination in235-1Department of60 DATE: March 25, 2011 TO:Policy7 DATE:91Final

  20. Microsoft Word - Flash2008-08attachmentFAC22.doc

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions forCheneyNovember S.Fluor-B&W (08-93) United970.5227-221 SUMMARY:

  1. Policy FLash 2014-36 FAC 2005-75 | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked QuestionsDepartmentGas and|Hours | Department of Energy Plug

  2. Policy Flash 2013-27 Federal Acquisition Circular (FAC) 2005-65 |

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked QuestionsDepartmentGas and|Hours | Department of Energy720 DATE:854Department

  3. Policy Flash 2014-11 Federal Acquisition Circular (FAC) 2005-71 |

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2:Introduction toManagementOPAM5ParabolicDepartment ofEnergy10 Class Deviation

  4. POLICY FLASH 2014-31 Federal Acquisition Circulars (FACs) 2005-73 and

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO Overview OCHCO Overview OCHCO OCHCO OverviewFreedomEnergyEnergyBriefing Process

  5. almahata sitta fall: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Theory of Systems of First Order Linear Equations. 37 MGMT 585 2013 Fall1 2013 Fall Syllabus Mathematics Websites Summary: MGMT 585 2013 Fall1 2013 Fall Syllabus MGMT 585:...

  6. ANNEX I / ANEXO I ADJUDICACIN PROVISIONAL DE BECARIOS CAMPAA

    E-Print Network [OSTI]

    Escolano, Francisco

    ALBEROLA LAURA FAC. CC. ECONÓMICAS Y EMPRESARIALESDIAZ-PAVON BERTOMEU ESMERALDA FAC. CC. ECONÓMICAS Y

  7. Data:Ac69267c-4bcc-449d-b172-53703574fac0 | Open Energy Information

    Open Energy Info (EERE)

    Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Elkhorn Rural Public Pwr Dist Effective date: 20130101 End date if known: Rate name: RATE 56,57 Urban...

  8. Last update: 8/18/11 SYN COURSE SEC TITLE FAC ROOM TY DAY START END CR PREREQ NOTES

    E-Print Network [OSTI]

    Bogaerts, Steven

    Independent Study Staff 1-4 1654 AFDS 492 0 AFDS Senior Project Staff 1-4 7562 ENGL 190A 1W Afro-Caribbean Lit-Caribbean Lit Wilkerson HOLL 217 CLS MWF 10:20AM 11:20AM 4 ENGL 101E 7535 ENGL 290A 1W American LiteraryH or HIST-227H or permission of instructor 3517 MUSI 208A 1W 20th Century American Music Siek KREG

  9. Last update: 10/17/13 SYN COURSE SEC TITLE FAC ROOM TY DAY START END CR PREREQ NOTES

    E-Print Network [OSTI]

    Bogaerts, Steven

    3168 ENGL 180A 1W Long Ago & Far Away Erwin HOLL 124 CLS MWF 10:20AM 11:20AM 4 ENGL 101E 3169 ENGL 180A Lit of Science Fiction McClelland HOLL 217 CLS MWF 01:50PM 02:50PM 4 ENGL 101E 7535 ENGL 290A 1W

  10. Last update: 10/31/13 SYN COURSE SEC TITLE FAC ROOM TY DAY START END CR PREREQ NOTES

    E-Print Network [OSTI]

    Bogaerts, Steven

    * 7535 ENGL 290A 1W American Literary Geneaologies Askeland HOLL 217 CLS MWF 11:30AM 12:30PM 4 ENGL 170

  11. Last update: 3/13/12 SYN COURSE SEC TITLE FAC ROOM TY DAY START END CR PREREQ NOTES

    E-Print Network [OSTI]

    Bogaerts, Steven

    END CR PREREQ NOTES 9524 ENGL 190A 1W Afro-Caribbean Studies Wilkerson HOLL 217 CLS MWF 03:00PM 04 0 Independent Study Staff 1-4 Permission Required 7186 ENGL 290A 1W American Literary Traditions Askeland HOLL 217 CLS MWF 12:40PM 01:40PM 4 ENGL 170, ENGL 180A or ENGL 190A/C 9599 ENGL 380A 1W The Beat

  12. Data:4ce23436-1708-4fac-8c1b-89f7650106bd | Open Energy Information

    Open Energy Info (EERE)

    than 1000 kW. Manufacturing Credit: This credit is only for manufactures with SIC codes 20 through 39 who are above 1000 kW but less than 5000 kW metered demand. The credit...

  13. Lab-on-a-chip flow cytometer and microfluidic fluorescence activated cell sorter ([Mu]FACS) for biomedical applications

    E-Print Network [OSTI]

    Cho, Sung Hwan

    2010-01-01T23:59:59.000Z

    with highly integrated microfluidics, optics, acoustics, andactuation,” submitted to Microfluidics and Nanofluidics (S. Tsai, Yu- Hwa Lo, “Microfluidics and photonics for Bio-

  14. Data:4e8fac39-1216-4901-9a87-4303efde603b | Open Energy Information

    Open Energy Info (EERE)

    1-9a87-4303efde603b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic...

  15. Data:25901054-7ddc-432f-ac48-7542db39cdb9 | Open Energy Information

    Open Energy Info (EERE)

    RES 1- Single-Phase General Service to use (0 - 3,000 kWhmonth) for residential, farm, commercial and public buildings Sector: Residential Description: Availability - Available...

  16. Applicability of the “Gallet equation” to the vegetation clearances of NERC Reliability Standard FAC-003-2

    SciTech Connect (OSTI)

    Kirkham, Harold

    2012-03-31T23:59:59.000Z

    NERC has proposed a standard to use to specify clearances between vegetation and power lines. The purpose of the rule is to reduce the probability of flashover to a calculably low level. This report was commissioned by FERC’s Office of Electrical Reliability. The scope of the study was analysis of the mathematics and documentation of the technical justification behind the application of the Gallet equation and the assumptions used in the technical reference paper

  17. Data:5c2ebd4a-779b-49ca-9f11-fac504355646 | Open Energy Information

    Open Energy Info (EERE)

    shall provide prepaid service to a single family residential dwelling. The charges for general residential electric service based on availability, application, character of...

  18. Data:17437da4-db13-4933-9fac-05d01acbb79c | Open Energy Information

    Open Energy Info (EERE)

    known: Rate name: Irrigation Service Schedule 2-3 Sector: Commercial Description: For pumping purposes to irrigate for crop production or similar purpose when all such service...

  19. Int. J. Engg, Sc. & Mgmt. / Vol. II / Issue II / Jul-Dec 2012 ISSN: 2231-3273 A HYBRID APPROACH TOWARDS INTRUSION DETECTION

    E-Print Network [OSTI]

    Sanyal, Sugata

    the network or the distributed computing infrastructure from malicious attacks like DDoS attack, key-logging

  20. major code major concentration code concentration AGBU Agricultural Business AGBM Agribusiness Management

    E-Print Network [OSTI]

    Lawrence, Rick L.

    Animal Science SCI Science ASSE Animal Science LVMI Livestock Mgmt & Industry ASSE Animal Science SCI

  1. Nipa (Nypa fruticans) sap as a potential feedstock for ethanol production Pramila Tamunaidu1

    E-Print Network [OSTI]

    Takada, Shoji

    . Introduction Currently the global ethanol supply is produced mainly from sugar and starch feedstocks. Sugar these feedstocks rely heavily on non-renewable fossil fuels and exploitation of forest lands which has negative cutting down the plant as in sugarcane which consequently produces large biomass waste such as straw

  2. Crude sap ascent and tree recovery 1 The watering of trees. Embolization and

    E-Print Network [OSTI]

    Boyer, Edmond

    - ascents thanks to the negative pressure generated by the evaporation of water from the leaves. Additively. · The concept of disjoining pressure must be taken into account and a strong negative pressure can be present in liquid-water bulks. · The disjoining pressure gradient induced by the flux of transpiration initiates

  3. Accelerating value capture of SAP enterprise resource planning (ERP) system : governance model and process

    E-Print Network [OSTI]

    Shih, Ting-Chih

    2009-01-01T23:59:59.000Z

    Raytheon produces a diverse range of defense products using a wide range of business systems and tools that are not currently integrated. To achieve the corporate vision of "one company", in 2005, Raytheon began to deploy ...

  4. SAP_on_HR2776_and_HR3221.pdf | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR -DepartmentRetailEnergy Role

  5. Nanoscale Physics The Wiess School of Natural Sciences

    E-Print Network [OSTI]

    Richards-Kortum, Rebecca

    Economics and Management (S) ECON 437 Energy Economics MGMT 636 Systems Analysis and Database Design MGMT in Semiconductor Manufacturing (S) ELEC 562 Submicrometer and Nanometer Device Technology (S) ELEC 565 Topics

  6. Scripta Fac. Sci. Nat. Univ. Masaryk. Brun., Volume 36, Geology. Brno, 2007. 57 The Early Miocene micromammalian assemblage from Mokr 1/2001 Turtle

    E-Print Network [OSTI]

    Horacek, Ivan

    and in deposits of the main brown coal seam (Merkur-North) or in the limestone quarry and erosive relicts of hot

  7. Data:2b44c914-9d66-462f-ac10-eca6644f9c6a | Open Energy Information

    Open Energy Info (EERE)

    facilities where such services can be provided directly from the 12.57.2 or 24.914.4 kV distribution system. Production Cost Adjustments In the event that adjustments are made...

  8. Data:2c75fac3-c8de-4af9-9fd3-ec543d395e4d | Open Energy Information

    Open Energy Info (EERE)

    date: 20140201 End date if known: Rate name: Small General Service Uncontrolled Water Heater Sector: Commercial Description: Source or reference: http:...

  9. Data:188ef1da-71c2-489f-ac19-5b3da3149f9c | Open Energy Information

    Open Energy Info (EERE)

    >> Basic Information Utility name: Cuming County Public Pwr Dist Effective date: 20111214 End date if known: Rate name: Municipal Commercial Rate Single Phase Sector:...

  10. Data:F4538b1e-396c-4e77-a9c3-4fac04c80d79 | Open Energy Information

    Open Energy Info (EERE)

    Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Tri-County Electric Coop, Inc (Kansas) Effective date: 20131101 End date if known: Rate...

  11. Data:272554fa-c2d1-4f73-9f54-7f3f9583ae2b | Open Energy Information

    Open Energy Info (EERE)

    and December, subject the established rules and regulations of the Cooperative. Wholesale Power Adjustment may apply. Source or reference: http:www.siouxvalleyenergy.comfiles...

  12. Data:9601bdb3-1156-4de8-b4fa-c9f1a164eed7 | Open Energy Information

    Open Energy Info (EERE)

    Residential Description: This service is available to all farm, residential, public buildings, and commercial service for continuous year around use, requiring less than 50...

  13. Data:E9d1575f-ac96-4257-ad7f-0c32dcb1754d | Open Energy Information

    Open Energy Info (EERE)

    metered services and Part B-23 is primary metered customers who own their own transformers and distribution service facilities and have a peak demand less than 800 KW. Part...

  14. Draft Title 40 CFR 191 compliance certification application for the Waste Isolation Pilot Plant. Volume 5: Appendices D and D, DEF, FAC

    SciTech Connect (OSTI)

    NONE

    1995-03-31T23:59:59.000Z

    This plan serves to describe the objectives of decommissioning for the Waste Isolation Pilot Plant (WIPP), identifies the elements necessary to accomplish the decommissioning, and defines the steps to execute those elements in a safe and environmentally sound manner. The plan provides a strategy for progressing from the final actions of the Disposal Phase, through the Decontamination and Decommissioning Phase, and into the initiation of the Long-Term Monitoring Phase. This plan describes a sequence of events for decontamination of the WIPP facilities and structures used to manage and contain TRU and TRU mixed waste during the receipt and emplacement operations. Alternative methods of decontamination are provided where practical. The methods for packaging and disposal of the waste generated (derived waste) during this process are discussed. The best available technology at the time of this plan`s development, may become outmoded by future technology and alternative strategies. If alternative technologies are identified the affected stakeholder(s), the Secretary of the Interior and the State will be consulted prior to implementation.

  15. Data:10faa314-c742-46b6-9493-8fac02a081c4 | Open Energy Information

    Open Energy Info (EERE)

    subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Baltimore Gas &...

  16. Data:9828fe39-9c3f-4fac-8ca9-7a8908b1f2da | Open Energy Information

    Open Energy Info (EERE)

    Indiana (Utility Company) Effective date: 20080701 End date if known: Rate name: Tariff A: Single Phase Residential Service 200 Amps or Less Sector: Residential Description:...

  17. Data:8fac01a0-76ee-48f3-8f3f-6cc62ec32199 | Open Energy Information

    Open Energy Info (EERE)

    reference: http:psc.ky.govtariffsElectricSalt%20River%20Electric%20Coop.%20CorpTariff.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW):...

  18. Data:70c83402-b68f-46d7-a4e1-030fac58aee1 | Open Energy Information

    Open Energy Info (EERE)

    R1PI Sector: Residential Description: Note: 10.00 added to Fixed monthly charge if Remote Read Device is used. Source or reference: Rates Binder 1, Illinois State University...

  19. Data:8e8569fb-812d-488a-85d7-010fac6de443 | Open Energy Information

    Open Energy Info (EERE)

    2.78 Standard Wood Pole with an Underground Feed, 30-35 feet: 4.24 Direct Burial Steel with an Underground Feed, 30 feet: 4.99 Source or reference: http:...

  20. Data:1d5cf1ef-fac5-40e2-af7f-727f242f4c9a | Open Energy Information

    Open Energy Info (EERE)

    Power Supply Cost Recovery Factor, Fixed Charge Customer Charge + Energy Optimization. kWh << Previous 1 2 3 Next >> Category:Categories Retrieved from "http:...

  1. Data:E32e3fac-39a0-475a-9f89-fee1783eeed9 | Open Energy Information

    Open Energy Info (EERE)

    Power Supply Cost Recovery Factor, Fixed Charge Customer Charge + Energy Optimization kWh << Previous 1 2 3 Next >> Category:Categories Retrieved from "http:...

  2. Published in the Proc. of GLOGIFT, Dec. 26-29, 2004, Inst. of Tech. Mgmt., Mussoorie, India, pp. 141-152 Practical Aspects of Technology and Innovation Capability Building

    E-Print Network [OSTI]

    Saha, Subir Kumar

    . 141-152 1 Practical Aspects of Technology and Innovation Capability Building: Learning from the Case@mech.iitd.ac.in Abstract Technology and innovation capabilities are becoming important as Indian organizations and firms and sustained. Our ongoing research on technology and innovation management and their role in competitiveness

  3. 2010 Sap Production Season Northern New England/New YorkNorthern New England/New York

    E-Print Network [OSTI]

    Hayden, Nancy J.

    .3% 92.3% 80 apYield(% 81.6% 60 70 Sa 60 New PE Used PE New PVC Used PVC Tubing Type NEW t bing is better cleaned) tubing. The newer polyethylene (PE) tubing is better than the old polyvinyl chloride (PVC

  4. Summary The empirical calibration of Granier-type heat dissipation sap flow probes that relate temperature difference

    E-Print Network [OSTI]

    Holbrook, N. Michele

    micrometeorological or gravimetric methods (Diawara et al. 1991, Granier et al. 1996b, David et al. 1997

  5. Aligned Partnerships

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    involved in collecting, reconciling, and transferring FAC funds. Also, WFO sponsors and CRADA partners program and financial personnel must process the FAC invoices for payment,...

  6. Isolation and characterization of PhoP homolog in Brucella abortus 

    E-Print Network [OSTI]

    Huang, Xin

    1997-01-01T23:59:59.000Z

    to defensins (20). With the further studies of defensin sensitive mutants, a collection of sap (sensitive to antimicrobial peptides) mutants of S. typhimurium were isolated and eight distinct peptide resistance loci scattered around the genome were... identified (40). Several Salmonella sap loci (the sapABCDF, sapJ, and sapG loci) independent from the phoPlphoQ regulatory system have been shown to be required for resistance to antimicrobial peptides (40, 41). The sapG sapJ or sapG sapABCDF double...

  7. Expansion of Domestic Production of Lithium Carbonate and Lithium...

    Broader source: Energy.gov (indexed) [DOE]

    2010 End Date: December, 2013 Partners Engineering: BE&K (a KBR company) Environmental Assessment: Nevada Bureau Land Mgmt Budget DOE Share - 28.4 million Rockwood Share -...

  8. Expansion of Domestic Production of Lithium Carbonate and Lithium...

    Broader source: Energy.gov (indexed) [DOE]

    June, 2014 Partners Engineering: BE&K (a KBR company), Jacobs Engineering Environmental Assessment: Nevada Bureau Land Mgmt Forecast Spending DOE Share - 28.4 million Rockwood...

  9. Liberty Utilities (Electric) - Commercial New Construction Rebate...

    Open Energy Info (EERE)

    Mgmt. SystemsBuilding Controls, Heat pumps, Lighting, Lighting ControlsSensors, Motor VFDs, Motors, Geothermal Heat Pumps, Control Sensors, Economizers Active Incentive Yes...

  10. Radiation and Chemical Risk Management | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Radiation & Chemical Risk Mgmt. Argonne assists technical problems as diverse as chemically and radiologically contaminated soil, military munitions disposal areas, and groundwater...

  11. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Lighting, Lighting ControlsSensors, Chillers, Heat Pumps, Air conditioners, Compressed air, Energy Mgmt. SystemsBuilding Controls, Motors, Motor VFDs, Agricultural Equipment,...

  12. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Heat Pumps, Lighting, Lighting ControlsSensors, Chillers, Furnaces, Boilers, Heat Pumps, Air conditioners, Heat recovery, Programmable Thermostats, Energy Mgmt. SystemsBuilding...

  13. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Institutional Savings Category: Biomass, Chillers, Furnaces, Boilers, Heat Pumps, Air conditioners, Energy Mgmt. SystemsBuilding Controls, Motor VFDs, Other EE Small...

  14. Local Option - Commercial PACE Financing (Utah) | Open Energy...

    Open Energy Info (EERE)

    Central Air conditioners, Chillers, CustomOthers pending approval, Doors, Energy Mgmt. SystemsBuilding Controls, Equipment Insulation, Furnaces, Heat pumps, Heat...

  15. DOE Facility Management Contracts Facility Owner Contractor

    Office of Environmental Management (EM)

    Palmer 630-252-2127 Oak Ridge Environmental Management EM Bechtel Jacobs Co LLC 12181997 12312011 12312011 Environmental Mgmt 1998 http:www.oakridge.doe.govexternal...

  16. Master of Science in Engineering and Technology Management Engineering Management Concentration Management of Technology Concentration

    E-Print Network [OSTI]

    Selmic, Sandra

    ELEN 527 Optical Communication Systems INEN 516 Production Planning Production Planning and Sequencing Control MGMT 510 Contemporary Management ENTR 501 Technology Transfer

  17. State-dependent M/G/1 type queueing analysis for congestion control in data networks

    E-Print Network [OSTI]

    Barakat, Chadi

    . Also affiliated with Fac. Ingeneria, Centro de Simulacion y Modelos, CESIMO, Universidad de Los Andes

  18. Data:5c03f4c3-de99-4ab4-92fa-c8eaa60c13d8 | Open Energy Information

    Open Energy Info (EERE)

    Rider: 1.00 per customer per month Source or reference: http:psc.wi.govapps40tariffsviewfile.aspx?typeelectric&id440 Source Parent: Comments Applicability Demand...

  19. Data:F6cbd293-b00c-4b6d-aa14-a8d5e2fac4d9 | Open Energy Information

    Open Energy Info (EERE)

    Inc Effective date: 20090201 End date if known: Rate name: SL- 400 Watt HPS 170 kWh ( Steel Pole Underground) Sector: Lighting Description: Source or reference: http:...

  20. Differential requirement for NMDAR activity in SAP97 -mediated regulation of the number and strength of glutamatergic AMPAR-containing synapses

    E-Print Network [OSTI]

    Liu, Mingna

    PSD-95-like, disc-large (DLG) family membrane-associated guanylate kinase proteins (PSD/DLG-MAGUKs) are essential for regulating synaptic AMPA receptor (AMPAR) function and activity-dependent trafficking of AMPARs. Using ...

  1. Summary We tested the hypothesis that the leaf area/sap-wood area ratio in Scots pine (Pinus sylvestris L.) is influenced

    E-Print Network [OSTI]

    Mencuccini, Maurizio

    - Monteith equation (to describe the transpiration rate of a coniferous canopy) and the Darcy equation (to and this information included in models of plant growth (Grace 1992). Whitehead and Jarvis (1981) proposed an equation

  2. TheoreticalandalgorithmicapproachestoaddresskeyissuesinSensornetworks,Adhocwirelessnetworks, and Peer-to-peer networks (simply called SAP networks) have played a central role in the development

    E-Print Network [OSTI]

    Wu, Jie

    and middleware support; power control systems and energy efficient design; applications; and performance

  3. The porous media model for the hydraulic system of a conifer tree: linking sap flux data to1 transpiration rate2

    E-Print Network [OSTI]

    Soatto, Stefano

    hydraulic system but also11 requires a direct estimation of its properties. Our proposed PM model play a dominant role in controlling CO2 uptake and4 partitioning of net radiation between latent-atmosphere flux measurement networks6 and free air CO2 enrichment (FACE) experiments require a quantitative

  4. Abstract--This paper introduces a framework for a highly constrained sports scheduling problem which is modeled from

    E-Print Network [OSTI]

    Bonomo, Flavia

    .goossens@econ.kuleuven.be). T. Bartsch is with the SAP AG, Walldorf, Germany (e-mail: thomas.bartsch@sap.com). F. Bonomo

  5. Cultivation and Care of Trees on the Farm in Texas. 

    E-Print Network [OSTI]

    Ness, H. (Helge)

    1922-01-01T23:59:59.000Z

    ................................................... 57 ....................... The Flow of the Sap and the Growth 57 ........................ Impediments to the Flow of the Sap 59 ................................. The Purposes of Pruning 59 ................................ Promotion...

  6. U S I N E S LOUISIANA TECH UNIVERSIT Y

    E-Print Network [OSTI]

    Selmic, Sandra

    management, you have an opportunity to work in a variety of organizations and businesses. Every industry FINC 318 Business Finance Management 310 MGMT 310 Management of Organizations Management 333 MGMT 310 Management of Organizations Marketing 300 MKTG 300 Marketing Principles and Policies SENIOR YEAR Business 495

  7. BUSINESS ADMINISTRATION -PLAN OF STUDY CATALOG YEAR: 2014-2015 Name________________________________________ PeopleSoft ID#____________________ Anticipated Date of Completion (MM/YY)_________

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Page 1 BUSINESS ADMINISTRATION - PLAN OF STUDY CATALOG YEAR: 2014-2015 Name-approved Business elective BADM 4075W MKTG 3101 MGMT 4902 Advisor-approved Business elective MGMT 3101 OPIM 3104 Extended core requirement Advisor-approved Business elective OPIM 3103 Extended core requirement Extended

  8. FFFAAALLLLLL 222000111111 EEENNNGGGIIINNNEEEEEERRRIIINNNGGG CCCAAARRREEEEEERRR FFFAAAIIIRRR

    E-Print Network [OSTI]

    Casavant, Tom

    Andersen Corporation & EMCO Barr Engineering Company Braun Intertec Cargill Centro Inc. Cerner Corporation Civco Medical Solutions Cobham Mission Systems Conductix-Wampfler Cook Medical Dell Inc. Eaton Corporation Eisenmann Corporation Emerson Process Mgmt/Fisher Controls Emerson Process Mgmt/Process Sys

  9. FRZ Section Enrollment Report (SER) -Table of Contents Subject Description

    E-Print Network [OSTI]

    Pittendrigh, Barry

    Engineering NUPH NUPH-Nuclear Pharmacy NUR NUR-Nursing OBHR OBHR-Orgnztnl Bhvr &Hum Resrce OLS OLS-Classics CLPH CLPH-Clinical Pharmacy CMCI CMCI-CIC Common Market COM COM-Communication CPB CPB Tech MGMT MGMT-Management MSE MSE-Materials Engineering NRES NRES-Natural Res & Environ Sci NUCL NUCL-Nuclear

  10. Comparative studies of diverged members of the phosphotriesterase family 

    E-Print Network [OSTI]

    Arriens, Cristina Gale

    2013-02-22T23:59:59.000Z

    -ndel ponl-sap pon I -Gsap pon1-sap* pon1-sap+ CGGCTTCCGCATATGGCGAAGCTGATTGCG GCTCTTCCGCATTAGAGCTCACAGTAAAGAGC GGTGGTTGCTCTTCCGCATTAGAGCTCACAGT AAAGAGC GCTCTTCTCTGTTAGAGACAGTAAAGAGC CGGCTTATGGCATGGGTGCGCTCTTCTCTGTTA GAGACAGTAAAGAGC Reactions were... Technologies Lab of the Institute of Developmental /k Molecular for analysis. The sequencing protocol was repeated using internal primers PON I-201a and PONI-201 to obtain the complete sequence of the gene. INTRODUCTION OF RESTRICTION SITES Primers PONI-sap...

  11. Formal analysis of BPMN models using Event-B Jeremy W. Bryans1

    E-Print Network [OSTI]

    Southampton, University of

    operation of many businesses, and SAP is a leading provider of such systems. Business process modeling has Science, Newcastle University, United Kingdom Jeremy.Bryans@ncl.ac.uk 2 SAP Research CEC Darmstadt, SAP AG, Bleichstr. 8, 64283 Darmstadt, Germany wei01.wei@sap.com Abstract. The use of business process models has

  12. TThhee BBuussiinneessss CCaassee ffoorr SSAAPP MMiiggrraattiioonn ffrroomm SSoollaarriiss//SSPPAARRCC ttoo WWiinnddoowwss SSeerrvveerr

    E-Print Network [OSTI]

    Narasayya, Vivek

    .......................................................................................... 5 A Model for a Migration of SAP from SPARC Solutions. All rights reserved. 1 The ROI of migrating SAP from SPARC/Solaris to Windows Server is 293% over platform for the hosting of enterprise application workloads such as SAP. More than 65,000 SAP

  13. A Case Study of Using HCI Methods to Improve Tools for Programmers Andrew Faulring, Brad A. Myers

    E-Print Network [OSTI]

    Myers, Brad A.

    to write soft- ware. In a recent project, we applied HCI techniques to a SAP developer tool for the SAP Net for applications to consume data stored inside a Business Suite system. SAP recognized that many mobile and web}@cs.cmu.edu Yaad Oren, Keren Rotenberg Technology & Innovation Platform BU SAP Labs Israel Ltd. Ra'anana, Israel

  14. 1. ABSTRACT The purpose of this paper is to report the power

    E-Print Network [OSTI]

    Martin, Tom

    , considering total system power, battery capacity and main memory bandwidth. The results, which are up to a fac

  15. versity (MT Assistant o

    E-Print Network [OSTI]

    discipline um vitae, s and contac electronica cmsearch@ 2011, an trategic Fac nitiative ates are en rsities

  16. Master of Science in Engineering and Technology Management Engineering Management Concentration Management of Technology Concentration

    E-Print Network [OSTI]

    Selmic, Sandra

    INEN 514 Statistical Analysis for Six Sigma INEN 509 Economics INEN 514 Statistical Analysis for Six Sigma Electives (Pick 5 Courses) 15 566 Six Sigma and Quality Control MGMT 510 Contemporary Management

  17. U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...

    Broader source: Energy.gov (indexed) [DOE]

    62 South Coast Air Quality Mgmt Dist. EE UPS Ontario-Las Vegas LNG Corrid Vehicle Technology Division 2010 Mike Bednarz 12109 12312013 21865 Copley Drive, Diamond Bar, CA, 9176...

  18. U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...

    Broader source: Energy.gov (indexed) [DOE]

    47 South Coast Air Quality Mgmt Dist. EE Heavy-Duty LNG Drayage Truck Prg Vehicle Technology Division 2010 Mike Bednarz 12109 12312013 21865 Copley Drive, Diamond Bar, CA, 9176...

  19. Beahrs Environmental Leadership Program All Participant List 2001-2010 University of California, Berkeley Region Country Year Name Employer Current Title Discipline Specialty

    E-Print Network [OSTI]

    Wildermuth, Mary C

    Science Environment, Natural Resource Management, Climate Change Africa, East Kenya 2008 Mrs. Violet Building Africa, East Kenya 2004 Dr. Philomena Muiruri Kenyatta University, Geography Dept. Lecturer Ngotho Green Network, South Africa Research and Development Officer Development Environmental Mgmt

  20. Expansion of Domestic Production of Lithium Carbonate and Lithium...

    Broader source: Energy.gov (indexed) [DOE]

    2010 End Date: February, 2013 Partners Engineering: BE&K (a KBR company) Environmental Assessment: Nevada Bureau of Land Mgmt Budget DOE Share - 28.4 million Rockwood Share -...

  1. This information describes typical occupations and employment settings associated with this major. Understand that some of these options may require additional training. Moreover, you are not limited to these options when choosing a possible career path.

    E-Print Network [OSTI]

    Arnold, Jonathan

    Perfect Circle Renewable Energy Railroads Resource Mgmt/Research Shaw Group South Shore YMCA SunTrust Bank desire to "make a difference" when it comes to wise, efficient, and productive management of public

  2. Javaune Adams-Gaston, PhD Vice President

    E-Print Network [OSTI]

    Neighborhood Svcs & Collaboration Willie Young Sr. Director Energy Mgmt & Sustainability Tom Reeves Director SLD Exec Director Career Connection Chris Rideout, PhD Director Planning & Design Steve Schick Director

  3. Javaune Adams-Gaston, PhD Vice President

    E-Print Network [OSTI]

    Neighborhood Svcs & Collaboration Willie Young Sr. Director Energy Mgmt & Sustainability Tom Reeves Director SL Davida Haywood, PhD Exec Director Director Career Connection Chris Rideout, PhD Director Planning

  4. Javaune Adams-Gaston, PhD Vice President

    E-Print Network [OSTI]

    Dye Director Neighborhood Svcs & Collaboration Willie Young Sr. Director Energy Mgmt & Sustainability Davida Haywood, PhD Exec Director Director Career Connection Chris Rideout, PhD Director Planning

  5. Advanced Vehicle Testing - Beginning-of-Test Battery Testing...

    Broader source: Energy.gov (indexed) [DOE]

    2.5 V Thermal Mgmt.: Passive, Vacuum-Sealed Unit Pack Weight: 294 kg BATTERY LABORATORY TEST RESULTS SUMMARY Vehicle Mileage and Testing Date Vehicle Odometer: 6,696 mi Date of...

  6. (4-5) Calculus IS - Department of Mathematics, Purdue University

    E-Print Network [OSTI]

    Susan Kaye Aufderheide

    2013-05-15T23:59:59.000Z

    (3-4) Language and Culture III Selective –LINK (Select courses COULD .... Students must earn a 2.0 average in MATH/STAT/MGMT courses required for major.

  7. Board of Trustees (Idaho State Board of Education)

    E-Print Network [OSTI]

    Barrash, Warren

    -Construction Mgmt. -Electrical and Computer Engineering -Instructional & Performance Tech. -Materials Science Compliance Planning & Facilities Jared Everett, Interim Assoc. VP -Facilities O & M -Architectural & Safety Government* Relations Bruce Newcomb Athletics*¨ Mark Coyle Internal Audit Larry Harmon Boise State

  8. Board of Trustees (Idaho State Board of Education)

    E-Print Network [OSTI]

    Barrash, Warren

    -Construction Mgmt. -Electrical and Computer Engineering -Instructional & Performance Tech. -Materials Science & Facilities David Smith, Assoc. VP -Facilities O & M -Architectural & Engineering Services -Capital Planning & Space Management -Transportation, Parking & Environmental Health & Safety Government* Relations Bruce

  9. Jill Parker Associate Vice Chancellor,

    E-Print Network [OSTI]

    Schladow, S. Geoffrey

    Records Management Hazardous Materials Hazardous Waste Health & Safety Injury & Illness Prevention Program Sue Fields Manager, Environmental Mgmt. Andrew Majewski, CIH, COHC Manager, Health & Safety/Hazardous Committee Policy Statements & Guidelines IACUC Inspections IACUC Protocols/ Amendments IACUC Records

  10. Slide 1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NNSA and other site tenants - Provide program ownership for SRS site-wide programs (e.g. Nuclear Criticality, ISMS, EP, NPDES, NEPA, Solid Waste Mgmt) - Manage all interfaces...

  11. Application for use of BPA Right-of-Way

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    OF ENERGY BONNEVILLE POWER ADMINISTRATION APPLICATION FOR PROPOSED USE OF BPA RIGHT-OF-WAY 1-800-282-3713 Electronic Form Approved by Forms Mgmt 02232011 Ask for Real Property...

  12. This information describes typical occupations and employment settings associated with this major. Understand that some of these options may require additional training. Moreover, you are not limited to these options when choosing a possible career path.

    E-Print Network [OSTI]

    Arnold, Jonathan

    Ditrich Engineering Services Cobb County Department of Transportation ConAgra, Inc. Cryolife, Inc. Dynamco Eaton Corporation EcoMetrix Environmental Mgmt EMC Corporation EnSafe Epic Systems Corp FAA Food Machinery Service

  13. Crude Injustice in the Gulf: Why Categorical Exclusions for Deepwater Drilling in the Gulf of Mexico are Inconsistent with U.S. International Ocean Law and Policy

    E-Print Network [OSTI]

    Hull, Eric V.

    2011-01-01T23:59:59.000Z

    and Whales and the Gulf of Mexico Oil Spill, NOAA FISHERIES:PRO- POSED GULF OF MEXICO OCS OIL AND GAS LEASE SALE 206,MGMT. SERV. , GULF OF MEXICO OCS OIL AND GAS LEASE SALES:

  14. Prairie Creek Branch Public Library, Dallas

    E-Print Network [OSTI]

    Meckfessel, R.

    2011-01-01T23:59:59.000Z

    and structural engineering Jaster-Quintanilla commissioning Apollo BBC architects / interior designers DSGN Associates ? smart orientation/massing ? sound stormwater mgmt ? indoor environment quality civic budgets mandate common-sense sustainability...

  15. Vice Chancellor for Academic Affairs

    E-Print Network [OSTI]

    Amin, S. Massoud

    Services Purchasing Custodial Annual Giving Application Development Video Conferencing Registrar Health Services Inventory Environmental Health & Safety Coordinator Athletic Fundraising End User Support of Diversity Programs Post Office Health Service Dir of Admissions & Enrollment Mgmt PRESIDENT University

  16. Lethbridge Research Centre, Lethbridge, Alberta, Canada Reducing Greenhouse Gas

    E-Print Network [OSTI]

    O soils CH4 enteric Biomass burning Rice mgmt Manure mgmt Source: US EPA (2006) 5-7 Billion tonnes 27.3 0 100 200 300 400 500 Latin Am erica Africa C hina India R estofAsia W estern Europe N orth Am erica N on E U FS UAust/N Z Eastern Europe M iddle East milliontCO2eq As summarized by F. O'Mara, 2010

  17. Phylogenetic revision of desert fireflies (Coleoptera: Lampyridae: microphotus) 

    E-Print Network [OSTI]

    Usener, Jessica LeAnn

    2006-04-12T23:59:59.000Z

    kit or an of EXO-SAP solution (USB product #70996). Five microliters of PCR product were added to 1 ?L of EXO and 1 ?L of SAP. The EXO-SAP cocktail was heated in a Peltier thermal cycler (PTC-200) at 37?C for 15 min followed by 80?C for 15 min. Cycle... or through the use of EXO-SAP solution (USB product #70996). 5 ?L of PCR product were added to 1 ?L of EXO and 1 ?L of SAP. The EXO-SAP cocktail was heated in a Peltier thermal cycler (PTC-200) at 37?C for 15 min followed by 80?C for 15 min. Cycle...

  18. An L2-based approach for wavelet approximation J.M.H. Karel, R.L.M. Peeters, R.L. Westra, S.A.P. Haddad and W.A. Serdijn

    E-Print Network [OSTI]

    Serdijn, Wouter A.

    of the signal. This transformation is usually computed digitally, yielding a high power consumption and poor with Pad´e-approximation. This analog im- plementation of wavelets yields large power savings over.haddad}@its.tudelft.nl Abstract-- Computation in the analog domain is very ap- pealing from a power-consumption perspective

  19. Modeling and Verification of Self-Adaptive Service-Oriented

    E-Print Network [OSTI]

    Weske, Mathias

    and service contracts slightly reduce instance graph's complexity Basil Becker | HPI/SAP Workshop | December! Component rules, refine service contract rules. Basil Becker | HPI/SAP Workshop | December 06, 2010 11 #12

  20. Rehabilitation Techniques and Assessment of a Historic Reinforced Concrete Variable Depth Girder Bridge 

    E-Print Network [OSTI]

    Ortiz, Laura Marie

    2013-05-08T23:59:59.000Z

    Modification ................................................. 161 7.2.1 General ....................................................................................................... 161 7.2.2 SAP2000 Model... span details. ................................................................ 101 xii Figure 4-8. Cantilever and main span joints. ................................................................. 102 Figure 5-1. SAP 2000 model for the cantilever...

  1. HPI Future SOC Lab: Call for Projects Next generation technology, such as multicore CPUs as well as increasing

    E-Print Network [OSTI]

    Weske, Mathias

    - Memory Computing Technology (SAP HANA). The SAP Business ByDesign systemHPI Future SOC Lab: Call for Projects Next generation technology, such as multicore, developers of service-oriented computing systems have to understand

  2. Towards Run-time Flexibility for Process Families: Open Issues and Research Challenges

    E-Print Network [OSTI]

    Ulm, Universität

    process models, e.g., ITIL in IT service management, reference processes in SAP's ERP system, or medical

  3. Reduce Steam Trap Failures at Chambers Works 

    E-Print Network [OSTI]

    Kouba, C.

    2010-01-01T23:59:59.000Z

    automatically within SAP ? Survey performed and work orders created ? Surveyor/Team Leader coordinates repair work ? Use backlog of work to justify number of mechanics ? Prioritize work for mechanics ? Repair Mechanics work across the site ? SAP Work Order... history updated for individual traps ? Surveyor updates excel spreadsheet with repair history ? Monthly reports sent to area and site management 10/20/2010 11Piloted Solution Key Learnings ? SAP Cumbersome and slows repair process ? Use SAP...

  4. A field guide to the trees, shrubs, and woody vines of Tamborwood, Newton County, Texas 

    E-Print Network [OSTI]

    Holm, Stephen Franke

    1972-01-01T23:59:59.000Z

    smooth, thin, flaking off in plates . . . EANTEORNS (Crataepus) 71 73 33. Sap milky; fruit a fleshy, multiple drupe on a short stalk . . RED MULBERRY (PSzus rubza) 61 33a. Sap clear; fruit simple on long stalk . . 34 34. Leaves with small teeth... . 52 37. Twigs armed with thorns . . . 38 37a. Twigs unarmed 39 38. Sap milky; leaves elliptic and pointed at tip OSAGE ORANGF. (Maclura pomifeza) 61 38a. Sap watery; leaves spatula-shaped . . MOOLYBUCKET BUMELIA (Bumelia lanuginosa) 101 39...

  5. Acquisition Guide --------------------?

    Office of Environmental Management (EM)

    or services not exceeding the simplified acquisition threshold SAT." Acquisition reform, including SAP, resulted from the following legislation: Federal Acquisition...

  6. Why Supply Chain

    E-Print Network [OSTI]

    Datta, Shoumen

    2000-01-01T23:59:59.000Z

    Why supply chain explains the importance of supply chains. It includes an introduction to ERP as designed by SAP.

  7. Asymmetric Information in Common-Value Auctions and Contests: Theory and Experiments 

    E-Print Network [OSTI]

    Rentschler, Lucas Aaren

    2011-10-21T23:59:59.000Z

    on the signal ................................... 94 Figure 11 Equilibrium bid functions and observed bids for contests ......... 98 Figure 12 SAP and Uninforrmed AAP cumulative distribution (all periods...) ............................................................................... 98 Figure 13 SAP and Uninforrmed AAP cumulative distribution (periods 1-10 and c21-30) .......................................................... 101 Figure 14 The difference between observed bids and break-even bids for SAP...

  8. Human Resources Organizational Readiness Project: An Overview

    E-Print Network [OSTI]

    Finzi, Adrien

    and easily interface with SAP software Managed by a special Human Resources project team Will be undertaken in close coordination with the BUworks program team HR Organizational Readiness Project BUworks / SAP of SAP Enhanced data security within the new system Current job "system" is 30 years old ­ it must

  9. Discovery and On-Demand Provisioning of Real-World Web Services Dominique Guinard1,3

    E-Print Network [OSTI]

    . A study from OnWorld [9] projects that wireless sen- sor network (WSN) systems and services will be worth,3 , Patrik Spiess2 , Bettina Dober1 , and Stamatis Karnouskos2 1 SAP Research Zurich, Switzerland 2 SAP: dominique.guinard@sap.com Abstract The increasing usage of smart embedded devices is blur- ring the line

  10. Course No.: CE 511 Graduate Student

    E-Print Network [OSTI]

    Ervin, Elizabeth K.

    the frequencies of a bent-pile system using SAP2000 To see the mode shapes of the system in SAP2000 #12 of that project which satisfies both my course requirement and research goal #12;Bent-Pile System Pile Cap Piles I-55 Intermediate Bent System #12;Defining Section Properties in SAP2000 Pile Cap Section Pile Section

  11. Improving Testing of Enterprise Systems by Model-based Testing on Graphical User Sebastian Wieczorek and Alin Stefanescu

    E-Print Network [OSTI]

    Southampton, University of

    their usage. Leading firms now use SOA on more than 50% of their solution delivery projects. SAP, a leadingImproving Testing of Enterprise Systems by Model-based Testing on Graphical User Interfaces Sebastian Wieczorek and Alin Stefanescu SAP Research Darmstadt, Germany {name.surname}@sap.com Abstract

  12. Chemical characterization of acidic components in a commercial depitching of crude tall oil 

    E-Print Network [OSTI]

    Tsurumi, Toshio

    1982-01-01T23:59:59.000Z

    of Constituents in CTO Saps: 30m SP-2330 Glass Capillary Column. FRN: 21790 . VII. Assignment of Constituents in TOD Saps: 30m SP-2330 Glass Capillary Column. FRN: 21628 . VIII. Assignment of Constituents in CTO Saps: 25m DB-5 Fused Silica Capillary Column.... FRN: ZI637 IX. Assignment of Constituents in TOD Saps: 25m DB-5 Fused Silica Capillary Column. FRN: 21705 X. Assignment of Constituents in TOP Saps: 25m DB-5 Fused Silica Capillary Column. FRN: 21638 XI. List of Chromatograms XII. Response...

  13. November 2013 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Mthly Pay Day 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On Sch Disabled @ 5:00 - HRMS Specialist - Fac/Staff Reviewer Bi-weekly P.P.E. 4 Out of Sys HRMS Spec & Fac Staff Rev 5 Out of Sys HRMS Spec & Fac Staff Rev 6 ALL HR/ Payroll Resp

  14. Monthly Planner Printed by Calendar Creator for Windows on 7/16/2012

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Sch Disabled @ 5:00 - HRMS Specialist - Fac/Staff Reviewer Bi-weekly P.P.E. 2 ALL HR/ Payroll Resp. On Out of Sys HRMS Spec & Fac Staff Rev Mthly Pay Day 3 Out of Sys HRMS Spec & Fac Staff Rev 4 UVa Holiday 5 ALL HR/ Payroll Resp. On 6

  15. Monthly Planner Printed by Calendar Creator for Windows on 6/25/2012

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Mthly Pay Day 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On Sch Disabled @ 5:00 - HRMS Specialist - Fac/Staff Reviewer Bi-weekly P.P.E. 4 Out of Sys HRMS Spec & Fac Staff Rev 5 Out of Sys HRMS Spec & Fac Staff Rev 6 ALL HR/ Payroll Resp

  16. SEISMIC MONITORING OF CARBON DIOXIDE FLUID FLOW

    E-Print Network [OSTI]

    santos

    SEISMIC MONITORING OF. CARBON DIOXIDE FLUID FLOW. J. E. Santos. 1. , G. B. Savioli. 2. , J. M. Carcione. 3. , D. Gei. 3. 1. CONICET, IGPUBA, Fac.

  17. Positron emission tomography probes for imaging immune activation and selected cancers

    DOE Patents [OSTI]

    Radu, Caius G. (Los Angeles, CA); Witte, Owen N. (Los Angeles, CA); Nair-Gill, Evan David (Los Angeles, CA); Satyamurthy, Nagichettiar (Los Angeles, CA); Shu, Chengyi J. (Los Angeles, CA); Czernin, Johannes (Los Angeles, CA)

    2012-01-24T23:59:59.000Z

    Compounds for use as PET probes and methods for synthesizing and using these, comprising [.sup.18F]D-FAC and other cytosine and adenosine analogs.

  18. The Texas Dairy Industry: Trends and Issues.

    E-Print Network [OSTI]

    Knutson, Ronald D.; Hunter Charles A. Jr.; Schwart, Robert B. Jr.

    1981-01-01T23:59:59.000Z

    Pe r Cow . . . . . . . . . . . . . . . . . . . . . . . . Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . MILKCONSUMPTION . . . . . . . . . . . . . . . . . . . . . . . . . . . Fac to r s In f luenc ing Consumption... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Popula t ion . . . . . . . . . . . . . . . . . . . . . . . . . . . . P r i c e . . . . . . . . . . . . . . . . . . . . . . . . . . . Income . . . . . . . . . . . . . . . . . . . . . . . . . Prefe rences...

  19. archatelthermophilic adenylate kinase: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Summary: Adenylate Cyclase 1 dependent refinement of retinotopic maps in the mouse Daniel T. Plas a , Axel is refined to precision by activity dependent fac- tors (Debski &...

  20. archaealthermophilic adenylate kinase: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Summary: Adenylate Cyclase 1 dependent refinement of retinotopic maps in the mouse Daniel T. Plas a , Axel is refined to precision by activity dependent fac- tors (Debski &...

  1. adenylate kinase reveals: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Summary: Adenylate Cyclase 1 dependent refinement of retinotopic maps in the mouse Daniel T. Plas a , Axel is refined to precision by activity dependent fac- tors (Debski &...

  2. Q-anisotropy in finely-layered media

    E-Print Network [OSTI]

    2009-12-11T23:59:59.000Z

    2CONICET,Departamento de Geof?sica. Aplicada, Fac. Ciencias Astronómicas y. Geof?sicas, UNLP, Paseo del Bosque S/N,. La Plata, 1900, Argentina, and ...

  3. E-Print Network 3.0 - amplitude insult project Sample Search...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Biology and Medicine 2 Original Paper Pathobiology 2005;72:171178 Summary: and acrolein in ischemic insults. The exploration of these fac- tors will likely help us design...

  4. Generation of Cardiomyocytes from Human Endogenous and Pluripotent Stem-Cell Derived Endothelial Cells

    E-Print Network [OSTI]

    Truong, Raymond

    2013-01-01T23:59:59.000Z

    through a 70 micron cell strainer to dissociate cellthrough a 45 micron cell strainer-capped FACS tube (Fisherthrough a 70 micron cell strainer to dissociate cell

  5. The temperature distribution produced by ion bombardment of silicon

    E-Print Network [OSTI]

    Juneau, Jon

    1980-01-01T23:59:59.000Z

    ) &FAC I t( I, Z) 4FAC2 4 tZ B=( I ~ +2+FAC1)/(7 I ~ +FAC?) 3 AX I AL= ~ 25t( A+(R(T ARtRE AR ) 4DLOG( B ) ) RFTURN END SUBROUTINE GAUS IN(B r T ~ N ~ VALUE) C C THIS SUBRDUT IN(=. CAL CUL A TCS THE (NTEGRAL DF Tt)E FUNCT ION F, FROM 8 TO T BY C.... TABLE OF CONTENTS page I. INTRODUCTION. II. DEVELOPMENT OF THE MODEL USED The Heat Equation. Source Term. Dimensionless Parameters Boundary and Initial Conditions. III. THE TEMPERATURE DISTRIBUTION. 4 6 8 10 12 Solution of the Heat Equation...

  6. 2.1E Supplement

    E-Print Network [OSTI]

    Winkelmann, F.C.

    2010-01-01T23:59:59.000Z

    from theoretical CIE sky luminance distributions LuminanceBACKG LUM FAC -SKY (background luminance factor -sky) is thefrom clear part of sky (lumens/watt) Luminance efficacy of

  7. adenylate kinase ak: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    precision by activity dependent fac- tors (Debski & Cline, 2002; Goodhill & Richards, 1999; Mc Crair, Michael C 12 Hypothalamic Pituitary Adenylate Cyclase-Activating...

  8. The Texas Dairy Industry: Trends and Issues. 

    E-Print Network [OSTI]

    Knutson, Ronald D.; Hunter Charles A. Jr.; Schwart, Robert B. Jr.

    1981-01-01T23:59:59.000Z

    Pe r Cow . . . . . . . . . . . . . . . . . . . . . . . . Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . MILKCONSUMPTION . . . . . . . . . . . . . . . . . . . . . . . . . . . Fac to r s In f luenc ing Consumption... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Popula t ion . . . . . . . . . . . . . . . . . . . . . . . . . . . . P r i c e . . . . . . . . . . . . . . . . . . . . . . . . . . . Income . . . . . . . . . . . . . . . . . . . . . . . . . Prefe rences...

  9. Compress® Periprosthetic Fractures: Interface Stability and Ease of Revision

    E-Print Network [OSTI]

    Tyler, Wakenda K.; Healey, John H.; Morris, Carol D.; Boland, Patrick J.; O’Donnell, Richard J.

    2009-01-01T23:59:59.000Z

    comorbidities such as osteoporosis, periprosthetic fractureswhom advanced age and osteoporosis may well signal a higherto risk fac- tors of osteoporosis (secondary to preoperative

  10. IEEE TRANSACTIONS ON COMMUNICATIONS, VOL. 49, NO. 9, SEPTEMBER 2001 1659 On Optimal Call Admission Control in a

    E-Print Network [OSTI]

    .Altman@sophia.inria.fr). T. Jiménez is with CESIMO--Centro de Simulacion y Modelos, Fac- ultdad de Ingenieria, Universidad de

  11. DPARTEMENT DES LETTRES ET COMMUNICATIONS HORAIRE -HIVER 2014 -CIRC

    E-Print Network [OSTI]

    Spino, Claude

    toxicomanie (15 h) (Portage) CRM229 Rédaction technique et spécialisée 51 25 Vendredi 13 h 00 D3-2041 Fac

  12. Special Issue On Estimation Of Baselines And Leakage In Carbon Mitigation Forestry Projects

    E-Print Network [OSTI]

    Sathaye, Jayant A.; Andrasko, Kenneth

    2008-01-01T23:59:59.000Z

    Tropical Region Estimates Bolivia, Noel Avoided 5-42Tropics; one each in Belize, Bolivia, and Brazil and threeproject, Noel Kempff in Bolivia, the FAC approach projects

  13. Annales Geophysicae (2004) 22: 40894101 SRef-ID: 1432-0576/ag/2004-22-4089

    E-Print Network [OSTI]

    Boyer, Edmond

    2004-01-01T23:59:59.000Z

    Union 2004 Annales Geophysicae Temporal evolution of two auroral arcs as measured by the Cluster-west at a radial distance of about 4.4 RE in the post-midnight sector. When mapped along geomagnetic field lines-aligned current (FAC) sheets associ- ated with the equatorward arc widened and the total amount of FAC doubled

  14. November 2011 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Mthly Pay Day 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On 4 ALL HR/ Payroll Resp. On 5 ALL HR/ Payroll Resp. On 6 ALL HR/ Payroll Spec & Fac Staff Rev 8 Out of Sys HRMS Spec & Fac Staff Rev 9 ALL HR/ Payroll Resp. On 10 ALL HR

  15. Monthly Planner Printed by Calendar Creator for Windows on 2/22/2012

    E-Print Network [OSTI]

    Acton, Scott

    Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Mthly Pay Day 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On 4 ALL HR/ Payroll Resp. On 5 ALL HR/ Payroll Resp. On 6 ALL HR/ Payroll Resp & Fac Staff Rev 8 Out of Sys HRMS Spec & Fac Staff Rev 9 ALL HR/ Payroll Resp. On 10 ALL HR/ Payroll

  16. January 2012 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Sch Disabled @ 5:00 - HRMS of Sys HRMS Spec & Fac Staff Rev 4 Out of Sys HRMS Spec & Fac Staff Rev 5 ALL HR/ Payroll Resp. On 6 ALL HR/ Payroll Resp. On BW Pay Date 7 ALL HR/ Payroll Resp. On 8 ALL HR/ Payroll Resp. On 9 ALL HR

  17. First Floor Interim Plan: January,2008 Draft: 28 February 2008

    E-Print Network [OSTI]

    Walker, Henry MacKay

    10061006A 1006B Bio Faculty Research Lindgren 1103 Bio Fac Res Hinsa 1103A1105A 1105 Bio Fac Res Gregg Phy Shop Instrum 1030 Phy Off Cadmus 1031 Phy Off Cunningham 1032 Phy Off Duke 1033 Phy Off Willig

  18. Vice Chair, Vice Chair,

    E-Print Network [OSTI]

    Leistikow, Bruce N.

    Neurosci Program Infect Dis Inflamm Program Nutrition Program Core Lab Informa- tics Program CAO, Clinical Digital Path Research Support Educ Tech Support Clinical Program Support Other Clin Lab Train Program TBD FAC ACE RAC ARC ACE - Advisory Committee for Education ARC - Advisory Research Committee FAC - Faculty

  19. Vice Chair, Vice Chair,

    E-Print Network [OSTI]

    Leistikow, Bruce N.

    Infect Dis Inflamm Program Nutrition Program Core Lab Informa- tics Program CAO, Clinical Services Path Research Support Educ Tech Support Clinical Program Support Other Clin Lab Train Program TBD FAC ACE RAC ARC ACE - Advisory Committee for Education ARC - Advisory Research Committee FAC - Faculty

  20. T-612: False Positive Detection Generic.dx!yxk in DAT 6329

    Broader source: Energy.gov [DOE]

    This issue can affect all McAfee anti-virus products utilizing this DAT, however it will manifest itself only on endpoints such as VirusScan. Spsgui.exe - This file is typically found only on workstations that have the SAP client installed. This file is loaded by the SAP client when it starts up and is used to send and receive faxes inside the SAP application.

  1. In Vitro Evolutionary Dynamics of C. albicans during Adaptation to Fluocnazole 

    E-Print Network [OSTI]

    Huang, Mian

    2012-10-19T23:59:59.000Z

    degradative enzymes are potential virulence factors as well, including members of secreted aspartyl proteinases (SAP) family and phospholipases (PL) family. Plb1p, a typical member of PL family, encodes a glycoprotein with both hydrolase... invasion when the gene is disrupted (43). In C. albicans SAP family consists of at least nine members (80). Depending on different model system, different members may be required for the host invasion of the pathogen. SAP1-6 were correlated...

  2. Acer saccharum 

    E-Print Network [OSTI]

    Hugh D. Wilson

    2011-08-10T23:59:59.000Z

    had a significant effect on sap flow up to the point at which transpiration ceased from drought stress. At this point, stomatal resistance was correlated with sap flow, indicating the stomates became more sensitive to dry conditions and closed... earlier than under well watered conditons to prevent water loss, causing sap flow to become unrelated to global irradiance. Water use decreased each day during the drought periods, especially for DR2, for all rootstocks. All rootstocks had the same...

  3. Hydrologic Impacts of Saltcedar Control Along a Regulated Dryland River 

    E-Print Network [OSTI]

    McDonald, Alyson Kay

    2012-02-14T23:59:59.000Z

    of saltcedar transpiration (sap flux) and evapotranspiration April ? June 2004 at Site B within the PREP study area along the Pecos River, Texas ..................................... 38 3.6 Comparison of saltcedar transpiration (sap flux... by saltcedar has been measured at a number of scales from that of individual plants to that of watersheds (Nagler et al., 2009; Shafroth et al., 2005) (Wilcox et al., 2006). Plant-scale measurements rely on sap flow (Sala et al., 1996; Devitt et al., 1997...

  4. Comparison of architectures for two-step flash analog-to-digital converters 

    E-Print Network [OSTI]

    Reese, Robert Bryan

    1982-01-01T23:59:59.000Z

    A/D converters have been designed and fabricated in the last three to five ?om a survey of the literature it was discovered that the majority of these converters were of the successive approximation (SAP) type (Table I, page 4). This is because... the SAP converter offers a fast conversion time, a low complexity level and a small area requirement. Only one comparator, the design critical subcircuit of most converters, is needed in a SAP converter. Area requirements increase only moderately...

  5. Chemical root pruning and its effects on water relations and root morphology of photinia 

    E-Print Network [OSTI]

    Vartak, Diptish Ramesh

    1993-01-01T23:59:59.000Z

    . . 1X LIST OF FIGURES. . Xl INTRODUCTION . . LITERATURE REVIEW Ascent of sap. . Transpiration and its measurement. . Effect of root pruning on plant physiology. Effect of root pruning on root morphology . 12 14 Stomatal measurement and its..., throughout the plant, and between the plant and its environment (Salisbury and Ross, 1991). Water moves in some of the tallest trees, from the roots to the uppermost leaves, a vertical distance of well over 120 m, Ascent of sap Xylem sap is a dilute...

  6. Establishment, growth and water use of Quercus virginiana (Mill.) on lignite surface-mined soils in response to irrigation 

    E-Print Network [OSTI]

    Duncan, Jacalyn E.

    1991-01-01T23:59:59.000Z

    . The petiole extended out to the exterior. Chamber pressure was slowly increased until water was forced out of the petiole. The pressure indicated on the pressure gauge at that time was regarded as equal to the tension originally existing in the xylem sap... and outside the stem flow gauge. Sap flow is determined from heat movement in the sap estimated by thermocouples on the stem surface. The stem flow gauge design assumes the surface temperatures provide an accurate estimate of the stem cross...

  7. Emerging technologies and their application in construction engineering 

    E-Print Network [OSTI]

    Franken Vecchio, Eduardo Anthony

    1999-01-01T23:59:59.000Z

    for materials identification. Additionally, it has implemented a Site Positioning System (SPS) that is able to track materials within the project site. Both suppliers are using RF/ID combined with bar coding to track and identify materials. Regarding... the potential benefits that these technologies can provide. 9. One of the latest trends is the SAP software. 8'hat is your opinion about this new software? SAP stands for Systems and Application Products in Data Processing. SAP is a highly integrated...

  8. Contractor Subject Matter Amount of Consideration Start Date Anticipated

    E-Print Network [OSTI]

    Greenslade, Diana

    Systems SAP Project Manager Office Lead $ 218,625 24-Jan-12 30-Jun-12 N N/A N N/A Ajilon Australia Pty Ltd Professional Services- Enterprise Business Systems SAP Test Manager $ 216,759 24-Jan-12 30-Jun-12 N N/A N N/A Ajilon Australia Pty Ltd Professional Services- Enterprise Business Systems SAP Employee Self Service

  9. acilities QuarterlyE R N E S T O R L A N D O L AW R E N C E B E R K E L E Y N AT I O N A L L A B O R ATO RY FAC I L I T I E S D I V I S I O N N E W S L E T T E RF From the Division Director 2

    E-Print Network [OSTI]

    on page 2 BIG C SUB SCRAPPED A small but important piece of Berkeley Lab history will soon disappear from a metal door ajar and one of the heavy steel bars, meant to hold the door shut, bent at a 90-degree angle and to network with some 2600 attendees from a broad range of industries as well as from government and academia

  10. Campbell Soup Company: Harmonizing Processes and Empowering Workers

    E-Print Network [OSTI]

    Ross, Jeanne W.

    2008-06-01T23:59:59.000Z

    In 2007 Campbell Soup Company was implementing Project Harmony: a multi-year effort to implement SAP and create more standardized and integrated business processes across

  11. Acronyms A AAAP Accelerated Access Authorization Program ACREM...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    S S Secret SRD SecretRestricted Data SAACS Security Alarm and Access Control System SAP Special Access Program SAPOC Special Access Program Oversight Committee SC Office...

  12. (A-13-007-00) National Aeronautics and Space Administration

    E-Print Network [OSTI]

    Waliser, Duane E.

    Act Agreement SAAM Space Act Agreement Maker SAP Systems Applications Products SIERA System Projects Agency FAR Federal Acquisition Regulation FY Fiscal Year GAO Government Accountability Office ISS

  13. Refining and Extending the Business Model with Information Technology: Dell Computer Corporation

    E-Print Network [OSTI]

    Kraemer, Kenneth L; Dedrick, Jason; Yamashiro, Sandra

    1999-01-01T23:59:59.000Z

    SAP implementation was dubbed the Genesis Project, and involved a 140 member staff pulled together from corporate and regional information systems

  14. \\Villiam Congreve. This 0 oer caused them to be

    E-Print Network [OSTI]

    able to project a bullet; because, in addition to the force which projects it ..... Water sap. The paper .... measure, but a more elaborate system of protecting the. Ft.

  15. The Uranium Processing Facility Finite Element Meshing Discussion

    Office of Environmental Management (EM)

    more nodes and elements (1 element 9 elements) - Changed from GTStrudl to SAP 2000. - Linear elastic computer model * DOE Project 2 - 15'-20' element size deemed...

  16. Saint Vincent and the Grenadines-Pilot Program for Climate Resilience...

    Open Energy Info (EERE)

    production system is dependent on the annual flooding and recession of Tonle Sap Great Lake, and is therefore particularly sensitive to potential changes in local...

  17. adapting heuristic mastermind: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Computer Technologies and Information Sciences Websites Summary: , Germany, joe.hoffmann@sap.com Abstract. In artificial intelligence, a relaxation of a problem is an over...

  18. Vadose Zone Soil Moisture Wicking Using Super Absorbent Polymers...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Vadose Zone Soil Moisture Wicking Using Super Absorbent Polymers. Vadose Zone Soil Moisture Wicking Using Super Absorbent Polymers. Abstract: Super-absorbent polymers (SAPs) have...

  19. apocynaceae constituintes quimicos: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    as protenas, txicas eou com (more) Laura Virginia Pereira Narvaes 2007-01-01 39 Hemp dogbane Apocynum cannabinum L. Renewable Energy Websites Summary: a milky sap when...

  20. aspidosperma cuspa apocynaceae: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    in the West Indies, it has become clear that M. pauciflora (Spreng Krings, Alexander 18 Hemp dogbane Apocynum cannabinum L. Renewable Energy Websites Summary: a milky sap when...

  1. VICE PRESIDENT FINANCE, RESOURCES & OPERATIONS

    E-Print Network [OSTI]

    Handy, Todd C.

    VICE PRESIDENT FINANCE, RESOURCES & OPERATIONS PIERRE OUILLET EA to VP Carolina Cerna ASSOCIATE VP ADMINISTRATION & FINANCE OKANAGAN CAMPUS Jackie Podger Michael Shakespeare (Interim) ASSOCIATE VP CAMPUS Dennis Silva FINANCE UBCO Carla Waters FINANCE UBCO Carla Waters BUDGET AND MGMT REPORTING Andrew Glynn

  2. FINANCE CONCENTRATION FOR UNDERGRADUATES The finance concentration, like a major, focuses on value creation, both inside a firm and in the capital

    E-Print Network [OSTI]

    Salama, Khaled

    FINANCE CONCENTRATION FOR UNDERGRADUATES The finance concentration, like a major, focuses on value in the basic finance concepts of risk and return, asset allocation, portfolio management, bond and stock International Financial Management MGMT 4340 Advanced Corporate Finance Optional Finance Concentration Courses

  3. LOUISIANA TECH UNIVERSITY______________________________________________________________________________________________________________________________________________________________________________________________________________________________________

    E-Print Network [OSTI]

    Selmic, Sandra

    INEN 514 Statistical Analysis for Six Sigma INEN 518 Project Management ELECTIVES ­ 12 hrs required (9 Mgmt CIS 510 Information Resource Management ENGR 566 Six Sigma & Quality Control ENTR 501 Technology and Decision Making INEN 514 Statistical Analysis for Six Sigma INEN 518 Project Management Electives 12 hours

  4. PROGRAMS AND DEGREES Twenty degree programs are offered by the College on the

    E-Print Network [OSTI]

    Marques, Oge

    · Marine Engineering Mgmt · Mechanical Engineering · · · Ocean Engineering · · · G.C. ­ Graduate University System. From the College's start in 1965 with the first degree program in ocean engineering. Discipline G.C. B.S. M.S. Ph.D. Bioengineering · · Civil Engineering · · · Computer Engineering

  5. PROGRAMS AND DEGREES Twenty degree programs are offered by the College on the

    E-Print Network [OSTI]

    Fernandez, Eduardo

    · Marine Engineering Mgmt · Mechanical Engineering · · · Ocean Engineering · · · G.C. ­ Graduate in 1965 with the first degree program in ocean engineering, the College of Engineering and Computer. Discipline G.C. B.S. M.S. Ph.D. Bioengineering · · Civil Engineering · · · Computer Engineering

  6. Regional Climate Variability in the Western U.S.: Observed vs. Anticipated

    E-Print Network [OSTI]

    Cycle · ENSO Footprint(s) · Recent Climate Trends · Outlook to Mid-21st Century Range Mgmt. Symposium, Denver, 10 February 10 #12;Average Annual Precipitation for the Western U.S. Based on PRISM OSU/WRCC #12 eruptions, this means more energy input - And higher global temperatures #12;Temperature Widespread warming

  7. Nets that are lit by ultraviolet lights deter turtles but catch just as many fish as unlit nets.

    E-Print Network [OSTI]

    City and Gabriel Victora at the Whitehead Institute for Biomedical Research in Cambridge, Massachusetts-based data can fill in gaps where there are no field data. Carbon Balance Mgmt. 8, 7 (2013) ZOOLOGY Bee trade such as energy-absorbing materials or acoustic dampeners, the authors suggest. Adv. Mater. http:// dx.doi.org/10

  8. Course Enrollment by College -Census West Lafayette -Spring 2010

    E-Print Network [OSTI]

    Pittendrigh, Barry

    Course Enrollment by College - Census West Lafayette - Spring 2010 Freeze Date: Jan 26, 2010 by College - Census West Lafayette - Spring 2010 Freeze Date: Jan 26, 2010 College Enrollment 01 02 03 04 05 7 3 16 13 21 63 AGEC41200 Farm Business Mgmt 3 8 11 AGEC42100 Livestock & Meat Mrkt 1 1 3 15 7 15 42

  9. Javaune Adams-Gaston, PhD Vice President

    E-Print Network [OSTI]

    , PhD Exec Director Director Career Connection Chris Rideout, PhD Director Planning & Design Steve Environmental Svcs Carl Bowman Director Bldg & Mechanical Svcs Ron Dye Director Neighborhood Svcs & Collaboration Willie Young Sr. Director Energy Mgmt & Sustainability Tom Reeves Director SL Graduate

  10. BUSINESS DATA ANALYTICS -PLAN OF STUDY CATALOG YEAR: 2014-2015 Name__________________________________________ PeopleSoft ID#________________ Anticipated Date of Completion (MM/YY) _________

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Page 1 BUSINESS DATA ANALYTICS - PLAN OF STUDY CATALOG YEAR: 2014-2015 Name OPIM 3104 3000/4000 level Business elective 3000/4000 level Business elective FNCE 3101 OPIM 3505 3000/4000 level Business elective MGMT 4902 OPIM 3103 BADM 4075W BADM 4072 1 ACCT 2101: Recommended to take

  11. Seattle University Albers School of Business

    E-Print Network [OSTI]

    Carter, John

    Seattle University Albers School of Business MGMT 464/564: Family Business Management Spring Term 2011 Instructor: Mark T. Green, Ph.D. ­ Clinical Professor of Family Business & Principal, Family Business Consulting Group Class location & time: 8:30 to 2:00 p.m. over five Saturdays (April 2, April 16

  12. AE Work Team Roster IT Email & Calendar Consolidation 2012-01-06 v1.3 dgk Project Member Team Role UW-Madison Role

    E-Print Network [OSTI]

    Sheridan, Jennifer

    AE Work Team Roster IT ­ Email & Calendar Consolidation 2012-01-06 v1.3 dgk Project Member Team Role UW-Madison Role Rhonda Davis Team Leader School of Veterinary Medicine (SVM) Roger Hanson Team Member Dept of Information Technology (DoIT) Bobby Burrow Team Member Administrative Information Mgmt

  13. TROPICAL ATMOSPHERE-OCEAN (TAO) PROGRAM FINAL CRUISE REPORT

    E-Print Network [OSTI]

    John Dobbins (618) 453-3734 Quigley 413 jdobbins@siu.edu Art Ms Diane McClain-Inman (618) 453 Security Mgmt Mr Gary Kistner (618) 453-7277 Quigley 402 siufire@siu.edu Food and Nutrition Mr Terry

  14. DOE Conference Approval Laurie Escudero

    E-Print Network [OSTI]

    Wechsler, Risa H.

    requests cannot be submitted when locked - Allows for earlier approvals · Event lockout dates can be longer than 60 days ­ Conf Mgmt will communicate when this happens - Example: Lockout date for March APS yet for exceptions to 60 day lock out · How will we know about early lock-out dates? · Process

  15. The University of Edinburgh Document Control Information

    E-Print Network [OSTI]

    Edinburgh, University of

    The University of Edinburgh Document Control Information: Last updated on: 25 February 2010 Approved by Court: February 2010 Created by: Fleur Ruckley, Estates Waste Management File name (this version): RecyclingWasteMgmtPolicy2010-FINAL Web address for pdf version of this document: http://www.ed

  16. Environmental Analysis and Decision Making The Wiess School of Natural Sciences

    E-Print Network [OSTI]

    Richards-Kortum, Rebecca

    175 Environmental Analysis and Decision Making The Wiess School of Natural Sciences Director of new science-based products. Degree Requirements for M.S. in Environmental Analysis and Decision Making in spring) CEVE 401 Introduction to Environmental Chemistry with lab MGMT 750 Management for Science

  17. Recommended Academic Plan for Horticulture Major -Business/Production Option (HORT/BSPRD) Berks Campus

    E-Print Network [OSTI]

    Guiltinan, Mark

    ) Elementary Statistics 4 Humanities (GH) 3 Business/Spanish Selection (Note A Below) 3 Business/Spanish Turf and Ornamental Weed Control or AGRO 438 Principles of Weed Management 3-4 Business/Spanish Business/Spanish: AG 301W, BLAW 243, FIN 100, MKTG 221, MKTG 220, MGMT 100, SPAN 1,2,3 OR 105, AG BM 200

  18. Recommended Academic Plan for Horticulture Major -Business/Production Option (HORT/BSPRD) Commonwealth Campuses (not including Berks)

    E-Print Network [OSTI]

    Guiltinan, Mark

    Statistics 4 Business/Spanish Selection (Note A Below) 3 Arts (GA) 3 Business/Spanish Selection (Note A Below) 3 Humanities (GH) 3 Social and Behavioral Science (GS) 3 Business/Spanish Selection (Note A Below) 3 courses from Business/Spanish: AG 301W, BLAW 243, FIN 100, MKTG 220, MKTG 221, MGMT 100, SPAN 1,2,3 OR 105

  19. Leadership and Management Development Section 345-02 @ 6:00 8:45 MWF

    E-Print Network [OSTI]

    Young, Paul Thomas

    MGMT 345 Leadership and Management Development Fall 2013 Section 345-02 @ 6:00 ­ 8:45 MWF C of C North Campus, Room 139 Syllabus Text: Leadership: Research Findings, Practice, and Skills, Dubrin, 7th by appointment Course Website: OAKS Course Description: An investigation of the factors that determine leadership

  20. Management and Organizational Behavior Section 301-01 @ 9:00 9:50 MWF

    E-Print Network [OSTI]

    Young, Paul Thomas

    MGMT 301 Management and Organizational Behavior Fall 2013 Section 301-01 @ 9:00 ­ 9:50 MWF Beatty organizational goals by working with, and through, people and other resources. Organizations are treated. To understand management and organizational behavior (OB) concepts associated with continuous improvement

  1. Course Syllabus Management and Organizational Behavior

    E-Print Network [OSTI]

    Young, Paul Thomas

    Course Syllabus MGMT 301 Management and Organizational Behavior 2013 Fall Section 301-2 M/W/F 8. Course Description This course approaches management as that process of reaching organizational goals and organizational behavior (OB) concepts associated with continuous improvement in individual, group

  2. Management and Organizational Behavior Section 301-08 @ 2:00 3:15 MW

    E-Print Network [OSTI]

    Young, Paul Thomas

    MGMT 301 Management and Organizational Behavior Fall 2013 Section 301-08 @ 2:00 ­ 3:15 MW Beatty organizational goals by working with, and through, people and other resources. Organizations are treated. To understand management and organizational behavior (OB) concepts associated with continuous improvement

  3. Management and Organizational Behavior Tuesday and Thursday

    E-Print Network [OSTI]

    Young, Paul Thomas

    1 MGMT 301 Management and Organizational Behavior Fall 2013 Tuesday and Thursday Course Syllabus of the Course: 1. To understand management and organizational behavior (ob) concepts associated with continuous improvement in individual, group, and organizational processes in our global environment. Specific attention

  4. The College of Charleston Management and Organizational Behavior

    E-Print Network [OSTI]

    Young, Paul Thomas

    The College of Charleston Management and Organizational Behavior Mgmt 301 Fall 2013 Dr Gordon E hours: T-Th 3-4p + by appt [please notify me via e-mail] Managing Organizational Life: From Mc 1. To understand management and organizational behavior concepts associated with continuous

  5. General Indicators: Performance Statistics

    E-Print Network [OSTI]

    Webb, Peter

    Bank Central Svcs. Energy Mgmt Admin Preventive Maintenance: Fire/Life/Safety (FLS) 87% -4% 100% 47 Trend Initial Target Steam Chilled Utility Outages 2 +1% 0 0 0 Preventive Maintenance: Fire participation reading will be June 2012 *Budget data FYTD through March 2012 Maintenance: Performance Statistics

  6. General Indicators: Performance Statistics

    E-Print Network [OSTI]

    Webb, Peter

    Bank Central Svcs. Energy Mgmt Admin Preventive Maintenance: Fire/Life/Safety (FLS) 85% -12% 100% 80 Trend Initial Target Steam Chilled Utility Outages 3 -5 0 1 0 Preventive Maintenance: Fire participation reading will be August 2012 *Budget data FYTD through May 2012 Maintenance: Performance Statistics

  7. General Indicators: Performance Statistics

    E-Print Network [OSTI]

    Webb, Peter

    . Energy Mgmt Admin Preventive Maintenance: Fire/Life/Safety (FLS) 97% +10% 100% 96% 93% 99% 98% Non Chilled Utility Outages 8 +6% 0 1 2 Preventive Maintenance: Fire/Life/Safety (FLS) 100% No Change 100 will be June 2012 *Budget data FYTD through April 2012 Maintenance: Performance Statistics Current Month Change

  8. Actuarial Science College of Science MATH-BS

    E-Print Network [OSTI]

    Kihara, Daisuke

    /Social Science Written Communication Information Literacy Oral Communication Science Selective QuantitativeActuarial Science College of Science MATH-BS Code-ACSC Departmental/Program Major Courses (90 Equations (3) STAT 51200 Applied Regression Analysis (3) STAT 42000 Introduction To Time Series (3) MGMT

  9. Virginia Tech Input* Steve Ellingson

    E-Print Network [OSTI]

    Ellingson, Steven W.

    for cable/power/heat mgmt, so not more than 24U #12;MCS Interim Data Recorder (64) How will data;MCS Interim Data Recorder (Not asked) What is the estimated power consumption for MCS-DR? 5 PCs; est) and (61) (60) What is the estimated power consumption for MCS? 3 PCs; est. 600W each 2 1GbE managed

  10. Organization & Description Purchasing Agent 10000 Chancellor Wanda Chilson

    E-Print Network [OSTI]

    Xie,Jiang (Linda)

    Internal Audit Josh Van Dyck 13115 Risk Mgmt, Safety & Security Leigh Murray 13200 Human Resources AVC Pierce 14250 High Voltage Shop Doug Pierce 14300 Facilities Management Zone 6 Doug Pierce 14350 FM Energy City Campus Sharon Caruthers 15200 School of Architecture Sharon Caruthers 15210 Col of Arts

  11. Campaign Participation March 11, 2013

    E-Print Network [OSTI]

    Portman, Douglas

    & Planning 67% President's Office 62% University Audit 60% Auxiliary Operations 56% Facilities & Services - Utility/Energy Mgmt 17% Purchasing 16% Facilities & Services - Mail 14% Facilities & Services - Support Operations 11% Institutional Resources 11% Security & Traffic 4% Career Center 0% 24-Warner School

  12. Campaign Participation May 27, 2014

    E-Print Network [OSTI]

    Portman, Douglas

    % 60-School of Nursing 38% 24-Warner School of Education 35% 90-Health Sciences 33% Finance - URMC 100% University Health Service 59% University Communications 57% University Audit 50% Research & Project% Facilities & Services - Utility/Energy Mgmt 11% Career Center 9% Security & Traffic 7% Page 2 #12;Campaign

  13. ESS280A_2012_011113.xlsx.1/11/13 2012 Sustainability Science Team

    E-Print Network [OSTI]

    Rose, Michael R.

    /4/12 Thursday 12:00-1:30 Integrated System for Energy Sustainability J. Brouwer, MAE 10/8/12 Monday 11ESS280A_2012_011113.xlsx.1/11/13 2012 Sustainability Science Team Topics in Sustainability Science) 11/15/12 Thursday 12:30-2:00 Environmental Security: Mgmt & Sustainability R. Matthew, PPD 11

  14. (BSET) -FIRE SAFETY ENGINEERING TECHNOLOGY CURRICULUM Effective Fall 2003

    E-Print Network [OSTI]

    Raja, Anita

    (BSET) - FIRE SAFETY ENGINEERING TECHNOLOGY CURRICULUM Effective Fall 2003 Updated - Fall 2009csd: In addition to University and College of Engineering requirements, an AAS transfer student who is admitted Advisor: Notes Engineering Economics Building Fire Safety Risk Mgmt. for Emerg. Services Professional

  15. Experimental Study of Water Droplet Flows in a Model PEM Fuel Cell Gas Microchannel

    E-Print Network [OSTI]

    Victoria, University of

    Experimental Study of Water Droplet Flows in a Model PEM Fuel Cell Gas Microchannel by Grant Minor Experimental Study of Water Droplet Flows in a Model PEM Fuel Cell Gas Microchannel by Grant Minor B. Eng. Mgmt Committee Member, Mechanical Engineering). Abstract Liquid water formation and flooding in PEM fuel cell gas

  16. 21 Apr 2006 IPSN / SPOTS `06 Trio: Enabling Sustainable and Scalable

    E-Print Network [OSTI]

    California at Berkeley, University of

    management. Use energy harvesting. Improve energy mgmt. Reduce power draw. #12;21 Apr 2006 IPSN / SPOTS `06 harvesting · Improve energy "transfer" ­ Lower operating voltage ­ Adapt load (e.g. MPP) · Decrease power ­ Increasing Lifetime through Solar Energy Solar Cell Short Circuit Current Richmond Field Station, August 24

  17. 1997/98 CSULB Catalog Management 435 Department Chair

    E-Print Network [OSTI]

    Sorin, Eric J.

    of principles and theories of management, organization theory, planning and control techniques. Consideration planning, organiza- tion, and control. Will also cover such topics as framework of international only. May be taken for a maximum of 6 units. 411. Production Planning (3) F Prerequisites: MGMT 300

  18. Detecting and Forecasting Economic Regimes in Automated Exchanges

    E-Print Network [OSTI]

    Ketter, Wolfgang

    Detecting and Forecasting Economic Regimes in Automated Exchanges Wolfgang Ketter , John Collins. of Mgmt., Erasmus University Dept. of Computer Science and Engineering, University of Minnesota Dept,gini,schrater}@cs.umn.edu, agupta@csom.umn.edu Abstract We present basic building blocks of an agent that can use observable market

  19. Detecting and Forecasting Economic Regimes in Automated Exchanges

    E-Print Network [OSTI]

    Ketter, Wolfgang

    Detecting and Forecasting Economic Regimes in Automated Exchanges Wolfgang Ketter # , John Collins, Rotterdam Sch. of Mgmt., Erasmus University + Dept. of Computer Science and Engineering, University wketter@rsm.nl, {jcollins,gini,schrater}@cs.umn.edu, agupta@csom.umn.edu Abstract We present basic

  20. 2009 No part may be reproduced in any form without prior authorization.

    E-Print Network [OSTI]

    Amin, S. Massoud

    /Tamper Detection 3. Comm. Protocol Security 4. Risk Mgmt. Enhancement 5. High Speed Encryption 1. Self Healing Grid without prior authorization. Goal: Optimize controls to compensate for damage or failure conditions prior authorization. Intelligent Flight Control System: Example ­ complete hydraulic failure (1997) #12

  1. Office of Facilities John Bollier

    E-Print Network [OSTI]

    Mike Halpern Mike Neville- UHC Pete Stanish (dual report to T. Ferrara) Utilities & Engineering Proj. Management & Const. Director David Parnigoni Engineering & Energy Mgmt. Sam Olmstead Jim Cramond Papallo Utility Plant Operations Tony Kearns Central PowerPlant Les Ross Tom Boothroyd Sterling Power

  2. Chinese Business Practices and Culture

    E-Print Network [OSTI]

    Hickman, Mark

    MGMT228 Chinese Business Practices and Culture School of Business and Economics 2014business Costs and food while in Hangzhou but there are other costs to consider also: Airfares approx. $1,800.00 Chinese: · Group project during orientation week at UC (35%) · Reflective learning journals while in China (30

  3. 03.01.01.M0.01 Enterprise Risk Management Page 1 of 3 STANDARD ADMINISTRATIVE PROCEDURE

    E-Print Network [OSTI]

    03.01.01.M0.01 Enterprise Risk Management Page 1 of 3 STANDARD ADMINISTRATIVE PROCEDURE 03.01.01.M0.01 Enterprise Risk Management Approved March 1, 2011 Next revised date: March 1, 2014 SAP Statement and Reason for SAP Texas A&M University is committed to identifying and managing risks in a proactive manner. As such

  4. Linking Two Seemingly Unrelated Diseases, Cancer and Acute Respiratory Distress Syndrome, Through a Dictyostelium Secreted Protein 

    E-Print Network [OSTI]

    Herlihy, Sarah E

    2014-06-05T23:59:59.000Z

    the sensitivity of SAP ....................... 162 Discussion .................................................................................................................. 163 APPENDIX E RBLA IS REQUIRED FOR APRA PROLIFERATION INHIBITION... Figure 33: Sodium chloride and PD fluid, but not sodium lactate, interfere with the ability of SAP to inhibit fibrocyte differentiation. ......................................... 163 Figure 34: RblA facilitates bacterial proliferation and colony...

  5. Vorlesung Enterprise Resource Planning, WS 06/07, Universitt Mannheim bungsblatt Vorlesung Enterprise Resource Planning WS 06/07

    E-Print Network [OSTI]

    Mannheim, Universität

    selbstständig bilanzierende Einheit da. X Über die Customizing Workbench werden alle Entwicklungen eines SAP-Systems koordiniert. X Aufgabe 2: Grundlagen Welche Module hat das SAP R/3 (Nennen Sie mindestens vier)? SD Vertrieb Personalwirtschaft FI Finanzwesen CO Controlling TR Treasury PS Projektsystem WF Workflow IS Branchenlösungen Aufgabe

  6. Proteases Potentiate Fibrocyte Differentiation 

    E-Print Network [OSTI]

    Galvis Carvajal, Elkin David

    2013-09-27T23:59:59.000Z

    by the presence of the plasma protein Serum Amyloid P (SAP). Tryptase and thrombin potentiate fibrocyte differentiation in the presence of SAP, suggesting that these proteases can be part of a triggering mechanism for scar tissue formation in both healing wounds...

  7. UNIVERSIDAD AUTNOMA DE MADRID ESCUELA POLITCNICA SUPERIOR

    E-Print Network [OSTI]

    Autonoma de Madrid, Universidad

    will be analyzed: SAP, a enterprise resource planning system (ERP) that allows information integration within una metodología de trabajo basada en el estándar más famoso y utilizado hoy en día (Project Management con anterioridad: SAP, un sistema de planificación de recursos de la empresa (ERP) que permite la

  8. GLIMPSE: A Generic and Flexible Monitoring Infrastructure Antonia Bertolino, Antonello Calabr, Francesca Lonetti

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    .secondname}@isti.cnr.it Antonino Sabetta SAP Research Sophia Antipolis antonino.sabetta@sap.com ABSTRACT To respond to the growing performance analysis through a simple example. Categories and Subject Descriptors H.4 [Information Systems- nect project (FP7­231167) Antonino Sabetta's contribution to the research presented in this paper

  9. HPI Future SOC Lab: Call for Projects The Hasso-Plattner-Institute (HPI) operates the "HPI Future SOC Lab" together

    E-Print Network [OSTI]

    Weske, Mathias

    by a number of smaller Intel systems as well as an NVIDIA Tesla GPU Computing system. SAP provides accessHPI Future SOC Lab: Call for Projects The Hasso-Plattner-Institute (HPI) operates the "HPI Future SOC Lab" together with its industrial partners EMC², Fujitsu, Hewlett-Packard, and SAP. EMC², Fujitsu

  10. SUMMER PLACEMENT REPORT International Corporate Leadership Programme

    E-Print Network [OSTI]

    Berzins, M.

    access has been reduced due to implementation of a newer system called SAP, Wang only certain fields can be changed and knowledge of SAP system is limited. This database is required to hold all the data Project: Project Summary: To Create Wiring Loom Database to address the information and organisation

  11. Technical University Hamburg-Harburg Department of Software Technology & Systems

    E-Print Network [OSTI]

    Moeller, Ralf

    TUHH Technical University Hamburg-Harburg Department of Software Technology & Systems Project work Processes & Systems) Department of Airbus Germany GmbH, to create their own eLearning courses for SAP: Migration from face-to-face SAP courses to eLearning International Master Program "Information and Media

  12. Yet Another Meta-Model to specify Non-Functional Antinisca Di Marco, Claudio Pompilio

    E-Print Network [OSTI]

    Boyer, Edmond

    , France antonino.sabetta@sap.com ABSTRACT In service-oriented systems non-functional properties become", CNR Pisa, Italy firstname.secondname@isti.cnr.it Antonino Sabetta SAP Research Sophia Antipolis-funded Con- nect project (FP7­231167) and EU-funded VISION ERC project (ERC-240555). Antonino Sabetta

  13. DOLCE ergo SUMO: On Foundational and Domain Models in SWIntO

    E-Print Network [OSTI]

    Hitzler, Pascal

    @eml.org 5 ontoprise GmbH, Karlsruhe, Germany, lastname@ontoprise.de 6 T-Systems, Berlin, Germany, firstname.lastname@t-systems.com 7 now at: SAP Research, CEC Karlsruhe, Germany, d.oberle@sap.com June 21, 2007 Abstract Increased the context of the SmartWeb project, we have developed a number of domain-specific on- tologies

  14. Contact Information Mustafa KRLI

    E-Print Network [OSTI]

    Erdem, Erkut

    Forces Information System project. I am a SAP BASIS consultant as well. Education Ms.D. : Turkish Air in various military projects. My business interest is on IBM Power hardware, AIX operating system, ORACLE database and RAC systems, SAN networks, SAP applications. I am one of the senior architects of Turkish Air

  15. Departmentof SupplyChainManagement andMarketingSciences

    E-Print Network [OSTI]

    Lin, Xiaodong

    Solutions with ERP/SAP II[1] (3) 22:799:661 Introduction to Project Management (3) 22:799:677 Fundamentals Resource Planning Systems 22:799:659 Supply Chain Solutions with ERP/SAP I 22:799:660 Supply Chain:799:650 Supply Chain Management Industry Project (required for full-time students; elective for part

  16. Aligning Data to Support Transportation Emerging Challenges &

    E-Print Network [OSTI]

    , vehicles, communications... · The transportation system ­ Finance ­ paying the bills ­ Privatization projections to determine whether, when, and where projected climate changes in their regions might? Essential data elements? http://www.climatescience.gov/Library/sap/sap4-7/final-report/ #12;9 Getting Ready

  17. Model-Driven Process Configuration of Enterprise Systems*

    E-Print Network [OSTI]

    van der Aalst, Wil

    have been funded by SAP Research and Queensland University of Technology with the project "ModellingModel-Driven Process Configuration of Enterprise Systems* Alexander Dreiling, Michael Rosemann Queensland University of Technology Wil van der Aalst Eindhoven University of Technology Wasim Sadiq SAP

  18. Consolidating the Access Control of Composite Applications and Workflows

    E-Print Network [OSTI]

    Kemper, Alfons

    .rits, volkmar.lotz}@sap.com Abstract. The need for enterprise application integration projects leads to complex¨unchen, Germany 2 SAP Research, Font de l'Orme, 06250 Mougins, France {wimmerma, kemper}@in.tum.de, {maarten systems (ERP) that rely on database backends. Also, business processes that are realized as Web service

  19. Towards a Model-Driven Infrastructure for Runtime Monitoring

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    the ongoing Connect European Project. 1 Introduction Nowadays software systems are increasingly pervasive of Computer Science, University of L'Aquila, Coppito (AQ), Italy antinisca.dimarco@univaq.it 3 SAP Research, Sophia Antipolis, France antonino.sabetta@sap.com Abstract. In modern pervasive dynamic and eternal

  20. An Experience with Ontology-based Agent Clustering Pepijn R. S. Visser

    E-Print Network [OSTI]

    Tamma, Valentina

    .liv.ac.uk £ From January 99 at: SAP-AG HRMS Development D-69190 Walldorf Pepijn.Visser@sap-ag.de Abstract/ experiment has been to identify the types of heterogeneity that can affect distributed systems. Furthermore-off of the KRAFT project [Gra97], [Gra98], a knowl- edge integration project that is currently conducted

  1. A Configurable Reference Modelling Language1 M. Rosemanna

    E-Print Network [OSTI]

    van der Aalst, Wil

    Systems, Configuration, Event-Driven Process Chains 1 This research project is financially supported by SAP Research. #12;- 2 - 1 Introduction Enterprise Systems (ES) offer business solutions for typical language used in the by far most successful Enterprise System (SAP) with configurable elements. Thus

  2. U.S. Senate Committee on Commerce, Science and Transportation Hearing on "A Time for Change: Improving the Federal Climate Change

    E-Print Network [OSTI]

    of the SAPs address the sensitivity and adaptability of ecosystems and human systems to climate change, the Climate Change Science Program has undertaken to produce 21 Synthesis and Assessment Products (SAPs of forces bringing about changes, and reducing uncertainty in projections of how climate may change. Seven

  3. HPI Future SOC Lab: Call for Projects The Hasso-Plattner-Institute (HPI) operates the "HPI Future SOC Lab" together

    E-Print Network [OSTI]

    Baer, Christian

    as an NVIDIA Tesla GPU Computing system. SAP provides access to its Platform as a Service offering, SAPHPI Future SOC Lab: Call for Projects The Hasso-Plattner-Institute (HPI) operates the "HPI Future SOC Lab" together with its industrial partners EMC², Fujitsu, Hewlett-Packard, and SAP. EMC², Fujitsu

  4. Cooperation Enablement for Centralistic Early Warning Systems

    E-Print Network [OSTI]

    Flegel, Ulrich

    Cooperation Enablement for Centralistic Early Warning Systems Ulrich Flegel SAP Research CEC that is considered here is the centralistic malware early warning system developed in the AMSEL project [3 Karlsruhe Vincenz-Prießnitz-Str. 1 76131 Karlsruhe, Germany ulrich.flegel@sap.com Johannes Hoffmann TU

  5. Fast Superiorization Using a Dual Perturbation Scheme for Proton Computed Tomography , R. W. Schulte2

    E-Print Network [OSTI]

    Censor, Yair

    -Averaging Projections (SAP) or Block Iterative Projection (BIP) methods). In pCT the parallel schemes are preferred on the general principle that many classes of projection methods (such as SAP and BIP) are perturbation resilient results [2,3]. These methods are used for solving a linear system of equations of the form (1) where

  6. Projektangebote fr das IS-Project (WS 2013/2014 und SS 2014) Fachgebiet Unternehmensrechnung und Wirtschaftsinformatik

    E-Print Network [OSTI]

    Steinhoff, Heinz-Jürgen

    System SAP Business Objects als einziges BI-System eingesetzt werden. Der Flughafen arbeitet mit dem ERP-System Controlling wurde das System SAP Business Objects angeschafft, in welches bereits die relevanten Daten aus der1 Projektangebote für das IS-Project (WS 2013/2014 und SS 2014) Fachgebiet Unternehmensrechnung und

  7. 1 Bocchino Resume Gregory Philip Bocchino, Ed.D.

    E-Print Network [OSTI]

    Meyers, Steven D.

    of APEX Degree Planner and SAP/Student Life Cycle Management System, reporting, updates, and exceptions: Microsoft Office, BlackBoard, Live Text, SLCM, SAP, APEX Education: Doctor of Education, Counseling University, FL, 2009 LGBT Safe Zone Project Training, KY, 2008 CPP, Inc. Myers Briggs Type Indicator

  8. Boston University Office of the Executive Vice President Human Resources Organizational Readiness Project

    E-Print Network [OSTI]

    Finzi, Adrien

    in a coordinated format required by the SAP enterprise resource planning (ERP) system. The collection of this data Project represents an important first step in the successful launch of SAP and modernizing our human Project To: Vice Presidents, Deans, Directors and Department Heads From: Joseph P. Mercurio, Executive

  9. MISMISMISMIS 373/OM 337.4373/OM 337.4373/OM 337.4373/OM 337.4 IT for Supply ChainsIT for Supply ChainsIT for Supply ChainsIT for Supply Chains Spring 20Spring 20Spring 20Spring 2011112222

    E-Print Network [OSTI]

    Ghosh, Joydeep

    of a group project. I want to emphasize that while you will gain an understanding of the SAP R/3 system such as procurement, fulfillment, and production using an actual ERP system (SAP R/3) as part of individual exercises to the use of the ERP simulation: (1) to understand how to use the transactional data in ERP systems

  10. Storage System and IBM System Storage

    E-Print Network [OSTI]

    IBM® XIV® Storage System and IBM System Storage® SAN Volume Controller deliver high performance and smart management for SAP® landscapes IBM SAP International Competence Center #12;"The combination of the XIV Storage System and SAN Volume Controller gives us a smarter way to manage our storage. If we need

  11. Early Warning System on a National Level Project AMSEL

    E-Print Network [OSTI]

    Flegel, Ulrich

    Early Warning System on a National Level ­ Project AMSEL Martin Apel, Joachim Biskup, Ulrich Flegel.biskup, michael.meier@cs.tu-dortmund.de SAP Research, Vincenz-Prießnitz-Str. 1, 76131 Karlsruhe, Germany ulrich.flegel@sap.com Abstract We present the architecture of an automatic early warning system (EWS) that aims at providing

  12. Washington University Department of Computer Science

    E-Print Network [OSTI]

    Schmidt, Douglas C.

    Washington University Department of Computer Science CS422: Operating Systems Programming Project_SOCK_Connector (void); // Default constructor. int connect (Muxed_SOCK_Stream *&new_stream, const INET_Addr &remote_sap); // Actively connect and produce a if things go well. // The sap> is the address that we

  13. Applying Genetic Algorithms to the State Assignment Problem: A case Study

    E-Print Network [OSTI]

    Amaral, José Nelson

    the codification of states in a Finite State Machine (FSM), is a well studied NP­complete problem. Micheli et al Assignment Problem (SAP) belongs to a broader class of combinatorial optimization problems than the well for a good solution is considerably more involved for the SAP than it is for the traveling salesman problem

  14. Andreev spectroscopy and surface density of states for a three-dimensional time-reversal-invariant topological superconductor

    E-Print Network [OSTI]

    Timm, Carsten

    November 2010 A topological superconductor is a fully gapped superconductor that exhibits exotic zero-energy, which connects the presence of delocalized boundary modes to the topologi- cal structure of the bulk in the neighborhood of the Fermi sur- fac

  15. Proc. Natl. Acad. Sci. USA Vol. 96, pp. 63536358, May 1999

    E-Print Network [OSTI]

    Dennis, Edward A.

    Gilman Drive, La Jolla, CA 92093-0682 Communicated by Daniel Steinberg, University of California, San-LDL. Using FACS analysis, we demonstrated that each of these EO antibodies bound to apo- ptotic cells

  16. SHORT REPORT Sexual dimorphism in campylobacteriosis

    E-Print Network [OSTI]

    Galan, Jorge E

    pets [2]. Risk fac- tors for human infection include eating undercooked meat (particularly chicken preparation and consumption [6], differences in the likelihood of seeking medical care [3] as well

  17. FACOLT DI ECONOMIA CENTRO DI RICERCA DELLA SAPIENZA

    E-Print Network [OSTI]

    Guidoni, Leonardo

    FACOLTÀ DI ECONOMIA CENTRO DI RICERCA DELLA SAPIENZA INTERDISCIPLINARE DI ECONOMIA INTERNAZIONALE Sapienza Università di Roma ­Fac. Economia Centro di Ricerca della Sapienza Interdisciplinare di Economia COMPETENZE DEL PRESTATORE: · Laurea specialistica in Economia Politica; · Conoscenza del pacchetto

  18. FACOLT DI ECONOMIA CENTRO DI RICERCA DELLA SAPIENZA

    E-Print Network [OSTI]

    Guidoni, Leonardo

    FACOLTÀ DI ECONOMIA CENTRO DI RICERCA DELLA SAPIENZA INTERDISCIPLINARE DI ECONOMIA INTERNAZIONALE Sapienza Università di Roma ­Fac. Economia Centro di Ricerca della Sapienza Interdisciplinare di Economia specialistica in Economia Politica; o conoscenza del pacchetto econometrico STATA; o esperienza nel trattamento

  19. Runtime Verification of Temporal Patterns for Dynamic Reconfigurations of Components

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    , Olga Kouchnarenko1 , and Arnaud Lanoix2 1 University of Franche-Comté, Besançon, France {jdormoy Software - FACS 2011 (2011)" #12;In [14], we have proposed a temporal pattern logic, called FTPL, to char

  20. Adapting Component-based Systems at Runtime via Policies with Temporal Patterns

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Adapting Component-based Systems at Runtime via Policies with Temporal Patterns Olga Kouchnarenko1 Aspect of Component Software - FACS 2013, Nanchang : Chine (2013)" #12;2 O. Kouchnarenko, J-F. Weber

  1. Using Temporal Logic for Dynamic Reconfigurations of Components

    E-Print Network [OSTI]

    Boyer, Edmond

    Using Temporal Logic for Dynamic Reconfigurations of Components Julien Dormoy1 , Olga Kouchnarenko1, published in "FACS 2010, 7th Int. Ws. on Formal Aspects of Component Software, Portugal (2010)" #12;More

  2. Using Temporal Logic for Dynamic Reconfigurations of Components

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Using Temporal Logic for Dynamic Reconfigurations of Components Julien Dormoy1 , Olga Kouchnarenko1, published in "7th International Workshop on Formal Aspects of Component Software - FACS'2010 (2010)" #12

  3. original article The new engl and jour nal of medicine

    E-Print Network [OSTI]

    Meyers, Ron

    and computed tomography. Body composition and energy expenditure were mea- sured with the use of dual-energy x that stimulating adaptive thermogenesis, defined as the fac- ultative heat produced in response to cold and diet

  4. AD : Airworthiness Directive ADC : Air Data Computer

    E-Print Network [OSTI]

    Ladkin, Peter B.

    FAA : Federal Aviation Administration FAC : Flight Augmentation Computer FADEC : Full Authority' Aviation Civile DH : Decision Height ECAM : Electronic Centralized Aircraft Monitoring BFCU : Electronic ICAO : International Civil Aviation Organization IGS : Instrument Guidance System IGV : Inlet Guide

  5. Larry Blake Superintendent

    E-Print Network [OSTI]

    Boyce, Richard L.

    07/05/12 AVP, Fac Mngt Larry Blake Superintendent Technical Systems Jeffrey Noel Superintendent Linda Hahn Gary Rudolph Dorian Chapman Linda Fields Tonya Courtney Elizabeth Cole Jimmy Martin

  6. Akce s mezinrodn cast v roce 2006 MFF -hlavn poadatel

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    .cas.cz/pragstoch06/ MFF ­ spolupoadatel Sekce F 1. Noise and Reliability of Nanoscale Electronic and Optoelectronic rd International Workshop on Formal Aspects of Component Models (FACS´06) Praha 20. ­ 22. 9. 2006

  7. NM INVESTMENT OVERSIGHT COMMITTEE ERB'S PLAN DESIGN RECOMMENDATION

    E-Print Network [OSTI]

    New Mexico, University of

    Presented at December 3, 2010 Working Session Normal Retirement Eligibility Early Retirement Eligibility Retirement Eligibility Early Retirement Eligibility Final Average Compensation (FAC) Ultimate Employer Working Session (& Other Recommended Proposals) Normal Retirement Eligibility Early Retirement Eligibility

  8. Annual Drosophila Research Conference, 2006 Amit Singh1*

    E-Print Network [OSTI]

    Kango-Singh, Madhuri

    different fac- ets of biomedical science. This meet- ing serves as a platform to present the cutting edge-distal (PD) axis generation in limbs. The highly conserved transcrip- tion factor Dll is important for speci

  9. Financial analysis of energy-efficient façade systems for application in commercial office developments

    E-Print Network [OSTI]

    Dee, Rocelyn Sy, 1976-

    2002-01-01T23:59:59.000Z

    Advocates for sustainable development have been campaigning for the implementation of green features in developments. New and high-technology energy-efficient technologies, such as photovoltaic cells and double skin fac?ades, ...

  10. Computer Supporting Diaspora Knowledge Networks

    E-Print Network [OSTI]

    Turner, William

    ; Gerhardt, Nadia; Siciliano, Florencia; Rosa Marano, Maria] Univ Nacl Rosario, Inst Biol Mol & Celular Biol Mol & Celular Rosario, CONICET, Fac Ciencias Bioquim & Farmaceut,Area Virol, RA-2000 Rosario

  11. Identifying and Understanding the Functional Significance of Cancer Stem Cells in Prostate and Pancreatic Cancer Initiation and Chemoresistance

    E-Print Network [OSTI]

    Hindoyan, Antreas Agop

    2013-01-01T23:59:59.000Z

    determined by FACS and FDG PET/CT scans show similar tumornegative controls. (D) PET/CT scan images of tumor-bearingSupp Figure S4-2: 18F FDG PET/CT scans show similar tumor

  12. We are exploring spatiotemporal dynamics of plant communities in urban and surrounding desert sites of the

    E-Print Network [OSTI]

    Hall, Sharon J.

    that changes in relation ships are related to environmental and socioeconomic fac tors but that their relative is being consumed faster than it is being re charged (Ellis et al. 2008). Accordingly, population and eco

  13. First Born calculations of the single and double ionization of H- by bare-ion projectiles

    E-Print Network [OSTI]

    Saunders, Anna Windsor

    1996-01-01T23:59:59.000Z

    -orbitals are added (Ford 1995). The numbers of electron configurations of each symmetry for various sp and spd orbital bases are given in table l. Table 1. Number of electron configurations for sp and spd orbital basis sets. 9s9p 13s13p 9s9p9d S 90 182 P' 81... spd orbital ground state energies (a. u. ) relative to 9s9p. 9s9p (FAc = 0 7s) 9s9p5d (FAc= 0. 75, 0 75, I s) 9s9p7d (FAc = 0. 75, 0 75, 1. 2) 9s9p7d (Frlc = 0 7s, 0. 75, l. o) 9s9p9d (FAc = 0 75, 0 75, 0 75) -2. 897736 -2. 898812 -2. 899388...

  14. Monthly Planner Printed by Calendar Creator for Windows on 11/26/2012

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On 4 ALL HR/ Payroll Resp. On 5 ALL HR/ Payroll Resp. On 6 ALL HR/ Payroll Resp. On 7 ALL HR HRMS Spec & Fac Staff Rev 9 Out of Sys HRMS Spec & Fac Staff Rev 10 ALL HR/ Payroll Resp. On 11 ALL HR

  15. October 2012 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On 4 ALL HR/ Payroll Resp. On 5 ALL HR/ Payroll Resp. On 6 ALL HR/ Payroll Resp. On 7 ALL HR HRMS Spec & Fac Staff Rev 9 Out of Sys HRMS Spec & Fac Staff Rev 10 ALL HR/ Payroll Resp. On 11 ALL HR

  16. Contractive piecewise continuous maps modeling networks of inhibitory neurons.

    E-Print Network [OSTI]

    ´istica Rafael Laguardia (IMERL), Fac. Ingenier´ia. Universidad de la Rep´ublica. Uruguay. Corresponding author. Address: Herrera y Reissig 565. C.P. 11300. Montevideo. Uruguay. Tel-fax: +598-2711-0621. E-mail: eleonora@fing.edu.uy Centro de Matem´atica. Fac. de Ciencias. Universidad de la Rep´ublica. Uruguay. §Departamento de Biomatem

  17. F-Area Acid/Caustic Basin groundwater monitoring report. Second quarter 1995

    SciTech Connect (OSTI)

    NONE

    1995-09-01T23:59:59.000Z

    During second quarter 1995, samples from the FAC monitoring wells at the F-Area Acid/Caustic Basin were collected and analyzed for herbicides/pesticides, indicator parameters, metals, nitrate, radionuclide indicators, volatile organic compounds, and other constituents. Piezometer FAC 5P and monitoring well FAC 6 were dry and could not be sampled. New monitoring wells FAC 9C, 10C, 11C, and 12C were completed in the Barnwell/McBean aquifer and were sampled for the first time during third quarter 1994 (second quarter 1995 is the fourth of four quarters of data required to support the closure of the basin). Analytical results that exceeded final Primary Drinking Water Standards (PDWS) or Savannah River Site (SRS) Flag 2 criteria such as the SRS turbidity standard of 50 NTU during the quarter were as follows: gross alpha exceeded the final PDWS and aluminum, iron, manganese, and radium-226 exceeded the SRS Flag 2 criteria in one or more of the FAC wells. Turbidity exceeded the SRS standard (50 NTU) in well FAC 3. Groundwater flow direction in the water table beneath the F-Area Acid/Caustic Basin was to the west at a rate of 1300 feet per year. Groundwater flow in the Barnwell/McBean was to the northeast at a rate of 50 feet per year.

  18. Groundwater level monitoring sampling and analysis plan for the environmental monitoring plan at waste area grouping 6, Oak Ridge National Laboratory, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    NONE

    1995-09-01T23:59:59.000Z

    This document is the Groundwater Level Monitoring Sampling and Analysis Plan (SAP) for Waste Area Grouping (WAG) 6 at Oak Ridge National Laboratory (ORNL). Note that this document is referred to as a SAP even though no sampling and analysis will be conducted. The term SAP is used for consistency. The procedures described herein are part of the Environmental Monitoring Plan (EMP) for WAG 6, which also includes monitoring tasks for seeps and springs, groundwater quality, surface water, and meteorological parameters. Separate SAPs are being issued concurrently to describe each of these monitoring programs. This SAP has been written for the use of the field personnel responsible for implementation of the EMP, with the intent that the field personnel will be able to take these documents to the field and quickly find the appropriate steps required to complete a specific task. In many cases, Field Operations Procedures (FOPs) will define the steps required for an activity. The FOPs for the EMP are referenced and briefly described in the relevant sections of the SAPs, and are contained within the FOP Manual. Both these documents (the SAP and the FOP Manual) will be available to personnel in the field.

  19. Origins of PM10 determined by the micro-proton induced X-ray emission spectra of single aerosol particles

    SciTech Connect (OSTI)

    Yue, W.S.; Li, X.L.; Wan, T.M.; Liu, J.F.; Zhang, G.L.; Li, Y. [Chinese Academy of Science, Shanghai (China). Shanghai Institute of Applied Physics

    2006-06-15T23:59:59.000Z

    The micro-proton induced X-ray emission (micro-PIXE) spectrum of a single aerosol particle (SAP) was considered as its fingerprint for tracing its origin. A proton microprobe was used to extract fingerprints of SAPs. Environmental monitoring samples of PM10 were collected from a heavy industrial area of Shanghai and were analyzed by proton microprobe for finding their pollution sources. In order to find the sources of SAPs collected from environmental monitoring sites, a fingerprint database of SAPS collected from various pollution Sources was established. The origins of samples collected through environmental monitoring were identified by comparison of the micro-PIXE spectra of SAPs with those of SAPs in the fingerprint database using a pattern recognition technique. The results of this study show that most of the measured PM10 is derived from metallurgic industry, soil dust, coal combustion, automobile exhaust, and motorcycle exhaust. The study also shows that the proton microprobe is an ideal tool for the analysis of SAPs. The unidentified particles of PM10 are classified into seven classes by hierarchical cluster analysis based on the element peak intensity in the spectra.

  20. Sampling and Analysis Plan - Waste Treatment Plant Seismic Boreholes Project

    SciTech Connect (OSTI)

    Reidel, Steve P.

    2006-05-26T23:59:59.000Z

    This sampling and analysis plan (SAP) describes planned data collection activities for four entry boreholes through the sediment overlying the basalt, up to three new deep rotary boreholes through the basalt and sedimentary interbeds, and one corehole through the basalt and sedimentary interbeds at the Waste Treatment Plant (WTP) site. The SAP will be used in concert with the quality assurance plan for the project to guide the procedure development and data collection activities needed to support borehole drilling, geophysical measurements, and sampling. This SAP identifies the American Society of Testing Materials standards, Hanford Site procedures, and other guidance to be followed for data collection activities.

  1. Iron and zinc response and nutrient uptake of sorghums grown on two calcareous soils from the High Plains of Texas 

    E-Print Network [OSTI]

    Pennington, Hurm Dale

    1971-01-01T23:59:59.000Z

    on the possible causes of Fe chlorosis have been proposed. Hi H in Plant Tissue, Ingalls and Shiver (30) studied the relationship between the pH of plant sap and the soluble (filterable) Fe from the sap. High light intensity caused the soluble Fe and pH values... to fluctu- ate; however, there seemed to be a trend that lower soluble Fe levels always accompanied. higher pH values. They suggested that a high pH and a low soluble Fe level in plant sap may induce Fe chlorosis. Rogers and. Shive (54) found this same...

  2. Resistant characteristics of cotton to sweet potato whitefly (Bemisia tabaci Gennadius) 

    E-Print Network [OSTI]

    Smith, Wendy Justine

    1993-01-01T23:59:59.000Z

    stage (Gerling, 1984). It has piercing-sucking mouthparts and feeds on phloem sap. Less than one millimeter long, and with a wing expanse of less than two millimeters, it lives on the undersurface of its host's leaves. B. rabaci has five nymphal... to the apparent ability of this biotype to ingest and process more phloem sap than SPW-A. This has allowed SPW-B to expand its host range to plants having lower phloem sap nutrient concentrations (Byrne and Miller, 1990). Many whitefly species, including SPW...

  3. Academic Program Development University of Zurich

    E-Print Network [OSTI]

    Zürich, Universität

    at the doctoral level and courses in licentiate programs. Reasons for this include no data in SAP online, students in licentiate programs who are enrolled in Bachelor or Master's level courses cannot

  4. MSU Extension's EZ Plant and Grow Tips www.migarden.msu.edu

    E-Print Network [OSTI]

    was the first U.S. ambassador to Mexico, where poinsettias are native. He brought plants back to South Carolina involved children. However, some people may be allergic to the milky sap called latex and small pets may

  5. July/August 1998 Small Hive Beetle Aethina tumida Changing Chemical World

    E-Print Network [OSTI]

    Ferrara, Katherine W.

    . Nitidulids are commonly called "sap beetles" because they are often found where plant fluids are fermenting. The tree's strong- tasting nectar, it was feared, would contaminate the citrus and palmetto honey crops

  6. Forbes Leadership Forum April 2, 2013

    E-Print Network [OSTI]

    policy. Our newfound boom in natural gas and oil production will ease. America's economy and security depend upon reliable sources of power. Over concerns. They sap our economy, exacerbate climate change, and constrict our foreign

  7. Mosquito Control Around the Home 

    E-Print Network [OSTI]

    Jackman, John A.; Olson, Jimmy K.

    2003-03-17T23:59:59.000Z

    mos- quitoes live on land and are winged. The males feed only on nectar, plant juices and other sources of liquid carbohydrates. Female mosquitoes also feed periodically on nectar, plant sap and other sources of plant carbohy- drates for energy...

  8. LESSONS 

    E-Print Network [OSTI]

    Bunker, G.

    2012-01-01T23:59:59.000Z

    on SAP standard details - Tacit knowledge gap, poor design detailing gbunker@dmu.ac.ukInsights ? Air tightness ? cause of heat loss up to 50%! ? Elm Tree Mews, High levels of infiltration ? Lessons - Energy failure due to difficult junction details...

  9. Structural Impairment Detection Using Arrays of Competitive Artificial Neural Networks 

    E-Print Network [OSTI]

    Story, Brett

    2012-07-16T23:59:59.000Z

    and indicated types and locations of possible impairments. Analytical modeling was initially performed in SAP2000 and then refined with ABAQUS. Modeling results from the Salmon Bay Bridge were used to determine measureable quantities sensitive to modeled...

  10. The potential use of thiabendazole and propiconazole for oak wilt control in live oak 

    E-Print Network [OSTI]

    Roberts, Paul Edwin

    1988-01-01T23:59:59.000Z

    ' It pathogen (9). It must be soluble in tree sap; fungitoxic with limited phytotoxicity; and mobile in the tree with prolonged residual effects. A compound with these characteristics should be easily administered and adequately distributed throughout...

  11. Plant phloem sterol content: forms, putative functions, and implications for phloem-feeding insects 

    E-Print Network [OSTI]

    Behmer, Spencer T.; Olszewski, Nathan; Sebastiani, John; Palka, Sydney; Sparacino, Gina; Sciarrno, Elizabeth; Grebenok, Robert J.

    2013-09-24T23:59:59.000Z

    we bulk collected phloem sap exudate from bean and tobacco, and analyzed its sterol content. This approach revealed two significant observations concerning phloem sterols. First, the phloem exudate from each plant was found to contain sterols in three...

  12. Optimizing Production of Hydroquinone Achieves Increased Yield and Energy Efficiency 

    E-Print Network [OSTI]

    Gross, S.

    2010-01-01T23:59:59.000Z

    2009 production to model of the old production strategy ? Amount of HQ produced in one year ? Year end inventory ? Energy Savings: compared 2009 electricity and steam usage to that of 2008 ? Manufacturing Cost Reporting (SAP) Results ? Energy...

  13. Assessment of seismic risk for subsea production systems in the Gulf of Mexico 

    E-Print Network [OSTI]

    Brown, Laura Ann

    2004-09-30T23:59:59.000Z

    -Headed Pile ......... 125 6.26. Summary of Bending Stresses from Parametric Study Fixed-Headed Pile ........ 126 6.27. Time History Analysis Results (SAP2000 1999).................................................. 127 A.1. Required Soil and Casing...

  14. Influence of Transpiration Suppressants, Sprinkler Irrigation and Moisture Levels on Transpiration and Evapotranspiration 

    E-Print Network [OSTI]

    Gerard, C. J.

    1970-01-01T23:59:59.000Z

    and net radiation data indicated that reflective treatment on tomatoes was effective in reflecting the incoming solar radiation in 1969. Thermoelectric Data Sap flow as influenced by treatments and climatic conditions was evaluated with a thermoelectric...

  15. Rapid Spatial Distribution Seismic Loss Analysis for Multistory Buildings 

    E-Print Network [OSTI]

    Deshmukh, Pankaj Bhagvatrao

    2012-07-16T23:59:59.000Z

    and incremental dynamic analysis along with the commercial software SAP2000 are used to establish demands from which story damage and financial losses are computed directly and aggregated for the entire structure. Rigorous and simplified methods are developed...

  16. Savings Along the Rio Grande 

    E-Print Network [OSTI]

    Supercinski, Danielle

    2007-01-01T23:59:59.000Z

    management programs for noxious weeds and analyze sap-flux and water-use estimates for saltcedar trees. Publications developed from this research address irrigating urban landscapes with moderately saline water. Researchers have also acquired a user...

  17. The effects of peritoneal dialysis fluid and its components on the differentiation of white blood cells into fibrocytes 

    E-Print Network [OSTI]

    Starke, Hannah

    2012-04-12T23:59:59.000Z

    the blood and develop into cells called fibrocytes. A blood protein called serum amyloid P (SAP) inhibits the development of fibrocytes. I investigated how the dialysis fluid and its separate salt components affect the development of fibrocytes. I found...

  18. Position Category: Operational and/or Administrative Region: Canada

    E-Print Network [OSTI]

    Kambhampati, Patanjali

    in English; Knowledge of the SAP System and/or an additional language would be an asset (French & Spanish and revenues on consultancy projects using an established database; Prepare/co-ordinate meeting documentation

  19. Business Systems and Analytics With ever increasing amounts of data, organizations are identifying

    E-Print Network [OSTI]

    Miles, Will

    , business systems analysis and design, enterprise resource planning, project management and business process offered by the International Institute of Business Analysis, SAP, the Project MaBusiness Systems and Analytics With ever increasing amounts of data, organizations are identifying

  20. BLIND AUDIO SOURCE SEPARATION USING SHORT+LONG TERM AR SOURCE MODELS AND SPECTRUM MATCHING

    E-Print Network [OSTI]

    Gesbert, David

    industrial partners: BMW Group, Cisco Systems, Monaco Telecom, Orange, SAP, SFR, STEr- icsson, Swisscom, Symantec, Thales. This research has also been partially supported by the SELIA project of the Futur

  1. 5/8/2014 Page 1 of 5 EXPORT CONTROL CERTIFICATION

    E-Print Network [OSTI]

    Papautsky, Ian

    : ___________________________________________________________________ Immigration Status requested: ___________________________________________________________________ SAP No. (if or agency sponsored research project? If yes, please list the project: 5. Will the duties involve working, accelerometers, thermal-imaging, gyros, UAVs, satellites, mass spectrometers, inertial navigation systems, GPS

  2. Bachelor of Business administration Course Descriptions

    E-Print Network [OSTI]

    Saldin, Dilano

    operations. Topic areas include customer management, purchasing, logistics, project management, demand Systems Concepts and Issues. 3 cr. Advanced concepts in ERP and integrated nature of business processes, all the major components of SAP R/3 and NetWeaver tools.

  3. PhD Recent Graduates with background in Distributed Systems. Virtualization, Distributed Systems, Application Servers or Operating Systems

    E-Print Network [OSTI]

    Plotkin, Joshua B.

    and maintenance support of the project. * Work closely with internal SAP associates, external partnersPhD Recent Graduates with background in Distributed Systems. Virtualization, Distributed Systems, Application Servers or Operating Systems Global Business Incubator Location ­ Palo Alto PURPOSE

  4. Georgia Southern University Career Services Williams Center (912) 478-5197 www.georgiasouthern.edu/career/ Explore. Experience. Excel.

    E-Print Network [OSTI]

    Hutcheon, James M.

    · Enterprise Resource Planning Sys. (SAP) · Accounting Information Systems · Business Application Development Developers · Project Analysts · Technical Consultant · Systems Programmer · Internet Developers · Application System Managers · Project Managers What Can I Do With A Major In . . . INFORMATION SYSTEMS #12;Georgia

  5. International Joint Research Project "Physical Violence and State Legitimacy in Late Socialism"

    E-Print Network [OSTI]

    Schubart, Christoph

    International Joint Research Project "Physical Violence and State Legitimacy in Late Socialism Regensburg Beyond Systemic Divides: Experience and Remembrance of Physical Violence in Soviet and post and the SAP Kosovo Robert Luci, ZZF Potsdam Printing t

  6. Business Systems Analysis With ever increasing amounts of data, organizations are identifying

    E-Print Network [OSTI]

    Miles, Will

    , business systems analysis and design, enterprise resource planning, project management and business process Institute of Business Analysis, SAP, the Project Management InBusiness Systems Analysis With ever increasing amounts of data, organizations are identifying

  7. Presented by the UT Dallas Career Center UT Dallas Fall Career Expo Days STEM Day | Friday, Sept. 26, 2014

    E-Print Network [OSTI]

    O'Toole, Alice J.

    , SAP, & Cyber Security Computer Engineering, Computer Science, Software Engineering, Systems, Software Engineering, Systems Engineering and Management, MIS, ITM Bachelors, Masters Full-time, Interns Bachelors Full-time Unable to consider Availity Developer, Product Owner, Scrum Master, Project Manager All

  8. NERSC-ScienceHighlightSlidesJune2011.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    can now be used at a larger scale to characterize many more materials - BESASCR SciDAC SAP project "Knowledge Guided Screening Tools for Identification of Porous Materials for CO...

  9. Boston University Office of Sponsored Programs

    E-Print Network [OSTI]

    Guenther, Frank

    will not be established in the SAP financial system until this review and approval has occurred. There is a high volume that the responsible Department has the resources and facilities to carry out the project; and to assess the potential

  10. Human Resources Organizational Readiness Project Over the past 18 months, hundreds of employees from across the University brought their institutional

    E-Print Network [OSTI]

    Finzi, Adrien

    Human Resources Organizational Readiness Project Over the past 18 months, hundreds of employees implement SAP. What is the Human Resources Organizational Readiness Project? In preparation for the BUworks Program, the Human Resources Organizational Readiness Project will collect, organize and standardize

  11. Precise Steps for Choreography Modeling for SOA Validation and Verification

    E-Print Network [OSTI]

    Southampton, University of

    as the next evolutionary step to cope with the software complexity of ERP systems where monolithic approaches component models by verification. This fits well into the model-driven development approach practiced at SAP

  12. Modulators of Toll-like Receptors -7 and -8

    E-Print Network [OSTI]

    Shukla, Nikunj M.

    2011-05-31T23:59:59.000Z

    RIG retinoic acid inducible gene RNA ribonucleic acid sAP secreted alkaline phosphatase SAR structure activity relationship SNAr aromatic nucleophilic substitution SSC side scatter ssRNA single stranded RNA TGF-? transforming growth...

  13. Influence of Mississippian Karst Topography on Deposition of the Cherokee Group: Ness County, Kansas

    E-Print Network [OSTI]

    Ramaker, Benjamin J.

    2009-06-12T23:59:59.000Z

    are confined to lowstand and transgressive systems tracts. Sand development is strongly influenced by Mississippian paleotopography. Thick sandstone successions were deposited in groundwater-sapped Mississippian valleys and along the paleoshoreline. Two...

  14. arteriovenous malformation embolization: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ascent of sap is possible even for the tallest trees avoiding the problems due to cavitation. Gouin, Henri 2014-01-01 34 Research Proximity to Pollution Sources and Risk of...

  15. The nanofluidics can explain ascent of water in tallest trees

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    The nanofluidics can explain ascent of water in tallest trees Henri Gouin Abstract. In Amazing, inhomogeneous liquid nanolayers wet the xylem walls of microtubes. The nanofluidic model of crude sap in tall

  16. apocynaceae alcaloides indolicos: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Last Page Topic Index First Page Previous Page 1 2 Next Page Last Page Topic Index 21 Hemp dogbane Apocynum cannabinum L. Renewable Energy Websites Summary: a milky sap when...

  17. Performance of LTE in Rural Areas -Benefits of Opportunistic Multi-User MIMO

    E-Print Network [OSTI]

    Gesbert, David

    urban environments at 2.6 GHz demand an extensive investigation of LTE transmission in this lucrative in part by its industrial partners: Swiss- com, Thales, SFR, Orange France, ST Ericsson, SAP, BMW Group

  18. Impact of Vehicular Integration Effects on the Performance of DSRC Communications

    E-Print Network [OSTI]

    Gesbert, David

    §Institute of Communications Technology, Leibniz Universität Hannover, Germany BMW Group Research communication capabilities in various environments, first through simulations, but more recently in small scale EURECOM acknowledges the support of its industrial members: Cisco, BMW Group, Monaco Telecom, Orange, SAP

  19. Single-Microphone Blind Audio Source Separation via Gaussian Short+Long Term AR Models

    E-Print Network [OSTI]

    Gesbert, David

    the source separation can be performed satisfactorily, especially in clean environment, for example by using, STEricsson, Cisco, BMW Group , SAP, Monaco Telecom and Symantec. The research reported herein was also

  20. Department of communications mobiles Campus Sophia Tech

    E-Print Network [OSTI]

    Gesbert, David

    industrial members: BMW Group, Cisco, Monaco Telecom, Orange, SAP, SFR, STEricsson, Swisscom, Symantec. i #12 in quasi mono-process simulation environment. To enable efficient packet-level simulation for large scale

  1. Serology of a cotton virus in Texas 

    E-Print Network [OSTI]

    Darling, Dale Robert

    1962-01-01T23:59:59.000Z

    of the virus through two or more generations of healthy plants by, s. draft transmission from an infected plant, b. mechanical transfer of the sap of infected plants, c. insect transmission of the virus from infected planta, and by 2. serological...) found that inoculations smde with expressed leaf sap of virus-infected cotton to cotton, bean, cowpes, tobacco and hollyhock plants failed to result in symptoms. Approach drafts of diseased to healthy plants of the Empire variety of cotton were smde...

  2. Usage of Friction-damped Braced Frames for Seismic Vibration Control 

    E-Print Network [OSTI]

    Fink, Brynnan 1992-

    2012-04-16T23:59:59.000Z

    -resisting (portal) frame due only to girder flexibility ...... 19 11 Equivalent spring system for a moment-resisting (portal) frame ......................... 21 12 Moment-resisting (portal) frame modeled in SAP2000 for comparison and deflected shape... system for the right-hand side of braced frame....................... 28 18 Braced frame used in SAP2000 for analysis and comparison.............................. 29 xi FIGURE Page 19 View of cross-braced frame in the plane of motion...

  3. PSiL?LC: an architecture for logical link control protocol processing 

    E-Print Network [OSTI]

    Mak, Albert Ho Kee

    1992-01-01T23:59:59.000Z

    in relation to the MAC frame SAP & Link Station association Message transfer in a Connect in operation The PSi architecture The PSi LLC architecture LLC sub-layer implemented using Connection Processors Data path in PSi LLC, Simplified PSi LLC... in the protocol stack communicate by passing messages via specific Service Access Points (SAPs). Communications between two neighboring layers are transparent to the two layers above and below [2]. The aim of the OSI protocol is to provide an open environment...

  4. Effect of water stress on growth and osmotic adjustment in the shoots of dark-grown sorghum seedlings 

    E-Print Network [OSTI]

    Balachandra, Sarojini

    1983-01-01T23:59:59.000Z

    , Richards, and Jarvis (13) determined 9 and s with the pressure chamber. Instead of a bal- ance pressure (P) of an even dehydration before collec- tion of sap as used by Tyree and Hammel, they increased the applied pressure (P) continuously by 50 or 100... up to ? 18 bars below which pressure bomb estimates were con- stantly more negative than the hydrometric estimates. Turner and Begg (36), working with sorghum, noticed that with the Dew Point Hygrometer technique extracellular sap diluted...

  5. Insights into Improving the Energy Performance of Buildings Taken from UK Case Studies in the Domestic and Education Sectors 

    E-Print Network [OSTI]

    Bunker, G.; Wright, A.; Greenough, R.; Shao, L.; Hernandez, J.; Kerrigan, R.

    2012-01-01T23:59:59.000Z

    % of the whole heat loss. This occurred at junctions and around doors and windows. SAP is the government's standard assessment procedure for energy rating of dwellings. It is adopted by government as part of the UK national methodology for calculation... heat loss at junctions and around windows was assumed in the design to be the equivalent of the default value in SAP for dwelling designs that makes use of a standard catalogue of the Government?s ?accredited details? [Communities and Local...

  6. The geology of North Fredonia area, McCulloch and San Saba Counties, Texas 

    E-Print Network [OSTI]

    Mosteller, Stanley Alfred

    1957-01-01T23:59:59.000Z

    ~ ~ ~ ~ * ~ e e ~ ~ i' oldllag e ~ ~ ~ ~ e ~ e ~ ~ ~ ~usawry oi Geologic liistory . ilefereoces Cited Appeacix ~ ~ e ~ ~ ~ e e ~ ~ ~ 3 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ILLUSTRATION& Plate &~logic sap of North !'redoain area, iacludiag cross... (1952), Frits (1955), Duval (1958). Parka (1953), aud Gross (1954). ScGrath (1952) studied aad prepared a aap of the Fredoaia area which borders the south side of the area sapped for this thesis. Bsraes (1956) described the lead deposits i...

  7. Application of the Grillage Methodology to Determine Load Distribution Factors for Spread Slab Beam Bridges 

    E-Print Network [OSTI]

    Petersen-Gauthier, Joel

    2013-08-09T23:59:59.000Z

    ) .................................................................................... 120 Figure 5.3 SAP2000 M3 Hinge Properties Used ..................................................... 121 Figure 5.4 Six Steps of Hinge Formation and Failure in Grillage Moment Loading Case 7... using the structural analysis finite element program SAP2000 (Computers and Structures (2012b)). Models were made for the Riverside experimental bridge, the Denison, Texas bridge, and for the Drehersville, Pennsylvania bridge. Figure 1.4 shows...

  8. Supraoptimal root-zone temperature effects on water use of three Cercis spp 

    E-Print Network [OSTI]

    Lawrence, Beth Jez

    1993-01-01T23:59:59.000Z

    Committee: Dr. Jayne M. Zajicek Stem flow rates of three Cercis spp. exposed to supraoptimal root- zone temperatures were characterized in a controlled environment chamber using a water bath to maintain treatment temperatures. Flow rates of sap... in the xylem were measured every 15 sec and averaged over 15 min intervals. Sap flow measurements were correlated to root-zone temperatures recorded during the same time intervals. Whole plant transpiration was also measured gravimetrically. Root...

  9. The risk of buildings overheating in a low-carbon climate change future 

    E-Print Network [OSTI]

    Banfill, P.F.G.; Jenkins, D.P.; Patidar, S.; Gul, M.; Menzies, G.F.; Gibson, G.J.

    2012-01-01T23:59:59.000Z

    calculations like SAP or PHPP, whereas in non-domestic buildings SBEM (steady state) would be supported by dynamic simulations using IES-VE, TAS, ESP-r, Hevacomp and ClassCool. Accepting that an LCF tool will be needed eventually, professional preference... Regulations and therefore use the same building specifications as those required for SAP calculations. One professional suggested that ?two levels of a tool, one with a high level of information for someone trying to understand the issues, and another...

  10. Review of EU airport energy interests and priorities with respect to ICT, energy efficiency and enhanced building operation 

    E-Print Network [OSTI]

    Costa, A.; Blanes, L. M.; Donnelly, C.; Keane, M. M.

    2012-01-01T23:59:59.000Z

    report at MXP. 3.2. Energy and maintenance action management Both airports use SAP software platform for enterprise management. This platform also allows for energy and maintenance action management, Fig. 10. shows the current actions work flow... at FCO: if a fault or an operation problem is detected by either a room occupant or the control room (though the BMS supervisory interface), a corrective action is assigned to the external maintenance company though the SAP call centre (outsourced...

  11. A comparison of two methods of cholecystoduodenostomy 

    E-Print Network [OSTI]

    Tangner, Cecil Herman

    1982-01-01T23:59:59.000Z

    , phosphorus, glucose, urea nitrogen, creatinine, cholesterol, total bilirubin, total protein, albumin, alkaline phosphatase (SAP) and glutamic pyruvic transaminase (SUPT) were evaluated on the re- maining 12 dogs 6, 15, 27, 34, 41, 48, and 62 days... in each case. Two dogs that had this technique performed for relief of biliary obstruction were clinically normal 15 months postoperatively. However, chronic liver disease was sus- pected in these dogs because of elevated serum alkaline phosphatase (SAP...

  12. Control of insects and spider mites by translocated compounds 

    E-Print Network [OSTI]

    Ivy, Edward Everett

    1951-01-01T23:59:59.000Z

    upward and downward. February 23E 1950 ................ 117 CONTROL OF INSECTS AND SPIDER MITES BY TRANSLOCATED COMPOUNDS INTRODUCTION Systemic insecticides are compounds which are translocated in the sap stream of plants, making such plants toxic... experiments in plant chemotherapy. The chemicals may have been too toxic to the plant at the concentration tested, or the chemicals may not have been toxic to the insect at which control was aimed. The chemical may not have been distributed in the sap...

  13. Studies of two cucumber mosaic virus isolates from spinach in the winter garden area of Texas 

    E-Print Network [OSTI]

    Wilson, Alphus Dan

    1983-01-01T23:59:59.000Z

    of the Cucumoviruses Diagnosis and Critical Comparison of Cucumoviruses Host Range of Cucumber Mosaic Virus 10 Mechanical Transmission and Stability in Extracted Sap . 13 Vector Relations and Epidemiology Strains and Serology Biochemistry MATERIALS AND METHODS... Page Gel-diffusion test of spinach virus isolates 'C' and 'N' and CMV-Commelina antigens against CMV-S antiserum. The center well contains antisera (As) to CNV-S ATCC PVAS 242a. The peripheral wells were loaded with sap extracted from tobacco...

  14. Mutual Impacts on a Specialist Herbivore and its Host Plants: Variation in Insect Morphology and Plant Tolerance 

    E-Print Network [OSTI]

    Chinchilla-Ramirez, Milena

    2014-12-04T23:59:59.000Z

    , Dávila-Flores et al. (2013) compared the performance of the specialist, sap-sucking herbivore corn leafhopper [Dalbulus maidis (Delong & Wolcott)] (Hemiptera: Cicadellidae) on a suite of Zea spp. representing the plant genus’ evolution from wild... importance in this study is the analysis of tolerance responses to damage by a sap-sucking insect in contrast to tolerance studies carried out with chewing insects. Methods Zea and Dalbulus maidis The genus Zea L. (Poaceae) is native to Mexico...

  15. The serological detection of tobacco ringspot virus reservoirs in the Lower Rio Grande Valley 

    E-Print Network [OSTI]

    Smith, Leon Russell

    1962-01-01T23:59:59.000Z

    and of the "pijcples" disease of watermelon reported by' Rosberg (19) in %exes -end by Shepherd. and Struble (20) in Gislahossu Valleau (25) in Kentucky inoculated tobacco with expressed sap. free eggplants showing the yellows disease and obtained typical TRSV... to determine potential v1rus carriers - mschani- csl inoculation of expressed sap to susceptible test plants, snd sero- logical techniques . utilisisg the reaction. of ths virus antigen with antiserum homologous to the virus. Xost oi' the known hosts of TRSV...

  16. Insects Attacking Vegetable Crops. 

    E-Print Network [OSTI]

    Newton, Weldon H.; Deer, James A.; Hamman, Philip J.; Wolfenbarger, Dan A.; Harding, James A.; Schuster, Michael F.

    1964-01-01T23:59:59.000Z

    THAT SUCK THE JUICES FROM FOLIAGE, FRUITS, STEMS AND ROOTS, CAUSING DISCOLORATION, STUNTING AND OTHER DAMAGE APHIDS Aphids are small, sluggish, soft-bodied insects often called plant lice. A number of species attack various crops, sucking plant sap..., peppers or dark brown with black leg joints, eyes and and tomatoes. cornicles. Aphids build up very rapidly and leave copious quantities of honeydew on leaves. Adults POPLAR PETIOLE GALL APHID, Pemphigus and nymphs suck juices from leaves, sapping...

  17. Experimentally Validated Compatibility Strut and Tie Modeling of Reinforced Concrete Bridge Piers 

    E-Print Network [OSTI]

    Scott, Reece Melby

    2010-10-12T23:59:59.000Z

    as a supplementary tool for capacity analysis purposes. This chapter presents a Compatibility Strut-and-Tie Model (C-STM) that is implemented in commercially available structural analysis software, SAP2000 (1995), to predict the nonlinear response... to the two-point Gauss Truss solution considering the following nonlinear failure mechanisms: (a) flexure steel yielding; (b) transverse steel yielding; and (c) concrete crushing. Each truss is modeled using commercial structural analysis software (SAP2000...

  18. Heat Recovery and Indirect Evaporative Cooling for Energy Conservation 

    E-Print Network [OSTI]

    Buckley, C. C.

    1984-01-01T23:59:59.000Z

    I TRU-12~-42.0-144.G-0-14E-14S-AP - 71.0 MODEL NUMBER I TRU-12:;j- 42.C-144.0-6-14E-14S-AP - 71.0 UNIT WEIGHT (5) 1 UNIT NO. 11 15~0. LBS UNIT NO.2: IS50. LBS PERFORMANCE SUMMARY SUP PRESS DAOP I INCHES WC I .88 EXH PRESS DROP (INCHES \\olC) .92...

  19. Seismic Interstory Drift Demands in Steel Friction Damped Braced Buildings 

    E-Print Network [OSTI]

    Peternell Altamira, Luis E.

    2010-01-16T23:59:59.000Z

    ) ......................................................................................... 31 viii Page Figure 4.4: Coulomb and Viscous Friction block (TheMathWorks 2008) ...................... 33 Figure 4.5: SIMULINK model for verification of the SAP2000 friction damped brace model behavior... of the SAP2000 analytical model of the FDB .................................................... 33 Table 5.1: Peak interstory drift ratio of the different damper configurations subjected to the series of BSE-1 records...

  20. Development of an in vitro procedure to eradicate potato viruses X, Y, and S from the potato (Solanum tuberosum L.) variety Russet Norko two of its strains 

    E-Print Network [OSTI]

    Zapata Carrero, Carmen Cecilia

    1994-01-01T23:59:59.000Z

    members are readily transmitted by sap inoculation, and there are no confirmed vectors. Group members are cassava common mosaic, cymbidium mosaic, hydrangea ringspot, papaya mosaic, and pepino mosaic, (90). 12 Potato virus Y (PVY) belongs... range of plants, but most individual members have a relatively narrow host range. They are transmitted by aphids in a non-persistent manner and by sap inoculation. Some group members are seed transmitted. Group members include bean common mosaic...

  1. Performance based evaluation of the seismic resistance of structures with concrete diaphragms 

    E-Print Network [OSTI]

    Barron, Joel Martin

    2001-01-01T23:59:59.000Z

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3. 3. 6 Acceptance Criteria: Nonlinear Procedures. . . . . . . . . . . . 37 37 50 51 52 56 63 69 69 71 73 4. ANALYTICAL TOOLS. 74 4. 1 General. 4. 2 SAP2000 Software . 4. 2. 1 Introduction 4. 2. 2 Static and Dynamic Analyses... static, linear dynamic, and nonlinear dynamic analysis procedures. SAP2000 (1999) was used for the linear static and linear dynamic analyses, and lDARC2 (Reinhorn et al. 1988) was used for the nonlinear dynamic analyses. Ten ground motions developed...

  2. Wood-boring Insects of Trees and Shrubs 

    E-Print Network [OSTI]

    Drees, Bastiaan M.; Jackman, John A.; Merchant, Michael E.

    2008-06-17T23:59:59.000Z

    termites, carpenter bees and carpenter ants. Many other insects live in dying or dead trees, including natural enemies (predators and parasites) of the insect borers, sap or fungi feeders, or species which merely use the spaces provided by the tunnels... segments behind the head capsule. While tunneling, larvae continually pack their tunnels with excrement (frass), which looks like compressed wood fibers, or push frass out of the holes they pro- duce. This excrement, along with the sap exuded by the plant...

  3. Whiteflies 

    E-Print Network [OSTI]

    Bogran, Carlos E.

    2006-12-18T23:59:59.000Z

    weeks according to temperature conditions and species. Many overlapping generations can occur each year. Adults and nymphs feed by inserting their mouthparts into plant tissue and sucking phloem sap. Silverleaf Whitefly The silverleaf whitefly.... Damage Whiteflies can damage plants directly or indirectly. Direct damage is caused through their feeding, which removes plant sap and stunts plant growth, especially in young plants. Silverleaf whitefly feeding has been associated with several plant...

  4. Characterization of Stem Growth and Chemical Composition in Sorghum Bicolor 

    E-Print Network [OSTI]

    Anderson Jr, Robert Taylor

    2014-03-31T23:59:59.000Z

    bicolor that are differently expressed across internode development ........45 Figure 18 Hypothetical pathways influencing stem growth in Sorghum bicolor ......46 Figure 19 Variation in saccharification efficiency of the E-SAP panel via... collected from 200 diverse lines of the E-SAP panel grown for 130 days in the College Station research field during the summer of 2012. Data of each accession represents the average of six biological replicates collected from two different field plots...

  5. The HealthAgents ontology: how to represent the knowledge behind a brain tumour distributed decision system

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    project, INTERPRET (Juli`a-Sap´e et al., 2006b), has shown that single voxel MRS data can aid in improving decision system BO HU1,5 , MADALINA CROITORU2 , ROMAN ROSET3 , DAVID DUPPLAW1 , MIGUEL LURGI3 , SRINANDANSAP Research, Belfast BT37 0QB, UK E-mail: bo01.hu@sap.com Abstract In this paper we present our

  6. ObjectGlobe: Ubiquitous Query Processing on the Internet

    E-Print Network [OSTI]

    Kemper, Alfons

    for scalable Internet applications, such as business-to-business (B2B) e-commerce systems like SAP's "mySAP capabilities. The goal of the ObjectGlobe project is to establish an open market place in which data and query on the Internet. One of the main challenges in the design of such an open system is to ensure privacy and security

  7. Building performance evaluation and certification in the UK

    E-Print Network [OSTI]

    Kelly, Scott; Pollitt, Michael G.; Crawford Brown, Doug

    2012-10-04T23:59:59.000Z

    Certificates EST Energy Saving Trust EU European Union FES Fuel and Energy Survey FIT Feed In Tariff GDP Gross Domestic Product PV Photovoltaic RdSAP Reduced Data Standard Assessment Procedure RHI Renewable Heat Incentive SAP Standard... ). This is only exacerbated by the forecasted increase to energy prices (DECC 2011b). Without detailed information about the performance of buildings classified as being in fuel poverty, it is difficult to determine what strategies may alleviate these pressures...

  8. The nanofluidics can explain ascent of water in tallest trees

    E-Print Network [OSTI]

    Gouin, Henri

    2012-01-01T23:59:59.000Z

    In Amazing numbers in biology, Flindt reports a giant, 128 meter-tall eucalyptus, and a 135 meter-tall sequoia. However, the explanation of the maximum altitude of the crude sap ascent and consequently the main reason of the maximum size that trees can reach is not well understood. According to tree species, the crude sap is driven in xylem microtubes with diameters ranging between 50 and 400 micrometers. The sap contains diluted salts but its physical properties are roughly those of water; consequently, hydrodynamic, capillarity and osmotic pressure yield a crude sap ascent of a few tens of meters only. Today, we can propound a new understanding of the ascent of sap to the top of very tall trees thanks to a new comparison between experiments associated with the cohesion-tension theory and the disjoining pressure concept. Here we show that the pressure in the water-storing tracheids of leaves can be strongly negative whereas the pressure in the xylem microtubes of stems may remain positive when, at high level...

  9. Superior Energy Performance Case Study at 3m Canada, Brockvill, Ontario Facility

    E-Print Network [OSTI]

    Hejnar, A.

    2014-01-01T23:59:59.000Z

    2 June 2014. All Rights Reserved.© 3M Sustaining OurFuture SEP and ISO 50001 at 3M Canada’s Brockville Plant Andrew Hejnar, MS Energy Mgmt, CEM, CEA, CRM ESL-IE-14-05-45 Proceedings of the Thrity-Sixth Industrial Energy Technology Conference New... bundling and holding tapes to high temperature fine line automotive masking tapes. ? Current ISO Registrations: – ISO 14001 ISO 9001-2000 ESL-IE-14-05-45 Proceedings of the Thrity-Sixth Industrial Energy Technology Conference New Orleans, LA. May 20...

  10. NVN-065558 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRose BendMiasoleTremor(Question) |RenewableBUREAU OF LAND MGMT Lessee 1

  11. NVN-065561 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRose BendMiasoleTremor(Question) |RenewableBUREAU OF LAND MGMT Lessee

  12. NVN-074196 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRose BendMiasoleTremor(Question) |RenewableBUREAU OF LAND MGMT

  13. NVN-074249 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRose BendMiasoleTremor(Question) |RenewableBUREAU OF LAND MGMT9/1/2007

  14. NVN-074250 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRose BendMiasoleTremor(Question) |RenewableBUREAU OF LAND MGMT9/1/2007

  15. Control of mRNA Export and Translation Termination by Inositol Hexakisphosphate Requires Specific Interaction with Gle1*S

    E-Print Network [OSTI]

    Bedwell, David M.

    Control of mRNA Export and Translation Termination by Inositol Hexakisphosphate Requires Specific of the nuclear pore complex (NPC) is mediated by interactions between soluble mRNA export fac- tors and distinct binding sites on the NPC. At the cytoplasmic side of the NPC, the conserved mRNA export factors Gle1

  16. Jabs, Matthew Assistant Coach Swimming Women -Minges Coliseum 159

    E-Print Network [OSTI]

    Info Technology Manager Infrastructure Services - Cotanche Building (ITCS) 157 Mail Stop 229 Jackson Assistant Professor FM Primary Care Firetower Mail Stop 664 Jackson, Paul Fac Maint Tech Mech Trad HVAC West HR Mail Stop 650 Jackson, Sherry Nurse Specialist ObGyn Maternal Fetal - 600 Moye Bovd Mod B office

  17. Comparison of large-scale field-aligned currents under sunlit and dark ionospheric conditions

    E-Print Network [OSTI]

    Higuchi, Tomoyuki

    geomagnetic activity as measured by the IMF BZ component. Result 1 can be partially explained in termsComparison of large-scale field-aligned currents under sunlit and dark ionospheric conditions S-aligned currents (FACs) under sunlit and dark ionospheric conditions. A total of $74,000 auroral oval crossings

  18. Electric eld eects on ionospheric and thermospheric parameters above the EISCAT station for summer conditions

    E-Print Network [OSTI]

    Boyer, Edmond

    parameters above EISCAT are pre- sented for quiet geomagnetic conditions in summer. The Global Self some eect on the ionospheric convection pattern during quiet geomagnetic conditions. It has a marked studied the eects of various ®eld- aligned current (FAC) distributions on thermosphere/ ionosphere

  19. Acid Placement in Acid Jetting Treatments in Long Horizontal Wells

    E-Print Network [OSTI]

    Sasongko, Hari

    2012-07-16T23:59:59.000Z

    of Vertically Extensive, Heterogeneous Gas Reservoirs. SPE Prod & Fac 25 (3): 388-397. SPE-124881-PA. http://dx.doi.org/10.2118/124881-PA. Ritchie, B., Abbasy, I., Pitts, M.J., and White, B. 2008. Challenges in Completing Long Horizontal Wells Selectively...

  20. i i N J I T M A G A Z I N E | F A L L 2 0 0 9 a Message froM

    E-Print Network [OSTI]

    Bieber, Michael

    could include the "planting" of wind turbines and solar panels on a fiscally sound, revenue- producing home city of Newark. It is a story of commitment and innovative involvement by NJIT fac- ulty, students of a nation in every stage of its existence will be found at least equal to its resources." Alexander Hamilton

  1. Immunology Review Topics for 2nd Exam February 27, 2008

    E-Print Network [OSTI]

    Murphy, Robert F.

    of these terms is found in the back of the text. You may be asked for a simple definition, a more elaborate-100 to the diversity. Immunological Techniques: Solid phase assays (ELISA), FACS, production of hybridomas. Processes and the fact that chains can mix in sub- class of class II MHC. e) Specificity of MHC for presented peptides

  2. October 2014 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On 4 ALL HR/ Payroll Resp. On 5 ALL HR/ Payroll Resp. On Sch Disabled @ 5:00 - HRMS Spec & Fac Staff Rev 8 ALL HR/ Payroll Resp. On 9 ALL HR/ Payroll Resp. On 10 ALL HR/ Payroll Resp

  3. September 2014 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On UVa Holiday 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On 4 ALL HR/ Payroll Resp. On 5 ALL HR/ Payroll Resp. On 6 ALL HR/ Payroll Resp. On 7 ALL HR/ Payroll Resp. On Sch Disabled @ 5:00 - HRMS Specialist - Fac/Staff Reviewer Bi

  4. Monthly Planner Printed by Calendar Creator for Windows on 11/26/2012

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Mthly Pay Day 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On 4 ALL HR/ Payroll Resp. On 5 ALL HR/ Payroll Resp. On Sch Disabled @ 5 of Sys HRMS Spec & Fac Staff Rev 8 ALL HR/ Payroll Resp. On 9 ALL HR/ Payroll Resp. On 10 ALL HR/ Payroll

  5. December 2013 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Sch Disabled @ 5:00 - HRMS Spec & Fac Staff Rev 4 ALL HR/ Payroll Resp. On 5 ALL HR/ Payroll Resp. On 6 ALL HR/ Payroll Resp. On BW Pay Date 7 ALL HR/ Payroll Resp. On 8 ALL HR/ Payroll Resp. On 9 ALL HR/ Payroll Resp. On 10 ALL

  6. Monthly Planner Printed by Calendar Creator for Windows on 11/26/2012

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On 2 ALL HR/ Payroll Resp. On Sch Rev 4 Out of Sys HRMS Spec & Fac Staff Rev 5 ALL HR/ Payroll Resp. On 6 ALL HR/ Payroll Resp. On 7 ALL HR/ Payroll Resp. On BW Pay Date 8 ALL HR/ Payroll Resp. On 9 ALL HR/ Payroll Resp. On 10 ALL HR

  7. December 2011 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Mthly Pay Day 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On 4 ALL HR/ Payroll Resp. On Sch Disabled @ 5:00 - HRMS Specialist - Fac ALL HR/ Payroll Resp. On 8 ALL HR/ Payroll Resp. On 9 ALL HR/ Payroll Resp. On BW Pay Date 10 ALL HR

  8. November 2014 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On 2 ALL HR/ Payroll Resp. On Sch Rev 4 Out of Sys HRMS Spec & Fac Staff Rev 5 ALL HR/ Payroll Resp. On 6 ALL HR/ Payroll Resp. On 7 ALL HR/ Payroll Resp. On BW Pay Date 8 ALL HR/ Payroll Resp. On 9 ALL HR/ Payroll Resp. On 10 ALL HR

  9. Monthly Planner Printed by Calendar Creator for Windows on 6/6/2014

    E-Print Network [OSTI]

    Acton, Scott

    Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Sch Disabled @ 5:00 - HRMS Specialist - Fac ALL HR/ Payroll Resp. On 5 ALL HR/ Payroll Resp. On 6 ALL HR/ Payroll Resp. On BW Pay Date 7 ALL HR/ Payroll Resp. On 8 ALL HR/ Payroll Resp. On 9 ALL HR/ Payroll Resp. On 10 ALL HR/ Payroll Resp. On 11 ALL

  10. September 2015 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 All HR/Payroll Responsibilities On Monthly Pay Day 2 All HR/Payroll Responsibilities On 3 All HR/Payroll Responsibilities On 4 All HR/Payroll Responsibilities On 5 All HR/Payroll Responsibilities On 6 All HR/Payroll Responsibilities On BW PPE Sch Disabled @5:00pm - HRMS Specialist - Fac

  11. Monthly Planner Printed by Calendar Creator for Windows on 3/31/2011

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Mthly Pay Day 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On 4 ALL HR/ Payroll Resp. On 5 ALL HR/ Payroll Resp. On Sch Disabled @ 5 of Sys HRMS Spec & Fac Staff Rev 8 ALL HR/ Payroll Resp. On 9 ALL HR/ Payroll Resp. On 10 ALL HR/ Payroll

  12. Monthly Planner Printed by Calendar Creator for Windows on 1/30/2014

    E-Print Network [OSTI]

    Acton, Scott

    Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Mthly Pay Day 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On 4 ALL HR/ Payroll Resp. On Sch Disabled @ 5:00 - HRMS Specialist - Fac ALL HR/ Payroll Resp. On 8 ALL HR/ Payroll Resp. On 9 ALL HR/ Payroll Resp. On BW Pay Date 10 ALL HR

  13. November 2012 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On Mthly Pay Day 2 ALL HR/ Payroll Resp. On 3 ALL HR/ Payroll Resp. On 4 ALL HR/ Payroll Resp. On Sch Disabled @ 5:00 - HRMS Specialist - Fac ALL HR/ Payroll Resp. On 8 ALL HR/ Payroll Resp. On 9 ALL HR/ Payroll Resp. On BW Pay Date 10 ALL HR

  14. Monthly Planner Printed by Calendar Creator for Windows on 11/7/2014

    E-Print Network [OSTI]

    Acton, Scott

    Wednesday Thursday Friday Saturday 1 All HR/Payroll Responsibilities On Monthly Pay Day 2 All HR/Payroll Responsibilities On 3 All HR/Payroll Responsibilities On BW PPE Sch Disabled @5:00pm - HRMS Specialist - Fac Specialist & Faculty Staff Reviewer 6 All HR/Payroll Responsibilities On 7 All HR/Payroll Responsibilities

  15. December 2012 Monthly Planner

    E-Print Network [OSTI]

    Acton, Scott

    Tuesday Wednesday Thursday Friday Saturday 1 ALL HR/ Payroll Resp. On 2 ALL HR/ Payroll Resp. On Sch Rev 4 Out of Sys HRMS Spec & Fac Staff Rev 5 ALL HR/ Payroll Resp. On 6 ALL HR/ Payroll Resp. On 7 ALL HR/ Payroll Resp. On BW Pay Date 8 ALL HR/ Payroll Resp. On 9 ALL HR/ Payroll Resp. On 10 ALL HR

  16. Reputation-based Wi-Fi Deployment: Protocols and Security Analysis

    E-Print Network [OSTI]

    fac- tors such as the large size and oligopolistic behavior of the operators, their willingness possibly on local initiative, higher competition and much faster time-to-market for new features for new types of ser- vices, whether these require higher bandwidth, lower per- bit costs, reduced energy

  17. Aerosol Science and Technology, 43:641652, 2009 Copyright American Association for Aerosol Research

    E-Print Network [OSTI]

    Aerosol Science and Technology, 43:641­652, 2009 Copyright © American Association for Aerosol is the irreversibility of the hygroscopic growth fac- tor of aerosol particles. The instrument uses the hysteresis for ideal instrument performance in application to a test aerosol of fully deliquesce- able particles

  18. Appl. Phys. A 74, 345348 (2002) / Digital Object Identifier (DOI) 10.1007/s003390201275 Applied Physics A

    E-Print Network [OSTI]

    2002-01-01T23:59:59.000Z

    on aerogel-supported catalyst B. Zheng, Y. Li, J. Liu Department of Chemistry, Duke University, Durham, NC monoxide on an aerogel-supported Fe/Mo catalyst. A simple acidic treat- ment followed by an oxidation of amorphous-carbon coating. Several fac- tors that affect the yield and the quality of the SWNTs were also

  19. Eur J Clin Nutr 45, 569-581 ], underreport-ing was defined with a value < 1.14 for an

    E-Print Network [OSTI]

    Boyer, Edmond

    , 4, 09124 Cagliari, Italy; !Fac- ulté des sciences, université de Corse, BP 52, 20250 Corte, France% of the Sardinian families use olive oil whereas two Corsican families out of three use other vegetable oils olive oil whereas in Corsica, although 65% of the families con- sume olive oil, 23% used other vegetable

  20. Marted 17 dicembre 2013 Il Mnemosyne Ensemble esegue

    E-Print Network [OSTI]

    Robbiano, Lorenzo

    Academici Cantores eseguono Wolfgang Amadeus Mozart (1756-1791) Sonata da chiesa KV278 - Allegro Scande o pignora" - Allegro Sonata da chiesa KV69 - Allegro Te Deum KV141 (66b) - "Te Deum laudamus" - Allegro "Te ergo quaesumus" - Adagio "Aeterna fac cum sanctis tuis"- Allegro "In te Domine speravi

  1. QUICK GUIDE Main Campus at Storrs

    E-Print Network [OSTI]

    Lozano-Robledo, Alvaro

    Garage D11 SPRK South Parking Garage C8 Police and Fire Departments PSC Public Safety Complex Police and parking assistance. HAC BAT CSS STC FIF MRH ACS ITEWGC HBL JRB ARH PRB DMD MNH INN HDB FAC EOS MTH MA MCC

  2. Multi-Touch Rotation Gestures: Performance and Ergonomics

    E-Print Network [OSTI]

    Multi-Touch Rotation Gestures: Performance and Ergonomics Eve Hoggan1 , John Williamson2 , Antti multi-touch gestures, yet little is known about the fac- tors affecting performance and ergonomics; gestures; ergonomics. ACM Classification Keywords H.5.2. User Interfaces: Evaluation/Methodology, Input De

  3. Highlights of Spanish Astrophysics VI, Proceedings of the IX Scientific Meeting of the Spanish Astronomical Society held on September 13 -17, 2010, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.)

    E-Print Network [OSTI]

    Complutense de Madrid, Universidad

    , in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.) Chromospheric activity of FGK stars. Astrof´isica, E-28040 Madrid, Spain 2 Universidad Aut´onoma de Madrid, Dpto. de F´isica Te´orica C-XI, Fac. Ciencias, Madrid, Spain 3 LAEX, CAB (CSIC-INTA), ESAC Campus, P.O. BOX 73, 28691 Villanueva de la

  4. Astronomical forcing of sedimentary cycles in the middle to late Miocene continental Calatayud Basin (NE Spain)

    E-Print Network [OSTI]

    Utrecht, Universiteit

    Basin (NE Spain) H. Abdul Aziz aY *, F. Hilgen a , W. Krijgsman b , E. Sanz c , J.P. Calvo d, Spain d Departemento de Petrologia y Geoqu|¨mica, Fac. CC. Geolo¨gicas, Universidad Complutense, 28040 Madrid, Spain Received 16 August 1999; received in revised form 28 January 2000; accepted 29 January 2000

  5. Environmental Health Perspectives volume 121 | number 3 | March 2013 359 Emerging evidence supports the idea that

    E-Print Network [OSTI]

    Blumberg, Bruce

    billion (in 2008 dollars), or approximately 21% of health care costs in the United States alone (Cawley balance between energy intake and energy expenditure; however, additional fac- tors are important a correlation between the epi- genetic state of DNA from the umbilical cord of children and adiposity later

  6. GaN(0001) Surface Structures Studied Using Scanning Tunneling Microscopy and First-Principles Total Energy Calculations

    E-Print Network [OSTI]

    occurring on the (0001) surface of wurtzite GaN are studied using scanning tunneling microscopy, electron and electronic properties of wurtzite GaN surfaces. Several prior studies have reported that these surfaces do reconstructions were identified, corresponding to the two inequivalent polar fac- es of wurtzite GaN, the (0001

  7. Evaluation of sulfidic mine tailings solidified/stabilized with cement kiln dust and fly ash to control acid mine drainage

    SciTech Connect (OSTI)

    Nehdi, M.; Tariq, A. [University of Western Ontario, London, ON (Canada). Dept. of Civil & Environmental Engineering

    2008-11-15T23:59:59.000Z

    In the present research, industrial byproducts, namely, cement kiln dust (CKD) and Class C fly ash (FAC) have been used as candidate materials along with the partial addition of sulfate-resistant cement (SRC) in the Stabilization/solidification of polymetallic sulfidic mine tailings (MT). The effectiveness of S/S was assessed by comparing laboratory experimental values obtained from unconfined compressive strength, hydraulic conductivity and leaching propensity tests of S/S samples with regulatory standards for safe surface disposal of such wastes. Despite general regulatory compliance of compressive strength and hydraulic conductivity, some solidified/stabilized-cured matrices were found unable to provide the required immobilization of pollutants. Solidified/stabilized and 90-day cured mine tailings specimens made with composite binders containing (10% CKD + 10% FAC), (5% SRC + 15% FAC) and (5% SRC + 5% CKD + 10% FAC) significantly impaired the solubility of all contaminants investigated and proved successful in fixing metals within the matrix, in addition to achieving adequate unconfined compressive strength and hydraulic conductivity values, thus satisfying USEPA regulations. Laboratory investigations revealed that, for polymetallic mining waste, leachate concentrations are the most critical factor in assessing the effectiveness of S/S technology.

  8. Golf Driving Toka Sticks

    E-Print Network [OSTI]

    EAGLE 3D ECET Research ECET 7D Engineering Studio ENGR 6D Fac. Mgt. & Police Dept. FMPD 6C Falcon TALON 3D Taylor Hall TAYLO 5F Technology Center TECH 6C Tech. Innovation Labs TLABS 7F Union Anx Map Legend Valley Metro Stop ASU Building Parking Area Intercampus Shuttle BEELAB APIARY ANNEX

  9. Estimating the Lead Time Distribution of Priority Lots in a Semiconductor Factory \\Lambda

    E-Print Network [OSTI]

    Gershwin, Stanley B.

    Estimating the Lead Time Distribution of Priority Lots in a Semiconductor Factory \\Lambda Asbjoern M. Bonvik y July 10, 1995 Abstract We consider the lead time of priority lots in a semiconductor fac for finding the lead time distribution is described. We describe a method of creating synthetic samples

  10. Annales Geophysicae (2002) 20: 13351348 c European Geophysical Society 2002 Geophysicae

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    2002-01-01T23:59:59.000Z

    Flight Center, Building 2, CODE 696, Greenbelt, MD 20771, USA 5Department of Communications Systems5 1Solar-Terrestrial Environment Laboratory, Nagoya University, Chikusa-ku, Nagoya 464-8601, Japan 2 The field-aligned current (FAC) plays a crucial role in the transfer of momentum and energy between

  11. Atmos. Chem. Phys., 14, 36373656, 2014 www.atmos-chem-phys.net/14/3637/2014/

    E-Print Network [OSTI]

    Meskhidze, Nicholas

    -3637-2014 © Author(s) 2014. CC Attribution 3.0 License. Atmospheric Chemistry and Physics OpenAccess Improved and SO2 average vertical column density (VCD), occurring over an area of intensive surface mining, by fac for the interference effect in the surface NO2 instruments and smoothing and clear-sky bi- ases in the OMI measurements

  12. 31 from R&D Innovator Volume 2, Number 4 April 1993 Three Silly Notions About Technology Transfer: And One That's Not

    E-Print Network [OSTI]

    Berry, R. Stephen

    31 from R&D Innovator Volume 2, Number 4 April 1993 Three Silly Notions About Technology Transfer://chemistry.uchicago.edu/fac/berry.shtml Innovation: What are the roles of basic and applied research? What are the roles of industries and universities? Industries need innovation just to stay in business, let alone compete successfully in the global

  13. A la memoire de celle qui m' a eleve. A ma femme, mes enfants, ma famille.

    E-Print Network [OSTI]

    Boyer, Edmond

    Mekn`es (Maroc), qui ont accept´e de porter un jugement sur mon travail et ce malgr´e leurs nombreuses Perpignan, L. Afifi de la Facult´e des Sciences de Casablanca (Maroc), Madame M. C. El Jai de l Monsieur L. AFIFI Professeur, Fac. Sc. de Casablanca, Maroc Examinateur Monsieur A. EL JAI Professeur, Univ

  14. Revision Date: 04.05.12 1 of 11 ACCOUNTING SERVICES

    E-Print Network [OSTI]

    Crews, Stephen

    Purpose: The Unit Accounting System (UAS) tracks and maintains investment account information (eRevision Date: 04.05.12 1 of 11 ACCOUNTING SERVICES Unit Accounting System (UAS) Reporting Manual: Users must have a valid ONYEN and obtain a FACS ID by completing the Consolidated Financial Systems

  15. Efficiency improvement of phosphorescent organic light-emitting diodes using semitransparent Ag as anode

    E-Print Network [OSTI]

    Efficiency improvement of phosphorescent organic light-emitting diodes using semitransparent Ag The emission efficiency in an organic light-emitting diode OLED based on fac tris phenyl pyridine iridium Ir current efficiency of 81 cd/A and a power efficiency of 79 lm/W, compared with 46 cd/A and 39 lm

  16. 702 VOLUME 20 NUMBER 6 JUNE 2013 nature structural & molecular biology a rt i c l e s

    E-Print Network [OSTI]

    Bedwell, David M.

    is initiated by the assembly of NMD fac- tors on target mRNAs. The core NMD factors are the proteins UPF1, UPF2 and UPF3, which are conserved in eukaryotes2,8. Translation termination at a PTC induces the assembly of UPF1, a superfamily 1 ATP-dependent RNA helicase, with the terminating ribosome through an interaction

  17. Remote Batch Invocation for Compositional Object Services

    E-Print Network [OSTI]

    Ryder, Barbara G.

    Remote Batch Invocation for Compositional Object Services Ali Ibrahim2 , Yang Jiao1 , Eli Tilevich1 Remote Procedure Calls do not compose efficiently, design- ers of distributed object systems use Data Transfer and Remote Fac¸ade patterns to create large-granularity interfaces, hard-coded for particular

  18. REVSTAT Statistical Journal Volume 7, Number 2, June 2009, 151170

    E-Print Network [OSTI]

    Alves, Maria Isabel Fraga

    PROCESSES WITH ROBUST CONTROL CHARTS Authors: Fernanda Figueiredo ­ C.E.A.U.L. and Fac. de Economia da: December 2008 Abstract: · The Shewhart control charts, used for monitoring industrial processes, are the most popular tools in Statistical Process Control (SPC). They are usually developed under

  19. Energy-Efficient Scheduling of HPC Applications in Cloud Computing

    E-Print Network [OSTI]

    Melbourne, University of

    Energy-Efficient Scheduling of HPC Applications in Cloud Computing Environments Saurabh Kumar Garg sustainable. Hence, energy-efficient solutions are required that can address the high increase in the energy centers for a Cloud provider. We consider a number of energy efficiency fac- tors such as energy cost

  20. A Location-aided Power-aware Routing Protocol in Mobile Ad Hoc Networks

    E-Print Network [OSTI]

    Li, Baochun

    hard problem due to two important fac- tors: First, the nodes may be mobile, demanding the energy-efficient algorithms, we are able to derive critical global properties with re- spect to end-to-end energy-efficient. Such observations pose significant challenges to design energy-efficient packet routing protocols while still ac