Powered by Deep Web Technologies
Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Pub Svc Elec  

Gasoline and Diesel Fuel Update (EIA)

Pub Pub Svc Elec and Gas Co......................... NJ 81,712,678 5.82 Columbia Gas Dist Co............................... OH,KY,PA,MD 76,048,915 5.95 Con Edison Co. of New York Inc............... NY 69,809,658 5.99 Consumers Pwr Co ................................... MI 58,661,306 4.46 Pacific Gas and Elec Co............................ CA 57,793,522 5.67 Minnegasco ............................................... MN 57,154,912 4.57 Southern California Gas Co ...................... CA 54,772,058 6.16 Michigan Consol Gas Co........................... MI 53,635,433 5.16 Entex Div of Noram Energy Corp.............. LA,TX,MS 49,485,836 4.80 Northern Illinois Gas Co ............................ IL 48,165,624 4.62 Pub Svc Co. of Colorado........................... CO 47,339,959 3.51 Atlanta Gas Lt Co ......................................


Northern Virginia Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Virginia Elec Coop (Redirected from Northern Virginia Electric Cooperative) Jump to: navigation, search Name Northern Virginia Elec Coop Place Manassas, Virginia Utility Id 13640...


Grundy County Rural Elec Coop | Open Energy Information  

Open Energy Info (EERE)

County Rural Elec Coop Jump to: navigation, search Name Grundy County Rural Elec Coop Place Iowa Utility Id 7864 Utility Location Yes Ownership C NERC Location MRO Activity...


Hess Retail Natural Gas and Elec. Acctg. (Connecticut) | Open...  

Open Energy Info (EERE)

Hess Retail Natural Gas and Elec. Acctg. (Connecticut) Jump to: navigation, search Name Hess Retail Natural Gas and Elec. Acctg. Place Connecticut Utility Id 22509 References EIA...


Matinicus Plantation Elec Co | Open Energy Information  

Open Energy Info (EERE)

Plantation Elec Co Plantation Elec Co Jump to: navigation, search Name Matinicus Plantation Elec Co Place Maine Utility Id 11844 Utility Location Yes Ownership M NERC Location NPCC NERC NPCC Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Commercial Commercial General Service Residential Residential Average Rates Residential: $0.4260/kWh Commercial: $0.5290/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Matinicus_Plantation_Elec_Co&oldid=411047


Unalakleet Valley Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Unalakleet Valley Elec Coop Unalakleet Valley Elec Coop Jump to: navigation, search Name Unalakleet Valley Elec Coop Place Alaska Utility Id 40548 Utility Location Yes Ownership C NERC Location AK NERC WECC Yes Operates Generating Plant Yes Activity Generation Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial and Small Power Service Commercial Residential Service Residential Average Rates Residential: $0.3920/kWh Commercial: $0.3680/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Unalakleet_Valley_Elec_Coop&oldid=41190


Withlacoochee River Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Withlacoochee River Elec Coop Withlacoochee River Elec Coop Jump to: navigation, search Name Withlacoochee River Elec Coop Place Florida Utility Id 20885 Utility Location Yes Ownership C NERC Location FRCC NERC FRCC Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Demand Commercial General Service Non-Demand Commercial Residential Service Residential Average Rates Residential: $0.1170/kWh Commercial: $0.0976/kWh Industrial: $0.0880/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"


Waverly Municipal Elec Utility | Open Energy Information  

Open Energy Info (EERE)

Municipal Elec Utility Municipal Elec Utility Jump to: navigation, search Name Waverly Municipal Elec Utility Place Iowa Utility Id 20214 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes ISO MISO Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Service Commercial Commercial and Municipal time of Use Service Commercial Electric Heat Rate for Residential Service Residential General Service General and Minicipal Demand Time of Use Service Commercial


Illinois Municipal Elec Agency | Open Energy Information  

Open Energy Info (EERE)

Illinois Municipal Elec Agency Illinois Municipal Elec Agency Place Illinois Utility Id 9286 Utility Location Yes Ownership A NERC Location RFC & SERC NERC RFC Yes NERC SERC Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Buying Distribution Yes Activity Wholesale Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Illinois_Municipal_Elec_Agency&oldid=410862


Central Wisconsin Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Central Wisconsin Elec Coop Central Wisconsin Elec Coop Jump to: navigation, search Name Central Wisconsin Elec Coop Place Wisconsin Utility Id 3293 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes ISO MISO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Controlled Heating Commercial Irrigation-Rate L Industrial Irrigation-Rate M Industrial Irrigation-Rate N (Controlled) Industrial Large General Service Industrial Medium General Service Industrial Outdoor Lighting Service-100w HPS Lighting Outdoor Lighting Service-150w HPS Lighting Outdoor Lighting Service-175w MV Lighting


Upson Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Elec Member Corp Elec Member Corp Place Georgia Utility Id 19581 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Rate 1,6 - Residental Service Residential Rate 3,7 - General Service Commercial Rate 8,10 - General Service Commercial Average Rates Residential: $0.1020/kWh Commercial: $0.1150/kWh Industrial: $0.0834/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Upson_Elec_Member_Corp&oldid=411917


Stearns Cooperative Elec Assn | Open Energy Information  

Open Energy Info (EERE)

Stearns Cooperative Elec Assn Stearns Cooperative Elec Assn Jump to: navigation, search Name Stearns Cooperative Elec Assn Place Minnesota Utility Id 18019 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Energy Management - Dual Fuel Heating Residential Energy Management - Generator Backup - GS3 Industrial Energy Management - Generator Backup - Single Phase Industrial Energy Management - Generator Backup - Three Phase Industrial Energy Management - Heat Pumps Residential Energy Management-Storage Heating Residential


Northern Virginia Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Elec Coop Elec Coop (Redirected from NOVEC) Jump to: navigation, search Name Northern Virginia Elec Coop Place Manassas, Virginia Utility Id 13640 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes RTO PJM Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] SGIC[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Northern Virginia Electric Cooperative Smart Grid Project was awarded $5,000,000 Recovery Act Funding with a total project value of $10,000,000. Utility Rate Schedules Grid-background.png Interruptible Service Rider - Rider IS-1 Schedule DPS, Delivery Point Service (Unbundled Rate) Commercial


Southern Illinois Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Elec Coop Elec Coop Jump to: navigation, search Name Southern Illinois Elec Coop Place Illinois Utility Id 17631 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png All Electric Residential Service Residential Commercial Service Commercial Farm and Home Service Residential Irrigation Service Commercial Large Power Service Commercial Large Power Service LP-1 Commercial Off-Peak Service (Applicable to Large Power Service Schedule LP or LP-1) Commercial Security Lighting Service (100 SV Existing Pole) Lighting


Cumberland Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Elec Member Corp Elec Member Corp Jump to: navigation, search Name Cumberland Elec Member Corp Place Tennessee Utility Id 4624 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial GSA 3 Commercial Commercial GSA 1 Commercial Commercial GSA 2 Commercial Facilities Rental (46-161 kV) Commercial Facilities Rental (less than 46 kV) Commercial Generation Partner 1 - Energy Credit Commercial Generation Partner 1 - Other Renewable Premium Commercial


Pella Cooperative Elec Assn | Open Energy Information  

Open Energy Info (EERE)

Pella Cooperative Elec Assn Pella Cooperative Elec Assn Jump to: navigation, search Name Pella Cooperative Elec Assn Place Iowa Utility Id 26765 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes ISO MISO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Agricultural Electric Rates - Single Phase Commercial Agricultural Electric Rates - Single Phase Pump Commercial Agricultural Electric Rates - Three Phase Pump Commercial Large Commercial Single Phase 75+ kVA Commercial Large Commercial Three Phase 75+ kVA Commercial Outdoor Lighting Metered Lighting


Choctawhatche Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Choctawhatche Elec Coop, Inc Choctawhatche Elec Coop, Inc Jump to: navigation, search Name Choctawhatche Elec Coop, Inc Place Florida Utility Id 3502 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 400 Watt Flood Light Lighting Commercial: General Service (Demand): Single Phase Commercial Commercial: General Service (Demand): Three Phase Commercial Commercial: General Service (Non-Demand): Single Phase Commercial Commercial: General Service (Non-Demand): Three Phase Commercial


Southwest Iowa Rural Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Iowa Rural Elec Coop Jump to: navigation, search Name Southwest Iowa Rural Elec Coop Place Iowa Utility Id 49986 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes...


Wheatland Rural Elec Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Rural Elec Assn, Inc Jump to: navigation, search Name Wheatland Rural Elec Assn, Inc Place Wyoming Utility Id 20506 Utility Location Yes Ownership C NERC Location WECC NERC WECC...


Pioneer Rural Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Rural Elec Coop, Inc Jump to: navigation, search Name Pioneer Rural Elec Coop, Inc Place Ohio Utility Id 15054 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes RTO...

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Cavalier Rural Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Cavalier Rural Elec Coop, Inc Jump to: navigation, search Name Cavalier Rural Elec Coop, Inc Place North Dakota Utility Id 3138 Utility Location Yes Ownership C NERC Location MRO...


Upshur Rural Elec Coop Corp | Open Energy Information  

Open Energy Info (EERE)

Upshur Rural Elec Coop Corp Jump to: navigation, search Name Upshur Rural Elec Coop Corp Place Texas Utility Id 19579 Utility Location Yes Ownership C NERC Location SPP NERC SPP...


Big Horn County Elec Coop, Inc (Wyoming) | Open Energy Information  

Open Energy Info (EERE)

Twitter icon Big Horn County Elec Coop, Inc (Wyoming) Jump to: navigation, search Name Big Horn County Elec Coop, Inc Place Wyoming Utility Id 1683 References EIA Form EIA-861...


Northeast Texas Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Northeast Texas Elec Coop, Inc Jump to: navigation, search Name Northeast Texas Elec Coop, Inc Place Texas Utility Id 13670 Utility Location Yes Ownership C NERC Location SPP NERC...


Washington Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Washington Elec Member Corp Washington Elec Member Corp Place Georgia Utility Id 20146 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1,000 Watt HPS Cobra Lighting 1,000 Watt HPS Flood Lighting 1,000 Watt MH Flood Lighting 100 Watt HPS Lighting 175 Watt MV 250 Watt HPS Lighting 250 Watt HPS Cobra Head Lighting 250 Watt HPS Flood Lighting 400 Watt HPS Cobra Head Lighting 400 Watt HPS Flood Lighting Rate-01 (RS) Residential Rate-02 (GSND) Commercial Rate-07 (GSD) Commercial Rate-08 (GS) Primary


Western Illinois Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Illinois Elec Coop Illinois Elec Coop Place Illinois Utility Id 29296 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Rate 1- General Purpose (Single Phase) Commercial Rate 10- Large Power Industrial Rate 11 - Three Phase-interruptible Commercial Rate 3- General Purpose (Three Phase) Commercial Rate 4- Large Power Commercial Rate 40/41 Electric Heat Commercial Rate 5- Large Power interruptible Industrial Rate 60/61 Geothermal Heat Commercial Security Light Lighting Security light Lighting Average Rates


Eastern Illinois Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Eastern Illinois Elec Coop Eastern Illinois Elec Coop Jump to: navigation, search Name Eastern Illini Electric Co-op Place Illinois Utility Id 5585 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png (RATE SCHEDULE 1)GENERAL SERVICE - SINGLE-PHASE Commercial (RATE SCHEDULE 18)LARGE SERVICE - SINGLE-PHASE - 400 AMP OR GREATER Commercial (RATE SCHEDULE 18)LARGE SERVICE - SINGLE-PHASE - LESS THAN 400 AMP Commercial (RATE SCHEDULE 20: ELECTRIC HEAT)OPTIONAL SERVICE - SINGLE-PHASE Commercial


Northern Virginia Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Northern Virginia Elec Coop Northern Virginia Elec Coop Place Manassas, Virginia Utility Id 13640 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes RTO PJM Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] SGIC[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Northern Virginia Electric Cooperative Smart Grid Project was awarded $5,000,000 Recovery Act Funding with a total project value of $10,000,000. Utility Rate Schedules Grid-background.png Interruptible Service Rider - Rider IS-1 Schedule DPS, Delivery Point Service (Unbundled Rate) Commercial Schedule HV-1 Large Power Dedicated Distribution Service Commercial


Northwestern Wisconsin Elec Co | Open Energy Information  

Open Energy Info (EERE)

Wisconsin Elec Co Wisconsin Elec Co Place Wisconsin Utility Id 13815 Utility Location Yes Ownership I NERC Location MRO NERC MRO Yes ISO MISO Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Retail Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1320/kWh Commercial: $0.1180/kWh Industrial: $0.0914/kWh The following table contains monthly sales and revenue data for


Intermountain Rural Elec Assn | Open Energy Information  

Open Energy Info (EERE)

Intermountain Rural Elec Assn Intermountain Rural Elec Assn Place Colorado Utility Id 9336 Utility Location Yes Ownership C NERC Location WECC Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Demand Metered Time of Use (B-TOU) Commercial Commercial Service Three Phase (E3) Commercial Commercial Service-Demand Metered (B) Commercial Commercial Time of Use Single Phase(E1-TOU) Commercial Commercial Time of Use Three Phase (E3-TOU) Commercial


Rutherford Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Elec Member Corp Elec Member Corp Place North Carolina Utility Id 16496 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Residential Service Average Rates Residential: $0.0984/kWh Commercial: $0.0988/kWh Industrial: $0.0667/kWh The following table contains monthly sales and revenue data for Rutherford Elec Member Corp (North Carolina). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS


Columbia Rural Elec Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Inc Jump to: navigation, search Name Columbia Rural Elec Assn, Inc Place Washington Utility Id 4041 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes Activity...


Hess Retail Natural Gas and Elec. Acctg. (Maryland) | Open Energy...  

Open Energy Info (EERE)

Maryland) Jump to: navigation, search Name Hess Retail Natural Gas and Elec. Acctg. Place Maryland Utility Id 22509 References EIA Form EIA-861 Final Data File for 2010 -...


Hess Retail Natural Gas and Elec. Acctg. (Pennsylvania) | Open...  

Open Energy Info (EERE)

Pennsylvania) Jump to: navigation, search Name Hess Retail Natural Gas and Elec. Acctg. Place Pennsylvania Utility Id 22509 References EIA Form EIA-861 Final Data File for 2010 -...


Hess Retail Natural Gas and Elec. Acctg. (Delaware) | Open Energy...  

Open Energy Info (EERE)

Delaware) Jump to: navigation, search Name Hess Retail Natural Gas and Elec. Acctg. Place Delaware Utility Id 22509 References EIA Form EIA-861 Final Data File for 2010 -...


Hess Retail Natural Gas and Elec. Acctg. (Massachusetts) | Open...  

Open Energy Info (EERE)

Massachusetts) Jump to: navigation, search Name Hess Retail Natural Gas and Elec. Acctg. Place Massachusetts Utility Id 22509 References EIA Form EIA-861 Final Data File for 2010 -...


Western Massachusetts Elec Co | Open Energy Information  

Open Energy Info (EERE)

Co Co Jump to: navigation, search Name Western Massachusetts Elec Co Place Massachusetts Service Territory Massachusetts Green Button Landing Page www.wmeco.com/Residential Green Button Reference Page www.wmeco.com/Residential Green Button Implemented Yes Utility Id 20455 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes ISO NE Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Retail Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile.


Shenandoah Valley Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search Name Shenandoah Valley Elec Coop Place Virginia Utility Id 17066 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100% RENEWABLE ENERGY ATTRIBUTES ELECTRIC SERVICE- RIDER R Residential INTERIM RATE INCREASE RIDER OD-09 SALES AND USE TAX SURCHARGE-Q SCHEDULE A-10 (UNBUNDLED) RESIDENTIAL SERVICE Residential SCHEDULE ALQ PRIVATE OUTDOOR AREA LIGHTING SERVICE Mercury 100 Watt - Customer-Owned Lighting SCHEDULE ALQ PRIVATE OUTDOOR AREA LIGHTING SERVICE Mercury 175 Watt -


Cumberland Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

(Redirected from CEMC) (Redirected from CEMC) Jump to: navigation, search Name Cumberland Elec Member Corp Place Tennessee Utility Id 4624 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial GSA 3 Commercial Commercial GSA 1 Commercial Commercial GSA 2 Commercial Facilities Rental (46-161 kV) Commercial Facilities Rental (less than 46 kV) Commercial Generation Partner 1 - Energy Credit Commercial Generation Partner 1 - Other Renewable Premium Commercial


East River Elec Pwr Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Elec Pwr Coop, Inc Elec Pwr Coop, Inc Jump to: navigation, search Name East River Elec Pwr Coop, Inc Place South Dakota Utility Id 5552 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Transmission Yes Activity Buying Transmission Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=East_River_Elec_Pwr_Coop,_Inc&oldid=410618"

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EnergyUnited Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

EnergyUnited Elec Member Corp EnergyUnited Elec Member Corp Jump to: navigation, search Name EnergyUnited Elec Member Corp Place North Carolina Utility Id 21632 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.0961/kWh Commercial: $0.0831/kWh Industrial: $0.0549/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=EnergyUnited_Elec_Member_Corp&oldid=410655"


New England Hydro-Tran Elec Co | Open Energy Information  

Open Energy Info (EERE)

England Hydro-Tran Elec Co England Hydro-Tran Elec Co Jump to: navigation, search Name New England Hydro-Tran Elec Co Place Massachusetts Utility Id 13355 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes Activity Transmission Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=New_England_Hydro-Tran_Elec_Co&oldid=411165" Categories: EIA Utility Companies and Aliases


Navasota Valley Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Navasota Valley Elec Coop, Inc Navasota Valley Elec Coop, Inc Jump to: navigation, search Name Navasota Valley Elec Coop, Inc Place Texas Utility Id 16146 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1170/kWh Commercial: $0.1100/kWh Industrial: $0.0718/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Navasota_Valley_Elec_Coop,_Inc&oldid=411152"


Lynches River Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Lynches River Elec Coop, Inc Lynches River Elec Coop, Inc Jump to: navigation, search Name Lynches River Elec Coop, Inc Place South Carolina Utility Id 11355 Utility Location Yes Ownership C NERC Location SERC Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1200/kWh Commercial: $0.1150/kWh Industrial: $0.0786/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Lynches_River_Elec_Coop,_Inc&oldid=411016" Categories:


Maquoketa Valley Rrl Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Maquoketa Valley Rrl Elec Coop Maquoketa Valley Rrl Elec Coop Jump to: navigation, search Name Maquoketa Valley Rrl Elec Coop Place Iowa Utility Id 12642 Utility Location Yes Ownership C NERC Location RFC NERC MRO Yes ISO MISO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1180/kWh Commercial: $0.1040/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Maquoketa_Valley_Rrl_Elec_Coop&oldid=411035" Categories:


Birch Creek Village Elec Util | Open Energy Information  

Open Energy Info (EERE)

Birch Creek Village Elec Util Birch Creek Village Elec Util Jump to: navigation, search Name Birch Creek Village Elec Util Place Alaska Utility Id 1747 Utility Location Yes Ownership M NERC Location AK Operates Generating Plant Yes Activity Generation Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.6070/kWh Commercial: $0.6150/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Birch_Creek_Village_Elec_Util&oldid=409048" Categories:


Pointe Coupee Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Pointe Coupee Elec Member Corp Pointe Coupee Elec Member Corp Jump to: navigation, search Name Pointe Coupee Elec Member Corp Place Louisiana Utility Id 15175 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.0859/kWh Commercial: $0.0909/kWh Industrial: $0.0582/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Pointe_Coupee_Elec_Member_Corp&oldid=411379"


Oliver-Mercer Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Oliver-Mercer Elec Coop Inc Oliver-Mercer Elec Coop Inc Jump to: navigation, search Name Oliver-Mercer Elec Coop Inc Place North Dakota Utility Id 14088 References Energy Information Administration.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available The following table contains monthly sales and revenue data for Oliver-Mercer Elec Coop Inc (North Dakota). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS


Tricounty Rural Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Tricounty Rural Elec Coop, Inc Tricounty Rural Elec Coop, Inc Jump to: navigation, search Name Tricounty Rural Elec Coop, Inc Place Ohio Utility Id 19176 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Residential (RESID) Average Rates Residential: $0.1040/kWh Commercial: $0.1080/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Tricounty_Rural_Elec_Coop,_Inc&oldid=411876" Categories: EIA Utility Companies and Aliases


Inside Passage Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Inside Passage Elec Coop, Inc Inside Passage Elec Coop, Inc Jump to: navigation, search Name Inside Passage Elec Coop, Inc Place Alaska Utility Id 18963 Utility Location Yes Ownership P NERC Location AK Operates Generating Plant Yes Activity Generation Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Power Commercial Large Power Interruptible Commercial Residential Residential Small Commercial Commercial Average Rates Residential: $0.5720/kWh Commercial: $0.4600/kWh Industrial: $0.5640/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Inside_Passage_Elec_Coop,_Inc&oldid=410873"


Rayburn Country Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Rayburn Country Elec Coop, Inc Rayburn Country Elec Coop, Inc Jump to: navigation, search Name Rayburn Country Elec Coop, Inc Place Texas Utility Id 18589 Utility Location Yes Ownership C NERC Location SPP NERC ERCOT Yes NERC SPP Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Buying Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Rayburn_Country_Elec_Coop,_Inc&oldid=411429


Nespelem Valley Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Nespelem Valley Elec Coop, Inc Nespelem Valley Elec Coop, Inc Jump to: navigation, search Name Nespelem Valley Elec Coop, Inc Place Washington Utility Id 13387 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png RESIDENTIAL RATE Residential Security Lighting Lighting Average Rates Residential: $0.0704/kWh Commercial: $0.0634/kWh Industrial: $0.0579/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Nespelem_Valley_Elec_Coop,_Inc&oldid=411159


Sangre De Cristo Elec Assn Inc | Open Energy Information  

Open Energy Info (EERE)

Sangre De Cristo Elec Assn Inc Sangre De Cristo Elec Assn Inc Jump to: navigation, search Name Sangre De Cristo Elec Assn Inc Place Colorado Utility Id 16649 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1510/kWh Commercial: $0.1270/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Sangre_De_Cristo_Elec_Assn_Inc&oldid=411495"


Calhoun County Elec Coop Assn | Open Energy Information  

Open Energy Info (EERE)

County Elec Coop Assn County Elec Coop Assn Jump to: navigation, search Name Calhoun County Elec Coop Assn Place Iowa Utility Id 4040 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1160/kWh Commercial: $0.0955/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Calhoun_County_Elec_Coop_Assn&oldid=409151" Categories: EIA Utility Companies and Aliases


Satilla Rural Elec Member Corporation | Open Energy Information  

Open Energy Info (EERE)

Satilla Rural Elec Member Corporation Satilla Rural Elec Member Corporation Jump to: navigation, search Name Satilla Rural Elec Member Corporation Place Georgia Utility Id 16674 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Residential Residential Average Rates Residential: $0.1020/kWh Commercial: $0.1120/kWh Industrial: $0.0626/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Satilla_Rural_Elec_Member_Corporation&oldid=411497"


Middle Kuskokwim Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Kuskokwim Elec Coop Inc Kuskokwim Elec Coop Inc Jump to: navigation, search Name Middle Kuskokwim Elec Coop Inc Place Alaska Utility Id 12485 Utility Location Yes Ownership C NERC Location AK Operates Generating Plant Yes Activity Generation Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Power Industrial Residential Rate Residential Small Power Commercial Average Rates Residential: $0.9390/kWh Commercial: $0.8500/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Middle_Kuskokwim_Elec_Coop_Inc&oldid=411085


Howell-Oregon Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Howell-Oregon Elec Coop, Inc Howell-Oregon Elec Coop, Inc Jump to: navigation, search Name Howell-Oregon Elec Coop, Inc Place Missouri Utility Id 8934 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Residential Residential Average Rates Residential: $0.0887/kWh Commercial: $0.0796/kWh Industrial: $0.0703/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Howell-Oregon_Elec_Coop,_Inc&oldid=410844


Columbia Rural Elec Assn, Inc (Oregon) | Open Energy Information  

Open Energy Info (EERE)

Inc (Oregon) Jump to: navigation, search Name Columbia Rural Elec Assn, Inc Place Oregon Utility Id 4041 References EIA Form EIA-861 Final Data File for 2010 - File220101...


Fall River Rural Elec Coop Inc (Montana) | Open Energy Information  

Open Energy Info (EERE)

Montana) Jump to: navigation, search Name Fall River Rural Elec Coop Inc Place Montana Utility Id 6169 References EIA Form EIA-861 Final Data File for 2010 - File220101 LinkedIn...


Fall River Rural Elec Coop Inc (Wyoming) | Open Energy Information  

Open Energy Info (EERE)

Wyoming) Jump to: navigation, search Name Fall River Rural Elec Coop Inc Place Wyoming Utility Id 6169 References EIA Form EIA-861 Final Data File for 2010 - File220101 LinkedIn...

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Raft River Rural Elec Coop Inc (Nevada) | Open Energy Information  

Open Energy Info (EERE)

Inc (Nevada) Jump to: navigation, search Name Raft River Rural Elec Coop Inc Place Nevada Utility Id 22814 References EIA Form EIA-861 Final Data File for 2010 - File220101...


Southwest Rural Elec Assn Inc (Texas) | Open Energy Information  

Open Energy Info (EERE)

Inc (Texas) Jump to: navigation, search Name Southwest Rural Elec Assn Inc Place Texas Utility Id 17681 References EIA Form EIA-861 Final Data File for 2010 - File220101...


Plumas-Sierra Rural Elec Coop (Nevada) | Open Energy Information  

Open Energy Info (EERE)

Coop (Nevada) Jump to: navigation, search Name Plumas-Sierra Rural Elec Coop Place Nevada Utility Id 15308 References EIA Form EIA-861 Final Data File for 2010 - File220101...


Hess Retail Natural Gas and Elec. Acctg. (Rhode Island) | Open...  

Open Energy Info (EERE)

Rhode Island) Jump to: navigation, search Name Hess Retail Natural Gas and Elec. Acctg. Place Rhode Island Utility Id 22509 References EIA Form EIA-861 Final Data File for 2010 -...


Hess Retail Natural Gas and Elec. Acctg. (District of Columbia...  

Open Energy Info (EERE)

District of Columbia) Jump to: navigation, search Name Hess Retail Natural Gas and Elec. Acctg. Place District of Columbia Utility Id 22509 References EIA Form EIA-861 Final Data...


Hess Retail Natural Gas and Elec. Acctg. (New Hampshire) | Open...  

Open Energy Info (EERE)

Hampshire) Jump to: navigation, search Name Hess Retail Natural Gas and Elec. Acctg. Place New Hampshire Utility Id 22509 References EIA Form EIA-861 Final Data File for 2010 -...


Hess Retail Natural Gas and Elec. Acctg. (Maine) | Open Energy...  

Open Energy Info (EERE)

Maine) Jump to: navigation, search Name Hess Retail Natural Gas and Elec. Acctg. Place Maine Utility Id 22509 References EIA Form EIA-861 Final Data File for 2010 - File220101...


New England Elec Transm'n Corp | Open Energy Information  

Open Energy Info (EERE)

Available References "EIA Form EIA-861 Final Data File for 2010 - File1a" Retrieved from "http:en.openei.orgwindex.php?titleNewEnglandElecTransm%27nCorp&oldid411164...


Duncan Valley Elec Coop, Inc (New Mexico) | Open Energy Information  

Open Energy Info (EERE)

Duncan Valley Elec Coop, Inc Place New Mexico Utility Id 5438 References EIA Form EIA-861 Final Data File for 2010 - File220101 LinkedIn Connections CrunchBase Profile No...


Goodhue County Coop Elec Assn | Open Energy Information  

Open Energy Info (EERE)

Elec Assn Elec Assn Jump to: navigation, search Name Goodhue County Coop Elec Assn Place Minnesota Utility Id 7460 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Power Commercial Single Phase Commercial Small Three Phrase Commercial Average Rates Residential: $0.1130/kWh Industrial: $0.1140/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Goodhue_County_Coop_Elec_Assn&oldid=410750


Barton County Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

County Elec Coop, Inc County Elec Coop, Inc Jump to: navigation, search Name Barton County Elec Coop, Inc Place Missouri Utility Id 1301 Utility Location Yes Ownership C NERC Location SERC Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png All Electric Rate Irrigation Rate Large Commercial Commercial Residential Rate Residential Small Commercial Rate Commercial Average Rates Residential: $0.1200/kWh Commercial: $0.1130/kWh Industrial: $0.0894/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Barton_County_Elec_Coop,_Inc&oldid=40902


Wayne-White Counties Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Wayne-White Counties Elec Coop Wayne-White Counties Elec Coop Jump to: navigation, search Name Wayne-White Counties Elec Coop Place Illinois Utility Id 20222 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes ISO MISO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Rate 1 Residential Rate 2 Residential Average Rates Residential: $0.1220/kWh Commercial: $0.1100/kWh Industrial: $0.0707/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Wayne-White_Counties_Elec_Coop&oldid=412155


Southern Iowa Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Iowa Elec Coop, Inc Iowa Elec Coop, Inc Place Iowa Utility Id 17643 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Residentail Rate Residential Security Light Metered Lighting Security Light Non-Metered Lighting Average Rates Residential: $0.1300/kWh Commercial: $0.0905/kWh Industrial: $0.0723/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Southern_Iowa_Elec_Coop,_Inc&oldid=411570


East Mississippi Elec Pwr Assn | Open Energy Information  

Open Energy Info (EERE)

Mississippi Elec Pwr Assn Mississippi Elec Pwr Assn Jump to: navigation, search Name East Mississippi Elec Pwr Assn Place Mississippi Utility Id 5578 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png GENERAL POWER RATE--SCHEDULE GSA--Rate 50 Commercial GENERAL POWER RATE--SCHEDULE GSA--Rate 51 Commercial GENERAL POWER RATE--SCHEDULE GSA--Rate 54 GENERAL POWER RATE--SCHEDULE GSA--Rate 80 Commercial GENERAL POWER RATE--SCHEDULE SGSB--Rate 56 General Power- Rate 40 Commercial LIGHTING--SCHEDULE LS--Rate SL


Southern Indiana Gas & Elec Co | Open Energy Information  

Open Energy Info (EERE)

Gas & Elec Co Gas & Elec Co Jump to: navigation, search Name Southern Indiana Gas & Elec Co Place Indiana Utility Id 17633 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes ISO MISO Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Bundled Services Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png AD - Area Development Commercial


Jefferson Davis Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Davis Elec Coop, Inc Davis Elec Coop, Inc Jump to: navigation, search Name Jefferson Davis Elec Coop, Inc Place Louisiana Utility Id 9682 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes RTO SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png All Electric Farm and Home Service Residential All Electric Farm and Home Service - Seasonal Residential Commercial and Industrial Services Commercial Extra Large Power Service Commercial Farm and Rice Dryers Residential Flood Lighting Service: 1000 watt- 140,000 Lumen High Pressure Sodium Lighting


Southern Indiana Gas & Elec Co | Open Energy Information  

Open Energy Info (EERE)

Gas & Elec Co Gas & Elec Co (Redirected from Vectren) Jump to: navigation, search Name Southern Indiana Gas & Elec Co Place Indiana Utility Id 17633 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes ISO MISO Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Bundled Services Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png AD - Area Development Commercial


Denton County Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

County Elec Coop, Inc County Elec Coop, Inc (Redirected from Denton County Electric Cooperative d/b/a CoServ Electric) Jump to: navigation, search Name Denton County Elec Coop, Inc Place Corinth, Texas Utility Id 5078 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes ISO Ercot Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] SGIC[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Rate Commercial Commercial-TOU (Demand Metered Customers) Commercial Commercial-TOU (Non-Coincident Peak Demand Charge) Commercial Commercial-TOU (Non-Demand Metered Customers) Residential Industrial Rate- TOU Industrial


Northern Neck Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Neck Elec Coop, Inc Neck Elec Coop, Inc Jump to: navigation, search Name Northern Neck Elec Coop, Inc Place Virginia Utility Id 13762 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes RTO PJM Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 % Renewable Energy Attributes Electric Service Rider Residential Net Metering Rider SCHEDULE C-5-U CHURCH SERVICE Commercial SCHEDULE GS-3-U GENERAL SERVICE Industrial SCHEDULE LP-5-U LARGE POWER SERVICE Industrial SCHEDULE R-2-U RESIDENTIAL SERVICE Residential SCHEDULE T-1-U NON-DEMAND TOU SERVICE Commercial


Mountrail-Williams Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Mountrail-Williams Elec Coop Mountrail-Williams Elec Coop Jump to: navigation, search Name Mountrail-Williams Elec Coop Place North Dakota Utility Id 20413 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Air conditioning rate Grain Drying Program Commercial Heat rate Residential rate Residential Wind Energy Average Rates Residential: $0.0717/kWh Commercial: $0.0885/kWh Industrial: $0.0703/kWh The following table contains monthly sales and revenue data for

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Rich Mountain Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Elec Coop, Inc Elec Coop, Inc Place Arkansas Utility Id 15811 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Industrial Power Service Industrial Large Power Service Commercial Single Phase Service Residential Three Phase Service- 50 kW or less Residential Average Rates Residential: $0.0939/kWh Commercial: $0.0808/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Rich_Mountain_Elec_Coop,_Inc&oldid=411446


East Central Oklahoma Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Oklahoma Elec Coop Inc Oklahoma Elec Coop Inc Jump to: navigation, search Name East Central Oklahoma Elec Coop Inc Place Oklahoma Utility Id 5598 Utility Location Yes Ownership C NERC Location SPP Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Pumping (Single Phase), Schedule CP-1 Commercial Commercial Pumping (Three Phase), Schedule CP-1 Commercial Commercial Service-Single Phase, Schedule C-1 Commercial Commercial Service-Three-Phase, Schedule C-1 Commercial Commercial Time of Use (Single-Phase), Schedule TOU-C Commercial Commercial Time of Use (Three-Phase), Schedule TOU-C Commercial


Jemez Mountains Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Jemez Mountains Elec Coop, Inc Jemez Mountains Elec Coop, Inc Jump to: navigation, search Name Jemez Mountains Elec Coop, Inc Place New Mexico Utility Id 9699 Utility Location Yes Ownership C NERC Location WECC Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Power Service Industrial Large Power Service-TOU Industrial Municipal Service and Small School Service Commercial Municipal Service and Small School Service TOU Commercial Residential Service Residential Residential Time of Use Rates Residential Small Commercial Service Residential


Heartland Rural Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Rural Elec Coop, Inc Rural Elec Coop, Inc Jump to: navigation, search Name Heartland Rural Elec Coop, Inc Place Kansas Utility Id 16854 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png ENBRIDGE PIPELINE SERVICE Industrial GENERAL COMMERCIAL SERVICE Commercial General Service Commercial HEAT PUMP SERVICE Commercial LARGE POWER - TOWER METAL PRODUCTS Commercial MAGELLAN PIPELINE SERVICE Industrial METERED SECURITY LIGHTING: 100 Watt High Pressure Sodium Light Lighting METERED SECURITY LIGHTING: 150 Watt High Pressure Sodium Light Lighting


Warren Rural Elec Coop Corp | Open Energy Information  

Open Energy Info (EERE)

Rural Elec Coop Corp Rural Elec Coop Corp Jump to: navigation, search Name Warren Rural Elec Coop Corp Place Kentucky Utility Id 20130 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Non-Residential GSA1 Industrial Non-Residential GSA2 Industrial Non-Residential GSA3 Industrial Residential Residential Average Rates Residential: $0.0938/kWh Commercial: $0.1070/kWh Industrial: $0.0751/kWh The following table contains monthly sales and revenue data for Warren


Roosevelt County Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Roosevelt County Elec Coop Inc Roosevelt County Elec Coop Inc Jump to: navigation, search Name Roosevelt County Elec Coop Inc Place New Mexico Utility Id 22690 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes RTO SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Service (A) Commercial Commercial Service (B) Commercial Commercial Service with Interruptible rate rider Commercial Commercial Service(B) with Interruptible rate rider Commercial Demand Energy Residential General Service Residential


Joe Wheeler Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Wheeler Elec Member Corp Wheeler Elec Member Corp Jump to: navigation, search Name Joe Wheeler Elec Member Corp Place Alabama Utility Id 9739 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png GENERAL POWER RATE--SCHEDULE GSA: Last 12-months use over 1,000 kW Commercial GENERAL POWER RATE--SCHEDULE GSA: Last 12-months' use < 50 kW Commercial General Power Rate--Schedule SGSB Commercial General Power Rate--Schedule SGSC Industrial General Power Rate--Schedule SGSD Industrial


Claverack Rural Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Claverack Rural Elec Coop Inc Claverack Rural Elec Coop Inc Jump to: navigation, search Name Claverack Rural Elec Coop Inc Place Pennsylvania Utility Id 40289 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes RTO PJM Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Service, Three-Phase Commercial Residential Service Residential Residential Service TOU Residential Average Rates Residential: $0.1280/kWh Commercial: $0.1370/kWh Industrial: $0.0902/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from


Jasper-Newton Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Jasper-Newton Elec Coop, Inc Jasper-Newton Elec Coop, Inc Jump to: navigation, search Name Jasper-Newton Elec Coop, Inc Place Texas Utility Id 9668 Utility Location Yes Ownership C NERC Location SERC NERC ERCOT Yes NERC SERC Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Churches and Schools Service Commercial Farm and Home Services Residential General Service Commercial Large Power Service Industrial Security Lighting-100 W high pressure sodium Lighting Security Lighting-150 W high pressure sodium Lighting Security Lighting-400 W high pressure sodium Lighting


Clinton County Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Clinton County Elec Coop, Inc Clinton County Elec Coop, Inc Jump to: navigation, search Name Clinton County Elec Coop, Inc Place Illinois Utility Id 3806 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png IPS - Industrial Power Service - Integrated Distribution Service Commercial SCHEDULE 13S - THREE-PHASE POWER - (Sole service being served by Cooperative substation) Industrial SL - 400W MV Directional S/L Schedule 01L - Residential Large Residential Schedule 02 - Commercial Commercial Schedule 02L - Commercial Large Commercial


Clearwater-Polk Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Clearwater-Polk Elec Coop Inc Clearwater-Polk Elec Coop Inc Jump to: navigation, search Name Clearwater-Polk Elec Coop Inc Place Minnesota Utility Id 3764 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial - Generator Commercial Commercial - Large Power Commercial Commercial - Three Phase Commercial Electric Dual Heat Residential Electric Dual Heat Short Term Rate Residential Residential Residential Security Lights - Metered Lighting Security Lights - Unmetered Lighting Average Rates Residential: $0.0958/kWh


North Western Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

North Western Elec Coop, Inc North Western Elec Coop, Inc Jump to: navigation, search Name North Western Elec Coop, Inc Place Ohio Utility Id 13704 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Devices/SL-100 W HPS Lighting Devices/SL-175 W MV Lighting General Service - Non-residential Single Phase Residential Multi-Phase - 0-50 KVA Service. Not on a Demand Rate. Commercial Multi-Phase - 50-500 KVA Service. Demand Charges Apply. Industrial Multi-Phase - Demand Rate over 500 KVA Commercial Outdoor Lighting Service Lighting


Weakley County Mun Elec Sys | Open Energy Information  

Open Energy Info (EERE)

Weakley County Mun Elec Sys Weakley County Mun Elec Sys Jump to: navigation, search Name Weakley County Mun Elec Sys Place Tennessee Utility Id 20228 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial (<50kW) Commercial Commercial (1,001-5,000kW) Commercial Commercial (51-1,000kW) Commercial Residential Residential Average Rates Residential: $0.0875/kWh Commercial: $0.0982/kWh Industrial: $0.0869/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from


Harrison County Rrl Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Rrl Elec Coop Rrl Elec Coop Jump to: navigation, search Name Harrison County Rrl Elec Coop Place Iowa Utility Id 8283 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1 & 1T Multi-Purpose Single Phase 13 & 13T Multi Phase Service 50 kW & Greater 2 Idle Service 3 & 3T Multi Phase Less than 50 kW 59 & 59T Interruptible Controlled I-1 Irrigation (Controlled/Interruptible) Commercial I-2 Irrigation (Uncontrolled) Commercial Security Light Lighting Average Rates Residential: $0.1070/kWh


Southern Maryland Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Elec Coop Inc Elec Coop Inc (Redirected from SMECO) Jump to: navigation, search Name Southern Maryland Elec Coop Inc Place Maryland Utility Id 17637 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes RTO PJM Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Calvert Cliffs Standby Service Industrial General Service Demand 3 Phase Commercial Commercial General Service Demand 3 Phase Industrial Industrial General Service Demand Commercial Commercial General Service Demand Industrial Industrial


Black Warrior Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Black Warrior Elec Member Corp Black Warrior Elec Member Corp Jump to: navigation, search Name Black Warrior Elec Member Corp Place Alabama Utility Id 1780 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Camp House Electric Service Residential City Limits- Residential Residential City Limits- Small Commercial Commercial Farm Electric Service Commercial Light and Power Service- Large Commercial Light and Power Service- Medium Commercial Light and Power Service- Small Commercial Outdoor Lighting Service (100 W High Pressure Sodium) Lighting


Jones-Onslow Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Jones-Onslow Elec Member Corp Jones-Onslow Elec Member Corp Jump to: navigation, search Name Jones-Onslow Elec Member Corp Place North Carolina Utility Id 9837 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Medium General Service Single Phase Commercial Medium General Service Three Phase Commercial Residential Rate Residential Small General Service Single Phase Commercial Small General Service Three Phase Commercial Average Rates Residential: $0.1040/kWh


Alaska Village Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Village Elec Coop, Inc Village Elec Coop, Inc Jump to: navigation, search Name Alaska Village Elec Coop, Inc Place Alaska Utility Id 221 Utility Location Yes Ownership C NERC Location AK Operates Generating Plant Yes Activity Generation Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Power- GS-2: Alakanuk Village Industrial Large Power- GS-2: Ambler Village Industrial Large Power- GS-2: Anvik Village Industrial Large Power- GS-2: Brevig Mission Village Industrial Large Power- GS-2: Chevak Village Industrial Large Power- GS-2: Eek Village Industrial


Bailey County Elec Coop Assn | Open Energy Information  

Open Energy Info (EERE)

County Elec Coop Assn County Elec Coop Assn Jump to: navigation, search Name Bailey County Elec Coop Assn Place Texas Utility Id 1169 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Cotton GINS 3O Industrial Cotton GINS 3O Ginning Season Farm & Home service 1O Residential Farm & Home service 3O Residential Industrial 3O Industrial Irrigation Mar to Sep Industrial Irrigation Sep to Mar Industrial Large Commercial 3O Commercial Medium Commercial 3O Commercial Outdoor Lighting 100 W HPS Lighting


Dakota Valley Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Dakota Valley Elec Coop Inc Dakota Valley Elec Coop Inc Jump to: navigation, search Name Dakota Valley Elec Coop Inc Place North Dakota Utility Id 4717 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Controlled Grain Drying - Off Season - Subject to Moderate Periods of Control Residential Controlled Grain Drying - Off Season - Subject to Extended Periods of Control Residential Controlled Irrigation Service Commercial Controlled Water Heaters - Storage Capacity over 80 Gallons with No

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Butler County Rural Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Butler County Rural Elec Coop Butler County Rural Elec Coop Jump to: navigation, search Name Butler County Rural Elec Coop Place Iowa Utility Id 2652 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Coincidental Demand Three Phase Industrial Coincidental Demand Three Phase* Industrial Electric Space Heat Commercial Electric Storage Heat Commercial Irrigation Three Phase Commercial Irrigation Three Phase* Commercial Regular Farm and Residential Single Phase Residential Regular Farm and Residential Three Phase Residential


Brown County Rural Elec Assn | Open Energy Information  

Open Energy Info (EERE)

Rural Elec Assn Rural Elec Assn Jump to: navigation, search Name Brown County Rural Elec Assn Place Minnesota Utility Id 2316 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Single Phase Service-Controlled electric Heat Commercial General Single Phase Service Commercial General Single Phase Service(Load Management) Commercial General Three Phase Service Commercial General Three Phase Service(Load Management) Commercial General Three Phase Service- Controlled Electric Heat Commercial


Harrison Rural Elec Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Rural Elec Assn, Inc Rural Elec Assn, Inc Jump to: navigation, search Name Harrison Rural Elec Assn, Inc Place West Virginia Utility Id 8192 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL AND INDUSTRIAL SERVICE Planned Development Rate Schedule C & I- Industrial Industrial COMMERCIAL AND INDUSTRIAL SERVICE Planned Development Rate Schedule C & I- Commercial Commercial COMMERCIAL AND INDUSTRIAL SERVICE Schedule L-P- Commercial Commercial COMMERCIAL AND INDUSTRIAL SERVICE Schedule L-P-Industrial Industrial


Escambia River Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Escambia River Elec Coop, Inc Escambia River Elec Coop, Inc Jump to: navigation, search Name Escambia River Elec Coop, Inc Place Florida Utility Id 5964 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Athletic Field Lighting- AL Commercial General Service Demand- GSD Commercial General Service Time of Use- GS TOU Commercial General Service- GS Commercial Outdoor Lighting- LS (100 W HPS) Lighting Outdoor Lighting- LS (175 W MH/MV) Lighting Outdoor Lighting- LS (250 W HPS-CH) Lighting Outdoor Lighting- LS (250 W HPS-Dir) Lighting


Tallapoosa River Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Elec Coop Inc Elec Coop Inc Jump to: navigation, search Name Tallapoosa River Elec Coop Inc Place Alabama Utility Id 18203 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial and Industrial Power Service Commercial Industrial Primary Service (kVA) Industrial Industrial Primary Service (kW) Industrial Residential, Farm, and GS Residential Security Lights: Flood Lights: 1000 W HPS on additional pole Lighting Security Lights: Flood Lights: 1000 W HPS on existing pole Lighting


Verdigris Valley Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Verdigris Valley Elec Coop Inc Verdigris Valley Elec Coop Inc Jump to: navigation, search Name Verdigris Valley Elec Coop Inc Place Oklahoma Utility Id 19785 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Large Commercial General Service Small Three-Phase Commercial General Service Small Single-Phase Commercial General Service Urban Single-Phase Commercial General Service Urban Three-Phase Commercial Municipal Street Lighting Service 100W HPS - Coop Owned Lighting


Big Sandy Rural Elec Coop Corp | Open Energy Information  

Open Energy Info (EERE)

Rural Elec Coop Corp Rural Elec Coop Corp Jump to: navigation, search Name Big Sandy Rural Elec Coop Corp Place Kentucky Utility Id 1708 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png (SCHEDULE A-1 FARM & HOMO),Residential Residential Commercial and Small Power Commercial Large Power Rate - Primary Meter Industrial Large Power Rate - Secondary Meter Industrial Large Power Service - Primary Meter Industrial Large Power Service - Secondary Meter Industrial Light - 1,500 watt Lighting Light - 100 watt MH Lighting


Chariton Valley Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Valley Elec Coop, Inc Valley Elec Coop, Inc Jump to: navigation, search Name Chariton Valley Elec Coop, Inc Place Iowa Utility Id 3314 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Outdoor Lighting Metered HPS 100 W Lighting Outdoor Lighting Metered HPS 150 W Lighting Outdoor Lighting Metered HPS 250 W Lighting Outdoor Lighting Metered MV 175 W Lighting Outdoor Lighting Metered MV 400 W Lighting Outdoor Lighting Unmetered HPS 100 W Lighting Outdoor Lighting Unmetered HPS 100 W New Pole Lighting


Sumner-Cowley Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Sumner-Cowley Elec Coop, Inc Sumner-Cowley Elec Coop, Inc Jump to: navigation, search Name Sumner-Cowley Elec Coop, Inc Place Kansas Utility Id 18316 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes RTO SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Large (GSL-04) Commercial General Service Small (GSS >50 kW - 04) Commercial General Service Small (GSS <50 kW - 04) Commercial Irrigation Service (IRR-04) Commercial Irrigation Service(IRRL-04)-Load Control Commercial Non-Residential Service (NORES-04) Commercial Public Service Lighting (PSL-04) Lighting


Cape Hatteras Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Hatteras Elec Member Corp Hatteras Elec Member Corp Jump to: navigation, search Name Cape Hatteras Elec Member Corp Place North Carolina Utility Id 2982 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Lighting and Power Commercial Industrial Lighting and Power Industrial Schedule A - RESIDENTIAL SERVICE Residential Security Light - 100 watt HPS Lighting Security Light - 1000 watt HPS Lighting Security Light - 175 watt MV Lighting Security Light - 250 watt HPS Lighting


Southern Pine Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Elec Coop, Inc Elec Coop, Inc Jump to: navigation, search Name Southern Pine Elec Coop, Inc Place Alabama Utility Id 17646 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Security Light: 100 Watt High Pressure Sodium (HPS) Lighting Security Light: 175 Watt Mercury Vapor Lighting Security Light: 400 Watt High Pressure Sodium (HPS) Lighting Security Light: 400 Watt Mercury Vapor Lighting Average Rates Residential: $0.1140/kWh Commercial: $0.0956/kWh Industrial: $0.0928/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"


Red River Valley Rrl Elec Assn | Open Energy Information  

Open Energy Info (EERE)

Rrl Elec Assn Rrl Elec Assn Jump to: navigation, search Name Red River Valley Rrl Elec Assn Place Oklahoma Utility Id 15746 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes RTO SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Experimental Residential TOU Residential General Purpose Single Phase Commercial General Purpose Three Phase Commercial Irrigation - Water pumping Commercial Large Power 1 Industrial Large Power 2 Industrial Low-Use General Purpose Residential Optional General Purpose TOU Industrial Outdoor Lighting 1000w Metal Halide - Metered Lighting


Three Notch Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Notch Elec Member Corp Notch Elec Member Corp Jump to: navigation, search Name Three Notch Elec Member Corp Place Georgia Utility Id 18499 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1000W Overhead Wiring (Non Mercury vapor fixtures) - (Type - 'HPS-Flood',Wood Pole (1)) Lighting 1000W Overhead Wiring (Non Mercury vapor fixtures) - (Type - 'HPS-Flood',Wood Pole (2)) Lighting 1000W Underground Wiring (Non Mercury vapor fixtures) - (Type - 'HPS-Flood',FiberglassPole(3)) Lighting 1000W Underground Wiring (Non Mercury vapor fixtures) - (Type -


Whetstone Valley Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Whetstone Valley Elec Coop Inc Whetstone Valley Elec Coop Inc Jump to: navigation, search Name Whetstone Valley Elec Coop Inc Place South Dakota Utility Id 20422 Utility Location Yes Ownership C NERC Location MRO Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Interrupitble Farm & Sm. Comm Commercial Irrigation controlled Commercial Metered Electirc Heating Commercial Multi Phase > 1000kw Commercial Multi Phase >50 kw Commercial Multi Phase >50 kw - Controlled Commercial Multi Phase <50 kva Commercial Multi Phase Rate 175 Commercial Multi Phase Rate 88 Commercial


Mora-San Miguel Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Mora-San Miguel Elec Coop, Inc Mora-San Miguel Elec Coop, Inc Jump to: navigation, search Name Mora-San Miguel Elec Coop, Inc Place New Mexico Utility Id 12901 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Service Commercial Lighting Service-100 W HPS Lighting Lighting Service-175 W MV Lighting Lighting Service-250 W HPS Lighting Lighting Service-400 W MV Lighting Power Service Commercial Residential Service Residential Seasonal Residential Service Residential Average Rates Residential: $0.1480/kWh


Pitt & Greene Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Greene Elec Member Corp Greene Elec Member Corp Jump to: navigation, search Name Pitt & Greene Elec Member Corp Place North Carolina Utility Id 14857 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Commercial Large Power Service Commercial Seasonal Service- Multi- Phase Service Commercial Seasonal Service-Single Phase Commercial Small General Service- Multi Phase Commercial Small General Service- Single Phase Commercial Average Rates Residential: $0.1240/kWh Commercial: $0.1060/kWh


Southern Maryland Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Elec Coop Inc Elec Coop Inc Jump to: navigation, search Name Southern Maryland Elec Coop Inc Place Maryland Utility Id 17637 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes RTO PJM Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Calvert Cliffs Standby Service Industrial General Service Demand 3 Phase Commercial Commercial General Service Demand 3 Phase Industrial Industrial General Service Demand Commercial Commercial General Service Demand Industrial Industrial General Service Demand Primary Commercial Commercial


Big Horn County Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

County Elec Coop, Inc County Elec Coop, Inc Jump to: navigation, search Name Big Horn County Elec Coop, Inc Place Montana Utility Id 1683 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Demand Rate Commercial Industrial Rate Industrial Irrigation Rate Commercial Lighting Rate- (100W HPS) Lighting Lighting Rate- (175W MVL) Lighting Lighting Rate- (250W HPS) Lighting Lighting Rate- (400W MVL) Lighting Residential Rate Residential Small Commercial- Single Phase Commercial


Public Service Elec & Gas Co | Open Energy Information  

Open Energy Info (EERE)

Elec & Gas Co Elec & Gas Co (Redirected from PSEG) Jump to: navigation, search Name Public Service Elec & Gas Co Place New Jersey Utility Id 15477 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes Activity Transmission Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 COBRA HEAD CUT OFF TYPE III HP Lighting 100 CORA HEAD H.P. Commercial 100 DELUXE ACORN H.P Lighting 100 FRANKIN PARK TYPE IV H.P Commercial 100 NEW XFORD BLACK TYPE III H.P Commercial


Surry-Yadkin Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Surry-Yadkin Elec Member Corp Surry-Yadkin Elec Member Corp Jump to: navigation, search Name Surry-Yadkin Elec Member Corp Place North Carolina Utility Id 18339 Utility Location Yes Ownership C NERC Location SERC Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png NC GreenPower Residential Conservation Service Residential SSI Supplemental Security Service Lighting Security Lighting 100 W HPS Lighting Single Phase General Service Commercial Average Rates Residential: $0.1120/kWh Commercial: $0.0976/kWh Industrial: $0.1160/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Steuben Rural Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Rural Elec Coop, Inc Rural Elec Coop, Inc Jump to: navigation, search Name Steuben Rural Elec Coop, Inc Place New York Utility Id 18102 Utility Location Yes Ownership C NERC Location NPCC NERC NPCC Yes ISO NY Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Electric Thermal Storage-TOU Commercial Electric Thermal Storage-TOU(Niagara Hydro Plus Program Participant) Commercial Industrial Industrial Industrial(Niagara Hydro Plus Program Participant) Industrial Residential Seasonal Residential


Wright-Hennepin Coop Elec Assn | Open Energy Information  

Open Energy Info (EERE)

Wright-Hennepin Coop Elec Assn Wright-Hennepin Coop Elec Assn Jump to: navigation, search Name Wright-Hennepin Coop Elec Assn Place Minnesota Utility Id 20996 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes ISO MISO Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Commercial and Industrial Rate Commercial Commercial and Industrial Time-of-Use Service Program Commercial General Service Residential General Service Rate Commercial Heat Pump Program Commercial


Somerset Rural Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Somerset Rural Elec Coop, Inc Somerset Rural Elec Coop, Inc Jump to: navigation, search Name Somerset Rural Elec Coop, Inc Place Pennsylvania Utility Id 40167 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes RTO PJM Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 Watt Lamp(Mercury Vapor) Lighting 175 Watt Lamp(Mercury Vapor) Lighting 400 Watt Lamp(Mercury Vapor) Lighting Commercial Service Single-Phase Commercial Dairy Farm Water Heating-Schedule DF Commercial Electric Thermal Storage and Dual Fuel, Schedule EM Commercial Farm and Home Service-Space Heating Residential


Columbia Basin Elec Cooperative, Inc | Open Energy Information  

Open Energy Info (EERE)

Elec Cooperative, Inc Elec Cooperative, Inc Jump to: navigation, search Name Columbia Basin Elec Cooperative, Inc Place Oregon Utility Id 4005 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes Activity Transmission Yes Activity Distribution Yes Activity Retail Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Demand Service Commercial Irrigation Pumping Residential Service (Single Phase) Residential Residential Service (Three Phase) Residential Small General Service (Single Phase) Commercial Small General Service (Three Phase) Commercial Street & Security Lighting (100 W SV) Commercial


Grayson-Collin Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Grayson-Collin Elec Coop, Inc Grayson-Collin Elec Coop, Inc Jump to: navigation, search Name Grayson-Collin Elec Coop, Inc Place Texas Utility Id 7559 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes Activity Transmission Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Large Power Commercial Industrial Large Power Industrial Residential Residential School Large Power Commercial Security Lights- 100 Watt HPS Lighting Security Lights- 175 Watt MVL Lighting Security Lights- 175 Watt MVL (Metered) Lighting


Arkansas Valley Elec Coop Corp (Oklahoma) | Open Energy Information  

Open Energy Info (EERE)

Arkansas Valley Elec Coop Corp Arkansas Valley Elec Coop Corp Place Oklahoma Utility Id 817 References Energy Information Administration.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.0800/kWh Commercial: $0.0668/kWh The following table contains monthly sales and revenue data for Arkansas Valley Elec Coop Corp (Oklahoma). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS 2009-03 332 4,381 3,942 104 1,622 485 436 6,003 4,427


Lumbee River Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Lumbee River Elec Member Corp Lumbee River Elec Member Corp Jump to: navigation, search Name Lumbee River Elec Member Corp Place North Carolina Utility Id 11291 Utility Location Yes Ownership C NERC Location SERC NERC ERCOT Yes NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Electric Rates- Rider SQF Residential Flood Lights 1000 W HPS Lighting Flood Lights 1000 W MH Lighting Flood Lights 1000 W MV Lighting Flood Lights 400 W HPS Lighting Industrial Power Service-CB Industrial Large General Service Commercial Large General Service- Time of Day Commercial


Mid-Yellowstone Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Yellowstone Elec Coop, Inc Yellowstone Elec Coop, Inc Jump to: navigation, search Name Mid-Yellowstone Elec Coop, Inc Place Montana Utility Id 12463 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes ISO Other Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Farm, Residential, and Public Buildings General Service 1 Phase General Service 3 Phase Irrigation Service > 200 HP Commercial Irrigation Service < 200 HP Commercial Seasonal Services Seasonal Services Security Light 400 watt light Lighting Security Lights 175 watt light Lighting


Crawfordsville Elec, Lgt & Pwr | Open Energy Information  

Open Energy Info (EERE)

Crawfordsville Elec, Lgt & Pwr Crawfordsville Elec, Lgt & Pwr Jump to: navigation, search Name Crawfordsville Elec, Lgt & Pwr Place Indiana Utility Id 4508 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes ISO MISO Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial General Power- Single Phase Commercial Commercial General Power- Three Phase Commercial Industrial Primary Power Industrial Outdoor Lighting- 100 watt sodium vapor Lighting Outdoor Lighting- 175 watt mercury vapor Lighting


East-Central Iowa Rural Elec Coop | Open Energy Information  

Open Energy Info (EERE)

East-Central Iowa Rural Elec Coop East-Central Iowa Rural Elec Coop Jump to: navigation, search Name East-Central Iowa Rural Elec Coop Place Iowa Utility Id 5588 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes ISO MISO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Communication Netowrk Hubs 120 Line Unit Commercial Communication Network Hubs 240 Line Unit Commercial Communication Network Hubs 480 Line Unit Commercial Heat Plus Multi Phase(October-May) Heat Plus Single Phase(October-May) Large Power Service Industrial Large Power Service Time of Day Industrial


Oneida-Madison Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Oneida-Madison Elec Coop, Inc Oneida-Madison Elec Coop, Inc Jump to: navigation, search Name Oneida-Madison Elec Coop, Inc Place New York Utility Id 14125 Utility Location Yes Ownership C NERC Location NPCC NERC NPCC Yes ISO NY Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Service Commercial Residential Service Residential Seasonal Service Residential Security Lighting Service Lighting Average Rates Residential: $0.1070/kWh Commercial: $0.1520/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"


French Broad Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

French Broad Elec Member Corp French Broad Elec Member Corp Jump to: navigation, search Name French Broad Elec Member Corp Place North Carolina Utility Id 6784 Utility Location Yes Ownership C NERC Location SERC Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Generation Single Phase Commercial Commercial Generation Three Phase Commercial Large Power Customer Industrial Residential Customer(NC) Residential Residential FlexPay Customer(NC) Residential Residential Generation Residential


South Alabama Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Alabama Elec Coop, Inc Alabama Elec Coop, Inc Place Alabama Utility Id 17534 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Security Light: HPS Lighting Average Rates Residential: $0.1270/kWh Commercial: $0.1170/kWh Industrial: $0.0938/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=South_Alabama_Elec_Coop,_Inc&oldid=411536" Categories: EIA Utility Companies and Aliases Utility Companies Organizations


Comanche County Elec Coop Assn | Open Energy Information  

Open Energy Info (EERE)

Comanche County Elec Coop Assn Comanche County Elec Coop Assn Jump to: navigation, search Name Comanche County Elec Coop Assn Place Texas Utility Id 4295 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service - Three Phase Service Commercial General Service-Single Phase Commercial Large Power Rate Industrial Large Power Rate Primary Metering Industrial Residential Residential SECURITY LIGHTS:100 watt HP Sodium Lighting SECURITY LIGHTS:175 watt Mercury Vapor Lighting SECURITY LIGHTS:250 watt HP Sodium Lighting


Singing River Elec Pwr Assn | Open Energy Information  

Open Energy Info (EERE)

Singing River Elec Pwr Assn Singing River Elec Pwr Assn Place Alabama Utility Id 17252 References Energy Information Administration.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1080/kWh Commercial: $0.1110/kWh The following table contains monthly sales and revenue data for Singing River Elec Pwr Assn (Alabama). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS 2009-03 34.718 304.244 306 4.774 40.12 19 39.492 344.364 325


Cookson Hills Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Elec Coop, Inc Elec Coop, Inc Jump to: navigation, search Name Cookson Hills Elec Coop, Inc Place Oklahoma Utility Id 4296 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes RTO SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Agricultural Service, Rate 18 Industrial Commercial and Small Power - Single Phase, Rate 2 Commercial Commercial and Small Power - Three Phase, Rate 3 Commercial Farm and Home, Rate 1 Residential Irrigation Service - Single Phase, Rate 27 Industrial Irrigation Service - Three Phase, Rate 28 Industrial Security Light Lighting


Western Farmers Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Western Farmers Elec Coop, Inc Western Farmers Elec Coop, Inc Place Oklahoma Utility Id 20447 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes RTO SPP Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Wholesale Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Western_Farmers_Elec_Coop,_Inc&oldid=412173


Sioux Valley SW Elec Coop | Open Energy Information  

Open Energy Info (EERE)

SW Elec Coop SW Elec Coop Jump to: navigation, search Name Sioux Valley SW Elec Coop Place Colman, South Dakota Utility Id 17267 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] SGIC[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Sioux Valley Southwestern Electric Cooperative, Inc. Smart Grid Project was awarded $4,016,368 Recovery Act Funding with a total project value of $8,032,736. Utility Rate Schedules Grid-background.png commercial electric heat rate Commercial commercial general service - single phase Commercial commercial general service - three phase Commercial


Codington-Clark Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Codington-Clark Elec Coop, Inc Codington-Clark Elec Coop, Inc Jump to: navigation, search Name Codington-Clark Elec Coop, Inc Place South Dakota Utility Id 3850 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 3 PH Large Industrial 5/7 Large Power Industrial Irrigation Industrial Residential Residential Residential - Electric Heat(Separate Meter) Residential Security Lights Lighting Average Rates Residential: $0.0828/kWh Commercial: $0.0827/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"


Natchez Trace Elec Power Assn | Open Energy Information  

Open Energy Info (EERE)

Natchez Trace Elec Power Assn Natchez Trace Elec Power Assn Jump to: navigation, search Name Natchez Trace Elec Power Assn Place Mississippi Utility Id 13227 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service (1001 kW-5000kW) Industrial General Service (50 kW and Under) Commercial General Service (51 kW-1000 kW) Commercial Outdoor Lighting HPS 100 W Lighting Outdoor Lighting HPS 100 W Dedicated Pole Lighting Outdoor Lighting HPS 100 W Dedicated Pole & Transformer Lighting Outdoor Lighting HPS 100 W Dedicated Transformer Lighting

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Barrow Utils & Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

& Elec Coop, Inc & Elec Coop, Inc Jump to: navigation, search Name Barrow Utils & Elec Coop, Inc Place Alaska Utility Id 1276 Utility Location Yes Ownership C NERC Location AK Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Distribution Yes Activity Bundled Services Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Primary Metering ASNA/PHS Commercial Primary Metering USAF/DEW Site Commercial Primary Metering NSB Gas Fields Commercial Primary Metering NSBSD, C/O Annex Commercial Primary Metering UIC/NARL Commercial


Slash Pine Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Slash Pine Elec Member Corp Slash Pine Elec Member Corp Jump to: navigation, search Name Slash Pine Elec Member Corp Place Georgia Utility Id 17290 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Outdoor Lighting 100 Watt HPS Security Light Lighting Outdoor Lighting 1000 Watt HPS Flood Light* Lighting Outdoor Lighting 1000 Watt MH Flood Light* Lighting Outdoor Lighting 1500 Watt MH Flood Light* Lighting Outdoor Lighting 175 Watt HPS Security Light Lighting Outdoor Lighting 250 Watt HPS Security Light Lighting


Canadian Valley Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Valley Elec Coop, Inc Valley Elec Coop, Inc Jump to: navigation, search Name Canadian Valley Elec Coop, Inc Place Oklahoma Utility Id 2911 Utility Location Yes Ownership C NERC Location SPP Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Irrigation-Rate I Industrial Lage Power-2 ,Distribution Service Commercial Lage Power-2 ,Secondary Service Commercial Large Power -Rate LP,Distribution Serivce Commercial Large Power-2 Commercial Residential - Rate A, Single Phase Residential Residential - Rate A, Three Phase Residential Security Lighting 1000Watt MH Lighting


Prentiss County Elec Pwr Assn | Open Energy Information  

Open Energy Info (EERE)

Prentiss County Elec Pwr Assn Prentiss County Elec Pwr Assn Jump to: navigation, search Name Prentiss County Elec Pwr Assn Place Mississippi Utility Id 15334 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Power GSA 1 (50 kW and Under) CT Metered Single-Phase Commercial General Power GSA 1 (50 kW and Under) Multi-Phase Commercial General Power GSA 1 (50 kW and Under) Single-Phase Commercial General Power GSA 2 (51 kW - 1000 kW) Commercial General Power GSA 3 (1001 kW - 5000 kW) Industrial


South Louisiana Elec Coop Assn | Open Energy Information  

Open Energy Info (EERE)

Elec Coop Assn Elec Coop Assn Jump to: navigation, search Name South Louisiana Elec Coop Assn Place Louisiana Utility Id 17565 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes RTO SPP Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Camp or Remote Service Residential Farm, Home or Residential Residential High Load Factor Incentive Service Industrial Large Power Service - Commercial Commercial Large Power Service - Industrial Industrial Large Power Service Time-of-Day "A" Industrial Large Power Service Time-of-Day "B" Industrial


Four County Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

County Elec Member Corp County Elec Member Corp Jump to: navigation, search Name Four County Elec Member Corp Place North Carolina Utility Id 6640 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service - Single Phase Commercial General Service - Three Phase Commercial Large Power Service Commercial Residential Service - All Electric - Single Phase Residential Residential Service - All Electric - Three Phase Residential Residential Service - Single Phase Residential Residential Service - Three Phase Residential


Pemiscot-Dunklin Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Pemiscot-Dunklin Elec Coop Inc Pemiscot-Dunklin Elec Coop Inc Jump to: navigation, search Name Pemiscot-Dunklin Elec Coop Inc Place Missouri Utility Id 14712 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Large Power Service Commercial Cotton Gin Rate Industrial Industrial Industrial Irrigation Multi-Phase (112.5 kVA) Commercial Irrigation Multi-Phase (150 kVA) Commercial Irrigation Multi-Phase (225 kVA) Commercial Irrigation Multi-Phase (51 kVA-100 kVA) Commercial Irrigation Multi-Phase (under 50 kVA) Commercial


Central Hudson Gas & Elec Corp | Open Energy Information  

Open Energy Info (EERE)

Hudson Gas & Elec Corp Hudson Gas & Elec Corp Jump to: navigation, search Name Central Hudson Gas & Elec Corp Place New York Utility Id 3249 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes ISO NY Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Bundled Services Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png DS-IN 85 Watt (acorn Decorative) Lighting DS-MH 175 Watt (acorn Decorative) Lighting


Deep East Texas Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Texas Elec Coop Inc Texas Elec Coop Inc Jump to: navigation, search Name Deep East Texas Elec Coop Inc Place Texas Utility Id 4975 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes NERC SPP Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Service Commercial Large Power Service Industrial Non-Municipal Pumping Service Commercial Residential Service Residential Security Lights(Metered) Lighting Security Lights(Non-Metered) Lighting Wholesale Power to Cities Industrial Average Rates Residential: $0.0967/kWh


Tipmont Rural Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Tipmont Rural Elec Member Corp Tipmont Rural Elec Member Corp Jump to: navigation, search Name Tipmont Rural Elec Member Corp Place Indiana Utility Id 18940 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes ISO Other Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Ornamental Services- 100w HPS Colonial w/Pinto Post Lighting Ornamental Services- 100w HPS Contempo w/Pinto Post Lighting Ornamental Services- 150w HPS Contempo w/Pinto Post Lighting Ornamental Services- 175w MV Contempo w/Pinto Post Lighting


Presque Isle Elec & Gas Coop | Open Energy Information  

Open Energy Info (EERE)

Elec & Gas Coop Elec & Gas Coop Jump to: navigation, search Name Presque Isle Elec & Gas Coop Place Michigan Utility Id 15340 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes ISO MISO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Controlled Heating Residential Customer Owned Backup Generation Commercial General Service - Single Phase Commercial General Service - Single Phase(Oil Related Accounts) Commercial General Service - Three Phase Commercial General Service - Three Phase(Oil Related Accounts) Commercial Green/Renewable Energy Rider


Duck River Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Duck River Elec Member Corp Duck River Elec Member Corp Jump to: navigation, search Name Duck River Elec Member Corp Place Tennessee Utility Id 5399 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Rate (GSA-1) Commercial RS Residential Average Rates Residential: $0.0939/kWh Commercial: $0.1030/kWh Industrial: $0.0719/kWh The following table contains monthly sales and revenue data for Duck River Elec Member Corp (Tennessee). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS


xxxx xxxx x 4147 f xx xxxx xxx xxxx elec xxxx xxxx xxxxx 191.3 ...  

Science Conference Proceedings (OSTI)

... ebxd fayo b 4433 f 20 elec tar same elec 60.91 22.43 225.1 224.0 232.4 ebxe fayp a 4235 f 22 carb tar diff elec 59.01 21.07 241.1 227.6 224.9 ebxf ...



Copper Valley Elec Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Copper Valley Elec Assn, Inc Copper Valley Elec Assn, Inc Place Alaska Utility Id 4329 Utility Location Yes Ownership C NERC Location AK Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Copper River Basin large commercial Commercial Copper River Basin small commercial Commercial Copper River Basin Residential Residential Valdez Residential Residential Valdez large commercial Commercial Valdez small commercial Commercial Average Rates Residential: $0.2520/kWh Commercial: $0.2150/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"


Lamar County Elec Coop Assn | Open Energy Information  

Open Energy Info (EERE)

Lamar County Elec Coop Assn Lamar County Elec Coop Assn Place Texas Utility Id 10649 Utility Location Yes Ownership C NERC Location TRE Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png LARGE COMMERCIAL Commercial LARGE COMMERCIAL PUBLIC BUILDINGS Commercial RESIDENTIAL & PUBLIC BUILDINGS Residential SMALL COMMERCIAL Commercial security light- 100 watt High Pressure Sodium Lighting security light- 400 watt Metal Halide Lighting security light-1000 watt Mercury Vapor Lighting security light-1000 watt Metal Halide Lighting security light-175 watt Mercury Vapor Lighting


Plumas-Sierra Rural Elec Coop | Open Energy Information  

Open Energy Info (EERE)

Plumas-Sierra Rural Elec Coop Plumas-Sierra Rural Elec Coop Place California Utility Id 15308 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes ISO CA Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100, 110 and 900 - Residential Farm or Home Service Residential 120 and 910 - Residential Farm or Home Service - All Electric Residential 200, 210 and 920 - Commercial and Small Power Service - Single Phase Commercial 200, 210 and 920 - Commercial and Small Power Service - Three Phase


Cherokee County Elec Coop Assn | Open Energy Information  

Open Energy Info (EERE)

Cherokee County Elec Coop Assn Cherokee County Elec Coop Assn Place Texas Utility Id 3470 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial - Single Phase Commercial Commercial - Three Phase Commercial Large Power Industrial Nonfirm Power From a Qualifying Facility Commercial Optional Large Power Time-of-Use Industrial Residential Residential Security Light Service - 100 HPS Lighting Security Light Service - 250 HPS Lighting Security Light Service - 400 MV Lighting Security Light Service- 175 MV Lighting


Ravalli County Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Ravalli County Elec Coop, Inc Ravalli County Elec Coop, Inc Place Montana Utility Id 26916 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Seasonal Service Commercial Security Light - 100 watt metered Lighting Security Light - 100 watt unmetered Lighting Single-Phase 200 AMP or Less Residential Single-Phase 320 AMP Commercial Single-Phase CT Rated AMP Commercial Single-Phase Irrigation Service Industrial Three-Phase > 50 kW Commercial Three-Phase < 50 kW Industrial Three-Phase Irrigation Service Industrial


Central Texas Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Elec Coop, Inc Elec Coop, Inc Place Texas Utility Id 3282 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Rate Schedule Commercial General Service Residential Irrigation and Large Pumping Rate Schedule Commercial Large Power Schedule Industrial Security Lights(100 Watt High Pressure Sodium) Lighting Security Lights(175 Watt Mercury Vapor ) Lighting Security Lights(250 Watt High Pressure Sodium) Lighting Security Lights(250 Watt Metal Halide (Special Application Only) Lighting


North Georgia Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Elec Member Corp Elec Member Corp Place Georgia Utility Id 13716 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Power(GSA 1- Tier 1) Commercial General Power(GSA 1- Tier 2) Commercial General Power(GSA2) Industrial Outdoor Lighting Decorative/ Pole Fluted Lighting Outdoor Lighting Decorative/ Pole Straight Lighting Outdoor Lighting HPS 100 W Lighting Outdoor Lighting HPS 200 W Lighting Outdoor Lighting HPS 400 W Lighting Outdoor Lighting LPS 135 W Lighting Outdoor Lighting LPS 55 W Lighting

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tri-County Rural Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Tri-County Rural Elec Coop Inc Tri-County Rural Elec Coop Inc Place Pennsylvania Utility Id 40290 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes RTO PJM Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 3 Phase Demand Commercial 3 Phase Demand Tri-county Commercial CP1 Commercial CP3 Industrial ETS2D Commercial ETS2M Commercial ETSDM Commercial ETSTC Commercial LP2 Commercial LP3 Industrial NCP1 Residential Residential Residential 2C Residential Residential 3C Residential Residential 4C Residential Residential Tri-County Residential Seasonal Budget Commercial


Blue Ridge Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Blue Ridge Elec Member Corp Blue Ridge Elec Member Corp Place North Carolina Utility Id 1889 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Cogeneration and Independent Power Porducers Industrial General Service - Single-Phase Commercial General Service - Three-Phase Commercial General Service Small Commercial - Single-Phase Commercial General Service Small Commercial - Three-Phase Commercial Growth Zone Pricing Industrial Industrial Economic Development Textile Industrial


Tri-County Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Tri-County Elec Member Corp Tri-County Elec Member Corp Place Georgia Utility Id 18956 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Church Demand - Single Phase Commercial Church Demand - Single Phase* Commercial Church Demand - Three Phase Commercial Church Demand - Three Phase* Commercial Church Service Basic Nondemand Commercial Church Service Electric NonDemand General Service Demand - Single Phase Industrial General Service Demand - Single Phase* Commercial General Service Demand - Three Phase Industrial


Southwest Texas Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Elec Coop, Inc Elec Coop, Inc Place Texas Utility Id 17693 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Single Phase Residential General Service Three Phase Residential Irrigation Commercial Large Power Service Industrial Large Power Service - Primary Service Discount Large Power- Over 1000KW Industrial Standby Service Primary Delivery Commercial Standby Service Secondary Delivery Commercial Average Rates Residential: $0.1350/kWh Commercial: $0.1290/kWh Industrial: $0.0762/kWh


Concho Valley Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search Name Concho Valley Elec Coop Inc Place Texas Utility Id 4146 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes ISO Ercot Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Farm and Home Service-Electirc Home Heating Residential Average Rates Residential: $0.1340/kWh Commercial: $0.1020/kWh Industrial: $0.0750/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Concho_Valley_Elec_Coop_Inc&oldid=4105


Panola-Harrison Elec Coop, Inc (Louisiana) | Open Energy Information  

Open Energy Info (EERE)

Louisiana) Louisiana) Jump to: navigation, search Name Panola-Harrison Elec Coop, Inc Place Louisiana Utility Id 14424 References EIA Form EIA-861 Final Data File for 2010 - File2_2010[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.0824/kWh Commercial: $0.0844/kWh Industrial: $0.0737/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File2_2010" Retrieved from "http://en.openei.org/w/index.php?title=Panola-Harrison_Elec_Coop,_Inc_(Louisiana)&oldid=412754" Categories: EIA Utility Companies and Aliases Utility Companies Organizations Stubs What links here


Mountain View Elec Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Mountain View Elec Assn, Inc Mountain View Elec Assn, Inc Place Colorado Utility Id 13058 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 16.01 RESIDENTIAL RATE Residential 16.05 RESIDENTIAL TIME OF DAY SERVICE RATE Residential 18.40 SMALL POWER RATE Commercial 18.60 LARGE POWER RATE Commercial 18.61 LARGE POWER - PRIMARY METERING RATE Commercial 18.62 LARGE POWER - LOAD MANAGEMENT RATE Commercial 18.63 LARGE POWER - LOAD MANAGEMENT - PRIMARY METERING RATE Commercial 18.64 GENERAL POWER RATE Industrial


South River Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

South River Elec Member Corp South River Elec Member Corp Place North Carolina Utility Id 17572 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large General Service Industrial Large General Time-of-Day Service Industrial Medium General Service Single Phase Commercial Medium General Service TOD Single Phase Commercial Medium General Service TOD Three Phase Commercial Medium General Service Three Phase Commercial Outdoor Lighting 100 W HPS, pendant Lighting Outdoor Lighting 250-Watt High Pressure Sodium, flood Lighting


Central Missouri Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Inc Inc Jump to: navigation, search Name Central Missouri Elec Coop Inc Place Missouri Utility Id 3268 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Automatic Outdoor Lighting Lighting Automatic Outdoor Lighting w/ Transformer Lighting Residential Single-Phase Residential Average Rates Residential: $0.0893/kWh Commercial: $0.0890/kWh Industrial: $0.0540/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Central_Missouri_Elec_Coop_Inc&oldid=409199


Tri-County Elec Member Corp (Tennessee) | Open Energy Information  

Open Energy Info (EERE)

Tri-County Elec Member Corp Tri-County Elec Member Corp Place Tennessee Utility Id 19162 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 Watt HPS Lighting 100 Watt Induction Lighting 1000 Watt MH Lighting 103 Watt LED Lighting 175 Watt MV Lighting 200 Watt HPS Lighting 250 Watt HPS Lighting 400 Watt HPS Lighting 400 Watt MH Lighting 400 Watt MV Lighting 51 Watt LED Lighting 85 Watt Induction Lighting GSA-Part 1 Commercial GSA-Part 2 Commercial GSA-Part 3 Industrial Residential Residential Average Rates


Paulding-Putman Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Paulding-Putman Elec Coop, Inc Paulding-Putman Elec Coop, Inc Place Ohio Utility Id 14599 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes RTO PJM Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Generator Station Service Industrial Power Service-1 Industrial Industrial Service Power 2 Industrial Large Power Off Peak Service Industrial Large Power Service Industrial Large Power Stand-by Service Industrial Municipal Streert Lights 100 W Lighting Outdoor & Street Light 100 W (Energy Only-Unmetered, Owned and Maintained by Member) Lighting Outdoor & Street Light 175 W (Energy Only-Unmetered; Owned and Maintained


United Rural Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

United Rural Elec Member Corp United Rural Elec Member Corp Place Indiana Utility Id 19443 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png GS-1 - Single Phase General Service Rate Commercial GS-3 - Three Phase General Service Rate Commercial IP - Industrial Power Rate Industrial LC - Large Commerical Rate Commercial NM - Non Metered Service RF- Residential and Farm Rate Residential RSS - Residential Seasonal Rate Residential SC - School and Church Rate Commercial SL - Security Light Rate 1000W(ON EXISTING POLE) Lighting


Arkansas Valley Elec Coop Corp | Open Energy Information  

Open Energy Info (EERE)

Arkansas Valley Elec Coop Corp Arkansas Valley Elec Coop Corp Place Arkansas Utility Id 817 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Farm and Home Service- Single Phase Residential Farm and Home Service- Three Phase Residential Large Power- 2 Commercial Large Power-1 Commercial Security Light Service (1000 W HPS) Lighting Security Light Service (175 W MVL/ 100 W HPS) Lighting Security Light Service (400 W HPS) Lighting Security Light Service (400 W MVL/ 250 W HPS) Lighting


Bedford Rural Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Bedford Rural Elec Coop, Inc Bedford Rural Elec Coop, Inc Place Pennsylvania Utility Id 40221 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes RTO PJM Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Commercial Commercial Large Commercial Interruptible Commercial Large Commercial Power Commercial Off Peak Rider for DUFEL Commercial Off Peak Rider for ETSTR Commercial Outdoor lighting 1000w HPS Lighting Outdoor lighting 1000w Mercury Vapor Lighting Outdoor lighting 100w HPS Lighting Outdoor lighting 175w Mercury Vapor Lighting Outdoor lighting 250w HPS Lighting


Central Valley Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Valley Elec Coop, Inc Valley Elec Coop, Inc Place New Mexico Utility Id 3287 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Cotton Gin Rate Industrial Irrigation Rate Large Commercial up to 1000 kW Commercial Large Power Service Greater 1000 kW Industrial Oil Well Rate Industrial Renewable Energy Rate Rider Residential Rate Residential SL- 1000 Watt MV 425 kWh (Steele Pole Overhead) Lighting SL- 1000 Watt MV 425 kWh (Steele Pole Underground) Lighting


Houston County Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Houston County Elec Coop Inc Houston County Elec Coop Inc Place Texas Utility Id 8898 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes Activity Transmission Yes Activity Distribution Yes Activity Retail Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial CG Large Power Commercial Industrial CG Large Power Industrial Large Commercial (LP1) Commercial Large Commercial (LP1)-Primary Service Commercial Large Commercial (LP2) Commercial Large Commercial-Primary Service (LP2) Commercial Residential Residential Residential Primary Service Residential Seasonal Residential


North Arkansas Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

North Arkansas Elec Coop, Inc North Arkansas Elec Coop, Inc Place Arkansas Utility Id 13676 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Power Off-Peak Commercial Large Power Service Commercial Large Power Service-Optional Commercial Residential and Small Commercial: Daily Service Availability - 10 Residential Residential and Small Commercial: Daily Service Availability - 30 Residential Security and Street Lighting: 1,000W MVL Lighting Security and Street Lighting: 1,500W MVL Lighting


Hamilton County Elec Coop Assn | Open Energy Information  

Open Energy Info (EERE)

Hamilton County Elec Coop Assn Hamilton County Elec Coop Assn Place Texas Utility Id 7979 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Outdoor Lighting 150-Watt HPS Lighting Outdoor Lighting 175-Watt MV Lighting Outdoor Lighting 400-Watt HPS Lighting Outdoor Lighting 400-Watt MV Lighting Rate 01 All Non-Residential Under 50kw, Three Phase Commercial Rate 01 Non-Residential Commercial Rate 01 Residential Residential Rate 02 All Non-Residential Over 50kw Commercial Average Rates Residential: $0.1250/kWh


Delaware County Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

County Elec Coop Inc County Elec Coop Inc Place New York Utility Id 5021 Utility Location Yes Ownership C NERC Location NPCC NERC NPCC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service-Single Phase(Residential Service Class #2) Residential General Service-Single Phase(Residential Service class #1) Residential Large CommerciaL (SC-4B-; <25 kw) Commercial Large Commercial(> 25kW) Industrial Public Building Commercial Security Lights (40W Unit LED-Unmetered) Lighting Security Lights(100 W HPS-Unmetered) Lighting Small Commercial (SC-3) Commercial


Central Florida Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Central Florida Elec Coop, Inc Central Florida Elec Coop, Inc Place Florida Utility Id 3245 Utility Location Yes Ownership C NERC Location FRCC NERC FRCC Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Rate Schedule GSD- General Service Demand Commercial Rate Schedule GSND Single Phase- General Service Non-Demand Commercial Rate Schedule GSND Three Phase- General Service Non-Demand Residential Rate Schedule GST- General Service Time of Use Commercial Rate Schedule OL- Outside Lighting (100 W HPS) Lighting Rate Schedule OL- Outside Lighting (1000 W MV) Lighting

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Denton County Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Denton County Elec Coop, Inc Denton County Elec Coop, Inc Place Corinth, Texas Utility Id 5078 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes ISO Ercot Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] SGIC[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Rate Commercial Commercial-TOU (Demand Metered Customers) Commercial Commercial-TOU (Non-Coincident Peak Demand Charge) Commercial Commercial-TOU (Non-Demand Metered Customers) Residential Industrial Rate- TOU Industrial Industrial Rates Industrial Public Building Rate (1) Residential Public Building Rate (2) Residential Public Building-TOU Residential


Okanogan County Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

County Elec Coop, Inc County Elec Coop, Inc Place Washington Utility Id 14074 Utility Location Yes Ownership C NERC Location WECC Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 2nd Meter Rate (Under 5KW/500KWH) Commercial G1/G2 No Demand - Commercial Commercial G1/G2 No Demand - Residential Residential General Service 1 (G1) Residential Residential General Service 1 (G1)Commercial Commercial General Service 2 (G2)Commercial Commercial General Service 2 (G2)Residential Residential General Service 3 (G3) - Residential Residential


North Central Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

North Central Elec Coop, Inc North Central Elec Coop, Inc Place Ohio Utility Id 13693 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Residential Rate Residential Residential TOD Residential Average Rates Residential: $0.1080/kWh Commercial: $0.1040/kWh Industrial: $0.0570/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" ↑ "Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data"


Wharton County Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Wharton County Elec Coop, Inc Wharton County Elec Coop, Inc Place Texas Utility Id 20472 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes ISO Ercot Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial - LP3 Commercial Commercial and Small Power Service Commercial Flood Light Fixtures-1000 w Mercury, Metallic or HPS Lighting Flood Light Fixtures-400 w Mercury, Metallic or HPS Lighting Industrial - LP3 Industrial Irrigation and Seasonal Agricultural Service Commercial Large Industrial Industrial Large Industrial-Primary Voltage Industrial


New York State Elec & Gas Corp | Open Energy Information  

Open Energy Info (EERE)

New York State Elec & Gas Corp New York State Elec & Gas Corp Place New York Utility Id 13511 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes NERC RFC Yes ISO NY Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Buying Distribution Yes Activity Wholesale Marketing Yes Activity Bundled Services Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png GS-2 (Small General Service ESS) Industrial


Raft River Rural Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Rural Elec Coop Inc Rural Elec Coop Inc Place Idaho Website www.rrelectric.com/index- Utility Id 22814 Utility Location Yes Ownership Cooperative NERC Location WECC NERC WECC Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png RAFT RIVER DIV: Small General, 60 AMPS and over, Single Phase Commercial RAFT RIVER DIV: Small General, 60 AMPS and over, Three Phase Commercial RAFT RIVER DIV: Large General 50KVA or greater, 60 AMPS or over Commercial RAFT RIVER DIV: Small General, Less than 60 AMPS, Single Phase Commercial RAFT RIVER DIV: Small General, Less than 60 AMPS, Three Phase Commercial


Southern Pine Elec Power Assn | Open Energy Information  

Open Energy Info (EERE)

Pine Elec Power Assn Pine Elec Power Assn Place Mississippi Utility Id 17647 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Agriculture/Farm Multi-Phase Commercial Commercial General Service (Under 75 kVA) Commercial Commercial Large General Service (75 kVA - 1000 kVA) Commercial Commercial/Small power Commercial Distributed Generation Rider Commercial Industrial General Service (Under 75 kVA) Industrial Industrial Large General Service (75 kVA - 1000 kVA) Primary Voltage


Northwestern Wisconsin Elec Co (Minnesota) | Open Energy Information  

Open Energy Info (EERE)

Minnesota) Minnesota) Jump to: navigation, search Name Northwestern Wisconsin Elec Co Place Minnesota Utility Id 13815 References Energy Information Administration.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1370/kWh Commercial: $0.1440/kWh The following table contains monthly sales and revenue data for Northwestern Wisconsin Elec Co (Minnesota). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS


Golden Valley Elec Assn Inc | Open Energy Information  

Open Energy Info (EERE)

Valley Elec Assn Inc Valley Elec Assn Inc Place Alaska Utility Id 7353 Utility Location Yes Ownership C NERC Location AK Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png GS-1 General Service Commercial GS-2 (P) Large General Service Primary Industrial GS-2 (S) Large General Service Secondary Industrial GS-3 Industrial Service Industrial Residential Residential


Morgan County Rural Elec Assn | Open Energy Information  

Open Energy Info (EERE)

Morgan County Rural Elec Assn Morgan County Rural Elec Assn Place Colorado Utility Id 12860 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Air Force Facilities - Rate Code 20 Commercial INDUSTRIAL Rate Codes 81 Industrial INDUSTRIAL Rate Codes 82 Industrial INDUSTRIAL Rate Codes 83 Industrial INDUSTRIAL Rate Codes 84 Industrial Irrigation 1 - Rate Codes 130, 131 and 132 Commercial Large Power - Rate Codes 50, 51, 53, 54 & 56 Industrial Residential - Rate Codes 01, 03, 60 Residential Residential Time-Of-Use - Rate Code 07 Residential


Raft River Rural Elec Coop Inc (Utah) | Open Energy Information  

Open Energy Info (EERE)

Inc (Utah) Inc (Utah) Jump to: navigation, search Name Raft River Rural Elec Coop Inc Place Utah Utility Id 22814 References EIA Form EIA-861 Final Data File for 2010 - File2_2010[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.0830/kWh Commercial: $0.0629/kWh Industrial: $0.0474/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File2_2010" Retrieved from "http://en.openei.org/w/index.php?title=Raft_River_Rural_Elec_Coop_Inc_(Utah)&oldid=412776" Categories: EIA Utility Companies and Aliases Utility Companies Organizations Stubs What links here


Elec District No. 5 Maricopa C | Open Energy Information  

Open Energy Info (EERE)

District No. 5 Maricopa C District No. 5 Maricopa C Jump to: navigation, search Name Elec District No. 5 Maricopa C Place Arizona Utility Id 49808 Utility Location Yes Ownership P NERC Location WECC NERC WECC Yes Activity Buying Transmission Yes Activity Buying Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Industrial: $0.0711/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Elec_District_No._5_Maricopa_C&oldid=410636" Categories:


G Ge Get Get E Get El Get Ele Get Elec Get Elect Get Electr Get ...  

Science Conference Proceedings (OSTI)

G. Ge. Get. Get E. Get El. Get Ele. Get Elec. Get Elect. Get Electr. Get Electri. Get Electrif. Get Electrifi. Get Electrifie. Get Electrified. Get Electrified Electronic...


Raft Rural Elec Coop Inc (Utah) | Open Energy Information  

Open Energy Info (EERE)

Utah Utah Utility Id 22814 References Energy Information Administration.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available The following table contains monthly sales and revenue data for Raft Rural Elec Coop Inc (Utah). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS 2009-03 26 442 337 7 139 40 101 5 254 134 586 631 2009-02 26 447 337 7 148 43 15 5 254 48 600 634


Tri-County Elec Member Corp (Kentucky) | Open Energy Information  

Open Energy Info (EERE)

Corp (Kentucky) Corp (Kentucky) Jump to: navigation, search Name Tri-County Elec Member Corp Place Kentucky Utility Id 19162 References EIA Form EIA-861 Final Data File for 2010 - File2_2010[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 Watt HPS Lighting 100 Watt Induction Lighting 1000 Watt MH Lighting 103 Watt LED Lighting 175 Watt MV Lighting 200 Watt HPS Lighting 250 Watt HPS Lighting 400 Watt HPS Lighting 400 Watt MH Lighting 400 Watt MV Lighting 51 Watt LED Lighting 85 Watt Induction Lighting GSA-Part 1 Commercial GSA-Part 2 Commercial GSA-Part 3 Industrial Residential Residential Average Rates Residential: $0.0941/kWh Commercial: $0.1050/kWh


French Broad Elec Member Corp (Tennessee) | Open Energy Information  

Open Energy Info (EERE)

Tennessee) Tennessee) Jump to: navigation, search Name French Broad Elec Member Corp Place Tennessee Utility Id 6784 References EIA Form EIA-861 Final Data File for 2010 - File2_2010[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Generation Single Phase Commercial Commercial Generation Three Phase Commercial Large Power Customer Industrial Residential Customer Residential Residential FlexPay Customer Residential Residential Generation Residential Security Light 175 W Lighting Security Light 400 W Lighting Small Commercial Customer Commercial Small Commercial Customer Three Phase Commercial Street Lighting Service 175 W Mercury Lighting


Coleman County Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Coop, Inc Coop, Inc Jump to: navigation, search Name Coleman County Elec Coop, Inc Place Texas Utility Id 3938 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial L/P Commercial Commercial L/P With Primary Metering Commercial Cotton Gin Commercial Idle Services Single Phase Commercial Idle Services Three Phase Commercial Irrigation Commercial Oil Field Commercial Oil Field L/P Commercial Oil Field L/P with primary metering Commercial Residential Residential Residential Wind Generation Residential


Doniphan Elec Coop Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Assn, Inc Assn, Inc Jump to: navigation, search Name Doniphan Elec Coop Assn, Inc Place Kansas Utility Id 5334 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Large (GSL-90) Commercial General Service Large, City of Severance Commercial General Service Small (GSS-90) Commercial General Service Small, City of Severance Commercial Mercury Vapor Lighting (MVL 90) (175 W Unmetered Mercury Vapor) Lighting Mercury Vapor Lighting (MVL 90) (175 W metered Mercury Vapor) Lighting


Suwannee Valley Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Inc Inc Jump to: navigation, search Name Suwannee Valley Elec Coop Inc Place Florida Utility Id 18360 Utility Location Yes Ownership C NERC Location FRCC NERC FRCC Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Large Demand 500 kW or greater Industrial General Large Demand Time of Use Industrial General Service (Optional Time of Use) Commercial General Service (Renewable Anerobic Digestor) Commercial General Service Demand 50kW to 499kW Industrial General Service Non-Demand Commercial Outdoor Lighting HPS 100 W Lighting


Public Service Elec & Gas Co | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search Name Public Service Elec & Gas Co Place New Jersey Utility Id 15477 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes Activity Transmission Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 COBRA HEAD CUT OFF TYPE III HP Lighting 100 CORA HEAD H.P. Commercial 100 DELUXE ACORN H.P Lighting 100 FRANKIN PARK TYPE IV H.P Commercial 100 NEW XFORD BLACK TYPE III H.P Commercial 100 POST-TOP TOWN & COUNTRY Lighting

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Alcorn County Elec Power Assn | Open Energy Information  

Open Energy Info (EERE)

Power Assn Power Assn Jump to: navigation, search Name Alcorn County Elec Power Assn Place Mississippi Utility Id 276 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service (1001 kW-5000 kW) Industrial General Service (50 kW and Under) Commercial General Service (51 kW-1000 kW) Industrial Outdoor Lighting HPS 100 W Lighting Outdoor Lighting HPS 250 W Lighting Outdoor Lighting MH 400 W Lighting Outdoor Lighting MV 175 W Lighting Residential Residential Average Rates Residential: $0.0959/kWh


Duncan Valley Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search Name Duncan Valley Elec Coop, Inc Place Arizona Utility Id 5438 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes ISO Other Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Schedule LS - Private Area Lighting Service(100 and 175 watt mercury and sodium vapor) Lighting Schedule LS - Private Area Lighting Service with pole(100 and 175 watt mercury and sodium vapor) Lighting Schedule PSHL - Public Street & Highway Lighting - 100W Lamp Lighting Schedule PSHL - Public Street & Highway Lighting - 175W Lamp Lighting


North Georgia Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

EMC) EMC) Jump to: navigation, search Name North Georgia Elec Member Corp Place Georgia Utility Id 13716 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Power(GSA 1- Tier 1) Commercial General Power(GSA 1- Tier 2) Commercial General Power(GSA2) Industrial Outdoor Lighting Decorative/ Pole Fluted Lighting Outdoor Lighting Decorative/ Pole Straight Lighting Outdoor Lighting HPS 100 W Lighting Outdoor Lighting HPS 200 W Lighting Outdoor Lighting HPS 400 W Lighting Outdoor Lighting LPS 135 W Lighting


Singing River Elec Pwr Assn (Mississippi) | Open Energy Information  

Open Energy Info (EERE)

Assn (Mississippi) Assn (Mississippi) Jump to: navigation, search Name Singing River Elec Pwr Assn Place Mississippi Utility Id 17252 Utility Location Yes Ownership C NERC Location SERC NERC ERCOT Yes NERC SERC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1]Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Delivery Point Service (Over 2500 kW) Commercial Commercial General Service (25 kw - 249 kW) Commercial Commercial General Service (25 kw - 249 kW) Primary Voltage Commercial Commercial Large General Service (250 kW - 749 kW) Commercial


Ark Valley Elec Coop Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Assn, Inc Assn, Inc Jump to: navigation, search Name Ark Valley Elec Coop Assn, Inc Place Kansas Utility Id 40208 Utility Location Yes Ownership C NERC Location SPP Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Irrigation Load Management Service Industrial Irrigation Service Industrial Single Phase Service Commercial Single Phase Water-Source Heat Pump Commercial Three Phase Service Commercial Average Rates Residential: $0.1380/kWh Commercial: $0.1240/kWh Industrial: $0.0954/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"


Paulding-Putman Elec Coop, Inc (Indiana) | Open Energy Information  

Open Energy Info (EERE)

Indiana) Indiana) Jump to: navigation, search Name Paulding-Putman Elec Coop, Inc Place Indiana Utility Id 14599 References EIA Form EIA-861 Final Data File for 2010 - File2_2010[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Industrial Power Service-1 Industrial Industrial Service Power 2 Industrial Large Power Service Industrial Large Power Stand-by Service Industrial Outdoor & Street Light 100 W (Energy Only-Unmetered, Owned and Maintained by Member) Lighting Outdoor & Street Light 175 W (Energy Only-Unmetered; Owned and Maintained by Member) Lighting Outdoor & Street Light 400 W ( Energy Only-Unmetered, Owned and Maintained


Raft Rural Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Inc Inc Place Idaho Utility Id 22814 References Energy Information Administration.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available The following table contains monthly sales and revenue data for Raft Rural Elec Coop Inc (Idaho). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS 2009-03 142 2,285 1,240 126 3,114 290 313 75 879 581 5,474 2,409 2009-02 136 2,201 1,240 135 3,097 290 104 47 878 375 5,345 2,408


Raft Rural Elec Coop Inc (Nevada) | Open Energy Information  

Open Energy Info (EERE)

Nevada Nevada Utility Id 22814 References Energy Information Administration.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available The following table contains monthly sales and revenue data for Raft Rural Elec Coop Inc (Nevada). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS 2009-03 131 1,650 1,442 176 2,833 248 17 49 45 324 4,532 1,735 2009-02 151 1,899 1,441 201 3,370 248 2 5 45 354 5,274 1,734


Hess Retail Natural Gas and Elec. Acctg. (New York) | Open Energy...  

Open Energy Info (EERE)

York) Jump to: navigation, search Name Hess Retail Natural Gas and Elec. Acctg. Place New York Utility Id 22509 References EIA Form EIA-861 Final Data File for 2010 - File220101...


uring the 1990s, the elec-tricity supply industry in  

E-Print Network (OSTI)

D uring the 1990s, the elec- tricity supply industry in Latin America underwent profound, according to the Energy Information Administration, the average cost for electricity supply for a consumer by a government that wanted to introduce market-oriented reforms throughout society, electricity supply included

Rudnick, Hugh


MHK Projects/Homeowner Tidal Power Elec Gen | Open Energy Information  

Open Energy Info (EERE)

Homeowner Tidal Power Elec Gen Homeowner Tidal Power Elec Gen < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.4468,"lon":-69.6933,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}


Section 5.2.4 Absorption Cooling: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

Though an elec- tric pump is usually used (the principal exceptions being the small hotel and recreational vehicle RV re- frigerators), pump energy requirements are...



E-Print Network (OSTI)

a greater number of wood central heating than in 1963, whichthe use of wood and elec- tric supplementary heating. Suchor wood, storage heaters dependant upon the central heating

Schipper, L.




E-Print Network (OSTI)

Pines, "Program GEOTHM, a Thermodynamic Process Program forand R. L. Fulton, "The Thermodynamic and Cost Benefits of aof Elec- tric Power, Thermodynamic and Economic Design

Pope, William L.



Tri-County Elec Member Corp (North Carolina) | Open Energy Information  

Open Energy Info (EERE)

Carolina) Carolina) Jump to: navigation, search Name Tri-County Elec Member Corp Place North Carolina Utility Id 18957 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Demand from 51 kW to 1,000 kW or kWh greater than 15,000 Commercial Demand of 1000 kW or greater Industrial General Power Rate 50 kW & >15,000 Commercial Green Power Switch Residential Rate Schedule Residential Average Rates Residential: $0.0987/kWh Commercial: $0.0925/kWh Industrial: $0.0623/kWh


Remote Sensing May Provide Unprecedented Hydrological Data http://www.agu.org/eos_elec, 1999 American Geophysical Union.  

E-Print Network (OSTI)

Remote Sensing May Provide Unprecedented Hydrological Data http://www.agu.org/eos_elec, © 1999 American Geophysical Union. Remote Sensing May Provide Unprecedented Hydrological Data -- Randal D. Koster, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, Md., USA Use of remote sensing

Houser, Paul R.



Gasoline and Diesel Fuel Update (EIA)

0. Electric Power Projections for EMM Region 0. Electric Power Projections for EMM Region East Central Area Reliability Coordination Agreement 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 Electricity Generating Capacity 1/ (gigawatts) Coal Steam 84.34 84.34 84.33 84.17 83.59 82.17 81.85 81.85 81.32 81.32 81.32 81.32 81.32 Other Fossil Steam 2/ 3.83 3.83 3.83 3.83 3.83 3.83 3.83 3.83 3.81 3.81 3.81 3.81 3.81 Combined Cycle 4.24 8.72 11.97 12.95 12.95 12.95 12.95 12.95 12.91 12.91 13.96 14.60 15.67 Combustion Turbine/Diesel 13.84 19.59 21.22 21.22 21.14 21.14 21.11 21.08 18.97 19.21 19.83 19.93 20.20 Nuclear Power 7.68 7.69 7.72 7.72 7.72 7.72 7.72 7.72 7.72 7.72 7.72 7.72 7.72 Pumped Storage/Other 3/ 3.36 3.36 3.36 3.36 3.36 3.36 3.36 3.36 3.36 3.36 3.36 3.36 3.36 Fuel Cells 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Renewable Sources 4/ 1.72



Gasoline and Diesel Fuel Update (EIA)

(1 of 3) (1 of 3) East Central Area Reliability Coordination Agreement 1999- Electricity Supply and Demand 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2020 Electricity Generating Capability 1/ (gigawatts) Coal Steam 84.09 84.09 84.09 84.09 82.89 82.08 81.52 81.43 81.43 80.78 80.78 80.78 80.78 80.78 80.78 80.78 80.78 80.78 80.78 80.78 80.78 80.78 -0.2% Other Fossil Steam 2/ 4.04 4.04 4.18 4.18 4.18 4.18 4.16 4.16 4.16 4.16 4.07 4.07 4.07 4.07 4.07 4.07 4.07 4.07 4.07 4.07 4.07 4.07 0.0% Combined Cycle 0.40 0.40 0.40 0.40 0.40 2.15 4.25 7.40 9.60 12.03 13.53 14.13 15.27 16.63 17.31 18.17 19.02 19.84 21.37 23.40 24.70 25.94 22.0% Combustion Turbine/Diesel 8.73 9.24 10.62 12.50 13.29 13.66 17.59 18.45 21.99 22.17 22.94 23.11 23.34 23.54 23.86 24.15 24.83 26.18 26.73 28.53 29.21 30.61



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Lakes, Lakes, Electricity & You Why It's So Important That Lakes Are Used To Generate Electricity Why We Can Thank Our Lakes For Electricity Because lakes were made to generate electricity. Back in the mid-1940s, Congress recognized the need for better flood control and navigation. To pay for these services, Congress passed laws that started the building of federal hydroelectric dams, and sold the power from the dams under long-term contracts. Today these dams provide efficient, environmentally safe electricity for our cities and rural areas. And now these beautiful lakes are ours to enjoy. There are now 22 major man-made lakes all across the Southeast built under these federal programs and managed by the U.S. Army Corps of Engineers - lakes that help prevent flooding and harness the renewable power of water to generate electricity. Power produced at these lakes is marketed by the Elberton,



Annual Energy Outlook 2012 (EIA)

gas, and blast furnace gas for utilities; and hydrogen, sulfur, batteries, chemicals, fish oil, and spent sulfite liquor. 4 Includes conventional hydroelectric, geothermal,...

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Recharge Elec. Upgrade Type  

E-Print Network (OSTI)

battery can be plugged in to an electric outlet to be recharged. Background: PHEVs 1. How many U" cost) · Variety of upgrade packages selected--some with zero upgrades · Most popular upgrade" Price Scenario ("home recharges" only) · "Base" PHEV=$3,000 premium · Added costs for upgrades (Full

California at Davis, University of


Modeling and Control Interactive Networks  

E-Print Network (OSTI)

and disturbance-free electricity; bank- ing and finance systems depend on the robustness of elec- tric power aircraft and land and sea vessels, depend on communica- tion and energy networks. Links between the power to be a lynchpin of energy 22 IEEE Control Systems Magazine February 2002 0272-1708/02/$17.00©2002IEEE Theauthor

Amin, S. Massoud


Number 159 August 1, 2002 Development of technically and economically viable processes for the conversion and utilization of fossil fuels is a major objective of both the DOE Fossil  

E-Print Network (OSTI)

at sizes typical of larger commercial power plants. --For more information, contact: David Anna, DOE for Tokyo Elec- tric Power Company's (TEPCO) Futtsu Thermal Power Station Group No. 4 Project. Each system will be supplied by Toshiba Corporation and Hitachi Limited. The Futtsu Power Plant is scheduled to generate 1


0018-9162/00/$10.00 2000 IEEE44 Computer Toward Self-Healing  

E-Print Network (OSTI)

0018-9162/00/$10.00 © 2000 IEEE44 Computer Toward Self-Healing Infrastructure Systems V irtually on the robustness of elec- tric power, cable, and wireless telecommunications. Transportation systems, including factors and policies and human performance also affect these networks. The Complex Interactive Networks/Systems

Amin, S. Massoud


continued on p. 2 Published by Oak Ridge National Laboratory No. 2 2010  

E-Print Network (OSTI)

of each vehicle, helping meet DOE goals. In a hybrid, plug-in hybrid, and all-elec- tric car, multiple and Integration Center, drove a plug-in hybrid electric vehicle (PHEV) between ORNL and the most energy in NewYork City, ECOSaver IV hybrid vehicles manufac- tured by DesignLine (Charlotte, N.C.) and equipped


he Northwest Power Planning Council and  

E-Print Network (OSTI)

Thomas Edison invented the phonograph and 12 years before Portland would have elec- tric street lights Scien- tific Group in 1996, the National Research Council, also in 1996, and the National Fish Hatchery harvest is being recon- sidered in light of issues such as genetic impacts on wild stocks and the capacity



E-Print Network (OSTI)

. Analysis over consumers historical kWh load profile data from Uruguayan Elec- tric Company (UTE) showsIMPROVING ELECTRIC FRAUD DETECTION USING CLASS IMBALANCE STRATEGIES Mat´ias Di Martino, Federico, jmolinelli}@gmail.com Keywords: Electricity theft, Support vector machine, Optimum path forest, Unbalance


Plug-In Electric Vehicle Handbook for Electrical  

E-Print Network (OSTI)

-based fuel while driving and produce no tailpipe emissions . EVSE (electric vehicle supply equipment) deliv a PEV requires plugging in to elec- tric vehicle supply equipment (EVSE, Figure 1). There are various communicates with the vehicle to ensure that an appropriate and safe flow of electricity is supplied. EVSE



E-Print Network (OSTI)

In this course we will study and visit several local elec- tric power generation plants. We will have a two, from writ- ing and literature to history and science. We encourage you to explore new subjects, delve.O.C. House 32 12:00-2:00 The History Of Hanover And Dartmouth (8 wks) Senior Center 32 4:30-6:00 Dance

Lotko, William


Science&TechnologyHighlights As the world's lightest metal, lithium is well positioned to meet  

E-Print Network (OSTI)

of one million plug-in hybrid elec- tric vehicles onAmerican highways by 2015. Battery manufacturers commitments from the EERE's Vehicle Technologies (VTP) and Industrial Technologies (ITP) Programs manufactur- ers to make dark-colored roofs more solar-reflective. "We found that the addition of certain


Published by Oak Ridge National Laboratory No. 1 2010 The industrial sector accounts for nearly one-third of the  

E-Print Network (OSTI)

in the production of batteries for elec- tric vehicles?" To help make American battery manufacturers more com-third of the U.S. economy and nearly one-quarter of the products of global manufacturing. Industry drives the U of technologies with interested manufacturers to ensure world-class technology and products. The technologies


Sustainability Research & Development Consortium for DoD Installations  

E-Print Network (OSTI)

the architectures for the future elec- tric grid, and brought clean energy solutions to the developing world's Capabilities: Engines and engine controls Energy systems Smart grid Energy for development Advanced and Energy Conversion Laboratory Center for Contaminant Hydrology InteGrid Test & Development Laboratory


2005 Elec. Safety-rev1.pmd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 5 Electrical Safety During Excavations and Penetrations Independent Oversight Lessons Learned Report Office of Independent Oversight and Performance Assurance Office of Security and Safety Performance Assurance U. S. Department of Energy SSA Office of Security and Safety Performance Assurance OVERSIGHT Table of Contents 1.0 INTRODUCTION ........................................................................... 1 2.0 RESULTS ......................................................................................... 3 3.0 CONCLUSIONS .............................................................................. 7 4.0 OPPORTUNITIES FOR IMPROVEMENT ................................... 9 Abbreviations Used in This Report CFR Code of Federal Regulations DOE U.S. Department of Energy EM Office of Environmental Management


ELEC4705 Fall 2009 Classical Physics  

E-Print Network (OSTI)

AND PROPERTIES 5 of vector field ­ such as gas velocity or current density. It represents the source field is the existence of electrical charge i.e. flux of E throguh a closed surface charge inside. . E will induces an electric field) · According to Ampere's law a current or a time varing electric field induces

Smy, Tom


2005 Elec. Safety-rev1.pmd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of Independent Oversight and Performance Assurance ORNL Oak Ridge National Laboratory ORPS Occurrence Reporting and Processing System OSHA Occupational Safety and health...


Intro: Atomic Ref. Data Elec. Structure Calculations  

Science Conference Proceedings (OSTI)

... It consists of total energies and orbital energy ... that use the exchange-correlation energy functional of ... 4]: (1) The local-density approximation (LDA ...


2005 Elec. Safety-rev1.pmd  

NLE Websites -- All DOE Office Websites (Extended Search)

based on review of drawings and the results of surveys made with specialized location instrumentation. Once identified, the locations are marked on the ground with paint,...


National Electric Transmission Congestion Study 2009 Executive Summary  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Executive Executive Summary In the Energy Policy Act of 2005 (EPAct), Con- gress directed the U.S. Department of Energy (DOE) to conduct a study every three years on elec- tric transmission congestion and constraints within the Eastern and Western Interconnections. The American Reinvestment and Recovery Act of 2009 (Recovery Act) further directed the Secretary to in- clude in the 2009 Congestion Study an analysis of significant potential sources of renewable energy that are constrained by lack of adequate transmis- sion capacity. Based on this study, and comments concerning it from states and other stakeholders, the Secretary of Energy may designate any geographic area experiencing electric transmission capacity constraints or congestion as a national interest elec- tric transmission corridor (National Corridor). In August 2006, the Department published its first National Electric


Southwest Rural Elec Assn Inc | Open Energy Information  

Open Energy Info (EERE)

Oklahoma Oklahoma Utility Id 17681 Utility Location Yes Ownership C NERC Location SPP Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1-10 175 Watts Commercial 100 Watt HPS, No Energy Lighting 100 Watt HPS, Unmetered Lighting 1000 Watt HPS or MH, No Energy Lighting 1000 Watt HPS or MH, Unmetered Lighting 11-50 175 Watts Commercial 175 Watt MVL, No Energy Lighting 175 Watt MVL, Unmetered Lighting 250 Watt HPS or MH, No Energy Lighting 250 Watt HPS or MH, Unmetered Lighting 400 Watt HPS or MH, No Energy Lighting 400 Watt HPS or MH, Unmetered Lighting


Monroe County Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Coop, Inc Coop, Inc Place Illinois Utility Id 12803 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 3-Phase Commercial 3-Phase (Small) Commercial Dual Fuel Electric Heat Rate - Rate 0014 Commercial Electric Heat Rate (Rate 0016) Commercial Large Power Loads Commercial Rate 0030 (Single Phase)(Schedule City of Waterloo Residential) Residential Rate 0031 (Three Phase)(Schedule City of Waterloo) Residential Residential Rate #1 Commercial Schedule A- Rate 0001 Commercial

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Trinity Valley Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

18976 18976 Utility Location Yes Ownership C NERC ERCOT Yes NERC SPP Yes ISO Ercot Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Power-Commercial Commercial Large Power-Industrial Industrial Lighting-100 w HPS Lighting Lighting-250 w HPS Lighting Lighting-400 w Directional Lamp Lighting Residential Single Phase Residential Small Commercial-Single Phase Commercial Three Phase-Commercial Commercial Three Phase-Industrial Industrial Average Rates Residential: $0.1100/kWh Commercial: $0.1070/kWh Industrial: $0.0839/kWh


Monroe County Elec Power Assn | Open Energy Information  

Open Energy Info (EERE)

Power Assn Power Assn Place Mississippi Utility Id 40303 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Rate Over 50 KW Commercial Commercial Rate Under 50 KW Commercial Demand Rate Outdoor Lights -100 watt Sodium Lighting Outdoor Lights 175 watt Mercury Vapor Lighting Outdoor Lights 400 watt Sodium Lighting Residential Rate Residential Average Rates Residential: $0.0916/kWh Commercial: $0.1110/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"


Bridger Valley Elec Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Wyoming Wyoming Utility Id 2215 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Irrigation Pumping Industrial Large General Service Single Phase Industrial Large Power (350 kVA or less) Industrial Large Power (350 kVA to 2000 kVA) Industrial Large Power (Over 2000 kVA) Industrial Lighting Service-100 watt High Pressure Sodium Lighting Lighting Service-175 watt Mercury Vapor Lamp Lighting Lighting Service-250 watt High Pressure Sodium Lighting Lighting Service-400 watt Mercury Vapor Lamp Lighting



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

North America North America Regulation of International Electricity Trade prepared by North American Energy Working Group December 2002 2 The North American Energy Working Group The North American Energy Working Group (NAEW G) was established in spring of 2001 by the Canadian Minister of Natural Resources, the Mexican Secretary of Energy and the U.S. Secretary of Energy, to enhance North American energy cooperation. The Group is led by officials from Natural Resources Canada, the Mexican Secretariat of Energy, and the U.S. Department of Energy. The goals of the NAEWG are to foster communication and cooperation among the governments and energy sectors of the three countries on energy-related matters of common interest, and to enhance North American energy trade and interconnections consistent with the goal of sustainable development, for the benefit of all.


Fall River Rural Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Idaho Idaho Utility Id 6169 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Industrial General Service > 10 kW Industrial General Service* Commercial Irrigation Service Rate Commercial Irrigation Service Rate* Commercial Residential Rate Residential Small General Service Commercial Small General Service > 10 kW Commercial Small General Service* Commercial Average Rates Residential: $0.1040/kWh


Ashley Chicot Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Arkansas Arkansas Utility Id 925 Utility Location Yes Ownership C NERC Location SERC NERC SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Irrigation Commercial Large Power Industrial Large Power Primary Service Discount Industrial Optional Irrigation Commercial Outdoor Lighting- 175W Mercury Vapor Lighting Outdoor Lighting- 400W HPS Lighting Park Service Commercial Residential, Church and School Residential Residential, Church and School Electric Heat Residential Small Commercial Commercial Small Commercial with Electric Heating Commercial


Panola-Harrison Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

4424 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1a1 LinkedIn...


Buckeye Rural Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

2502 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1a1 LinkedIn...


Central Power Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Yes Ownership C NERC Location MRO NERC MRO Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for...


Summary notation: Atomic Ref. Data Elec. Struct. Cal.  

Science Conference Proceedings (OSTI)

... For example, the fully qualified path name of the data file for neutral uranium treated in the RLDA approximation will be: ...


NBS Mono115: Lab-Fixed Components of Elec. Dipole ...  

Science Conference Proceedings (OSTI)

3.1. Laboratory-Fixed Components of the Electric Dipole Moment Operator ?. ... 2.9) to the overall parity selection rule for electric dipole transitions . ...


Cass County Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Rate 200 (Small three-phase commercial) Commercial Rate 510 (Apartment, General house-Single Phase) Residential Rate 520 (Apartment, General house-Single Phase) Residential...


NIST: Physics Laboratory Brochure; Elec. Opt. Phys. Div.  

Science Conference Proceedings (OSTI)

... Experimental and theoretical studies of giant magnetoresistance for applications in sensors and recording heads. Development ...


Atomic total energies: Atomic Ref.Data Elec Struc Cal  

Science Conference Proceedings (OSTI)

... These tables contain the atomic total energies and orbital eigenvalues, for the ground electronic configuration of the elements H ... Definition of format ...


Atomic total energies: Atomic Ref. Data Elec. Struc. Cal.  

Science Conference Proceedings (OSTI)

... These tables contain the atomic total energies and orbital eigenvalues, for the ground electronic configuration of the elements H ... Definition of format ...


New Hampshire Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

9 10,994 53,021 78,260 2008-09 6,879 34,071 67,984 3,898 21,729 10,253 464 2,887 10 11,241 58,687 78,247 2008-08 7,585 38,462 67,963 4,284 24,146 10,243 472 2,861 10 12,341...


Guadalupe Valley Elec Coop Inc | Open Energy Information  

Open Energy Info (EERE)

7752 7752 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Retail Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png G-1 Single-Phase General Service Commercial G-2 All-Electric Residential G-3 Three-Phase Under 250 kW Industrial G-4 Large Power 250-1000 kW Industrial G-5 Large Power Over 1000kw Industrial Outdor lighting Metered Class A Lighting Outdor lighting Metered Class B Lighting Outdor lighting Metered Class C Lighting


Offering Songs, Festive Songs, Procesional Songs mGar-gLu, Khro-Glu, Phebsnga: Tashi Tsering's Music: Dug cher tang dro  

E-Print Network (OSTI)

Primarily a collection of folk and religious offering songs sung by a specialised class of folk singers (Emeda) in Lo. Most of these songs are sung by Tashi Tsering, the last remaining Emeda singer in Lo. In many of these songs, he accompanies...

Blumenthal, Katey


Quarterly Coal Report, October-December 1997  

Gasoline and Diesel Fuel Update (EIA)

4Q) 4Q) Distribution Category UC-950 Quarterly Coal Report October-December 1997 Energy Information Administration Office of Coal, Nuclear, Electric and Alternate Fuels U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the Department of Energy. The information contained herein should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Contacts This publication was prepared by Paulette Young under the direction of Mary K. Paull, Project Leader, Coal Data Branch, Coal and Electric Data and Renewables Division, Office of Coal, Nuclear, Elec- tric and Alternate Fuels. Questions addressing the


Quarterly Coal Report October-December 1996  

Gasoline and Diesel Fuel Update (EIA)

4Q) 4Q) Distribution Category UC-950 Quarterly Coal Report October-December 1996 Energy Information Administration Office of Coal, Nuclear, Electric and Alternate Fuels U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the Department of Energy. The information contained herein should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Contacts This publication was prepared by Paulette Young under the direction of Mary K. Paull, Acting Chief, Coal Data Branch, Coal and Electric Data and Renewables Division, Office of Coal, Nuclear, Elec- tric and Alternate Fuels. Specific information about

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Quarterly Coal Report, January-March 1998  

Gasoline and Diesel Fuel Update (EIA)

1Q) 1Q) Distribution Category UC-950 Quarterly Coal Report January-March 1998 Energy Information Administration Office of Coal, Nuclear, Electric and Alternate Fuels U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the Department of Energy. The information contained herein should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Contacts This publication was prepared by Paulette Young under the direction of Mary K. Paull, Project Leader, Coal Data Branch, Coal and Electric Data and Renewables Division, Office of Coal, Nuclear, Elec- tric and Alternate Fuels. Questions addressing the


Quarterly Coal Report, January-March 1997  

Gasoline and Diesel Fuel Update (EIA)

1Q) 1Q) Distribution Category UC-950 Quarterly Coal Report January-March 1997 Energy Information Administration Office of Coal, Nuclear, Electric and Alternate Fuels U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the Department of Energy. The information contained herein should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Contacts This publication was prepared by Paulette Young under the direction of Mary K. Paull, Acting Chief, Coal Data Branch, Coal and Electric Data and Renewables Division, Office of Coal, Nuclear, Elec- tric and Alternate Fuels. Questions addressing the


Quarterly Coal Report, July-September 1997  

Gasoline and Diesel Fuel Update (EIA)

3Q) 3Q) Distribution Category UC-950 Quarterly Coal Report July-September 1997 Energy Information Administration Office of Coal, Nuclear, Electric and Alternate Fuels U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the Department of Energy. The information contained herein should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Contacts This publication was prepared by Paulette Young under the direction of Mary K. Paull, Project Leader, Coal Data Branch, Coal and Electric Data and Renewables Division, Office of Coal, Nuclear, Elec- tric and Alternate Fuels. Questions addressing the


The Dynamics of an Electric Dipole Moment in a Stochastic Electric Field  

E-Print Network (OSTI)

The mean-field dynamics of an electric dipole moment in a deterministic and a fluctuating electric field is solved to obtain the average over fluctuations of the dipole moment and the angular mo- mentum as a function of time for a Gaussian white noise stochastic electric field. The components of the average electric dipole moment and the average angular momentum along the deterministic electric field direction do not decay to zero, despite fluctuations in all three components of the elec- tric field. This is in contrast to the decay of the average over fluctuations of a magnetic moment in a stochastic magnetic field with Gaussian white noise in all three components. The components of the average electric dipole moment and the average angular momentum perpendicular to the deterministic electric field direction oscillate with time but decay to zero, and their variance grows with time.

Band, Y B



uring the 1990s, the elec-tricity supply industry in  

E-Print Network (OSTI)

reservoir has not been replen- ished. On the other hand, to turn on a thermal plant and save water for use by an increase in actual supply, owing to the length of time required to bring new power plants -- mainly thermal plant program, in which gas prices would be guaranteed for 20 years for those plants starting

Catholic University of Chile (Universidad Católica de Chile)



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Paulina Jaramillo, Ph.D. Executive Director, RenewElec Project  

E-Print Network (OSTI)

.S.; Jaramillo, P.; Weber, C.L.; "Energy consumption in the production of high-brightness light-emitting diodes

Reddy, Raj


The modern industrial facility depends on sensitive elec-tronic equipment that can be shut down suddenly by  

E-Print Network (OSTI)

loss of power. For example, a recent agreement between Detroit Edison Company and manufacturers of motor vehicles reimburses the customer for defects in the supplier's product. This contract embraces Manufacturers want faster, more efficient machines that are more productive. The electrical utilities encour


An nual En ergy Re view 2001  

Gasoline and Diesel Fuel Update (EIA)

An nual En ergy Re view 2001 An nual En ergy Re view 2001 The An nual En ergy Re view (AER) pres ents the En ergy In for ma tion Ad min - is tra tion's his tor i cal en ergy sta tis tics. For many se ries, sta tis tics are given for ev ery year from 1949 through 2001. The sta tis tics, ex pressed in ei ther phys i cal units or Brit ish ther mal units, cover all ma jor en ergy ac tiv i ties, in - clud ing con sump tion, pro duc tion, trade, stocks, and prices, for all ma jor en - ergy com mod i ties, in clud ing fos sil fu els, elec tric ity, and re new able en ergy sources. Pub li ca tion of this re port is re quired un der Pub lic Law 95-91 (De part ment of En ergy Or ga ni za tion Act), Sec tion 205(c), and is in keep ing with re spon - si bil i ties given to the En ergy In for ma tion Ad min is tra tion un der Sec tion


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

tric-frontier-foundation-implementing Page Parking and Garage Parking in the Forrestal Garage http:energy.govmanagementoffice-managementemployee-servicesparking-and-garage...


The African wave-type electric fish,

Science Conference Proceedings (OSTI)

tric fish, performs its jamming avoidance response by relying solely upon ... cy lowers its frequency, suggesting that the fish can deter- mine the sign of the...



NLE Websites -- All DOE Office Websites (Extended Search)

of Pressure and Dissolved Gas Supersaturation on Turbine-Passed Fish Migratory and resident fish in the Columbia River Basin are exposed to stresses associated with hydroelec- tric...


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

tric-generation-and-transmission-siting-kentucky Rebate Black Hills Energy- On-Site Solar PV Rebate Program '''''Note: This program is temporarily closed while the Colorado Public...


Traveling Wave Thermoacoustic-Piezoelectric Energy Harvester: Theory and Experiment.  

E-Print Network (OSTI)

??This thesis presents a theoretical and experimental investigation of a piezoelec- tric energy harvester coupled to a traveling wave thermoacoustic engine (TWTAE). By simplifying the (more)

Roshwalb, Andrew Zvi



Clean Coal Briefs The Ohio Power Company recently  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydroelec- tric power potential is estimated to be 220 GW, but cannot meet all future energy needs. Hydro also has the disadvantage of severe environ- mental disruption and...


Characterization of an Apically Derived Epithelial Membrane Glycoprotein from Bovine Milk, Which Is  

E-Print Network (OSTI)

~ ............ RR--MQND~FU~D Cal RRL~TNSERYI N V N R R G ~ Dro ---QER .................. QNNWQK 811 825 826 840 Sar

Mather, Ian


Turk J Elec Eng & Comp Sci, Vol.18, No.5, 2010, c TUBITAK doi:10.3906/elk-0906-55  

E-Print Network (OSTI)

estimation methods will be determined based on the motor type (induction or interior permanent magnet induction and interior permanent magnet synchronous motors will be presented. The study helps the motion investigation of shaft transducerless speed and position control of ac induction and interior permanent magnet

Hava, Ahmet



E-Print Network (OSTI)

to Elec (RDSF) MSW to Elec (Oil) Source Separation *Million~----------- MSW to Elec (Oil) Source Separation(2) *D.C.Oil Bituminous (Incineration) Coal Particulates Sulphur Oxide Carbon Monoxide Hydrocarbon Nitrogen Oxide Source:

Authors, Various



Released: June 2006  

U.S. Energy Information Administration (EIA) Indexed Site

Sources (more than one may apply)" ,,,"Elec- tricity","Natural Gas","District Chilled Water",,,"Elec- tricity","Natural Gas","District Chilled Water" "All Buildings*...


Table 2.5 Household Energy Consumption and Expenditures by End ...  

U.S. Energy Information Administration (EIA)

Appliances, 2 Electronics, and Lighting : Natural Gas: Elec-tricity 3: Fuel Oil 4: LPG 5: Total: Electricity 3: Natural Gas: Elec-tricity 3: Fuel Oil ...

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Table 2.5 Household Energy Consumption and Expenditures by End Use ...  

U.S. Energy Information Administration (EIA)

Air Conditioning: Water Heating: Appliances, 2 Electronics, and Lighting : Natural Gas: Elec-tricity 3: Fuel Oil 4: LPG 5: Total: Electricity 3: Natural Gas: Elec ...


--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Energy Sources (more than one may apply) Elec- tricity Natural Gas District Chilled Water Elec- tricity Natural Gas District Chilled Water All Buildings* ......


Market failures, consumer preferences, and transaction costs in energy efficiency purchase decisions  

E-Print Network (OSTI)

determine their levelized costs per kWh saved. For any givenCFL Wattage Elec Cost per kWh Lifetime (Hours) Hours of UseAnnual Energy Cost, Elec per w/ Gas WH Water kWh Elec Elec

Sathaye, Jayant; Murtishaw, Scott



Nuclear Instruments and Methods in Physics Research A 349 (1994) 609-613 North-Holland  

E-Print Network (OSTI)

can be attributed to the results of nonuniform eletrical field near the elec- trodes. The phenomenon

Gilbert, Pupa Gelsomina De Stasio


The Future of Low Carbon Transportation Fuels  

E-Print Network (OSTI)

" Nuclear" Oil resources" Unconventional:" oil shale liquid, " oil sands" Coal resources" Transport! Elec

Kammen, Daniel M.



Office of Legacy Management (LM)

,, The ,foll.owing recommeodations were previ0nsl.y slrbmtted the May' 8, 1959 tric ' report on the initial piercing opcrations on April 14 to April 23. 1959, and April 2G to :...



U.S. Energy Information Administration (EIA) Indexed Site

Corporation","FP",-9200,-10,0,-478400,-478400 4180,"Connecticut Mun Elec Engy Coop",8,36,"Hydro Quebec Energy Savings U.S.","FP",14400,50,0,647732,647732 4180,"Connecticut Mun Elec...


News Briefs  

Science Conference Proceedings (OSTI)

... a unique infrared spectrumwith sensitivities at ... momentum transfer, total vibrational excitation, elec ... components such as methane, ethane, propane ...



Assessment of Supply Chain Energy Efficiency Potentials: A U.S. Case Study  

E-Print Network (OSTI)

heating Elec: Industrial refrigeration Petr: Agriculturalestimates for industrial HVAC, refrigeration, and lightingCommercial Refrigeration NG: Industrial process heating

Masanet, Eric



Structural Stability of Udimet-500, A Nickel-Base Superalloy  

Science Conference Proceedings (OSTI)

transmission electron microscopy, and electron ... transmission elec- tron microscopy of replicas ... nature and distribution of precipitated phases. Holding for 4...


Category:Charleston, WV | Open Energy Information  

Open Energy Info (EERE)

WV WV Jump to: navigation, search Go Back to PV Economics By Location Media in category "Charleston, WV" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Charleston WV Harrison Rural Elec Assn Inc.png SVFullServiceRestauran... 59 KB SVQuickServiceRestaurant Charleston WV Harrison Rural Elec Assn Inc.png SVQuickServiceRestaura... 60 KB SVHospital Charleston WV Harrison Rural Elec Assn Inc.png SVHospital Charleston ... 57 KB SVLargeHotel Charleston WV Harrison Rural Elec Assn Inc.png SVLargeHotel Charlesto... 57 KB SVLargeOffice Charleston WV Harrison Rural Elec Assn Inc.png SVLargeOffice Charlest... 58 KB SVMediumOffice Charleston WV Harrison Rural Elec Assn Inc.png SVMediumOffice Charles... 60 KB SVMidriseApartment Charleston WV Harrison Rural Elec Assn Inc.png


Category:Elkins, WV | Open Energy Information  

Open Energy Info (EERE)

Elkins, WV Elkins, WV Jump to: navigation, search Go Back to PV Economics By Location Media in category "Elkins, WV" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Elkins WV Harrison Rural Elec Assn Inc.png SVFullServiceRestauran... 59 KB SVQuickServiceRestaurant Elkins WV Harrison Rural Elec Assn Inc.png SVQuickServiceRestaura... 60 KB SVHospital Elkins WV Harrison Rural Elec Assn Inc.png SVHospital Elkins WV H... 57 KB SVLargeHotel Elkins WV Harrison Rural Elec Assn Inc.png SVLargeHotel Elkins WV... 57 KB SVLargeOffice Elkins WV Harrison Rural Elec Assn Inc.png SVLargeOffice Elkins W... 58 KB SVMediumOffice Elkins WV Harrison Rural Elec Assn Inc.png SVMediumOffice Elkins ... 59 KB SVMidriseApartment Elkins WV Harrison Rural Elec Assn Inc.png


FUELING THE FUTURE: Meeting Pakistan's Energy Needs in the 21st Century  

E-Print Network (OSTI)

controversy and provincial disagreements associated with storage-based hydroelec- tric power generation of the industries and ther- mal power generating units in the country, and includes 9,060 km of high pressure percent is oil. Nuclear energy accounts for only 3 percent of power generation. Current installed capacity

Vermont, University of


A Study on Energy Harvesting Aware Routing for Vibration-Motivated Wireless Sensor Networks  

E-Print Network (OSTI)

Mechanics, Shijiazhuang Railway Institute, Shijiazhuang 050043, P.R. China R. K. L. Su (B) Department the participating phases are piezoelectric and piezomag- netic (Avellaneda and Harshe 1994; Benvensite 1995; Harshe 1976) used for piezoelec- tric ceramics to magnetoelectroelastic materials. However, for piezoelectric

Lim, Sunho


American Institute of Aeronautics and Astronautics  

E-Print Network (OSTI)

and Julie A. Kangas This paper explores the characteristics (i.e. stability and performance) of transfers accelerations. The two types of capture methods we consider are capture in a distant retrograde orbit (DRO acceleration transfers to Europa from either Ganymede or from larger more distant orbits, is a complex

Hirani, Anil N.


Category:Atlantic City, NJ | Open Energy Information  

Open Energy Info (EERE)

NJ NJ Jump to: navigation, search Go Back to PV Economics By Location Media in category "Atlantic City, NJ" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Atlantic City NJ Public Service Elec & Gas Co.png SVFullServiceRestauran... 63 KB SVMidriseApartment Atlantic City NJ Public Service Elec & Gas Co.png SVMidriseApartment Atl... 62 KB SVQuickServiceRestaurant Atlantic City NJ Public Service Elec & Gas Co.png SVQuickServiceRestaura... 64 KB SVSecondarySchool Atlantic City NJ Public Service Elec & Gas Co.png SVSecondarySchool Atla... 62 KB SVStandAloneRetail Atlantic City NJ Public Service Elec & Gas Co.png SVStandAloneRetail Atl... 63 KB SVHospital Atlantic City NJ Public Service Elec & Gas Co.png


What Are the Lights on Your Surge Protector Telling You?  

Science Conference Proceedings (OSTI)

... TO place this undesirable situation in perspective, I visited three local elec- tronics and do-it-yourself stores and bought 17 different brands of TVSSs ...



U.S. Electric Utility Demand-Side Management 1994  

U.S. Energy Information Administration (EIA)

Preface. The U.S. Electric Utility Demand-Side Management report is prepared by the Coal and Electric Data and Renewables Division; Office of Coal, Nuclear, Elec-


Inefficiencies and Market Power in Financial Arbitrage: A Study of California's Electricity Markets  

E-Print Network (OSTI)

and C. Stalon (1999). Second Report on Market Issues in thePower Exchange Energy Markets. Prepared for the Federals Proposed Elec- tricity Market. Utilities Policy vol. 6,

Borenstein, Severin; Bushnell, James; Knittel, Christopher R.; Wolfram, Catherine



--No Title--  

U.S. Energy Information Administration (EIA) Indexed Site

Total Floorspace (million square feet) All Buildings* Buildings with Space Heating Space-Heating Energy Sources Used (more than one may apply) Elec- tricity Natural Gas Fuel Oil...

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



U.S. Energy Information Administration (EIA) Indexed Site

October 2006 Next CBECS will be conducted in 2007 Elec- tricity Natural Gas Fuel Oil District Heat Propane Other a All Buildings* ... 64,783...


--No Title--  

Annual Energy Outlook 2012 (EIA)

2003 Number of Buildings (thousand) All Buildings* Buildings with Space Heating Space-Heating Energy Sources Used (more than one may apply) Elec- tricity Natural Gas Fuel Oil...



E-Print Network (OSTI)

heating Elec:Industrialrefrigeration Petr:AgriculturalestimatesforindustrialHVAC,refrigeration,and lightingCommercialRefrigeration NG:Industrialprocessheating

Masanet, Eric




E-Print Network (OSTI)

were tested: or vitreous carbon, Exxon graphite- types, mostGraphite) stationary elec- Exxon Graphite Loaded Polymer (All substrates except the Exxon graphite loaded polymer were

Sutija, D.P.



Preliminary assessment of potential CDM early start projects in Brazil  

E-Print Network (OSTI)

16 XIV. Hydroelectricity Generation in the State ofFOR ELEC GENERATION HYDROELECTRICITY IN AMAPA ALCOHOL/DIESELXIV. Hydroelectricity Generation in the State of Amap

Meyers, S.; Sathaye, J.; Lehman, B.; Schumacher, K.; van Vliet, O.; Moreira, J.R.



Data:802b0cf4-dc6c-4015-9707-e4801c7be272 | Open Energy Information  

Open Energy Info (EERE)

Roosevelt County Elec Coop Inc Effective date: 20130221 End date if known: Rate name: Oil Well Pumping Service(Interruptible rate) Sector: Commercial Description: Source or...


Configuration Studies and Recommendations for the ILC Damping Rings  

E-Print Network (OSTI)

supercon- ducting device, the power consumption is primarilypower consumption of a normal-conducting electromagnetic device,power consumption for a normal-conducting elec- tromagnetic device,

Wolski, Andrzej; Gao, Jie; Guiducci, Susanna



Data:1b4dbc5e-62f8-4b40-a87e-9b5f2981026f | Open Energy Information  

Open Energy Info (EERE)

Elec Coop, Inc Effective date: 20120101 End date if known: Rate name: Outdoor & Street Light 175 W (Energy Only Owned and Maintained by Member) Sector: Lighting...


Data:9235f77b-f320-4bda-9e2e-cdf2a6f52836 | Open Energy Information  

Open Energy Info (EERE)

Elec Coop, Inc Effective date: 20120101 End date if known: Rate name: Outdoor & Street Light 400 W ( Energy Only, Owned and Maintained by Member) Sector: Lighting...


Data:Ee54db70-1d15-4877-a1f2-da46a8bc253b | Open Energy Information  

Open Energy Info (EERE)

Black Warrior Elec Member Corp Effective date: 20130901 End date if known: Rate name: Street Light Service (100 W High Pressure Sodium) Sector: Lighting Description: Source or...


Brookhaven National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

current version by checking the document effective date on the PS Training website. Brookhaven National Laboratory Photon Sciences Directorate Subject: Photon Sciences ELEC PPE -...


Evaluation of Persistence of Savings from SMUD Retrocommissioning Program  

E-Print Network (OSTI)

electricity or natural gas usage and monthly outside drycost [$] Saved cost [$] Gas usage [therm] Elec usage [kWh]11 Table 4: Actual Monthly Natural Gas Usage for

Bourassa, Norman J.; Piette, Mary A.; Motegi, Naoya




U.S. Energy Information Administration (EIA)

PHOTVL8 Photovoltaic cells used to generate elec 125- 125 $YESNO. FUELCL8 Fuel cells used to generate electricity 127- 127 $YESNO. MCROTB8 ...


Agglomeration Economies and the High-Tech Computer  

E-Print Network (OSTI)

Terminal Manuf. Other Computer Peripheral Equip. Manuf.and Testing of Elec. Computer Systems Design and RelatedData Processing Services Computer Program Services Computer

Wallace, Nancy E.; Walls, Donald



High power flip-chip light emitting diode.  

E-Print Network (OSTI)

??xiv, 74 leaves : ill. (some col.) ; 30 cm HKUST Call Number: Thesis ELEC 2004 Lai Recently, Light-emitting diodes (LEDs) are widely used in (more)

Lai, Yin Hing



Alternative Fuel News Vol. 6- No. 1, Part 1 pages 1-8  

NLE Websites -- All DOE Office Websites (Extended Search)

(but accurate). Why do more governments and businesses use ethanol, natural gas, propane, elec- tricity, and biodiesel? Not because these fuels are "alternative," but because...


Fleet purchase behavior: decision processes and implications for new vehicle technologies and fuels  

E-Print Network (OSTI)

hybrid electric and fuel cell electric vehicles (powered by alcohols, natural gas, petroleum fuels, hydrogen, and/or elec- tricity) (for history

Nesbitt, Kevin; Sperling, Dan



Fleet Purchase Behavior: Decision Processes and Implications for New Vehicle Technologies and Fuels  

E-Print Network (OSTI)

hybrid electric and fuel cell electric vehicles (powered by alcohols, natural gas, petroleum fuels, hydrogen, and/or elec- tricity) (for history

Nesbitt, Kevin; Sperling, Daniel



2007 Technology Transfer Awards  

NLE Websites -- All DOE Office Websites (Extended Search)

electrochemical reactions of the gases catalyzed by the electrode materials. An electrolytic layer of an electrolyte is formed over the elec- trodes to cover a first portion of...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

c","Investor-Owned",1439002,513084,720009,205909,"-" "4. Sioux Valley SW Elec Coop","Cooperative",543948,273406,37503,233039,"-" "5. Southeastern Electric Coop...

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

of","Public",5548651,2712976,1742137,1093538,"-" "4. Joe Wheeler Elec Member Corp","Cooperative",1567029,663987,273698,629344,"-" "5. Baldwin County El Member...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska" "1. Golden Valley Elec Assn Inc","Cooperative",1288167,304785,140257,843125,"-" "2. Chugach Electric Assn Inc","Cooperative",1169430,545123,578892,45415,"-" "3. Anchorage...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Authority","Federal",3886876,"-","-",3886876,"-" "4. Southern Pine Elec Power Assn","Cooperative",2128184,976549,334932,816703,"-" "5. Coast Electric Power Assn","Cooperative",1754...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

nvestor-Owned",16604770,6919563,4249870,5435337,"-" "3. Rappahannock Electric Coop","Cooperative",3654089,1961373,250097,1442619,"-" "4. Northern Virginia Elec...


Four-dimensional imaging of the initial stage of fast evolving plasmas Pengfei Zhu, Zhongchao Zhang, Long Chen, Jun Zheng, Runze Li et al.  

E-Print Network (OSTI)

- trons immediately.4,5 While part of these suprathermal elec- trons move inward heating more electrons suprathermal electrons generation, mo- tion of heated charge particles, and the accompanying elec- tromagnetic are all-optical pump-probe techniques, such as time-resolved optical shadowgraph,7 Faraday rotation,8

Cao, Jianming


Corrective Action Decision Document for Corrective Action Unit 322: Areas 1 and 3 Release Sites and Injection Wells Nevada Test Site, Nevada, Rev. No. 0  

SciTech Connect

This Corrective Action Decision Document has been prepared for Corrective Action Unit (CAU) 322, Areas 1 and 3 Release Sites and Injection Wells, Nevada Test Site, Nevada, in accordance with the ''Federal Facility Agreement and Consent Order'' (1996). Corrective Action Unit 322 is comprised of the following corrective action sites (CASs): (1) 01-25-01 - AST Release Site; (2) 03-25-03 - Mud Plant and AST Diesel Release; and (3) 03-20-05 - Injection Wells and BOP Shop. The purpose of this Corrective Action Decision Document is to identify and provide the rationale for the recommendation of a corrective action alternative for each CAS within CAU 322. Corrective action investigation activities were performed from April 2004 through September 2004, as set forth in the Corrective Action Investigation Plan. The purposes of the activities as defined during the data quality objectives process were: (1) Determine if contaminants of concern (COCs) are present; (2) If COCs are present, determine their nature and extent; and (3) Provide sufficient information and data to recommend appropriate corrective actions for the CASs. Analytes detected during the corrective action investigation were evaluated against appropriate preliminary action levels to identify contaminants of concern for each corrective action site. Radiological field measurements were compared to unrestricted release criteria. Assessment of the data generated from investigation activities revealed the following: (1) CAS 01-25-01 contains an AST berm contaminated with total petroleum hydrocarbons (TPH) diesel-range organics (DRO). (2) CAS 03-25-03 includes two distinct areas: Area A where no contamination remains from a potential spill associated with an AST, and Area B where TPH-DRO contamination associated with various activities at the mud plant was identified. The Area B contamination was found at various locations and depths. (3) CAS 03-25-03 Area B contains TPH-DRO contamination at various locations and depths in the area associated with the Mud Plant. (4) CAS 03-20-05 contains TPH-DRO, metals, and radiological contamination within the injection well casing soil and TPH-DRO contamination at the depth coincidental with the bottom of the injection well sump. Based on the evaluation of analytical data from the corrective action investigation, review of future and current operations in Areas 1 and 3 of the Nevada Test Site, and the detailed and comparative analysis of the potential corrective action alternatives, the following corrective actions are recommended for the Corrective Action Unit 322 CASs. Closure in Place with Administrative Controls is the preferred corrective action for the following CASs: (1) CAS 01-25-01, removal of TPH-DRO contamination would pose a significant safety hazard due to the site location. (2) CAS 03-25-03 No contamination remains at Area A (AST Berm); and thus, no further action is the preferred alternative at this part of the CAS. However at Area B, TPH-DRO contamination is varied in concentration and location and the footprint of the CAS is large, removal of contaminated ''pockets'' would be laborious and cost prohibitive. The plutonium-239 surface contamination identified at CAS 03-25-03 Area B has been removed and drummed as a best management practice. (3) CAS 03-20-05, TPH-DRO, metals, and radiological contamination are present in the injection well casing soils. Recommend corrective action includes removal of the liquid in the injection well sump (approximately 3 feet (ft) of liquid at 60 ft below ground surface), grouting the sump, and the area within the injection well casing.

Robert Boehlecke



A. At the lo B. Follow t  

E-Print Network (OSTI)

personal in 1. In the up 2. From the 3. To enrol 4. Select th 5. Enter th 6. Type in t "Search" 7. Click in, the myU nformation reco pper left hand c e menu that dro ll in classes, clic e Term for whi e 5 wi ? Go to http:// Your "Ke Search for a cla du k on "What are s on the page. , click "Return

Van Stryland, Eric


Closure Report for Corrective Action Unit 300: Surface Release Areas Nevada Test Site, Nevada  

SciTech Connect

Corrective Action Unit (CAU) 300 is located in Areas 23, 25, and 26 of the Nevada Test Site, which is located approximately 65 miles northwest of Las Vegas, Nevada. CAU 300 is listed in the Federal Facility Agreement and Consent Order of 1996 as Surface Release Areas and is comprised of the following seven Corrective Action Sites (CASs), which are associated with the identified Building (Bldg): {sm_bullet} CAS 23-21-03, Bldg 750 Surface Discharge {sm_bullet} CAS 23-25-02, Bldg 750 Outfall {sm_bullet} CAS 23-25-03, Bldg 751 Outfall {sm_bullet} CAS 25-60-01, Bldg 3113A Outfall {sm_bullet} CAS 25-60-02, Bldg 3901 Outfall {sm_bullet} CAS 25-62-01, Bldg 3124 Contaminated Soil {sm_bullet} CAS 26-60-01, Bldg 2105 Outfall and Decon Pad The Nevada Division of Environmental Protection (NDEP)-approved corrective action alternative for CASs 23-21-03, 23-25-02, and 23-25-03 is no further action. As a best management practice, approximately 48 feet of metal piping was removed from CAS 23-25-02 and disposed of as sanitary waste. The NDEP-approved corrective action alternative for CASs 25-60-01, 25-60-02, 25-62-01, and 26-60-01, is clean closure. Closure activities for these CASs included removing and disposing of soil impacted with total petroleum hydrocarbons-diesel range organics (TPH-DRO), polychlorinated biphenyls (PCBs), semivolatile organic compounds (SVOCs), and cesium (Cs)-137, concrete impacted with TPH-DRO, and associated piping impacted with TPH-DRO. CAU 300 was closed in accordance with the NDEP-approved CAU 300 Corrective Action Plan (CAP) (U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office [NNSA/NSO], 2006). The closure activities specified in the CAP were based on the recommendations presented in the CAU 300 Corrective Action Decision Document (NNSA/NSO, 2005). This Closure Report documents CAU 300 closure activities. During closure activities, approximately 40 cubic yards (yd3) of low-level waste consisting of TPH-DRO-, PCB-, and Cs-137-impacted soil and debris, approximately 7 yd3 of hydrocarbon waste consisting of TPH-DRO-impacted soil, and approximately 66 yd3 of sanitary debris consisting of soil and concrete debris were generated, managed, and disposed of appropriately. Waste minimization techniques, such as the utilization of field screening and laboratory analysis to determine the extent of excavation required, were employed during the performance of closure work.

NSTec Environmental Restoration



Design of phase-shifted hybrid silicon distributed feedback lasers  

E-Print Network (OSTI)

to the change in input electrical power (d?/dP elec ) andto change in input electrical power for different laserpower consumption and limited communication bandwidth faced by conventional electrical

Srinivasan, Sudharsanan; Fang, Alexander W; Liang, Di; Peters, Jonathan D; Kaye, Bryan; Bowers, J E



Exhibit Floor Plan  

Science Conference Proceedings (OSTI)

Jan 25, 2007 ... Tri State. Ref. SMV. Natl Elec. Carbon. Blasch. Carl Zeiss. Micro. Imaging. Mid- ... LP Royer ... New. Orleans. C&VB. Graphite. Machining. Xothermic. MetSoc ... York. Linings. Carl Zeiss. SMT. Darco. Southern. Bruno. Presezzi.



U.S. Energy Information Administration (EIA)

Avra Valley Solar AZ SUN PV Golden Valley Elec Assn Inc Eva Creek Wind EVW WND WT Gowrie Municipal Utilities Gowrie IA DFO IC High Plains Ranch II, LLC California ...


Market Share Elasticities for Fuel and Technology Choice in Home Heating and Cooling  

E-Print Network (OSTI)

Price Cap Cost Gas Heat Cap Cost Oil Heat Electric Share GasPrice Cap Cost Gas Heat Cap Cost Oil Heat 3. Summary of WorkEPRI [this study] Cap Cost Elec Heat Oil Price Income Gas

Wood, D.J.



Thermal Energy Storage for Cooling of Commercial Buildings  

E-Print Network (OSTI)

Utility Southern California Edison San Dieao Gas & Elec. Co.Salt River Project Boston Edison No Maximum No Maxime'm Noin Southern Califor- nia Edison's (SCE) service area ($50/kW

Akbari, H.




Annual Energy Outlook 2012 (EIA)

2 Pub Svc Elec and Gas Co... NJ 71,383,367 2.72 Con Edison Co. of New York Inc... NY 71,235,302 5.13 Southern California Gas Co...


Graduate Study in PhySicS and  

E-Print Network (OSTI)

-Einstein condensation, strongly coupled ultra-cold plasmas, cold collisions, the control and manipula- tion of atomic Experimental groups study membrane active proteins, membrane fusion, membrane elec- trostatics, protein folding



E-Print Network (OSTI)

and commercial uses" of oil products as given by the 1978does not tell which kinds of oils were used for which ties.other I Incl. 200El 01450-oil Thermal Elec. 350 Coal Other I

Schipper, Lee




E-Print Network (OSTI)

CONSTRAINTS Takao Hinamoto, Ken-ichi Iwata Graduate School of Engineering Hiroshima University Higashi-Hiroshima 739-8527, Japan Email: hinamoto@hiroshima-u.ac.jp Wu-Sheng Lu Dept. of Elec. and Comp. Engineering

Lu, Wu-Sheng


Ab Initio Study of C4H3 Potential Energy Surface and Reaction of Ground-State  

E-Print Network (OSTI)

car- bon in its C(3 Pj) electronic ground state with unsaturated hydrocarbon molecules are of major own. Diacetylene (butadiyne) is the simplest hydro- carbon with conjugated triple bonds and its elec

Kaiser, Ralf I.


Data:Fe96708b-7748-40ca-8991-2376f4d9635a | Open Energy Information  

Open Energy Info (EERE)

name: Shenandoah Valley Elec Coop Effective date: End date if known: Rate name: INTERIM RATE INCREASE RIDER OD-09 Sector: Description: Applicable to Rate Schedules A-10; B-10;...


Effective Electroslag Remelting of Superalloys  

Science Conference Proceedings (OSTI)

Up to 30% can be added to calcium fluoride without raising the mel-ting point. The elec- trical resistance of the CaF2-CaO system is essentially the same as CaF,.

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Buildings*","Buildings Using Any Energy  

U.S. Energy Information Administration (EIA) Indexed Site

apply)" ,,,"Elec- tricity","Natural Gas","Fuel Oil","District Heat","District Chilled Water","Propane","Other a " "All Buildings* ...",4645,4414,4404,2391,451,67,33,5...



E-Print Network (OSTI)

to the refineries. quantity of crude oil would be refined inspecify the quantities of natural gas, oil or elec- tricity.The additional oil requirement is quantities are also shown

Authors, Various



Word Pro - Untitled1  

Gasoline and Diesel Fuel Update (EIA)

Year Coal Coal Coke Net Imports Natural Gas 3 Petroleum Retail Elec- tricity 8 Total 2 Biomass 2 Distillate Fuel Oil 4 Kero- sene LPG 5 Lubri- cants Motor Gasoline 6 Petroleum Coke...


Calendar Year 2009 Program Benefits for ENERGY STAR Labeled Products  

E-Print Network (OSTI)

Res. Gas Price Oil Price Price Sources Elec. Carbon EmissionGas or Oil) Central Air Conditioner Air-Source Heat PumpGas or Oil) Central Air Conditioner Air-Source Heat Pump

Homan, Gregory K



Calendar Year 2008 Program Benefits for ENERGY STAR Labeled Products  

E-Print Network (OSTI)

Res. Gas Price Oil Price Price Sources Elec. Carbon EmissionGas or Oil) Central Air Conditioner Air-Source Heat PumpGas or Oil) Central Air Conditioner Air-Source Heat Pump

Homan, GregoryK



EFP05 -OPTIPOLYGEN Optimum integration of  

E-Print Network (OSTI)

to its significant and simulta- neous demand for process-heat, electricity and cooling, the food of elec- tricity trade and transmission, district heat trade and transmission, carbon dioxide tax


Data:4ab69f06-bfef-42d1-8a9a-165af1df0418 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: NSL-MV 100 Watt...


Data:6d4220f5-d14b-4d5c-bd9e-9508ecd7ea28 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: L-SV 400 watt...


Data:5b5c2004-f460-4a71-a15a-868ce4c149d2 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: NSL-MV 250 Watt...


Data:316315b2-9387-431d-8e30-2f8ff9b70ca2 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: LF-MH 250 Watt (...


Data:3f31d8b4-037e-4802-b06e-3bdc937e08e2 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: LF- S 70 Watt...


Data:9c50ff59-56cf-4d78-adf7-472cbf6ba726 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: LF-M 1000 Watt (...


Data:8f0a9c39-838a-4ffa-852a-520df41dc562 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: L-SV 70 Watt 344...


Data:3c410dcf-9e83-4a52-b3c9-41b182c5ca38 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: DS-IN 85 Watt...


Data:1723f49b-7eff-4702-9664-6360975cbde3 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: DS-S 400 Watt...


Data:A0c7f897-db27-4a38-abb9-17b1c9d97ca4 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: LF-MH 250 Watt...


Data:4c5236a7-b3fa-4f7d-8c3b-8471f0dc2ec0 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: DS-MH 250 Watt...


Data:0ff3c1a4-eb3f-48e2-acc0-a11d3590a5ac | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: NSL- IN 92 Watt...


Data:424c0f57-acaf-46b8-b71d-e09c01a00e8d | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: LF-S 150 Watt...


Data:A2909528-8e64-4f66-a72e-43bde8731642 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: L-SV 150 Watt 720...

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Data:992a3db3-7a64-41f2-90c3-3553866127fe | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: NSL- IN 405 Watt...


Data:155806a7-214e-4c11-a70e-f4009370e312 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: DS-MH 175 Watt...


Data:190bd977-7e91-494e-9a7e-76b3796bf050 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: DS-S 250 Watt...


Data:47084c73-0c85-4e74-947d-08a16e5a71aa | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: DS-S 250 Watt...


Data:5c2844f9-f4b2-4943-b60d-b7e2b6f58b92 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: L-SV 250 Watt...


Data:C581ba98-2b18-4a6d-a4c4-668dbef8bfa0 | Open Energy Information  

Open Energy Info (EERE)

Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Hudson Gas & Elec Corp Effective date: 20120701 End date if known: Rate name: DS-S 70 Watt...


Data:28d1d89d-f93c-428a-a1c3-88e08be03777 | Open Energy Information  

Open Energy Info (EERE)

https:cas.sharepoint.illinoisstate.edugrantsSunshotListsDATA%20ENTRY%20Needs%20V2Attachments200Jump%20River%20Elec%20Coop0075.pdf Source Parent: Comments Applicability...


Word Pro - Untitled1  

U.S. Energy Information Administration (EIA) Indexed Site

2 Liquefied petroleum gases. 3 Electricity-only and combined-heat-and-power plants whose primary business is to sell elec- tricity, or electricity and heat, to the public....


Application Programming Interface Documentation - Qb - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

SERIES NAME: MMBTU per Unit : International Paper Courtland Mill : Wood/Wood Waste Solids : All Primemovers : Quarterly SERIES ID: ELEC.PLANT.AVG_HEAT.50245-WDS-ALL.Q


Building Scale DC Microgrids  

E-Print Network (OSTI)

an increasingly familiar generation source and elec- tronicssource of ancillary services either to buffer local variable generation,sources, e.g. photovoltaic modules (PV), from other direct current (DC) generation,

Marnay, Chris



--No Title--  

Gasoline and Diesel Fuel Update (EIA)

than one may apply) Elec- tricity Natural Gas Fuel Oil District Heat District Chilled Water Propane Other a All Buildings* ... 64,783 63,343 63,307...


--No Title--  

Gasoline and Diesel Fuel Update (EIA)

than one may apply) Elec- tricity Natural Gas Fuel Oil District Heat District Chilled Water Propane Other a All Buildings* ... 4,645 4,414 4,404 2,391...


IEEE TRANSACTIONS ON INSTRUMENTATION AND MEASUREMENT, VOL. 53, NO. 4, AUGUST 2004 1113 Explosives Detection With Hard-Wired Moths  

E-Print Network (OSTI)

-powered searchlight, and elec- trical-fire initiation in nuclear reactor control rooms. He has been involved, a Lockheed Martin Com- pany, for the U.S. Department of Energy's National Nuclear Security Admin- istration is in learning theory. #12;

Daly, Kevin Charles


Aesthetic Theory and Landscape Protection: The Many Meanings of Beauty and Their Implications for the Design, Control and Protection of Vermont's Landscape  

E-Print Network (OSTI)

1984). 19. See C. ZULICK, THE VERMONT BACKROAt M \\NI--" \\NCIN Y.S 2d 235 (1976). 126. Vermont Elec. Power Co. v. Bandel,Ist Cir. 1982). 35. See VERMONT NATURAL RESOURCES COUNCIL

Brooks, Richard O.; Lavigne, Peter




Annual Energy Outlook 2012 (EIA)

Propane Elec- tricity Natural Gas Propane All Buildings* ... 4,645 801 410 457 108 64,783 22,237 13,161 15,438 1,460 Building Floorspace (Square...


Journal of Power Sources 196 (2011) 36463649 Contents lists available at ScienceDirect  

E-Print Network (OSTI)

, such as electrical vehicles (EV), including hybrid elec- trical vehicles (HEV). Recently, Li transition metal, Seattle, WA 98195, USA a r t i c l e i n f o Article history: Received 28 October 2010 Received in revised

Cao, Guozhong


Market Share Elasticities for Fuel and Technology Choice in Home Heating and Cooling  

E-Print Network (OSTI)

Oil share Elec Price Gas Price Electric Share Gas Share OilBaughman and Joskow [3] Oil Price Gas Price Lin, Hirst,and Cohn [10] Gas Price Oil Price Hartman and Hollyer [8] (

Wood, D.J.



arch layout 11.21.98  

NLE Websites -- All DOE Office Websites (Extended Search)

IMAGE imgsesl3111.jpg December noon 21 2 Annual Lighting and Total Electricity Use (kWhft 2 flooryr) with lower window Dayltg Zones Total Elec. (kWh ft2 yr) Lighting...


Obtaining attosecond X-ray pulses using a self-amplified spontaneous emission free electron laser  

E-Print Network (OSTI)

1369 (2004). [10] W. B. Colson, in Laser Handbook, Volume 6:Free Elec- tron Lasers (North-Holland, Amsterdam, 1990),B. Murphy and C. Pellegrini, in Laser Handbook, Vol- ume 6:

Zholents, A.A.; Penn, G.



Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Inc","Other Provider",834064,"-",514698,319366,"-" "4. New Hampshire Elec Coop Inc","Cooperative",657104,441564,172464,43076,"-" "5. TransCanada Power Mktg Ltd","Other...

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Word Pro - Untitled1  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas b Petroleum Retail Elec- tricity f Total g Aviation Gasoline Distillate Fuel Oil c Jet Fuel LPG d Lubri- cants Motor Gasoline e Residual Fuel Oil Total 1973 Total...


Climate for Collaboration: Analysis of US and EU Lessons and...  

NLE Websites -- All DOE Office Websites (Extended Search)

coal, nuclear, or hydroelectric power, may have less incen- tive to invest in local non-hydro renewable energy (RE) resources than states that must import elec- tricity or fuels...



U.S. Energy Information Administration (EIA) Indexed Site

,8,26,"Aquila","FP",-2000,-50,0,-71100,-71100 4180,"Connecticut Mun Elec Engy Coop",8,27,"Hydro Quebec Energy Savings U.S.","FP",50000,50,0,1784200,1784200 4180,"Connecticut Mun...



U.S. Energy Information Administration (EIA) Indexed Site

Aron & Company","FP",0,-50,-45000,,-45000 4180,"Connecticut Mun Elec Engy Coop",8,19,"Hydro Quebec Energy Savings U.S.","FP",5600,50,15400,413200,428600 4180,"Connecticut Mun...


Word Pro - Untitled1  

U.S. Energy Information Administration (EIA) Indexed Site

Years, 1949-2011 (Quadrillion Btu) Year Imports Exports Net Imports 1 Coal Coal Coke Natural Gas Petroleum Bio- fuels 4 Elec- tricity Total Coal Coal Coke Natural Gas...


Residential Sector End-Use Forecasting with EPRI-REEPS 2.1: Summary Input Assumptions and Results  

E-Print Network (OSTI)

Homes End-Use Equipment Type Equipment Market Shares Index Heating ElecFurnace Gas Furnace LPG Furnace OilHomes (millions) End-Use Equipment Type Appliance stock in millions of units Index Heating FJec Furnace Gas Furnace L P G Furnace OilHomes End-Use Equipment Type Units Efficiency for Stock Equipment Index Heating Elec Furnace Btu.out/Wh.in Gas Furnace AFUE LPG Furnace AFUE Oil

Koomey, Jonathan G.



L b t t di f D kLow carbon energy system studies for Denmark Peter Meibom & Kenneth Karlsson, 2008 June 9th  

E-Print Network (OSTI)

Elec. And district heating Central heat pumps X X X X X XCentral heat pumps X X X X X X Wind power X X - X X Reduction transport demand NA X NA X NA NA Heating Energy eff. Building X X X X - X Biomass - X X X X X Heat pumps X NA X X X X Micro CHP - X - X - - Solar heating - X (X) X - - Elec. Savings


Gene structure and expression of serotonin receptor HTR2C in hypothalamic samples from infanticidal and control sows  

E-Print Network (OSTI)

) [24] and psychia- tric disorders such as puerperal psychosis [25] there is a modest association with HTR2C specific haplotypes, but many genetic association studies in humans are incon- clusive or contradictory. More detailed recent analyses looking... TTGAAGGATGGGGATTCTTG cDNA 653 HTR2CX2-5 GTAGGCCAAGAATCCCCATC ACCAATAGGCCAATCAGGTG cDNA 263 HTR2CX4-5 CATGGTGAACCTGAGGAAAG GCAGAGACAGTGGCATGA cDNA 335 HTR2CX5-7 CATGCCACTGTCTCTGCTTG TGTTGTTGACGAACACCTTG cDNA 299/204 HTR2CNR TTGCCCAAACAATAGCAATC cDNA HTR2CL...

Quilter, Claire R; Bagga, Meenashki; Moinie, Ahmad; Junaid, Fatima; Sargent, Carole A



Corrective Action Decision Document for Corrective Action Unit 322: Areas 1 and 3 Release Sites and Injection Wells Nevada Test Site, Nevada, Revision 0 with ROTC 1  

Science Conference Proceedings (OSTI)

This Corrective Action Decision Document has been prepared for Corrective Action Unit (CAU) 322, Areas 1 and 3 Release Sites and Injection Wells, Nevada Test Site, Nevada, in accordance with the ''Federal Facility Agreement and Consent Order'' (1996). Corrective Action Unit 322 is comprised of the following corrective action sites (CASs): (1) 01-25-01 - AST Release Site; (2) 03-25-03 - Mud Plant and AST Diesel Release; and (3) 03-20-05 - Injection Wells and BOP Shop. The purpose of this Corrective Action Decision Document is to identify and provide the rationale for the recommendation of a corrective action alternative for each CAS within CAU 322. Corrective action investigation activities were performed from April 2004 through September 2004, as set forth in the Corrective Action Investigation Plan. The purposes of the activities as defined during the data quality objectives process were: (1) Determine if contaminants of concern (COCs) are present; (2) If COCs are present, determine their nature and extent; and (3) Provide sufficient information and data to recommend appropriate corrective actions for the CASs. Analytes detected during the corrective action investigation were evaluated against appropriate preliminary action levels to identify contaminants of concern for each corrective action site. Radiological field measurements were compared to unrestricted release criteria. Assessment of the data generated from investigation activities revealed the following: (1) CAS 01-25-01 contains an AST berm contaminated with total petroleum hydrocarbons (TPH) diesel-range organics (DRO). (2) CAS 03-25-03 includes two distinct areas: Area A where no contamination remains from a potential spill associated with an AST, and Area B where TPH-DRO contamination associated with various activities at the mud plant was identified. The Area B contamination was found at various locations and depths. (3) CAS 03-25-03 Area B contains TPH-DRO contamination at various locations and depths in the area associated with the Mud Plant. (4) CAS 03-20-05 contains TPH-DRO, metals, and radiological contamination within the injection well casing soil and TPH-DRO contamination at the depth coincidental with the bottom of the injection well sump. Based on the evaluation of analytical data from the corrective action investigation, review of future and current operations in Areas 1 and 3 of the Nevada Test Site, and the detailed and comparative analysis of the potential corrective action alternatives, the following corrective actions are recommended for the Corrective Action Unit 322 CASs. Closure in Place with Administrative Controls is the preferred corrective action for the following CASs: (1) CAS 01-25-01, removal of TPH-DRO contamination would pose a significant safety hazard due to the site location. (2) CAS 03-25-03 No contamination remains at Area A (AST Berm); and thus, no further action is the preferred alternative at this part of the CAS. However at Area B, TPH-DRO contamination is varied in concentration and location and the footprint of the CAS is large, removal of contaminated ''pockets'' would be laborious and cost prohibitive. The plutonium-239 surface contamination identified at CAS 03-25-03 Area B has been removed and drummed as a best management practice. (3) CAS 03-20-05, TPH-DRO, metals, and radiological contamination are present in the injection well casing soils. Recommend corrective action includes removal of the liquid in the injection well sump (approximately 3 feet (ft) of liquid at 60 ft below ground surface), grouting the sump, and the area within the injection well casing. The plutonium-239 surface contamination identified at CAS 03-20-05 has been removed and drummed as a best management practice and will be disposed of as low-level radioactive waste. It is recommended that the liquids be removed from the holding tank wells and the sumps of the two outer holding tanks within the BOP Shop, and the sumps be grouted, and the holding tanks filled in to the BOP Shop floor surface. The preferred corrective action alternatives were ev

Boehlecke, Robert



"2012 Utility Bundled Retail Sales- Total"  

U.S. Energy Information Administration (EIA) Indexed Site

Total" Total" "(Data from forms EIA-861- schedules 4A & 4D and EIA-861S)" "Entity","State","Ownership","Customers (Count)","Sales (Megawatthours)","Revenues (Thousands Dollars)","Average Price (cents/kWh)" "Alaska Electric Light&Power Co","AK","Investor Owned",16180,399144,41820,10.477422 "Alaska Power and Telephone Co","AK","Investor Owned",6976,64788,18175,28.053035 "Alaska Village Elec Coop, Inc","AK","Cooperative",7923,73956,42708,57.74785 "Anchorage Municipal Light and Power","AK","Municipal",30747,1100665,100959.2,9.1725639 "Barrow Utils & Elec Coop, Inc","AK","Cooperative",1871,49580,5293,10.675676


A study of time-dependent responses of a mechanical displacement ventilation (DV) system and an underfloor air distribution (UFAD) system : building energy performance of the UFAD system  

E-Print Network (OSTI)

kWh. The elec- tricity cost per kWh is obtained from U.S.Ad- ministration. The gas cost per kWh is calculated fromper kWh. The electricity cost per kWh is obtained from U.S.

Yu, Jong Keun



InsideIllinoisOct. 20, 2011 Vol. 31, No. 8  

E-Print Network (OSTI)

, an electrochemical cell uses energy from a solar collector or a wind turbine to convert CO2 to simple carbon fuels into the Engineering and Science Hall of Fame. Holonyak is recognized for his invention of the first practical light ­ devices that convert elec- tricity into light or vice-versa. He gained eminence through his numerous

Illinois at Urbana-Champaign, University of


LETTER doi:10.1038/nature09718 Grains and grain boundaries insingle-layergraphene  

E-Print Network (OSTI)

transferred onto holey silicon nitride or Quantifoil transmission elec- tron microscopy (TEM) grids using two the several billion atoms in each grain, we use diffraction-filtered imaging14 to rapidly map the location sample fabrication20 was the gentle transfer of the gra- phene onto a TEM grid using a minimum of polymer

McEuen, Paul L.


11,23,1,3,2,19,30,"BANGOR HYDRO ELECTRIC CO","MEDWAY",0,"LIGHT...  

U.S. Energy Information Administration (EIA) Indexed Site

9,2520,35860,99999999,7799,4,11479,"NG","GT" 35,55,1,7,"D",72,25,"MADISON GAS & ELEC CO","WIND ENERGY",0,"NA",0,0,"M",1100,"A",,2000,0,0,99999999,0,0,99999999,0,0,99999999,0,0,999...


11,23,1,3,2,19,30,"BANGOR HYDRO ELECTRIC CO","MEDWAY",0,"LIGHT...  

U.S. Energy Information Administration (EIA) Indexed Site

00,20425,262090,1e+15,7799,4,11479,"NG","GT" 35,55,1,7,"D",72,25,"MADISON GAS & ELEC CO","WIND ENERGY",0,"NA",0,0,"M",1100,"A",,2000,2213,0,1e+15,7886,4,11479,"GEO","WI"...


Variation-Tolerant Non-Uniform 3D Cache Management in Die Stacked Multicore Processor  

E-Print Network (OSTI)

. Process variation can introduce latency disparity among different memory arrays. With the proliferation of the major hurdles in scaling in nanometer regime is the difficulty in controlling the de- vice, wire width etc., or elec- trical, such as threshold voltage, resistance per unit length, etc. [29

Zhang, Youtao


3D Inversion of Time Domain Data with application to San Nicolas Napier , Oldenburg , Haber , and Shekhtman  

E-Print Network (OSTI)

electromagnetic data collected in a field survey can be inverted to recover a 3D distribution of elec- trical grid where E is defined on cell faces and H is defined on cell edges. The electric field is decomposed3D Inversion of Time Domain Data with application to San Nicolas Napier , Oldenburg , Haber

Oldenburg, Douglas W.


Tarn Yates, Senior Thesis, Physics Department UCSC Summer 2003 Solar Cells in Concentrating Systems  

E-Print Network (OSTI)

.1109/JMEMS.2006.880246 have been developed for remote sensors typically based on ei- ther optical [6], [7 allowing power to be delivered by three on- board photovoltaic (PV) cells. The sensor itself is comprised environment is elec- trodeposited as driven by the PV cell array. The total mass de- 1057-7157/$20.00 © 2006


National Renewable Energy Laboratory Innovation for Our Energy Future  

E-Print Network (OSTI)

.1109/JMEMS.2006.880246 have been developed for remote sensors typically based on ei- ther optical [6], [7 allowing power to be delivered by three on- board photovoltaic (PV) cells. The sensor itself is comprised environment is elec- trodeposited as driven by the PV cell array. The total mass de- 1057-7157/$20.00 © 2006


Matter & Energy Solar Energy  

E-Print Network (OSTI)

See Also: Matter & Energy Solar Energy· Electronics· Materials Science· Earth & Climate Energy at the University of Illinois, the future of solar energy just got brighter. Although silicon is the industry Electronics Over 1.2 Million Electronics Parts, Components and Equipment. www.AlliedElec.com solar energy

Rogers, John A.

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Islanded house operation using a micro CHP Albert Molderink, Vincent Bakker, Johann L. Hurink, Gerard J.M. Smit  

E-Print Network (OSTI)

of their en- ergy usage, due to rising energy prices and a growing awareness of the greenhouse effect. Because. Figure 1 shows the (measured) electricity usage of a house with a typical high-demand [4]. The total elec. These two models are schematic given in Figure 2. According to the measured energy usage given in Figure 1

Al Hanbali, Ahmad


Large Plastic Deformation in High-Capacity Lithium-Ion Batteries Caused by Charge and Discharge  

E-Print Network (OSTI)

Large Plastic Deformation in High-Capacity Lithium-Ion Batteries Caused by Charge and Discharge, Massachusetts 02138 Evidence has accumulated recently that a high-capacity elec- trode of a lithium-ion battery in the particle is high, possibly leading to fracture and cavitation. I. Introduction LITHIUM-ION batteries

Suo, Zhigang


Dielectric Boundary Force in Molecular Solvation with the PoissonBoltzmann Free Energy: A Shape  

E-Print Network (OSTI)

Dielectric Boundary Force in Molecular Solvation with the Poisson­Boltzmann Free Energy: A Shape boundary force acting on such a boundary is the negative first variation of the elec- trostatic free energy [17,18,35,43,44]. Such a predefined interface is used to compute the solvation free energy as the sum

Li, Bo


The Free Energy of an Electrical Double Layer DEREK Y. C. CHAN AND D. JOHN MITCHELL  

E-Print Network (OSTI)

The Free Energy of an Electrical Double Layer DEREK Y. C. CHAN AND D. JOHN MITCHELL Department for the potential determining ions. The interaction free energy due to the overlap of two double layers has a simple The concept of the free energy of an elec- trical double layer is of considerable impor- tance in colloid

Chan, Derek Y C


_ _i_i Association for ,nformation and Image Management i; _ J , IA Spring, Maryland 20310  

E-Print Network (OSTI)

the maximum pressure needed to lift the overburden (``the fracture pressure''), and new CO2 injection wells (MMscf) of natural gas burned to generate elec- tricity (n3045us2a.xls). All these data are posted generation has been calculated from the DOE EIA files epmxlfile4_1.xls (Report DOE/EIA-0226) for coal, and n

Hazen, Terry


Universitat Stuttgart -Institut fur Wasserbau Lehrstuhl fur Hydromechanik und Hydrosystemmodellierung  

E-Print Network (OSTI)

the maximum pressure needed to lift the overburden (``the fracture pressure''), and new CO2 injection wells (MMscf) of natural gas burned to generate elec- tricity (n3045us2a.xls). All these data are posted generation has been calculated from the DOE EIA files epmxlfile4_1.xls (Report DOE/EIA-0226) for coal, and n

Cirpka, Olaf Arie


Manual for Development of a Transient MODFLOW/MT3DMS/SEAWAT Simulation  

E-Print Network (OSTI)

the maximum pressure needed to lift the overburden (``the fracture pressure''), and new CO2 injection wells (MMscf) of natural gas burned to generate elec- tricity (n3045us2a.xls). All these data are posted generation has been calculated from the DOE EIA files epmxlfile4_1.xls (Report DOE/EIA-0226) for coal, and n


Realization of 3-D Separable-Denominator Digital Filters with Very Low l2-Sensitivity  

E-Print Network (OSTI)

Hinamoto Graduate School of Engineering Hiroshima University Higashi-Hiroshima 739-8527, Japan Email: hinamoto@hiroshima-u.ac.jp Osamu Tanaka Graduate School of Engineering Hiroshima University Higashi-Hiroshima 739-8527, Japan Email: o­tanaka@hiroshima-u.ac.jp Wu-Sheng Lu Dept. of Elec. and Comp. Engineering

Lu, Wu-Sheng


Realization of MIMO Linear Discrete-Time Systems with Minimum L2-Sensitivity and No Overflow Oscillations  

E-Print Network (OSTI)

Oscillations Takao Hinamoto Graduate School of Engineering Hiroshima University Higashi-Hiroshima 739-8527, Japan Email: hinamoto@hiroshima-u.ac.jp Osemekhian I. Omoifo Graduate School of Engineering Hiroshima University Higashi-Hiroshima 739-8527, Japan Email: osei@hiroshima-u.ac.jp Wu-Sheng Lu Dept. of Elec

Lu, Wu-Sheng


Case-study of a coal gasification-based energy supply system for China  

E-Print Network (OSTI)

for biogas or DME, so we assumed the same values for biogas as for coke oven gas (i.e., town gas coal, washed coal and coke, 75 % for petroleum products and town gas, and 90 % for heat. We also synthesis gas and elec- tricity, high-value-added chemicals, high-value-added fu- els for vehicles


These long-standing issues have been debated in various processes. The  

E-Print Network (OSTI)

unprofitable to serve. This low-cost power helped to shape the economy and advance the growth of the region tributaries and one non-federal nuclear power plant. Bonneville provides about half the elec- tricity used draft policy, ince its creation in 1937 to market the power from the Bonneville and Grand Coulee dams


Journal of Policy Modeling 31 (2009) 404424 Available online at www.sciencedirect.com  

E-Print Network (OSTI)

assumptions about nuclear power growth and the future price of natural gas. A main determinant of the future. 1 The EPPA sub-model of fossil resource depletion, particularly of coal and natural gas (HTRN) Energy Coal (COAL) Crude Oil (OIL) Refined Oil (ROIL) Natural Gas (GAS) Electric: Fossil (ELEC


2012 by the American Academy of Arts & Sciences Is Shale Gas Good for Climate Change?  

E-Print Network (OSTI)

concern is the impact of low-priced natural gas on the electrici- ty sector for technologies beyond coal gas for coal in the elec- tricity sector. Even with an increase in natural gas price because employment by the coal industry. A price on carbon would be in the best interests of the natural gas industry

Schrag, Daniel


Utilities Policy 11 (2003) 7586 www.socscinet.com/bam/jup  

E-Print Network (OSTI)

­NewJersey­Maryland (PJM) elec- tricity market is enjoying low energy prices. In fact, the users of this market initially of the trading in the California for- ward markets.6 The PX ran auctions to establish energy prices and schedules contracts to tailor consumers' needs. The energy prices in the different SCs converge as trading among SCs

Marathe, Achla


Cutting the Electric Bill for Internet-Scale Systems Asfandyar Qureshi  

E-Print Network (OSTI)

center energy efficiency gains [2], and elec- tricity prices are expected to rise. Permission to make demand (i.e., route service requests) to places with lower prices, we can reduce energy costs. 2. Large energy everywhere, even in re- gions with high energy prices. Without adequate elasticity, we cannot

Akella, Aditya


The homeobox transcription factor Even-skipped regulates acquisition of electrical properties in Drosophilaneurons  

E-Print Network (OSTI)

, 10 pA/500 ms, p ? 0.05; Figure 1d). Increased Eve regulates postsynaptic sensitivity to excitatory neurotransmitter We also measured synaptic input to aCC/RP2 following Over-expression of eve in aCC/RP2 is sufficient to alter elec-trical prop rties...

Pym, Edward C G; Southall, Tony D; Mee, Christopher J; Brand, Andrea H; Baines, Richard A



A. Kornilov Department of Mechanical Engineering,  

E-Print Network (OSTI)

attracted considerable attention in the elec- tronic industry. In this method a wafer is positioned is important to the electronic industry. Since chips often operate at a high power level Bar-Cohen 1 , Suhir 2.g., glass, glass- ceramic and some other glass-like materials, into chips which is based on the effect

Elperin, Tov


Solar Two is a concentrating solar power plant that can supply electric power "on demand"  

E-Print Network (OSTI)

Solar Two is a concentrating solar power plant that can supply electric power "on demand time ever, a utility-scale solar power plant can supply elec- tricity when the utility needs it most achievement. The design is based on lessons learned at Solar One, this country's first power tower. Solar One

Laughlin, Robert B.


What is needed to initiate new fuel/vehicle pathways?  

E-Print Network (OSTI)

/year target by 2030. · "Biofuels capital expenditures necessary to achieve 60 billion gallons per year and Biofuels Prof. Joan Ogden Institute of Transportation Studies University of California, Davis June 14, 2010) TRANSPORT SECTOR GHG EMISSIONS HIGHER VEHICLE EFF. => 50% of CO2 EMISSIONS CUT; BIOFUELS, ELEC & H2 FCVs

California at Davis, University of


A Publication of the Georgia Institute of Technology Fall 2010 ServingGeorgia  

E-Print Network (OSTI)

in a "chicken-wire" lattice. These layers, sometimes just a single atom thick, conduct electricity the semiconductor industry to continue its march toward ever-smaller and faster electronic devices. Georgia the semiconductor industry to continue its march toward ever-smaller and faster elec- tronic devices ­ progress

Löffler, Frank E.

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ENVIRONMENTAL BIOTECHNOLOGY Electricity generation at high ionic strength in microbial fuel  

E-Print Network (OSTI)

ENVIRONMENTAL BIOTECHNOLOGY Electricity generation at high ionic strength in microbial fuel cell organic matter using elec- trochemically active bacteria as catalysts to generate electrical energy of the most exciting applications of MFCs is their use as benthic unattended generators to power electrical

Sun, Baolin


NJITMAGA-HARDCOPY Some of those involved in the public policy debate may have  

E-Print Network (OSTI)

fuels used to generate electricity. Under the old regulatory model, these costs would have been directly or functionally transfer ownership of their electric generating plants. Utilities still deliver elec- tricity. The savings stem from reducing the impact of fuel cost increases and efficiency improvements at electric

Bieber, Michael


Optimization of a Single Phase Ultrasonic Linear Motor  

E-Print Network (OSTI)

Optimization of a Single Phase Ultrasonic Linear Motor Markus Flueckiger, Jos´e M. Fernandez.flueckiger@epfl.ch Abstract--Piezoelectric ultrasonic motors are superior to elec- tromagnetic micromotors, because by the means of the finite element method (FEM) is a common approach for dimensioning piezoelectric motors

Psaltis, Demetri


Microsoft Word - NEWSLETTER_EuroAOCS_Oct_2007.doc  

Science Conference Proceedings (OSTI)

Dear European member of the AOCS. It is on time to give some information from the board of the EAOCS and for me to hand over the leadership to Dr. Charlotte Jacobsen, the proposed next president. The election of the new board will be made elec


Patricia Hayes Andrews Young scholars hoping to shape a career with a far-reaching and long-lasting legacy would do well to  

E-Print Network (OSTI)

for forecasting weather and predicting climate. You don't need any hi-tech equipment; just download a free sur into life on campus. There are now more than 75,000 files available to down- load on iTunes U from over 800 of the Department of Electrical and Elec- tronic Engineering, wants to make data-gathering sensors smaller

Indiana University


All products of the future clothes, household devices, lamps will contain electronic units. Graduates in Electronic Design Engineering will be able  

E-Print Network (OSTI)

to design the software and elec- tronics of the future, design energy-friendly systems by using clean tech. Graduates in Electronic Design Engineering will be able to design both electronics and system software hardware and software electronics, as well as mathematics and physics, to prototype cutting-edge projects


Solid-State Water Electrolysis with an Alkaline Membrane Yongjun Leng,,  

E-Print Network (OSTI)

production. Hydrogen is an excellent energy storage medium for renewable and sustainable energy systems.1 hydrogen and elec- tricity, (2) good energy density of compressed hydrogen storage compared to the energy hydrogen from renewable energy such as solar, wind, and hydropower for grid-scale energy storage.4


Meeting an 80% Reduction in Greenhouse Gas Emissions from Transportation by 2050: A Case Study in California  

E-Print Network (OSTI)

biomass and renewable elec- tricity generation, the untapped supplyBiomass as a Feedstock for a Bioenergy and Bioprocessing Industry: The Technical Feasibility of a Billion-Ton Annual Supply.supply in 2030: crude oil (12,699 PJ), natural gas (21,099 PJ), coal (30,202 PJ), biomass (

Yang, Christopher; McCollum, David L; McCarthy, Ryan; Leighty, Wayne



Available online at www.sciencedirect.com Sensors and Actuators B 129 (2008) 200210  

E-Print Network (OSTI)

gas (syngas), is the first step in an advanced, minimally polluting process for production of elec produces syngas from coal, cleans the syngas and supplies it as fuel to a gas turbine operated steam reforming or partial oxidation of a hydrocarbon (or a combination of the two) to pro- duce syngas

Ghosh, Ruby N.


Journal of Colloid and Interface Science 235, 8088 (2001) doi:10.1006/jcis.2000.7249, available online at http://www.idealibrary.com on  

E-Print Network (OSTI)

of adsorption envelopes, electrophoretic mobility (EM) measurements, and X-ray absorp- tion spectroscopy (XAS Key Words: arsenic; -Al2O3; adsorption mechanisms; XAS; elec- trophoretic mobility; oxide the maximum concentration level (MCL) for total As in drinking water from 50 to 5 ppb. This new MCL 1 To whom

Sparks, Donald L.


xxxx xxxx xxxxxxxxxxxxxxxx x 1116 f xx xx xxxx tar diff trnhs ...  

Science Conference Proceedings (OSTI)

... ee p2 205.1 220.3 gpfp hany 970127_3500_3398 a 3500 f xx 24 elec tar diff trnhs 59.43 20.59 608848klx ee p2 209.9 241.1 gbcb hany ...



Physics and Dynamics of Current Sheets in Pulsed Plasma Thrusters  

E-Print Network (OSTI)

canting in pulsed electromagnetic accelerators is the departure of the plasma sheet that carries Pulsed electromagnetic accelerators are devices which use intense bursts of elec- trical current (O(104 to improve the performance of pulsed electromagnetic accelerators in the context of plasma propulsion

Choueiri, Edgar



E-Print Network (OSTI)

biogas, electricity and fertilizer from 30 000 tons of annually waste. The plant was opened in March 2008 together it an- nually produces 18,9 GWh biogas and around 10 GWh of elec- tricity. The Cambi THP ­process


In October 2002, Sue Hock (78)  

E-Print Network (OSTI)

. In addition to being drivers, they are vehicle engineers and are constantly tinkering and improv- ing a manufacturing technology that may allow photovoltaics to become the cost effective, clean and efficient elec Student Competitions: 3/16-20 Clean Snowmobile 2004 Houghton, MI, 4/23-25 Human Powered Vehicle Oregon St


Impact of local recharge on arsenic concentrations in shallow aquifers1 inferred from the electromagnetic conductivity of soils in Araihazar,2  

E-Print Network (OSTI)

as a few other groups, primarily in England [13-161, have embarked on a program to evaluate the potential of the elec- trochemical environmentswith specific examples from our research program. 2. Characteristicsof of different symmetry and in which one of the states is pumped by the excitation laser. In this circumstance

van Geen, Alexander


Understanding the Role of Buildings in a Smart Microgrid  

E-Print Network (OSTI)

that this relationship can bring as well as the challenges in implementing this vision. I. INTRODUCTION The smart grid, robustness and efficiency, the smart grid will radically revolutionize the elec- trical networks and networking at various points in the smart grid make this possible, and information along with electricity

Gupta, Rajesh


Corrective Action Investigation Plan for Corrective Action Unit 214: Bunkers and Storage Areas Nevada Test Site, Nevada: Revision 0, Including Record of Technical Change No. 1 and No. 2  

SciTech Connect

This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office's approach to collect the data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit (CAU) 214 under the Federal Facility Agreement and Consent Order. Located in Areas 5, 11, and 25 of the Nevada Test Site, CAU 214 consists of nine Corrective Action Sites (CASs): 05-99-01, Fallout Shelters; 11-22-03, Drum; 25-99-12, Fly Ash Storage; 25-23-01, Contaminated Materials; 25-23-19, Radioactive Material Storage; 25-99-18, Storage Area; 25-34-03, Motor Dr/Gr Assembly (Bunker); 25-34-04, Motor Dr/Gr Assembly (Bunker); and 25-34-05, Motor Dr/Gr Assembly (Bunker). These sites are being investigated because existing information on the nature and extent of potential contamination is insufficient to evaluate and recommend corrective action alternatives (CAAs). The suspected contaminants and critical analyte s for CAU 214 include oil (total petroleum hydrocarbons-diesel-range organics [TPH-DRO], polychlorinated biphenyls [PCBs]), pesticides (chlordane, heptachlor, 4,4-DDT), barium, cadmium, chronium, lubricants (TPH-DRO, TPH-gasoline-range organics [GRO]), and fly ash (arsenic). The land-use zones where CAU 214 CASs are located dictate that future land uses will be limited to nonresidential (i.e., industrial) activities. The results of this field investigation will support a defensible evaluation of viable corrective action alternatives that will be presented in the corrective action decision document.

U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office



Data:97537479-c34a-4515-b4be-3e55a70d93c6 | Open Energy Information  

Open Energy Info (EERE)

Data Data Edit with form History Facebook icon Twitter icon » Data:97537479-c34a-4515-b4be-3e55a70d93c6 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Mid-Yellowstone Elec Coop, Inc Effective date: 2011/10/20 End date if known: Rate name: Irrigation Service > 200 HP Sector: Commercial Description: Averaging more than 200 HP of billed horsepower per season. Source or reference: https://cas.sharepoint.illinoisstate.edu/grants/Sunshot/Lists/DATA%20ENTRY%20Database%20Now%20Compatible%20with%20Rates/Attachments/42/Mid-Yellowstone%20Elec%20Coop,%20Inc%20Rates.pdf


Property:EIA/861/NercSerc | Open Energy Information  

Open Energy Info (EERE)

NercSerc NercSerc Jump to: navigation, search This is a property of type Boolean. Description: Nerc Serc Entity conducts business operations within the SERC region (Y or N) [1] References ↑ EIA Form EIA-861 Final Data File for 2008 - F861 File Layout-2008.doc Pages using the property "EIA/861/NercSerc" Showing 25 pages using this property. (previous 25) (next 25) 4 4-County Electric Power Assn + true + A Access Energy Coop + true + Adams Electric Coop + true + Aiken Electric Coop Inc + true + Alabama Municipal Elec Authority + true + Alabama Power Co + true + Albany Water Gas & Light Comm + true + Albemarle Electric Member Corp + true + Albertville Municipal Utils Bd + true + Alcorn County Elec Power Assn + true + Altamaha Electric Member Corp + true +


City of Sylvania, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Sylvania, Georgia (Utility Company) Sylvania, Georgia (Utility Company) Jump to: navigation, search Name City of Sylvania Place Georgia Utility Id 18397 Utility Location Yes Ownership M NERC Location SERC NERC ERCOT Yes NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Agri SS Elec Commercial Agri SS Elec Demand Commercial Cobra Head Mercury Vapor Lighting Commercial Electric under 500 DMD Commercial Commercial Electric Commercial Commercial Electric - DISC Commercial Commercial Electric DMD Commercial Commercial Electric Over 500 Commercial Commercial Electric Rate Commercial

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


City of Stanhope, Iowa (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Stanhope, Iowa (Utility Company) Stanhope, Iowa (Utility Company) Jump to: navigation, search Name City of Stanhope Place Iowa Utility Id 27269 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Rate #5 (Single Phase) Composite Rate Commercial Commercial Rate #5 (Single Phase) Tiered Rate Commercial Commercial Rate #5 (three Phase) Composite Rate Commercial Commercial Rate #5 (three Phase) Tiered Rate Commercial Commercial Rate#20 (referred to as coop elec-1) Composite Commercial Commercial Rate#20 (referred to as coop elec-1) Tiered Commercial



Gasoline and Diesel Fuel Update (EIA)

8 8 Southern California Gas Co ..................... CA 269,739,909 7.31 Pacific Gas and Elec Co........................... CA 224,402,286 6.32 Northern Illinois Gas Co ........................... IL 196,608,329 4.63 Consumers Pwr Co .................................. MI 153,128,350 4.92 Columbia Gas Dist Co.............................. OH,KY,PA,MD 138,064,908 7.21 Pub Svc Elec and Gas Co........................ NJ 126,142,540 6.61 Michigan Consol Gas Co.......................... MI 125,456,377 5.35 East Ohio Gas Co .................................... OH 117,574,196 6.21 Peoples Gas Lt and Coke Co................... IL 89,685,006 6.81 Atlanta Gas Lt Co ..................................... GA 89,103,601 6.69 Lone Star Gas Co..................................... TX 84,559,915 5.95 Brooklyn Union Gas Co............................ NY


Northern Illinois Gas Co IL  

Gasoline and Diesel Fuel Update (EIA)

Northern Northern Illinois Gas Co ............................ IL 254,574,988 4.60 Southern California Gas Co ...................... CA 233,632,354 6.89 Columbia Gas Dist Co............................... OH,KY,PA,MD 196,322,935 6.64 Pacific Gas and Elec Co............................ CA 190,864,262 5.83 Consumers Pwr Co ................................... MI 188,587,672 4.81 Michigan Consol Gas Co........................... MI 160,809,168 5.16 East Ohio Gas Co ..................................... OH 146,802,045 5.44 Pub Svc Elec and Gas Co......................... NJ 140,712,209 6.62 Peoples Gas Lt and Coke Co.................... IL 126,356,925 6.40 Brooklyn Union Gas Co............................. NY 106,349,594 9.43 Atlanta Gas Lt Co ...................................... GA 106,075,815 6.66 Lone Star Gas Co......................................



Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................


DOE OE Permitting, Siting Analysis Division: Samples of State Technical Assistance Work as of June 2011  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE OE Permitting, Siting DOE OE Permitting, Siting Analysis Division: Samples of State Technical Assistance Work as of June 2011 December 2008 State TA: Midwest Gov Assn/NCSL/National Council on Elec Policy/NGA/NASEO December 2008 State TA: Natl Conf of State Legislatures/ Natl Council on Elec Policy/Natl Gov Assn/Natl Assn of State Energy Offices December 2008 State TA: NCSL/NGA/NASEO/ National Council on Electricity Policy December 2008 Regulatory Assistance Project Sample Products: Utility Planning December 2008 Lawrence Berkeley Nat'l Lab (LBNL) Sample Products: Smart Grid & Demand Response December 2008 LBNL Sample Products: Ratepayer- Financed Energy Efficiency December 2008 LBNL Sample Products: EE Business Models for Use by PUCs December 2008 LBNL Sample Products: EE Evaluation, Measurement & Verification (EM&V)



Gasoline and Diesel Fuel Update (EIA)

4 4 Con Edison Co. of New York Inc.............. NY 88,830,005 5.25 Pub Svc Elec and Gas Co........................ NJ 70,705,783 5.28 Columbia Gas Dist Co.............................. OH,KY,PA,MD 63,746,659 7.11 Southern California Gas Co ..................... CA 57,000,043 6.63 Minnegasco .............................................. MN 55,213,151 4.69 Pacific Gas and Elec Co........................... CA 54,854,821 6.15 Entex Div of Noram Energy Corp ............. LA,MS,TX 51,551,370 5.31 Consumers Pwr Co .................................. MI 50,657,354 4.44 Michigan Consol Gas Co.......................... MI 50,589,626 5.55 Northern Illinois Gas Co ........................... IL 47,159,304 5.26 Pub Svc Co. of Colorado.......................... CO 46,479,502 3.88 East Ohio Gas Co .................................... OH 41,561,614 5.92


Data:2674f340-381e-45b6-8333-8ca1bb52038f | Open Energy Information  

Open Energy Info (EERE)

381e-45b6-8333-8ca1bb52038f 381e-45b6-8333-8ca1bb52038f No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Kaw Valley Electric Coop Inc Effective date: 2012/02/01 End date if known: Rate name: Private Area/Street Lighting(175W MV) Sector: Lighting Description: http://www.kve.coop/elecRates.pdf Source or reference: http://www.kve.coop/elecRates.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous



Gasoline and Diesel Fuel Update (EIA)

3 3 Con Edison Co of New York Inc............... NY 102,311,001 3.84 Pub Svc Elec and Gas Co........................ NJ 73,839,186 3.05 Southern California Gas Co ..................... CA 62,380,076 5.55 Pacific Gas and Elec Co........................... CA 58,692,831 6.82 Keyspan Energy Del Co ........................... NY 53,162,984 6.07 Minnegasco .............................................. MN 52,910,769 4.25 Entex Div of Noram Energy Corp ............. TX,LA,MS 47,337,378 4.81 Lone Star Gas Co..................................... TX 45,843,050 4.67 Consumers Energy Co ............................. MI 45,391,308 4.50 Michigan Consol Gas Co.......................... MI 41,336,416 5.38 Pub Svc Co of Colorado........................... CO 39,230,403 4.47 Columbia Gas Dist Co.............................. KY,PA,MD,OH 35,550,535 6.78


City of Wessington Springs, South Dakota (Utility Company) | Open Energy  

Open Energy Info (EERE)

Wessington Springs, South Dakota (Utility Company) Wessington Springs, South Dakota (Utility Company) Jump to: navigation, search Name City of Wessington Springs Place South Dakota Utility Id 20359 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1 Ele Res Residential 11 Sec Lgt 1.50 Lighting 12 Sec Lgt 3.00 Lighting 14 Sec Lgt 5.00 Lighting 15 Res 06 Debt Ser Residential 16 Sm 06 Com Debt Commercial 17 Lr 06 Debt Serv 18 03 Debt Serv 2 Elec Comm Commercial 5 Elec City 6 LCom Energy Commercial 8 Demand Rate



Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................


Data:1f06c3a9-fb2c-4234-a83b-c527755c7472 | Open Energy Information  

Open Energy Info (EERE)

c3a9-fb2c-4234-a83b-c527755c7472 c3a9-fb2c-4234-a83b-c527755c7472 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Tri-County Elec Member Corp Effective date: 2012/01/01 End date if known: Rate name: Church Service Electric NonDemand Sector: Description: Three-phase service is available to churches with prior approval of the Cooperative. Members receiving three-phase service will be billed a monthly charge of $12.50 in addition to all other charges. Source or reference: http://www.tri-countyemc.com/skins/userfiles/file/Church%20Elec%20Nondemand%20C-1E%202012.pdf Source Parent: Comments Applicability



Gasoline and Diesel Fuel Update (EIA)

Energy Information Administration / Natural Gas Annual 1999 Southern California Gas Co ..................... CA 275,767,714 6.50 Pacific Gas and Elec Co........................... CA 234,195,449 6.61 Nicor Gas ................................................. IL 211,147,988 4.71 Consumers Energy Co ............................. MI 167,318,229 4.89 Michigan Consol Gas Co.......................... MI 134,432,032 5.42 Pub Svc Elec and Gas Co........................ NJ 133,426,119 6.86 East Ohio Gas Co .................................... OH 127,141,913 5.81 Keyspan Energy Del Co ........................... NY 125,709,092 9.79 Columbia Gas Dist Co.............................. KY,PA,MD,OH 121,011,064 7.32 Peoples Gas Lt and Coke Co................... IL 98,758,164 6.77 Pub Svc Co of Colorado........................... CO 84,115,032 5.28



Gasoline and Diesel Fuel Update (EIA)

3 3 Northern Illinois Gas Co ........................... IL 241,353,299 5.25 Southern California Gas Co ..................... CA 237,581,205 7.28 Pacific Gas and Elec Co........................... CA 191,919,171 6.12 Consumers Pwr Co .................................. MI 178,690,154 4.80 Columbia Gas Dist Co.............................. OH,KY,PA,MD 178,512,589 7.64 Michigan Consol Gas Co.......................... MI 152,111,213 5.59 East Ohio Gas Co .................................... OH 147,197,186 6.36 Pub Svc Elec and Gas Co........................ NJ 138,404,765 7.58 Peoples Gas Lt and Coke Co................... IL 113,561,765 6.96 Lone Star Gas Co..................................... TX 100,079,759 6.13 Atlanta Gas Lt Co ..................................... GA 96,381,162 7.41 Brooklyn Union Gas Co............................


Kotzebue Wind Project III | Open Energy Information  

Open Energy Info (EERE)

Kotzebue Wind Project III Kotzebue Wind Project III Jump to: navigation, search Name Kotzebue Wind Project III Facility Kotzebue Wind Project Sector Wind energy Facility Type Small Scale Wind Facility Status In Service Owner Kotzebue Elec. Assoc. Developer Kotzebue Electric Association Energy Purchaser Kotzebue Elec. Assoc. Location Kotzebue AK Coordinates 66.83716°, -162.556955° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":66.83716,"lon":-162.556955,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Kotzebue Wind Project II | Open Energy Information  

Open Energy Info (EERE)

II II Facility Kotzebue Wind Project Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Kotzebue Elec. Assoc. Developer Kotzebue Electric Association Energy Purchaser Kotzebue Elec. Assoc. Location Kotzebue AK Coordinates 66.83912°, -162.562816° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":66.83912,"lon":-162.562816,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Polk County Rural Pub Pwr Dist | Open Energy Information  

Open Energy Info (EERE)

County Rural Pub Pwr Dist County Rural Pub Pwr Dist Jump to: navigation, search Name Polk County Rural Pub Pwr Dist Place Nebraska Utility Id 15188 Utility Location Yes Ownership P NERC Location MRO Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Cabin Residential City of Stromsburg - CYC 3/REV 8 Commercial Commercial Elec Space Heating - One Phase Commercial Commercial Elec Space Heating - Three Phase Commercial General Service CYC 2/REV1 - Three Phase Residential General Service CYC/Rev1 - Single Phase Residential Irrigation CYC 1 - Five 1/2 day - Single Phase Industrial


Kotzebue Wind Project I | Open Energy Information  

Open Energy Info (EERE)

Kotzebue Wind Project I Kotzebue Wind Project I Facility Kotzebue Wind Project Sector Wind energy Facility Type Small Scale Wind Facility Status In Service Owner Kotzebue Elec. Assoc. Developer Kotzebue Electric Association Energy Purchaser Kotzebue Elec. Assoc. Location Kotzebue AK Coordinates 66.836485°, -162.556955° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":66.836485,"lon":-162.556955,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


International Energy Outlook 2006  

Gasoline and Diesel Fuel Update (EIA)

consumption doubles in the IEO2006 projections from 2003 to 2030. consumption doubles in the IEO2006 projections from 2003 to 2030. Non-OECD countries account for 71 percent of the projected growth, and OECD countries account for 29 percent. In the IEO2006 reference case, the world's total net elec- tricity consumption 11 doubles, growing at an average rate of 2.7 percent per year, from 14,781 billion kilowatt- hours in 2003 to 21,699 billion kilowatthours in 2015 and 30,116 billion kilowatthours in 2030 (Figure 55). Non- OECD countries account for 71 percent of the projected growth and OECD countries 29 percent. This chapter examines the future of electricity demand and supply, beginning with a discussion of regional demand and trends anticipated over the 27-year projec- tion period. The remainder of the chapter discusses the projections for electricity generating capacity and elec- tricity generation from


Property:EIA/861/NercSpp | Open Energy Information  

Open Energy Info (EERE)

NercSpp NercSpp Jump to: navigation, search This is a property of type Boolean. Description: Nerc Spp Entity conducts business operations within the SPP region (Y or N) [1] References ↑ EIA Form EIA-861 Final Data File for 2008 - F861 File Layout-2008.doc Pages using the property "EIA/861/NercSpp" Showing 25 pages using this property. (previous 25) (next 25) A Alfalfa Electric Coop, Inc + true + Anadarko Public Works Auth + true + Arkansas Electric Coop Corp + true + Ashley Chicot Elec Coop, Inc + true + Auburn Board of Public Works + true + B Bailey County Elec Coop Assn + true + Basin Electric Power Coop + true + Big Country Electric Coop, Inc + true + Bluestem Electric Coop Inc + true + Bowie-Cass Electric Coop, Inc + true + Brown-Atchison E C A Inc + true +


Establishing Tower-Top Equipotential Zones--Case-Study of Incidents  

Science Conference Proceedings (OSTI)

The Occupational Safety and Health Administration (OSHA) requires employers to provide protection and training for workers who perform work on de-energized and energized lines. This Technical Update report contains the draft script of a new training video on DVD under development on establishing tower-top equipotential zones. The script contains case studies and analysis of specific selected incidents that have occurred in the field. It also includes recommendations for minimizing risks and avoiding elec...


Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Materials Reliability Program: San Onofre Nuclear Generating Station Reactor Vessel Internals Management Engineering Program (MRP-303)  

Science Conference Proceedings (OSTI)

All operating pressurized water reactors must have a reactor vessel internals aging management document in place by December 2011 according to the mandatory requirement under Nuclear Energy Institute (NEI) 03-08. This program should be developed to meet the guidance provided by Materials Reliability Program (MRP) -227, Rev. 0, Pressurized Water Reactor Internals Inspection and Evaluation Guidelines. For non-license renewal plants, the requirements are valid within the current license period, and the Elec...



Research Awards 06/01/2011From  

E-Print Network (OSTI)

in Novel Wind Turbine Blades Raymond A. Pearson PA Dept of Community & Economic Development START_DATE: 6-Navy-Arlington START_DATE: 6/29/2011 END_DATE: 7/31/2014 Structure and Micro-Fracture Testing of Single Grain-Directorate for Education And Human Resources START_DATE: 7/1/2011 END_DATE: 6/30/2013 Elec & Comp Engr SBIR Phase 2

Gilchrist, James F.


Data:Ab53d37d-0e23-4bbd-934c-29bdc4b170ef | Open Energy Information  

Open Energy Info (EERE)

3d37d-0e23-4bbd-934c-29bdc4b170ef 3d37d-0e23-4bbd-934c-29bdc4b170ef No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: East Central Oklahoma Elec Coop Inc Effective date: 2002/12/19 End date if known: Rate name: Special Contract - Kwikset Sector: Industrial Description: Available to Kwikset at its Bristow plant under this special contract, subject to the established rules and regulations of the Cooperative. No standby or auxiliary service provided. East Central OK Elec Coop Inc was previously providing Kwikset, INC power and energy under its LP-4 Large Power Service standard rate schedule and provided this special rate as an incentive to keep Kwikset from closing its facility and continue power purchase from East Central OK Elec Coop Inc.


Entity State Ownership  

U.S. Energy Information Administration (EIA) Indexed Site

2,174 2,174 129,783 12,857.0 9.91 Alaska Power and Telephone Co AK Investor Owned 2,173 40,397 10,705.0 26.50 Alaska Village Elec Coop, Inc AK Cooperative 1,775 42,871 23,433.0 54.66 Anchorage Municipal Light and Power AK Municipal 6,304 953,876 83,738.0 8.78 Barrow Utils & Elec Coop, Inc AK Cooperative 400 38,069 3,929.0 10.32 Bethel Utilities Corp AK Investor Owned 1,017 30,229 16,102.0 53.27 Chugach Electric Assn Inc AK Cooperative 9,204 574,284 67,370.0 11.73 City & Borough of Sitka - (AK) AK Municipal 1,622 58,534 5,638.0 9.63 City of Petersburg - (AK) AK Municipal 717 9,064 1,030.5 11.37 City of Seward - (AK) AK Municipal 503 8,651 1,869.0 21.60 City of Unalaska - (AK) AK Municipal 242 11,183 4,906.4 43.87 City of Wrangell - (AK) AK Municipal 778 19,919 2,132.0 10.70 Copper Valley Elec Assn, Inc AK Cooperative 797 65,757


Entity State Ownership  

U.S. Energy Information Administration (EIA) Indexed Site

3,912 3,912 142,255 16,970.0 11.93 Alaska Power and Telephone Co AK Investor Owned 4,803 24,391 7,470.0 30.63 Alaska Village Elec Coop, Inc AK Cooperative 6,148 31,085 19,275.0 62.01 Anchorage Municipal Light and Power AK Municipal 24,443 146,789 17,221.2 11.73 Barrow Utils & Elec Coop, Inc AK Cooperative 1,471 11,511 1,364.0 11.85 Bethel Utilities Corp AK Investor Owned 1,671 10,677 5,990.0 56.10 Chugach Electric Assn Inc AK Cooperative 69,495 549,748 76,083.0 13.84 City & Borough of Sitka - (AK) AK Municipal 3,669 47,899 4,570.0 9.54 City of Petersburg - (AK) AK Municipal 1,354 20,803 2,010.2 9.66 City of Seward - (AK) AK Municipal 2,064 16,488 3,344.0 20.28 City of Unalaska - (AK) AK Municipal 686 4,009 1,997.6 49.83 City of Wrangell - (AK) AK Municipal 1,170 15,273 1,604.0 10.50 Copper Valley Elec Assn, Inc AK Cooperative


Corrective Action Decision Document/Closure Report for Corrective Action Unit 554: Area 23 Release Site Nevada Test Site, Nevada, Rev. No.: 0 with Errata Sheet  

Science Conference Proceedings (OSTI)

This Corrective Action Decision Document/Closure Report has been prepared for Corrective Action Unit 554, Area 23 Release Site, located in Mercury at the Nevada Test Site, Nevada, in accordance with the ''Federal Facility Agreement and Consent Order'' (1996). Corrective Action Unit (CAU) 554 is comprised of one corrective action site (CAS): CAS 23-02-08, USTs 23-115-1, 2, 3/Spill 530-90-002. The purpose of this Corrective Action Decision Document/Closure Report is to provide justification and documentation supporting the recommendation for closure of CAU 554 with no further corrective action. To achieve this, corrective action investigation (CAI) activities were performed from January 18 through May 5, 2005, as set forth in the Corrective Action Investigation Plan for Corrective Action Unit 554: Area 23 Release Site (NNSA/NSO, 2004) and Records of Technical Change No. 1 and No. 2. The purpose of the CAI was to fulfill the following data needs as defined during the data quality objective (DQO) process: (1) Determine whether contaminants of concern are present. (2) If contaminants of concern are present, determine their nature and extent. (3) Provide sufficient information and data to complete appropriate corrective actions. The CAU 554 dataset from the investigation results was evaluated based on the data quality indicator parameters. This evaluation demonstrated the quality and acceptability of the dataset for use in fulfilling the DQO data needs. Analytes detected during the CAI were evaluated against preliminary action levels (PALs) established in the CAU 554 CAIP for total petroleum hydrocarbons (TPH) benzo(a)pyrene, dibenz(a,h)anthracene, and trichloroethene (TCE). Specifically: (1) The soil beneath and laterally outward from former underground storage tanks at CAS 23-02-08 contains TPH-diesel-range organics (DRO) above the PAL of 100 milligrams per kilogram, confined vertically from a depth of approximately 400 feet (ft) below ground surface (bgs). The contamination is confined to 12.5 ft bgs to the subsurface media and laterally within approximately 100 ft of the release. (2) A single soil sample collected from the depth of 99 to 100 ft bgs demonstrated the presence of TCE at a concentration above the PAL. (3) Two soil samples collected from depths of 198 to 199 ft bgs and 380 to 382 ft bgs demonstrated the presence of benzo(a)pyrene at a concentration above the PAL. (4) Two soil samples collected from depths of 240 to 241 ft bgs and 290 to 291 ft bgs demonstrated the presence of dibenz(a,h)anthracene at a concentration above the PAL. Tier 2 final action levels (FALs) were then calculated for these contaminants. The Tier 2 FALs for TCE, benzo(a)pyrene, and dibenz(a,h)anthracene were calculated based on a limited exposure to subsurface contamination scenario, and the Tier 2 FAL for TPH-DRO was established as the U.S. Environmental Protection Agency Region 9 Preliminary Remediation Goal values for the individual hazardous constituents of diesel. The evaluation of TPH-DRO, benzo(a)pyrene, dibenz(a,h)anthracene, and TCE based on the Tier 2 FALs determined that no FALs were exceeded. Therefore, the DQO data needs were met, and it was determined that no corrective action (based on risk to human receptors) is necessary for the site.

Evenson, Grant



Microsoft PowerPoint - Romanosky  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fossil Energy's HBCU Research Activities Fossil Energy's HBCU Research Activities Robert R. Romanosky, Advanced Research Technology Manager Washington DC July 09, 2009 2 * Innovations for Existing Plants * Gasification * Turbines * Fuel Cells * Sequestration * Fuels * Advanced Research Strategic Center for Coal Program 3 Fossil Energy Program Outline Basic Research Applied Research Process & Engineering Development Demonstration & Commercialization I n d u s t r y P a r t i c i p a t i o n & C o s t S h a r i n g I n c r e a s e s CCPI, PPII, CCT Demos FutureGen Fossil Energy Core Programs (e.g Gasification, Turbines) Office of Science Research Fossil Energy Advanced Research Public Benefits DOE Research Programs NETL's Energy RD&D Portfolio 4 Ultra-Clean Energy Plant CO2 S eq uestration O x y ge n M e m b ra n e Ele c tric ity Pr o c es s H e a t/ Ste a m P OWE R FU EL S


Addendum to the Closure Report for Corrective Action Unit 165: Area 25 and 26 Dry Well and Washdown Areas, Nevada Test Site, Nevada, Revision 0  

SciTech Connect

This document constitutes an addendum to the Closure Report for Corrective Action Unit 165: Area 25 and 26 Dry Well and Washdown Areas, Nevada Test Site, Nevada as described in the document Recommendations and Justifications To Remove Use Restrictions Established under the U.S. Department of Energy, National Nuclear Security Administration Nevada Field Office Federal Facility Agreement and Consent Order dated September 2013. The Use Restriction Removal document was approved by the Nevada Division of Environmental Protection on October 16, 2013. The approval of the UR Removal document constituted approval of each of the recommended UR removals. In conformance with the UR Removal document, this addendum consists of: This page that refers the reader to the UR Removal document for additional information The cover, title, and signature pages of the UR Removal document The NDEP approval letter The corresponding section of the UR Removal document This addendum provides the documentation justifying the cancellation of the UR for CAS 25-20-01, Lab Drain Dry Well. This UR was established as part of FFACO corrective actions and was based on the presence of tetrachloroethene contamination at concentrations greater than the action level established at the time of the initial investigation. Although total petroleum hydrocarbon diesel-range organics contamination at concentrations greater than the NDEP action level was present at the site, no hazardous constituents of TPH-DRO exceeded the U.S. Environmental Protection Agency (EPA) Region 9 preliminary remediation goals established at the time of the initial investigation.

Krauss, Mark J.



Experimental shellside flow visualization in a shell and tube heat exchanger  

E-Print Network (OSTI)

Shell and tube heat exchangers are an extremely effective and mechanically feasible method of transferring thermal energy between two fluids. There is great demand for effective design methods capable of producing highly efficient models. To further improve efficiency, there must be an increased understanding of the physics of shellside flow at a local level. To accomplish this end, an experimental investigation was conducted to obtain flow visualization and internal local pressure drop information in the shellside flow. A scale-model shell and tube heat exchanger with an outer diameter of 30.5 cm and a length of 61 cm was designed and constructed out of acrylic. Water was utilized as the working fluid and flowrates ranging from 0.32 to 2.21 L/s were studied. Flow visualization photographs confirmed the existence of leakage streams and recirculation zones. Anomalous vortices were also detected under certain circumstances. Global experimental pressure drops were in good agreement with values predicted from other methods. Local internal pressure dro s were also recorded for the first time and were in good agreement with what would be expected from conventional theory.

Fischer, Matthew Winslow



Word Pro - Untitled1  

U.S. Energy Information Administration (EIA) Indexed Site

3 3 Table 2.5 Household 1 Energy Consumption and Expenditures by End Use, Selected Years, 1978-2005 Year Space Heating Air Conditioning Water Heating Appliances, 2 Electronics, and Lighting Natural Gas Elec- tricity 3 Fuel Oil 4 LPG 5 Total Electricity 3 Natural Gas Elec- tricity 3 Fuel Oil 4 LPG 5 Total Natural Gas Elec- tricity 3 LPG 5 Total Consumption (quadrillion Btu) 1978 4.26 0.40 2.05 0.23 6.94 0.31 1.04 0.29 0.14 0.06 1.53 0.28 1.46 0.03 1.77 1980 3.41 .27 1.30 .23 5.21 .36 1.15 .30 .22 .07 1.74 .36 1.54 .05 1.95 1981 3.69 .26 1.06 .21 5.22 .34 1.13 .30 .22 .06 1.71 .43 1.52 .05 2.00 1982 3.14 .25 1.04 .19 4.62 .31 1.15 .28 .15 .06 1.64 .43 1.50 .05 1.98 1984 3.51 .25 1.11 .21 5.08 .32 1.10 .32 .15 .06 1.63 .35 1.59 .04 1.98 1987 3.38 .28 1.05 .22 4.93 .44 1.10 .31 .17 .06 1.64 .34 1.72 .04 2.10 1990 3.37 .30 .93 .19 4.79 .48 1.16 .34 .11 .06 1.67 .33 1.91 .03 2.27 1993 3.67


Table 3. Top Five Retailers of Electricity, with End Use Sectors, 2010  

U.S. Energy Information Administration (EIA) Indexed Site

Rhode Island" Rhode Island" "1. The Narragansett Electric Co","Investor-Owned",5287440,3068731,1938910,279799,"-" "2. Constellation NewEnergy, Inc","Other Provider",594900,"-",387627,191168,16105 "3. TransCanada Power Mktg Ltd","Other Provider",501659,"-","-",501659,"-" "4. Hess Retail Natural Gas and Elec. Acctg.","Other Provider",389583,"-",116875,272708,"-" "5. Glacial Energy Holdings","Other Provider",283973,"-",283973,"-","-" "Total Sales, Top Five Providers",,7057555,3068731,2727385,1245334,16105 "Percent of Total State Sales",,90,98,74,100,59


"1. Beluga","Gas","Chugach Electric Assn Inc",344 "2. George M Sullivan Generation Plant 2","Gas","Anchorage Municipal Light and Power",220  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska" Alaska" "1. Beluga","Gas","Chugach Electric Assn Inc",344 "2. George M Sullivan Generation Plant 2","Gas","Anchorage Municipal Light and Power",220 "3. North Pole","Petroleum","Golden Valley Elec Assn Inc",144 "4. Bradley Lake","Hydroelectric","Homer Electric Assn Inc",126 "5. Anchorage 1","Gas","Anchorage Municipal Light and Power",88 "6. Snettisham","Hydroelectric","Alaska Electric Light&Power Co",78 "7. Bernice Lake","Gas","Chugach Electric Assn Inc",62 "8. Lemon Creek","Petroleum","Alaska Electric Light&Power Co",58


Awardee AwardeeHeadquarters RecoveryFunding TotalValue Tech Inc Pittsburgh Pennsylvania  

Open Energy Info (EERE)

Pittsburgh Pennsylvania Pittsburgh Pennsylvania Duluth Minnesota Amber Kinetics Inc Fremont California American Transmission Company LLC Waukesha Wisconsin American Transmission Company LLC Waukesha Wisconsin Atlantic City Electric Co Mays Landing New Jersey Spokane Washington Baltimore Gas Electric Co Baltimore Maryland Battelle Memorial Institute Pacific Northwest Division Richland Washington Beacon Power Corporation Tyngsboro Massachusetts Black Hills Power Inc Rapid City South Dakota Black Hills Colorado Elec Utility Co LP Pueblo Colorado City of Burbank Water and Power California Utility Company Burbank California Center for the Commercialization of Electric Technologies Austin Texas CenterPoint Energy Houston Texas Central Lincoln People s Utility District Newport Oregon


Simulating permanent magnet brushless motors in DYMOLA  

E-Print Network (OSTI)

Multi-domain dynamic simulation is becoming an issue in the design of high performance mechatronic systems, where advances are foreseen only if the mutual interaction of different parts of the system is well understood. The modelling environment provided by DYMOLA with Modelica language proved to be ideal for studying the mutual effects of mechanics, elec- tronics and control in a brushless motor, whose model has been conceived as one of the building blocks of a wider project, aimed at simulating a complete machining centre. Details on the model of the brushless motor as well as on its simulation are given in the present pa- per.

G. Ferretti; G. Magnani; P. Rocco; L. Bonometti; M. Maraglino



FEG2002 9_30_01.p65  

NLE Websites -- All DOE Office Websites (Extended Search)

6 6 ABBREVIATIONS: .............. Highest MPG in class A- .......... Automatic Transmission A-S ........ Special Automatic Transmission AV ......... Continuously variable Transmission Cty ......... MPG on City Test Procedure CNG ...... Compressed Natural Gas Cyl ......... Number of Cylinders D ........... Diesel DOHC ... Double Overhead Cam E85 ........ 85% Ethanol/15% Gasoline Elec ....... Electric Vehicle Eng ........ Engine Volume in Liters FFV ....... Flexible Fuel Vehicle Hwy ....... MPG on Highway Test Procedure LPG ....... Liquified Petroleum Gas M- .......... Manual Transmission NA ......... Not Available P ............ Premium Gasoline SOHC .... Single Overhead Cam T ............ Turbocharger/Supercharger Trans ..... Transmission Type Tax ........ Subject to Gas Guzzler Tax VTEC .... Variable Valve Timing and Lift



NLE Websites -- All DOE Office Websites (Extended Search)

5 5 L ABBREVIATIONS: .............. Highest MPG in class A- .......... Automatic Transmission A-S ........ Special Automatic Transmission AV ......... Continuously Variable Transmission AWD ...... All Wheel Drive City ........ MPG on City Test Procedure CNG ...... Compressed Natural Gas Conv ...... Convertible Convsn .. Conversion D ........... Diesel E85 ........ 85% Ethanol/15% Gasoline Elec ....... Electric Vehicle Eng Size Engine Volume in Liters FFV ....... Flexible Fuel Vehicle FWD ...... Front Wheel Drive Hwy ....... MPG on Highway Test Procedure LPG ....... Liquified Petroleum Gas M- .......... Manual Transmission NA ......... Not Available P ............ Premium Gasoline Tax ........ Subject to Gas Guzzler Tax Trans ..... Transmission Type VTEC .... Variable Valve Timing and Lift Electronic Control Trans


Table 3. Top Five Retailers of Electricity, with End Use Sectors, 2010  

U.S. Energy Information Administration (EIA) Indexed Site

District of Columbia" District of Columbia" "1. Potomac Electric Power Co","Investor-Owned",3388490,2014044,1374446,"-","-" "2. Constellation NewEnergy, Inc","Other Provider",2427380,"-",2369901,12091,45388 "3. PEPCO Energy Services","Other Provider",2099946,1012,2098934,"-","-" "4. Washington Gas Energy Services","Other Provider",1759773,39513,1720260,"-","-" "5. Hess Retail Natural Gas and Elec. Acctg.","Other Provider",801256,"-",536225,265031,"-" "Total Sales, Top Five Providers",,10476845,2054569,8099766,277122,45388 "Percent of Total State Sales",,88,97,88,100,14


Table 3. Top Five Retailers of Electricity, with End Use Sectors, 2010  

U.S. Energy Information Administration (EIA) Indexed Site

Maine" Maine" "1. NextEra Energy Power Marketing LLC","Other Provider",3876276,3548267,316308,11701,"-" "2. Dominion Retail Inc","Other Provider",1308742,"-",1308742,"-","-" "3. Constellation NewEnergy, Inc","Other Provider",987998,"-",704002,283996,"-" "4. Hess Retail Natural Gas and Elec. Acctg.","Other Provider",593324,"-",593324,"-","-" "5. Suez Energy Resources North America","Other Provider",483466,"-",483466,"-","-" "Total Sales, Top Five Providers",,7249806,3548267,3405842,295697,"-" "Percent of Total State Sales",,63,81,83,10



U.S. Energy Information Administration (EIA) Indexed Site

3. Cooking Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 3. Cooking Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings* Build- ings with Cooking Cooking Energy Sources (more than one may apply) All Build- ings* Build- ings with Cooking Cooking Energy Sources (more than one may apply) Elec- tricity Natural Gas Propane Elec- tricity Natural Gas Propane All Buildings* ............................... 4,645 801 410 457 108 64,783 22,237 13,161 15,438 1,460 Building Floorspace (Square Feet) 1,001 to 5,000 ................................ 2,552 354 170 183 63 6,789 997 493 549 165 5,001 to 10,000 .............................. 889 155 82 88 Q 6,585 1,136 621 641 Q 10,001 to 25,000 ............................ 738 127 59 75 Q 11,535 1,954 961 1,115 Q


Alaska Village Cooperative Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Alaska Village Cooperative Wind Farm Alaska Village Cooperative Wind Farm Jump to: navigation, search Name Alaska Village Cooperative Wind Farm Facility Alaska Village Cooperative Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Alaska Village Elec Coop Developer Kotzebue Electric Association Energy Purchaser Alaska Village Elec Coop Location Toksook Bay AK Coordinates 60.5315°, -165.109° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":60.5315,"lon":-165.109,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "dro elec tric" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Data:1b13f76f-9b4e-4340-ab95-7647b78e88aa | Open Energy Information  

Open Energy Info (EERE)

f-9b4e-4340-ab95-7647b78e88aa f-9b4e-4340-ab95-7647b78e88aa No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Mid-Yellowstone Elec Coop, Inc Effective date: 2011/10/20 End date if known: Rate name: Irrigation Service < 200 HP Sector: Commercial Description: Averaging less than 200 HP of billed HP per season. Source or reference: https://cas.sharepoint.illinoisstate.edu/grants/Sunshot/Lists/DATA%20ENTRY%20Database%20Now%20Compatible%20with%20Rates/Attachments/42/Mid-Yellowstone%20Elec%20Coop,%20Inc%20Rates.pdf Source Parent: Comments Seasonal minimum larger of $15.75 per hp of maximum seasonal demand, or power contract.



U.S. Energy Information Administration (EIA) Indexed Site

0,1,2793,22377,4245,26473,1051,9324,549,3057,8638,61231 0,1,2793,22377,4245,26473,1051,9324,549,3057,8638,61231 213,"Alaska Electric Light&Power Co","AK",90,1,1095,14242,243,3072,233,3806,429,5357,2000,26477 221,"Alaska Village Elec Coop Inc","AK",90,1,651,1598,166,477,0,0,537,1601,1354,3676 599,"Anchorage City of","AK",90,1,1567,17705,4596,57345,0,0,111,986,6274,76036 3522,"Chugach Electric Assn Inc","AK",90,1,3886,50405,2419,39292,126,2737,102,760,6533,93194 6129,"Fairbanks City of","AK",90,1,300,3318,1012,9834,0,0,103,1107,1415,14259 7353,"Golden Valley Elec Assn Inc","AK",90,1,2156,22656,1350,14187,583,8460,11,145,4100,45448 9680,"Klukwan Indian Village","AK",90,1,5,130,0,0,0,0,0,0,5,130



Gasoline and Diesel Fuel Update (EIA)

Energy Information Administration / Natural Gas Annual 1998 Southern California Gas Co......................... 271,780,410 110,726,162 278,809,422 1,818,869 138,826,184 801,961,047 Pacific Gas and Elec Co.............................. 225,881,609 152,010,740 174,660,660 530,262 125,268,956 678,352,227 Midcon Texas P L Operator Inc................... 0 0 552,267,806 0 109,741,739 662,009,545 Lone Star Gas Co ........................................ 84,559,915 39,926,208 265,224,831 0 172,286,535 561,997,489 Northern Illinois Gas Co .............................. 205,099,056 82,609,756 133,712,245 2,251 48,524,867 469,948,175 Columbia Gas Dist Co ................................. 151,708,989 89,151,761 177,068,077 18,365 833,281 418,780,473 Pub Svc Elec and Gas Co ........................... 126,142,540 110,995,082 142,801,508


International Energy Outlook 2007  

Gasoline and Diesel Fuel Update (EIA)

generation nearly doubles in the IEO2007 reference case from 2004 to 2030. generation nearly doubles in the IEO2007 reference case from 2004 to 2030. In 2030, generation in the non-OECD countries is projected to exceed generation in the OECD countries by 30 percent. In the IEO2007 reference case, world demand for elec- tricity advances strongly from 2004 to 2030. Global elec- tricity generation increases by 2.4 percent per year over the projection period, from 16,424 billion kilowatthours in 2004 to 30,364 billion kilowatthours in 2030 (Figure 60). Much of the growth in electric power demand is pro- jected for nations outside the OECD. Although the non-OECD nations consumed 26 percent less electricity than the OECD nations in 2004, total electricity genera- tion in the non-OECD region in 2030 is projected to exceed generation in the OECD by 30 percent (Figure 61). Total electricity demand in the non-OECD nations is expected



Gasoline and Diesel Fuel Update (EIA)

0. Cooling Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 0. Cooling Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings* Build- ings with Cooling Cooling Energy Sources (more than one may apply) All Build- ings* Build- ings with Cooling Cooling Energy Sources (more than one may apply) Elec- tricity Natural Gas District Chilled Water Elec- tricity Natural Gas District Chilled Water All Buildings* ............................... 4,645 3,625 3,589 17 33 64,783 56,940 54,321 1,018 2,853 Building Floorspace (Square Feet) 1,001 to 5,000 ................................ 2,552 1,841 1,838 Q Q 6,789 5,007 4,994 Q Q 5,001 to 10,000 .............................. 889 732 727 Q Q 6,585 5,408 5,367 Q Q



Gasoline and Diesel Fuel Update (EIA)

4 4 Energy Information Administration / Natural Gas Annual 1999 Southern California Gas Co......................... 277,719,484 114,941,064 269,458,175 2,169,770 82,219,615 746,508,108 Pacific Gas and Elec Co.............................. 236,015,345 109,165,123 173,522,808 743,788 40,977,372 560,424,436 Lone Star Gas Co ........................................ 69,066,379 47,818,632 278,167,278 0 127,909,424 522,961,713 Nicor Gas..................................................... 222,803,478 91,585,840 137,592,440 5,656 37,794,659 489,782,073 Midcon Texas P L Operator Inc................... 0 0 365,563,289 0 114,011,139 479,574,428 Columbia Gas Dist Co ................................. 167,055,264 94,607,073 180,274,855 11,992 445,223 442,394,407 Pub Svc Elec and Gas Co ........................... 133,426,119 124,790,684



Gasoline and Diesel Fuel Update (EIA)

5 5 Southern California Gas Co......................... 239,806,156 103,413,827 284,215,130 1,109,160 157,653,320 786,197,593 Pacific Gas and Elec Co.............................. 193,084,756 132,564,645 157,954,353 608,896 145,959,132 630,171,782 Lone Star Gas Co ........................................ 100,079,759 39,125,204 331,114,725 0 124,116,343 594,436,031 Midcon Texas P L Operator Inc................... 0 0 474,624,481 0 109,413,069 584,037,550 Northern Illinois Gas Co .............................. 249,453,348 95,871,972 143,206,591 1,537 39,419,013 527,952,461 Columbia Gas Dist Co ................................. 183,896,512 102,145,657 175,997,075 30,684 580,790 462,650,718 Pub Svc Elec and Gas Co ........................... 138,404,765 130,108,996 135,651,934 0 13,184,142 417,349,837 Michigan Consol Gas Co .............................



U.S. Energy Information Administration (EIA) Indexed Site

2,1,2977,21737,4371,26706,122,668,639,3188,8109,52299 2,1,2977,21737,4371,26706,122,668,639,3188,8109,52299 213,"Alaska Electric Light&Power Co","AK",92,1,1119,13141,257,3165,235,3715,468,5610,2079,25631 221,"Alaska Village Elec Coop Inc","AK",92,1,702,1675,188,513,0,0,607,1745,1497,3933 599,"Anchorage City of","AK",92,1,1404,15097,4238,55346,0,0,115,1356,5757,71799 3522,"Chugach Electric Assn Inc","AK",92,1,4098,47343,2678,39679,146,2608,114,747,7036,90377 6129,"Fairbanks City of","AK",92,1,278,2999,1003,9762,0,0,114,1166,1395,13927 7353,"Golden Valley Elec Assn Inc","AK",92,1,2084,22084,1418,15680,645,9884,11,116,4158,47764 9680,"Klukwan Indian Village","AK",92,1,6,84,0,0,0,0,0,0,6,84


Closure Report for Corrective Action Units 530, 531, 532, 533, 534, 535: NTS Mud Pits, Nevada Test Site, Nevada, Rev. No.: 0  

SciTech Connect

This Closure Report (CR) presents information supporting the recommendation of no further action for the following six Corrective Action Units (CAUs): (1) CAU 530 - LANL Preshot Mud Pits; (2) CAU 531 - LANL Postshot Mud Pits; (3) CAU 532 - LLNL Preshot Mud Pits; (4) CAU 533 - LLNL Postshot Mud Pits; (5) CAU 534 - Exploratory/Instrumentation Mud Pits; and (6) CAU 535 - Mud Pits/Disposal Areas. This CR complies with the requirements of the ''Federal Facility Agreement and Consent Order'' (FFACO) (1996) that was agreed to by the State of Nevada, the U.S. Department of Energy, and the U.S. Department of Defense. CAUs 530-535 are located in Areas 1-10, 14, 17, 19, and 20 of the Nevada Test Site and are comprised of 268 Corrective Action Sites (CASs) listed in Table 1-1. The purpose of this CR is to validate the risk-based closure strategy presented in the ''Mud Pit Risk-Based Closure Strategy Report'' (RBCSR) (NNSA/NSO, 2004) and the CAUs 530-535 SAFER Plan (NNSA/NSO, 2005b). This strategy uses 52 CASs as a statistical representation of CAUs 530-535 to confirm the proposed closure alternative, no further action, is sufficient to protect human health and the environment. This was accomplished with the following activities: A field investigation following a probabilistic sampling design to collect data that were used in a non-carcinogenic risk assessment for human receptors; Visual habitat surveys to confirm the lack of habitat for threatened and endangered species; Disposal of debris and waste generated during field activities; and Document Notice of Completion and closure of CAUs 530-535 issued by Nevada Division of Environmental Protection. The field investigation and site visits were conducted between August 31, 2005 and February 21, 2006. As stated in the RBCSR and Streamlined Approach for Environmental Restoration (SAFER) Plan, total petroleum hydrocarbons-diesel-range organics (TPH-DRO) was the only contaminant of potential concern identified for CAUs 530-535. This analyte was detected in 22 percent of the soil samples, but the risk assessment confirmed that the reported levels did not pose an unacceptable risk to human receptors (i.e., the associated Hazard Index for each CAS is {le} 1.0). A data quality assessment was performed on the collected TPH-DRO data to confirm they were of sufficient quality and quantity to satisfy the data quality objective decisions. The collected dataset met all the criteria specified in the SAFER Plan. Visual habitat surveys were conducted at 201 CASs and confirmed that the mud pit CASs are not suitable habitat for threatened or endangered species. Based on these activities, there is also no unacceptable risk to ecological receptors. These results support the recommended closure alternative of no further action for the 268 CASs within CAUs 530-535.

Alfred Wickline



Phase conjugation of high energy lasers.  

Science Conference Proceedings (OSTI)

In this report we explore claims that phase conjugation of high energy lasers by stimulated Brillouin scattering (SBS) can compensate optical aberrations associated with severely distorted laser amplifier media and aberrations induced by the atmosphere. The SBS media tested was a gas cell pressurized up to 300 psi with SF6 or Xe or both. The laser was a 10 Hz, 3J, Q-switched Nd:YAG with 25 ns wide pulses. Atmospheric aberrations were created with space heaters, helium jets and phase plates designed with a Kolmogorov turbulence spectrum characterized by a Fried parameter, ro , ranging from 0.6 - 6.0 mm. Phase conjugate tests in the laboratory were conducted without amplification. For the strongest aberrations, D/ro ~ 20, created by combining the space heaters with the phase plate, the Strehl ratio was degraded by a factor of ~50. Phase conjugation in SF6 restored the peak focusable intensity to about 30% of the original laser. Phase conjugate tests at the outdoor laser range were conducted with laser amplifiers providing gain in combination with the SBS cell. A large 600,000 BTU kerosene space heater was used to create turbulence along the beam path. An atmospheric structure factor of Cn2 = 5x10-13 m2/3 caused the illumination beam to expand to a diameter 250mm and overfill the receiver. The phase conjugate amplified return could successfully be targeted back onto glints 5mm in diameter. Use of a lenslet arrays to lower the peak focusable intensity in the SBS cell failed to produce a useful phase conjugate beam; The Strehl ratio was degraded with multiple random lobes instead of a single focus. I will review literature results which show how multiple beams can be coherently combined by SBS when a confocal reflecting geometry is used to focus the laser in the SBS cell.

Bliss, David Emery; Valley, Michael T.; Atherton, Briggs W.; Bigman, Verle; Boye, Lydia Ann; Broyles, Robin Scott; Kimmel, Mark W.; Law, Ryan J.; Yoder, James R.



Corrective Action Decision Document/Closure Report for Corrective Action Unit 554: Area 23 Release Site Nevada Test Site, Nevada, Revision 0  

Science Conference Proceedings (OSTI)

This Corrective Action Decision Document/Closure Report has been prepared for Corrective Action Unit 554, Area 23 Release Site, located in Mercury at the Nevada Test Site, Nevada, in accordance with the ''Federal Facility Agreement and Consent Order'' (1996). Corrective Action Unit (CAU) 554 is comprised of one corrective action site (CAS): (1) CAS 23-02-08, USTs 23-115-1, 2, 3/Spill 530-90-002. The purpose of this Corrective Action Decision Document/Closure Report is to provide justification and documentation supporting the recommendation for closure of CAU 554 with no further corrective action. To achieve this, corrective action investigation (CAI) activities were performed from January 18 through May 5, 2005, as set forth in the ''Corrective Action Investigation Plan for Corrective Action Unit 554: Area 23 Release Site'' (NNSA/NSO, 2004) and Records of Technical Change No. 1 and No. 2. The purpose of the CAI was to fulfill the following data needs as defined during the data quality objective (DQO) process: (1) Determine whether contaminants of concern are present. (2) If contaminants of concern are present, determine their nature and extent. (3) Provide sufficient information and data to complete appropriate corrective actions. The CAU 554 dataset from the investigation results was evaluated based on the data quality indicator parameters. This evaluation demonstrated the quality and acceptability of the dataset for use in fulfilling the DQO data needs. Analytes detected during the CAI were evaluated against preliminary action levels (PALs) established in the CAU 554 CAIP for total petroleum hydrocarbons (TPH) benzo(a)pyrene, dibenz(a,h)anthracene, and trichloroethene (TCE). Specifically: (1) The soil beneath and laterally outward from former underground storage tanks at CAS 23-02-08 contains TPH-diesel-range organics (DRO) above the PAL of 100 milligrams per kilogram, confined vertically from a depth of approximately 400 feet (ft) below ground surface (bgs). The contamination is confined to 12.5 ft bgs to the subsurface media and laterally within approximately 100 ft of the release. (2) A single soil sample collected from the depth of 99 to 100 ft bgs demonstrated the presence of TCE at a concentration above the PAL. (3) Two soil samples collected from depths of 198 to 199 ft bgs and 380 to 382 ft bgs demonstrated the presence of benzo(a)pyrene at a concentration above the PAL. (4) Two soil samples collected from depths of 240 to 241 ft bgs and 290 to 291 ft bgs demonstrated the presence of dibenz(a,h)anthracene at a concentration above the PAL. Tier 2 final action levels (FALs) were then calculated for these contaminants. The Tier 2 FALs for TCE, benzo(a)pyrene, and dibenz(a,h)anthracene were calculated based on a limited exposure to subsurface contamination scenario, and the Tier 2 FAL for TPH-DRO was established as the U.S. Environmental Protection Agency Region 9 Preliminary Remediation Goal values for the individual hazardous constituents of diesel. The evaluation of TPH-DRO, benzo(a)pyrene, dibenz(a,h)anthracene, and TCE based on the Tier 2 FALs determined that no FALs were exceeded. Therefore, the DQO data needs were met, and it was determined that no corrective action (based on risk to human receptors) is necessary for the site. As a best management practice for the remaining subsurface diesel contamination present at the site, a use restriction was imposed on future site activities that would not allow for future contact of the subsurface contamination. Therefore, the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office provides the following recommendations: (1) No further corrective action for CAU 554. (2) No Corrective Action Plan. (3) A Notice of Completion to the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office is requested from the Nevada Division of Environmental Protection for closure of CAU 554. (4) Corrective Action Unit 554 should be moved from Appendix III to Appendix IV of the Federal Facility Agreement and Consent Order.

Evenson, Grant



Data:76ed6fbf-e500-4b84-aab9-a0ce4d3e4733 | Open Energy Information  

Open Energy Info (EERE)

fbf-e500-4b84-aab9-a0ce4d3e4733 fbf-e500-4b84-aab9-a0ce4d3e4733 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Southern Indiana Gas & Elec Co Effective date: 2011/05/03 End date if known: Rate name: OL - 200 watt HPS - Directional Luminaire Sector: Lighting Description: AVAILABILITY This Rate Schedule shall be available throughout Company's Service Area, subject to the availability of adequate facilities and power supplies, which determinations shall be within Company's reasonable discretion. APPLICABILITY This Rate Schedule shall be applicable for outdoor lighting to any Customer including Community Organizations or Real Estate Developers.


Data:4d7b9447-c318-4a69-9d97-ddc5f6b04579 | Open Energy Information  

Open Energy Info (EERE)

b9447-c318-4a69-9d97-ddc5f6b04579 b9447-c318-4a69-9d97-ddc5f6b04579 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Southern Indiana Gas & Elec Co Effective date: 2011/05/03 End date if known: Rate name: SL-1 - B - 175 watt - Twin Arm - Underground Sector: Commercial Description: AVAILABILITY This Rate Schedule shall be available throughout Company's Service Area, subject to the availability of adequate facilities and power supplies, which determinations shall be within Company's reasonable discretion. APPLICABILITY This Rate Schedule shall be applicable for standard street and highway lighting service to any Customer which is a Municipal Corporation.


Data:45374021-97cd-4c7e-ba6e-1d71437f4394 | Open Energy Information  

Open Energy Info (EERE)

-97cd-4c7e-ba6e-1d71437f4394 -97cd-4c7e-ba6e-1d71437f4394 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Natchez Trace Elec Power Assn Effective date: End date if known: Rate name: Outdoor Lighting MV 400 W Dedicated Pole & Transformer Sector: Lighting Description: Source or reference: http://www.ntepa.com/ Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous


Data:C089ecd4-3d8d-4fba-9655-338ed64b9eab | Open Energy Information  

Open Energy Info (EERE)

ecd4-3d8d-4fba-9655-338ed64b9eab ecd4-3d8d-4fba-9655-338ed64b9eab No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Tri-County Elec Member Corp (North Carolina) Effective date: 2010/07/01 End date if known: Rate name: Residential Rate Schedule Sector: Residential Description: Source or reference: http://www.tcemc.org/rates.aspx Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>


Data:1af5a767-257e-43a2-a6e8-dfbcdfbf7004 | Open Energy Information  

Open Energy Info (EERE)

a767-257e-43a2-a6e8-dfbcdfbf7004 a767-257e-43a2-a6e8-dfbcdfbf7004 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of New Bern, North Carolina (Utility Company) Effective date: 2008/07/01 End date if known: Rate name: Street Lighting Service - Underground 7000 Lumen Mercury Vapor (1 light per 10 customers) - Metal Pole Sector: Lighting Description: Source or reference: www.newbern-nc.org/Elec/documents/SLS32B2009.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V):


Data:7da98bb6-e217-44f6-a961-9545892d9028 | Open Energy Information  

Open Energy Info (EERE)

bb6-e217-44f6-a961-9545892d9028 bb6-e217-44f6-a961-9545892d9028 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Wright-Hennepin Coop Elec Assn Effective date: 2010/08/01 End date if known: Rate name: Security and Street Lights: Parkway Decorative 2-250 Watt HPS Sector: Lighting Description: Source or reference: www.whe.org Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>


Data:80dcbd90-dff7-4d5e-842a-006ef396b889 | Open Energy Information  

Open Energy Info (EERE)

dcbd90-dff7-4d5e-842a-006ef396b889 dcbd90-dff7-4d5e-842a-006ef396b889 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Puget Sound Energy Inc Effective date: 2013/07/01 End date if known: Rate name: Company Street Lights-105 watt Sector: Lighting Description: Source or reference: http://pse.com/aboutpse/Rates/Documents/elec_sch_053.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>


Data:65d47992-ad60-4857-80cf-939ce8589831 | Open Energy Information  

Open Energy Info (EERE)

2-ad60-4857-80cf-939ce8589831 2-ad60-4857-80cf-939ce8589831 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bailey County Elec Coop Assn Effective date: 2004/03/01 End date if known: Rate name: Farm & Home service 1O Sector: Residential Description: There will be a $1.00 per KVA over 10 KVA charge applicable to this rate. Source or reference: Rate Binder 5, Illinois State University Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service


Data:6cee25fa-80a5-434f-a15e-611da439602d | Open Energy Information  

Open Energy Info (EERE)

5fa-80a5-434f-a15e-611da439602d 5fa-80a5-434f-a15e-611da439602d No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Southern Indiana Gas & Elec Co Effective date: 2011/05/03 End date if known: Rate name: OL - 175 watt MV Sector: Lighting Description: AVAILABILITY This Rate Schedule shall be available throughout Company's Service Area, subject to the availability of adequate facilities and power supplies, which determinations shall be within Company's reasonable discretion. APPLICABILITY This Rate Schedule shall be applicable for outdoor lighting to any Customer including Community Organizations or Real Estate Developers.