Sample records for download shapefile zip

  1. 2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.

    E-Print Network [OSTI]

    Daniels, Jeffrey J.

    Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

  2. The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or

    E-Print Network [OSTI]

    1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta

  3. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  4. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  5. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  6. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  7. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  8. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  9. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  10. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  11. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  12. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  13. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  14. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  15. Zipping mechanism for force-generation by growing filament bundles

    E-Print Network [OSTI]

    Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

    2011-03-02T23:59:59.000Z

    We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

  16. ZipZone Technologies | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

  17. REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY

    E-Print Network [OSTI]

    Weaver, Benjamin Patrick

    2009-04-06T23:59:59.000Z

    The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

  18. Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along

    E-Print Network [OSTI]

    VanRullen, Rufin

    Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

  19. NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER

    E-Print Network [OSTI]

    NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

  20. Protein folding by zipping and assembly S. Banu Ozkan*

    E-Print Network [OSTI]

    Southern California, University of

    Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

  1. Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP

    E-Print Network [OSTI]

    Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

  2. Property:Incentive/Cont2Zip | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

  3. Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory

    E-Print Network [OSTI]

    Helmstetter, Fred J.

    Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

  4. INSTRUCTIONS for DOWNLOADING COURSE ROSTERS

    E-Print Network [OSTI]

    saerens

    2009-02-27T23:59:59.000Z

    Feb 27, 2009 ... Please view rather than print this information. A version without pictures is ... 3d Click on the file Download my Course Rosters. Picture of my†...

  5. Downloads | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesDataTranslocationDiurnal CycleDonald1 Jul 2002 to10 JanDownloads

  6. Downloads | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesDataTranslocationDiurnal CycleDonald1 Jul 2002 to10Downloads Topic

  7. Downloads | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-Series to UserProduct:Directives Templates8. U.S.Donald R.DouglasDownloads Topic

  8. Downloads | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-Series to UserProduct:Directives Templates8. U.S.Donald R.DouglasDownloads

  9. Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code

    E-Print Network [OSTI]

    Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

  10. ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY

    E-Print Network [OSTI]

    Ohta, Shigemi

    86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

  11. Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP

    E-Print Network [OSTI]

    Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

  12. How to download your course rosters

    E-Print Network [OSTI]

    saerens

    2008-12-08T23:59:59.000Z

    Please view rather than print documents. Graduate instructors and ... 3d Click on the file Download my Course Rosters. 4 If need be, select the relevant semester†...

  13. How to download your course rosters

    E-Print Network [OSTI]

    saerens

    2008-12-08T23:59:59.000Z

    Please view rather than print documents. Graduate instructors and ... 3d Click on the file Download my Course Rosters. Picture of my myPurdue Home page†...

  14. Download

    E-Print Network [OSTI]

    2003-10-20T23:59:59.000Z

    Oct 20, 2003 ... Then more than a dozen software packages for complete global .... Holland [137] introduced in 1973 genetic algorithms, till today a .... free energy) corresponds to the situation matching reality; .... (including simulated annealing). ..... conditions, and a comparison of their function values shows that R is the†...

  15. Download

    E-Print Network [OSTI]

    2008-03-31T23:59:59.000Z

    Constraints (9) are the integrity constraints for the cycle variables. We can ..... As s and t are symmetric as well as U and V \\ U, we will only consider two cases :.

  16. Download

    E-Print Network [OSTI]

    2010-08-18T23:59:59.000Z

    The maximal deviation at time tn? ?1 is then the harmonic number n??2. ? i=0 ?n? (ti) = n??2. ? i=0. 1 ..... totic stability. Journal of Differential Equations 233,†...

  17. Download

    E-Print Network [OSTI]

    2004-03-13T23:59:59.000Z

    Mar 13, 2004 ... he was affiliated with Departamento de CiÍncias da Terra, Universidade de Coimbra,. 3000 Coimbra, Portugal. (M.G.C. Resende) Internet and†...

  18. Download

    E-Print Network [OSTI]

    G Bao et al

    2010-06-29T23:59:59.000Z

    Jul 1, 2010 ... To overcome these difficulties, a stable and efficient recursive .... model problems

  19. Download

    E-Print Network [OSTI]

    2007-05-15T23:59:59.000Z

    Optimisation of irradiation directions in IMRT treatment. Proc. Of the 37th. Annual Conf. of the Oper. Res. Soc. Of New Zealand. [22] Langer, M., R. Brown, M. Urie†...

  20. Download

    E-Print Network [OSTI]

    2004-12-01T23:59:59.000Z

    Dec 1, 2004 ... Nonlinear optimization for seismic travel time tomography. Geophysical Journal International, 115:929Ė940, 1993. [30] J. S. Shahabuddin.

  1. Downloadable

    E-Print Network [OSTI]

    2012-09-24T23:59:59.000Z

    Sep 24, 2012 ... As in most Data Mining procedures, how to tune the parameters of a Support Vector. Machine (SVM) ..... flare-solar 34.50. -0.50 .... nested VNS, in which the parameters obtained as output when optimizing simpler models are.

  2. Download

    E-Print Network [OSTI]

    2008-04-15T23:59:59.000Z

    view the relevant literature and explain our approach for generating valid cuts. In Section ...... Finding the integer efficient frontier for quadratic capital budgeting†...

  3. Download

    E-Print Network [OSTI]

    2006-03-29T23:59:59.000Z

    to satisfy the different types of demands while limiting inventories and shortages. A survey of these problems can be found in [12]. In this paper, we consider a†...

  4. Download

    E-Print Network [OSTI]

    2012-06-11T23:59:59.000Z

    Wachter for taking a lot of organizational stuff from my shoulders, our chair Winfried ...... To further improve efficiency, we only dualize those constraints in every†...

  5. Download

    E-Print Network [OSTI]

    2015-03-20T23:59:59.000Z

    Mar 20, 2015 ... and Yang, L., editors, High Performance Computing and Communications, volume 4782 of Lecture Notes in Computer Science, pages 62Ė73.

  6. AVTA: 2012 Chevrolet Volt PHEV Downloadable Dynamometer Database...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Chevrolet Volt PHEV Downloadable Dynamometer Database Reports AVTA: 2012 Chevrolet Volt PHEV Downloadable Dynamometer Database Reports The Vehicle Technologies Office's Advanced...

  7. AVTA: 2012 Toyota Prius PHEV Downloadable Dynamometer Database...

    Energy Savers [EERE]

    Toyota Prius PHEV Downloadable Dynamometer Database Reports AVTA: 2012 Toyota Prius PHEV Downloadable Dynamometer Database Reports The Vehicle Technologies Office's Advanced...

  8. AVTA: 2010 Honda CR-Z Hybrid Downloadable Dynamometer Database...

    Energy Savers [EERE]

    CR-Z Hybrid Downloadable Dynamometer Database Reports AVTA: 2010 Honda CR-Z Hybrid Downloadable Dynamometer Database Reports The Vehicle Technologies Office's Advanced Vehicle...

  9. AVTA: 2009 Volkswagen Jetta TDI Diesel Downloadable Dynamometer...

    Energy Savers [EERE]

    09 Volkswagen Jetta TDI Diesel Downloadable Dynamometer Database Reports AVTA: 2009 Volkswagen Jetta TDI Diesel Downloadable Dynamometer Database Reports The Vehicle Technologies...

  10. Oil and Gas Company Oil and Gas Company Address Place Zip Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

  11. Building Footprints (Shapefile) of University of Kansas, Lawrence Campus

    E-Print Network [OSTI]

    Houser, Rhonda

    2011-02-18T23:59:59.000Z

    Data layer geneated with Intention to have basic building dataset for data analysis and generation of maps, for Lawrence Campus of the University of Kansas. Building outlines were digitized using ArcMap in ca. 2007 from aerial photograph to create...

  12. Client-Centered Energy and Delay Analysis for TCP Downloads

    E-Print Network [OSTI]

    Lowenthal, David

    convinces the server to send data in predictable bursts, trading lower WNIC energy cost for increased] trade reduced energy for potentially increased execution time. The focus of this paper is to allow mobile clients to trade download speed for energy savings during TCP downloads in a client

  13. This article was downloaded by:[Roach, Greg] [Roach, Greg

    E-Print Network [OSTI]

    This article was downloaded by:[Roach, Greg] [Roach, Greg] On: 16 July 2007 Access Details: Sample D. Roach a a The Centre for Sleep Research, The University of South Australia. Adelaide. Australia, Drew and Roach, Gregory D. , (2006) 'Do Short International Layovers Allow Sufficient Opportunity

  14. This article was downloaded by:[Roach, Greg] [Roach, Greg

    E-Print Network [OSTI]

    This article was downloaded by:[Roach, Greg] [Roach, Greg] On: 16 July 2007 Access Details: Sample a ; Gregory D. Roach a ; Drew Dawson a ; Nicole Lamond a a The Centre for Sleep Research, University of South, Renée M., Roach, Gregory D., Dawson, Drew and Lamond, Nicole , (2006) 'The Sleep, Subjective Fatigue

  15. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    electrical energy into mechanical work; thus, the size of the overall micropump is restricted to the size electrical energy for them to function, accompanied by significant thermal losses. Mechanical micropumps also details: IP Address: 152.78.66.59 This content was downloaded on 01/12/2014 at 12:05 Please note

  16. Wind: wind power density GIS data at 50m above ground and 1km...

    Open Energy Info (EERE)

    of Columns: 735Number of Rows: 949Pixel Resolution (m): 1000Data Type: integer Spatial Reference Information (End) ** Data and Resources Download DataZIP Download Data...

  17. Wind: wind power density maps at 50m above ground and 1km resolution...

    Open Energy Info (EERE)

    density for Ghana. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Ghana. Data and Resources Download MapsZIP Download Maps More...

  18. Wind: wind power density maps at 50 m above ground and 1km resolution...

    Open Energy Info (EERE)

    density for Cuba. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Cuba. Data and Resources Download MapsZIP Download Maps More...

  19. Download GETEM, August 2012 Beta | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-UpHeat Pump Models |Conduct, Parent(CRADA and DOW AreaJuneDonna FriendHotDownload GETEM,

  20. This article was downloaded by:[Bowling Green State University] [Bowling Green State University

    E-Print Network [OSTI]

    McGovern, Warren W.

    This article was downloaded by:[Bowling Green State University] [Bowling Green State University] On. © Taylor and Francis 2007 #12;DownloadedBy:[BowlingGreenStateUniversity]At:00:0621June2007 Communications and Statistics, Bowling Green State University, Bowling Green, Ohio, USA SP-domains were first introduced

  1. A Report on Surgery 101: The first 100,000 downloads What is Surgery 101?

    E-Print Network [OSTI]

    MacMillan, Andrew

    Republic of 21 Eritrea 3 United Arab Emirates 460 France 123 Latvia 21 Zambia 3 Singapore 432 Turkey 116 Region Downloads % United States 39,870 39 Canada 17,854 18 United Kingdom 12,058 12 Asia 8,255 8 Europe #12;Worldwide download data in detail Country # Country # Country # Country # United States 39

  2. This article was downloaded by:[University of Saskatchewan] [University of Saskatchewan

    E-Print Network [OSTI]

    Bremner, Murray

    This article was downloaded by:[University of Saskatchewan] [University of Saskatchewan] On: 27. © Taylor and Francis 2007 #12;DownloadedBy:[UniversityofSaskatchewan]At:01:0827March2007 Communications ASSOCIATIVE Murray R. Bremner Department of Mathematics and Statistics, University of Saskatchewan, Saskatoon

  3. This article was downloaded by:[University of Colorado Libraries] [University of Colorado Libraries

    E-Print Network [OSTI]

    Mohseni, Kamran

    This article was downloaded by:[University of Colorado Libraries] [University of Colorado Libraries. © Taylor and Francis 2007 #12;DownloadedBy:[UniversityofColoradoLibraries]At:23:094June2007 A UNIFIED, University of Colorado at Boulder, Boulder, Colorado, USA This article presents a unified model

  4. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Texas Austin

    E-Print Network [OSTI]

    Patzek, Tadeusz W.

    PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Texas Austin] On: 9 ..........................................................................................................................................275 III. AVERAGE UNSUSTAINABILITY OF US MAIZE PRODUCTION? ............................................................................................................................278 C. The Limiting Anthropogenic Energy Input

  5. COS DCE BOOT FSW v1.13 Component Test Results Requirement 5.5.2.2 Download Data Timing

    E-Print Network [OSTI]

    Colorado at Boulder, University of

    COS DCE BOOT FSW v1.13 Component Test Results Requirement 5.5.2.2 Download Data Timing Date. Brownsberger 2-13-01 The Center for Astrophysics and Space Astronomy Reviewed: Approved: COS DCE BOOT FSW v1 Initial Release COS DCE BOOT FSW v1.13 Component Test Results Requirement 5.5.2.2 Download Data Timing

  6. COS DCE BOOT FSW v1.09 Component Test Results Requirement 5.5.2.2 Download Data Timing

    E-Print Network [OSTI]

    Colorado at Boulder, University of

    COS DCE BOOT FSW v1.09 Component Test Results Requirement 5.5.2.2 Download Data Timing Date. Brownsberger 2-13-01 The Center for Astrophysics and Space Astronomy Reviewed: Approved: COS DCE BOOT FSW v1 Initial Release COS DCE BOOT FSW v1.09 Component Test Results Requirement 5.5.2.2 Download Data Timing

  7. Friction Stir Welding Download the files fswss.txt and fswdyn.txt from the course website. These files contain

    E-Print Network [OSTI]

    Landers, Robert G.

    Friction Stir Welding QUESTION 1 Download the files fswss.txt and fswdyn.txt from the course website. These files contain experimental data from a friction stir welding process of 6061 aluminum 0 2 1 0 F z b z b d z z a z a + = + + (3) #12;Friction Stir Welding QUESTION 2 Download the files

  8. This article was downloaded by:[Canadian Research Knowledge Network] On: 21 July 2008

    E-Print Network [OSTI]

    Mandelis, Andreas

    of this technique to differential measurements of optical properties of solid laser crystals, thermal diffusivity dynamic range. Keywords; pyroelectric thin film; thermal-wave interferometry; thermal diffusivity; hydroThis article was downloaded by:[Canadian Research Knowledge Network] On: 21 July 2008 Access

  9. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Kenney, Melissa A.

    E-Print Network [OSTI]

    Arhonditsis, George B.

    PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Kenney, Melissa A.] On: 20 April-41 Mortimer Street, London W1T 3JH, UK Lake and Reservoir Management Publication details, including for south-central Florida lakes Melissa A. Kenney a ; George B. Arhonditsis b ; Linda C. Reiter c ; Matthew

  10. UCI Replay Install on Your Computer Go to http://replay.uci.edu/download.php

    E-Print Network [OSTI]

    Brody, James P.

    UCI Replay Install on Your Computer Go to http://replay.uci.edu/download.php A service Relay program to begin 5 For help recording see the "Using the Recorder" guide at http://replay.uci.edu/getstarted.php://replay.uci.edu/pdfs/EEEPodcasts.pdf Guides ­ http://replay.uci.edu/getstarted.php Troubleshooting ­ http://replay.uci.edu/troubleshooting.php

  11. UCI Replay Install on Your USB Drive Go to http://replay.uci.edu/download.php

    E-Print Network [OSTI]

    Brody, James P.

    UCI Replay Install on Your USB Drive Go to http://replay.uci.edu/download.php A service For help recording see the "Portable Recorder" guide at http://replay.uci.edu/getstarted.php Follow your) ­ http://replay.uci.edu/pdfs/EEEPodcasts.pdf Guides ­ http://replay.uci.edu/getstarted.php

  12. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Oak Ridge National Laboratory

    E-Print Network [OSTI]

    Pennycook, Steve

    PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Oak Ridge National Laboratory] On for Nanophase Materials Sciences, Oak Ridge National Laboratory, Oak Ridge, Tennessee, U.S.A. b Department Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee, U

  13. This article was downloaded by: [University of Michigan] On: 01 May 2013, At: 07:20

    E-Print Network [OSTI]

    Brown, Daniel G.

    This article was downloaded by: [University of Michigan] On: 01 May 2013, At: 07:20 Publisher, University of Michigan, Ann Arbor, Michigan, USA c Institute for Social Research, Taubman College of Architecture and Urban Planning, University of Michigan, Ann Arbor, Michigan, USA Published online: 16 Aug 2011

  14. This article was downloaded by:[University of Michigan] On: 25 February 2008

    E-Print Network [OSTI]

    Rosenberg, Noah

    This article was downloaded by:[University of Michigan] On: 25 February 2008 Access Details. Rosenberg abc ; Randa Tao b a Department of Human Genetics, University of Michigan, Ann Arbor, Michigan, USA b Center for Computational Medicine and Biology, University of Michigan, Ann Arbor, Michigan, USA c

  15. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Michigan

    E-Print Network [OSTI]

    PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Michigan] On: 12 May Greifswald, Greifswald, Germany e Department of Geological Sciences, University of Michigan, Ann Arbor, US Department of Geological Sciences, University of Michigan, Ann Arbor, US (Received 23 June 2009; final

  16. This article was downloaded by: [University of Michigan] On: 06 September 2011, At: 12:09

    E-Print Network [OSTI]

    Wooldridge, Margaret S.

    This article was downloaded by: [University of Michigan] On: 06 September 2011, At: 12:09 Publisher, University of Michigan, Ann Arbor, Michigan, USA b Department of Aerospace Engineering, University of Michigan, Ann Arbor, Michigan, USA c Department of Biomedical Engineering, University of Michigan, Ann

  17. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Michigan

    E-Print Network [OSTI]

    Tesfatsion, Leigh

    PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Michigan] On: 2 College, Middlebury, VT b Whittemore School of Business and Economics, University of New Hampshire, Durham, University of Copenhagen, Copenhagen, Denmark e GREQAM, Universite d'Aix-Marseille III, EHESS et IUF

  18. This article was downloaded by: [Michigan State University] On: 27 March 2013, At: 06:03

    E-Print Network [OSTI]

    Qian, Jianliang

    , Michigan, USA 3 Department of Mathematics and ICES, The University of Texas at Austin, Austin, Texas, USAThis article was downloaded by: [Michigan State University] On: 27 March 2013, At: 06:03 Publisher b Department of Mathematics, Michigan State University, East Lansing, Michigan, USA c Department

  19. This article was downloaded by: [Alan Biggs] On: 23 January 2014, At: 06:30

    E-Print Network [OSTI]

    Biggs, Alan R.

    This article was downloaded by: [Alan Biggs] On: 23 January 2014, At: 06:30 Publisher: Taylor ascorbic acid Amin Tayebi-Meigooni a , Yahya Awang a , Alan R. Biggs b , Rosli Mohamad a , Babak Madani Published online: 20 Jan 2014. To cite this article: Amin Tayebi-Meigooni, Yahya Awang, Alan R. Biggs, Rosli

  20. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [US Geological Survey Library

    E-Print Network [OSTI]

    PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [US Geological Survey Library] On & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer-quality issues, and the potential utility of dissolved or- ganic matter as an indicator of success of restoration

  1. This article was downloaded by: [West Virginia University] On: 06 November 2014, At: 08:01

    E-Print Network [OSTI]

    Lai, Hong-jian

    This article was downloaded by: [West Virginia University] On: 06 November 2014, At: 08 Department of Mathematics, West Virginia University, Morgantown, WV, USA. Published online: 14 Feb 2014 of access and use can be found at http://www.tandfonline.com/page/terms- and-conditions Downloadedby[WestVirginia

  2. This article was downloaded by: [West Virginia University] On: 05 November 2012, At: 08:20

    E-Print Network [OSTI]

    McNeil, Brenden

    This article was downloaded by: [West Virginia University] On: 05 November 2012, At: 08 a , Jamison F. Conley a & Brenden E. McNeil a a Department of Geology and Geography, West Virginia University of Geology and Geography, West Virginia University, Morgantown, WV 26506-6300, USA (Received 25 May 2012

  3. This article was downloaded by: [West Virginia University] On: 22 August 2011, At: 09:38

    E-Print Network [OSTI]

    McNeil, Brenden

    This article was downloaded by: [West Virginia University] On: 22 August 2011, At: 09:38 Publisher. Read, and Charles T. Driscoll Department of Geology and Geography, West Virginia University Brenden E. McNeil a , Jane M. Read b & Charles T. Driscoll c a Department of Geology and Geography, West

  4. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [West Virginia University

    E-Print Network [OSTI]

    Lai, Hong-jian

    PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [West Virginia University] On: 2 b ; Hong-Jian Lai a a Department of Mathematics, West Virginia University, Morgantown, WV, USA b of Mathematics, West Virginia University, Morgantown, WV, USA; b Department of Mathematics, South China Normal

  5. This article was downloaded by: [University Library Utrecht] On: 01 August 2013, At: 01:03

    E-Print Network [OSTI]

    Veltkamp, Remco

    This article was downloaded by: [University Library Utrecht] On: 01 August 2013, At: 01 Anja Volk a & Aline Honingh b a Department of Information and Computing Sciences, Utrecht University, P.O. Box 80089, 3508, TB, Utrecht, the Netherlands b Institute for Logic, Language and Computation

  6. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Smith, Lloyd V.

    E-Print Network [OSTI]

    Smith, Lloyd V.

    PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Smith, Lloyd V.] On: 21 February and challenges in numerically modelling solid sports balls with application to softballs Lloyd V. Smith, Washington, USA First Published:January2009 To cite this Article Smith, Lloyd V. and Duris, Joseph G.(2009

  7. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Smith, Bradley

    E-Print Network [OSTI]

    Smith, Bradley D.

    PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Smith, Bradley] On: 19 March 2009 of stopper size on squaraine rotaxane stability Na Fu a ; Jeremiah J. Gassensmith a ; Bradley D. Smith: 01 January 2009 To cite this Article Fu, Na, Gassensmith, Jeremiah J. and Smith, Bradley D.(2009

  8. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Wright, Timothy F.

    E-Print Network [OSTI]

    Wright, Timothy F.

    PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Wright, Timothy F.] On: 7 November://www.informaworld.com/smpp/title~content=t916668712 Behavioral flexibility and species invasions: the adaptive flexibility hypothesis T. F. Wright *a Online publication date: 05 November 2010 To cite this Article Wright *, T. F. , Eberhard *, J. R

  9. This article was downloaded by: [University of Pennsylvania] On: 21 December 2012, At: 15:40

    E-Print Network [OSTI]

    Sharp, Kim

    , University of Oviedo, Oviedo, Spain c Department of Management, Wharton University, Philadelphia, PA, USA¬īn de Empresas, University of Oviedo, Oviedo, Spain; c Department of Management, Wharton UniversityThis article was downloaded by: [University of Pennsylvania] On: 21 December 2012, At: 15

  10. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Columbia University HHMI

    E-Print Network [OSTI]

    PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Columbia University HHMI] On: 19, Rehovot, Israel c Dept. of Radiation Medicine, Loma Linda University Medical Center, Loma Linda, USA d Dept. of Radiology, University of California at San Diego, La Jolla, USA e Physikalisch Technische

  11. Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note

    E-Print Network [OSTI]

    de Lijser, Peter

    Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

  12. Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note

    E-Print Network [OSTI]

    de Lijser, Peter

    only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

  13. Ground Magnetic Data for west-central Colorado

    SciTech Connect (OSTI)

    Zehner, Richard

    2012-03-08T23:59:59.000Z

    Ground Magnetic Data for west-central Colorado Modeled ground magnetic data was extracted from the Pan American Center for Earth and Environmental Studies database at http://irpsrvgis08.utep.edu/viewers/Flex/GravityMagnetic/GravityMagnetic_CyberShare/ on 2/29/2012. The downloaded text file was then imported into an Excel spreadsheet. This spreadsheet data was converted into an ESRI point shapefile in UTM Zone 13 NAD27 projection, showing location and magnetic field strength in nano-Teslas. This point shapefile was then interpolated to an ESRI grid using an inverse-distance weighting method, using ESRI Spatial Analyst. The grid was used to create a contour map of magnetic field strength. This dataset includes the raw spreadsheet data, an ESRI point shapefile showing magnetic sample locations and magnetic field strength, and an ESRI line shapefile showing magnetic contours. Projection: UTM Zone 13 NAD27 Magnetic Contour Shapefile Extent: West -108.698836 East -105.283977 North 41.048206 South 36.950086 Magnetic Point Shapefile Extent: West -108.698832 East -105.283908 North 41.048142 South 36.950086

  14. Case study of visualizing global user download patterns using Google Earth and NASA World Wind

    SciTech Connect (OSTI)

    Zong, Ziliang; Job, Joshua; Zhang, Xuesong; Nijim, Mais; Qin, Xiao

    2012-10-09T23:59:59.000Z

    Geo-visualization is significantly changing the way we view spatial data and discover information. On the one hand, a large number of spatial data are generated every day. On the other hand, these data are not well utilized due to the lack of free and easily used data-visualization tools. This becomes even worse when most of the spatial data remains in the form of plain text such as log files. This paper describes a way of visualizing massive plain-text spatial data at no cost by utilizing Google Earth and NASAWorld Wind. We illustrate our methods by visualizing over 170,000 global download requests for satellite images maintained by the Earth Resources Observation and Science (EROS) Center of U.S. Geological Survey (USGS). Our visualization results identify the most popular satellite images around the world and discover the global user download patterns. The benefits of this research are: 1. assisting in improving the satellite image downloading services provided by USGS, and 2. providing a proxy for analyzing the hot spot areas of research. Most importantly, our methods demonstrate an easy way to geovisualize massive textual spatial data, which is highly applicable to mining spatially referenced data and information on a wide variety of research domains (e.g., hydrology, agriculture, atmospheric science, natural hazard, and global climate change).

  15. How to Download, Install, and Use Cisco AnyConnect VPN Client

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickr FlickrGuidedCH2MLLC HistoryVeterans |VirtualLoveApplyDownload,

  16. View and download all Security Smarts for your safety and security meetings

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered energy consumption by sectorlongUpdatesValley winsVideo Videoand download all

  17. Download as

    E-Print Network [OSTI]

    John C Mclachlan

    2010-01-01T23:59:59.000Z

    unpleasant in order to give it greater acceptability. However, changing the name of Windscale nuclear plant

  18. download here

    E-Print Network [OSTI]

    Yi Chen

    2014-07-16T23:59:59.000Z

    Research Interest and Experience ... Mysql Intermediate level, experience in project of my personal interest, online market ... French Limited Working Proficiency.

  19. Downloads Feed

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesDataTranslocationDiurnal CycleDonald1 Jul 2002 to10 Jan

  20. DownloadedBy:[IngentaContentDistribution]At:16:4529February2008 Geomicrobiology Journal, 24:117, 2007

    E-Print Network [OSTI]

    Gilli, Adrian

    Laboratory, Switzerland S. Stroes-Gascoyne AECL, Whiteshell Laboratories, Pinawa, Manitoba, Canada A-Gascoyne in this project is gratefully acknowledged. Address correspondence to S. Stroes-Gascoyne, AECL, Whiteshell Laboratories, Pinawa, Manitoba, Canada, ROE 1LO. E-mail: stroess@ aecl.ca 1 #12;Downloaded

  1. Interfaces within graphene nanoribbons This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Yanikoglu, Berrin

    Interfaces within graphene nanoribbons This article has been downloaded from IOPscience. Please s i c s New Journal of Physics Interfaces within graphene nanoribbons J Wurm1,2,4 , M Wimmer1 , I the conductance through two types of graphene nanostructures: nanoribbon junctions in which the width changes from

  2. This article was downloaded by: [Oak Ridge National Laboratory], [Henriette Jager] On: 09 April 2013, At: 15:51

    E-Print Network [OSTI]

    Jager, Henriette I.

    This article was downloaded by: [Oak Ridge National Laboratory], [Henriette Jager] On: 09 April , Daniel Farrae b c & Mark S. Bevelhimer a a Environmental Sciences Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee, 37831-6038, USA b Warnell School of Forestry, University of Georgia, 180 East

  3. Extrinsic morphology of graphene This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Li, Teng

    Extrinsic morphology of graphene This article has been downloaded from IOPscience. Please scroll (2011) 054005 (15pp) doi:10.1088/0965-0393/19/5/054005 Extrinsic morphology of graphene Teng Li at stacks.iop.org/MSMSE/19/054005 Abstract Graphene is intrinsically non-flat and corrugates randomly. Since

  4. This article was downloaded by: [West Virginia University], [Hong-Jian Lai] On: 23 April 2014, At: 08:00

    E-Print Network [OSTI]

    Lai, Hong-jian

    This article was downloaded by: [West Virginia University], [Hong-Jian Lai] On: 23 April 2014, At University, Xuzhou, Jiangsu, 221116, China d Department of Mathematics, West Virginia University, Morgantown://www.tandfonline.com/page/terms- and-conditions Downloadedby[WestVirginiaUniversity],[Hong-JianLai]at08:0023April2014 #12;International

  5. Thebarton Campus Map Our University is smoke-free. January 2014 Download map at www.adelaide.edu.au/campuses

    E-Print Network [OSTI]

    Thebarton Campus Map Our University is smoke-free. January 2014 Download map at www.adelaide.edu.au/campuses #12;Gymnasium BUILDINGS GRID Alaska Towers D2 Bonar D6 ETSA Transformer D4 Gaskell D6 Gilbey Court E5 Railway B2 Paterson House E6 River Mansions C1 Schamm D6 Soap & Candle D6 BUILDINGS GRID Springfield House

  6. This article was downloaded by: [Rochester Institute of Technology] On: 26 March 2013, At: 11:38

    E-Print Network [OSTI]

    Kandlikar, Satish

    This article was downloaded by: [Rochester Institute of Technology] On: 26 March 2013, At: 11 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK Heat Transfer Engineering://www.tandfonline.com/loi/uhte20 Selected Papers from the Seventh International Conference on Nanochannels, Microchannels

  7. This article was downloaded by: [The University of British Columbia] On: 16 December 2013, At: 14:59

    E-Print Network [OSTI]

    Bluman, George

    This article was downloaded by: [The University of British Columbia] On: 16 December 2013, At: 14 of Mathematics , University of British Columbia , Vancouver , British Columbia , Canada c Electrical and Computer Engineering , University of Victoria , Victoria , British Columbia , Canada Published online: 19 Apr 2012

  8. Authorized licensed use limited to: Columbia University. Downloaded on September 7, 2009 at 21:53 from IEEE Xplore. Restrictions apply. Authorized licensed use limited to: Columbia University. Downloaded on September 7, 2009 at 21:53 from IEEE Xplore. Res

    E-Print Network [OSTI]

    Chang, Shih-Fu

    Authorized licensed use limited to: Columbia University. Downloaded on September 7, 2009 at 21:53 from IEEE Xplore. Restrictions apply. #12;Authorized licensed use limited to: Columbia University limited to: Columbia University. Downloaded on September 7, 2009 at 21:53 from IEEE Xplore. Restrictions

  9. Fiducial approach to uncertainty assessment accounting for error due to instrument resolution This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Hannig, Jan

    Metrologia 44 476 (http://iopscience.iop.org/0026-1394/44/6/006) Download details: IP Address: 152 Contact us My IOPscience #12;IOP PUBLISHING METROLOGIA Metrologia 44 (2007) 476­483 doi:10

  10. This paper has been downloaded from the Building and Environmental Thermal Systems Research Group at Oklahoma State University (www.hvac.okstate.edu)

    E-Print Network [OSTI]

    Ghajar, Afshin J.

    to reductions in electrical energy usage, and allow more effective demand-side management. However, comparedThis paper has been downloaded from the Building and Environmental Thermal Systems Research Group

  11. http://dx.doi.org/10.1090/conm/426/08187 Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48.

    E-Print Network [OSTI]

    Bressan, Alberto

    on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48. License or copyright restrictions may(t,O+),z(t))dt. ~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP://www.ams.org/publications/ebooks/terms #12;~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download

  12. Property:Zip | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

  13. Copyright ASCE 2004 Earth & Space 2004 Downloaded 20 Oct 2008 to 82.130.125.21. Redistribution subject to ASCE license or copyright; see http://www.ascelibrary.org/

    E-Print Network [OSTI]

    Bosché, Frédéric

    Copyright ASCE 2004 Earth & Space 2004 Downloaded 20 Oct 2008 to 82.130.125.21. Redistribution subject to ASCE license or copyright; see http://www.ascelibrary.org/ #12;Copyright ASCE 2004 Earth; see http://www.ascelibrary.org/ #12;Copyright ASCE 2004 Earth & Space 2004 Downloaded 20 Oct 2008

  14. Non-contiguous SCHEMA protein recombination Matthew A. Smith and Frances H. Arnold*

    E-Print Network [OSTI]

    Arnold, Frances H.

    1 Non-contiguous SCHEMA protein recombination Matthew A. Smith and Frances H. Arnold* Division downloaded and unpacked. This is available from: http://cheme.che.caltech.edu/groups/fha/media/ncr.zip 3

  15. Specific heat capacity of freshly excised prostate specimens This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Patch, Sarah

    is the specific heat capacity per unit mass in J g-1 C-1 , is the thermal diffusivity in cm2 s-1 , kSpecific heat capacity of freshly excised prostate specimens This article has been downloaded from IOPscience. Please scroll down to see the full text article. 2011 Physiol. Meas. 32 N55 (http

  16. Phase-field modeling of corrosion kinetics under dual-oxidants This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Chen, Long-Qing

    Phase-field modeling of corrosion kinetics under dual-oxidants This article has been downloaded-field modeling of corrosion kinetics under dual-oxidants You-Hai Wen1 , Long-Qing Chen2 and Jeffrey A Hawk1 1 is proposed to simulate corrosion kinetics under a dual- oxidant atmosphere. It will be demonstrated

  17. Plasma Treatments and Biomass Gasification This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Boyer, Edmond

    Plasma Treatments and Biomass Gasification This article has been downloaded from IOPscience. Please Treatments and Biomass Gasification J Luche1 , Q Falcoz2 , T Bastien2 , J P Leninger2 , K Arabi1 , O Aubry1 various methods of biomass processing. Gasification is one of the ways to recover energy from biomass

  18. Reliability of regional climate model trends This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Drijfhout, Sybren

    Reliability of regional climate model trends This article has been downloaded from IOPscience.1088/1748-9326/8/1/014055 Reliability of regional climate model trends G J van Oldenborgh1, F J Doblas Reyes2, S S Drijfhout1 and E probabilistic forecast is that the forecast system is shown to be reliable: forecast probabilities should equal

  19. This paper has been downloaded from the Building and Environmental Thermal Systems Research Group at Oklahoma State University (http://www.hvac.okstate.edu).

    E-Print Network [OSTI]

    This paper has been downloaded from the Building and Environmental Thermal Systems Research Group that is typically only the case for envelope-dominated buildings in a given location. ∑ Reasonably constant ground thermal properties between locations for which the rule-of-thumb would be applied. The main example

  20. Magnetism in bcc and fcc Fe with carbon and manganese This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Medvedeva, Julia E.

    Magnetism in bcc and fcc Fe with carbon and manganese This article has been downloaded from.1088/0953-8984/22/31/316002 Magnetism in bcc and fcc Fe with carbon and manganese N I Medvedeva1,2 , D Van Aken2 and J E Medvedeva3 1 functional theory calculations were performed to study the structure and magnetic properties of bcc

  1. COS DCE BOOT FSW v1.09 Component Test Results Requirement 5.5.2.1 Process Memory Download Commands

    E-Print Network [OSTI]

    Colorado at Boulder, University of

    COS DCE BOOT FSW v1.09 Component Test Results Requirement 5.5.2.1 Process Memory Download Commands. Brownsberger 2-13-01 The Center for Astrophysics and Space Astronomy Reviewed: Approved: COS DCE BOOT FSW v1 Astronomy Initial Release COS DCE BOOT FSW v1.09 Component Test Results Requirement 5.5.2.1 Process Memory

  2. COS DCE BOOT FSW v1.13 Component Test Results Requirement 5.5.2.1 Process Memory Download Commands

    E-Print Network [OSTI]

    Colorado at Boulder, University of

    COS DCE BOOT FSW v1.13 Component Test Results Requirement 5.5.2.1 Process Memory Download Commands. Brownsberger 2-13-01 The Center for Astrophysics and Space Astronomy Reviewed: Approved: COS DCE BOOT FSW v1 Astronomy Initial Release COS DCE BOOT FSW v1.13 Component Test Results Requirement 5.5.2.1 Process Memory

  3. This article has been downloaded from IOPscience. Please scroll down to see the full text article. 2012 Environ. Res. Lett. 7 011009

    E-Print Network [OSTI]

    Address: 128.112.21.106 The article was downloaded on 27/03/2012 at 19:33 Please note that terms Search Collections Journals About Contact us My IOPscience #12;IOP PUBLISHING ENVIRONMENTAL RESEARCH ever so slightly between years 40 and 100, because once CO2 enters the atmosphere it lingers

  4. An interferometric and spectroscopic argon arc plasma diagnostic This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    An interferometric and spectroscopic argon arc plasma diagnostic This article has been downloaded An interferometric and spectroscopic argon arc plasma diagnostic K MusioltS, A Czernichowskit, J ChapelleS and C de diagnostics of an arc plasma, when the halfwidth of the Balmer H, line is measured, there is a certain amount

  5. DownloadedBy:[BiblUniversityDeLuminy]At:11:114June2008 Perception and action in sport: Half-time comments

    E-Print Network [OSTI]

    Jirsa, Viktor

    and indispensable element in the process of perception, as advocated by the ecological approach to perception perception, decision and the production of movement, the ecological approach to perception and action seeksDownloadedBy:[BiblUniversityDeLuminy]At:11:114June2008 Perception and action in sport: Half

  6. This article was downloaded by: [MNHN Musum National D'Histoire Naturelle], [Salvador Bailon] On: 05 March 2014, At: 00:32

    E-Print Network [OSTI]

    This article was downloaded by: [MNHN Muséum National D'Histoire Naturelle], [Salvador Bailon] On) Salvador Bailon a , Renaud Boistel b , Pere Bover c d & Josep Antoni Alcover c d a UMR 7209--7194 du CNRS: Salvador Bailon , Renaud Boistel , Pere Bover & Josep Antoni Alcover (2014) Maioricalacerta rafelinensis

  7. Ice-assisted electron beam lithography of graphene This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Ice-assisted electron beam lithography of graphene This article has been downloaded from IOPscience PUBLISHING NANOTECHNOLOGY Nanotechnology 23 (2012) 185302 (6pp) doi:10.1088/0957-4484/23/18/185302 Ice demonstrate that a low energy focused electron beam can locally pattern graphene coated with a thin ice layer

  8. 3+1 geodesic equation and images in numerical spacetimes This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Gourgoulhon, Eric

    3+1 geodesic equation and images in numerical spacetimes This article has been downloaded from.1088/0264-9381/29/24/245005 3+1 geodesic equation and images in numerical spacetimes F H Vincent1,2 , E Gourgoulhon2 and J Novak Online at stacks.iop.org/CQG/29/245005 Abstract The equations governing null and timelike geodesics

  9. Carbon nanotube yarn strain sensors This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Zhu, Yuntian T.

    Carbon nanotube yarn strain sensors This article has been downloaded from IOPscience. Please scroll Nanotechnology 21 (2010) 305502 (5pp) doi:10.1088/0957-4484/21/30/305502 Carbon nanotube yarn strain sensors nanotube (CNT) based sensors are often fabricated by dispersing CNTs into different types of polymer

  10. Singular Optics: more ado about nothing This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Singular Optics: more ado about nothing This article has been downloaded from IOPscience. Please PUBLISHING JOURNAL OF OPTICS A: PURE AND APPLIED OPTICS J. Opt. A: Pure Appl. Opt. 11 (2009) 090201 (3pp) doi:10.1088/1464-4258/11/9/090201 EDITORIAL Singular Optics: more ado about nothing Mark R Dennis1 , Yuri

  11. Tokamak start-up with electron-cyclotron heating This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Sprott, Julien Clinton

    Tokamak start-up with electron-cyclotron heating This article has been downloaded from IOPscience to the journal homepage for more Home Search Collections Journals About Contact us My IOPscience #12;LETTERS [3 September 1979 Final manuscript received 6 August 1981) TOKAMAK START-UP WITH ELECTRON- CYCLOTRON HEATING D

  12. Modeling capsid self-assembly: design and analysis This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Rapaport, Dennis C.

    Modeling capsid self-assembly: design and analysis This article has been downloaded from IOPscience capsid self-assembly: design and analysis D C Rapaport Department of Physics, Bar-Ilan University, Ramat of simulations aimed at elucidating the self-assembly dynamics of spherical virus capsids is described

  13. Hydrogenation enabled scrolling of graphene This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Li, Teng

    Hydrogenation enabled scrolling of graphene This article has been downloaded from IOPscience.1088/0022-3727/46/7/075301 Hydrogenation enabled scrolling of graphene Shuze Zhu and Teng Li Department of Mechanical Engineering.iop.org/JPhysD/46/075301 Abstract Hydrogenation of graphene leads to local bond distortion of each hydrogenated

  14. Accounting for the water impacts of ethanol production This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Kammen, Daniel M.

    Accounting for the water impacts of ethanol production This article has been downloaded from for the water impacts of ethanol production Kevin R Fingerman1,4 , Margaret S Torn1,2 , Michael H O'Hare3 scarcity, and aggressive alternative fuel incentive policies. Life cycle water consumption for ethanol

  15. Laser microfluidics: fluid actuation by light This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Zhang, Wendy

    Laser microfluidics: fluid actuation by light This article has been downloaded from IOPscience.1088/1464-4258/11/3/034015 Laser microfluidics: fluid actuation by light Jean-Pierre Delville1 , Matthieu Robert de Saint Vincent1.iop.org/JOptA/11/034015 Abstract The development of microfluidic devices is still hindered by the lack of robust

  16. Urban gravity: a model for inter-city telecommunication flows This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Nesterov, Yurii

    are directly proportional to a city's population size, other features--such as productivity or energyUrban gravity: a model for inter-city telecommunication flows This article has been downloaded from for this issue, or go to the journal homepage for more Home Search Collections Journals About Contact us My

  17. Nanoimprint of dehydrated PEDOT:PSS for organic photovoltaics This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Hu, Wenchuang "Walter"

    Nanoimprint of dehydrated PEDOT:PSS for organic photovoltaics This article has been downloaded from.1088/0957-4484/22/48/485301 Nanoimprint of dehydrated PEDOT:PSS for organic photovoltaics Y Yang1 , K Lee2 , K Mielczarek2 , W Hu1 photovoltaic devices (OPV), showing enhancement of photocurrent and power efficiency in comparison to OPV

  18. Global warming: it's not only size that matters This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Global warming: it's not only size that matters This article has been downloaded from IOPscience.1088/1748-9326/6/3/031002 PERSPECTIVE Global warming: it's not only size that matters Gabriele C Hegerl School of Geosciences to global warming. However, Mahlstein et al (2011) point out that the signal of climate change is emerging

  19. Life cycle greenhouse gas emissions of Marcellus shale gas This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Jaramillo, Paulina

    Life cycle greenhouse gas emissions of Marcellus shale gas This article has been downloaded from.1088/1748-9326/6/3/034014 Life cycle greenhouse gas emissions of Marcellus shale gas Mohan Jiang1 , W Michael Griffin2,3 , Chris greenhouse gas (GHG) emissions from the production of Marcellus shale natural gas and compares its emissions

  20. Results of the Sixth International Comparison of Absolute Gravimeters, ICAG-2001 This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    been downloaded from IOPscience. Please scroll down to see the full text article. 2002 Metrologia 39 IOPscience #12;metrologia Results of the Sixth International Comparison of Absolute Gravimeters, ICAG-2001 L di Metrologia "G. Colonnetti" (IMGC), Turin, Italy. M. Diament: Institut de Physique du Globe de

  1. Devil's staircase for nonconvex interactions This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Miekisz, Jacek

    Devil's staircase for nonconvex interactions This article has been downloaded from IOPscience. Lett., 50 (3), pp. 307­311 (2000) EUROPHYSICS LETTERS 1 May 2000 Devil's staircase for nonconvex as the complete devil's staircase. Lattice systems (or lattice gases), where the space available to particles

  2. Laser power-meter comparison at far-infrared wavelengths and terahertz frequencies This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Winfree, Erik

    been downloaded from IOPscience. Please scroll down to see the full text article. 2012 Metrologia 49 Contact us My IOPscience #12;IOP PUBLISHING METROLOGIA Metrologia 49 (2012) 583­587 doi:10

  3. A carbon-fiber electrode array for long-term neural recording This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    A carbon-fiber electrode array for long-term neural recording This article has been downloaded from.1088/1741-2560/10/4/046016 A carbon-fiber electrode array for long-term neural recording Grigori Guitchounts1,5, Jeffrey E Markowitz2 of the array is approximately 26 m along the full extent of the implant. Main results. Carbon fiber arrays were

  4. A model of the lateral line of fish for vortex sensing This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Mohseni, Kamran

    A model of the lateral line of fish for vortex sensing This article has been downloaded from.1088/1748-3182/7/3/036016 A model of the lateral line of fish for vortex sensing Zheng Ren1 and Kamran Mohseni1,2,3,4 1 Department.iop.org/BB/7/036016 Abstract In this paper, the lateral line trunk canal (LLTC) of a fish is modeled

  5. Paradoxes in laser heating of plasmonic nanoparticles This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Paradoxes in laser heating of plasmonic nanoparticles This article has been downloaded from to the journal homepage for more Home Search Collections Journals About Contact us My IOPscience #12;T h e o p e n ≠ a c c e s s j o u r n a l f o r p h y s i c s New Journal of Physics Paradoxes in laser heating

  6. Constant-flux discrete heating in a unit aspect-ratio annulus This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Lopez, John M.

    Constant-flux discrete heating in a unit aspect-ratio annulus This article has been downloaded from to the journal homepage for more Home Search Collections Journals About Contact us My IOPscience #12;IOP.1088/0169-5983/44/6/065507 Constant-flux discrete heating in a unit aspect-ratio annulus J M Lopez1,2 , M Sankar3 and Younghae Do2 1

  7. Download - Optimization Online

    E-Print Network [OSTI]

    2005-12-14T23:59:59.000Z

    APPSPACK is software for solving unconstrained and bound constrained ... Division at the United States Department of Energy and by Sandia National Laboratory, a multi- ... APPSPACK is targeted to simulation-based optimization. .... Satisfying decrease condition (4) is only part of the comparison APPSPACK uses.

  8. downloadForm.asp

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the on-site personnel include: officework space, officework area furniture, local area network services, parking facilities, and other services as described in the clause...

  9. download here my CV

    E-Print Network [OSTI]

    Author

    2012-03-19T23:59:59.000Z

    Jan 18, 2012 ... F. Baudoin: Further Exponential Generalization of Pitman's 2M-X theorem, Elec- tronic Communications in Probability, Vol. 7, 37-46, (2002). 27.

  10. Download as a PDF

    E-Print Network [OSTI]

    1910-00-51T23:59:59.000Z

    Since rank(A) = n = rank(P) + rank(Q) and A = P + Q, only the zero vector is in the range of P and the range of Q. This means that only the zero vector is in the†...

  11. Downloads | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesDataTranslocationDiurnal CycleDonald1 Jul 2002 to10

  12. NERSC Software Downloads

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLas Conchas recovery challengeMultiscaleLogos NERSC Logos NERSC logos arePlayed Workflow Software

  13. downloadForm.asp

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered energy consumption byAbout SRNL HomeYoungCleanJournal of Environmental

  14. Downloads | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-Series to UserProduct:Directives Templates8. U.S.Donald R.Douglas

  15. downloadForm.asp

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched5 Industrial Carbon Capture and Storageconvert 2 3 DEPARTMENT OF 

  16. downloadForm.asp

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched5 Industrial Carbon Capture and Storageconvert 2 3 DEPARTMENT OF 

  17. download of publication list

    E-Print Network [OSTI]

    2012-08-31T23:59:59.000Z

    tails and Dirac points. An analysis for families of Hamiltonians and applications to wire networks, especially the Gyroid, Annals of Physics 327 (2012) 2865Ė2884.

  18. Museum Fan Downloads

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Ted Hall Atmospheric Testing icons Nevada Pacific, Pacific, Nevada Test Site Eniwetok Bikini Test Site Charlie Mike Bravo Hornet Charlie Mike Bravo Hornet Oct 30, '51 Oct 31, '52...

  19. Dye-sensitized solar cell with a pair of carbon-based electrodes This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Demir, Hilmi Volkan

    Dye-sensitized solar cell with a pair of carbon-based electrodes This article has been downloaded. 45 (2012) 165103 (8pp) doi:10.1088/0022-3727/45/16/165103 Dye-sensitized solar cell with a pair have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using

  20. Role of buffer layer in electronic structures of iron phthalocyanine molecules on Au(111) This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Gao, Hongjun

    ) This article has been downloaded from IOPscience. Please scroll down to see the full text article. 2010 Chinese neighbour [10¬Į1] direction with a lobe downward to the central hole of the unit cell in the first layer of individ- ual pentacene molecules adsorbed on ultrathin insu- lating sodium chloride film supported by Cu

  1. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

  2. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

  3. Institution Name Institution Name Address Place Zip Notes Website...

    Open Energy Info (EERE)

    www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

  4. Name Name Address Place Zip Category Sector Telephone number...

    Open Energy Info (EERE)

    Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

  5. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

  6. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

  7. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

  8. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

  9. Exploring zipping and assembly as a protein folding principle

    E-Print Network [OSTI]

    Voelz, Vince A; Dill, Ken A

    2007-01-01T23:59:59.000Z

    C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

  10. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

  11. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

  12. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

  13. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

  14. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

  15. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

  16. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

  17. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

  18. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

  19. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

  20. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

  1. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

  2. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

  3. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

  4. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

  5. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

  6. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

  7. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

  8. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

  9. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

  10. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

  11. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

  12. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

  13. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

  14. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

  15. Name Address Place Zip Sector Product Stock Symbol Year founded...

    Open Energy Info (EERE)

    Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

  16. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

  17. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

  18. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

  19. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

  20. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

  1. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

  2. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

  3. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

  4. Name Name Address Place Zip Category Sector Telephone number Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

  5. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

  6. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

  7. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

  8. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

  9. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

  10. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

  11. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

  12. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

  13. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

  14. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

  15. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

  16. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

  17. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

  18. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

  19. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

  20. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

  1. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

  2. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

  3. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

  4. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

  5. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

  6. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

  7. Property:Incentive/Cont4Zip | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

  8. Property:Incentive/ContZip | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

  9. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

  10. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

  11. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

  12. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

  13. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

  14. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

  15. Reducing environmental burdens of solid-state lighting through end-of-life design This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-Print Network [OSTI]

    Jaramillo, Paulina

    .237.145.145 The article was downloaded on 26/09/2011 at 22:24 Please note that terms and conditions apply. View the table of contents for this issue, or go to the journal homepage for more Home Search Collections Journals About is considered. Likewise, as SSL products enter into widespread use, disposal of more and more end-of-life SSL

  16. Evaluated Nuclear (reaction) Data from the Evaluated Nuclear Data File (ENDF)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The current version is ENDF/B VII.0, released in 2006. Users can search ENDF via specialized interfaces, browse sub-libraries or download them as zipped files. Data plots can be generated through the Sigma interface. The ENDF web page also provides access to covariance data processing and plots. (Specialized Interface)

  17. TUTORIAL FOR UW NETWORK CODING USING OPNET AND CHRIS LYDICK

    E-Print Network [OSTI]

    Roy, Sumit

    have downloaded the .zip or .tar.gz file from the UWEE FUNLAB web- site (http, the packets we are processing for network coding) follow the dark blue arrow to either a sink processor to all of its output streams (again, the dark blue arrows going from the nc-proc processor to other

  18. EERC Download | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Year in Review: TopEnergy DOEDealingVehicle1 ClosingA TraditionEnergy-Efficient NATIONALEERC

  19. SRI2007 Conference - Poster Download

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security Administration the1 -the Mid-Infrared0 ResourceAwards SAGE Awards ,#2446Smalln n51964780620999 SRI

  20. download | OpenEI Community

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop,SaveWhiskey Flats GeothermalElectric Coop Home7databusdownload Home

  1. Download Data | Transparent Cost Database

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirect EnergyOrganization ofVirginiaYou are here Home

  2. OpenEI Community - download

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/Geothermal < Oklahomast, 2012Coast

  3. Adapted from FDA refrigerator and freezer guidelines: http://www.fda.gov/downloads/Food/ResourcesForYou/HealthEducators/UCM109315.pdf Have you ever wondered how long you should keep things in the refrigerator or freezer? If so, then the chart below can he

    E-Print Network [OSTI]

    Adapted from FDA refrigerator and freezer guidelines: http://www.fda.gov/downloads/Food/ResourcesForYou/HealthEducators/UCM109315.pdf Have you ever wondered how long you should keep things in the refrigerator or freezer? If so to preserve quality. Refrigerator & Freezer Storage Chart Product Refrigerator Freezer Product Refrigerator

  4. Oil and Gas Company Oil and Gas Company Address Place Zip Website

    Open Energy Info (EERE)

    Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

  5. Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor

    E-Print Network [OSTI]

    Hur, Jung-Im

    2009-05-15T23:59:59.000Z

    results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

  6. Address State: Zip: All participants: please complete the form below and return it to

    E-Print Network [OSTI]

    Schladow, S. Geoffrey

    to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

  7. Business Name Year Address City State Zip Phone Email Address Contact

    E-Print Network [OSTI]

    Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

  8. A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor

    E-Print Network [OSTI]

    Yang, Xue'en, 1975-

    2005-01-01T23:59:59.000Z

    Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

  9. LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP

    E-Print Network [OSTI]

    Tsien, Roger Y.

    AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

  10. Business Name Year Address City State Zip Phone Email Address Contact

    E-Print Network [OSTI]

    water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

  11. Business Name Year Address City State Zip Phone Email Address Contact

    E-Print Network [OSTI]

    is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

  12. 3D compression: from A to Zip: a first complete example THOMAS LEWINER

    E-Print Network [OSTI]

    Lewiner, Thomas (Thomas Lewiner)

    the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

  13. Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*

    E-Print Network [OSTI]

    Schšfer, Eberhard

    in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

  14. Determining protein interaction specificity of native and designed bZIP family transcription factors

    E-Print Network [OSTI]

    Reinke, Aaron W

    2012-01-01T23:59:59.000Z

    Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

  15. Quick Start The various sample data files after expansion (use Zip)

    E-Print Network [OSTI]

    library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

  16. Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

  17. Looking for a way to find utilites per zip code (a list?) | OpenEI

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

  18. Name Address Place Zip Sector Product Stock Symbol Year founded Number

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

  19. State Oil and Gas Board State Oil and Gas Board Address Place Zip Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

  20. Do we get actual vendor name while we searched with zip code? | OpenEI

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

  1. Electric Utility Company Assigned to a Zip Code? | OpenEI Community

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

  2. Helen Gordon Child Development Center WAITLIST APPLICATION

    E-Print Network [OSTI]

    Lafferriere, Gerardo

    ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

  3. MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY

    E-Print Network [OSTI]

    Weitz, Joshua S.

    : ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

  4. Women @ Energy Poster Download: Terri Quinn

    Broader source: Energy.gov [DOE]

    Women @ Energy showcases outstanding Energy Department employees who are helping change the world, ensuring Americaís security and prosperity through transformative science and technology solutions...

  5. Download the Final Agenda | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Year in Review: TopEnergy DOEDealingVehicle1 Guidanceflash2004-12.pdfDownhole Sensor HoldsFinal

  6. Alternative Fuels Data Center: Data Downloads

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation InInformationCenterResearch Highlights MediaFuelAboutCase Studies Printable VersionTools

  7. OHA Archive Download Page | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomen OwnedofDepartment ofJaredOakscience-based,OHA FOIA Cases Archive File OHA

  8. EERC Linux Download | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-UpHeat Pump Models |Conduct,Final9:Department of Energy atDepartment ofClimateLinux

  9. K-12 Popular Downloads | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: AlternativeEnvironment, Safety andGeothermalGreenBenefits08Joshua Sneideman AboutK-12 Popular

  10. Sandia National Laboratories: Wind Software Downloads

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security Administration the1development Sandia, NREL Release Wave EnergyLinks WaterWindSandia Wind

  11. Alternative Fuels Data Center: Video Download Help

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAbout theOFFICE OFFuelsPropane Tank OverfillSanTexasUtah559

  12. ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.

    E-Print Network [OSTI]

    Thomases, Becca

    @ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

  13. Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review

    E-Print Network [OSTI]

    Chapman, Michael S.

    experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

  14. Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)

    E-Print Network [OSTI]

    Ciaccio, Natalie Anne

    2010-05-31T23:59:59.000Z

    was amplified using PCR for insertion to a plasmid using the following primers: 5íGCGCGCCCATGGGCCCTGCCACCACCCGA3í (forward primer with NcoI restriction site), 5íGCGCGCCATATGCCTGCCACCACCCGAGGG3í (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

  15. 2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.

    E-Print Network [OSTI]

    Qiu, Weigang

    #_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

  16. Cal State Fullerton Alumni Association Candidate Information Sheet

    E-Print Network [OSTI]

    de Lijser, Peter

    ________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

  17. 2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.

    E-Print Network [OSTI]

    Qiu, Weigang

    #_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

  18. This article was downloaded by:[Smith, Bradley] [Smith, Bradley

    E-Print Network [OSTI]

    Smith, Bradley D.

    . Keywords: Membrane transport; Ionosphere; Ion channel; Mobile carrier; Membrane pore; Self the permeability of small polar molecules and inorganic ions. Controlled ion transport across membranes and W. Matthew Leevy , 'Recent Advances in Synthetic Membrane Transporters', Supramolecular Chemistry

  19. Fleet DNA Project - Data Dictionary for Public Download Files

    SciTech Connect (OSTI)

    Duran, A.; Burton, E.; Kelly, K.; Walkowicz, K.

    2014-09-01T23:59:59.000Z

    Reference document for the Fleet DNA results data shared on the NREL public website. The document includes variable definitions and descriptions to assist users in understanding data.

  20. This content has been downloaded from IOPscience. Please scroll...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ionic liquid electrolytes by organic solvents Song Li 1 , Pengfei Zhang 2 , Pasquale F Fulvio 2 , Patrick C Hillesheim 2 , Guang Feng 1, 4, 5 , Sheng Dai 2, 3 and Peter T Cummings...

  1. BuildingSync File Download | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    energy audit data, developed using the standard energy data terminology defined in the Building Energy Data Exchange Specification (BEDES). Learn more about BuildingSync or view...

  2. Downloads: August 6-8, 2013 National Veterans Small Business...

    Office of Environmental Management (EM)

    Energy More Documents & Publications Business Opportunity Session July 29 2013 December 12, 2013 Business Opportunity Session Presentations Small Business Program Manager Directory...

  3. This article was downloaded by:[Phillip, Jean] [Phillip, Jean

    E-Print Network [OSTI]

    Li, Jun

    not be liable for any loss, actions, claims, proceedings, demand or costs or damages whatsoever or howsoever dust properties (identification, optical thickness, particle radius, and dust density) from the Spinning Enhanced Visible and Infrared Imager (SEVIRI) aboard Meteosat-8, the first of the Meteosat Second

  4. Download Going Places: A Car-free Guide to

    E-Print Network [OSTI]

    Bou-Zeid, Elie

    about TDM at the Sustainability Open House. FA L L 2 0 1 0 I S S U E CAR SHARING CARPOOLING VANPOOLING and incentives. With over 230 participants in the University Car Sharing Program, WeCars have been in high demand, Transportation & Parking Services TDM Manager PRINT Transportation & Parking Services #12;Car sharing

  5. This content has been downloaded from IOPscience. Please scroll...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    note that terms and conditions apply. Interfaces of dicationic ionic liquids and graphene: a molecular dynamics simulation study View the table of contents for this issue, or...

  6. Downloads & Patient Materials - HPMC Occupational Health Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesDataTranslocationDiurnal CycleDonald1 Jul 2002 to10 Jan 2005

  7. Biographies Download: Ambassadors for the Minorities in Energy Initiatve |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Year in Review: Top Five EEREDepartmentFebruary 4, 2014Biogas and Fuel Cells Workshop Biogas

  8. Microsoft Word - Using Green Button Download.doc

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomen OwnedofDepartment ofJared TemansonEnergySAR.doc More Documents &U.S. -a

  9. Energy 101 Dialogue Series Downloads | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists'Montana.Program - LibbyofThisStatementNOTElectricityofWaterMap ofJune 26, 2014

  10. EERC MAC OS X Download | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-UpHeat Pump Models |Conduct,Final9:Department of Energy atDepartment

  11. Fleet DNA Project ¬Ö Data Dictionary for Public Download Files

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsing ZirconiaPolicyFeasibilityFieldMinds" | National Hansen 1 , M.62 16 30

  12. AVTA: 2009 Volkswagen Jetta TDI Diesel Downloadable Dynamometer Database

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up fromDepartment of Energy 601 High26-OPAM63-OPAMGuidanceAVTA ¬Ö PHEVDepartment

  13. AVTA: 2012 Chevrolet Volt PHEV Downloadable Dynamometer Database Reports |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up fromDepartment of Energy 601 High26-OPAM63-OPAMGuidanceAVTASmartHondaCNG

  14. AVTA: 2012 Toyota Prius PHEV Downloadable Dynamometer Database Reports |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up fromDepartment of Energy 601Department of Energy Toyota Prius PHEV

  15. Geothermal Technologies Office: Download GETEM, August 2012 Beta

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Year in3.pdf Flash2006-53.pdf0.pdfCostAnalysis Geothermal Play Fairway

  16. DOE Booth Presentations From Grainger Show 2015 Downloads | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up fromDepartmentTieCelebratePartnersDepartment of EnergyEnergy DOE Booth

  17. NREL: Jobs and Economic Development Impact (JEDI) Models - Downloading the

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security Administration the Contributions and Achievements ofLiz

  18. This article was downloaded by:[Hebrew University] [Hebrew University

    E-Print Network [OSTI]

    McGaugh, Stacy

    -distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone correctly predicted subtle effects in the dynamics of the solar system, in the celebrated Hulse ­ Taylor

  19. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Usoskin, Ilya G.

    on 17/10/2013 at 13:29 Please note that terms and conditions apply. Influence of a Carrington-like event-9326/8/4/045010) Home Search Collections Journals About Contact us My IOPscience #12;IOP PUBLISHING ENVIRONMENTAL be accelerated to high energies of up to a few Content from this work may be used under the terms of the Creative

  20. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Lu, Benzhuo

    transport through a three-dimensional channel system that consists of a protein and a membrane. The platform for the Poisson­Nernst­Planck equations describing the electrodiffusion process of ion transport that terms and conditions apply. A software platform for continuum modeling of ion channels based

  1. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Napp, Nils

    . The ratio of the viscous diffusivity to the thermal diffusivity (Prandtl number) is one of the interesting:10.1088/0029-5515/54/4/045001 Review Article Rotation and momentum transport in tokamaks and helical

  2. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Napp, Nils

    alternative sources of energy, motion-based mechanical energy is abundant in the environment, and more to nuclear power. Besides the electromagnetic generator (EMG), other typical generators are also effective Collaborative Innovation Center of Chemistry for Energy Materials, Xiamen University, Xiamen 361005, People

  3. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Harris, Peter J F

    graphite: evidence for a three-dimensional structure Peter J F Harris1 , Thomas J A Slater2 , Sarah J Haigh, SPEME, University of Leeds, Leeds, LS2 9JT, UK E-mail: p.j.f.harris@reading.ac.uk Received 6 August 2014 Microscopy Laboratory, Department of Chemistry, J.J. Thomson Building, University of Reading, Whiteknights

  4. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    of synthesized thermoelectric inks that consist of thermoelectric material powders in a binder and solvent matrix that terms and conditions apply. Screen printed flexible Bi 2 Te 3 -Sb 2 Te 3 based thermoelectric generator About Contact us My IOPscience #12;Screen printed flexible Bi2Te3-Sb2Te3 based thermoelectric generator

  5. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Guidoni, Leonardo

    , the corresponding natural analogue is represented by the oxygen-evolving complex of photosystem II, which is a large of the ferromagnetic/antiferromagnetic coupling between the metal centers. S Online supplementary data available from important steps in this process is represented by the oxidation of water, which is carried out by the oxygen

  6. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Thygesen, Kristian

    semiconductor and the created electron­hole pair is used to evolve hydrogen and oxygen. The maximum efficiency and Karsten W Jacobsen1 1 Center for Atomic-Scale Materials Design, Department of Physics, Technical Development Center, University of the Basque Country UPV/EHU, Avenida de Tolosa 72, E-20018 San Sebastian

  7. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Stuart, Andrew

    and Engineering Division, King Abdullah University of Science and Technology, Thuwal 23955-6900, Kingdom of Saudi with data. The algorithm is used in oceanography, oil reservoir simulation and weather prediction [4

  8. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Robock, Alan

    geoengineering View the table of contents for this issue, or go to the journal homepage for more 2014 Environ by solar geoengineering Ben Kravitz1 , Douglas G MacMartin2,3 , Alan Robock4 , Philip J Rasch1 , Katharine Abstract Global-scale solar geoengineering is the deliberate modification of the climate system to offset

  9. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Koch, Christiane

    that terms and conditions apply. Controlling the transport of an ion: classical and quantum mechanical. 16 075007 (http://iopscience.iop.org/1367-2630/16/7/075007) Home Search Collections Journals About to the different length and time scales that enter and the experimental limitations on the controls that need

  10. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Giesen, Thomas

    and material migration in order to characterize the status of the first wall in future fusion devices. In LIAS, nuclear fusion power, plasma­material interactions, excitation and ionization by electron impact, safety. Introduction Plasma­wall interaction plays a key role for future fusion reactors, as the first wall lifetime

  11. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Khare, Sanjay V.

    S is found as a window layer for thin film cadmium telluride (CdTe) and copper indium gallium (di)selenide based solar cells. The recent advances in CdTe/CdS thin film technology and fabrication Materials allowed CdTe/CdS solar cells to emerge as a leader in the growing market of thin film module production

  12. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Park, Byungwoo

    . Phys. 42 3966 (http://iopscience.iop.org/1347-4065/42/6S/3966) Home Search Collections Journals About various growth conditions. The isotropic/anisotropic growth behavior of Si epitaxial layers was carefully analyzed and a new model is proposed, considering surface mass transport and the free energy change

  13. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Meyerovich, Alex

    . 17 219 (http://iopscience.iop.org/0295-5075/17/3/006) Home Search Collections Journals About Contact, normally requires a field sufficient to produce a magnetic energy ,u.H of the same order asthe Fermi energy it shows nearly Curie-paramagnet behavior down to a few mK, can be strongly polarized in available magnetic

  14. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Brandenburg, Axel

    ://iopscience.iop.org/1742-6596/318/7/072025) Home Search Collections Journals About Contact us My IOPscience #12;The Decay. 1. Introduction: the behavior of the large scales in the absence of body forces In order to place, ui(x)uj(x + r) = uiu j , decay sufficiently rapidly with separation r = |r| = |x - x| , the energy

  15. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Lenstra, Arjen K.

    . A miniaturized lithium 6+ ion source injects fast ions with energies up to 1 KeV and a double-gridded energy wind or the magnetosphere, ions can be accelerated by wave≠particle interactions to high energies [1, 2

  16. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Battisti, David

    --of critical importance for ecological and human systems--is principally controlled by background GHG levels About Contact us My IOPscience #12;Environmental Research Letters Environ. Res. Lett. 9 (2014) 024005 (9 of ongoing anthropogenic greenhouse gas (GHG) emissions. However, its efficacy depends on its indefinite

  17. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Napp, Nils

    and sustainable architecture. During the course of evolution, biological organisms adapted their character through that terms and conditions apply. Design and construction principles in nature and architecture View the table.1088/1748-3182/7/1/015002 Design and construction principles in nature and architecture Jan Knippers1,2,3,4,6 and Thomas Speck2

  18. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    , A Nikroo6 , R E Olson4 , K Opachich1 , A Pak1 , T Parham1 , P Patel1 , H-S Park1 , R P Petrasso5 , J Ralph1 Laboratory for Laser Energetics, Rochester, NY, USA 3 Los Alamos National Laboratory, Los Alamos, NM, USA 4

  19. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Peinke, Joachim

    phase-locked pulse pairs in order to extract physical mechanisms of strong field quantum control control scenario based on selective population of dressed states (SPODS). We use intense phase- locked is based on the investigation of quantum control on a simple well defined model system excited by well

  20. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Carretero, Ricardo

    , Universidad de Sevilla, C/ Virgen de ¬īAfrica, 7, 41011-Sevilla, Spain 5 Department of Physics, University findings, the nodeless state becomes unstable towards the formation of stable nonlinear single or multi

  1. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Sun, Yu

    , and the applications of micro- and nano-printing. Keywords: nano-printing, micro-printing, 3D printing (Some figures

  2. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Brown, Michael R.

    ) We present a review of laboratory sources of turbulent plasma. Our focus will be on sources that terms and conditions apply. Laboratory sources of turbulent plasma: a unique MHD plasma wind tunnel View the table of contents for this issue, or go to the journal homepage for more 2014 Plasma Sources Sci

  3. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Ickert-Bond, Steffi

    -9326/8/3/035017) Home Search Collections Journals About Contact us My IOPscience #12;IOP PUBLISHING ENVIRONMENTAL, 2332 Cordes Way, Fairbanks, AK 99709, USA 2 US Geological Survey, Menlo Park, CA 94025, USA 3 Park Service, Fairbanks, AK 99709, USA 5 US Geological Survey, Boulder, CO 80303, USA 6 Department

  4. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Ebert, Ute

    ] as well as in industrial applications such as lighting [5­7], treatment of polluted gases and water [8 on the hydrodynamic drift­diffusion approximation are presented and compared. The comparison with the MC model clearly optimization and understanding of such applications depend on an accurate knowledge of the electron dynamics

  5. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Napp, Nils

    present an interdisciplinary investigation that brings together research in design, 3D printing, smart

  6. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Napp, Nils

    that terms and conditions apply. Bending fluidic actuator for smart structures View the table of contents in extremely confined spaces [2]. Furthermore, the materials used for these devices should be non body, they require no lubrication and are less susceptible to wear than similarly sized metal actuators

  7. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Rubloff, Gary W.

    much attention in recent years due to its potential as a rare-earth-free permanent magnet material material for exchange coupling nanocomposite magnets. MnBi phase is difficult to obtain, partly becauseBi permanent magnets. To date, high purity MnBi (>90%) can be routinely produced in large quantities

  8. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Tsymbal, Evgeny Y.

    a coupled structural and magnetic (first-order) phase transition at 628 K and transforms into a paramagnetic than that of Nd2Fe14B, the most powerful (highest energy product) permanent magnet developed so far technological applications such as high- temperature permanent magnets, spintronics and high-density magnetic

  9. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Cao, Jianshu

    -fuels, currently the main energy suppliers in our modern society, get scarcer and more expensive, renewable

  10. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Ickert-Bond, Steffi

    to address these challenges. Keywords: soil organic carbon, Earth system models, uncertainty, carbon

  11. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Vogel, Richard M.

    decades, RWH has also become a popular supplemental (and generally non- potable) water source in urban that terms and conditions apply. Generalized storage­reliability­yield relationships for rainwater harvesting for publication 26 June 2014 Published 28 July 2014 Abstract Sizing storage for rainwater harvesting (RWH) systems

  12. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Daraio, Chiara

    is driving increasing research on electrochemical double-layer capacitors (EDLCs), commonly referred

  13. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Cao, Jianshu

    ­6]. Significantly, this high efficiency is achieved in the presence of an inherently noisy and disordered is of fundamental interest in condensed matter physics, and is ubiquitous in solid state, semiconductor, chemical and biological physics. In the latter most, much effort has recently focused on understanding the remarkably high

  14. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Cambridge, University of

    structures are widespread; e.g. fracking, implosions of mine shafts, collapse of buildings, fracture of bones

  15. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Rothstein, Jonathan

    perfluoropolyether (PFPE) composite molds on a custom designed roll-to-roll nanoimprinter. The efficiency

  16. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Socha, Jake

    About Contact us My IOPscience #12;Smart Materials and Structures Smart Mater. Struct. 23 (2014) 057001, is a remarkable smart material. It serves the protective role of skin and the supportive role of the skeleton cockroach View the table of contents for this issue, or go to the journal homepage for more 2014 Smart Mater

  17. Topographic and Air-Photo Lineaments in Various Locations Related to Geothermal Exploration in Colorado

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Zehner, Richard

    These shapefiles was constructed as an aid to geothermal exploration in preparation for a site visit for field checking. We make no claims as to the existence of the lineaments, their location, orientation, and/or nature.

  18. 16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers

    E-Print Network [OSTI]

    Short, Daniel

    on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

  19. Codes for the fast SSS QR eigens

    E-Print Network [OSTI]

    Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip†...

  20. Microsoft Word - VIPERS instructions.doc

    Office of Environmental Management (EM)

    Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...

  1. Ribosomal Database Project II

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  2. Sandia Wind Turbine Loads Database

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The Sandia Wind Turbine Loads Database is divided into six files, each corresponding to approximately 16 years of simulation. The files are text files with data in columnar format. The 424MB zipped file containing six data files can be downloaded by the public. The files simulate 10-minute maximum loads for the NREL 5MW wind turbine. The details of the loads simulations can be found in the paper: ďDecades of Wind Turbine Loads SimulationsĒ, M. Barone, J. Paquette, B. Resor, and L. Manuel, AIAA2012-1288 (3.69MB PDF). Note that the site-average wind speed is 10 m/s (class I-B), not the 8.5 m/s reported in the paper.

  3. Boise State University Human Resource Services Employee Information Form

    E-Print Network [OSTI]

    Barrash, Warren

    : ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

  4. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Pereira, A. L.

    E-Print Network [OSTI]

    Carrapiço, Francisco

    . Pereira a ; A. C. Figueiredo b ; J. G. Barroso b ; L. G. Pedro b ; F. Carrapiço a a Universidade de Lisboa Pereira, A. L., Figueiredo, A. C., Barroso, J. G., Pedro, L. G. and Carrapiço, F.(2009)'Volatile compounds filiculoides- Anabaena azollae bacteria A. L. PEREIRA1 , A. C. FIGUEIREDO2 , J. G. BARROSO2 , L. G. PEDRO2

  5. This article was downloaded by: [Luz Rello] On: 24 September 2012, At: 08:13

    E-Print Network [OSTI]

    ://www.tandfonline.com/loi/tham20 The presence of English and Spanish dyslexia in the Web Luz Rello a b & Ricardo Baeza-Yates a c & Ricardo Baeza-Yates (): The presence of English and Spanish dyslexia in the Web, New Review of Hypermedia of this material. #12;The presence of English and Spanish dyslexia in the Web LUZ RELLO$%* and RICARDO BAEZA

  6. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Nottingham

    E-Print Network [OSTI]

    Nottingham, University of

    orthographic input. Keywords: Dyslexia; Reading; Orthography; Letter search. Much of the research that has been conducted on dyslexia over the past 40 years has focused on the difficulties that individuals with dyslexia processing of written words in indi- viduals with dyslexia. Velluti

  7. This article was downloaded by:[Miall, Chris] On: 5 September 2007

    E-Print Network [OSTI]

    Miall, Chris

    do find such evidence, especially in autism, schizophrenia and dyslexia, we caution. There is also a suggested link between cerebellar abnormality and dyslexia, with motor deficits

  8. DownloadedBy:[UniversityofYork]At:10:2013March2008 SERIOL Reading

    E-Print Network [OSTI]

    Cornelissen, Piers

    of developmental dyslexia. Although it is widely assumed that dyslexia stems from a core phonological deficit

  9. This article was downloaded by: [University Of Maryland] On: 01 February 2013, At: 11:58

    E-Print Network [OSTI]

    Golbeck, Jennifer

    of the ``dot-com bubble'' in 2001, Web 2.0 and related concepts (e.g., social media, social networking, social

  10. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Vigasin, A. A.

    E-Print Network [OSTI]

    Bussery-Honvault, Béatrice

    of the temperature variations of collision-induced absorption (CIA) intensity in the nitrogen fundamental. Recent measurements (Yu.I. Baranov et al., JMS 233, 160 (2005)) showed that the band integrated CIA intensity as the temperature increases. To check this idea a complete analysis of the CIA intensity based on ab initio

  11. This article was downloaded by:[Canadian Research Knowledge Network] On: 21 July 2008

    E-Print Network [OSTI]

    Mandelis, Andreas

    -NORMALIZED PHOTOACOUSTIC THERMAL DIFFUSIVITY MEASUREMENTS OF DENTAL RESINS J. A. Balderas-López a ; M. Moreno-Márquez a ; A THERMAL DIFFUSIVITY MEASUREMENTS OF DENTAL RESINS', International Journal of Polymeric Materials, 51.1080/00914030290046192 SELF-NORMALIZED PHOTOACOUSTIC THERMAL DIFFUSIVITY MEASUREMENTS OF DENTAL RESINS J. A. Balderas

  12. This article was downloaded by:[Matricardi, E. A. T.] On: 20 February 2007

    E-Print Network [OSTI]

    Camara, Gilberto

    ­7% of the annual carbon release from deforestation. In this research, visual interpretation and semi increasing in both intensity (regional) and area (basin-wide). By 1992, at least 5980 km2 of forest had been forest regions in the world (Fearnside et al. 1990, Skole and Tucker 1993, Kuntz and Siegert 1999). Data

  13. This article was downloaded by: [Columbia University] On: 25 June 2011, At: 08:54

    E-Print Network [OSTI]

    Barrett, Lisa Feldman

    caused arising directly or indirectly in connection with or arising out of the use of this material. #12 philosophy, but they are doing it in stealth, enacting certain as- sumptions that are left unsaid. In "Mind

  14. This article was downloaded by: [King's College London] On: 29 September 2013, At: 07:59

    E-Print Network [OSTI]

    Bertero, Mario

    : Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK Optica Acta: International Journal of Optics & E.R. Pike (1983) Particle Size Distributions from Fraunhofer Diffraction, Optica Acta: International-and-conditions #12;OPTICA ACTA, 1983, voI. 30, NO . 8, 1043-1049 Particle size distributions from Fraunhofer

  15. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Rochester Institute of Technology

    E-Print Network [OSTI]

    Kandlikar, Satish

    . Com- pact heat exchanger surfaces were developed in response to the increasing demands from the automo not be liable for any loss, actions, claims, proceedings, demand or costs or damages whatsoever or howsoever in these fertile grounds, and they went on to become the architects of new products in industry. The Massachusetts

  16. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Harvard College

    E-Print Network [OSTI]

    Liu, Jun

    David Caplan Neuropsychology Laboratory, Massachusetts General Hospital, Boston, MA, USA Responses of 42 Neuropsychology Laboratory, Massachusetts General Hospital, Boston, MA, USA Online publication date: 05 November not be liable for any loss, actions, claims, proceedings, demand or costs or damages whatsoever or howsoever

  17. This article was downloaded by: [Tel Aviv University] On: 20 October 2013, At: 20:57

    E-Print Network [OSTI]

    Ben-Gal, Irad E.

    of the traditional TBM were suggested, such as the reliability-centered mainte- nance approach that studies Condition-Based Maintenance via Simulation and a Targeted Bayesian Network Metamodel Aviv Gruber a , Shai-Gal (2013) Condition-Based Maintenance via Simulation and a Targeted Bayesian Network Metamodel, Quality

  18. This article was downloaded by:[Canadian Research Knowledge Network] On: 25 March 2008

    E-Print Network [OSTI]

    Hossain, M. Enamul

    . A typical digester design is also shown here. It has been shown that an estimate of biogas production can. Keywords biogas, clean vehicle fuel, digester, natural gas, waste management Introduction It is most that biogas derived from household waste and manure can be used as an efficient fuel source for vehicles

  19. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [sultan qaboos university

    E-Print Network [OSTI]

    Hossain, M. Enamul

    , 37-41 Mortimer Street, London W1T 3JH, UK Petroleum Science and Technology Publication details in Porous Media',Petroleum Science and Technology,27:6,597 -- 611 To link to this Article: DOI: 10 caused arising directly or indirectly in connection with or arising out of the use of this material. #12

  20. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Delaware

    E-Print Network [OSTI]

    Sparks, Donald L.

    -distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone of atmospheric acid deposition on soils: 1) does acid rain enhance mobilization of harmful heavy metals in soils to the development of our forest and water resources3 . It could seriously hinder the prospects of using coal

  1. This article was downloaded by: [University of Arizona] On: 28 October 2013, At: 13:46

    E-Print Network [OSTI]

    Bonar, Scott A.

    : Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK Fisheries Publication details, including in diverse field locations on multiple age classes - from juveniles to adults.) BATTERY OPERATED (Fully

  2. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Otago

    E-Print Network [OSTI]

    Hickman, Mark

    Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37--the Cambridge Automated Neuropsy- chological Test Battery ``Stockings of Cambridge'' (CANTAB-TOL) and the Delis

  3. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [informa internal users

    E-Print Network [OSTI]

    Harris, Peter J F

    -resolution electron microscopy studies of non-graphitizing carbons P. J. F. Harris a ; S. C. Tsang a a Catalysis: 01 September 1997 To cite this Article Harris, P. J. F. and Tsang, S. C.(1997)'High carbons By P. J. F. HARRIS and S. C. TSANG Catalysis Research Centre, Department of Chemistry, University

  4. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [CDL Journals Account

    E-Print Network [OSTI]

    Kammen, Daniel M.

    neutral comfort temperatures and variations in building envelope performance, solar heat gain, thermal Street, London W1T 3JH, UK Building Research & Information Publication details, including instructions standards and variations in exceedance for mixed-mode buildings Sam Borgesonab ; Gail Bragerac a Center

  5. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Oxford

    E-Print Network [OSTI]

    ://www.informaworld.com/smpp/title~content=t713439457 Understanding Carbon Offset Technologies Heather Lovella ; Diana Livermanb a Centre for the Study(2010) 'Understanding Carbon Offset Technologies', New Political Economy, 15: 2, 255 -- 273 To link Carbon Offset Technologies HEATHER LOVELL & DIANA LIVERMAN In this article we unpack the `black box

  6. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Canadian Research Knowledge Network

    E-Print Network [OSTI]

    Farrell, Anthony P.

    ://www.informaworld.com/smpp/title~content=t713667234 Carbon Offsets and Inequality: Social Costs and Co-Benefits in Guatemala and Sri Lanka Hannah K Date: 01 September 2009 To cite this Article Wittman, Hannah K. and Caron, Cynthia(2009)'Carbon Offsets;Carbon Offsets and Inequality: Social Costs and Co-Benefits in Guatemala and Sri Lanka HANNAH K. WITTMAN

  7. This article was downloaded by:[American Museum of Natural History] On: 22 July 2008

    E-Print Network [OSTI]

    DeSalle, Rob

    ://www.informaworld.com/smpp/title~content=t713658732 Resolution of a Supertree/Supermatrix Paradox John Gatesy a ; Conrad Matthee b ; Rob DeSalle c, USA. First Published on: 01 July 2002 To cite this Article: Gatesy, John, Matthee, Conrad, De for geography, endemism and taxonomic af lation. Ecography 21: 181­203. FREY, J. K. 1992. Response

  8. 3596 IEEE TRANSACTIONS ON WIRELESS COMMUNICATIONS, VOL. 13, NO. 7, JULY 2014 Optimal Mobile Content Downloading

    E-Print Network [OSTI]

    Chen, Sheng

    University, Jeddah 21589, Saudi Arabia (e-mail: sqc@ecs.soton.ac.uk). Color versions of one or more data traffics delivered by mobile service providers, such as weather forecasts, multimedia newspapers

  9. This article was downloaded by: [University of Georgia] On: 04 February 2014, At: 13:21

    E-Print Network [OSTI]

    Georgia, University of

    b a Savannah River National Laboratory, Savannah River Site, Aiken, SC 29808, USA b Savannah River. Fletcherb and Andrew M. Grosseb,y a Savannah River National Laboratory, Savannah River Site, Aiken, SC 29808, USA; b Savannah River Ecology Laboratory, University of Georgia, Aiken, SC 29808, USA (Received 30

  10. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Suo, Zhigang

    E-Print Network [OSTI]

    Suo, Zhigang

    an elastomer of interpenetrating networks [12], by swelling an elastomer with a solvent [13], and by spraying that the snap-through instability is markedly affected by both the extension limit of polymer chains

  11. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Maloof, Joan

    E-Print Network [OSTI]

    Maloof, Joan

    knowledge one has about the ecological functioning of an environment, the more beautiful it will seem. All did. No significant difference was seen between the ratings from before or after an ecology aesthetics; Forest age; Serious beauty; Nature aesthetics; Gender perception Introduction The quality

  12. This article was downloaded by: [University of Connecticut] On: 27 August 2012, At: 07:43

    E-Print Network [OSTI]

    Wang, Bing

    ://www.tandfonline.com/loi/gpaa20 Decentralised online charging scheduling for large populations of electric vehicles: a cyber): Decentralised online charging scheduling for large populations of electric vehicles: a cyber-physical system 16 January 2012; final version received 16 January 2012) As the number of electric vehicles (EVs

  13. This article was downloaded by:[CDL Journals Account] On: 12 September 2007

    E-Print Network [OSTI]

    Koehl, Mimi

    of wind chop and ship wakes. As a fouling community develops, its topography becomes more complex, but also dislodges them. This paper reviews experiments in the field and in laboratory flumes, as well

  14. This article was downloaded by: [New York University] On: 29 April 2014, At: 10:11

    E-Print Network [OSTI]

    Pylkkänen, Liina

    York University, Abu Dhabi, United Arab Emirates Published online: 05 Dec 2013. To cite this article; c NYU Abu Dhabi Institute, New York University, Abu Dhabi, United Arab Emirates (Received 11 April

  15. This article was downloaded by: [New York University] On: 17 September 2014, At: 12:32

    E-Print Network [OSTI]

    Pylkkänen, Liina

    , Abu Dhabi, United Arab Emirates Published online: 16 Sep 2014. To cite this article: Timothy Leffel Abu Dhabi, PO Box 129188, Abu Dhabi, United Arab Emirates (Received 24 November 2013; accepted 6

  16. Event link: Download any free QR-Code reader app to

    E-Print Network [OSTI]

    Hall, Sharon J.

    Agency (EPA) Region 9 Administrator Jared Blumenfeld presents ASU's Sustainable Cities Network Change Administrator, U.S. EPA Pacific Southwest Region Join us as the U.S. Environmental Protection in the success of the Sustainable Cities Network at the award presentation. As former director of San Francisco

  17. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Canadian Research Knowledge Network

    E-Print Network [OSTI]

    Hossain, M. Enamul

    experiments are extensively used to investigate various issues in the petroleum industry. Such experiments House, 37- 41 Mortimer Street, London W1T 3JH, UK Petroleum Science and Technology Publication details., Ketata, C. and Islam, M. R.(2009) 'A Scaled Model Study of Waterjet Drilling', Petroleum Science

  18. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Rochester Institute of Technology

    E-Print Network [OSTI]

    Kandlikar, Satish

    ://www.informaworld.com/smpp/title~content=t713723051 A Roadmap for Implementing Minichannels in Refrigeration and Air- Conditioning Systems for Implementing Minichannels in Refrigeration and Air- Conditioning Systems--Current Status and Future Directions in Refrigeration and Air-Conditioning Systems -- Current Status and Future Directions SATISH G. KANDLIKAR

  19. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Kyusyhu University

    E-Print Network [OSTI]

    Weng, Lin

    of these highest weight vect,ors for the inner product introduced by Garland [GI. Wti hope that such results can

  20. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Canadian Research Knowledge Network

    E-Print Network [OSTI]

    Bahrami, Majid

    Akbari, Mohsen , Sinton, David and Bahrami, Majid(2010) 'Laminar Fully Developed Flow in Periodically­Diverging Microtubes MOHSEN AKBARI,1 DAVID SINTON,2 and MAJID BAHRAMI1 1 Mechatronic Systems Engineering, School

  1. This article was downloaded by: [University of Arizona] On: 10 January 2013, At: 04:09

    E-Print Network [OSTI]

    that include solid electrolyte batteries, fuel cells etc [1]. The special attention is paid to the crystals, proceedings, demand, or costs or damages whatsoever or howsoever caused arising directly or indirectly conductor where pro- tons can move in the subsystem of hydrogen bonds. The consideration is based

  2. This article was downloaded by:[Canadian Research Knowledge Network] On: 26 April 2008

    E-Print Network [OSTI]

    Hudlicky, Tomas

    -Sánchez a ; Fernando J. Gómez a ; Luz M. Jaramillo-Gómez a ; Tomas Hudlioky b a Departamento de Quimica, Universidad-Gomez,*a Tomas Hudlicky* $Departamentode Quimica, Universidad del Valle, A.A. 25360,Cali, Colombia *Chemistry correspondence should be addressed. luzmaja@quimica.univaile.edu.co 2795 Copyright Q 1999 by Marcel Dekker, Inc

  3. This article was downloaded by:[Rochester Institute of Technology] [Rochester Institute of Technology

    E-Print Network [OSTI]

    Kandlikar, Satish

    -square minichannel and adiabatic flows corresponding to practical PEM fuel cell conditions. Pressure drop data, chemical processing plants, nuclear reactor systems, and fuel cells. The present work considers a 1 mm not be liable for any loss, actions, claims, proceedings, demand or costs or damages whatsoever or howsoever

  4. This article was downloaded by: [Tel Aviv University] On: 24 October 2012, At: 01:19

    E-Print Network [OSTI]

    Shai, Offer

    A theoretical analysis of creativity methods in engineering design: casting and improving ASIT within C­K theory Shai & Eswaran Subrahmanian (2012): A theoretical analysis of creativity methods in engineering design of Engineering Design Vol. 23, No. 2, February 2012, 137­158 A theoretical analysis of creativity methods

  5. This article was downloaded by:[Univ of N Carolina Chapel Hill] On: 29 July 2008

    E-Print Network [OSTI]

    Entwislea , Stephen J. Walsha , Li Anc , Nathan Badenochd , Daniel G. Brownd , Peter Deadmane , Tom P and comparisons Ronald R. Rindfuss ab ; Barbara Entwisle a ; Stephen J. Walsh a ; Li An c ; Nathan Badenoch d ; Daniel G. Brown d ; Peter Deadman e ; Tom P. Evans f ; Jefferson Fox b ; Jacqueline Geoghegan g ; Myron

  6. This article was downloaded by:[Indiana University Libraries] On: 26 July 2008

    E-Print Network [OSTI]

    Evans, Tom

    Entwislea , Stephen J. Walsha , Li Anc , Nathan Badenochd , Daniel G. Brownd , Peter Deadmane , Tom P and comparisons Ronald R. Rindfuss ab ; Barbara Entwisle a ; Stephen J. Walsh a ; Li An c ; Nathan Badenoch d ; Daniel G. Brown d ; Peter Deadman e ; Tom P. Evans f ; Jefferson Fox b ; Jacqueline Geoghegan g ; Myron

  7. This article was downloaded by: [Jessie Peissig] On: 14 February 2012, At: 11:26

    E-Print Network [OSTI]

    Peissig, Jessie J.

    naturalistic images in which individuals posed with a variety of wigs and eyeglasses. Experiment 1 tested that a change in hairstyle or the removal of eyeglasses had more impact on performance than did the addition of eyeglasses. In Experiment 2, disguised and undisguised faces were presented upright or inverted to examine

  8. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Mejia-Rodriguez, Gilberto

    E-Print Network [OSTI]

    Tomar, Vikas

    ://www.informaworld.com/smpp/title~content=t713641621 Multi-objective ceramic matrix composite material design using the variable fidelity model MejŪa-RodrŪguez, G. , Renaud, J. E. and Tomar, V.(2010) 'Multi-objective ceramic matrix composite;Engineering Optimization iFirst, 2010, 1≠24 Multi-objective ceramic matrix composite material design using

  9. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [CDL Journals Account

    E-Print Network [OSTI]

    Klein, Ophir

    Sciences, Dar es Salaam, Tanzania Online Publication Date: 01 April 2008 To cite this Article Taché, S and Allied Sciences, School of Medicine, Dar es Salaam, Tanzania Abstract The shortage of qualified health

  10. This article was downloaded by: [Duke University Libraries] On: 12 December 2013, At: 12:20

    E-Print Network [OSTI]

    McShea, Daniel W.

    visual searchers Adam T. Biggs a & Stephen R. Mitroff a a Department of Psychology & Neuroscience, Center.Published online: 09 Dec 2013. To cite this article: Adam T. Biggs & Stephen R. Mitroff , The Quarterly of multiple-target search accuracy between nonprofessional and professional visual searchers Adam T. Biggs

  11. This article was downloaded by: [Duke University Libraries] On: 25 June 2013, At: 12:40

    E-Print Network [OSTI]

    Mitroff, Stephen

    and nonprofessional visual searchers Adam T. Biggs a , Matthew S. Cain a , Kait Clark a , Elise F. Darling a & Stephen University , Durham , NC , USA Published online: 13 May 2013. To cite this article: Adam T. Biggs , Matthew S and nonprofessional visual searchers Adam T. Biggs, Matthew S. Cain, Kait Clark, Elise F. Darling, and Stephen R

  12. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Arizona

    E-Print Network [OSTI]

    Scott, Christopher

    data, Krishna Basin, India T. W. Biggs ab ; P. S. Thenkabail c ; M. K. Gumma a ; C. A. Scott d ; G. R To cite this Article Biggs, T. W., Thenkabail, P. S., Gumma, M. K., Scott, C. A., Parthasaradhi, G. R, Krishna Basin, India T. W. BIGGS*{{, P. S. THENKABAIL§, M. K. GUMMA{, C. A. SCOTT", G. R. PARTHASARADHI

  13. This article was downloaded by:[University of Sydney] On: 12 March 2008

    E-Print Network [OSTI]

    Powles, Rebecca

    they are and what they can be used for M. J. Biggs a ; A. Buts a a Institute for Materials and Processes, University of Edinburgh, Edinburgh, Scotland, UK Online Publication Date: 01 June 2006 To cite this Article: Biggs, M. J be used for M. J. BIGGS* and A. BUTS Institute for Materials and Processes, University of Edinburgh, King

  14. This article was downloaded by:[CDL Journals Account] On: 27 August 2007

    E-Print Network [OSTI]

    California at Berkeley, University of

    Steinmaus ab ; Lee E. Moore ac ; Miriam Shipp d ; David Kalman e ; Omar A. Rey f ; Mary L. Biggs g ; Claudia., Shipp, Miriam, Kalman, David, Rey, Omar A., Biggs, Mary L., Hopenhayn, Claudia, Bates, Michael N., Zheng

  15. This article was downloaded by:[Danish Veterinary and Agricultural Library] [Danish Veterinary and Agricultural Library

    E-Print Network [OSTI]

    Nielsen, Rasmus

    & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer of mappings is also presented, and the utility of the method is illustrated on two previously published data to this problem has been to infer the location of mutations on the phylogeny us- ing maximumparsimony

  16. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University College London

    E-Print Network [OSTI]

    Alfè, Dario

    ://www.informaworld.com/smpp/title~content=t713644482 Benchmarking DFT surface energies with quantum Monte Carlo S. J. Binnie abc ; E. Sola ad ; D. Alfè First Published:June2009 To cite this Article Binnie, S. J., Sola, E., Alfè, D. and Gillan, M. J.(2009)'Benchmarking DFT surface energies with quantum Monte Carlo',Molecular Simulation,35:7,609 -- 612 To link

  17. This article was downloaded by: [oscar schofield] On: 04 November 2014, At: 11:04

    E-Print Network [OSTI]

    floats, gliders, and autonomous underwater vehicles. The observational data is complemented and hazards associated with wind, waves, and storms limit the ability of humans to sustain a coherent glob

  18. This article was downloaded by:[Cornell University] On: 20 December 2007

    E-Print Network [OSTI]

    cross-validated cubic smoothing splines S. B. Pope a ; R. Gadh b a Sibley School of Mechanical. and Gadh, R. (1988) 'Fitting noisy data using cross-validated cubic smoothing splines', Communications USING CROSS-VALIDATED CUBIC SMOOTHING SPLINES S.B. Pope R. Gadh Sibley School of Mechanical & Aerospace

  19. This article was downloaded by: [University of Akron] On: 24 February 2012, At: 08:24

    E-Print Network [OSTI]

    Dhinojwala, Ali

    , including instructions for authors and subscription information: http://www.tandfonline.com/loi/gadh20

  20. This article was downloaded by: [Duke University Libraries] On: 20 August 2013, At: 16:08

    E-Print Network [OSTI]

    a , S. C. Deshmukh a , A. A. Gadhe a , G. S. Kannade a , S. K. Lokhande a , R. A. Pandey a , A. N this article: R. M. Dixit , S. C. Deshmukh , A. A. Gadhe , G. S. Kannade , S. K. Lokhande , R. A. Pandey , A. N

  1. This article was downloaded by: [Purdue University] On: 22 January 2014, At: 09:34

    E-Print Network [OSTI]

    Cheng, Guang

    ), NIH grants NIH/NCI R01 CA-085848 (Zhang), NIH/NCI R01 CA-149569 (Liu), and NIH/NCI P01 CA142538 (Zhang

  2. DownloadedBy:[UniversityofCalifornia]At:21:248August2007 A Tribute to Heinz

    E-Print Network [OSTI]

    Bell, Alexis T.

    between the Laboratory and the U.S. Department of Energy. During the course of his career, which spanned laboratory. Upon his retirement from Mobil in 1978, he became a Senior Scientist at the Lawrence Berkeley Laboratory, where he continued to pursue research on new catalytic processes for the production of gaseous

  3. This article was downloaded by:[Eliazar, I.] On: 3 February 2008

    E-Print Network [OSTI]

    Yechiali, Uri

    a Department of Technology Management, Holon Institute of Technology, Holon, Israel b Department of Statistics of Technology Management, Holon Institute of Technology, Holon, Israel 2 Department of Statistics & Operations

  4. This article was downloaded by: [the Bodleian Libraries of the University of Oxford], [Yadvinder Malhi

    E-Print Network [OSTI]

    Malhi, Yadvinder

    to monitor aboveground biomass in forest and oil palm in Sabah, Malaysia, for 2000­2008 with Landsat ETM to monitor aboveground biomass in forest and oil palm in Sabah, Malaysia, for 2000­2008 with Landsat ETM the potential to monitor aboveground biomass in forest and oil palm in Sabah, Malaysia, for 2000

  5. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Islam, M. R.

    E-Print Network [OSTI]

    Hossain, M. Enamul

    An Environment-Friendly Alkaline Solution for Enhanced Oil Recovery M. S. Rahman a ; M. E. Hossain a ; M. R Environment-Friendly Alkaline Solution for Enhanced Oil Recovery',Petroleum Science and Technology,26 for Enhanced Oil Recovery M. S. Rahman,1 M. E. Hossain,1 and M. R. Islam1 1Faculty of Engineering, Dalhousie

  6. This article was downloaded by: [Manuel Prieto] On: 15 March 2012, At: 09:24

    E-Print Network [OSTI]

    , teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling government (1973­1990) that included reforms in both the water and electricity sectors. One of the stated purposes of these reforms was to remove ideology from both water management and electricity generation

  7. This article was downloaded by: [LSE Library] On: 18 March 2013, At: 13:36

    E-Print Network [OSTI]

    Fryzlewicz, Piotr

    ://www.tandfonline.com/loi/uasa20 Modeling and Forecasting Daily Electricity Load Curves: A Hybrid Approach Haeran Cho a , Yannig: Haeran Cho , Yannig Goude , Xavier Brossat & Qiwei Yao (2013): Modeling and Forecasting Daily Electricity, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling

  8. This article was downloaded by:[B-on Consortium -2007] On: 15 November 2007

    E-Print Network [OSTI]

    Carrapiço, Francisco

    have a transfer-like ultrastructure normally associated with secretion of metabolites. The aim of lipids, unsaturated lipids, polysaccharides, polyphenols (o-dihydroxyphenols, phenols with free √?√?OH is not known. Key words: Alkaloids, Azolla filiculoides, histochemistry, lipids, polysaccharides, tannins

  9. This article was downloaded by: [MM Ali] On: 04 January 2012, At: 17:55

    E-Print Network [OSTI]

    , 37-41 Mortimer Street, London W1T 3JH, UK Remote Sensing Letters Publication details, including of satellite-derived tropical cyclone heat potential with in situ observations in the North Indian Ocean, National Remote Sensing Centre, ISRO, Hyderabad, Andhra Pradesh, India b Atlantic Oceanographic

  10. This article was downloaded by:[Universitetsbiblioteket i Bergen] [Universitetsbiblioteket i Bergen

    E-Print Network [OSTI]

    Norway, constrained by surface exposure dating and clay mineralogy First Published on: 19 February 2007 reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form, constrained by surface exposure dating and clay mineralogy ATLE NESJE, SVEIN OLAF DAHL, HENRIETTE LINGE, COLIN

  11. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Delaware

    E-Print Network [OSTI]

    Sparks, Donald L.

    reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form of micaceous and vermiculitic clay ( Coastal Plain soils, N is readily lost via leaching and denitrification due to low clay and organic matter

  12. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Vajda, Vivi

    E-Print Network [OSTI]

    Vajda, Vivi

    -distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone of Bornholm (Fig. 1). Plant fossils were particularly abundant in the old clay pit at the Hasle tile factory

  13. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Florida State University Libraries

    E-Print Network [OSTI]

    Donoghue, Joseph

    -distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone. Seventy-nine short cores were collected from 66 sample locations, representing four lithofacies:clay for texture, total organic matter, total carbon, total nitrogen, clay mineralogy, and major and trace

  14. This article was downloaded by:[Wen, Guang] On: 30 January 2008

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    and chickpea to phosphorus addition in a clay loam soil of central Montana Guang Wen a ; Chengci Chen b and chickpea to phosphorus addition in a clay loam soil of central Montana', Archives of Agronomy and Soil reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form

  15. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Vince, A.

    E-Print Network [OSTI]

    Vince, Andrew

    reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form are preserved on Babylonian clay tablets from about 2300 B.C. The first whole world maps began to appear

  16. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [O'Keefe, F. Robin

    E-Print Network [OSTI]

    O'Keefe, F. Robin

    reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form by a lack of fossils from outside the Oxford Clay deposits of England. Recent fieldwork in the Sundance

  17. This article was downloaded by:[UT Arlington] On: 7 September 2007

    E-Print Network [OSTI]

    Winguth, Arne

    -distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone near Batticaloa at the coast of Sri Lanka encompasses coral reefs and sandy clay over gravel

  18. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Rutgers University

    E-Print Network [OSTI]

    Guo, Zhixiong "James"

    ://www.informaworld.com/smpp/title~content=t713657973 Ultrafast Radiative Heat Transfer in Three-Dimensional Highly-Scattering Media Subjected to Pulse;ULTRAFAST RADIATIVE HEAT TRANSFER IN THREE-DIMENSIONAL HIGHLY-SCATTERING MEDIA SUBJECTED TO PULSE TRAIN therapy [6­10], and so forth. Since the advent of ultra-short pulsed lasers, the study of ultrafast

  19. Multicast Protocols for Scalable On-Demand Download Niklas Carlsson Derek L. Eager

    E-Print Network [OSTI]

    Vernon, Mary K.

    not model packet loss recovery, although our analyses and protocols are compatible with erasure coded data bandwidth and maximum client delay for this batching with constant batch delay (bcd) protocol, as follows

  20. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Dudley, Bruce D.

    E-Print Network [OSTI]

    Shima, Jeff

    , Wellington, New Zealand Bruce D. Dudley a ;Jeffrey S. Shima a a School of Biological Sciences, Victoria, New Zealand Bruce D Dudley* and Jeffrey S Shima School of Biological Sciences, Victoria University of Wellington, PO Box 600, Wellington, New Zealand (Received 4 August 2009; final version received 2 November

  1. This article was downloaded by: [Tufts University] On: 25 November 2014, At: 08:08

    E-Print Network [OSTI]

    Patel, Aniruddh D.

    spatial uncertainty Tad T. Brunyé ac , Stephanie A. Gagnon abc , Aaron L. Gardony ac , Nikhil Gopal of Linguistics, Bangor University, Bangor, UK Published online: 06 Oct 2014. To cite this article: Tad T. Brunyé navigation decisions during spatial uncertainty Tad T. Brunyé1,3 , Stephanie A. Gagnon1,2,3 , Aaron L

  2. This article was downloaded by: [Tufts University] On: 21 May 2013, At: 08:03

    E-Print Network [OSTI]

    Patel, Aniruddh D.

    Better you than I: Perspectives and emotion simulation during narrative comprehension Tad T. Bruny√© a c Published online: 26 Jul 2011. To cite this article: Tad T. Bruny√© , Tali Ditman , Caroline R. Mahoney;Better you than I: Perspectives and emotion simulation during narrative comprehension Tad T. Brunye¬ī 1

  3. This article was downloaded by: [Tufts University] On: 21 May 2013, At: 08:30

    E-Print Network [OSTI]

    Patel, Aniruddh D.

    Caffeine increases false memory in nonhabitual consumers Caroline R. Mahoney a b , Tad T. Bruny√© a b Medicine, Natick, MA, USA Published online: 07 Mar 2012. To cite this article: Caroline R. Mahoney , Tad T in nonhabitual consumers Caroline R. Mahoney1,2 , Tad T. Brunye¬ī 1,2 , Grace E. Giles1,2 , Tali Ditman1

  4. This article was downloaded by: [Jrme Pousin] On: 04 December 2012, At: 01:49

    E-Print Network [OSTI]

    Buscaglia, Gustavo C.

    of asymptotic partial decomposition of a domain (MAPDD) originates from the works of Panasenko [1]. The idea recently become available for several systems (linear/nonlinear, fluid/ solid, etc.) which allow for each

  5. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Cimprich, Bernadine

    E-Print Network [OSTI]

    ; Marc G. Berman c ; Daniel F. Hayes bf ; Douglas C. Noll g ; Scott Peltier g ; Robert C. Welsh h, Douglas C., Peltier, Scott and Welsh, Robert C.(2009)'Prechemotherapy alterations in brain function Therrien,1 Daniel Normolle,5 Marc G. Berman,3 Daniel F. Hayes,2,6 Douglas C. Noll,7 Scott Peltier,7

  6. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Columbia University

    E-Print Network [OSTI]

    Medellín, Rodrigo

    Qu√≠mico Biol√≥gicas, Universidad Aut√≥noma de Campeche, Colonia Buenavista, Campeche, M√©xico b Instituto de la Frontera Sur, Unidad Campeche, Campeche, M√©xico Online Publication Date: 01 January 2009 To cite¬īmico Biolo¬īgicas, Universidad Auto¬īnoma de Campeche, Colonia Buenavista, Campeche, Me¬īxico; c El Colegio de

  7. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Rochester Institute of Technology

    E-Print Network [OSTI]

    Kandlikar, Satish

    appears in the fuel cells not only from the water generated at the cathode catalyst layer but also cells is being pursued world- wide to develop hydrogen as a replacement fuel for the cur- rent petroleum in enabling hydrogen- based fuel cell technology. The role of effective water man- agement in proton exchange

  8. Using Space-Data-Routers for the timely and targeted downloading of

    E-Print Network [OSTI]

    Anastasiadis, Anastasios

    onboard geostationary (e.g. Meteosat Second Generation MSG viewing Europe and Africa) and near polar orbit Heat Island; thematic quiries; big data; Space Data Routers I. INTRODUCTION Land surface temperature. This is shown in Table 1. These missions have been providing continuous monitoring of LST distribution

  9. This article was downloaded by: [Julia Jones] On: 21 June 2013, At: 11:37

    E-Print Network [OSTI]

    Kurapov, Alexander

    House, 37-41 Mortimer Street, London W1T 3JH, UK Atmosphere-Ocean Publication details, including and Streamflow Trends in the Columbia River Basin: Evidence for Ecological and Engineering Resilience to Climate in the Columbia River Basin: Evidence for Ecological and Engineering Resilience to Climate Change, Atmosphere

  10. This article was downloaded by: [University of Connecticut] On: 18 March 2014, At: 08:17

    E-Print Network [OSTI]

    House, 37-41 Mortimer Street, London W1T 3JH, UK Journal of Motor Behavior Publication details for the Ecological Study of Perception and Action , University of Connecticut , Storrs b Haskins Laboratories , New

  11. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Stanford University

    E-Print Network [OSTI]

    Pratt, Vaughan

    Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37 the Cleanroom: On Ecological Validity and Ubiquitous Computing Scott Carter a ; Jennifer Mankoff b ; Scott R: On Ecological Validity and Ubiquitous Computing',Human-Computer Interaction,23:1,47 -- 99 To link

  12. This article was downloaded by: [University of Connecticut] On: 09 August 2013, At: 16:16

    E-Print Network [OSTI]

    House, 37-41 Mortimer Street, London W1T 3JH, UK Ecological Psychology Publication details, including Nature of the Reaction Time Task Michael T. Turvey a & Claudia Carello b a Center for the Ecological for the Ecological Study of Perception and Action University of Connecticut Published online: 26 Jul 2013. To cite

  13. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Montana

    E-Print Network [OSTI]

    Belsky, Jill M.

    Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37 environmental learning and enhance social≠ecological systems resilience? Participatory action research (PAR. As such it may be a useful tool for environmental learning which would enable a social≠ ecological system

  14. This article was downloaded by: [Eugene Goldfield] On: 12 November 2012, At: 16:25

    E-Print Network [OSTI]

    Park, Yong-Lae

    House, 37-41 Mortimer Street, London W1T 3JH, UK Ecological Psychology Publication details, including Assistive Devices: The Interface of Physics, Biology, and Behavior, Ecological Psychology, 24:4, 300-327 #12. Downloadedby[EugeneGoldfield]at16:2512November2012 #12;Ecological Psychology, 24:300≠327, 2012 Copyright

  15. This article was downloaded by: [Colorado State University] On: 25 August 2011, At: 09:14

    E-Print Network [OSTI]

    : Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK International Journal of Phytoremediation://www.tandfonline.com/loi/bijp20 Selenium Accumulation in Plants--Phytotechnological Applications and Ecological Implications Josť Accumulation in Plants--Phytotechnological Applications and Ecological Implications, International Journal

  16. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [CDL Journals Account

    E-Print Network [OSTI]

    Martin, Michael C.

    Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House. This heterogeneity, which can be of ecological significance, clearly can- not be evaluated in experiments that are averaged over large populations. The challenge is to identify those cells of ecological importance within

  17. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Tiquia, S. M.

    E-Print Network [OSTI]

    Tiquia-Arashiro, Sonia M.

    Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer), and Turning Basin (T1A). A total of 498 dsrAB clones were sequenced from the three sites. Ecological indices

  18. SPRING QUARTER 2013 System:Users:natalie:Downloads:Roster SQ13.xls

    E-Print Network [OSTI]

    Kolner, Brian H.

    @ucdavis.edu 3016 Kemper Hall 8 2-1437 Suprun, Yulia - Acct Manager ysuprun@ucdavis.edu 2064 Kemper Hall 9 2

  19. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Canadian Research Knowledge Network

    E-Print Network [OSTI]

    Li, Michael

    ://www.informaworld.com/smpp/title~content=t744398444 Global dynamics of a staged-progression model with amelioration for infectious diseases Hongbin Guo; Michael Y. Li Online Publication Date: 01 April 2008 To cite this Article Guo, Hongbin and Li-progression model with amelioration for infectious diseases Hongbin Guo and Michael Y. Li* Department

  20. Downloaded 30.4.2008 from http://freebooksource.com/?p=10173

    E-Print Network [OSTI]

    Zevenhoven, Ron

    . He has been a member of the Thermo- Fluids-Engineering group of the Mechanical Engineering Department engaged in research and consulting in thermo-fluids engineering and is an active reviewer of research National Academy of Engineering (FNAE). #12;#12;Introduction to Computational Fluid Dynamics ANIL W. DATE

  1. Document Downloaded: Wednesday February 23, 2011 Recognizing and Managing Personal Conflicts of Interest

    E-Print Network [OSTI]

    Alabama in Huntsville, University of

    -intensive universities. This document is the result of the efforts of the COGR Working Group on Conflicts of Interest of Interest Author: COGR Published Date: 10/01/2002 #12;Recognizing and Managing Personal Financial Conflicts of Interest COGR COUNCIL ON GOVERNMENTAL RELATIONS Winter 2002 #12;Council on Governmental Relations 2

  2. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Soward, Andrew

    E-Print Network [OSTI]

    Priest, Eric

    as a mechanism for accelerating electrons near a black hole to produce gamma-ray bursts (Vlahos et al., 2003

  3. This article was downloaded by: [UNSW Library] On: 05 March 2013, At: 07:27

    E-Print Network [OSTI]

    Pota, Himanshu Roy

    House, 37-41 Mortimer Street, London W1T 3JH, UK International Journal of Sustainable Energy Publication power margin; solar; wind turbine 1. Introduction Distributed generation (DG) based on renewable energy energy N. K. Roy a , H. R. Pota a & M. J. Hossain b a School of Engineering and Information Technology

  4. This article was downloaded by:[University of Nevada, Las Vegas, Libraries] On: 9 October 2007

    E-Print Network [OSTI]

    Ahmad, Sajjad

    ://www.informaworld.com/smpp/title~content=t713401148 Variations in Depleted Uranium Sorption and Solubility with Depth in Arid Soils William H. Johnson., Brogonia, Henry and Brock, Amy L. (2004) 'Variations in Depleted Uranium Sorption and Solubility with Depth-8337 print / 1549-7887 online DOI: 10.1080/10588330490519428 Variations in Depleted Uranium Sorption

  5. This article was downloaded by:[University of Nevada, Las Vegas, Libraries] On: 9 October 2007

    E-Print Network [OSTI]

    Ahmad, Sajjad

    ://www.informaworld.com/smpp/title~content=t713401148 Corrosion of Depleted Uranium in an Arid Environment: Soil-Geomorphology, SEM/EDS, XRD J., Brock, Amy L., Johnson, William H. and Ulery, April L. (2004) 'Corrosion of Depleted Uranium of Depleted Uranium in an Arid Environment: Soil-Geomorphology, SEM/EDS, XRD, and Electron Microprobe Analyses

  6. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Texas Austin

    E-Print Network [OSTI]

    Patzek, Tadeusz W.

    .................................................................................................................225 4. FARM SOLAR ARRAY ...................................://www.informaworld.com/smpp/title~content=t713400911 The Visible, Sustainable Farm: A Comprehensive Energy Analysis of a Midwestern Farm Aaron W, Tadeusz , Bender, Martin , Renich, Steve and Jackson, Wes(2009) 'The Visible, Sustainable Farm

  7. This article was downloaded by: [Georgia Tech Library] On: 05 April 2013, At: 11:47

    E-Print Network [OSTI]

    Wu, Jeff

    pressure and solar irradiation. These are the microclimate variables used by building energy models to define boundary conditions that encapsulate the interaction of the building with the surrounding physical

  8. This article was downloaded by: [SLU Library] On: 07 October 2011, At: 03:43

    E-Print Network [OSTI]

    Wageningen, The Netherlands d Institute of Conservation Biology, Vegetation Ecology and Landscape Ecology.1080/09640568.2011.575698 #12;PLEASE SCROLL DOWN FOR ARTICLE Full terms and conditions of use: http://www.tandfonline.com/page Wageningen University and Research Centre, PO Box 47, 6700 AA Wageningen, The Netherlands; d Institute

  9. This article was downloaded by: [Universiteit Twente] On: 14 March 2013, At: 02:55

    E-Print Network [OSTI]

    Boucherie, Richard J.

    , The Netherlands b Korteweg-de Vries Institute for Mathematics, University of Amsterdam, Amsterdam, The Netherlands.1080/03610918.2012.625337 PLEASE SCROLL DOWN FOR ARTICLE Full terms and conditions of use: http://www.tandfonline.com/page Engineering, Mathematics, and Computer Science, University of Twente, The Netherlands 2 Korteweg-de Vries

  10. This article was downloaded by: [University of Leeds] On: 06 March 2012, At: 09:14

    E-Print Network [OSTI]

    Burke, Ian

    Centre for Radwaste and Decommissioning and Williamson Research Centre for Molecular Environmental and Katherine Morris1 1 Research Centre for Radwaste and Decommissioning and Williamson Research Centre, The University of Leeds, Leeds, United Kingdom Groundwaters at nuclear sites can be characterized by low p

  11. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Leeds

    E-Print Network [OSTI]

    Burke, Ian

    and Decommissioning, and Williamson Centre for Molecular Environmental Science, School of Earth, Atmospheric, United Kingdom 2 Research Centre for Radwaste and Decommissioning, and Williamson Centre for Molecular. The microcosm experiments contained sediment representative of the nuclear facility at Dounreay, UK. In oxic

  12. This article was downloaded by: [Adrian Tuck] On: 22 August 2011, At: 11:16

    E-Print Network [OSTI]

    Lovejoy, Shaun

    ://www.tandfonline.com/loi/tres20 Vertical scaling of temperature, wind and humidity fluctuations: dropsondes from 13 km Journal of Remote Sensing iFirst, 2011, 1­28 Vertical scaling of temperature, wind and humidity from research dropsondes for temperature, wind speed and relative humidity during the 800 s it takes

  13. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Simitev, Radostin

    E-Print Network [OSTI]

    Simitev, Radostin D

    . In industrial applications, thermal convection enters wherever heat transfer is involved. In nuclear reactors;Geophysical and Astrophysical Fluid Dynamics Vol. 105, No. 1, February 2011, 109­111 Book Review Thermal

  14. Download the SunShot Initiative 2014 Portfolio | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Year in Review: TopEnergy DOEDealingVehicle1 Guidanceflash2004-12.pdfDownhole Sensor

  15. Downloads: August 6-8, 2013 National Veterans Small Business Conference |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Year in Review: TopEnergy DOEDealingVehicle1 Guidanceflash2004-12.pdfDownhole SensorDepartment

  16. Quarterly Smart Grid Data available for download on OpenEI | OpenEI

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to:Co Jump to:

  17. Downloaded 01 Jul 2002 to 128.104.222.103. Redistribution subject to AIP license

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesDataTranslocationDiurnal CycleDonald1 Jul 2002 to 128.104.222.103.

  18. Downloaded 09 Feb 2007 to 128.104.165.60. Redistribution subject to AIP license

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesDataTranslocationDiurnal CycleDonald1 Jul 2002 to

  19. Downloaded 09 Feb 2007 to 128.104.165.60. Redistribution subject to AIP license

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesDataTranslocationDiurnal CycleDonald1 Jul 2002 to

  20. Downloaded 10 Jan 2005 to 128.104.223.90. Redistribution subject to AIP license

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesDataTranslocationDiurnal CycleDonald1 Jul 2002 to10 Jan 2005 to

  1. 5 Reasons to Download the New Building America Solutions App | Department

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustionImprovement3 Beryllium-Associated Worker2014Department ofDepartment of Energy 5 Questionsof

  2. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Central Florida

    E-Print Network [OSTI]

    Wu, Shin-Tson

    for the case of strong anchoring and x ! 1 when the anchoring is weak (1­3). The demand for faster response not be liable for any loss, actions, claims, proceedings, demand or costs or damages whatsoever or howsoever, are presented. Potential applications of these compounds are discussed. Compounds with a negative dielectric

  3. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Central Florida

    E-Print Network [OSTI]

    Wu, Shin-Tson

    not be liable for any loss, actions, claims, proceedings, demand or costs or damages whatsoever or howsoever. The dielectric relaxation and electro-optical properties of these compounds were characterised. Potential is response time. The response time of a LC device is determined by cell gap, viscoelastic coefficient

  4. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [University of Edinburgh

    E-Print Network [OSTI]

    , University of Edinburgh, Edinburgh, EH9 3JL, UK Micro combined-heat-and-power (micro-CHP) technology has://www.informaworld.com/smpp/title~content=t713447357 The hesitant emergence of low carbon technologies in the UK: the micro- CHP innovation system carbon technologies in the UK: the micro-CHP innovation system', Technology Analysis & Strategic

  5. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Rochester Institute of Technology

    E-Print Network [OSTI]

    Kandlikar, Satish

    reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form reached the current limits of air-cooling technology. Some of the applications require heat fluxes well beyond the limit of 100 W/cm2, thus demanding advanced cooling solutions. Liquid cooling technology has

  6. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Isosaari, Pirjo

    E-Print Network [OSTI]

    Rubin, Yoram

    regulations, and conserve water, material, and energy resources. KEY WORDS: constructed wetland, food processing, land appli- cation, treatment pond, solar evaporation, sustainable technology, wastewater-governmental organizations (Graedel & Klee, 2002). These concerns are often linked to energy efficiency, reduction of en

  7. Appendix B Forms Note: Current versions of these forms (downloadable) are available on-line at

    E-Print Network [OSTI]

    : [www.energy.ca.gov/renewables/documents/index.html#rps] Some of these forms are new or have been Program regulations. Schedule 1: Renewables and the Attestation are provided in this version Aggregate and Schedule 5: SB 1 Solar Program Status Report, are not directly applicable to the RPS program

  8. This article was downloaded by: [Brian Blackwell] On: 09 September 2011, At: 11:25

    E-Print Network [OSTI]

    for smallmouth bass collected with fyke nets were variable but generally low (0.2≠4.7 fish/net night) across increased from May through September, primarily due to age-0 bass becoming vulnerable to electro- fishing Seasonal sampling dynamics of smallmouth bass (Micropterus dolomieu) in northeastern South Dakota Thomas D

  9. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [South Dakota State University

    E-Print Network [OSTI]

    chrysops) is an important sport fish species in the upper Midwest. As such, understanding white bass://www.informaworld.com/smpp/title~content=t925992003 White bass population demographics in a northwestern South Dakota reservoir Quinton E. Phelpsab this Article Phelps, Quinton E. , Ward, Matthew J. and Willis, David W.(2011) 'White bass population

  10. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Ingenta Content Distribution Psy Press Titles

    E-Print Network [OSTI]

    Kandlikar, Satish

    , while refrigerant charge reduction and performance enhancement remain important safety and operating://www.informaworld.com/smpp/title~content=t713723051 A Roadmap for Implementing Minichannels in Refrigeration and Air- Conditioning Systems Kandlikar, Satish G.(2007)'A Roadmap for Implementing Minichannels in Refrigeration and Air

  11. This article was downloaded by: [Elizabeth Barron] On: 07 June 2014, At: 08:41

    E-Print Network [OSTI]

    Lave, Rebecca

    the Depth of Field on Stream Restoration: Observing the Rise of Neoliberal Para-science Elizabeth S. Barron on Stream Restoration: Observing the Rise of Neoliberal Para-science, Science as Culture, DOI: 10 the Depth of Field on Stream Restoration: Observing the Rise of Neoliberal Para-science ELIZABETH S. BARRON

  12. This article was downloaded by:[Bochkarev, N.] On: 13 December 2007

    E-Print Network [OSTI]

    Priest, Eric

    reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form by Gordon and Breach Science Publishers Printed in India Session 2 : The Sun BASIC MAGNETIC FIELD) is about 100 times greater than the surrounding coro- nal value while their temperature (- 8000 K) is about

  13. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Canadian Research Knowledge Network

    E-Print Network [OSTI]

    Farrell, Anthony P.

    increasing concerns about climate change, food shortages, and wide- spread environmental degradation to widespread rural dislocation and environmental degradation, but have also disrupted the practice of agrarian loss, actions, claims, proceedings, demand or costs or damages whatsoever or howsoever caused arising

  14. This article was downloaded by: [Lib4RI] On: 26 August 2011, At: 01:47

    E-Print Network [OSTI]

    , Switzerland b Landscape Ecology Group, Department of Ecology and Environmental Science, Umeå University, SE not be liable for any loss, actions, claims, proceedings, demand or costs or damages whatsoever or howsoever-natural references) or to avoid (degraded references). We studied the extent to which investigators' conclusions

  15. This article was downloaded by: [Georgia Tech Library] On: 10 April 2013, At: 14:09

    E-Print Network [OSTI]

    Wu, Jeff

    of the variation in manufacturing and environmental condi- tions, and degradation over time, the actual value, proceedings, demand, or costs or damages whatsoever or howsoever caused arising directly or indirectly

  16. This article was downloaded by:[Virginia Tech./University Libraries] On: 30 July 2007

    E-Print Network [OSTI]

    Aggarwal, Suresh K.

    FLAMES IN METHANE/OXYGEN/INERT MIXTURES', Combustion Science and Technology, 179:9, 1777 - 1795 To linkJH, UK Combustion Science and Technology Publication details, including instructions for authors-GAS THERMODYNAMICS ON SIMULATIONS OF FREELY PROPAGATING FLAMES IN METHANE/OXYGEN/INERT MIXTURES Online Publication

  17. Moratorium and Suspension of the Release of Metals from DOE Sites (Download

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector General Office0-72.pdfGeorgeDoesn't32Department of EnergyDepartmentJuly 2013 MonthlyPage) |

  18. AVTA: 2010 Honda CR-Z Hybrid Downloadable Dynamometer Database Reports |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up fromDepartment of Energy 601 High26-OPAM63-OPAMGuidanceAVTA ¬ÖFord Fusion

  19. This content has been downloaded from IOPscience. Please scroll down to see the

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism in Layered NbS2 andThe1A: Handling of4,3, 20114,0,24, 2014PA-133G37

  20. This content has been downloaded from IOPscience. Please scroll down to see the

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism in Layered NbS2 andThe1A: Handling of4,3, 20114,0,24, 2014PA-133G375

  1. This content has been downloaded from IOPscience. Please scroll down to see the

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism in Layered NbS2 andThe1A: Handling of4,3, 20114,0,24, 2014PA-133G3756

  2. This article was downloaded by: [Kamran Mohseni] On: 02 April 2013, At: 11:03

    E-Print Network [OSTI]

    Mohseni, Kamran

    House, 37-41 Mortimer Street, London W1T 3JH, UK Advanced Robotics Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tadr20 Passive mitigation 2013. To cite this article: Matt Shields & Kamran Mohseni (2013): Passive mitigation of roll stall

  3. This article was downloaded by:[Cornell University Library] On: 20 December 2007

    E-Print Network [OSTI]

    Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK). For the simple case of decaying fluctuations of a passive scalar in homogeneous turbu- lence, measurements

  4. This article was downloaded by: [Oregon State University] On: 18 December 2012, At: 11:46

    E-Print Network [OSTI]

    : Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK Fisheries Publication details, including times, and survival of 4,140 JSATS-tagged and 48,433 passive integrated transponder (PIT)- tagged

  5. This article was downloaded by:[Montana State University] On: 27 June 2008

    E-Print Network [OSTI]

    Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK spring constant that provides for passive vibration damping down to sub-Hertz frequencies while allowing using this device.Two-dimensional(threedegree-of-freedom)passive damping tests were conducted on NASA

  6. This article was downloaded by: [Nicholas Burnett] On: 27 December 2012, At: 21:33

    E-Print Network [OSTI]

    Cooke, Steven J.

    : Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK North American Journal of Fisheries Management://www.tandfonline.com/loi/ujfm20 Comparison of Detection Efficiency among Three Sizes of Half-Duplex Passive Integrated. Cooke (2013): Comparison of Detection Efficiency among Three Sizes of Half-Duplex Passive Integrated

  7. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Soward, Andrew

    E-Print Network [OSTI]

    Priest, Eric

    -distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone the catastrophe point is reached. Numerical results for field lines that are open into the solar corona suggest-equilibrium to be reached. KEY WORDS: Solar coronal magnetic fields, magnetohydrodynamic stability, line-tying. 1

  8. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Soward, Andrew

    E-Print Network [OSTI]

    Priest, Eric

    -distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone is believed to be the energy source for solar flares, prominences, coronal heating and a host of other

  9. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Soward, Andrew

    E-Print Network [OSTI]

    Priest, Eric

    reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form in astrophysical, solar, space and laboratory plasmas, and there- fore its investigation deserves much attention

  10. This article was downloaded by: [ ] On: 25 November 2014, At: 03:14

    E-Print Network [OSTI]

    purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub Infrared (FTIR) solar absorption spectra have been recorded at Peterhof station (59.82¬į N, 29.88¬į E

  11. This article was downloaded by:[University College London] [University College London

    E-Print Network [OSTI]

    Vocadlo, Lidunka

    reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form be a significant com- ponent of outer solar system ices; the predicted ammonia abundances (5­10 wt.%) should result

  12. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Simitev, Radostin D.

    E-Print Network [OSTI]

    Simitev, Radostin D

    reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form dipolar fields nearly aligned with the axis of rotation or the solar magnetic cycle with its surprisingly

  13. This article was downloaded by: [Australian National University] On: 04 April 2012, At: 17:33

    E-Print Network [OSTI]

    Lineweaver, Charles H.

    reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form the water' approach in its search for life elsewhere in the Solar System and on potentially habitable of terrestrial planets (Baross 2007). Active searches for life in our Solar System involve the search for liquid

  14. This article was downloaded by: [University Of Maryland] On: 18 April 2012, At: 08:14

    E-Print Network [OSTI]

    Li, Zhanqing

    ://www.tandfonline.com/loi/tres20 Enhancement of a fire-detection algorithm by eliminating solar contamination effects-detection algorithm by eliminating solar contamination effects and atmospheric path radiance: application to MODIS or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution

  15. This article was downloaded by: [P. A. Polito] On: 04 July 2011, At: 02:51

    E-Print Network [OSTI]

    Hiatt, Eric E.

    ://www.tandfonline.com/loi/taje20 Advances in understanding the Kombolgie Subgroup and unconformity-related uranium deposits in the Alligator Rivers Uranium Field and how to explore for them using lithogeochemical principles P. A. Polito (Australia), PO Box 1067, Bentley DC, Bentley, WA, 6983, Australia b Department of Geological Sciences

  16. Security for Downloadable Automotive Services Stephan Merk*, Kathrin Scheidemann*, Michael Rudorfer*, Thomas Stauner*,

    E-Print Network [OSTI]

    Cengarle, María Victoria

    *, Thomas Stauner*, Johannes Gr√ľnbauer**, Gerhard Popp**, Guido Wimmel** *BMW Car IT GmbH, Petuelring 116, 80809 M√ľnchen, Germany [stephan.merk,kathrin.scheidemann,michael.rudorfer,thomas.stauner]@bmw to their environment and are even able to alter the whole system: adaptiveness can change the whole structure

  17. This article was downloaded by: [Australian National University] On: 08 November 2012, At: 15:27

    E-Print Network [OSTI]

    Qin, Qinghua

    of steam and gas turbines, jet engines, rocket motors and nuclear reactors. Thermal stresses induced. The publisher does not give any warranty express or implied or make any representation that the contents

  18. This article was downloaded by: [University of Florida] On: 27 November 2012, At: 07:03

    E-Print Network [OSTI]

    Jawitz, James W.

    quality assurance (QA) protocols and analyzed in a National Environmental Laboratory Accredita- tion Conference (NELAC)-certified laboratory in compliance with the state's QA rule. The R2 values for paired for regulatory decisions, if such programs and agencies work together to ensure necessary data quality

  19. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Texas A&M University

    E-Print Network [OSTI]

    Ding, Yu

    sound quality assurance strate- gies hinges upon how well one can observe changes of vari- ation that cause product quality defects. This paper addresses the problem of optimally distributing sensors such as the interpretation of the rules generated by the data mining method and how many sensors are required are also

  20. PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Rivera, Daniel E.

    E-Print Network [OSTI]

    Contractor, Anis

    change J.-Emeterio Navarro-Barrientosa ; Daniel E. Riveraa ; Linda M. Collinsb a Control Systems Navarro-Barrientos, J.-Emeterio , Rivera, Daniel E. and Collins, Linda M.(2011) 'A dynamical model for describing behavioural interventions for weight loss and body composition change J.-Emeterio Navarro