Powered by Deep Web Technologies
Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Dow Kokam | Open Energy Information  

Open Energy Info (EERE)

Kokam Kokam Jump to: navigation, search Name Dow Kokam Place Midland, Michigan Zip 48642 Product U.S-based joint venture between Dow and Townsend Kokam LLC, to develop a new generation of high-power battery technology to supply the automotive industry. Coordinates 38.597065°, -77.723064° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.597065,"lon":-77.723064,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

2

Microsoft Word - DowKokam Final EA for concurrence-RLSO_03-24-10.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE'S PROPOSED FINANCIAL DOE'S PROPOSED FINANCIAL ASSISTANCE TO DOW KOKAM MI, LLC TO MANUFACTURE ADVANCED LITHIUM POLYMER BATTERIES FOR HYBRID AND ELECTRIC VEHICLES AT MIDLAND, MICHIGAN U.S. Department of Energy National Energy Technology Laboratory March 2010 DOE/EA-1708 FINAL ENVIRONMENTAL ASSESSMENT DOE'S PROPOSED FINANCIAL ASSISTANCE TO DOW KOKAM MI, LLC TO MANUFACTURE ADVANCED LITHIUM POLYMER BATTERIES FOR HYBRID AND ELECTRIC VEHICLES AT MIDLAND, MICHIGAN U.S. Department of Energy National Energy Technology Laboratory March 2010 DOE/EA-1708 ACRONYMS AND ABBREVIATIONS CFR Code of Federal Regulations CE Consumers Energy DOE U.S. Department of Energy (also called the Department) EA environmental assessment Energy Act Energy Independence and Security Act of 2007

3

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

4

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

5

Michigan | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Assistance to Dow Kokam Mi, LLC To Manufacture Advanced Lithium Polymer Batteries for Hybrid and Electric Vehicles At Midland, Michigan March 1, 2010 EA-1721: Final...

6

Interested Parties - Dow Chemical | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Dow Chemical Interested Parties - Dow Chemical 06-10-10DowChemical.pdf More Documents & Publications Interested Parties - Myriant Interested Parties - XtremePower Interested...

7

Dow Chemical Company | Open Energy Information  

Open Energy Info (EERE)

Company Company Jump to: navigation, search Name Dow Chemical Company Place Midland, MI Zip 48667 Website http://www.dow.com/ Coordinates 43.6039709°, -84.2370999° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.6039709,"lon":-84.2370999,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

8

The Dow Chemical Company - NA System House ...  

Science Conference Proceedings (OSTI)

The Dow Chemical Company - NA System House - Wilmington. NVLAP Lab Code: 100210-0. Address and Contact Information: ...

2013-09-27T23:59:59.000Z

9

Koch Filter and DOW Teaming Profile  

NLE Websites -- All DOE Office Websites (Extended Search)

Koch Filter Corporation Dow Chemical Koch Filter Corporation Dow Chemical 4411-A Darien Street 2301 Brazosport Boulevard Houston, TX 77028 Freeport, TX 77541 Business: HVAC Filter Manufacturer Business: Chemical Manufacturer Bob Sheppard John Theile Regional Sales Manager Reliability Engineer Phone: 713-672-6550 Phone: 979-238-1894 Email: bobs@kochfilter.com Email: jptheile@dow.com Koch Filter saves Dow $156,000 by improving air flow to turbines Project Scope Koch Filter Corporation evaluated the turbine operation at a Dow Chemical facility. They determined that the gas turbine's air intake system was undersized and pre-filters had an initial resistance that was too high, causing the turbine to be "starved" for air. Koch replaced these filters with a better filter that

10

STATEMENT OF CONSIDERATIONS REQUEST BY 'I'HE DOW CHEMICAL COMPANY (DOW) FOR AN ADVANCE WAIVER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'I'HE DOW CHEMICAL COMPANY (DOW) FOR AN ADVANCE WAIVER 'I'HE DOW CHEMICAL COMPANY (DOW) FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN PAT'ENT RIGHTS UNDER DOE AWARD NO. DE- EE0005434; W(A) 2011-071 DOW has requested a waiver of domestic and foreign patent rights of the United States of America in all subject invent.ions arising from its participation under the above referenced cooperative agreement entitled "'Iransformational Approach to Reducing the Total System Costs of Building Integrated Photovoltaics." According to DOW's petition, the objective of the project funded by the cooperative agreement is to "developed new methods to integrate PV cells within a [Building Integrated Photovoltaic (BIPV)] application that will result in a breakthrough low installed cost and increased power supply to the residential consumer.

11

Energy Management at Dow Chemical Co.  

E-Print Network (OSTI)

As one of the largest industrial consumers of energy in the world, The Dow Chemical Company and its 46,000 employees have put energy efficiency at the very core of its business both as a cost savings initiative and as a primary corporate social responsibility. Dows sustained commitment to achieving specific short-and-long-term energy efficiency goals is accomplished through the companys proven Energy Efficiency and Conservation Management System. By committing to comprehensive goal setting, meticulous energy measurement, tracking and reporting, benchmarking, continuous efficiency improvement, utilization of energy best practices, and fully engaging employees, Dow exceeded its aggressive 2005 goals to reduce overall energy intensity by 22 percent from 1995 to 2005. Over a 10-year period, Dow saved more than $4 billion, conserved over 900 trillion Btus and mitigated an estimated 51 million metric tons of CO2 equivalent greenhouse gas, which is like taking more than 6.5 million cars off the road for one year.

Almaguer, J.

2008-01-01T23:59:59.000Z

12

October 30, 2008, Visiting Speakers Program - Dow Chemicals Presentation - Dows Approach to Sustainability  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Catalyst for Change Catalyst for Change Dow's Approach to Sustainability Dr. Susan Butts Sr. Director, External Science & Technology Programs The Dow Chemical Company Office of Health, Safety & Security Visiting Speaker Program US Department of Energy The Power of the Human Element At The Dow Chemical Company, we view chemistry as the work of humanity. We believe the most important element of all is not found on the periodic table, yet is part of every equation for the future. This element is the Human Element. With it, we are more than a chemical company, we are a difference-maker in the world. October 30, 2008 2 3 October 30, 2008 About Dow A science and technology leader with annual sales of $54 billion Founded in 1897 by Herbert H. Supplies plastics and chemical

13

STATEMENT OF CONSIDERATION REQUEST BY DOW CORNING CORPORATION (DOW CORNING) FOR AN ADVANCED  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CONSIDERATION CONSIDERATION REQUEST BY DOW CORNING CORPORATION (DOW CORNING) FOR AN ADVANCED WAIVER OF DOMESTIC AND FOREIGN INVENTION RIGHTS UNDER COOPERATIVE AGREEMENT NO. DE-FC22-96PC96050-W(A)-96-026, CH-0915 The Petitioner, Dow Corning, was awarded this cooperative agreement in response to an unsolicited proposal for the engineering scale development of a process for the conversion of natural gas to methyl chloride. The Petitioner was selected based on its past experience in identifying an oxyhydrochlorination catalyst and separation process for this conversion. The initial phase of this work was performed under DOE Contract No. DE-AC22- 91PC91030. The Contracting Officer has found that the provisions of the 1992 Energy Policy Act P.L. 102-486 apply to this cooperative agreement and that the cost sharing requirement of

14

06-10-10_Dow_Chemical.pdf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A. Viola Title: Senior Policy Advisor Firm or Organization, if applicable Holland & Knight 2099 Pennsylvania Avenue, NW 100 Washington DC, 20006 Client: The Dow Chemical Company...

15

STATEMENT OF CONSIDERATIONS REQUEST BY CARGILL DOW POLYMER, LLC...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

acid producing acid tolerant biocatalyst and hydrolysis processes for corn fiber and corn stover. Cargill Dow is seeking to develop the technology to convert biomass in the...

16

STATEMENT OF CONSIDERATIONS REQUEST BY DOW CORNING CORPORATION...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Dow), was awarded this cooperative agreement for the performance of work entitled, "Thin Film Packaging Solutions for High Efficiency OLED Lighting Products." The waiver will...

17

Dow Chemical Co | Open Energy Information  

Open Energy Info (EERE)

Co Co Jump to: navigation, search Name Dow Chemical Co Place Midland, Michigan Zip 48674 Sector Hydro, Hydrogen Product Michigan-based global chemical, plastic and agricultural products maker, working on hydrogen production technology with General Motors. Coordinates 38.597065°, -77.723064° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.597065,"lon":-77.723064,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

18

Feasibility evaluation of downhole oil/water separator (DOWS) technology.  

SciTech Connect

The largest volume waste stream associated with oil and gas production is produced water. A survey conducted by the American Petroleum Institute estimated that 20.9 billion barrels of produced water were disposed of in 1985 (Wakim 1987). Of this total, 91% was disposed of through disposal wells or was injected for enhanced oil recovery projects. Treatment and disposal of produced water represents a significant cost for operators. A relatively new technology, downhole oil/water separators (DOWS), has been developed to reduce the cost of handling produced water. DOWS separate oil and gas from produced water at the bottom of the well and reinject some of the produced water into another formation or another horizon within the same formation, while the oil and gas are pumped to the surface. Since much of the produced water is not pumped to the surface, treated, and pumped from the surface back into a deep formation, the cost of handling produced water is greatly reduced. When DOWS are used, additional oil may be recovered as well. In cases where surface processing or disposal capacity is a limiting factor for further production within a field, the use of DOWS to dispose of some of the produced water can allow additional production within that field. Simultaneous injection using DOWS minimizes the opportunity for contamination of underground sources of drinking water (USDWs) through leaks in tubing and casing during the injection process. This report uses the acronym 'DOWS' although the technology may also be referred to as DHOWS or as dual injection and lifting systems (DIALS). Simultaneous injection using DOWS has the potential to profoundly influence the domestic oil industry. The technology has been shown to work in limited oil field applications in the United States and Canada. Several technical papers describing DOWS have been presented at oil and gas industry conferences, but for the most part, the information on the DOWS technology has not been widely transferred to operators, particularly to small or medium-sized independent U.S. companies. One of the missions of the U.S. Department of Energy's (DOE's) National Petroleum Technology Office (NPTO) is to assess the feasibility of promising oil and gas technologies that offer improved operating performance, reduced operating costs, or greater environmental protection. To further this mission, the NPTO provided funding to a partnership of three organizations a DOE national laboratory (Argonne National Laboratory), a private-sector consulting firm (CH2M-Hill), and a state government agency (Nebraska Oil and Gas Conservation Commission) to assess the feasibility of DOWS. The purpose of this report is to provide general information to the industry on DOWS by describing the existing uses of simultaneous injection, summarizing the regulatory implications of simultaneous injection, and assessing the potential future uses of the technology. Chapter 2 provides a more detailed description of the two major types of DOWS. Chapter 3 summarizes the existing U.S. and Canadian installations of DOWS equipment, to the extent that operators have been willing to share their data. Data are provided on the location and geology of existing installations, production information before and after installation of the DOWS, and costs. Chapter 4 provides an overview of DOWS-specific regulatory requirements imposed by some state agencies and discusses the regulatory implications of handling produced water downhole, rather than pumping it to the surface and reinjecting it. Findings and conclusions are presented in Chapter 5 and a list of the references cited in the report is provided in Chapter 6. Appendix A presents detailed data on DOWS installations. This report presents the findings of Phase 1 of the simultaneous injection project, the feasibility assessment. Another activity of the Phase 1 investigation is to design a study plan for Phase 2 of the project, field pilot studies. The Phase 2 study plan is being developed separately and is not included in this report.

Veil, J. A.; Langhus, B. G.; Belieu, S.; Environmental Assessment; CH2M Hill; Nebraska Oil and Gas Conservation Commission

1999-01-31T23:59:59.000Z

19

Dow Chemical Company-Oyster Creek VIII | Open Energy Information  

Open Energy Info (EERE)

Company-Oyster Creek VIII Jump to: navigation, search Name Dow Chemical Company-Oyster Creek VIII Place Texas Utility Id 5374 References EIA Form EIA-861 Final Data File for 2010 -...

20

STATEMENT OF CONSIDERATIONS REQUEST BY THE DOW CHEMICAL COMPANY...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE CH 630 252 2779 TO AGCP-HQ P.0204 STATEMENT OF CONSIDERATIONS REQUEST BY THE DOW CHEMICAL COMPANY FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN PATENT RIGHTS UNDER DOE...

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

STATEMENT OF CONSIDERATIONS REQUEST BY DOW CHEMICAL COMPANY FOR...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

approaches and materials. In Answer 9, Dow cited an NREL prediction that the commercial market for solar collectors will not develop before the end of the century and even then,...

22

EA-1708: Finding of No Significant Impact | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8: Finding of No Significant Impact 8: Finding of No Significant Impact EA-1708: Finding of No Significant Impact Dow Kokam Mi, LLC, Manufacture Advanced Lithium POlymer Batteries for Hybrid and Electric Vehicles At Midland, Michigan U.S. Department of Energy (DOE) prepared this Environmental Assessment (EA) to evaluate the potential environmental impacts of providing two types of financial assistance to Dow Kokam MI, LLC to construct and operate the Midland Battery Park for manufacturing of advanced lithium polymer batteries for hybrid and electric vehicles: (1) a grant under Funding Opportunity Announcement DE-FOA 0000026, Recovery Act - Electric Drive Vehicle Battery and Component Manufacturing Initiative and (2) a loan pursuant to Section 136 of the Energy Independence and Security Act of 2007

23

EA-1708: Final Environmental Assessment | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

708: Final Environmental Assessment 708: Final Environmental Assessment EA-1708: Final Environmental Assessment Financial Assistance to Dow Kokam Mi, LLC To Manufacture Advanced Lithium Polymer Batteries for Hybrid and Electric Vehicles At Midland, Michigan U.S. Department of Energy (DOE) prepared this Environmental Assessment (EA) to evaluate the potential environmental impacts of providing two types of financial assistance to Dow Kokam MI, LLC to construct and operate the Midland Battery Park for manufacturing of advanced lithium polymer batteries for hybrid and electric vehicles: (1) a grant under Funding Opportunity Announcement DE-FOA 0000026, Recovery Act - Electric Drive Vehicle Battery and Component Manufacturing Initiative and (2) a loan pursuant to Section 136 of the Energy Independence and Security Act of 2007

24

STATEMENT OF CONSIDERATIONS REQUEST BY THE DOW CHEMICAL COMPANY (DOW) FOR AN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

21D14428; 21D14428; W(A)-02-032; CH-1115 The Petitioner, DOW, has requested a waiver of domestic and foreign patent rights for all subject inventions arising from its participation under the above referenced cooperative agreement entitled "In Situ Analysis for the Chemical Industry." The Petitioner will be partnering with two small business companies, Analytical Sciences Inc. (ASI) and Nanomaterials Research Corp., and with Rice University. These organization are not subject to this waiver request. This waiver shall not impact the rights of those parties subject to Public Law 96-517, as amended, nor shall it grant any rights in inventions made by employees of the National Laboratories. The objective of the cooperative agreement is to develop two platforms for

25

STATEMENT OF CONSIDERATIONS REQUEST BY THE DOW CHEMICAL COMPANY (DOW) FOR AN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1ID14213; 1ID14213; W(A)-01-032; CH-1079 The Petitioner, DOW, has requested a waiver of domestic and foreign patent rights for all subject inventions arising from its participation under the above referenced cooperative agreement entitled "Development of Improved Chemicals and Plastics from Oilseeds." Petitioner is part of an interactive team comprised further of a small agricultural company, Castor Oil, Inc., and the USDA Western Regional Research Center. USDA will not be providing any part of the total cost of the cooperative agreement. Under their agreement with USDA, Petitioner may receive an exclusive license in any USDA inventions which may arise. This waiver shall not impact the rights of those parties subject to Public Law 96-517, as amended, nor shall it grant any rights in

26

DOW CHEMICAL U.S.A. + WESTERN DIVISION  

Office of Legacy Management (LM)

DOW CHEMICAL U.S.A. + DOW CHEMICAL U.S.A. + WESTERN DIVISION 2855 MITCHELL DRIVE WALNUT CREEK. CtyLlFORNlA 94598 October 29,1976 415 944-2300 (., L,'; ! - J. 022 . William J. Thornton Health Protection Branch Safety and Environmental Control Division U.S. Energy Research and Development Administration Oak Ridge Operations P. 0. Box E Oak Ridge, Tennessee 37830 Dear Mr. Thornton: This letter is in response to your request of September 24,1976 for information on records of radiological condition of the laboratories at th$ Dow Pittsburg location. We have not been able to find records that would be applicable. The work was with natural uranium carried out under contract no. AT-(30-l)-GEN-236 which was concluded in 1957. We have now comileted a radiological survey of these laboratories since receipt

27

FIA-13-0054 - In the Matter of Dow Jones & Company | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

the Matter of Dow Jones & Company FIA-13-0054 - In the Matter of Dow Jones & Company On August 19, 2013, The Office of Hearings and Appeals (OHA) granted in part and denied in...

28

STATEMENT OF CONSIDERATIONS REQUEST BY DOW CORNING CORPORATION FOR AN ADVANCE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOW CORNING CORPORATION FOR AN ADVANCE DOW CORNING CORPORATION FOR AN ADVANCE WAIVER OF THE GOVERNMENT'S DOMESTIC AND FOREIGN PATENT RIGHTS UNDER DOE COOPERATIVE AGREEMENT DE-EE0003915; DOE WAIVER NO. W{A)2011-006; CH1590 The Petitioner, Dow Corning Corporation (DOW), has requested an Advance Waiver of the Government's domestic and foreign rights to inventions in the above cited research and development cooperative agreement issued by DOE's National Energy Technology Laboratory (NETL). See attached Dow's Petition, Answer 1. The waiver is to apply to DOW's and its subcontractors' employee subject inventions, except inventions made by subcontractors eligible to retain title to inventions pursuant to P.L. 96-517 as amended. Subject of the R&D Cooperative Agreement Title: Contributing to Net Zero Building: High Energy Efficient EIFS Wall Systems

29

STATEMENT OF CONSIDERATIONS REQUEST BY DOW CHEMICAL COMPANY FOR AN ADVANCE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOW CHEMICAL COMPANY FOR AN ADVANCE DOW CHEMICAL COMPANY FOR AN ADVANCE WAIVER OF U.S. AND FOREIGN RIGHTS UNDER PROPOSED NREL SUBCONTRACT NO. ZAL-3-11191-03-107195 UNDER DOE PRIME CONTRACT NO. DE-AC02-83CH10093, WAIVER NO. W(A)-93-007, CH0758. The attached petition by Dow Chemical Company (hereafter Dow) is for an advance waiver of patent rights under proposed NREL Subcontract ZAL-3-11191-03- 107195, under DOE Contract No. DE-AC02-83CH10093. Dow requests that the Department of Energy grant an advance waiver for the domestic and foreign rights to inventions made in the performance of work under the above identified proposed subcontract and that these rights vest in Dow subject to the standard march-in, preference for U.S. industry, and the patent rights provisions of the subcontract. The scope of work under the above subcontract involves using proprietary

30

STATEMENT OF CONSIDERATIONS PETITION FOR ADVANCE WAIVER OF PATENT RIGHTS BY DOW  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOW DOW CORNING CORPORATION ("DOW-CORNING n ) UNDER A SUB-AWARD OF COOPERATIVE AGREEMENT NO. DE-FC36-OBG01B02B BElWEEN SUNPOWER CORPORATION AND DOE; W(A)-OB-030; CH-1448 The Petitioner, DOW-CORNING, has requested a waiver of domestic and certain foreign patent rights for all subject inventions that may be conceived or first actually reduced .to practice by DOW-CORNING arising from its participation under a sub-award to the above referenced cooperative agreement entitled -Grid Compatible Residential and Commercial Fully Automated PV Systems Technology." The objective of the project is the development of adhesive and encapsulation material and application systems optimized for front glass replacement and adhesive and encapsulation materials for photovoltaic systems.

31

DOE's Oak Ridge and Lawrence Berkeley National Labs Join with Dow Chemical  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE's Oak Ridge and Lawrence Berkeley National Labs Join with Dow DOE's Oak Ridge and Lawrence Berkeley National Labs Join with Dow Chemical to Develop Next-Generation Cool Roofs DOE's Oak Ridge and Lawrence Berkeley National Labs Join with Dow Chemical to Develop Next-Generation Cool Roofs April 14, 2011 - 12:00am Addthis Washington, DC - The U.S. Department of Energy today announced that Oak Ridge National Laboratory (ORNL) and Lawrence Berkeley National Laboratory (LBNL) have joined with Dow Chemical Company as part of a Cooperative Research and Development Agreement to fund key research that will help develop the next generation of cool roof technologies in the U.S. The agreement will support research to increase the energy savings from existing cool roof technologies by more than 50 percent, decreasing the nation's carbon footprint and providing an opportunity for Americans to

32

DOE's Oak Ridge and Lawrence Berkeley National Labs Join with Dow Chemical  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE's Oak Ridge and Lawrence Berkeley National Labs Join with Dow DOE's Oak Ridge and Lawrence Berkeley National Labs Join with Dow Chemical to Develop Next-Generation Cool Roofs DOE's Oak Ridge and Lawrence Berkeley National Labs Join with Dow Chemical to Develop Next-Generation Cool Roofs April 14, 2011 - 12:00am Addthis Washington, DC - The U.S. Department of Energy today announced that Oak Ridge National Laboratory (ORNL) and Lawrence Berkeley National Laboratory (LBNL) have joined with Dow Chemical Company as part of a Cooperative Research and Development Agreement to fund key research that will help develop the next generation of cool roof technologies in the U.S. The agreement will support research to increase the energy savings from existing cool roof technologies by more than 50 percent, decreasing the nation's carbon footprint and providing an opportunity for Americans to

33

STATEMENT OF CONSIDERATIONS REQUEST BY DOW CORNING CORPORATION FOR AN ADVANCE WAIVER OF  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

STATEMENT OF CONSIDERATIONS REQUEST BY DOW CORNING CORPORATION FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN INVENTION RIGHTS UNDER DOE COOPERATIVE AGREEMENT NO. DE-FC26-05NT42344; W(A)-05-002, CH-1266 The Petitioner, Dow Coming Corporation (Dow), was awarded this cooperative agreement for the performance of work entitled, "Thin Film Packaging Solutions for High Efficiency OLED Lighting Products." The waiver will apply to inventions made by Dow employees and its subcontractors' employees, regardless of tier, except inventions made by subcontractors eligible to retain title to inventions pursuant to P.L. 96-517, as amended, and National Laboratories. The purpose of the cooperative agreement is to develop novel substrate and packaging technology for solid state lighting devices that use Organic Light Emitting Diodes (OLEDs) as the

34

Dow Chemical Company: Assessment Leads to Steam System Energy Savings in a Petrochemical Plant  

SciTech Connect

This DOE Save Energy Now case study describes how Dow Chemical Company saves 272,000 MMBtu and $1.9 million annually after increasing the steam system energy efficiency of a plant in Louisiana.

2007-11-01T23:59:59.000Z

35

Hydrogen Generation Rate Scoping Study of DOW Corning Antifoam Agent  

DOE Green Energy (OSTI)

The antifoam agent DOW Corning Q2-3183A will be added to waste streams in the Hanford River Protection Program-Waste Treatment and Immobilization Plant (RPP-WTP) to prevent foaming. It consists mostly of polydimethylsiloxane (PDMS) and polypropylene glycol (PPG). These and other minor constituents of the antifoam have organic constituents that may participate in radiolytic and chemical reactions that produce hydrogen in Hanford waste. It has been recommended by The WTP R&T Department recommended personnel to treat the organic compounds of the antifoam like the in a similar manner as other organic compounds that are native to the Hanford waste with respect to hydrogen production. This testing has investigated the radiolytic and thermal production of hydrogen from antifoam added to simulant waste solutions to determine if the organic components of the antifoam produce hydrogen in the same manner as the native organic species in Hanford waste. Antifoam additions for this testing were in the range of 4 to 10 wt% to ensure adequate hydrogen detection. Test conditions were selected to bound exposures to the antifoam agent in the WTP. These levels are higher than previously recommended values of 350 mg/L for actual applications in WTP tanks containing air spargers and pulse jet mixers. Limited degradation analyses for the organic components of the antifoam were investigated in this study. A more detailed study involving analyses of antifoam degradation and product formation is in progress at SRNL and results from that study will be reported at a later time. The total organic carbon (TOC) content of the Q2-3183A antifoam was measured to be 39.7 {+-} 4.9 wt% TOC. This measurement was performed in triplicate with on three different dilutions of the pure antifoam liquid using a TOC combustion analyzer instrument with catalytic oxidation, followed by CO{sub 2} quantification using an infrared detector. Test results from this study indicate that the WTP HGR correlation conservatively bounds hydrogen generation rates (HGRs) from antifoam-containing simulants if the antifoam organic components are treated the same as other native organics. Tests that used the combination of radiolysis and thermolysis conducted on simulants containing antifoam produced measured hydrogen that was bounded by the WTP correlation. These tests used the bounding WTP temperature of 90 C and a dose rate of 1.8 x 10{sup 5} rad/hr. This dose rate is about ten times higher than the dose rate equivalent calculated for a bounding Hanford sludge slurry composition of 10 Ci/L, or 2 x 10{sup 4} rad/hr. Hydrogen was measured using a quadrupole mass spectroscopy instrument. Based on the analyses from the 4wt% and 10wt% antifoam samples, it is expected that the HGR results are directly proportional to the antifoam concentration added. A native organic-containing simulant that did not contain any added antifoam also produced a measurable radiolytic/thermal hydrogen rates that was in bounded by the WTP correlation. A base simulant with no added organic produced a measurable radiolytic/thermal HGR that was {approx}2X higher than the predicted HGR. Analysis of antifoam-containing simulants after prolonged irradiation of 52 Mrad and heating (23 days at 90 C) indicates that essentially all of the PDMS and greater than 60% of the PPG components are degraded, likely to lower molecular weight species. The antifoam components were analyzed by extraction from the salt simulants, followed by gel permeation chromatography (GPC) by personnel at Dow Corning. A more detailed study of the antifoam degradation and product formation from radiolysis and thermolysis is currently in progress at SRNL. That study uses a dose rate of about 2 x 10{sup 4} rad/hr and bounding temperatures of 90 C. Results from that study will be reported in a future report.

Crawford, Charles

2005-09-27T23:59:59.000Z

36

DOE - Office of Legacy Management -- Dow Chemical Co - Walnut Creek - CA 02  

Office of Legacy Management (LM)

Dow Chemical Co - Walnut Creek - CA Dow Chemical Co - Walnut Creek - CA 02 FUSRAP Considered Sites Site: Dow Chemical Co. - Walnut Creek (CA.02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 2800 Mitchell Drive , Walnut Creek , California CA.02-1 Evaluation Year: 1987 CA.02-2 CA.02-3 Site Operations: From 1947 to 1957, conducted process studies and experimental investigations on different uranium and thorium-bearing ores; pilot-scale solvent extraction of uranium from phosphoric acid; liquid waste disposal studies CA.02-1 CA.02-4 CA.02-5 Site Disposition: Eliminated - Radiation levels below criteria CA.02-6 CA.02-7 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Thorium CA.02-1 CA.02-4

37

STATEMENT OF CONSIDERATIONS REQUEST BY THE DOW CHEMICAL COMPANY FOR AN ADVANCE WAIVER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 2005 10:51 FR IPL DOE CH 630 252 2779 TO AGCP-HQ P.02/04 1 2005 10:51 FR IPL DOE CH 630 252 2779 TO AGCP-HQ P.02/04 STATEMENT OF CONSIDERATIONS REQUEST BY THE DOW CHEMICAL COMPANY FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN PATENT RIGHTS UNDER DOE COOPERATIVE AGREEMENT NO. DE-FG36-05G015157 ENTITLED "ENABLING METATHESIS CHEMISTRY FOR THE ECONOMIC PRODUCTION OF CHEMICALS FROM OILS AND CARBOHYDRATES"; W(A -05-022; CH-1286 As set out in the attached waiver petition and in subsequent discussions with DOE Patent Counsel, The Dow Chemical Company (DOW) has reque ted an advance waiver of domestic and foreign patent rights for all subject inventions r ade under the above-identified cooperative agreement by its employees and its sub ntractors' employees, regardless of tier, except inventions made by subcontractcrs eligible to

38

STATEMENT OF CONSIDERATIONS REQUEST BY THE CARGILL DOW LLC FOR AN ADVANCE WAIVER OF  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CARGILL DOW LLC FOR AN ADVANCE WAIVER OF CARGILL DOW LLC FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN PATENT RIGHTS UNDER DOE COOPERATIVE AGREEMENT NO. 04-03-CA-70372; W(A)-03-029; CH-1154 The Petitioner, Cargill Dow LLC, has requested a waiver of domestic and foreign patent rights for all subject inventions arising under the above referenced cooperative agreement and subcontracts entered thereunder. The cooperative agreement is entitled "Making Industrial Biorefining Happen." The objective of the cooperative agreement is to develop and validate process technologies which will cost effectively produce sugars and chemicals such as lactic acid and ethanol from lignocellulosic biomass The total anticipated cost of the cooperative agreement is $52 million, with the Petitioner providing about fifty percent (50%) cost sharing. This waiver is contingent upon the Petitioner

39

Koch Filter and DOW Teaming Profile | ENERGY STAR Buildings & Plants  

NLE Websites -- All DOE Office Websites (Extended Search)

Koch Filter and DOW Teaming Profile Koch Filter and DOW Teaming Profile Secondary menu About us Press room Contact Us Portfolio Manager Login Facility owners and managers Existing buildings Commercial new construction Industrial energy management Small business Service providers Service and product providers Verify applications for ENERGY STAR certification Design commercial buildings Energy efficiency program administrators Commercial and industrial program sponsors Associations State and local governments Federal agencies Tools and resources Training In This Section Campaigns Commercial building design Communications resources Energy management guidance Financial resources Portfolio Manager Products and purchasing Recognition Research and reports Service and product provider (SPP) resources Success stories Target Finder

40

REQUEST BY THE DOW CHEMICAL COMPANY FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS IN SUBJECT  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOW CHEMICAL COMPANY FOR AN ADVANCE DOW CHEMICAL COMPANY FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS IN SUBJECT INVENTIONS MADE IN THE COURSE OF OR UNDER MARTIN MARIETTA ENERGY SYSTEMS SUBCONTRACT RFP NO. SK761-86; DOE WAIVER DOCKET W(A)-93-036 [0RO-563] The Dow Chemical Company (Dow) has made a timely request for an advance waiver to worldwide rights in Subject Inventions made in the course of or under a Martin Marietta Energy Systems Subcontract RFP No. SK761-86. The scope of the work calls for the development of a scaled process to synthesize a high- quality, low-cost silicon nitride powder with suitable properties for forming heat engine parts. The work is sponsored by the Office of Transportation Technologies. The dollar amount of the subcontract is $2,281,959 with Dow cost sharing at

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

STATEMENT OF CONSIDERATIONS ADVANCE WAIVER OF PATENT RIGHTS TO CARGILL DOW L.L.C., INC.  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

12 2004 10:45 FR IPL DOE CH 630 252 2779 TO RGCP-HQ P.02/06 12 2004 10:45 FR IPL DOE CH 630 252 2779 TO RGCP-HQ P.02/06 * * STATEMENT OF CONSIDERATIONS ADVANCE WAIVER OF PATENT RIGHTS TO CARGILL DOW L.L.C., INC. UNDER CONTRACT NO. DE-FC36-031D14216 FOR COLLECTION, COMMERCIAL PROCESSING AND UTILIZATION OF CORN STOVER; CH-1201; W(A)-04-033 Cargill Dow L.L.C. (Cargill Dow) has petitioned for an advance waiver of domestic and ' foreign patent rights to inventions conceived or first actually reduced to practice under DOE Contract No. DE-FC36-031D14216. This advance waiver is intended to apply to all subject inventions of Cargill Dow's employees and those of its subcontractors, regardless of tier, except subcontractors eligible to obtain title pursuant to P.L. 96-517 as amended, and National Laboratories. As brought out in its waiver petition, the long term objective of this contract is to develop a

42

Evaluation of a Dow-Based Gasification-Combined-Cycle Plant Using Low-Rank Coals  

Science Conference Proceedings (OSTI)

This feasibility study developed performance and cost data for two different Dow-based gasification-combined-cycle (GCC) power plants, designed to fire either Texas lignite or Wyoming subbituminous coals at a Gulf Coast location. It demonstrated the cost-effectiveness and efficiency of these plants for generating power from low-rank coals.

1989-04-25T23:59:59.000Z

43

STATEMENT OF CONSIDERATIONS REQUEST BY CARGILL DOW POLYMER, LLC, FOR AN ADVANCE WAIVER  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

POLYMER, LLC, FOR AN ADVANCE WAIVER POLYMER, LLC, FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN PATENT RIGHTS UNDER DOE CONTRACT DE-FC36-00GO10598; W(A)-00-022; CH-1037 The Petitioner, Cargill Dow Polymers, LLC (Cargill Dow), has requested an advance waiver of domestic and foreign patent rights for all subject inventions arising from its participation under the above referenced contract entitled "Bioenergy Project for Polylactic Acid, Ethanol and Power." The Petitioner is a cooperative venture between Cargill PLA, Inc. and CD Polymers, Inc. As brought out in the attached copy of the Petitioner's waiver petition, this award was made under DOE's Bioenergy Initiative. The objective of the contract is to develop lactic acid producing acid tolerant biocatalyst and hydrolysis processes for corn fiber and corn stover.

44

Dynamic-radius species-conserving genetic algorithm for the financial forecasting of dow jones index stocks  

Science Conference Proceedings (OSTI)

This research uses a Niche Genetic Algorithm (NGA) called Dynamic-radius Species-conserving Genetic Algorithm (DSGA) to select stocks to purchase from the Dow Jones Index. DSGA uses a set of training data to produce a set of rules. These rules are then ... Keywords: Niche genetic algorithm, black-box investing, classification, financial forecasting, genetic algorithm, stock forecasting

Michael Scott Brown, Michael J. Pelosi, Henry Dirska

2013-07-01T23:59:59.000Z

45

STATEMENT OF CONSIDERATIONS REQUEST BY CARGILL DOW LLC FOR AN ADVANCE WAIVER OF  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

LLC FOR AN ADVANCE WAIVER OF LLC FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN PATENT RIGHTS UNDER DOE COOPERATIVE AGREEMENT NO. DE-FC36-021D14349; W(A)-02-052; CH-1125 The Petitioner, Cargill Dow LLC, has requested a waiver of domestic and foreign patent rights for all subject inventions arising under the above referenced cooperative agreement and subcontracts entered thereunder. The cooperative agreement is entitled "Development of Yeast for the Fermentation of Agricultural Feedstocks to Chemicals." This waiver does not apply to the rights of those parties subject to Public Law 96-517, as amended, nor does it grant any rights in inventions made by employees of National Laboratories. The objective of the cooperative agreement is to develop a genetically engineered yeast that can metabolize sugars such as xylose into useful chemical

46

Geopressured-Geothermal Drilling and Testing Plan, Volume II, Testing Plan; Dow Chemical Co. - Dept. of Energy Dow-DOE Sweezy No. 1 Well, Vermilion Parish, Louisiana  

DOE Green Energy (OSTI)

The Dow/D.O.E. L. R. Sweezy No. 1 geopressured geothermal production well was completed in August of 1981. The well was perforated and gravel packed in approximately 50 feet of sand from 13,344 feet to 13,395 feet. Permeabilities of 6 to 914 millidarcies were measured with porosity of 25 to 36%. Static surface pressure after well clean-up was 5000 psi. At 1000 B/D flow rate the drawdown was 50 psi. The water produced in clean-up contained 100,000 ppm TDS. This report details the plan for testing this well with the goal of obtaining sufficient data to define the total production curve of the small, 939 acre, reservoir. A production time of six to nine months is anticipated. The salt water disposal well is expected to be completed and surface equipment installed such that production testing will begin by April 1, 1982. The program should be finished and reports written by February 28, 1983. The brine will be produced from the No.1 well, passed through a separator where the gas is removed, then reinjected into the No.2 (SWD) well under separator pressure. Flow rates of up to 25,000 B/D are expected. The tests are divided into a two-week short-term test and six to nine-month long-term tests with periodic downhole measurement of drawdown and buildup rates. Data obtained in the testing will be relayed by phoneline computer hookup to Otis Engineering in Dallas, Texas, where the reservoir calculations and modeling will be done. At the point where sufficient data has been obtained to reach the objectives of the program, production will be ended, the wells plugged and abandoned, and a final report will be issued.

None

1982-02-01T23:59:59.000Z

47

STABILITY OF DOW CORNING Q2-3183A ANTIFOAM IN IRRADIATED HYDROXIDE SOLUTION  

SciTech Connect

Researchers at the Savannah River National Laboratory (SRNL) examined the stability of Dow Corning Q2-3183A antifoam to radiation and aqueous hydroxide solutions. Initial foam control studies with Hanford tank waste showed the antifoam reduced foaming. The antifoam was further tested using simulated Hanford tank waste spiked with antifoam that was heated and irradiated (2.1 x 10{sup 4} rad/h) at conditions (90 C, 3 M NaOH, 8 h) expected in the processing of radioactive waste through the Waste Treatment and Immobilization Plant (WTP) at Hanford. After irradiation, the concentration of the major polymer components polydimethylsiloxane (PDMS) and polypropylene glycol (PPG) in the antifoam was determined by gel permeation chromatography (GPC). No loss of the major polymer components was observed after 24 h and only 15 wt% loss of PDMS was reported after 48 h. The presence of degradation products were not observed by gas chromatography (GC), gas chromatography mass spectrometry (GCMS) or high performance liquid chromatography mass spectrometry (HPLC-MS). G values were calculated from the GPC analysis and tabulated. The findings indicate the antifoam is stable for 24 h after exposure to gamma radiation, heat, and alkaline simulated waste.

White, T; Crawford, C; Burket, P; Calloway, B

2009-10-19T23:59:59.000Z

48

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

49

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

50

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

51

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

52

Findings of No Significant Impact (FONSI) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

March 30, 2010 March 30, 2010 EA-1708: Finding of No Significant Impact Dow Kokam Mi, LLC, Manufacture Advanced Lithium POlymer Batteries for Hybrid and Electric Vehicles At Midland, Michigan March 30, 2010 EA-1725: Finding of No Significant Impact SBE, Inc. Electric Drive Vehicle Battery and Component Manufacturing Initiative Application, Power Ring Manufacturing Scale-up, Barre, Vermont March 25, 2010 EA-1714: Finding of No Significant Impact Toda America, Incorporated, Electric Drive Vehicle Battery and Component Manufacturing Initiative Project, Battle Creek, Michigan March 25, 2010 EA-1717: Finding of No Significant Impact BASF Catalysts, LLC Electric Drive Vehicle Battery and Component Manufacturing Initiative Project, Elyria, Ohio March 22, 2010 EA-1774: Finding of No Significant Impact

53

Stock mechanics: theory of conservation of total energy and predictions of coming short-term fluctuations of Dow Jones Industrials Average (DJIA)  

E-Print Network (OSTI)

Predicting absolute magnitude of fluctuations of price, even if their sign remains unknown, is important for risk analysis and for option prices. In the present work, we display our predictions about absolute magnitude of daily fluctuations of the Dow Jones Industrials Average (DJIA), utilizing the original theory of conservation of total energy, for the coming 500 days.

Tuncay, C

2006-01-01T23:59:59.000Z

54

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

55

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

56

Impacting US Industry Today A Snapshot of Innovative Solutions at Work for You  

E-Print Network (OSTI)

Research Drives Threefold Cost Cut in US Automotive Batteries Lithium-ion secondary batteries allow full credits for A123 Systems and Dow Kokam to construct battery manufacturing facilities and cost-shares ORNL of manufacturing jobs has steadily declined due to increased global competition and rising energy costs. To combat

57

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

58

The integration of Dow's Fire and Explosion Index into process design and optimization to achieve an inherently safer design  

E-Print Network (OSTI)

The integration of the safety parameter into process design and optimization is essential. However, there is no previous work in integrating the fire and explosion index (F&EI) into design and optimization. This research proposed a procedure for integrating safety into the design and optimization framework by using the safety parameter as optimization constraint. The method used in this research is Dowâ??s Fire and Explosion Index which is usually calculated manually. This research automates the calculation of F&EI. The ability to calculate the F&EI, to determine loss control credit factors and business interruption, and to perform process unit risk analysis are unique features of this F&EI program. In addition to F&EI calculation, the F&EI program provides descriptions of each item of the penalties, chemicals/materials databases, the flexibility to submit known chemical/material data to databases, and material factor calculations. Moreover, the sensitivity analyses are automated by generating charts and expressions of F&EI as a function of material inventory and pressure. The expression will be the focal point in the process of integrating F&EI into process design and optimization framework. The proposed procedure of integrating F&EI into process design and optimization framework is verified by applying it into reactor-distillation column system. The final result is the optimum economic and inherently safer design for the reactor and distillation column system.

Suardin, Jaffee Arizon

2005-08-01T23:59:59.000Z

59

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

60

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

62

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

63

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

64

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

65

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

66

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

67

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

68

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

69

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

70

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

71

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

72

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

73

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

74

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

75

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

76

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

77

Thermal Insulation Materials  

Science Conference Proceedings (OSTI)

... IN. Knauf Insulation Product Testing Laboratory, Shelbyville, IN [200883- 0] MI. Dow Chemical Building Solutions Product Perf. ...

2014-01-03T23:59:59.000Z

78

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

79

Michigan's 1st congressional district: Energy Resources | Open Energy  

Open Energy Info (EERE)

st congressional district: Energy Resources st congressional district: Energy Resources Jump to: navigation, search Equivalent URI DBpedia This article is a stub. You can help OpenEI by expanding it. This page represents a congressional district in Michigan. Registered Energy Companies in Michigan's 1st congressional district AG Solutions Inc Dow Building Solutions Dow Chemical Co Dow Chemical Company Dow Kokam Energy Generation Facilities in Michigan's 1st congressional district Hillman Power Co. Biomass Facility Viking-Lincoln Biomass Facility Retrieved from "http://en.openei.org/w/index.php?title=Michigan%27s_1st_congressional_district&oldid=194174" Categories: Places Stubs Congressional Districts What links here Related changes Special pages Printable version Permanent link Browse properties

80

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

82

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

83

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

84

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

85

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

86

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

87

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

88

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

89

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

90

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

91

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

92

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

93

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

94

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

95

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

96

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

97

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

98

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

99

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

100

DOW CORNING CORPORATION Material Safety Data Sheet  

E-Print Network (OSTI)

NFPA Standards. 07.A.09 If work is to be performed at night, a night operations' lighting plan shall outdoor - tunnels and general underground work areas (minimum 110 lux required at tunnel and shaft heading during drilling, mucking, and scaling) 110 50 110 10 5 10 Conveyor routes 110 10 Dam Operating Areas

Lin, Anna L.

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

SEQUENTIAL ORDER UNDER MA ALAN DOW  

E-Print Network (OSTI)

system t* *his sequence of random variables is tight (as N varies), while for the non-interacting parti.1)), and that b 6= 0. a) The sequence ( k(f))k~1is tight (or, bounded in probability). b) If further f variances ~oe2n;sand ~oe2n; furthermore, (3.27) and (3.28) and ff

Dow, Alan

102

Dow Building Solutions | Open Energy Information  

Open Energy Info (EERE)

Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building...

103

DOW Radar Observations of Wind Farms  

Science Conference Proceedings (OSTI)

The growth of the wind industry in recent years has motivated investigation into wind farm interference with the operation of the nationwide Weather Surveillance Radar-1988 Doppler (WSR-88D) network. Observations of a wind farm were taken with a Doppler ...

Mallie Toth; Erin Jones; Dustin Pittman; David Solomon

2011-08-01T23:59:59.000Z

104

Dow Chemical USA Report - Appendix B  

DOE Green Energy (OSTI)

The geopressured zone, assuming the presence of natural gas and high water productivity, may be used to produce economical electric power only if the water is at least 375 F or a means of conversion more efficient than flashing is found. The design and costing of a double-flash 25-megawatt plant using water at 325 F gave a capital cost of $678/kwh, a fuel cost of 63?/M Btu and a unit power cost of 46 mills/kwh. The conversion efficiency of the plant, including hydraulic turbine energy from the well head overpressure, was 10.3%. This low efficiency accounts for the high unit power cost. A one-well, 1.5-megawatt test facility will require a total capital cost of $6,661,000. Expansion of this site to a four-well, 10-megawatt pilot plant will require an additional capital expenditure of $27,843,000. The total capital cost for an independent 10-megawatt pilot plant was estimated at $31,777,000. It should be noted that the economics calculated in this report is based on industrial power plant experience. Maintenance, operating costs, and rate of return for industrial investment, as used in the calculations, do not reflect utility plant practices. The cost of power producing may compare more favorably with that of utility plants. Future power costs are projected to at least equal the costs expressed here.

Underhill, Gary K.; Carlson, Ronald A.; Clendinning, William A.; Erdos, Jozsef; Gault, John; Hall, James W.; Jones, Robert L.; Michael, Herbert K.; Powell, Paul H.; Riemann, Carl F.; Rios-Castellon, Lorenzo; Shephard, Burchard P.; Wilson, John S.

1976-01-01T23:59:59.000Z

105

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

106

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

107

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

108

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

109

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

110

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

111

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

112

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

113

Missouri Lithium-Ion Battery Company Hosts Tour With U.S. Deputy Secretary  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Missouri Lithium-Ion Battery Company Hosts Tour With U.S. Deputy Missouri Lithium-Ion Battery Company Hosts Tour With U.S. Deputy Secretary of Energy Poneman Missouri Lithium-Ion Battery Company Hosts Tour With U.S. Deputy Secretary of Energy Poneman February 9, 2012 - 4:25pm Addthis Washington, D.C. - Today, U.S. Deputy Secretary of Energy Daniel Poneman toured Dow Kokam's new global battery research and development center, located in Lee's Summit, Missouri, outside of Kansas City, to highlight America's investments in cutting-edge energy innovations that are laying the building blocks for an American economy built to last. The R&D center aims to bring next-generation lithium-ion battery solutions to the market faster, increase battery performance and reduce their overall cost. Lithium batteries are used in a variety of everyday products from laptops to cell

114

Missouri Lithium-Ion Battery Company Hosts Tour With U.S. Deputy Secretary  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Missouri Lithium-Ion Battery Company Hosts Tour With U.S. Deputy Missouri Lithium-Ion Battery Company Hosts Tour With U.S. Deputy Secretary of Energy Poneman Missouri Lithium-Ion Battery Company Hosts Tour With U.S. Deputy Secretary of Energy Poneman February 9, 2012 - 4:25pm Addthis Washington, D.C. - Today, U.S. Deputy Secretary of Energy Daniel Poneman toured Dow Kokam's new global battery research and development center, located in Lee's Summit, Missouri, outside of Kansas City, to highlight America's investments in cutting-edge energy innovations that are laying the building blocks for an American economy built to last. The R&D center aims to bring next-generation lithium-ion battery solutions to the market faster, increase battery performance and reduce their overall cost. Lithium batteries are used in a variety of everyday products from laptops to cell

115

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

116

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

117

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

118

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

119

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

120

Dow AgroSciences LLC - Using Yeast Fermentation to ...  

Science Conference Proceedings (OSTI)

Page 1. Performance of the Third 50 Completed ATP Projects National Institute of Standards and Technology Technology ...

2007-07-24T23:59:59.000Z

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

STATEMENT OF CONSIDERATION REQUEST BY DOW CORNING CORPORATION...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

was selected based on its past experience in identifying an oxyhydrochlorination catalyst and separation process for this conversion. The initial phase of this work was...

122

STATEMENT OF CONSIDERATIONS REQUEST BY THE CARGILL DOW LLC FOR...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

continues to invest approximately 15 millionyear to improve this technology and lower production costs. Considering Petitioner's technical expertise, established market...

123

Dow AgroSciences LLC - Using Yeast Fermentation to ...  

Science Conference Proceedings (OSTI)

... fuel cell, battery, environmental technologies, separation ... systems engineering for an artifactual environment" ... and Trademark Office (USPTO) and ...

2007-07-24T23:59:59.000Z

124

STATEMENT OF CONSIDERATIONS REQUEST BY THE DOW CHEMICAL COMPANY...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

under the above referenced cooperative agreement entitled "In Situ Analysis for the Chemical Industry." The Petitioner will be partnering with two small business companies,...

125

STATEMENT OF CONSIDERATIONS REQUEST BY CARGILL DOW LLC FOR AN...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

is investing about 300 million to construct a facility to convert biomass in the form of corn sugars to polylactide polymers and lactide and holds over 110 US patents covering...

126

Mr. Thomas Lingafeter Environmental Control Department Dow Chemical  

Office of Legacy Management (LM)

screening survey of the site was performed by DOE Chicago Operations Office and Argonne National Laboratory personnel on December 8, 1977. No readings above background were...

127

Hitting the Roof: Dow Launches Consumer-Friendly Solar Shingles  

Science Conference Proceedings (OSTI)

Posted on: 10/9/2009 12:00:00 AM... Money. Time. Aesthetics. These have generally been barriers to adoption of solar power in the residential housing market.

128

STATEMENT OF CONSIDERATIONS REQUEST BY THE DOW CHEMICAL COMPANY...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

recently built up its biotech capabilities in San Diego including extensive molecular biology and analytical capabilities. Petitioner states that it has invested 4.5 million so...

129

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

130

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

131

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

132

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

133

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

134

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

135

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

136

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

137

Missouri's 5th congressional district: Energy Resources | Open...  

Open Energy Info (EERE)

Missouri's 5th congressional district Alternative Energy Sources Inc Kokam America Smith Electric Vehicles US SEV US Registered Financial Organizations in Missouri's 5th...

138

Missouri's 6th congressional district: Energy Resources | Open...  

Open Energy Info (EERE)

Project Registered Energy Companies in Missouri's 6th congressional district Alternative Energy Sources Inc Golden Triangle Energy Heartland biodiesel LLC Kokam...

139

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

140

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

142

Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

143

REQUEST BY THE DOW CHEMICAL COMPANY FOR AN ADVANCE WAIVER OF...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OF DOMESTIC AND FOREIGN RIGHTS IN SUBJECT INVENTIONS MADE IN THE COURSE OF OR UNDER MARTIN MARIETTA ENERGY SYSTEMS SUBCONTRACT RFP NO. SK761-86; DOE WAIVER DOCKET W(A)-93-036...

144

Cost of meeting geothermal hydrogen sulfide emission regulations. [DOW, EIC, Stretford, and iron catalyst processes  

DOE Green Energy (OSTI)

H{sub 2}S emission abatement processes considered feasible for control of airborne emissions included two upstream and two downstream treatment techniques. From literature describing the technical aspects of the processes, individual treatment cost functions were developed. These functions were then used to estimate the range of costs that may be encountered when controlling H{sub 2}S emissions to meet given standards. Treatment costs include estimates of certain fixed charges and overheads that normally apply to long lived capital investment projects of similar nature. Continuing experience with control technology for H{sub 2}S abatement indicates process application may have a significant impact on the total cost of geothermal electricity at sites with H{sub 2}S concentrations in excess of 50 ppM{sub w}. Approximately four sites of the 38 USGS high temperature hydrothermal systems fall into this category. At Baca, New Mexico the cost of controlling H{sub 2}S emissions was estimated to be 5.5 mills per kWh. Calculations were based on a 50 MWe flashed steam plant using the Stretford-Peroxide combination of processes to achieve 99% abatement.

Wells, K.D.; Currie, J.W.; Weakley, S.A.; Ballinger, M.Y.

1980-01-01T23:59:59.000Z

145

WA_02_032_DOW_CHEMICAL_CO_Waiver_of_Domestic_and_Foreign_Pat...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

32DOWCHEMICALCOWaiverofDomesticandForeignPat.pdf WA02032DOWCHEMICALCOWaiverofDomesticandForeignPat.pdf WA02032DOWCHEMICALCOWaiverofDomesticandForeign...

146

WA_05_022_DOW_CHEMICAL_COMPANY_Waiver_of_domestic_and_Foreig...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2DOWCHEMICALCOMPANYWaiverofdomesticandForeig.pdf WA05022DOWCHEMICALCOMPANYWaiverofdomesticandForeig.pdf WA05022DOWCHEMICALCOMPANYWaiverofdomesticandFore...

147

WA_1993_036_DOW_CHEMICAL_COMPANY_Waiver_of_Domestic_and_Fore...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

36DOWCHEMICALCOMPANYWaiverofDomesticandFore.pdf WA1993036DOWCHEMICALCOMPANYWaiverofDomesticandFore.pdf WA1993036DOWCHEMICALCOMPANYWaiverofDomesticandFor...

148

WA_01_032_DOW_CHEMICAL_Waiver_of_Domestic_and_foreign_Patent...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1032DOWCHEMICALWaiverofDomesticandforeignPatent.pdf WA01032DOWCHEMICALWaiverofDomesticandforeignPatent.pdf WA01032DOWCHEMICALWaiverofDomesticandforeign...

149

WA_1993_007_DOW_CHEMICAL_COMPANY_Waiver_of_U.S._and_Foreign_...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1993007DOWCHEMICALCOMPANYWaiverofU.S.andForeign.pdf WA1993007DOWCHEMICALCOMPANYWaiverofU.S.andForeign.pdf WA1993007DOWCHEMICALCOMPANYWaiverofU.S.andF...

150

THOMAS PEYTON LYON Dow Chair of Sustainable Science, Technology and Commerce  

E-Print Network (OSTI)

for Natural Gas: The Effects of State Regulation," Journal of Regulatory Economics, v. 2, no. 3, 1990, pp. 299-183. "The Structure and Regulation of the Natural Gas Industry," (principal author), Chapter 5, North of The Emerging New Order in Natural Gas: Markets versus Regulation by Arthur S. De Vany and W. David Walls

Lyon, Thomas P.

151

THOMAS PEYTON LYON Dow Chair of Sustainable Science, Technology and Commerce  

E-Print Network (OSTI)

for Natural Gas: The Effects of State Regulation," Journal of Regulatory Economics, v. 2, no. 3, 1990, pp. 299 Economics), 1990, pp. 173-183. "The Structure and Regulation of the Natural Gas Industry," (principal author of The Emerging New Order in Natural Gas: Markets versus Regulation by Arthur S. De Vany and W. David Walls

Lyon, Thomas P.

152

THOMAS PEYTON LYON Dow Chair of Sustainable Science, Technology and Commerce  

E-Print Network (OSTI)

of State Regulation," Journal of Regulatory Economics, v. 2, no. 3, 1990, pp. 299-326. "Natural Gas Policy-183. "The Structure and Regulation of the Natural Gas Industry," (principal author), Chapter 5, North New Order in Natural Gas: Markets versus Regulation by Arthur S. De #12;Thomas P. Lyon / Page 6 Vany

Lyon, Thomas P.

153

Interaction between crude oil price and Dow Jones Index on integrated oil and gas company.  

E-Print Network (OSTI)

??The crude oil is one of the major energy resources in our lifetime and plays its crucial role in our economy. How the stock prices (more)

Houng, Chi-yao

2006-01-01T23:59:59.000Z

154

Materials Dow Select Decisions Made Within DOEs Chemical Hydrogen Storage Center of Excellence  

NLE Websites -- All DOE Office Websites (Extended Search)

Down Select Report of Chemical Hydrogen Down Select Report of Chemical Hydrogen Storage Materials, Catalysts, and Spent Fuel Regeneration Processes Chemical Hydrogen Storage Center of Excellence FY2008 Second Quarter Milestone Report Submitted by: The Chemical Hydrogen Storage Center of Excellence Coordinating Council Authors: Kevin C. Ott, Los Alamos National Laboratory Sue Linehan, Rohm and Haas Company Frank Lipiecki, Rohm and Haas Company Christopher L. Aardahl, Pacific Northwest National Laboratory May 2008 Acknowledgements The authors of this report wish to thank all of the partners of the Chemical Hydrogen Storage Center of Excellence. Without their dedication, technical contributions and teamwork, and the hard work of the students and postdocs involved in this work, this Center would not have been

155

A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada

2005-09-01T23:59:59.000Z

156

PowerPoint Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

- integrated emissions, DAQ, CAN, power analyzer 3 Testing Completed - Kokam Hymotion Prius, dedicated test vehicle - EnergyCS Prius ver.1 and ver.2, AVTA vehicle - A123 Hymotion...

157

Sodium--sulphur battery system. Annual report, May 19, 1975--May 19, 1976. [Dow Chemical U. S. A  

DOE Green Energy (OSTI)

The development of the hollow-glass-fiber sodium--sulfur battery progressed significantly. Glass fiber quality improved greatly, and the fiber spinning and assembly machinery was made capable of more uniform operation. Impurities in the sulfur, including H, C, Zn/sup + +/, and Al/sup + + +/, do not appear to affect cell lifetime, while impurities in the Na are important. The Ca and ''oxide'' contents of the Na must be held to low levels. Corrosion products of a 316 stainless steel case are harmless to at least 75-day lifetimes. The Mg content of aluminum alloys can leach out in the catholyte and cause cell resistance to increase. Lifetime does not seem to be a function of total current passed or current density across the fibers. On 1000-fiber, 0.5-Ah cells, over 1400 deep charge--discharge cycles were achieved in 75 days of operating life. A larger 5-Ah cell went through 130 cycles at over 80 percent depth. Cell resistance and capacity remained constant, even at the /sup 1///sub 2/ hour rate. At lesser depths of discharge, the cells lasted longer. Failure was usually in the fibers when ''dirty'' Na was used, and usually just below the tube sheet when ''clean'' Na was used. An updated estimate of ''cost for sale'' of the bare cell is approximately $23.15 per kWh, based on 0.8-kWh cells. 21 figures, 3 tables.

Levine, C.A.

1976-11-01T23:59:59.000Z

158

DESIGN PROJECTS 2012-2013 1. Quantum Dot Light Emitting Diodes (Dr. K. Deshpande, Dow Chemical Company/Prof. M.  

E-Print Network (OSTI)

/acoustic insulation materials (Jenn Weber, Boeing): You are a Material and Process Engineer in a Design Team: a. Must perform acoustical, thermal, and fire barrier functions. b. Must not be heavy; New

Weaver, John H.

159

u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The Dow Chemical Company The Dow Chemical Company STATE: MI PROJECT TITLE: Scale-up of Novel Low-Cost Carbon Fibers Leading to High-Volume Commercial Launch Funding Opportunity Announcement Number Procu.-ement Instrument Number NEPA Control Number CID Number DE-FOA-()()()()560 DE-EEOOO5760 GFO-{X)QS76D-001 G05760 Based on my review orthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: A91nfonnation gathering, analysis, and dissemination Information gathenng (including, but not limited to, literature surveys, Inventories, site visits, and audits), data analysis (including, but not limited to, computer modeling), document preparabon

160

Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

MI ROPYROLIZER FOR RAPID IOIDENTIFI ATION  

POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...

162

MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2

163

Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...

164

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...

165

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...

166

Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...

167

Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P

2003-01-01T23:59:59.000Z

168

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

169

Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...

170

A FUNDAMENTAL REAKTHROUGH IN HEAT TRANSFER TE HNOLOGY FOR MI ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION

171

Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)

172

Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael

2008-01-01T23:59:59.000Z

173

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as

174

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake

175

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1996  

E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.

176

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1994  

E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.

177

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...

178

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...

179

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...

180

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...

182

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...

183

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...

184

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...

185

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...

186

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

187

St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...

188

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

189

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...

190

St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...

191

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...

192

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...

193

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...

194

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...

195

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

196

ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks

197

miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha

2012-01-01T23:59:59.000Z

198

Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.

199

Final_Tech_Session_Schedule_and_Location.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

Design of Metal Organic Design of Metal Organic Frameworks for the Separation of Carbon Dioxide From Flue Gas and Gasification Streams John J. Low UOP LLC, 50 E. Algonquin Rd, Des Plaines, IL 60017-5016, (847) 391-3046, John.Low@uop.com Randall Q. Snurr Northwestern University, Department of Chemical & Biological Engineering, Evanston, IL 60208 (847) 467-2977, snurr@northwestern.edu Omar Yaghi and Adam Matzger University of Michigan, 2815 DOW Laboratory, Department of Chemistry, Ann Arbor, MI 48109-1055, (734) 615-2146, oyaghi@umich.edu Project Objectives Develop a low cost novel adsorbent to remove CO 2 from flue gas and gasification streams -High selectivity -High adsorption capacity -Good adsorption/desorption rates -Adsorbent has low enough binding energy for regenerability Scope of Work

200

STATEMENT OF CONSIDERATIONS ADVANCE WAIVER OF PATENT RIGHTS TO...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CONTRACT NO. DE-FC36-031D14216 FOR COLLECTION, COMMERCIAL PROCESSING AND UTILIZATION OF CORN STOVER; CH-1201; W(A)-04-033 Cargill Dow L.L.C. (Cargill Dow) has petitioned for an...

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

PROGRESSIVE VENTILATION OF THE OCEANS - POTENTIAL FOR RETURN TO ANOXIC CONDITIONS IN THE POST-PALEOZOIC  

E-Print Network (OSTI)

Dow, W. G. 1978. Petroleum source beds on continental slopesShale in California are petroleum source rocks. The apparent

Wilde, Pat

2013-01-01T23:59:59.000Z

202

Commerce's NIST Receives Valuable Chemical Data from ...  

Science Conference Proceedings (OSTI)

... scientific community, said Richard M. Gross, Dow vice president for global research and ... Infrared spectra provide insight into molecular structure. ...

2010-10-05T23:59:59.000Z

203

SunShot Initiative: Extreme Balance of System Hardware Cost Reduction  

NLE Websites -- All DOE Office Websites (Extended Search)

are actively working under this effort: Cascade Engineering: Innovative Ballasted Flat Roof Solar Photovoltaic Racking System Dow Chemical Company: Transformational...

204

Browse wiki | Open Energy Information  

Open Energy Info (EERE)

Academy + , Shandong University + , United States Environmental Protection Agency + , Energy Foundation + , Dow Chemical Company + Place China + ProgramResources Softwaremodeling...

205

FABRICATION OF SMALL MICROBRIDGES (*) R. Y. CHIAO, M. J. FELDMAN, H. OHTA~(*) and P. T. PARRISH  

E-Print Network (OSTI)

, Petersham, Massachusetts 01366. #12;185 measured with a 1 000 x optical microscope. Dow Corning 704

Paris-Sud XI, Université de

206

Measurement of 100 nm and 60 nm Particle Standards by ...  

Science Conference Proceedings (OSTI)

... The voltage is increased, and the droplets are observed through the viewing win- dow illuminated by a light emitting diode. ...

2006-08-07T23:59:59.000Z

207

COMPLETED: NIST Combinatorial Methods Center (NCMC)  

Science Conference Proceedings (OSTI)

... than 30 companies have benefited from NCMC membership, including Air Products, Arkema, Bayer, BASF, Dow, ExxonMobil, Honeywell, Hysitron ...

2012-10-05T23:59:59.000Z

208

Environmental Argonne National Laboratory is a U.S. Department of  

E-Print Network (OSTI)

. The system has a lower net cost over its lifetime than a home equipped with a conventional roof and grid in the shingles. Design and processing of the shingles occurred at Dow facilities. Impact Dow has patented. It will employ 1,200 people. Solar power is a clean and renewable energy source. Dow officials estimate

Hudson, Randy

209

SEMIPERMEA LE MEM RANES FOR MI ROMA HINED SILI ON SURFA ES 5 US ...  

co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...

210

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

211

ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George

212

UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...

213

May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po

2012-01-01T23:59:59.000Z

214

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

215

Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer

216

Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.

1993-03-01T23:59:59.000Z

217

Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas

2009-01-01T23:59:59.000Z

218

Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan

2013-01-01T23:59:59.000Z

219

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

220

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois

222

Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.

223

Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela

224

Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche

2009-08-01T23:59:59.000Z

225

LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P

226

ATP News Archival  

Science Conference Proceedings (OSTI)

... $300 million deal with PowerLite on their highest efficiency PV modules. ... Solar Energy Home Runs on Ribbons (08/30/02); Cargill Dow Technology ...

2011-10-19T23:59:59.000Z

227

Analysis of Data from a Downhole Oil/Water Separator Field Trial in East Texas  

SciTech Connect

Downhole oil/water separator (DOWS) technology is available to separate oil from produced water at the bottom of an oil well. Produced water can be injected directly to a disposal formation rather than lifting it to the surface, treating it there, and reinjecting it. Because of a lack of detailed performance data on DOWS systems, the U.S. Department of Energy (DOE) provided funding to secure DOWS performance data. A large U.S. oil and gas operator offered to share its data with Argonne National Laboratory. This report summarizes data from the DOWS installation in eastern Texas.

Veil, John A.; Layne, Arthur Langhus

2001-04-19T23:59:59.000Z

228

Parallel Processing Enables Rapid Computation of X-ray ...  

Science Conference Proceedings (OSTI)

... Feff has a user base of over 400 research groups, including a number of industrial users, such as Dow, DuPont, Boeing, Chevron, Kodak, and ...

2011-01-12T23:59:59.000Z

229

Day Two of 2012 ARPA-E Summit Will Feature Bill Gates, Secretary...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- Bart Gordon, K&L Gates, Partner; Former Representative from Tennessee Stefan Heck, McKinsey & Co., Director, Leader of Global Cleantech Practice Carrie Houtman, The Dow Chemical...

230

Universitt Ulm | 2011 2 Inhalt Content  

E-Print Network (OSTI)

, and the synthesis of novel electrolytes for solar cells, lithium batteries, and fuel cells. Seemingly unrelated Company Abbott Laboratories BP Corporation BASF Corporation Chevron Corporation Novartis Corporation Dow

Ulm, Universität

231

New Research Further Strengthens Evidence of the Benefits of the Health Care Safety Net  

E-Print Network (OSTI)

Mathematica Policy Research. William H. Dow is Professor ofHealth Economics and Evaluation Research Program at the UCLACenter for Health Policy Research and Assistant Professor of

Dow, William H.; Roby, Dylan H. `; Kominski, Gerald; Jacobs, Ken

2013-01-01T23:59:59.000Z

232

Photon Sciences | Operating the National Synchrotron Light Source...  

NLE Websites -- All DOE Office Websites (Extended Search)

AstraZeneca Pharmaceuticals Bristol-Myers Squibb Corning, Inc. Dow Chemical Company Exxon Mobil Research & Engineering Co. GE Global Research GlaxoSmithKline IBM Research...

233

Biobased Surfactants and DetergentsChapter 9 Self-Assembling Properties of Glycolipid Biosurfactants and Their Functional Developments  

Science Conference Proceedings (OSTI)

Biobased Surfactants and Detergents Chapter 9 Self-Assembling Properties of Glycolipid Biosurfactants and Their Functional Developments Surfactants and Detergents eChapters Surfactants - Detergents Press Dow

234

JOM Subject Index  

Science Conference Proceedings (OSTI)

Mar 8, 2005 ... Dow Chemical Corporation was one of the first companies to exploit electrochemistry to produce chlorine and bromine. Chlorine production...

235

DND-CAT  

NLE Websites -- All DOE Office Websites (Extended Search)

Home Advanced Photon Source Advanced Photon Source User Activity Report DND-CAT, E. I. du Pont de Nemours & Co. - Northwestern University - The Dow Chemical Co....

236

NCNR BT5-USANS Instrument Schedule D. Mildner Tel: (301) ...  

Science Conference Proceedings (OSTI)

... 7CB Mildner VanDyke (Dow PROP on coatings Chemical) Feb 2 2 source down source down Feb 4 1 J Mang (LANL) 14575 Nanoscale porosity in ...

237

Thin-Film/Low-K Dielectric Constant Measurement  

Science Conference Proceedings (OSTI)

... to pursue a very different approach to dielectric thin-film characterization at ... at NIST; DOW will simply deposit and pattern the thin films on pretested ...

2010-10-05T23:59:59.000Z

238

Diacylglycerol Oil, 2nd EditionChapter 2 Digestion and Absorption of Glycerides  

Science Conference Proceedings (OSTI)

Diacylglycerol Oil, 2nd Edition Chapter 2 Digestion and Absorption of Glycerides Food Science Health Nutrition Biochemistry eChapters Food Science & Technology Health - Nutrition - Biochemistry Press Dow

239

Photon Sciences Directorate | 2010 Annual Report | Friends  

NLE Websites -- All DOE Office Websites (Extended Search)

Berkeley National Laboratory Joseph Lenhart, Army Research Laboratory Robert Lodder, University of Kentucky Gary Mitchell, Dow Chemical Company IRUVSoft X-ray Spectroscopy...

240

Lightweighting Homepage  

Science Conference Proceedings (OSTI)

... DuPont, Dow Chemical, SABIC; AMNPO/AMTech, US Army, DOE-EERE, NSF, ONR, ORNL, DOC, OSTP, State of Michigan Economic Development ...

2013-08-20T23:59:59.000Z

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

THE DECEMBER 2005 ISSUE The Review Home  

E-Print Network (OSTI)

-intensive industries as ferrous metallurgy, chemical syntheses, crude oil refining and food processing · Terms & Conditions · Contact Us About the Review · Introduction · History China's Thirsty Future · Contact Us · Submit Articles Other Sites from Dow Jones and more About Dow Jones that the country

Smil, Vaclav

242

Organic sponges for cost-effective CVOC abatement. Final report, September 1992--April 1994  

SciTech Connect

Air contaminated with CVOCs (chlorinated volatile organic compounds) arise from air stripping of ground water or from soil and dual phase vapor extraction. A research program was undertaken to develop sorbents better than activated carbon for remediation. Two such sorbents were found: Dow`s XUS polymer and Rohm and Haas` Ambersorb 563 (carbonaceous). Opportunities exist to further develop sorption and biodegradation technologies.

Flanagan, W.P.; Grade, M.M.; Horney, D.P.; Mackenzie, P.D.; Salvo, J.J.; Sivavec, T.M.; Stephens, M.L.

1994-07-01T23:59:59.000Z

243

Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti

2011-01-01T23:59:59.000Z

244

Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius

2009-01-01T23:59:59.000Z

245

Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.

2011-01-01T23:59:59.000Z

246

1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.

1996-12-31T23:59:59.000Z

247

I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc

248

Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl

249

Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available

1987-01-01T23:59:59.000Z

250

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st

251

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS

252

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL

253

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION

254

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN

255

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS

256

LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance

257

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS

258

I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals

259

Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of

260

Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Catalysis for Mixed Alcohol Synthesis from Biomass Derived Syngas: Cooperative Research and Development Final Report, CRADA Number CRD-08-292  

SciTech Connect

The Dow Chemical Company (Dow) developed and tested catalysts for production of mixed alcohols from synthesis gas (syngas), under research and development (R&D) projects that were discontinued a number of years ago. Dow possesses detailed laboratory notebooks, catalyst samples, and technical expertise related to this past work. The National Renewable Energy Laboratory (NREL) is conducting R&D in support of the United States Department of Energy (DOE) to develop methods for economically producing ethanol from gasified biomass. NREL is currently conducting biomass gasification research at an existing 1/2 ton/day thermochemical test platform. Both Dow and NREL believe that the ability to economically produce ethanol from biomass-derived syngas can be enhanced through collaborative testing, refinement, and development of Dow's mixed-alcohol catalysts at NREL's and/or Dow's bench- and pilot-scale facilities. Dow and NREL further agree that collaboration on improvements in catalysts as well as gasifier operating conditions (e.g., time, temperature, upstream gas treatment) will be necessary to achieve technical and economic goals for production of ethanol and other alcohols.

Hensley, J.

2013-04-01T23:59:59.000Z

262

Summary of Data from DOE-Subsidized Field Trial No.1 of Downhole Oil/Water Separator Technology, Texas Well Bilbrey 30-Federal No. 5 Lea County, New Mexico  

SciTech Connect

This reports, DOWS technology reduced the quality of produced water that is handled at the surface by separating it from the oil downhole and simultaneously injecting it underground. The two primary components of a DOWS system are an oil/water separation system and at least one pump to lift oil to the surface and inject the water. Two basic types of DOWS have been developed -- one type using hydrocyclones to mechanically separate oil and water and one relying on gravity separation that takes place in the well bore.

Veil, John A.

2001-04-19T23:59:59.000Z

263

Procedure for determining the distribution ranking index  

SciTech Connect

The Distribution Ranking Index (DRI) has been developed as a simple but effective means to indicate the inherent, acute hazards of a material that might be released in a transportation accident. Utilizing existing Dow resources and procedures, it is one of the methods used for prioritization of chemicals in Dow`s distribution related process risk management effort. Seven individual hazard indexes are considered for a material. The values range from 1 to 4 with 4 representing the most severe hazard. The highest value from any hazard index determines the overall DRI. 3 refs., 1 fig., 8 tabs.

Latino, M.A. [Dow Chemical Co., Freeport, TX (United States)

1996-12-31T23:59:59.000Z

264

Recent advances in solid polymer electrolyte fuel cell technology  

DOE Green Energy (OSTI)

With methods used to advance solid polymer electrolyte fuel cell technology, we are close to obtaining the goal of 1 A/cm/sup 2/ at 0.7. Higher power densities have been reported (2 A/cm/sup 2/ at 0.5 V) but only with high catalyst loading electrodes (2 mg/cm/sup 2/ and 4 mg/cm/sup 2/ at anode and cathode, respectively) and using a Dow membrane with a better conductivity and water retention characteristics. Work is in progress to ascertain performances of cells with Dow membrane impregnated electrodes and Dow membrane electrolytes. 5 refs., 6 figs.

Ticianelli, E.A.; Srinivasan, S.; Gonzalez, E.R.

1988-01-01T23:59:59.000Z

265

Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...

266

Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard

2004-01-01T23:59:59.000Z

267

Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...

268

Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...

269

Presentation to the Plastics Developers Association North America Conference  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

in in Dow Chemical 26 May 2010, Beijing Ningke Peng About Dow A diversified chemical company, harnessing the power of science and technology to improve living daily  founded in Midland, Michigan in 1897  annual sales of $58 billion  52,000 employees  3,900+ in China and growing daily  supplies more than 5,000 products  serve customers in 160 countries  a company committed to sustainability  24 sites and offices in China Dow's Energy Use Dow is among the largest Industrial Energy Consumers  Annual Energy Consumption Globally ≈ 600 Trillion Btu's (22 million tons of coal equivalent)  The Cost of Energy in 2009 Approached US $2.5 Billion Globally (~17 billion RMB)

270

Lipid Analysis and Lipidomics: New Techniques & ApplicationChapter 2 An Overview of Modern Mass Spectrometry Methods in the Toolbox of Lipid Chemists and Biochemists  

Science Conference Proceedings (OSTI)

Lipid Analysis and Lipidomics: New Techniques & Application Chapter 2 An Overview of Modern Mass Spectrometry Methods in the Toolbox of Lipid Chemists and Biochemists Methods and Analyses eChapters Methods - Analyses Books Dow

271

A First Look at the Impact of Electric Vehicle Charging on the...  

NLE Websites -- All DOE Office Websites (Extended Search)

Liu, L. Dow, E. Liu, "A Survey of PEV Impacts on Electric Utilities," IEEE PES Innovative Smart Grid Technologies Conference, Anaheim, CA, January 2011 2 M. Kintner-Meyer, K....

272

Deep Frying: Chemistry, Nutrition and Practical ApplicationsChapter 8 Role of Fat in the Diet  

Science Conference Proceedings (OSTI)

Deep Frying: Chemistry, Nutrition and Practical Applications Chapter 8 Role of Fat in the Diet Food Science Health Nutrition Biochemistry eChapters Food Science & Technology Health - Nutrition - Biochemistry Press Dow

273

Optical Properties of Some Silicone Diffusion?Pump Oils in the Vacuum UltravioletUsing a Closed?Cell Technique  

Science Conference Proceedings (OSTI)

The optical properties of Dow Corning?704 and ?705 diffusion?pump oils have been measured from 2?10.6 eV using a closed?cell technique. The data are interpreted in terms of molecular excitations of ?

B. L. Sowers; M. W. Williams; R. N. Hamm; E. T. Arakawa

1971-01-01T23:59:59.000Z

274

Design and Deployment of a Portable, Pencil-Beam, Pulsed, 3-cm Doppler Radar  

Science Conference Proceedings (OSTI)

A portable, pencil-beam, pulsed, Doppler, 3-cm wavelength radar has been constructed to study a wide variety of meteorological phenomena including tornadoes, severe storms, and boundary layer processes. The new radar, the Doppler on Wheels (DOW), ...

Joshua Wurman; Jerry Straka; Erik Rasmussen; Mitch Randall; Allen Zahrai

1997-12-01T23:59:59.000Z

275

NREL: Biomass Research - Video Text  

NLE Websites -- All DOE Office Websites (Extended Search)

is to apply heat and acid." (Voiceover) After pretreatment Nancy Dowe: "So this is the corn stover." The video shows various stages of corn stover from biomass to pretreated...

276

Low-Level Winds in Tornadoes and Potential Catastrophic Tornado Impacts in Urban Areas  

Science Conference Proceedings (OSTI)

Using an axisymmetric model of tornado structure tightly constrained by high-resolution wind field measurements collected by Doppler on Wheels (DOW) mobile radars, the potential impacts of intense tornadoes crossing densely populated urban areas ...

Joshua Wurman; Paul Robinson; Curtis Alexander; Yvette Richardson

2007-01-01T23:59:59.000Z

277

Chemical Engineering Research Support 2007 Abitibi-Consolidated Inc.  

E-Print Network (OSTI)

Chemical Engineering Research Support 2007 Abitibi-Consolidated Inc. Agilent Technologies Agriculture & Agri-Food Canada Ahlstrom Research and Services Air Products & Chemicals Alcon Canada Alcon Hill Clariant Canada Inc. Coopervision Coveright Surfaces Holding Dofasco Inc. Domtar Inc. Dow Chemical

Thompson, Michael

278

NCNR BT5-USANS Instrument Schedule D. Mildner Tel: (301) ...  

Science Conference Proceedings (OSTI)

... Dow Chem) Jun 14 6 L Anovitz(Tenn)+ D 17989 multiscale porosity in 6CB Mildner Cole(OSU)+ G U29-15 the Eagle Ford gas shale Rother(ORNL ...

279

Buildings | Open Energy Information  

Open Energy Info (EERE)

This article is a stub. You can help OpenEI by expanding it. Buildings provide shelter for nearly everything we do-we work, live, learn, govern, heal, worship, and play in...

280

Advances in Conjugated Linoleic Acid Research, Vol 2Chapter 2 Gas Chromatography - Mass Spectrometry of Conjugated Linoleic Acids and Metabolites  

Science Conference Proceedings (OSTI)

Advances in Conjugated Linoleic Acid Research, Vol 2 Chapter 2 Gas Chromatography - Mass Spectrometry of Conjugated Linoleic Acids and Metabolites Health Nutrition Biochemistry eChapters Health - Nutrition - Biochemistry Dow

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Finescale Radar Observations of Tornado and Mesocyclone Structures  

Science Conference Proceedings (OSTI)

A variety of vortex configurations observed at finescale with Doppler On Wheels (DOW) radars in and near the hook echoes of supercell thunderstorms are described. These include marginal/weak tornadoes, often with no documented condensation funnels,...

Joshua Wurman; Karen Kosiba

2013-10-01T23:59:59.000Z

282

Fuel Cell Technologies Office: News Archives - 2004  

NLE Websites -- All DOE Office Websites (Extended Search)

Request Unveiled Federal Register Notice for On-Board Fuel Processing GoNo-Go Decision NRC Report Assesses Future of Hydrogen Economy Secretary Abraham Applauds DowGM Milestone...

283

An Examination of Avoided Costs in Utah  

E-Print Network (OSTI)

ultimately accepted a natural gas price projection that wasfrom the NWPPC s natural gas price forecast (basis East-about future natural gas prices, this issue really boils dow

Bolinger, Mark; Wiser, Ryan

2005-01-01T23:59:59.000Z

284

JGI - The Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

The Facility aerial photo of JGI The Joint Genome Institute (foreground) The U.S. Department of Energy (DOE) Joint Genome Institute (JGI) is located in the former Dow Chemical...

285

STATEMENT OF CONSIDERATIONS  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Dow Chemical Company for an Advance Waiver of Domestic and Foreign Dow Chemical Company for an Advance Waiver of Domestic and Foreign Invention Rights under DOE Cooperative Agreement No. DE-EE0003916, W(A) 2011-049, CH-1626 The Petitioner, The Dow Chemical Company, (Dow) was awarded the subject cooperative agreement with DOE for the performance of work entitled, "Advanced Insulation for High Performance Cost-Effective Wall, Roof, and Foundation Systems." The objective of the work is to explore and develop high performing insulation with increased Rlinch and low impact on climate change that will help with design and build of highly insulating building envelope systems with more durable performance and lower overall system cost than envelopes with equivalent performance made with materials available today. Further details about the project are provided in

286

WABASH RIVER INTEGRATED METHANOL AND POWER PRODUCTION FROM CLEAN COAL TECHNOLOGIES (IMPPCCT)  

DOE Green Energy (OSTI)

The Wabash River Integrated Methanol and Power Production from Clean Coal Technologies (IMPPCCT) project is evaluating integrated electrical power generation and methanol production through clean coal technologies. The project is conducted by a multi-industry team lead by Gasification Engineering Corporation (GEC), a company of Global Energy Inc., and supported by Air Products and Chemicals, Inc., Dow Chemical Company, Dow Corning Corporation, Methanex Corporation, and Siemens Westinghouse Power Corporation. Three project phases are planned for execution over several years, including: (1) Feasibility study and conceptual design for an integrated demonstration facility, and for fence-line commercial embodiment plants (CEP) operated at Dow Chemical or Dow Corning chemical plant locations (2) Research, development, and testing to define any technology gaps or critical design and integration issues (3) Engineering design and financing plan to install an integrated commercial demonstration facility at the existing Wabash River Energy Limited (WREL) plant in West Terre Haute, Indiana.

Albert Tsang

2003-03-14T23:59:59.000Z

287

--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...

288

Downhole oil/water separators - What's new?  

SciTech Connect

The US Department of Energy's (DOE's) National Petroleum Technology Office is interested in new technologies that can bring oil to the surface at a lower cost or with less environment impact. DOE is particularly interested in technologies that can accomplish both of these goals, and downhole oil/water separators (DOWS) seem to achieve that. They have the potential to reduce operating costs while providing a greater degree of environmental protection. DOE learned of the innovative DOWS technology and funded a team from Argonne National Laboratory, CH2M Hill (a private-sector consulting firm), and the Nebraska Oil and Gas Conservation Commission (a state agency) to conduct an independent evaluation of the technical feasibility, economic viability, and regulatory applicability of the DOWS technology. The results of that investigation were published in January 1999 and represent the most complete publicly available reference material on DOWs technology (the full text of the report can be downloaded from Argonne's website at www.ead.anl.gov). Other abbreviated versions of this information have been published during the past year. Last January, in the 1999 Produced Water Seminar, the author provided an overview of the DOWS technology. For the 2000 Produced Water Seminar, the author is providing updated information on DOWS and related technologies. To set the stage for the new information, the next few sections provided a review of previously reported information.

Veil, J. A.

2000-01-12T23:59:59.000Z

289

Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob

2009-01-01T23:59:59.000Z

290

Whither the Keiretsu, Japan's Business Networks? How Were They Structured? What Did They Do? Why Are They Gone?  

E-Print Network (OSTI)

Construction Nippon Flour Mills Kirin Brewery Oji PaperSa Textile NIPPON FLOUR MILLS Mi Food TORAY INDUSTRIES Mi

Lincoln, James R.; Shimotani, Masahiro

2009-01-01T23:59:59.000Z

291

Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsa- miR-195. Hsa-miR-30a and hsa-miR-195 were...

292

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

Science Conference Proceedings (OSTI)

The principal objective of the study was to test a new analytical technique, Solid-Phase Microextraction (SPME), for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. This involved measuring the effectiveness of SPME to extract hydrocarbons under controlled conditions in the laboratory. As part of the study, a field demonstration was undertaken to assess the validity and usefulness of the laboratory results. Presented in this quarterly report is the condensed version of the Case History and Well Summary for the Bear Lake area in Manistee County, Michigan. The full version will be in the annual report. The condensed case history presents the important technical details regarding the geochemistry and horizontal lateral for Bear Lake, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan

2003-04-01T23:59:59.000Z

293

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The geochemical sampling team collected additional 148 samples at Vernon Field along 5 new traverses. Most of the locations were sampled for three types of analyses: microbial, iodine and enzyme leach; no results from the second batch of samples were available in time for this report. In addition to the sampling, a study was begun on the feasibility of collecting and analyzing hydrocarbon gases (C1-C8) directly. Although several companies offer these services, the cost ($200-300/sample w/o sampling fee) is high, on par with the cost of a 3D seismic survey, and may not include the raw data. However direct sampling of reservoir gases collecting in the soil appear to offer the best approach and should be included in this study. It would probably work well at Vernon Field. It may be possible to lower costs considerably; initial estimates of $20/sample for GCMS (Gas Chromatography--mass spectrometry) analysis are attractive and might induce to Michigan producers to include soil surveys in their routine field work-ups. A complete set of digital data was assembled for Vernon Field and nearby locations. The set consists of well locations, formation top picks, lithologies and scanned images of driller's reports and scout tickets. Well logs are still being located. The annual meeting for the Class Revisit work group is tentatively scheduled for the week of March 1-7 in Tampa, Fl. By that time all of the geochemical data will be available and final decisions regarding drilling can be made.

James R. Wood; T.J. Bornhorst; S.D. Chittichk; William B. Harrison; W. Quinlan

2001-01-01T23:59:59.000Z

294

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

A principal goal of the Budget Period I was to demonstrate that surface geochemistry could be used to locate bypassed hydrocarbons in old fields. This part of the program was successful. A surface geochemical survey, employing 5 different techniques, was carried out in the Spring and Summer of 2000 and a demonstration well, the State Vernon & Smock 13-23 HD1 (permit number: PN 53945) was drilled in Vernon Township, Isabella County, Michigan in the late fall of 2000. A demonstration well was selected and drilled based on geologic considerations and surface geochemistry. Over 460 soil samples were collected and analyzed over the drill site. A good anomaly was detected near the proposed well site and the demonstration well, the Smock 13-23, was drilled to a depth of 3157 feet by November 17, 2000. Two laterals were drilled, and hydrocarbons were located in a zone approximately 175 feet in length. However, it was determined that the pay zone was too small and difficult reservoir conditions (water production) prevented putting the well in production. The Smock 13-23 was shut in and abandoned January 15, 2001. A post-mortem determined that the main reason the well was not economic was because the zone was nearly completely flushed by earlier recovery operations. The post mortem also revealed the presence of an unmapped shale plug crossing the first lateral. It appears that this shale was detected by the geochemical survey, but its significance was not appreciated at the time. It is possible that sections of the well were faulty, ''porposing'' up and down so as to create water blockages. We are continuing to use the Vernon Field and the demonstration well to calibrate the geochemical data. Eventually, this study may provide a standard site that can be used to test and calibrate geochemical anomalies, something that does not presently exist. A postmortem report on the well, including the geology and geochemistry used to site the well, is presented in Appendix I. Five geochemical techniques have been tested in Phase I. These include surface iodine, microbial, enzyme leaching, soil gas and subsurface iodine. We are most comfortable with the results of the microbial surveys but feel that direct measurement of soil gas is the best method if analytical difficulties can be overcome. The reason the microbial surveys are presently favored is because they provide a logical, consistent picture that is easy to interpret and easy to explain. This in turn is because the microbial anomaly is manifested as an ''apical'' as opposed to an ''edge'' or ''halo'' anomaly. Several lessons were learned during Phase I activities. The main one was that surface geochemistry could locate anomalies over old fields such as Vernon. We also learned that horizontal drilling has advantages and disadvantages in situations such as this. On the plus side, it does provide a means to probe for pockets of bypassed oil, but it is expensive relative to vertical (or slant wells?) and is difficult to control in a narrow pay zone. We tentatively conclude that horizontal wells do not provide a cost-effective solution in this setting and suggest that geochemical anomalies be investigated via a single vertical well or multiple vertical wells.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan; E. Taylor

2001-07-31T23:59:59.000Z

295

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTRY, MI  

Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. A major part of the remaining project will focus on using surface geochemistry to delineate prospects. A Niagaran reef field geochemical survey, the Bagley Prospect area in Otsego County, Michigan is scheduled to take place this summer. Previous wells drilled in Bagley Prospect area in the early 1970's and in place in late 2002 and early 2003 resulted in discoveries and numerous hydrocarbon shows in the Brown Niagaran reservoir interval. The Bagley region is still considered an area of interest by the industry and appears ripe for a geochemical survey. Our industry partner is interested in a possible test in the Bagley prospect because subsurface geophysical and geological interpretation indicates the presence of structures. Anomalous production and pressure data further suggest the region is not yet well understood and should not be considered mature. The most recent well, the Bagley 1-22A sidetrack, was unsuccessful at locating a new reef culmination to the south of the original vertical well and did not encounter hydrocarbon shows. The sidetrack and well were plugged and abandoned. The proposed geochemical survey will concentrate on areas away from the Bagley 1-22A to the north and west but will include the entire prospect so that the existing data can be used in interpretations. Bagley appears to offer a unique combination of potential and data for a geochemical study that focuses on looking for new oil in an area that has exhausted traditional geologic and geophysical methods. The Bear Lake pinnacle reef trend in Manistee County, Michigan, is also scheduled for further geochemical work this summer. Industry interest, mostly by small companies, is picking up in this area and it is also ripe for targeted geochemical surveys for the same reasons cited above.

James R. Wood; A. Wylie; W. Quinlan

2004-04-01T23:59:59.000Z

296

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

Science Conference Proceedings (OSTI)

One of the main objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, several field demonstrations were undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The important observations from each of these field demonstrations are briefly reviewed in this annual report. These demonstrations have been successful in identifying the presence or lack of hydrocarbons in the subsurface and can be summarized as follows: (1) The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path of the State Springdale & O'Driscoll No.16-16 horizontal demonstration well in Manistee County, Michigan. The well was put on production in December 2003. To date, the well is flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which is a good well in Michigan. Reserves have not been established yet. Two successful follow-up horizontal wells have also been drilled in the Springdale area. Additional geochemistry data will be collected in the Springdale area in 2004. (2) The surface geochemistry sampling in the Bear Lake demonstration site in Manistee County, Michigan was updated after the prospect was confirmed and production begun; the original subsurface and seismic interpretation used to guide the location of the geochemical survey for the Charlich Fauble re-entry was different than the interpretation used by the operator who ultimately drilled the well. As expected, the anomaly appears to be diminishing as the positive (apical) microbial anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. (3) The geochemical sampling program over the Vernon Field, Isabella County, Michigan is now interpreted as a large negative anomaly associated with the entire field. The results of the State Smock horizontal well and the Bowers 4-25 well confirmed the lack of additional recoverable hydrocarbons in the Vernon Field. (4) The surface geochemistry data showed a strong anomaly in the Myrtle Beach, Burke County, North Dakota area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the geological and geophysical data; the microbial values here were the highest we have observed. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling, however, a pipeline has not yet been completed that would allow the wells to be placed into production. We also present in this annual report the results of recent efforts to map carbonate facies tracts in the middle Devonian Dundee and Rogers City Limestones using gamma ray, bulk density, and photoelectric effect geophysical well log amplitudes. This work was undertaken to identify fairways for exploration in the Dundee and Rogers City where surface geochemical techniques could then be used to screen potential leads.

James R. Wood; A. Wylie; W. Quinlan

2004-04-01T23:59:59.000Z

297

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

Two major accomplishments resulted from Phase I. One is the success of the surface geochemistry program, which collected over 800 samples from the site of the 1st demonstration well in Vernon Field and has pretty well provided us with the tools to delineate favorable ground from unfavorable. The second is the recent detailed mapping of the Central Michigan Basin that for the first time revealed the presence of at least two major faults that control the location of many of the reservoirs in the Michigan Basin. These faults were located from structure maps obtained by contouring the surface of the Dundee Formation using top picks from 9861 wells in 14 counties. Faults were inferred where the contour lines were most dense (''stacked'').

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan

2001-10-31T23:59:59.000Z

298

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The fault study continues to find more faults and develop new techniques to visualize them. Data from the Dundee Formation has been used to document 11 major faults in the Michigan Basin which have now been verified using data from other horizons. These faults control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new GC laboratory is now functional and has been fully staffed as of December. The annual project review was held March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer. A request was made to extend the scope of the project to include the Willison Basin. A demonstration well has been suggested in Burke County, N. Dakota, following a review of 2D seismic and surface geochem. A 3D seismic survey is scheduled for the prospect.

James R. Wood; T.J. Bornhorst; William B. Harrison; W. Quinlan

2002-04-01T23:59:59.000Z

299

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

In this reporting period, we extended the fault study to include more faults and developed new techniques to visualize the faults. We now have used data from the Dundee Formation to document 11 major faults in the Michigan Basin and are in the process of reviewing data from other horizons. These faults appear to control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new laboratory is now functional and has been fully staffed as of December. The annual project review has been set for March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan

2002-01-01T23:59:59.000Z

300

Role of microRNA?155 in dendritic cells and macrophages MiR?155 directly targets PU.1 and IL13R1.  

E-Print Network (OSTI)

??In search of genes differentially expressed between M1 (pro?Th1 or pro?inflammatory) and M2 (pro?Th2 or pro?tolerogenic) macrophages, BIC (microRNA 155 hosting gene) was found up (more)

Martinez?Nunez, Rocio Teresa

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

1. (P) M.I. Ojovan, W.E. Lee. New Developments in Glassy Nuclear Wasteforms. Nova Science Publishers, New York, 131p. (2007).  

E-Print Network (OSTI)

xxx Keywords: A. Intermetallics, miscellaneous B. Phase diagrams B. Thermodynamic and thermochemical in the Vienna ab-initio simulation package (VASP) [27]. We used the generalized gradient approximation (GGA, Lamoreaux RH. Molybdenum: physicochemical properties of its compounds and alloys. I. thermochemical

Ojovan, Michael

302

Summary of the EPRI Early Event Analysis of the Fukushima Daiichi Spent Fuel Pools Following the March 11, 2011 Earthquake and Tsuna mi in Japan  

Science Conference Proceedings (OSTI)

Damage to the Fukushima Daiichi Unit 4 reactor building observed on March 15, 2011, initially generated confusion and concern throughout the nuclear industry. The reactor had been defueled approximately 100 days prior to the March 11 earthquake and tsunami; therefore, any explosion in Unit 4 could not be linked to a recently operating reactor within that unit. With the full core in the spent fuel pool, suspicions immediately turned to hydrogen generated by oxidation of overheating spent fuel cladding fol...

2012-05-31T23:59:59.000Z

303

Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

converting any H 2 gas produced to water) and measuring thefor the tritium produced in pore water of the fractured rockfor the tritium produced in pore water of the fractured rock

2006-01-01T23:59:59.000Z

304

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 16, 1994 Place Time Name GroupGroup Place Time Name GroupGroup  

E-Print Network (OSTI)

-49 8 30 11:56.7 Dan Gheng Wool 40-49 1 89 13 of the participants. The official number of finishers was 780, including babies in strollers page 7 #12;HISTORY OF LBL

305

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR; VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The main news this reporting period is the confirmed discovery of producing hydrocarbons at the State Springdale & O'Driscoll No.16-16 demonstration well in Manistee County. This well was spudded in late November, tested and put on production in December 2003. To date it is flowing nearly 100 barrels of liquid hydrocarbons per day, which is a good well in Michigan. Reserves have not been established yet. The surface geochemistry sampling at the Springdale demonstration site will be repeated this spring after the well has been on production for several months to see if the anomaly pattern changes. We expect that the anomaly will diminish as the original positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. This is the behavior that we observed at the Bear lake demonstration well reported last quarter.

James R. Wood; A. Wylie; W. Quinlan

2004-01-01T23:59:59.000Z

306

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

In this reporting period two main accomplishments stand out. The Springdale task is in play in the northern Michigan Basin and the geochemical survey work over the Springdale prospect continued to progress. We still need to characterize the play in terms of the type of trap (basal reef diagenetic (?)) and its relation to the well documented pinnacle reef play. Also, we have become aware that Capac Field in the southern reef trend (Figure 1) is a possible analog to Springdale and so will be looking more closely at the literature on that field, particularly the work by Bowers (1987). Future work is directed toward further defining the Springdale project via more wells and examination and characterization of well cuttings. One to two more geochemical surveys are planned, one this spring and a final one in early fall. Based on current oil prices and Springdale production as of January 2005, an ROI, (defined as Total liquids revenue, $5.45m/DOE support, $1.45m) better than 3.75. This does not include gas revenues, which have not yet been calculated.

James R. Wood; A. Wylie; W. Quinlan

2005-04-01T23:59:59.000Z

307

USING RECENT ADVANCES IN 2ND SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

Science Conference Proceedings (OSTI)

Three horizontal wells have been completed (St. Springdale & Trezil 9-15 HD, St. Springdale 13-14 HD, St. Springdale & Stedronsky 10-15 HD) and three more wells were spudded (St. Springdale & CSX 2-22 HD, St. Springdale & Mann 9-21 HD and St. Springdale 7-22 HD) in the Springdale play this past reporting period. All are horizontal wells in the Brown Niagaran. This brings the total wells in the play to 12 with seven wells contributing to a total daily production exceeding 350 bbls/day. Data from these wells has been converted from drillers logs (footage calls) and converted to Michigan GeoRef coordinates and plotted. The Gamma Ray data along the well bore was available since it was used to steer the tool during drilling and this data was superimposed on the well trajectories in an effort to help distinguish pay zones from unproductive rock. One new geochemical survey was conducted over the projected surface path of the State Springdale & Stedronsky 14-15 HD and a final project survey was planned over one of the unsurveyed wells. This will bring the total surveyed wells to five and should provide enough data to determine if the idea of only sampling along the well bore is a sound strategy.

James R. Wood; A. Wylie; W. Quinlan

2005-06-30T23:59:59.000Z

308

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, plans were finalized for additional surface geochemical sampling in the new Springdale Prospect field demonstration in Manistee County, Michigan. Plans were also developed to acquire additional surface geochemical data in the vicinity of the Bagley Prospect area in Otsego County, Michigan. The main news this reporting period is the continued success in the Springdale demonstration area. The State Springdale & O'Driscoll No.16-16 and the State Springdale & Herban 12-16 horizontal demonstration wells in Manistee County, Michigan are both flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which are good wells in Michigan. Reserves have not been established yet. A third horizontal well, the State Springdale & Wilburn 1-21 HD has been drilled and is waiting on completion. Two more horizontal wells have been permitted in the Springdale area by our industry partner.

James R. Wood; A. Wylie; W. Quinlan

2004-07-01T23:59:59.000Z

309

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Springdale prospect area in Manistee County, Michigan. The samples were taken along the trace of the proposed horizontal wells. The samples are presently being analyzed and the results will be reported in the next quarterly report. The main news this reporting period is that the Springdale prospect area in Manistee County, Michigan, continues to see drilling activity. Our industry partner, Jordan Development Company, LLC, is permitting additional horizontal wells following their success in the prospect area.

James R. Wood; A. Wylie; W. Quinlan

2004-12-31T23:59:59.000Z

310

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

SciTech Connect

Presented in this quarterly report is the Case History and Well Summary for the Vernon Field demonstration project in Isabella County, Michigan. This new case history and well summary format organizes and presents the technical and historical details of the Vernon Field demonstration, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion. Planning for the annual project meeting in Tampa, Florida has begun. This meeting will be held March 7-9, 2003 at the same site as the last three meetings. The goals of this project were to: (1) test the use of multi-lateral wells to recover bypassed hydrocarbons and (2) to access the potential of using surface geochemistry to reduce drilling risk. Two new demonstration wells, the State-Smock and the Bowers 4-25, were drilled to test the Dundee Formation at Vernon Field for bypassed oil. Neither well was commercial, although both produced hydrocarbon shows. An extensive geochemical survey in the vicinity of Vernon Field, covering much of Isabella County, has produced a base map for interpretation of anomalies in Michigan. Several potential new anomalies were discovered that could be further investigated.

James R. Wood; W. Quinlan

2003-01-01T23:59:59.000Z

311

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The surface geochemistry sampling at the original Bear Lake demonstration site was updated several months after the prospect was confirmed and production begun. As expected, the anomaly appears to be diminishing as the positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir.

James R. Wood; W. Quinlan

2003-10-01T23:59:59.000Z

312

Functional miRNA regulation of metastatic genes promotes tumor cell dissemination in non-small cell and small cell lung carcinomas  

E-Print Network (OSTI)

Tumor progression, from initiation to advanced metastatic disease, requires the orchestration of a diverse group of cell-intrinsic and extrinsic factors. This multifactorial disease is promoted by an accumulation of genetic ...

Blat, Irene Catherine

2013-01-01T23:59:59.000Z

313

Energetics of gas-driven limnic and volcanic eruptions Department of Geological Sciences, The University of Michigan, Ann Arbor, MI 48109-1063, USA  

E-Print Network (OSTI)

and when equilibrium is reached between the gas and liquid phases Natural silicate melts often contain two.3. Dynamics of reversible gas-driven eruptions through a fluid medium Because buoyancy plays an important roleEnergetics of gas-driven limnic and volcanic eruptions Y. Zhang* Department of Geological Sciences

Zhang, Youxue

314

Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

from three different sources (fractured rock, concrete, and+Rock Concentration, no Decay, Rock Source Concentration,Decay, Rock Source Mass Storage, no Decay, Rock Source Mass

2006-01-01T23:59:59.000Z

315

50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale

316

Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

nontritium-bearing drilling fluid during the coring process,nontritium-bearing drilling fluid during the coring process,cores be drilled with drilling fluid spiked with a tracer.

2006-01-01T23:59:59.000Z

317

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, a field demonstration was undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a strong anomaly in the Myrtle Beach area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the 3D seismic data. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling. Presented in this quarterly report is the Case History and Well Summary for the Myrtle Beach area in Burke County, North Dakota. This case history presents the important technical details regarding the geochemistry and the two vertical wells that are part of this field demonstration, and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and is being used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan

2003-07-01T23:59:59.000Z

318

AND FINANCIAL 2011 Edition | EConoMiC And FinAnCiAL PRoFiLE oF QUBEC  

E-Print Network (OSTI)

ENERGY AGENCY. SOURCE: HYDRO-QU?BEC, COMPARISON OF ELECTRICITY PRICES IN MAJOR NORTH AMERICAN CITIES renewable energy, hydro-electricity in particular. It supports the development of wind power through its Energy Strategy 2006-2015, Hydro-Québec is actively pursuing development of Québec's hydroelectric

Rosei, Federico

319

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Trusty Steed prospect area in Grand Traverse County, Michigan. The samples were analyzed using the Microbial Oil Surveying Technique (MOST) technique and revealed only a local (1-point) anomaly. A decision to resample over that point is pending, but drilling has been postponed for the time being. The main news this reporting period is that in the Bear Lake area, northwest Michigan, Federated Oil & Gas Properties' Charlich-Fauble 2-9HD horizontal lateral, has cumulative production of more than 72,000 barrels of oil and is still producing 50 to 75 bopd from a Silurian Niagaran reef reservoir eighteen months after the well was completed. Surface geochemical surveys conducted in the demonstration area were consistent with production results although the ultimate decision to drill was based on interpretation of conventional subsurface and 2D seismic data. The surface geochemical techniques employed were Solid Phase MicroExtraction (SPME) and MOST. The geochemical results have been submitted to World Oil for publication. New geochemical surveys are planned for November in the Springdale quadrangle in Manistee County, Michigan. These surveys will concentrate on sampling over the trace of the proposed horizontal wells rather than a broad grid survey.

James R. Wood; A. Wylie; W. Quinlan

2004-10-01T23:59:59.000Z

320

Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsamiR- 195. Hsa-miR-30a and hsa-miR-195 were...

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

,"Michigan Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050MI3","N3010MI3","N3020MI3","N3035MI3","N3045MI3" "Date","Natural Gas Citygate Price in Michigan (Dollars per Thousand Cubic Feet)","Michigan Price of...

322

Katech (Lithium Polymer) 4-Passenger NEV - Range and Battery Testing Report  

SciTech Connect

The U.S. Department of Energys (DOEs) Advanced Vehicle Testing Activity (AVTA) received a Neighborhood Electric Vehicle (NEV) from the Korea Automotive Technology Institute (KATECH) for vehicle and battery characterization testing. The KATECH NEV (called the Invita) was equipped with a lithium polymer battery pack from Kokam Engineering. The Invita was to be baseline performance tested by AVTAs testing partner, Electric Transportation Applications (ETA), at ETAs contract testing facilities and test track in Phoenix, Arizona, to AVTAs NEVAmerica testing specifications and procedures. Before and during initial constant speed range testing, the Invita battery pack experienced cell failures, and the onboard charger failed. A Kokamsupplied off-board charger was used in place of the onboard charger to successfully perform a constant speed range test on the Invita. The Invita traveled a total of 47.9 miles in 1 hour 47 minutes, consuming 91.3 amp-hours and 6.19 kilowatt-hours. The Kokam Engineering lithium polymer battery was also scheduled for battery pack characterization testing, including the C/3 energy capacity, dynamic stress, and peak power tests. Testing was stopped during the initial C/3 energy capacity test, however, because the battery pack failed to withstand cycling without cell failures. After the third discharge/charge sequence was completed, it was discovered that Cell 6 had failed, with a voltage reading of 0.5 volts. Cell 6 was replaced, and the testing sequence was restarted. After the second discharge/charge sequence was complete, it was discovered that Cell 1 had failed, with its voltage reading 0.2 volts. At this point it was decided to stop all battery pack testing. During the discharge cycles, the battery pack supplied 102.21, 94.34, and 96.05 amp-hours consecutively before Cell 6 failed. After replacing Cell 6, the battery pack supplied 98.34 and 98.11 amp-hours before Cell 1 failed. The Idaho National Laboratory managed these testing activities for the AVTA, as part of DOEs FreedomCAR and Vehicle Technologies Program.

J. Francfort; D. Karner

2005-07-01T23:59:59.000Z

323

Microsoft Word - FIA-13-0054.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Dow Jones & Company ) Dow Jones & Company ) ) Filing Date: August 7, 2013 ) ) Case No. FIA-13-0054 ____________________________________) Issued: August 19, 2013 _______________ Decision and Order _______________ Dow Jones & Company (the Appellant) filed an Appeal from a determination issued by the Department of Energy's Office of Electricity Delivery and Energy Reliability (OE) on July 24, 2013. In that determination, OE denied in part a request for information that the Appellant had submitted on June 5, 2013, pursuant to the Freedom of Information Act (FOIA), 5 U.S.C. § 552. OE released eight documents that it identified as responsive to the Appellant's request, but withheld portions of these documents under FOIA Exemption 4. This Appeal, if granted, would require OE to release this information, and to conduct an

324

CX-009237: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CX-009237: Categorical Exclusion Determination CX-009237: Categorical Exclusion Determination CX-009237: Categorical Exclusion Determination The Dow Chemical Company CX(s) Applied: B5.7 Date: 10/02/2012 Location(s): Texas Offices(s): Fossil Energy The Dow Chemical Company (Dow), a Delaware corporation, with its primary place of business in Midland, Michigan, filed an application with the Office of Fossil Energy (FE) on July 13, 2012, seeking authorization to export previously imported liquefied natural gas (LNG) from the Freeport LNG Development, L.P. (Freeport LNG) Terminal on Quintana Island, Texas, to any country not prohibited by U.S. law or policy. CX-009237.pdf More Documents & Publications CX-006219: Categorical Exclusion Determination EA-1650: Finding of No Significant Impact EA-1650: Final Environmental Assessment

325

madison  

Office of Legacy Management (LM)

Madison, Illinois, Site (formerly known as Madison, Illinois, Site (formerly known as Spectralite Corporation site or Dow Chemical Company site) is located northeast of and across the Mississippi River from St. Louis, Missouri. The site consists of a multisectional complex of 10 interconnecting buildings with a total under-roof area of 1.4 million square feet. During the late 1950s and early 1960s, the Dow Metal Products Division of Dow Chemical Company machined and shaped uranium metal and straightened uranium rods for the U.S. Atomic Energy Commission (AEC), a predecessor agency of the U.S. Department of Energy (DOE). This work was conducted under subcontract to the Uranium Division of the Mallinckrodt Chemical Works. The work conducted for AEC resulted in residual radioactive contamination in Building 6, a large

326

CX-009237: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

37: Categorical Exclusion Determination 37: Categorical Exclusion Determination CX-009237: Categorical Exclusion Determination The Dow Chemical Company CX(s) Applied: B5.7 Date: 10/02/2012 Location(s): Texas Offices(s): Fossil Energy The Dow Chemical Company (Dow), a Delaware corporation, with its primary place of business in Midland, Michigan, filed an application with the Office of Fossil Energy (FE) on July 13, 2012, seeking authorization to export previously imported liquefied natural gas (LNG) from the Freeport LNG Development, L.P. (Freeport LNG) Terminal on Quintana Island, Texas, to any country not prohibited by U.S. law or policy. CX-009237.pdf More Documents & Publications CX-006219: Categorical Exclusion Determination CX-006821: Categorical Exclusion Determination EA-1650: Finding of No Significant Impact

327

Applications in the Nuclear Industry for Thermal Spray Amorphous Metal and Ceramic Coatings  

E-Print Network (OSTI)

Science & Technology 2007, Detroit, MI, Sept. 16 20, 2007,2007, Sept. 1620, 2007, Detroit, MI, American CeramicExhib. , Sept. 1620, 2007, Detroit, MI, American Ceramic

Blink, J.; Farmer, J.; Choi, J.; Saw, C.

2009-01-01T23:59:59.000Z

328

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Vehicle Usage Number of trips 773,602 Total distance traveled (mi) 5,558,155 Avg trip distance (mi) 7.2 Avg distance traveled per day when the vehicle was driven (mi) 30.2 Avg...

329

Computational Enhancements in Low-Rank Semidefinite ...  

E-Print Network (OSTI)

Jul 12, 2004 ... curvature condition necessary for L-BFGS, to be more efficient than the WP linesearch if the ... The precise condition ..... (Mi D)Mi, Mi := AiR.

330

Tradeoffs between Costs and Greenhouse Gas Emissions in the Design of Urban Transit Systems  

E-Print Network (OSTI)

mi) Maintenance emissions (g/veh-mi) Total emissions (g/veh-mi) Total emissions (g/veh-km) Comments 15,300 Based onfrom Chester (2008); emissions from EIO-LCA (CMU 2012) 1,841

Griswold, Julia Baird

2013-01-01T23:59:59.000Z

331

Energy Information Administration/Oil and Gas Field Code ...  

U.S. Energy Information Administration (EIA)

mississippi union 01-26n-9w grand traverse mi 055 003557 n 1969 union 02-26n-9w grand traverse mi 055 006252 n 1973 union 03-26n-9w grand traverse mi ...

332

Process to recover CO/sub 2/ from flue gas gets first large-scale tryout in Texas  

SciTech Connect

This article describes a new plant that will recover 1,120 tons/day of CO/sub 2/ for use in an enhanced oil recovery (EOR) project in West Texas. Feed for the plant is flue gas from an adjacent electrical power generating station. Product CO/sub 2/ is pipelined from the recovery plant in a supercritical state at about 2,000 psig. The pilot plant demonstrated the ability of Dow Chemical's Gas Spec amine solvent to recover CO/sub 2/ from industrial flue gas, and confirmed that Procon/Dow's improved solvent adsorption system is effective in reducing the energy requirements.

St. Clair, J.H.; Simister, W.F.

1983-02-14T23:59:59.000Z

333

Recovery of Valuable Chlorosilane Intermediates by a Novel Waste Conversion Process, Phase IIIB (Progress)  

Science Conference Proceedings (OSTI)

From June 1998 through September 1999, direct process residue (DPR, a waste byproduct) hydrogenolysis has been studied at a large pilot plant within Dow Corning's Carrollton, KY, facility. The system reacts filtered DPR with chlorosilane monomers at high temperature and pressure. The process routinely demonstrates DPR conversions from 59% to 89% on a monthly basis. The reaction product contains high concentrations of valuable monomers such as dimethyldichlorosilane and methyldichlorosilane. An expansion of the current unit's capacity is planned to be on-line by the end of CY2000. Furthermore, a larger DPR hydrogenolysis reactor based on these results is being designed for operation in Europe at Dow Corning's Barry, Wales, site.

Kurt E. Anderson

2000-03-31T23:59:59.000Z

334

Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

816 Maple St. 738 E. Gull Lake Dr. Three Rivers, MI 49093 Augusta, MI 49012 Business: Steam, air & hot water systems Business: Pharmaceutical manufacturing Tom Henry, Director of...

335

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

experiments with approximately 25 hours and 51 minutes of luminosity - NuMI off due to power supply - MI transformer replaced Monday evening - Store established Tuesday morning...

336

Subsidized Housing and Neighborhood Change  

E-Print Network (OSTI)

97 Figure 3-6a Detroit, MI PMSA Neighborhood Quintile98 Figure 3-6b Detroit, MI PMSA Neighborhood Quintileinterviewing from the Detroit Area Study. Neighborhood

Wilson, Florence Louise

2011-01-01T23:59:59.000Z

337

DOE - Office of Legacy Management -- General Motors Co - Flint...  

Office of Legacy Management (LM)

Motors Co - Flint - MI 07 FUSRAP Considered Sites Site: GENERAL MOTORS CO. (MI.07 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate...

338

E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve

2012-01-01T23:59:59.000Z

339

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Clean Energy Coalition - Michigan Green Fleets This CX form is for installing propane refueling infrastructure at one site in MI. This CX is for project selected under...

340

Current Membership  

NLE Websites -- All DOE Office Websites (Extended Search)

Membership Membership * 3M Company * ABC Group Sales & Engineering * Advanced Composites Group * Alpha Industries * ATK Launch Systems * BASF Corporation * Chomarat NA, LLC * Composite Applications Group * Continental Structural Plastics * Cytec Carbon Fibers * Dow Chemical Company * Despatch Industries * Faurecia * Fibria * Ford Motor Company * General Electric * Global Composites Solutions * Graftech International

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Treatability studies on different refinery wastewater samples using high-throughput microbial electrolysis cells (MECs)  

E-Print Network (OSTI)

for the first time. Bioelectrochemical treatability was evaluated relative to oxygen demand. MECs were-oiled refinery wastewater sample from one site (DOW1) produced the best results, with 2.1 ± 0.2 A/m2 (maximum current density), 79% chemical oxygen demand removal, and 82% headspace biological oxygen demand removal

342

The black widow spider genus Latrodectus (Araneae: Theridiidae): phylogeny, biogeography, and invasion history  

E-Print Network (OSTI)

movement. In particular, the nearly cosmopolitan range of the brown widow, Latrodectus geometricus, and its is sister species, the cosmopolitan L. geometricus, and (2) the mactans clade containing all other hasselti Thorell, 1870) and the cosmopolitan brown wi- dow (L. geometricus C.L. Koch, 1841). Members

Gillespie, Rosemary

343

IEEE TRANSACTIONS ON PLASMA SCIENCE. VOL. 17, NO. 1, FEBRUARY 1989 17 Experimental Study of CF4Conical Theta Pinch  

E-Print Network (OSTI)

) Optical multichannel analyzer, C ) Photodiode, H) Langmuir probe, and I) Oil diffusion vacuum pump. netically driven puff valve [lo] that delivered CF4 gas. The vacuum pump was an oil diffusion type with DOW Corning 704 pump oil. The conical theta pinch coil was IO-cm long, had a small ID of 12 cm, a large ID

Pedrow, Patrick D.

344

Optical Properties of Some Silicone Diffusion?Pump Oils in the Vacuum UltravioletUsing an Open?Dish Technique  

Science Conference Proceedings (OSTI)

The optical properties of Dow Corning?704 and ?705 diffusion?pump oils have been measured from 4?24.8 eV using an open?dish technique. These are the first liquids for which optical constants have been obtained above 11.8 eV. In the region above 10.6 eV

G. D. Kerr; M. W. Williams; R. D. Birkhoff; L. R. Painter

1971-01-01T23:59:59.000Z

345

Optimistic futurists suggest that we'll have a working space `elevator'  

E-Print Network (OSTI)

-- Dow Corning 705 diffusion pump oil. Even at about 300 K -- the likely temperature of a film in thermal equilibrium, under exposure to sunlight -- this oil (actually, a modified cousin of this oil with slightly higher molecular weight) could easily remain for as long as a year before evaporating. Keeping the oil

Loss, Daniel

346

Modelling environmental risk  

Science Conference Proceedings (OSTI)

As environmental issues have become increasingly important in economic research and policy for sustainable development, firms in the private sector have introduced environmental and social issues in conducting their business activities. Such behaviour ... Keywords: Asymmetry, Conditional volatility, Dow Jones Sustainability Indexes, Environmental risk, Environmental sustainability index, GARCH, GJR, Log-moment condition, Moment condition, Persistence, Shocks

Suhejla Hoti; Michael McAleer; Laurent L. Pauwels

2005-10-01T23:59:59.000Z

347

Development of a Low Cost Insulated Foil Substrate for Cu(InGaSe)2 Photovoltaics  

DOE Green Energy (OSTI)

The project validated the use of stainless steel flexible substrate coated with silicone-based resin dielectric, developed by Dow Corning Corporation, for Cu(InGa)Se2 based photovoltaics. The projects driving force was the high performance of Cu(InGa)Se2 based photovoltaics coupled with potential cost reduction that could be achieved with dielectric coated SS web substrate.

ERTEN ESER

2012-01-22T23:59:59.000Z

348

Rebalancing the British economy: a strategic assessment  

E-Print Network (OSTI)

, the budget might not be financeable at any price. The risk of secular stagnation can be reduced, although up in two phases, each dominated by an asset price bubble. 1 Introduction and Summary 4 1 Dow (1998, favourable asset price developments that reflected and reinforced rising domestic confidence. Higher property

de Gispert, Adrià

349

PRESS RELEASE 6 April 2010  

E-Print Network (OSTI)

smart meters to measure and control energy usage, technology to pow er-dow n equipment such as computers in order to identify w ays companies can reduce high energy usage and w aste, w hilst increasing comfort the first organisation in Britain to achieve certification from BSI to the new energy management system

350

N d'ordre : 3680 ANNE 2009 THSE / UNIVERSIT DE RENNES 1  

E-Print Network (OSTI)

GROUP EASTMAN CHEMICAL COMPANY ENERGIZER ENVIRONMENTAL MGMT. /Env. Mgmt. Div. ExxonMobil FMC CORPORATION, New Delhi, India B.S., Lafayette College, Easton, PA ExxonMobil Upstream Research Company, Houston, TX. of the NAVY DOW CHEMICAL COMPANY DUPONT EASTERN RESEARCH GROUP EASTMAN CHEMICAL COMPANY ENERGIZER Exxon

Paris-Sud XI, Université de

351

WARREN BUCKLER POWELL BIRTH DATE: April 11, 1955 HOME: 328 Christopher Drive  

E-Print Network (OSTI)

) B.S., University of Cincinnati ExxonMobil, Houston, TX Doctor of Philosophy (Ph.D.) Degrees May 2004. Deloitte Consulting Dow Chemical Company DuPont Eastern Research Group ExxonMobile Fuji Silysia Chemical DuPont, Mobil Oil, Bayer Corporation, Novo Nordisk, Shell Oil, Exxon, Chevron, Texaco, Hoechst

Powell, Warren B.

352

DefenestraTor: Throwing out Windows in Tor Mashael AlSabah1  

E-Print Network (OSTI)

on Privacy in the Electronic Society (WPES 2007). Washington, DC, USA (October 2007) 2. Brakmo, L.S., ODefenestraTor: Throwing out Windows in Tor Mashael AlSabah1 , Kevin Bauer2 , Ian Goldberg1 , Dirk first evaluate small fixed-size circuit win- dows and a dynamic circuit window that adaptively resizes

Goldberg, Ian

353

Installing NikonView 4 under Windows (COOLPIX5000/995/885/775/990/880) A-1 Installing NikonView 4 underWindows  

E-Print Network (OSTI)

Installing NikonView 4 under Windows (COOLPIX5000/995/885/775/990/880) A-1 Installing NikonView 4 underWindows Installing Nikon View 4 for the COOLPIX5000/995/885/775/990/880 NikonView 4 includes- trator" (Windows 2000 Professional) or "ComputerAdministrator" (Win- dows XP Home Edition/Windows XP

Kleinfeld, David

354

High Performance Packaging Solutions for Low Cost, Reliable PV Modules: Final Subcontract Report, 26 May 2005 - 30 November 2008  

DOE Green Energy (OSTI)

During this research effort, Dow Corning Corporation has addressed the PV manufacturing goals of: (i) improving PV manufacturing processes and equipment; (ii) accelerating manufacturing cost reductions of PV modules; (iii) increasing commercial product performance and reliability; and (iv) scaling up U.S. manufacturing capacity.

Keotla, B. M.; Marinik, B. J.

2009-06-01T23:59:59.000Z

355

Mapping of Near-Surface Winds in Hurricane Rita Using Finescale Radar, Anemometer, and Land-Use Data  

Science Conference Proceedings (OSTI)

Data collected from a Doppler on Wheels (DOW) mobile radar deployed in Port Arthur, Texas, near the point of landfall of Hurricane Rita (2005) and from two Florida Coastal Monitoring Program 10-m weather stations (FCMP-WSs) are used to ...

Karen Kosiba; Joshua Wurman; Forrest J. Masters; Paul Robinson

2013-12-01T23:59:59.000Z

356

Technical Analysis from A to Z by Steven B. Achelis  

E-Print Network (OSTI)

://www.equis.com/Customer/Resources/TAAZ/?p=5) Technical analysis Should I buy today? What will prices be tomorrow, next week, or next year analysis is the study of prices, with charts being the primary tool. The roots of modern-day technical or indirectly from the Dow Theory, these roots include such principles as the trending nature of prices, prices

Boetticher, Gary D.

357

The 30 May 1998 Spencer, South Dakota, Storm. Part II: Comparison of Observed Damage and Radar-Derived Winds in the Tornadoes  

Science Conference Proceedings (OSTI)

A violent supercell tornado passed through the town of Spencer, South Dakota, on the evening of 30 May 1998 producing large gradients in damage severity. The tornado was rated at F4 intensity by damage survey teams. A Doppler On Wheels (DOW) ...

Joshua Wurman; Curtis R. Alexander

2005-01-01T23:59:59.000Z

358

Polarimetric and Dual-Doppler Radar Observations of the Lipscomb County, Texas, Supercell Thunderstorm on 23 May 2002  

Science Conference Proceedings (OSTI)

Polarimetric and dual-Doppler observations of a supercell observed by the National Center for Atmospheric Research (NCAR) S-band Polarimetric (SPOL) radar, two Doppler-On-Wheels (DOW) radars, and the Greek XPOL radar on 23 May 2002 during the ...

Jeffrey Frame; Paul Markowski; Yvette Richardson; Jerry Straka; Joshua Wurman

2009-02-01T23:59:59.000Z

359

Acknowledgments  

Science Conference Proceedings (OSTI)

...Tim Webber, IPG Photonics, Oxford, MA Frank Brennan, Trumpf, Plymouth, MI Rainer Uhlig, ABB, Fort Collins, CO Jim Cann, Rofin Sinar, Plymouth, MI Urban Widén, Permanova, Mölndal, Sweden Robert Borgstrom, Precitec, New Hudson, MI Scott Green, LT Ultra, New Hudson, MI Mike...

360

Supporting Information Evolution of Dendritic Platinum Nanosheets  

E-Print Network (OSTI)

87131. 3 Toyota Technical Center, Toyota Motor Engineering & Manufacturing North America, Ann Arbor, MI

Shelnutt, John A.

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Civil Works Fact Sheets  

E-Print Network (OSTI)

HAMILTON DAM, FLINT RIVER, FLINT, MI ............................................ LRD-19 HOLES CREEK, WEST

US Army Corps of Engineers

362

MicroRNA expression in canine mammary cancer  

E-Print Network (OSTI)

MicroRNAs (miRNAs) play a vital role in differentiation, proliferation and tumorigenesis by binding to messenger RNAs (mRNA) and inhibiting translation. To initiate an investigation into the identification of miRNAs in the domestic dog, an emerging model for human disease, a comparison of the human and canine genetic databases was conducted. The bioinformatics work revealed significant conservation of miRNA genes between the two species. Proof of principle experiments, including serial dilutions and sequencing, were performed to verify that primers made to amplify human mature miRNAs can be used to amplify canine miRNAs, providing that the mature sequences are conserved. TaqMan Real-time RT-PCR, a sensitive and specific method, was used to isolate the first miRNA mature products from canine tissues. The expression levels of miR-17-3p, miR-17-5p, miR-18, miR-19a, miR-19b, miR-20, and miR-92 were evaluated in five canine tissues (heart, lung, brain, kidney, and liver). Because miRNAs have been found to act as both tumor suppressors and oncogenes in several different cancers, expression patterns of ten miRNAs (miR-15a, miR-16, miR-17-5p, miR-21, miR-29b, miR-125b, miR-145, miR-155, miR-181b, let-7f) known to be associated with human breast cancer were compared between malignant canine mammary tumors (n=6) and normal canine mammary tissue (n=10). Resulting data revealed miR-29b and miR-21 to have a statistically significant (p<0.05) up-regulation in cancerous samples. Overall expression patterns showed nine of the ten miRNAs follow the same pattern of expression in the domestic dog as the human, while the miR-145 expression does not show a difference between the normal and cancerous samples.

Boggs, Rene' Michelle

2008-05-01T23:59:59.000Z

363

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi)¹ 45 Overall DC electrical energy consumption (DC Wh/mi)² 22 Total number of trips 1,585 Total distance traveled (mi) 14,910 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 34 DC electrical energy consumption (DC Wh/mi) 49 Number of trips 883 Percent of trips city | highway 81% | 19% Distance traveled (mi) 4,778 Percent of total distance traveled 32%

364

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

4 4 Overall AC electrical energy consumption (AC Wh/mi)¹ 64 Overall DC electrical energy consumption (DC Wh/mi)² 31 Total number of trips 831 Total distance traveled (mi) 7,559 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 35 DC electrical energy consumption (DC Wh/mi) 54 Number of trips 541 Percent of trips city | highway 79% | 21% Distance traveled (mi) 3,402 Percent of total distance traveled 45%

365

IL-1 beta and TNF-alpha upregulate angiotensin II type 1 (AT(1)) receptors on cardiac fibroblasts and are associated with increased AT(1) density in the post-MI heart  

E-Print Network (OSTI)

broblasts and the infarcted heart. Am J Physiol 1998;274:matrix remodeling in heart failure: a role for de novoin right and left heart after myocardial infarction. Mol

Gurantz, D; Cowling, R T; Varki, N; Frikovsky, E; Moore, C D; Greenberg, Barry H

2005-01-01T23:59:59.000Z

366

P LUS: A DVENT URES I N VET ERI NA RY M EDI CI NE s T RA NSF O R MI N G D A I RY FA R MS Boosting the  

E-Print Network (OSTI)

doxycycline make a difference? Maybe, but here was the catch: To slow IMHA's destruction of red blood cells- tion. How to get out of this catch-22? Start the doxycycline but "contin- ue to treat the IMHA because

Tufts University

367

A Kallikrein 15 (KLK15) single nucleotide polymorphism located close to a novel exon shows evidence of association with poor ovarian cancer survival  

E-Print Network (OSTI)

of the UTR and splice site SNPs. Analysis for putative microRNA (miRNA) sites was performed using miRBase Targets V4, Target scan, miRanda, PicTar and Patrocles. Cell culture, RT PCR and sequencing of KLK15 putative promoter region The normal ovarian cell... intronic SNPs located within 30 bp of exon- intron boundaries. We also predicted miRNA binding sites using three different software programs; Target Scan, miRanda and Patrocles. A maximum of 32 miRNA bind- ing sites scattered throughout the gene were...

Batra, Jyotsna; Nagle, Christina M; O'Mara, Tracy; Higgins, Melanie; Dong, Ying; Tan, Olivia L; Lose, Felicity; Skeie, Lene Marie; Srinivasan, Srilakshmi; Bolton, Kelly L; Song, Honglin; Ramus, Susan J; Gayther, Simon A; Pharoah, Paul D P; Kedda, Mary-Anne; Spurdle, Amanda B; Clements, Judith A

2011-04-01T23:59:59.000Z

368

C-J  

Office of Legacy Management (LM)

C-J C-J EH: (07~00) M7iZed- States Government - DATE: OCT 0 8 1992 REPLY TO AlTN OF: EM-421 (W. A. W illiams, 903-8149) SUBJECT: Authorization for Remedial Action at the Former Dow Chemical Company Site in M a d ison, Illinois To' Manager, DOE Oak Ridge F ield O ffice This is to notify you that the former Dow Chemical Company site in M a d ison, Illinois, is designated for remedial action under the Formerly Utilized Sites Remedial Action Program (FUSRAP). This notification does not constitute a FUSRAP baseline change control approval. Approval of the baseline change will be accomplished through the normal baseline change control procedures. The site was used by the former Atomic Energy C o m m ission for the extrusion and shaping of uranium metal during the late 1950s. A radiological survey

369

STATEMENT OF CONSIDERATIONS REQUEST BY VEELOCYS, INC. FOR AN ADVANCE WAIVER OF PATENT  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VEELOCYS, INC. FOR AN ADVANCE WAIVER OF PATENT VEELOCYS, INC. FOR AN ADVANCE WAIVER OF PATENT RIGHTS UNDER DOE COOPERATIVE AGREEMENT NO. DE-FC36- 04G014154 ENTITLED "OLEFINS BY HIGH-INTENSITY OXIDATION (OHIO)"; W(A)-04-037; CH-1204 As set out in the attached waiver petition and in subsequent discussions with DOE Patent Counsel, Velocys Inc. (Velocys) has requested an advance waiver of domestic and foreign patent rights for gill subject inventions made under the above-identified cooperative agreement by its employees and its subcontractors' employees, regardless o0 tier, except inventions made by subcontractors eligible to retain title pursuant to P.L. 96-517, as amended, and National Laboratories. Velocys is leading a teaming arrangement with thei Dow Chemical Company(Dow) to develop an ethylene production process based on oxyhydrogenation of

370

U.S. Energy Secretary Visits Kuwait | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Kuwait Kuwait U.S. Energy Secretary Visits Kuwait November 15, 2005 - 2:30pm Addthis Stop included meeting with U.S. business leaders and military troops KUWAIT CITY, KUWAIT - On Monday, November 14, 2005, U.S. Department of Energy Secretary Samuel W. Bodman toured the EQUATE petrochemical plant and met with U.S. business representatives while visiting Kuwait, as part of his trip through the Middle East. The EQUATE petrochemical plant is a joint venture between Kuwait's Petrochemical Industries Company (PIC) and U.S. company Union Carbide, a subsidiary of The Dow Chemical Company. "The EQUATE petrochemical plant is a wonderful example of international cooperation and investment. We are pleased that the joint venture between the Petrochemical Industries Company and Dow Chemical has been so

371

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 - 17220 of 28,905 results. 11 - 17220 of 28,905 results. Download Applicant Organization: http://energy.gov/downloads/applicant-organization-2 Download Interested Parties- Smith Dawson & Andrews http://energy.gov/downloads/interested-parties-smith-dawson-andrews Download Interested Parties- Myriant http://energy.gov/downloads/interested-parties-myriant Download Interested Parties- Dow Chemical http://energy.gov/downloads/interested-parties-dow-chemical Download EA-1418: Final Environmental Assessment Otter Tail Power Company Advanced Hybrid Particulate Collector, Big Stone City, Grant County, South Dakota http://energy.gov/nepa/downloads/ea-1418-final-environmental-assessment Download Flash2011-91.pdf Attachment - Acquisition Guide 6.1 - Competition Requirements http://energy.gov/management/downloads/flash2011-91pdf

372

Argonne Chemical Sciences & Engineering - News & Highlights - Current News  

NLE Websites -- All DOE Office Websites (Extended Search)

1 News & Highlights 1 News & Highlights tijana rajh Batteries get quick charge with new anode technology argonne logo Argonne Hosts Natural Gas-Hydrogen Workshop Jun Lu Jun Lu receives DOE EERE Postdoctoral Research Award Sodium-ion batteries Making sodium-ion batteries that are worth their salt Artem Guelis and Kevin Nichols Miniaturizing nuclear recycling experiments YouTube logo Don Hillebrand and Jeff Chamberlain discuss advanced batteries on TEDxUIllinois japan flag Argonne team helps map Fukushima radiation release Western Lithium Argonne, Western Lithium to develop lithium carbonate for multiple battery applications Dow logo Dow and Argonne collaborating on new battery materials magazine cover Revealing Reaction Mechanisms by Combining Raman Spectroscopy and Quantum Chemistry

373

US DOE Industrial Steam BestPractices Software Tools  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOW RESTRICTED For internal DOW RESTRICTED For internal use only US DOE Industrial Steam BestPractices Software Tools Riyaz Papar, PE, CEM Hudson Technologies Company Phone: (281) 298 0975 Email: rpapar@hudsontech.com - Agenda * Introduction * Steam System BP Tools Suite - SSST - SSAT - 3EPlus * Q & A 1 Steam System Management Objective: Minimize Steam Use, Energy Losses And Most Importantly STEAM COST!! Steam Market Assessment Takeaways * Fuel savings estimates - individual projects - ranged from 0.6 percent to 5.2 percent * Estimated payback periods generally very attractive - Ranged from 2 to 34 months - Most less than 2 years * Potential steam savings in target industries - over 12 percent of fuel use 2 Promising Areas To Achieve Steam Energy and Cost Savings? Use Steam System Scoping Tool (SSST) For

374

All General Counsel Reports | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1993_036_DOW_CHEMICAL_COMPANY_Waiver_of_Domestic_and_Fore.pdf 1993_036_DOW_CHEMICAL_COMPANY_Waiver_of_Domestic_and_Fore.pdf July 27, 2011 WA_1993_003_EATON_CORPORATION_Waiver_of_Domestic_and_Foreign.pdf July 27, 2011 WC_1999_002_CLASS_WAIVERUNIVERSITY_OF_CHICAGO_RESEARCH_AND_D.pdf July 27, 2011 Memo to DOE re conference call minutes DOE Notice of Inquiry on the Convention on Supplementary Compensation for Nuclear Damage (CSC) Contingent Cost Allocation --March 16, 2011 conference call with ConverDyn. Conference call minutes July 27, 2011 Public comment re Convention on Supplementary Compensation Contingent Cost Allocation DOE published a Notice of Inquiry in the Federal Register (75 Fed. Reg. 43,945) requesting public comment on issues related to the funding obligations under the Convention on Supplementary Compensation for Nuclear

375

Uniter+ States Government  

Office of Legacy Management (LM)

EFG (07-90) EFG (07-90) Uniter+ States Government ~L.aQ-i; Department of Energy inemorandum DATE: SEP 2 5 1992 REPLY TO Al-fN OF: EM-421 (W. A. W illiams, 903-8149) SUBJECT: Authorization for Remedial Action at the Former Dow Chemical Company Facility in M a d ison, Illinois TO: L. Price, OR The site of the Former Dow Chemical Company in M a d ison, Illinois, which is currently owned and operated by the Spectrulite Consortium, is designated for inclusion in the Formerly Utilized Sites Remedial Action Program (FUSRAP). This designation is based upon the results of a preliminary radiological survey and other information described in the attached Designation Summary. The authority determination and preliminary survey report also are attached for information. The site has been assigned a low priority under the FUSRAP protocol, as

376

Cladding Attachment Over Thick Exterior Insulating Sheathing (Fact Sheet), Building America Case Study: Technology Solutions for New and Existing Homes, Building Technologies Office (BTO)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Cladding Attachment Over Thick Cladding Attachment Over Thick Exterior Insulating Sheathing Project InformatIon: Project name: Cladding Attachment Over Thick Exterior Insulating Sheathing Partners: Building Science Corporation www.buildingscience.com The Dow Chemical Company www.dow.com James Hardie Building Products www.jameshardie.com Building component: Building envelope component application: New and/or retrofit; Single and/or multifamily Year research conducted: 2011 through 2012 applicable climate Zone(s): All The addition of insulation to the exterior of buildings is an effective means of increasing the thermal resistance of wood-framed walls and mass masonry wall assemblies. The location of the insulation on the exterior of the structure has many direct benefits, including better effective R-value from reduced thermal

377

DOEEA-1157 ENVIRONlMENTAL ASSESSMENT METHYL CHLORIDE VIA OXYHYDROCHLOFUNATION OF METHANE:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

57 57 ENVIRONlMENTAL ASSESSMENT METHYL CHLORIDE VIA OXYHYDROCHLOFUNATION OF METHANE: A BUILDING BLOCK FOR CHEMICALS AND FUELS FROM NATURAL GAS DOW CORNING CORPORATION CARROLLTON, KENTUCKY SEPTEMBER 1996 U.S. DEPARTMENT OF ENERGY PITTSBURGH ENERGY TECHNOLOGY CENTER CUM ~~~~~~~~ DOEEA-1157 ENVIRONlMENTAL ASSESSMENT METHYL CHLORIDE VIA OXYHYDROCHLORINATION OF METHANE: A BUILDING BLOCK FOR CHEMICALS AND FUELS FROM NATURAL GAS DOW CORNING CORPORATION CARROLLTON, KENTUCKY SEPTEMBER 1996 U.S. DEPARTMENT OF ENERGY PITTSBURGH ENERGY TECHNOLOGY CENTER Portions of this document may be illegible in electronic image products. Image are produced from the best available original document. &E/,Etq --,/s7 FINDING OF NO SIGNIFICANT IMPACT FOR THE PROPOSED METHYL CHLORIDE V

378

NETL: Gasifipedia  

NLE Websites -- All DOE Office Websites (Extended Search)

Gasifier: Commercial Gasifiers: Entrained Flow Gasifiers Gasifier: Commercial Gasifiers: Entrained Flow Gasifiers CB&I E-Gas(tm) Gasifiers Originally owned by Global Energy, Destec and Dow, later by ConocoPhillips, and currently owned by CB&I, E-Gas(tm) coal gasifier technology was first demonstrated at the Louisiana Gasification Technology Inc. (LGTI) integrated gasification combined cycle (IGCC) plant (also known as the Dow Syngas Project), which operated from 1987 to 1995. The technology is currently incorporated in the Wabash River Coal Gasification Repowering Project, funded under the DOE Clean Coal Demonstration Program in the 1990s. The Wabash IGCC plant has been in operation since 1995. Diagram of the E-Gas Gasifier source: ConocoPhillips Operation The E-Gas(tm) coal gasifier is a pressurized, upflow, entrained slagging

379

Notices  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

500 Federal Register 500 Federal Register / Vol. 78, No. 51 / Friday, March 15, 2013 / Notices of experimental use: April 1, 2013 through April 1, 2016; Contact: Jennifer Gaines, RD, (703) 305-5967, email address: gaines.jennifer@epa.gov. 3. 62719-EUP-AL. (EPA-HQ-OPP- 2013-0077). Submitter: Dow AgroSciences LLC, 9330 Zionsville Road, Indianapolis, IN 46268. Pesticide Chemicals: 2,4&-D Choline Salt plus Glyphosate. Type of Chemical: Herbicide. Summary of Request: For use of 1,000 lbs. of 2,4-D Choline Salt plus 1,000 lbs. of glyphosate 600 gal. in/on 500 acres of AAD-1 Corn from March 1, 2013 through March 1, 2014. Contact: Michael Walsh, RD, (703) 308-2972, email address: walsh.michael@epa.gov. 4. 62719-EUP-AU. (EPA-HQ-OPP- 2013-0076). Submitter: Dow AgroSciences LLC, 9330 Zionsville

380

Chicago Operations Office 9800 South Cass Avenue  

Office of Legacy Management (LM)

Office Office 9800 South Cass Avenue Argonne,, Illinois 60439 James L. Liver-man, Acting Assistant Secretary for Environment, HQ THE DOW CHEMICAL COMPANY On December 8, 1977, Edward J. Jascewsky, Department of Energy (DOE), and Walter Smith, Argonne National Laboratory (ANL), visited The Dow Chemical Company, Walnut'Creek, California. The purpose of the visit was to discuss the past operations at these facilities under Atomic Energy Commission (AEC), Contract AT (40-l)-GEN 236, which involved process studies on different uranium ores. Discussions were held with Dr. Charles Levine, Radiation Safety Officer. He identified four rooms (j/l, 2, 18, and 25) in the Research Building that were used during the period of the contract. A survey of the facility was performed by Messrs. Jascewsky and Smith.

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

HSS Visiting Speaker Program - October 30, 2008. | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

October 30, 2008. October 30, 2008. HSS Visiting Speaker Program - October 30, 2008. Dr. Susan Butts is Senior Director of External Science and Technology Programs at The Dow Chemical Company. In this capacity she is responsible for Dow's contract research activities with US and European government agencies and sponsored research programs at over 100 universities, institutes, and national laboratories worldwide. She has also held the role of Global Staffing Leader in which she managed recruiting and hiring activities for the R&D function. Dr. Butts is active in a number of organizations that address issues pertaining to relationships between industry, universities, and government research laboratories. She was a co-founder and member of the Steering Team for the University-Industry

382

Application of Spray Foam Insulation Under Plywood and OSB Roof Sheathing (Fact Sheet), Building America Case Study: Technology Solutions for New and Existing Homes, Building Technologies Office (BTO)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Application of Spray Foam Application of Spray Foam Insulation Under Plywood and OSB Roof Sheathing PROJECT aPPliCaTiON Construction: Existing homes with unvented cathedralized roofs. Type: Residential Climate Zones: All TEam mEmbERs Building Science Corporation www.buildingscience.com BASF www.basf.com Dow Chemical Company www.dow.com Honeywell http://honeywell.com Icynene www.icynene.com COdE COmPliaNCE 2012 International Code Council, International Residential Code Spray polyurethane foams (SPFs) have advantages over alternative insulation methods because they provide air sealing in complex assemblies, particularly roofs. Spray foam can provide the thermal, air, and vapor control layers in both new and retrofit construction. Unvented roof strategies with open cell and

383

Solar production of industrial process steam ranging in temperature from 300/sup 0/F to 550/sup 0/F (Phase I). Volume 1. Final report, September 30, 1978-June 30, 1979  

DOE Green Energy (OSTI)

This section summarizes the Foster Wheeler Development Corporation/Dow Chemical Company Phase I solar industrial process steam system and includes a system schematic, a brief system description, general specifications of the major system components, expected system performance, and a cost estimate summary for Phases II and III. The objectives of Phase I are: (1) design a cost-effective solar steam generating system, using state-of-the-art components and technology, to supply steam for Dow Chemical Company's Dalton, Georgia, plant; (2) predict the performance of the solar process steam plant; (3) conduct a safety evaluation and an environmental impact assessment of the solar steam system; (4) conduct an economic analysis to determine the potential economic benefits of a solar-augmented process steam production system compared with an existing fossil-fuel-fired steam generator; and (5) promote the project extensively to make it visible to industry and the general public.

Not Available

1979-06-30T23:59:59.000Z

384

Recovery of Valuable Chlorosilane Intermediates by a Novel Waste Conversion Process  

DOE Green Energy (OSTI)

From 1994 to 2001, Dow Corning studied a waste recycling process to recover direct process residues (DPR) resulting from the production of silicone precursors. Over the course of eight years, Dow Corning constructed and operated a pilot plant, a small scale commercial plant, and a full scale plant. The process reacts DPR with hydrogen and chlorosilane monomers at high temperature and high pressure. The process converted 85% of the DPR to valuable chlorosilane monomers such as dimethyldichlorosilane and methyldichlorosilane. When feeding methyltrichlorosilane, the process converted 30% of the MeSiCl3 to other monomers. Alternate co-feed monomers were tested. By converting waste DPR to valuable intermediates, the technology significantly reduces waste from the basic silicones manufacturing process.

J. Ashley Brinson

2002-06-20T23:59:59.000Z

385

TO : John T. Sherman, Assistant Director for  

Office of Legacy Management (LM)

John T. Sherman, Assistant Director for John T. Sherman, Assistant Director for DATE: February 26, 1957 Domestic Procurement FROM : E.G. Vanhlarcom 'I ~~,&k,(+~~~ - i,;;, : : . .,,)_! ,A:!' SUBJ=T: SOLVENT XTHACTION OF PHOSPXMIC ACT 'On the occasion of my visit to the Dow Chemical Laboratory February 13th, I took the opportunity to discuss with them their original work on the use of solvent extraction for recovering- uranium from phosphoric acid. I told them that it was my under- standing that the operating companies in Florida were experiencing serl.cus loss of solvent and consequent high cost of this product. Er. Bailes and Ray Long explained to me that they had done the original work which was all reported in Dow--8. They said that they had worked cooperatively with both the Florida companies and with

386

DOE - Office of Legacy Management -- Madison_FUSRAP  

Office of Legacy Management (LM)

Illinois Illinois Madison, Illinois, Site FUSRAP Site Madison Map Background-The Madison Site was remediated under the Formerly Utilized Sites Remedial Action Program (FUSRAP). FUSRAP was established in 1974 to remediate sites where radioactive contamination remained from Manhattan Project and early U.S. Atomic Energy Commission (AEC) operations. History-During the late 1950s and early 1960s, the Dow Metal Products Division of Dow Chemical Company machined and shaped uranium metal and straightened uranium rods for AEC. Radiological surveys conducted in 1989 identified uranium dust on interior overhead surfaces that exceeded DOE guidelines. The site was designated for remedial action under FUSRAP in 1992. The U.S. Army Corps of Engineers (USACE) completed remediation in

387

DOE Solar Decathlon: Sponsors  

NLE Websites -- All DOE Office Websites (Extended Search)

Dow Corning Lowe's M.C. Dean Pepco Schneider Electric Supporting Sponsors Contributing Sponsors Where Are the Houses Now? Quick Links Solar Decathlon Home Solar Decathlon 2011 Solar Decathlon 2009 Solar Decathlon 2007 Solar Decathlon 2005 Solar Decathlon 2002 Solar Decathlon 2011 Sponsors The U.S. Department of Energy (DOE) Solar Decathlon is organized by the National Renewable Energy Laboratory, which works in partnership with sponsors at all levels to make this student solar housing competition and event a reality. 2011 Sustaining Sponsors These sponsors made significant contributions-including financial support, materials, volunteers, outreach, and awards-to the success of Solar Decathlon 2011. Learn more about each sponsor and its role in Solar Decathlon 2011. Dow Corning

388

CLASSIFY-Profiles: Volume 4: Designing Energy Services for Commercial and Industrial Customers  

Science Conference Proceedings (OSTI)

In a changing marketplace, utilities will likely need to enhance their revenue streams through the introduction of nontraditional products and services in areas such as power quality, facilities management, energy management, and utility information. This report defines basic information about customer preferences to help utilities develop attractive, profitable, new services for larger commercial and industrial markets. This report is available only to funders of Program 101A or 101.001. Funders may dow...

1996-03-22T23:59:59.000Z

389

High Stress Cable Using Nanocomposites: Status Report and Future Prospects  

Science Conference Proceedings (OSTI)

The Electric Power Research Institute (EPRI) has been pursuing the development of a nanocomposite cable insulation compound for several years. Early successes in the laboratory led to commercialization efforts with Dow Chemical Company and several trial runs of commercial-scale compound manufacturing. Medium-voltage underground cables were made with the experimental compound. The fundamental challenge in dispersing nanoscale particles into a bulk polymer is achieving a homogenous dispersion throughout th...

2011-12-18T23:59:59.000Z

390

Distribution Class Nanodielectric Cable: Status Report and Future Prospects  

Science Conference Proceedings (OSTI)

The Electric Power Research Institute (EPRI) has been pursuing the development of a nanocomposite cable insulation compound for several years. Early successes in the laboratory led to commercialization efforts with Dow Chemical Company and several trial runs of commercial-scale compound manufacturing. Medium-voltage underground cables were made with the experimental compound. The fundamental challenge in dispersing nanoscale particles into a bulk polymer is achieving a homogenous dispersion throughout t...

2011-12-18T23:59:59.000Z

391

The testosterone-dependent and independent transcriptional networks in the hypothalamus of Gpr54 and Kiss1 knockout male mice are not fully equivalent  

E-Print Network (OSTI)

. Testosterone implants were manually and asep- tically prepared in the laboratory using silicone tubing (0.058 inch ID/0.077 inch OD; Dow Corning) filled with crystalline testosterone (T-1500; Sigma Aldrich, UK), and sealed with adhesive silicone type A glue [45... phase lock tube to separate out the aqueous phase through centrifugation. RNA was precipitated out of the aqueous phase with an equal volume of isopropa- nol and pelletted by centrifugation. Seventy percent ethanol was used to wash the pellet...

Prentice, Leah M; d'Anglemont de Tassigny, Xavier; McKinney, Steven; Ruiz de Algara, Teresa; Yap, Damian; Turashvili, Gulisa; Poon, Steven; Sutcliffe, Margaret; Allard, Pat; Burleigh, Angela; Fee, John; Huntsman, David G; Colledge, William H; Aparicio, Samuel

2011-04-28T23:59:59.000Z

392

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

74 74 Number of trips 399 Distance traveled (mi) 148 Percent of total distance traveled (%) 73% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 6.3 Average Stops per mile 35.5 Percent of Regen Braking Energy Recovery (%) 11% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 423 Number of trips 27 Distance traveled (mi) 54 Percent of total distance traveled (%) 27% Average Trip Distance (mi) 2.0 Average Driving Speed (mph) 20.7 Average Stops per mile 3.5 Percent of Regen Braking Energy Recovery (%) 15% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 0 Number of trips 0 Distance traveled (mi) 0 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.0 Average Driving Speed (mph)

393

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi)¹ 111 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 61 Total number of trips 1,135 Total distance traveled (mi) 4,408 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 296 Number of trips 264 Percent of trips city | highway 100% | 0% Distance traveled (mi) 781 Percent of total distance traveled 18% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 19 DC electrical energy consumption (DC Wh/mi) 141 Number of trips 44 Percent of trips city | highway 96% | 4% Distance traveled CD | CS (mi) 333 | 389 Percent of total distance traveled CD | CS

394

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 493 Distance traveled (mi) 189 Percent of total distance traveled (%) 38% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 4.9 Average Stops per mile 28.7 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 377 Number of trips 67 Distance traveled (mi) 275 Percent of total distance traveled (%) 56% Average Trip Distance (mi) 4.1 Average Driving Speed (mph) 17.9 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 438 Number of trips 1 Distance traveled (mi) 29 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 28.7 Average Driving Speed (mph)

395

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

505 505 Number of trips 601 Distance traveled (mi) 245 Percent of total distance traveled (%) 62% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.4 Average Stops per mile 34.8 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 373 Number of trips 35 Distance traveled (mi) 124 Percent of total distance traveled (%) 31% Average Trip Distance (mi) 3.5 Average Driving Speed (mph) 23.0 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 319 Number of trips 3 Distance traveled (mi) 25 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 8.5 Average Driving Speed (mph)

396

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 Overall AC electrical energy consumption (AC Wh/mi)¹ 93 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 40 Total number of trips 11,047 Total distance traveled (mi) 119,879 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 25 DC electrical energy consumption (DC Wh/mi) 208 Number of trips 4,491 Percent of trips city | highway 92% | 8% Distance traveled (mi) 30,376 Percent of total distance traveled 25% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 71 Number of trips 1,352 Percent of trips city | highway 69% | 31% Distance traveled CD | CS (mi) 12,772 | 20,001 Percent of total distance traveled CD | CS

397

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

613 613 Number of trips 89 Distance traveled (mi) 9 Percent of total distance traveled (%) 30% Average Trip Distance (mi) 0.1 Average Driving Speed (mph) 7.0 Average Stops per mile 44.5 Percent of Regen Braking Energy Recovery (%) 9% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 8 Distance traveled (mi) 5 Percent of total distance traveled (%) 16% Average Trip Distance (mi) 0.6 Average Driving Speed (mph) 25.0 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 6% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 7 Distance traveled (mi) 16 Percent of total distance traveled (%) 54% Average Trip Distance (mi) 2.3 Average Driving Speed (mph)

398

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 1,610 Distance traveled (mi) 372 Percent of total distance traveled (%) 72% Average Trip Distance (mi) 0.2 Average Driving Speed (mph) 5.2 Average Stops per mile 32.1 Percent of Regen Braking Energy Recovery (%) 13% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 383 Number of trips 114 Distance traveled (mi) 144 Percent of total distance traveled (%) 28% Average Trip Distance (mi) 1.3 Average Driving Speed (mph) 18.3 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 16% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 549 Number of trips 5 Distance traveled (mi) 2 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.4 Average Driving Speed (mph)

399

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

530 530 Number of trips 1,308 Distance traveled (mi) 495 Percent of total distance traveled (%) 69% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.6 Average Stops per mile 31.4 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 471 Number of trips 91 Distance traveled (mi) 175 Percent of total distance traveled (%) 24% Average Trip Distance (mi) 1.9 Average Driving Speed (mph) 16.6 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 357 Number of trips 2 Distance traveled (mi) 49 Percent of total distance traveled (%) 7% Average Trip Distance (mi) 24.7 Average Driving Speed (mph)

400

Computational and experimental analysis of plant microRNAs  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are small, endogenous, non-coding RNAs that mediate gene regulation in plants and animals. We demonstrated that Arabidopsis thaliana miRNAs are highly complementary (0-3 mispairs in an ungapped alignment) ...

Jones-Rhoades, Matthew W. (Matthew William)

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

Johnson Controls, Inc. Ford Motor Company 2875 High Meadow Cir. 550 Town Center Dr., Ste 200 Auburn Hills, MI 48326-2773 Dearborn, MI 48126 Business: Building Automation, Facility...

402

Bang smad Villages New Year in 2011  

E-Print Network (OSTI)

and Mi Nyag Tibetan ??????? ??????????????????? Performer(s)'s first / native language Khams Tibetan and Mi Nyag Tibetan ??????? last updated by World Oral Literature Project staff on Wednesday, Tuesday, June 8, 2010 ??????????????????? Performer...

Bkar shis bzang po

403

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050mi2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050mi2a.htm" ,"Source:","Energy Information...

404

C:\\DS\\08-2225 - Final with Errata Page.wpd  

NLE Websites -- All DOE Office Websites (Extended Search)

per liter MgO magnesium oxide mi milemiles mi 2 square miles mL millilitermilliliters MOU memorandum of understanding mph miles per hour mrem milliremmillirem MRL method...

405

Screening SNPs residing in the microRNA-binding sites of Hepatocellular Carcinoma related genes  

Science Conference Proceedings (OSTI)

Single nucleotide polymorphisms located at miRNA-binding sites are likely to affect the expression of the miRNA targets and may contribute to the susceptibility of humans to common diseases. Here we selected 289 candidate Hepatocellular Carcinoma ...

Jun Ding; Yuzhen Gao; Yan He; Yifeng Zhou; Moli Huang; Haiyan Liu

2011-02-01T23:59:59.000Z

406

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

with battery state of charge below 90% (for charging events with SOC reported) Vehicle Usage Number of trips 3,364 Total distance traveled (mi) 21,706 Avg trip distance (mi) 5.8...

407

Many families of Caenorhabditis elegans microRNAs are not essential for development or viability  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are approximately 23 nt regulatory RNAs that posttranscriptionally inhibit the functions of protein-coding mRNAs. We previously found that most C. elegans miRNAs are individually not essential for ...

Alvarez-Saavedra, Ezequiel

408

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

Technical Publications website. The URA tracks the number of theses we produce each year. Power Outage News MI-65 October 25 Power will be off to the MI-65 service building and...

409

PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Chow, T. Edwin  

E-Print Network (OSTI)

a ; Michael E. Hodgson b a Department of Earth and Resource Science, University of Michigan--Flint, Flint, MI*{ and MICHAEL E. HODGSON{ {Department of Earth and Resource Science, University of Michigan--Flint, Flint, MI

Chow, Tzeekiu Edwin

410

GTdemo (.mw) - CECM  

E-Print Network (OSTI)

Algorithm: Backtracking (Branch & Bound) MaximumIndependentSet(G); NygiIiMiIiQiIiYiIiciIigiIzc= MaximumClique(G); NyUiIiMiIikiIio= ChromaticNumber( G...

411

Species Revision and Generic Systematics of World Rileyinae (Hymenoptera: Eurytomidae)  

E-Print Network (OSTI)

Woolley (9F TAMU); 23 mi. S. Trona, 13.v.1980, J. Woolley,Gates (2m UCR); 23 mi. S. Trona, 13.v.1980, J. Woolley (1m

Gates, Michael William

2008-01-01T23:59:59.000Z

412

PowerPoint Presentation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

law * Tech transfer and licensing Why do GIV and V2G make sense? Basic GIVV2G Math * US car used 1 hour day, parked 23 h d * Battery 100 mi, daily travel 30 mi, thus * Drive...

413

Modulation of Intestinal Micrornas by a Chemoprotective Diet  

E-Print Network (OSTI)

We have hypothesized that dietary modulation of intestinal miRNA expression may contribute to the chemoprotective effects of nutritional bioactives (fish oil and pectin). Using a rat colon carcinogen model, we determined miRNAs-let-7d, miR-15b, miR-107, miR-191 and miR-324-5p were modulated by fish oil + pectin. We also demonstrated that BACE1 and PTEN are targets of miR-107 and miR-21, respectively. To further elucidate the biological effects of diet and carcinogen on miRNAs, we integrated global miRNAs, total and polysomal gene expression datasets obtained from the above mentioned study and used four computational approaches. We demonstrated that polysomal profiling is tightly related to microRNA changes when compared with total mRNA profiling. In addition, diet and carcinogen exposure modulated a number of microRNAs and complementary gene expression analyses showed that oncogenic PTK2B, PDE4B, and TCF4 were suppressed by the chemoprotective diet at both the mRNA and protein levels. To determine the function of select diet and colon carcinogen modulated miRNAs and to validate their targets, we carried out a series of loss and gain of function experiments along with luciferase reporter assays. We verified that PDE4B and TCF4 are direct targets of miR-26b and miR-203, respectively. PTK2B was determined to be an indirect target of miR-19b. In addition, microRNA physiological function was assessed by examining effects on apoptosis and cell proliferation. To better understand how the colonic stem cell population responds to environmental factors such as diet and carcinogen, we investigated the chemoprotective effects of dietary agents on miRNAs in colonic stem cells obtained from Lgr5-EGFP-IRES-creERT2 knock in mice injected with AOM. We demonstrated that based on relative expression of miR-125a-5p, miR-190b and miR-191 in stem cells vs. daughter cells and differentiated cells, these miRNAs may be stem cell specific miRNAs. We also identified miR-21 to be significantly reduced in stem cells compared to differentiated cells and selectively modulated by these dietary agents in stem cells. In summary, our results indicate for the first time that fish oil plus pectin protect against colon tumorigenesis in part by modulating a subset of miRNAs and their target genes (mRNAs) implicated in the regulation of the colon stem cell niche and tumor development.

Shah, Manasvi 1984-

2012-12-01T23:59:59.000Z

414

Downhole oil/water separators offer lower costs and greater environmental protection  

Science Conference Proceedings (OSTI)

Produced water management can be a significant expense for oil and gas operators. This paper summarizes a study of the technical, economic, and regulatory feasibility of a relatively new technology, downhole oil/water separators (DOWS), to reduce the volume of water pumped to the surface. The study was funded by the US Department of Energy and conducted by Argonne National Laboratory, CH2M Hill, and the Nebraska Oil and Gas Conservation Commission. DOWS are devices that separate oil and gas from produced water at the bottom of the well and reinject some of the produced water into another formation or another horizon within the same formation, while the oil and gas are pumped to the surface. Since much of the produced water is not pumped to the surface, treated, and pumped from the surface back into a deep formation, the cost of handling produced water is greatly reduced. The oil production rate has increased for more than half of the DOWS installations to date.

Veil, J. A.

1999-11-02T23:59:59.000Z

415

Texas refiner optimizes by integrating units from idle plant  

SciTech Connect

In 1993, Phibro Energy USA Inc. purchased Dow Chemical Co.`s idle 200,000 b/d refinery at Freeport, TX. The Dow facility, known as the Oyster Creek refinery, was incapable of producing gasoline, and therefore was somewhat incomplete as a stand-alone refinery. By relocating and integrating units from the Dow plant with Phibro`s 130,700 b/d refinery at Texas City, TX, and adding a new residual oil solvent extraction (ROSE) unit, Phibro will optimize its Texas refinery operations. The dismantling, movement, and re-erection phases of the project are all but finished, and installation of piping and new instrumentation for the major relocated units is well under way. When the project is complete, Phibro will drastically reduce fuel oil production at Texas City and increase output of middle distillate. Resid, which the company now produces in excess, will be converted to a heavy fluid catalytic cracking (FCC) feedstock. Most of this stream will be fed to the oversized FCC unit at Phibro`s 71,000 b/d Houston refinery, thus eliminating Phibro`s reliance on purchased FCC feed. The paper discusses the Oyster Creek refinery, the decision to reduce residual fuel oil production company-wide, building versus moving equipment, dismantling and transport, construction, products, operational changes, utilities, process wastes, regulations, preparations, and future prospects. The remaining equipment at Oyster Creek was sold to a South Korean refinery.

Rhodes, A.K.

1995-03-20T23:59:59.000Z

416

Semiconductor Landing  

Science Conference Proceedings (OSTI)

Title Goes Here. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Sed malesuada accumsan mi, et adipiscing nunc varius quis. ...

2013-08-14T23:59:59.000Z

417

R 0 G RES S ASSOCIATE EDITORS  

E-Print Network (OSTI)

: Gole Mi" Myrtle Williomson. Deye Muey. Chris Moderl. led Row: Dr. Gron· yille Price. Deen Judd. Ed

O'Laughlin, Jay

418

Particulate matter chemistry and dynamics in the Twilight Zone at VERTIGO ALOHA and K2 Sites  

E-Print Network (OSTI)

Marine Chemistry 105, 208 Volk, T. , Hoffert, M.I. , 1985.Broecker and Peng, 1982; Volk and Hoffert, 1985; Armstrong

Bishop, James K.B.

2008-01-01T23:59:59.000Z

419

The export of carbon mediated by mesopelagic fishes in the northeast Pacific Ocean  

E-Print Network (OSTI)

Chapman and Hall, New York. Volk, T. , Hoffert, M.I. , 1985.the biological pump (Volk and Hoffert, 1985). The

Davison, Peter Charles

2011-01-01T23:59:59.000Z

420

I Cant Walk! Acute Thrombosis of Descending Aorta Causing Paraplegia  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, Michigan Supervising SectionWest Grand Boulevard, CFP-258, Detroit, MI 48202. Email:

Mitchell, Matthew Lee; Yucebey, Elif; Weaver, Mitchell R; Jaehne, A Kathrin; Rivers, Emanuel P

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Observation of a Narrow Charm-Strange Meson D A.V. Evdokimov,8  

E-Print Network (OSTI)

University of Iowa, Iowa City, IA 52242, USA 17 University of Michigan-Flint, Flint, MI 48502, USA 18

Akgun, Ugur

422

Preserving the U.S. Underground and Alternative Press of the 1960s and '70s: History, Prospects, and Microform Sources  

E-Print Network (OSTI)

Reporter, Washington, DC, 1985- , UMI Navajo Times, WindowWashington, DC Native Sun, Detroit, MI Navajo Times, Window

Tsang, Daniel C

1993-01-01T23:59:59.000Z

423

Materials Technology @ TMS  

Science Conference Proceedings (OSTI)

... MI; Elizabeth Holm, Carnegie Mellon University, Pittsburgh, PA; Peter Gumbsch, Fraunhofer Institute for Mechanics of Materials IWM, Freiburg, Germany.

424

2012 Proceedings of the Performance Metrics for Intelligent ...  

Science Conference Proceedings (OSTI)

Page 1. NIST Special Publication 1136 2012 Proceedings of the Performance Metrics for Intelligent Systems (PerMI '12) Workshop ...

2012-11-19T23:59:59.000Z

425

The FASEB Journal Research Communication Structure-function analysis of human l-prostaglandin D  

E-Print Network (OSTI)

the commercially available PGD2-MOX ELISA kit (Cay- man Chemicals, Ann Arbor, MI, USA). One unit of enzyme activity

Zhijie, Liu

426

PNIC*F.F2a U.S. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sciences STATE: MI PROJECT TITLE : Manufacturing Industrial Development for the Alternative Energy Systems Funding Opportunity Announcement Number Procurement Instrument...

427

Au  

Science Conference Proceedings (OSTI)

... the permission of GJ Ackland and MI Mendelev. These potentials are not designed for simulations of radiation damage. ...

2013-07-06T23:59:59.000Z

428

Project Brief: Michigan Aerospace Corporation  

Science Conference Proceedings (OSTI)

... RECIPIENT: Michigan Aerospace Corporation, Ann Arbor, MI. Project duration: 3 Years; Total NIST Funding: $1,499,463. ...

2010-10-05T23:59:59.000Z

429

Mark Iadicola  

Science Conference Proceedings (OSTI)

... 2002-2003 Postdoctoral Research Fellow University of Michigan, Ann Arbor, MI. 1996-2002 University of Michigan, Ann ...

2012-10-01T23:59:59.000Z

430

California Cuckoo Wasps in the Family Chrysididae (Hymenoptera)  

E-Print Network (OSTI)

Panamint Springs; 13 mi. n Trona; Lone Pine; Death Valley;San Bernardino Co. : Trona. Map 89. California distribution

Kimsey, Lynn S.

2006-01-01T23:59:59.000Z

431

Available Technologies: Long-term Growth of Finite Life ...  

APPLICATIONS OF TECHNOLOGY: Examine carcinogenesis, aging, expression of genes, proteins and miRNA, signaling pathways, epigenetics, and genomic ...

432

U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI : 140 : 2011-2013: Marysville, MI: 176 : 1,080: 14 : 2011-2013: St. Clair, MI: 1,562: 1,422: 2 : 26 : 2011-2013: Noyes, MN: 13,380: 14,460: 20,624: 33,889 ...

433

U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 3.80 : 4.50 : 2011-2013: Marysville, MI: 3.63: 3.65 : 4.57: 4.70 : 2011-2013: St. Clair, MI: 3.75: 3.67: 4.09: 4.41 : 4.35: 2011-2013: Noyes, MN: 3.74: 3 ...

434

U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 22,904: 27,220: 43,980: 44,275: 43,690: 50,347: 1996-2011: Marysville, MI: 9,158: 8,756: 14,925: 22,198: 41,964: 42,866: 1996-2011: Sault Ste. Marie, MI ...

435

U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 8.28: 6.58: 4.53: 8.37: 5.17 : 1996-2011: Marysville, MI: 7.59: 8.59: 3.80: 4.44: 4.42: 2.99: 1996-2012: St. Clair, MI: 6.97: 10.03: 5.10: 4.97: 4.29: 2 ...

436

U.S. Price of Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 6.88: 8.37: 4.01: 4.69: 4.26: 3.10: 1996-2012: Marysville, MI: 7.77: 7.48: 4.85: 4.87: 4.48: 3.18: 1996-2012: Sault Ste. Marie, MI: 7.13: 8.75: 5.04: 5 ...

437

Brief communication: Genome-wide computational identification of microRNAs and their targets in the deep-branching eukaryote Giardialamblia  

Science Conference Proceedings (OSTI)

Using a combined computational program, we identified 50 potential microRNAs (miRNAs) in Giardia lamblia, one of the most primitive unicellular eukaryotes. These miRNAs are unique to G. lamblia and no homologues have been found in other organisms; miRNAs, ... Keywords: CDS, Computational, EST, Gene regulation, Giardia lamblia, MicroRNA, UTR, VSPs

Yan-Qiong Zhang; Dong-Liang Chen; Hai-Feng Tian; Bao-Hong Zhang; Jian-Fan Wen

2009-10-01T23:59:59.000Z

438

July 2009 NW Michigan Regional Fruit Grower Newsletter CALENDER OF EVENTS  

E-Print Network (OSTI)

Basket Sparta, MI 7/10 Grape IPM Update L. Mawby's Tasting Room 7/13 Canola Research 2009 Plot Days Central Lake, MI 7/14 Canola Research 2009 Plot Days Marion, MI 7/16 Backyard Chicken Production Workshop

439

Historical Material Analysis of DC745U Pressure Pads  

SciTech Connect

As part of the Enhance Surveillance mission, it is the goal to provide suitable lifetime assessment of stockpile materials. This report is an accumulation of historical publication on the DC745U material and their findings. It is the intention that the B61 LEP program uses this collection of data to further develop their understanding and potential areas of study. DC745U is a commercially available silicone elastomer consisting of dimethyl, methyl-phenyl, and methyl-vinyl siloxane repeat units. Originally, this material was manufactured by Dow Corning as Silastic{reg_sign} DC745U at their manufacturing facility in Kendallville, IN. Recently, Dow Corning shifted this material to the Xiameter{reg_sign} brand product line. Currently, DC745U is available through Xiameter{reg_sign} or Dow Corning's distributor R. D. Abbott Company. DC745U is cured using 0.5 wt% vinyl-specific peroxide curing agent known as Luperox 101 or Varox DBPH-50. This silicone elastomer is used in numerous parts, including two major components (outer pressure pads and aft cap support) in the W80 and as pressure pads on the B61. DC745U is a proprietary formulation, thus Dow Corning provides limited information on its composition and properties. Based on past experience with Dow Corning, DC745U is at risk of formulation changes without notification to the costumer. A formulation change for DC745U may have a significant impact because the network structure is a key variable in determining material properties. The purpose of this report is to provide an overview of historical DC745U studies and identify gaps that need to be addressed in future work. Some of the previous studies include the following: 1. Spectroscopic characterization of raw gum stock. 2. Spectroscopic, thermal, and mechanical studies on cured DC745U. 3. Nuclear Magnetic Resonance (NMR) and solvent swelling studies on DC745U with different crosslink densities. 4. NMR, solvent swelling, thermal, and mechanical studies on thermally aged DC745U. 5. NMR, solvent swelling, thermal, and mechanical studies on radiolytically aged DC745U. Each area is reviewed and further work is suggested to improve our understanding of DC745U for systems engineering, surveillance, aging assessments, and lifetime assessment.

Ortiz-Acosta, Denisse [Los Alamos National Laboratory

2012-07-30T23:59:59.000Z

440

WABASH RIVER INTEGRATED METHANOL AND POWER PRODUCTION FROM CLEAN COAL TECHNOLOGIES (IMPPCCT)  

DOE Green Energy (OSTI)

The Wabash River Integrated Methanol and Power Production from Clean Coal Technologies (IMPPCCT) project is evaluating integrated electrical power generation and methanol production through clean coal technologies. The project is conducted by a multi-industry team lead by Gasification Engineering Corporation (GEC), a company of Global Energy Inc., and supported by Air Products and Chemicals, Inc., Dow Chemical Company, Dow Corning Corporation, Methanex Corporation, and Siemens Westinghouse Power Corporation. Three project phases are planned for execution over a three year period, including: (1) Feasibility study and conceptual design for an integrated demonstration facility, and for fence-line commercial embodiment plants (CEP) operated at Dow Chemical or Dow Corning chemical plant locations (2) Research, development, and testing to define any technology gaps or critical design and integration issues (3) Engineering design and financing plan to install an integrated commercial demonstration facility at the existing Wabash River Energy Limited (WREL) plant in West Terre Haute, Indiana. The WREL facility is a project selected and co-funded under the Round IV of the U.S. Department of Energy's (DOE's) Clean Coal Technology Program. In this project, coal and/or other solid fuel feedstocks are gasified in an oxygen-blown, entrained-flow gasifier with continuous slag removal and a dry particulate removal system. The resulting product synthesis gas is used to fuel a combustion turbine generator whose exhaust is integrated with a heat recovery steam generator to drive a refurbished steam turbine generator. The gasifier uses technology initially developed by The Dow Chemical Company (the Destec Gasification Process), and now offered commercially by Global Energy, Inc., as the E-GAS{trademark} technology. In a joint effort with the DOE, a Cooperative Agreement was awarded under the Early Entrance Coproduction Plant (EECP) solicitation. GEC and an Industrial Consortium are investigating the use of synthesis gas produced by the E-GAS{trademark} technology in a coproduction environment to enhance the efficiency and productivity of solid fuel gasification combined cycle power plants. During the reporting period, various methods to remove low-level contaminants for the synthesis gas were reviewed. In addition, there was a transition of the project personnel for GEC which has slowed the production of the outstanding project reports.

Gary Harmond; Albert Tsang

2003-03-14T23:59:59.000Z

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

WABASH RIVER INTEGRATED METHANOL AND POWER PRODUCTION FROM CLEAN COAL TECHNOLOGIES (IMPPCCT)  

DOE Green Energy (OSTI)

The Wabash River Integrated Methanol and Power Production from Clean Coal Technologies (IMPPCCT) project is evaluating integrated electrical power generation and methanol production through clean coal technologies. The project is conducted by a multi-industry team lead previously by Gasification Engineering Corporation (GEC). The project is now under the leadership of ConocoPhillips Company (COP) after it acquired GEC and the E-Gas{trademark} gasification technology from Global Energy in July 2003. The Phase I of this project was supported by Air Products and Chemicals, Inc., Dow Chemical Company, Dow Corning Corporation, Methanex Corporation, and Siemens Westinghouse Power Corporation, while the Phase II is supported by Gas Technology Institute, TDA Research, Inc., and Nucon International, Inc. The two project phases planned for execution include: (1) Feasibility study and conceptual design for an integrated demonstration facility at Global Energy's existing Wabash River Energy Limited (WREL) plant in West Terre Haute, Indiana, and for a fence-line commercial embodiment plants (CEP) operated at Dow Chemical or Dow Corning chemical plant locations (2) Research, development, and testing (RD&T) to define any technology gaps or critical design and integration issues. The WREL facility was designed, constructed, and operated under a project selected and co-funded under the Round IV of the United States Department of Energy's (DOE's) Clean Coal Technology Program. In this project, coal and/or other solid fuel feedstocks are gasified in an oxygen-blown, entrained-flow gasifier with continuous slag removal and a dry particulate removal system. The resulting product synthesis gas is used to fuel a combustion turbine generator whose exhaust is integrated with a heat recovery steam generator to drive a refurbished steam turbine generator. The gasifier uses technology initially developed by The Dow Chemical Company (the Destec Gasification Process), and now acquired and offered commercially by COP as the E-GAS{trademark} technology. In a joint effort with the DOE, a Cooperative Agreement was awarded under the Early Entrance Coproduction Plant (EECP) solicitation. GEC, and now COP and the industrial partners are investigating the use of synthesis gas produced by the E-GAS{trademark} technology in a coproduction environment to enhance the efficiency and productivity of solid fuel gasification combined cycle power plants. The objectives of this effort are to determine the feasibility of an EECP located at a specific site which produces some combination of electric power (or heat), fuels, and/or chemicals from synthesis gas derived from coal, or, coal in combination with some other carbonaceous feedstock. The project's intended result is to provide the necessary technical, economic, and environmental information that will be needed to move the EECP forward to detailed design, construction, and operation by industry.

Thomas Lynch

2004-01-07T23:59:59.000Z

442

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Usage Usage Overall fuel economy (mpg) 139 Overall electrical energy consumption (AC Wh/mi) 293 Number of trips¹ 76,425 Total distance traveled (mi) 609,737 Avg trip distance (mi) 8.0 Avg distance traveled per day when the vehicle was driven (mi) 36.4 Avg number of trips between charging events 3.0 Avg distance traveled between charging events (mi) 24.1 Avg number of charging events per day when the vehicle was driven 1.5

443

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

6 6 Overall AC electrical energy consumption (AC Wh/mi) 175 Average Trip Distance 12.2 Total distance traveled (mi) 272,366 Average Ambient Temperature (deg F) 54.1 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 368 Distance traveled (mi) 129,389 Percent of total distance traveled 47.5% Average driving style efficiency (distance weighted)¹ 75% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.0 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 142,977 Percent of total distance traveled 52.4% Average driving style efficiency (distance weighted)¹ 77% City³ Highway³ Percent of miles in EV operation (%) 65.1% 31.1% Percent Number of trips 85.5% 14.5% Average trip distance (mi)

444

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

45 45 Overall DC electrical energy consumption (DC Wh/mi)² 29 Total number of trips 1,839 Total distance traveled (mi) 21,089 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 61 Number of trips 654 Percent of trips city | highway 66% | 34% Distance traveled (mi) 5,717 Percent of total distance traveled 27% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 38 DC electrical energy consumption (DC Wh/mi) 57 Number of trips 117 Percent of trips city | highway 39% | 62% Distance traveled (mi) 3,683 Percent of total distance traveled 17% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 33 Number of trips 1,068 Percent of trips city | highway 71% | 30% Distance traveled (mi)

445

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

4.8 4.8 Overall AC electrical energy consumption (AC Wh/mi) 185 Average Trip Distance 13.1 Total distance traveled (mi) 208,165 Average Ambient Temperature (deg F) 77.6 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 369 Distance traveled (mi) 104,687 Percent of total distance traveled 50.3% Average driving style efficiency (distance weighted)¹ 87% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 37.2 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 103,478 Percent of total distance traveled 49.7% Average driving style efficiency (distance weighted)¹ 82% City³ Highway³ Percent of miles in EV operation (%) 69.8% 33.9% Percent Number of trips 85.0% 15.0% Average trip distance (mi)

446

Microsoft PowerPoint - Junior_ONR  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mi Mi it S i I tit ti (MSI ) Minority Serving Institutions (MSIs): Bridging the Gap between Federal g g p Agencies and MSIs Dr. Anthony Junior, Program Manager Naval Historically Black Colleges and University/Minority Institutions Program Office of Naval Research 874 North Randolph Street, Arlington, VA 22203 anthony.junior@navy.mil AVJ HBCU/MI SP Concepts V2 Agenda * The Requirement The Requirement * The Strategic Plan * HBCU/MI Full Engagement Model HBCU/MI Full Engagement Model * STEM Research Pipeline * HBCU/MI Accredited Engineering Schools * HBCU/MI Accredited Engineering Schools 2 10 USC 2362 Objective: Enhance defense-related research and education at HBCU/MIs to assist the Department in education at HBCU/MIs to assist the Department in defense-related research, development, testing, and

447

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

2.5 2.5 Overall AC electrical energy consumption (AC Wh/mi) 166 Average Trip Distance 12.1 Total distance traveled (mi) 385,849 Average Ambient Temperature (deg F) 78.2 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 332 Distance traveled (mi) 193,336 Percent of total distance traveled 50.1% Average driving style efficiency (distance weighted)¹ 85% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.2 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 192,512 Percent of total distance traveled 49.9% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 67.2% 31.5% Percent Number of trips 86.7% 13.3% Average trip distance (mi)

448

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

36 36 Overall DC electrical energy consumption (DC Wh/mi)² 18 Total number of trips 1,290 Total distance traveled (mi) 13,023 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 58 Number of trips 432 Percent of trips city | highway 75% | 25% Distance traveled (mi) 2,835 Percent of total distance traveled 22% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 41 DC electrical energy consumption (DC Wh/mi) 48 Number of trips 52 Percent of trips city | highway 31% | 69% Distance traveled (mi) 1,613 Percent of total distance traveled 12% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips 806 Percent of trips city | highway 73% | 27% Distance traveled (mi)

449

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

7.8 7.8 Overall AC electrical energy consumption (AC Wh/mi) 180 Average Trip Distance 12.8 Total distance traveled (mi) 346,409 Average Ambient Temperature (deg F) 51.5 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 384 Distance traveled (mi) 161,982 Percent of total distance traveled 46.8% Average driving style efficiency (distance weighted)¹ 74% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.1 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 184,427 Percent of total distance traveled 53.2% Average driving style efficiency (distance weighted)¹ 76% City³ Highway³ Percent of miles in EV operation (%) 63.8% 28.4% Percent Number of trips 85.7% 14.3% Average trip distance (mi)

450

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

49 49 Overall DC electrical energy consumption (DC Wh/mi)² 27 Total number of trips 927 Total distance traveled (mi) 9,301 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 66 Number of trips 313 Percent of trips city | highway 68% | 32% Distance traveled (mi) 2,138 Percent of total distance traveled 23% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 41 DC electrical energy consumption (DC Wh/mi) 63 Number of trips 46 Percent of trips city | highway 30% | 70% Distance traveled (mi) 1,462 Percent of total distance traveled 16% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips 568 Percent of trips city | highway 75% | 25% Distance traveled (mi)

451

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 Overall AC electrical energy consumption (AC Wh/mi)¹ 148 Overall DC electrical energy consumption (DC Wh/mi)² 104 Total number of trips 1,212 Total distance traveled (mi) 11,846 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 58 DC electrical energy consumption (DC Wh/mi) 160 Number of trips 823 Percent of trips city | highway 81% | 19% Distance traveled (mi) 5,559 Percent of total distance traveled 47% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 46 DC electrical energy consumption (DC Wh/mi) 85 Number of trips 195 Percent of trips city | highway 40% | 61% Distance traveled (mi) 4,217 Percent of total distance traveled 36% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips

452

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Overall AC electrical energy consumption (AC Wh/mi) 174 Average Trip Distance 12.6 Total distance traveled (mi) 1,243,988 Average Ambient Temperature (deg F) 63.2 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 352 Distance traveled (mi) 615,161 Percent of total distance traveled 49.5% Average driving style efficiency (distance weighted)¹ 80% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.4 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 628,828 Percent of total distance traveled 50.5% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.8% 31.7% Percent Number of trips 85.5% 14.5% Average trip distance (mi)

453

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

50 50 Overall DC electrical energy consumption (DC Wh/mi)² 22 Total number of trips 730 Total distance traveled (mi) 9,164 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 40 DC electrical energy consumption (DC Wh/mi) 61 Number of trips 225 Percent of trips city | highway 68% | 32% Distance traveled (mi) 1,768 Percent of total distance traveled 19% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 36 DC electrical energy consumption (DC Wh/mi) 53 Number of trips 40 Percent of trips city | highway 23% | 78% Distance traveled (mi) 1,638 Percent of total distance traveled 18% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 35 Number of trips 465 Percent of trips city | highway 70% | 30% Distance traveled (mi)

454

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

71.0 71.0 Overall AC electrical energy consumption (AC Wh/mi) 169 Average Trip Distance 12.5 Total distance traveled (mi) 1,661,080 Average Ambient Temperature (deg F) 67.1 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 340 Distance traveled (mi) 826,775 Percent of total distance traveled 49.8% Average driving style efficiency (distance weighted)¹ 81% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.7 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 834,306 Percent of total distance traveled 50.2% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.9% 31.6% Percent Number of trips 85.8% 14.2% Average trip distance (mi)

455

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi) 170 Average Trip Distance 12.4 Total distance traveled (mi) 2,041,556 Average Ambient Temperature (deg F) 64.4 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 345 Distance traveled (mi) 1,002,495 Percent of total distance traveled 49.1% Average driving style efficiency (distance weighted)¹ 80% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 1,039,061 Percent of total distance traveled 50.9% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.2% 31.0% Percent Number of trips 86.0% 14.0% Average trip distance (mi)

456

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

1.1 1.1 Overall AC electrical energy consumption (AC Wh/mi) 182 Average Trip Distance 11.8 Total distance traveled (mi) 355,058 Average Ambient Temperature (deg F) 46.0 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 416 Distance traveled (mi) 155,080 Percent of total distance traveled 43.7% Average driving style efficiency (distance weighted)¹ 69% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 34.4 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 199,978 Percent of total distance traveled 56.3% Average driving style efficiency (distance weighted)¹ 74% City³ Highway³ Percent of miles in EV operation (%) 60.5% 27.0% Percent Number of trips 86.3% 13.7% Average trip distance (mi)

457

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

53 53 Overall DC electrical energy consumption (DC Wh/mi)² 34 Total number of trips 1,515 Total distance traveled (mi) 15,617 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 37 DC electrical energy consumption (DC Wh/mi) 65 Number of trips 739 Percent of trips city | highway 74% | 26% Distance traveled (mi) 4,915 Percent of total distance traveled 31% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 38 DC electrical energy consumption (DC Wh/mi) 58 Number of trips 93 Percent of trips city | highway 38% | 62% Distance traveled (mi) 2,842 Percent of total distance traveled 18% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 33 Number of trips 683 Percent of trips city | highway 72% | 28% Distance traveled (mi)

458

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

6.6 6.6 Overall AC electrical energy consumption (AC Wh/mi) 171 Average Trip Distance 11.9 Total distance traveled (mi) 370,316 Average Ambient Temperature (deg F) 53.8 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 371 Distance traveled (mi) 170,860 Percent of total distance traveled 46.1% Average driving style efficiency (distance weighted)¹ 75% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 199,456 Percent of total distance traveled 53.9% Average driving style efficiency (distance weighted)¹ 77% City³ Highway³ Percent of miles in EV operation (%) 63.2% 28.1% Percent Number of trips 86.7% 13.3% Average trip distance (mi)

459

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi) 157 Average Trip Distance 12.3 Total distance traveled (mi) 407,245 Average Ambient Temperature (deg F) 67.9 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 338 Distance traveled (mi) 189,426 Percent of total distance traveled 46.5% Average driving style efficiency (distance weighted)¹ 82% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.5 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 217,819 Percent of total distance traveled 53.5% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 65.2% 28.3% Percent Number of trips 86.5% 13.5% Average trip distance (mi)

460

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

73.7 73.7 Overall AC electrical energy consumption (AC Wh/mi) 170 Average Trip Distance 12.6 Total distance traveled (mi) 370,987 Average Ambient Temperature (deg F) 71.0 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 341 Distance traveled (mi) 185,282 Percent of total distance traveled 49.9% Average driving style efficiency (distance weighted)¹ 83% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 185,705 Percent of total distance traveled 50.1% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 68.0% 32.4% Percent Number of trips 85.4% 14.6% Average trip distance (mi)

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Organizational Sustainability | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Services » Outreach & Collaboration » Organizational Services » Outreach & Collaboration » Organizational Sustainability Organizational Sustainability About Organizational Sustainability Sustainability - a recognized business approach The Department of Energy's (DOE's) Office of Health, Safety and Security (HSS) is researching the concept of sustainability as one part of its efforts to ensure the Department's continuing effectiveness in reliably achieving its mission in an increasingly global and diverse business climate. Sustainability allows senior executives to capture a full and integrated view of diverse and complex organizations factoring in the economic, safety, environmental, and social needs. The relevance of sustainability is reflected in various manifestations in corporate business. For example, Dow Jones recognizes sustainability as an investable

462

arch layout 11.21.98  

NLE Websites -- All DOE Office Websites (Extended Search)

Production Readiness Production Readiness Weprogressed towardmarketadoptionby developing, build- ing and testing prototype systems using numerical simula- tion tools andfield tests,by working with industry andmanu- facturing partners, and by demonstrating the technologies in full-scalecommercialbuildings. Thisprovidedabroad,highly defensible record of documented performance. Prototypeswere developed in cooperationwith industrypart- ners to speed commercializationand to work out market bar- riers to full-scaleadoption.Industrypartners in glazing, win- dow systems, shading systems, controls hardware and light- ing were solicited to participate. Feedback through trade as- sociations, conferences and industry associations helped to identify potential obstaclessuch asdifficulties with cross-dis-

463

New Cool Roof Coatings and Affordable Cool Color Asphalt  

NLE Websites -- All DOE Office Websites (Extended Search)

New Cool Roof Coatings and New Cool Roof Coatings and Affordable Cool Color Asphalt Shingles Meng-Dawn Cheng Oak Ridge National Laboratory chengmd@ornl.gov; 865-241-5918 April 4, 2013 PM: Andre Desjarlais PI: Meng-Dawn Cheng, Ph.D. David Graham, Ph.D. Sue Carroll Steve Allman Dawn Klingeman Susan Pfiffner, Ph.D. (FY12) Karen Cheng (FY12) Partner: Joe Rokowski (Dow) Roof Testing Facility at ORNL Building Technologies Research and Integration Center 2 | Building Technologies Office eere.energy.gov * Building accounted for 41% of the US energy consumption in 2010 greater than either transportation (28%) or industry (31%).

464

Emerging Energy-efficiency and Carbon Dioxide Emissions-reduction Technologies  

NLE Websites -- All DOE Office Websites (Extended Search)

Emerging Energy-efficiency and Carbon Dioxide Emissions-reduction Technologies for the Iron and Steel Industry Ali Hasanbeigi, Lynn Price China Energy Group Energy Analysis and Environmental Impacts Department Environmental Energy Technologies Division Lawrence Berkeley National Laboratory Marlene Arens Fraunhofer Institute for Systems and Innovation Research (ISI) January 2013 This work was supported by the China Sustainable Energy Program of the Energy Foundation and Dow Chemical Company (through a charitable contribution) through the Department of Energy under contract No.DE- AC02-05CH11231. ERNEST ORLANDO LAWRENCE BERKELEY NATIONAL LABORATORY LBNL-6106E ii Disclaimer This document was prepared as an account of work sponsored by the United States

465

New Cool Roof Coatings and Affordable Cool Color Asphalt  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

New Cool Roof Coatings and New Cool Roof Coatings and Affordable Cool Color Asphalt Shingles Meng-Dawn Cheng Oak Ridge National Laboratory chengmd@ornl.gov; 865-241-5918 April 4, 2013 PM: Andre Desjarlais PI: Meng-Dawn Cheng, Ph.D. David Graham, Ph.D. Sue Carroll Steve Allman Dawn Klingeman Susan Pfiffner, Ph.D. (FY12) Karen Cheng (FY12) Partner: Joe Rokowski (Dow) Roof Testing Facility at ORNL Building Technologies Research and Integration Center 2 | Building Technologies Office eere.energy.gov * Building accounted for 41% of the US energy consumption in 2010 greater than either transportation (28%) or industry (31%).

466

Superior Energy Performance: A Roadmap for Achieving Continual Improvements in Energy Performance  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Superior Energy Performance: Superior Energy Performance: A Roadmap for Achieving Continual Improvements in Energy Performance March 4, 2010 Joe Almaguer Dow Chemical Paul Scheihing U.S. Department of Energy Agenda: * Superior Energy Performance Overview * Program Design * Program Status and Moving Forward Superior Energy Performance What is Superior Energy Performance? A market-based, ANSI-accredited plant certification program that provides industrial facilities with a roadmap for achieving continual improvement in energy efficiency while boosting competitiveness. Goals: * Drive continual improvement in energy intensity * Develop a transparent system to validate energy intensity improvements and management practices * Encourage broad participation

467

Advanced Combustion Diagnostics and Control for Furnaces, Fired Heaters and Boilers  

SciTech Connect

The objective of this project was to develop and apply enabling tools and methods towards advanced combustion diagnostics and control of fired-equipment in large-scale petrochemical manufacturing. There are a number of technology gaps and opportunities for combustion optimization, including technologies involving advanced in-situ measurements, modeling, and thermal imaging. These technologies intersect most of manufacturing and energy systems within the chemical industry. This project leveraged the success of a previous DOE funded project led by Dow, where we co-developed an in-situ tunable diode laser (TDL) analyzer platform (with Analytical Specialties Inc, now owned by Yokogawa Electric Corp.). The TDL platform has been tested and proven in a number of combustion processes within Dow and outside of Dow. The primary focus of this project was on combustion diagnostics and control applied towards furnaces, fired heaters and boilers. Special emphasis was placed on the development and application of in-situ measurements for O2, CO and methane since these combustion gases are key variables in optimizing and controlling combustion processes safely. Current best practice in the industry relies on measurements that suffer from serious performance gaps such as limited sampling volume (point measurements), poor precision and accuracy, and poor reliability. Phase I of the project addressed these gaps by adding improved measurement capabilities such as CO and methane (ppm analysis at combustion zone temperatures) as well as improved optics to maintain alignment over path lengths up to 30 meters. Proof-of-concept was demonstrated on a modern olefins furnace located at Dow Chemical's facility in Freeport TX where the improved measurements were compared side-by-side to accepted best practice techniques (zirconium oxide and catalytic bead or thick film sensors). After developing and installing the improved combustion measurements (O2, CO, and methane), we also demonstrated the ability to improve control of an olefins furnace (via CO-trim) that resulted in significant energy savings and lower emissions such as NOx and other greenhouse gases. The cost to retrofit measurements on an existing olefins furnace was found to be very attractive, with an estimated payback achieved in 4 months or less.

Tate, J. D.; Le, Linh D.; Knittel,Trevor; Cowie, Alan

2010-03-20T23:59:59.000Z

468

Advanced Combustion Diagnostics and Control for Furnaces, Fired Heaters and Boilers  

SciTech Connect

The objective of this project was to develop and apply enabling tools and methods towards advanced combustion diagnostics and control of fired-equipment in large-scale petrochemical manufacturing. There are a number of technology gaps and opportunities for combustion optimization, including technologies involving advanced in-situ measurements, modeling, and thermal imaging. These technologies intersect most of manufacturing and energy systems within the chemical industry. This project leveraged the success of a previous DOE funded project led by Dow, where we co-developed an in-situ tunable diode laser (TDL) analyzer platform (with Analytical Specialties Inc, now owned by Yokogawa Electric Corp.). The TDL platform has been tested and proven in a number of combustion processes within Dow and outside of Dow. The primary focus of this project was on combustion diagnostics and control applied towards furnaces, fired heaters and boilers. Special emphasis was placed on the development and application of in-situ measurements for O2, CO and methane since these combustion gases are key variables in optimizing and controlling combustion processes safely. Current best practice in the industry relies on measurements that suffer from serious performance gaps such as limited sampling volume (point measurements), poor precision and accuracy, and poor reliability. Phase I of the project addressed these gaps by adding improved measurement capabilities such as CO and methane (ppm analysis at combustion zone temperatures) as well as improved optics to maintain alignment over path lengths up to 30 meters. Proof-of-concept was demonstrated on a modern olefins furnace located at Dow Chemical's facility in Freeport TX where the improved measurements were compared side-by-side to accepted best practice techniques (zirconium oxide and catalytic bead or thick film sensors). After developing and installing the improved combustion measurements (O2, CO, and methane), we also demonstrated the ability to improve control of an olefins furnace (via CO-trim) that resulted in significant energy savings and lower emissions such as NOx and other greenhouse gases. The cost to retrofit measurements on an existing olefins furnace was found to be very attractive, with an estimated payback achieved in 4 months or less.

Tate, J. D.; Le, Linh D.; Knittel,Trevor; Cowie, Alan

2010-03-20T23:59:59.000Z

469

KCP Activities Supporting the W76LEP Stress Cushions and LK3626 RTV Replacement Material Development  

SciTech Connect

The S-5370 RTV blown foam previously produced by Dow Corning is no longer commercially available. The S-5370 material has been used on all of Los Alamos National Laboratory (LANL) programs to manufacture Stress Cushions up through the W88. The Kansas City Plant (KCP) did not have a sufficient supply of S-5370 material to cover the schedule requirements for the Program. This report provides information on the numerous activities conducted at KCP involving the development of the Program Stress Cushion and replacement RTV material.

J. W. Schneider

2009-10-01T23:59:59.000Z

470

Safety analysis report for packaging: the ORNL DOT specification 6M - special form package  

SciTech Connect

The ORNL DOT Specification 6M - Special Form Package was fabricated at the Oak Ridge Nation al Laboratory (ORNL) for the transport of Type B solid non-fissile radioactive materials in special form. The package was evaluated on the basis of tests performed by the Dow Chemical Company, Rocky Flats Division, on the DOT-6M container and special form tests performed on a variety of stainless steel capsules at ORNL by Operations Division personnel. The results of these evaluations demonstrate that the package is in compliance with the applicable regulations for the transport of Type B quantities in special form of non-fissile radioactive materials.

Schaich, R.W.

1982-07-01T23:59:59.000Z

471

Deep frac activity breaks records in Rockies  

SciTech Connect

Record depths and extent of massive hydraulic fracture treatments have been reported in central Wyoming recently. Dowell Division of Dow Chemical Co. pumped 250,000 lb of bauxite through 24 perforations between 18,970 and 19,253 ft near Lysite, and Halliburton Services forced 110,140 lb of bauxite through a set of perforations between 20,064 and 20,100 ft in the Madden Gas Field. Dowell also treated another Madden Field well with 340,000 lb of bauxite between 20,031 and 20,099 ft. The Dowell treatments utilized the new YF400 frac fluid to deal with static bottom-hole temperatures.

Not Available

1980-07-01T23:59:59.000Z

472

Revue dEtudes Tibtaines  

E-Print Network (OSTI)

. Moscou : Nauka. Zhang Yisun 1993. Bod rgya tshig mdzod chen mo, Pkin : Mi rigs dpe skrun khang LA ROCA BLANCA DE LHANG LHANG Un santuario en Nyag rong Oriol Aguilar En Tbet, el Pas de las Nieves, en el centro de... mi nyag pa en el Nyag rong, procedentes del norte. La predominancia del dialecto mi nyag habra cambiado el antiguo nombre del rea, que era Brag dmar, en Rag dmar8. Tambin facilita los nombres de los diversos centros religiosos desde tiempos...

Achard, Jean-Luc

2007-01-01T23:59:59.000Z

473

microRNA: human disease and development  

Science Conference Proceedings (OSTI)

microRNAs or miRNAs are an abundant class of highly conversed, small non-coding RNAs that present an entirely new theme of post-transcriptional gene regulation. miRNAs play a key role in diverse biological systems, such as virology, embryogenesis, ... Keywords: bioinformatics, biomarkers, cancer, eukaryotes, gene regulation, immune system development, immune system response, immunity regulation, metabolic pathways, miRNAs, microRNA expression, stem cells, target predictions

Virendra S. Gomase; Akshay N. Parundekar

2009-09-01T23:59:59.000Z

474

www.eia.gov  

U.S. Energy Information Administration (EIA)

Pilgrim Nuclear Power Station Massachusetts Total MD Calvert Cliffs Nuclear Power Plant Maryland Total MI Fermi Donald C Cook Michigan Total MN Prairie Island ...

475

Materials Week '97: Wednesday AM Session  

Science Conference Proceedings (OSTI)

... MI 48104; Gordon Geiger, Qualitech Steel Corporation, 301 Merchant Bank .... hardness and impact energy are reported during austempering at 400, 375,...

476

CNST Group Seminars - 2008  

Science Conference Proceedings (OSTI)

... Joshua Hihath Arizona State University. ... electrostatic potential in high spatial and energy resolutions, and ... MI is a four-wave-mixing (FWM) process ...

2013-05-07T23:59:59.000Z

477

Ecosystem dynamics of the Aleutian Islands.  

E-Print Network (OSTI)

??Located between Asia and America and extending over a 1,000 mi., the Aleutian Islands have commonly been studied in a partial or fragmented manner. This (more)

Ortiz, Ivonne

2007-01-01T23:59:59.000Z

478

Molecular characterization of animal microRNAs : sequence, expression, and stability  

E-Print Network (OSTI)

(cont.) miRNAs. These cells lines may also be useful for other functional studies, such as validation of putative mRNA target genes.

Lau, Nelson C., 1978-

2004-01-01T23:59:59.000Z

479

fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny

480

Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

Bay Controls, LLC Ford Motor Company 6528 Weatherfield Ct. 550 Town Center Dr., Ste 200 Maumee, OH 43537 Dearborn, MI 48126 Business: Air Compressor Controls Business: Automotive...

Note: This page contains sample records for the topic "dow kokam mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

La Roca Blanca de Lhang lhang - Un santuario en Nyag rong  

E-Print Network (OSTI)

de Rag dmar, debido a la progresiva influencia a lo largo de los siglos de la emigracin de poblacin mi nyag pa en el Nyag rong, procedentes del norte. La predominancia del dialecto mi nyag habra cambiado el antiguo nombre del rea, que era Brag... mi nyag pa shar dang lho phyogs su phos mthus mi nyag log skad da ltaang lus yod pa de sa gnas dir rag dmar go zer ba ni brag dmar go zer ba yin/ La Roca Blanca de Lhang lhang 15 masculina(dbon brgyud) 9 . Muchos de estos centros religiosos...

Aguillar, Oriol

2007-01-01T23:59:59.000Z

482

Past Chairmen of the Conference  

Science Conference Proceedings (OSTI)

... 73rd 1988 Grand Rapids, MI D. Guensler, CA 74th 1989 Seattle, WA J. Bartfai, NY 75th 1990 Washington, DC F. Gerk, NM ...

2013-07-08T23:59:59.000Z

483

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- 07312013 Midland, MI CONTRIBUTING TO NET ZERO BUILDING: HIGH ENERGY EFFICIENT EIFS WALL SYSTEMS Enhance exterior insulation and finishing system (EIFS) envelope systems to...

484

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Project Management Center 2010 Gary Sames 812010 - 7312013 Midland, MI Advanced Insulation for High-Performance, Cost-Effective Wall, Roof and Foundation Systems Develop...

485

VERTIGO (VERtical Transport In the Global Ocean): A study of particle sources and flux attenuation in the North Pacific  

E-Print Network (OSTI)

Research II, this volume. Volk, T. , Hoffert, M.I. , 1985.the oceans biological pump (Volk and Hoffert, 1985). This

Buesseler, K.O.

2008-01-01T23:59:59.000Z

486

High Biomass Low Export Regimes in the Southern Ocean  

E-Print Network (OSTI)

Research-Oceans 106 (C12) Volk, T. , Hoffert, M.I. , 1985.in the atmosphere (Volk and Hoffert 1985), understanding the

Lam, Phoebe J.; Bishop, James K.B.

2006-01-01T23:59:59.000Z

487

Quantifying the surface-subsurface biogeochemical coupling during the VERTIGO ALOHA and K2 studies  

E-Print Network (OSTI)

projects/vertigo.html Volk, T. , Hoffert, M.I. , 1985. Oceanto the oceans interior (Volk and Hoffert, 1985). The source

Boyd, P.W.

2008-01-01T23:59:59.000Z

488

Chrysler RAM PHEV Fleet Results Report  

NLE Websites -- All DOE Office Websites (Extended Search)

istance (mi) 4 45 Trips in Charge Depleting (CD) mode City Highway Gasoline fuel economy (mpg) DC electrical energy consumption (DC Whmi) Percent of miles with internal combustion...

489

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 14% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 380 Number of trips 106 Distance traveled (mi) 237 Percent...

490

EnergyCS Prius Altairnano 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...

491

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 15% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 414 Number of trips 152 Distance traveled (mi) 131 Percent...

492

EnergyCS Prius Valence 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...

493

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 15% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 410 Number of trips 94 Distance traveled (mi) 307 Percent of...

494

1 Introduction  

E-Print Network (OSTI)

1Department of Mathematics, Wayne State University, Detroit, MI 48202 (boris@ math.wayne.edu). Research of this author was partly supported by the National...

495

1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202, USA; email: boris@math.wayne.edu. Research of this author was also partly supported ...

496

Approximate Maximum Principle for Discrete Approximations of ...  

E-Print Network (OSTI)

Detroit, MI 48202. Email: boris@math.wayne.edu. ILYA SHVARTSMAN. Department of Mathematics and Computer Science. Penn State University - Harrisburg.

497

Hlder Metric Subregularity with Applications to Proximal Point Method  

E-Print Network (OSTI)

Feb 2, 2012 ... Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. Email: boris@math.wayne.edu. Research of this author was also...

498

1 Introduction  

E-Print Network (OSTI)

Strategic Reference Framework under grant PTDC/MAT/111809/2009. 3Doctoral Student, Department of Mathematics, Wayne State University, Detroit, MI 48202...

499

www.eia.gov  

U.S. Energy Information Administration (EIA)

... , "Detroit, MI",, ,Coking,Steam 2000,61542,1142280 2005,177414,8456023 2010,160896,6187802 Jan-Aug 2011,9323,1227071 ,, "Mobile, AL", ...

500

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DTE Energy PMCPVT FY2012Appx. 11 months Rondle Harp Detroit, MI GM Battery Pack Assembly Plant - Electric Substation Upgrade General business actions to support the EDV battery...