National Library of Energy BETA

Sample records for dna double strand

  1. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; Chattopadhyay, Debasish

    2015-06-02

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore »represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  2. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOE Patents [OSTI]

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  3. Spin transport and spin polarization properties in double-stranded DNA

    SciTech Connect (OSTI)

    Simchi, Hamidreza; Esmaeilzadeh, Mahdi Mazidabadi, Hossein

    2013-11-21

    We study the spin-dependent electron transport through a double-stranded DNA (dsDNA) using the Bogoliubov-de Gennes equations and non-equilibrium Green's function method. We calculate the spin-dependent electron conductance and spin-polarization for different lengths, helix angles, twist angles of dsDNA, the environment-induced dephasing factors, and hopping integral. It is shown that the conductance decreases by increasing the length and dephasing factor. Also, we show that the spin-polarization depends on the helical symmetry and the length of DNA. It is shown that the double-stranded DNA can act as a perfect spin filter. Finally, we show that the sign of spin polarization can be inverted from +1 (?1) to ?1 (+1) for some values of hopping integral.

  4. Microbial Pathogens Trigger Host DNA Double-Strand Breaks Whose Abundance Is Reduced by Plant Defense

    E-Print Network [OSTI]

    of an alternative mediator of pathogen-induced H2AX phosphorylation. In summary, pathogenic microorganisms canMicrobial Pathogens Trigger Host DNA Double-Strand Breaks Whose Abundance Is Reduced by Plant largely unknown. We report that multiple bacterial, fungal and oomycete plant pathogen species induce

  5. Sequence-dependent spin-selective tunneling along double-stranded DNA

    E-Print Network [OSTI]

    Guo, Ai-Min

    2012-01-01

    We report spin-selective tunneling of electrons along natural and artificial double-stranded DNA (dsDNA) sandwiched by nonmagnetic leads. The results reveal that the spin polarization strongly depends on the dsDNA sequence and is dominated by its end segment. Both genomic and artificial dsDNA could be efficient spin filters. The spin-filtering effects are sensitive to point mutation which occurs in the end segment. These results are in good agreement with recent experiments and are robust against various types of disorder, and could help for designing DNA-based spintronic devices.

  6. Euler buckling and nonlinear kinking of double-stranded DNA

    E-Print Network [OSTI]

    Cohen, Adam E.

    physiological conditions: at high curvature, does the DNA bend smoothly, or does it kink like a drinking straw and damage). These aspects of DNA mechanics are likely to influence protein binding and DNA packaging, yet the effect of single-nucleotide mismatches on DNA bending. Our data support a model of linear elastic bending

  7. Zinc chromate induces chromosome instability and DNA double strand breaks in human lung cells

    SciTech Connect (OSTI)

    Xie Hong; Holmes, Amie L.; Young, Jamie L.; Qin Qin; Joyce, Kellie; Pelsue, Stephen C.; Peng Cheng; Wise, Sandra S.; Jeevarajan, Antony S.; Wallace, William T.; Hammond, Dianne; Wise, John Pierce E-mail: John.Wise@usm.maine.edu

    2009-02-01

    Hexavalent chromium Cr(VI) is a respiratory toxicant and carcinogen, with solubility playing an important role in its carcinogenic potential. Zinc chromate, a water insoluble or 'particulate' Cr(VI) compound, has been shown to be carcinogenic in epidemiology studies and to induce tumors in experimental animals, but its genotoxicity is poorly understood. Our study shows that zinc chromate induced concentration-dependent increases in cytotoxicity, chromosome damage and DNA double strand breaks in human lung cells. In response to zinc chromate-induced breaks, MRE11 expression was increased and ATM and ATR were phosphorylated, indicating that the DNA double strand break repair system was initiated in the cells. In addition, our data show that zinc chromate-induced double strand breaks were only observed in the G2/M phase population, with no significant amount of double strand breaks observed in G1 and S phase cells. These data will aid in understanding the mechanisms of zinc chromate toxicity and carcinogenesis.

  8. Double stranded nucleic acid biochips

    DOE Patents [OSTI]

    Chernov, Boris; Golova, Julia

    2006-05-23

    This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

  9. Double-stranded DNA organization in bacteriophage heads: An alternative toroid-based model

    SciTech Connect (OSTI)

    Hud, N.V.

    1995-10-01

    Studies of the organization of double-stranded DNA within bacteriophage heads during the past four decades have produced a wealth of data. However, despite the presentation of numerous models, the true organization of DNA within phage heads remains unresolved. The observations of toroidal DNA structures in electron micrographs of phage lysates have long been cited as support for the organization of DNA in a spool-like fashion. This particular model, like all other models, has not been found to be consistent with all available data. Recently, the authors proposed that DNA within toroidal condensates produced in vitro is organized in a manner significantly different from that suggested by the spool model. This new toroid model has allowed the development of an alternative model for DNA organization within bacteriophage heads that is consistent with a wide range of biophysical data. Here the authors propose that bacteriophage DNA is packaged in a toroid that is folded into a highly compact structure.

  10. The effect of a magnetic field on the spin-selective transport in double-stranded DNA

    SciTech Connect (OSTI)

    Simchi, Hamidreza; Esmaeilzadeh, Mahdi Mazidabadi, Hossein

    2014-05-28

    Spin-polarization in double-stranded DNA is studied in the presence of a magnetic field applied along its helix axis using the non-equilibrium Green's function method. The spin-polarization could be tuned by changing the magnetic field. In some special cases, the double-stranded DNA behaved as a perfect spin-filter. Furthermore, the dependency of the spin-polarization on the spin-orbit strength and dephasing strength is studied.

  11. Translocation frequency of double-stranded DNA through a solid-state nanopore

    E-Print Network [OSTI]

    Bell, Nicholas A W; Keyser, Ulrich F

    2015-01-01

    Solid-state nanopores are single molecule sensors that measure changes in ionic current as charged polymers such as DNA pass through. Here, we present comprehensive experiments on the length, voltage and salt dependence of the frequency of double-stranded DNA translocations through conical quartz nanopores with mean opening diameter 15 nm. We observe an entropic barrier limited, length dependent translocation frequency at 4M LiCl salt concentration and a drift-dominated, length independent translocation frequency at 1M KCl salt concentration. These observations are described by a unifying convection-diffusion equation which includes the contribution of an entropic barrier for polymer entry.

  12. Processing of 3'-Phosphoglycolate-Terminated DNA Double-StrandBreaks by Artemis Nuclease

    SciTech Connect (OSTI)

    Povrik, Lawrence F.; Zhou, Tong; Zhou, Ruizhe; Cowan, Morton J.; Yannone, Steven M.

    2005-10-01

    The Artemis nuclease is required for V(D)J recombination and for repair of an as yet undefined subset of radiation-induced DNA double-strand breaks. To assess the possibility that Artemis functions on oxidatively modified double-strand break termini, its activity toward model DNA substrates, bearing either 3{prime}-hydroxyl or 3{prime}-phosphoglycolate moieties, was examined. A 3{prime}-phosphoglycolate had little effect on Artemis-mediated trimming of long 3{prime} overhangs (>9 nucleotides), which were efficiently trimmed to 4-5 nucleotides. However, 3{prime}-phosphoglycolates on overhangs of 4-5 bases promoted selective Artemis-mediated trimming of a single 3{prime}-terminal nucleotide, while at least 2 nucleotides were trimmed from identical hydroxyl-terminated substrates. Artemis also efficiently removed a single nucleotide from a phosphoglycolate-terminated 3-base 3{prime} overhang, while leaving an analogous hydroxyl-terminated overhang largely intact. Such removal was dependent upon Ku, DNA-dependent protein kinase, and ATP. Together, these data suggest that Artemis-mediated cleavage of 3{prime} overhangs requires a minimum of 2 nucleotides, or a nucleotide plus a phosphoglycolate, 3{prime} to the cleavage site. Shorter 3{prime}-phosphoglycolate-terminated overhangs and blunt ends were also processed by Artemis, but much less efficiently. Consistent with the in vitro substrate specificity of Artemis, human cells lacking Artemis exhibited hypersensitivity to X-rays, bleomycin and neocarzinostatin, which all induce 3{prime}-phosphoglycolate-terminated double-strand breaks. Collectively, these results suggest that 3{prime}-phosphoglycolate termini and/or specific classes of DNA ends that arise from such blocked termini are relevant Artemis substrates in vivo.

  13. Bubble dynamics in double stranded DNA : A Rouse chain based approach

    E-Print Network [OSTI]

    Rajarshi Chakrabarti

    2010-10-26

    We propose a model for the fluctuation dynamics of the local denaturation zones (bubbles) in double-stranded DNA. In our formulation, the DNA strand is model as a one dimensional Rouse chain confined at both the ends. The bubble is formed when the transverse displacement of the chain attains a critical value. This simple model effectively reproduces the autocorrelation function for the tagged base pair in the DNA strand as measured in the seminal single molecule experiment by Altan-Bonnet et. al (Phys. Rev. Lett. 90, 138101 (2003)). Although our model is mathematically similar to the one proposed by Chatterjee et al. (J. Chem. Phys. 127, 155104 (2007)) it goes beyond a single reaction coordinate description by incorporating the chain dynamics through a confined Rouse chain and thus considers the collective nature of the dynamics. Our model also shows that the autocorrelation function is very sensitive to the relaxation times of the normal modes of the chain, which is obvious since the fluctuation dynamics of the bubble has the contribution from the different normal modes of the chain.

  14. Proximity-induced superconductivity effect in a double-stranded DNA

    SciTech Connect (OSTI)

    Simchi, Hamidreza; Esmaeilzadeh, Mahdi Mazidabadi, Hossein

    2014-02-07

    We study the proximity-induced superconductivity effect in a double-stranded DNA by solving the Bogoliubov-de Gennes equations and taking into account the effect of thermal fluctuations of the twist angle between neighboring base pairs. We show that the electron conductance is spin-dependent and the conductance of spin up (down) increases (decreases) due to the spin-orbit coupling (SOC). It is found that, for T?

  15. The probability of double-strand breaks in giant DNA decreases markedly as the DNA concentration increases

    E-Print Network [OSTI]

    Shimobayashi, Shunsuke F; Mori, Toshiaki; Yoshikawa, Kenichi

    2012-01-01

    DNA double-strand breaks (DSBs) represent a serious source of damage for all living things and thus there have been many quantitative studies of DSBs both in vivo and in vitro. Despite this fact, the processes that lead to their production have not yet been clearly understood, and there is no established theory that can account for the statistics of their production, in particular, the number of DSBs per base pair per unit Gy, here denoted by P1, which is the most important parameter for evaluating the degree of risk posed by DSBs. Here, using the single-molecule observation method with giant DNA molecules (166 kbp), we evaluate the number of DSBs caused by gamma-ray irradiation. We find that P1 is nearly inversely proportional to the DNA concentration above a certain threshold DNA concentration. A simple model that accounts for the marked decrease of P1 shows that it is necessary to consider the characteristics of giant DNA molecules as semiflexible polymers to interpret the intrinsic mechanism of DSBs.

  16. Crystal Structure of E. coli RecE Protein Reveals a Toroidal Tetramer for Processing Double-Stranded DNA Breaks

    SciTech Connect (OSTI)

    Zhang, Jinjin; Xing, Xu; Herr, Andrew B.; Bell, Charles E.; (OSU); (UCIN)

    2009-07-21

    Escherichia coli RecE protein is part of the classical RecET recombination system that has recently been used in powerful new methods for genetic engineering. RecE binds to free double-stranded DNA (dsDNA) ends and processively digests the 5{prime}-ended strand to form 5{prime}-mononucleotides and a 3{prime}-overhang that is a substrate for single strand annealing promoted by RecT. Here, we report the crystal structure of the C-terminal nuclease domain of RecE at 2.8 {angstrom} resolution. RecE forms a toroidal tetramer with a central tapered channel that is wide enough to bind dsDNA at one end, but is partially plugged at the other end by the C-terminal segment of the protein. Four narrow tunnels, one within each subunit of the tetramer, lead from the central channel to the four active sites, which lie about 15 {angstrom} from the channel. The structure, combined with mutational studies, suggests a mechanism in which dsDNA enters through the open end of the central channel, the 5{prime}-ended strand passes through a tunnel to access one of the four active sites, and the 3{prime}-ended strand passes through the plugged end of the channel at the back of the tetramer.

  17. Probability of double-strand breaks in genome-sized DNA by {gamma}-ray decreases markedly as the DNA concentration increases

    SciTech Connect (OSTI)

    Shimobayashi, Shunsuke F.; Iwaki, Takafumi; Mori, Toshiaki; Yoshikawa, Kenichi

    2013-05-07

    By use of the single-molecule observation, we count the number of DNA double-strand breaks caused by {gamma}-ray irradiation with genome-sized DNA molecules (166 kbp). We find that P{sub 1}, the number of double-strand breaks (DSBs) per base pair per unit Gy, is nearly inversely proportional to the DNA concentration above a certain threshold DNA concentration. The inverse relationship implies that the total number of DSBs remains essentially constant. We give a theoretical interpretation of our experimental results in terms of attack of reactive species upon DNA molecules, indicating the significance of the characteristics of genome-sized giant DNA as semiflexible polymers for the efficiency of DSBs.

  18. Detection and Repair of Ionizing Radiation-Induced DNA Double Strand Breaks: New Developments in Nonhomologous End Joining

    SciTech Connect (OSTI)

    Wang, Chen [Departments of Biochemistry and Molecular Biology and Oncology, and Southern Alberta Cancer Research Institute, University of Calgary, Calgary (Canada)] [Departments of Biochemistry and Molecular Biology and Oncology, and Southern Alberta Cancer Research Institute, University of Calgary, Calgary (Canada); Lees-Miller, Susan P., E-mail: leesmill@ucalgary.ca [Departments of Biochemistry and Molecular Biology and Oncology, and Southern Alberta Cancer Research Institute, University of Calgary, Calgary (Canada)

    2013-07-01

    DNA damage can occur as a result of endogenous metabolic reactions and replication stress or from exogenous sources such as radiation therapy and chemotherapy. DNA double strand breaks are the most cytotoxic form of DNA damage, and defects in their repair can result in genome instability, a hallmark of cancer. The major pathway for the repair of ionizing radiation-induced DSBs in human cells is nonhomologous end joining. Here we review recent advances on the mechanism of nonhomologous end joining, as well as new findings on its component proteins and regulation.

  19. Comment on "Monomer Dynamics in Double- and Single-Stranded DNA Polymers"

    E-Print Network [OSTI]

    J. Tothova; B. Brutovsky; V. Lisy

    2005-09-15

    It is discussed that the kinetics observed by Shusterman et al. [Phys. Rev. Lett. 92, 048303] for long dsDNA is not the Rouse one and, in fact, the macromolecule behaves (approximately) as the Zimm polymer.

  20. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    E-Print Network [OSTI]

    Dekker, Cees

    and mechanism of the unwinding and rewinding reaction through single-molecule experiments. Human RPA (h Department of Cell Biology and Genetics, Cancer Genomic Center and 3 Department of Radiation OncologyDNA. Here, we study the dynamics of human RPA (hRPA) activity on topolog- ically constrained ds

  1. Identification, Exploitation and Manipulation of BRCA1-Dependent DNA Double-Strand Break and Interstrand Crosslink Repair in Breast and Ovarian Cancer Therapy

    E-Print Network [OSTI]

    Stecklein, Shane Richard

    2012-05-12

    motif-containing protein 1 (gene) RING Really interesting new gene domain SCE Sister chromatid exchange xxiii SEM Standard error of the mean shRNA Short hairpin RNA ssDNA single-strand DNA TAE Tris-acetate-EDTA TN Triple...

  2. PAXX, a paralog of XRCC4 and XLF, interacts with Ku to promote DNA double-strand break repair

    E-Print Network [OSTI]

    Ochi, Takashi; Blackford, Andrew N.; Coates, Julia; Jhujh, Satpal; Mehmood, Shahid; Tamura, Naoka; Travers, Jon; Wu, Qian; Draviam, Viji M.; Robinson, Carol V.; Blundell, Tom L.; Jackson, Stephen P.

    2015-01-09

    regions of PAXX1-204 and PAXXV199A/F201A were amplified from the vectors by PCR and cloned into the pcDNA3.1(-) vector (a gift from Dr. V. Bolanos-Garcia) together with GFP or FLAG tags using In-Fusion (Clontech). Vectors were sequenced by the DNA... -treated or treated for 1 hour with 300 µM phleomycin to induce large numbers of DSBs, before being harvested either at this point or after an additional 1-hour recovery period in phleomycin-free medium after three PBS washes. Cells were washed twice in ice-cold PBS...

  3. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    SciTech Connect (OSTI)

    Zafar, Faria; Seidler, Sara B.; Kronenberg, Amy; Schild, David; Wiese, Claudia

    2010-06-29

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  4. Induction and Rejoining of DNA Double Strand Breaks Assessed by H2AX Phosphorylation in Melanoma Cells Irradiated with Proton and Lithium Beams

    SciTech Connect (OSTI)

    Ibanez, Irene L.; Bracalente, Candelaria; Molinari, Beatriz L.; Palmieri, Monica A.; Policastro, Lucia; Kreiner, Andres J.; Burlon, Alejandro A.; Valda, Alejandro; Navalesi, Daniela; Davidson, Jorge; Davidson, Miguel; Vazquez, Monica; Ozafran, Mabel; Duran, Hebe

    2009-07-15

    Purpose: The aim of this study was to evaluate the induction and rejoining of DNA double strand breaks (DSBs) in melanoma cells exposed to low and high linear energy transfer (LET) radiation. Methods and Materials: DSBs and survival were determined as a function of dose in melanoma cells (B16-F0) irradiated with monoenergetic proton and lithium beams and with a gamma source. Survival curves were obtained by clonogenic assay and fitted to the linear-quadratic model. DSBs were evaluated by the detection of phosphorylated histone H2AX ({gamma}H2AX) foci at 30 min and 6 h post-irradiation. Results: Survival curves showed the increasing effectiveness of radiation as a function of LET. {gamma}H2AX labeling showed an increase in the number of foci vs. dose for all the radiations evaluated. A decrease in the number of foci was found at 6 h post-irradiation for low LET radiation, revealing the repair capacity of DSBs. An increase in the size of {gamma}H2AX foci in cells irradiated with lithium beams was found, as compared with gamma and proton irradiations, which could be attributed to the clusters of DSBs induced by high LET radiation. Foci size increased at 6 h post-irradiation for lithium and proton irradiations in relation with persistent DSBs, showing a correlation with surviving fraction. Conclusions: Our results showed the response of B16-F0 cells to charged particle beams evaluated by the detection of {gamma}H2AX foci. We conclude that {gamma}H2AX foci size is an accurate parameter to correlate the rejoining of DSBs induced by different LET radiations and radiosensitivity.

  5. Nonenzymatic Role for WRN in Preserving Nascent DNA Strands after Replication Stress

    SciTech Connect (OSTI)

    Su, Fengtao [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States); Mukherjee, Shibani [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States); Yang, Yanyong [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States); Mori, Eiichiro [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States); Bhattacharya, Souparno [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States); Kobayashi, Junya [Kyoto Univ. (Japan); Yannone, Steven  M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Chen, David  J. [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States); Asaithamby, Aroumougame [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States)

    2014-11-20

    WRN, the protein defective in Werner syndrome (WS), is a multifunctional nuclease involved in DNA damage repair, replication, and genome stability maintenance. It was assumed that the nuclease activities of WRN were critical for these functions. Here, we report a nonenzymatic role for WRN in preserving nascent DNA strands following replication stress. We found that lack of WRN led to shortening of nascent DNA strands after replication stress. Furthermore, we discovered that the exonuclease activity of MRE11 was responsible for the shortening of newly replicated DNA in the absence of WRN. Mechanistically, the N-terminal FHA domain of NBS1 recruits WRN to replication-associated DNA double-stranded breaks to stabilize Rad51 and to limit the nuclease activity of its C-terminal binding partner MRE11. Thus, this previously unrecognized nonenzymatic function of WRN in the stabilization of nascent DNA strands sheds light on the molecular reason for the origin of genome instability in WS individuals.

  6. An intercalation-locked parallel-stranded DNA tetraplex

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Tripathi, S.; Zhang, D.; Paukstelis, P. J.

    2015-01-27

    DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(ACBrUCGGABrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A base pairs betweenmore »adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H–1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

  7. Nonenzymatic Role for WRN in Preserving Nascent DNA Strands after Replication Stress

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Su, Fengtao; Mukherjee, Shibani; Yang, Yanyong; Mori, Eiichiro; Bhattacharya, Souparno; Kobayashi, Junya; Yannone, Steven  M.; Chen, David  J.; Asaithamby, Aroumougame

    2014-11-20

    WRN, the protein defective in Werner syndrome (WS), is a multifunctional nuclease involved in DNA damage repair, replication, and genome stability maintenance. It was assumed that the nuclease activities of WRN were critical for these functions. Here, we report a nonenzymatic role for WRN in preserving nascent DNA strands following replication stress. We found that lack of WRN led to shortening of nascent DNA strands after replication stress. Furthermore, we discovered that the exonuclease activity of MRE11 was responsible for the shortening of newly replicated DNA in the absence of WRN. Mechanistically, the N-terminal FHA domain of NBS1 recruits WRNmore »to replication-associated DNA double-stranded breaks to stabilize Rad51 and to limit the nuclease activity of its C-terminal binding partner MRE11. Thus, this previously unrecognized nonenzymatic function of WRN in the stabilization of nascent DNA strands sheds light on the molecular reason for the origin of genome instability in WS individuals.« less

  8. DNA: The Strand that Connects Us All

    SciTech Connect (OSTI)

    Kaplan, Matt (University of Arizona Genetics Core) [University of Arizona Genetics Core

    2011-03-29

    Learn how the methods and discoveries of human population genetics are applied for personal genealogical reconstruction and anthropological testing. Dr. Kaplan starts with a short general review of human genetics and the biology behind this form of DNA testing. He looks at how DNA testing is performed and how samples are processed in the University of Arizona laboratory. He also examines examples of personal genealogical results from Family Tree DNA and personal anthropological results from the Genographic Project. Finally, he describes the newest project in the UA laboratory, the DNA Shoah Project.

  9. Synthesis of DNA

    DOE Patents [OSTI]

    Mariella, Jr., Raymond P. (Danville, CA)

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  10. DNA Strand Damage Product Analysis Provides Evidence That the Tumor Cell-Specific Cytotoxin Tirapazamine

    E-Print Network [OSTI]

    Gates, Kent. S.

    DNA Strand Damage Product Analysis Provides Evidence That the Tumor Cell-Specific Cytotoxin DNA strand damage that is initiated by the abstraction of hydrogen atoms from the deoxyribose damage. We find that the action of TPZ on duplex DNA under hypoxic conditions generates 5-methylene-2

  11. 1 Plasmodium falciparum SSB Tetramer Wraps 2 Single-Stranded DNA with Similar Topology but

    E-Print Network [OSTI]

    Lohman, Timothy M.

    1 Plasmodium falciparum SSB Tetramer Wraps 2 Single-Stranded DNA with Similar Topology but 3 methods, we show that Pf-SSB forms a stable homo-tetramer 32 alone and when bound to single-stranded DNA (ssDNA). We also present a 33 crystal structure at 2.1 Å resolution of the Pf-SSB tetramer bound

  12. Kinetic Mechanism of Direct Transfer of Escherichia coli SSB Tetramers between Single-Stranded DNA Molecules

    E-Print Network [OSTI]

    Lohman, Timothy M.

    Kinetic Mechanism of Direct Transfer of Escherichia coli SSB Tetramers between Single-Stranded DNA tetramer forms transiently prior to the release of the acceptor DNA. When an initial 1:1 SSB-ssDNA complex tetramer to form a singly ligated complex. However, when an initial SSB-ssDNA complex is formed with (dT)35

  13. VOLUME 82, NUMBER 22 P H Y S I C A L R E V I E W L E T T E R S 31 MAY 1999 Bending and Base-Stacking Interactions in Double-Stranded DNA

    E-Print Network [OSTI]

    Zhang, Yang

    is proposed by taking into account the structural properties of realistic dsDNA. Bending energy of the sugar and un- winding instability of DNA. We suggest that the present model, after some revisions, will also

  14. Asymmetric quantum transport in a double-stranded Kronig-Penney model

    E-Print Network [OSTI]

    Taksu Cheon; Sergey S. Poghosyan

    2015-03-03

    We introduce a double-stranded Kronig-Penney model and analyze its transport properties. The asymmetric fluxes between two strands with suddenly alternating localization patterns are found as the energy is varied. The zero-size limit of the internal lines connecting two strands is examined using quantum graph vertices with four edges. We also consider a two-dimensional Kronig-Penney lattice with two types of alternating layers with $\\delta$ and $\\delta'$ connections, and show that the existence of energy bands in which the quantum flux can flow only in selected directions.

  15. Ion assisted structural collapse of a single stranded DNA: a molecular dynamics approach

    E-Print Network [OSTI]

    Ghosh, Soumadwip; Chakrabarti, Rajarshi

    2015-01-01

    The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counter-ions. It is well known that the structural collapse of DNA is favored in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl2) single stranded DNA (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  16. Biochemistry 1990, 29, 8017-8019 8017 Reaction of Single-Stranded DNA with Hydroxyl Radical Generated by

    E-Print Network [OSTI]

    Martin, Craig T.

    Biochemistry 1990, 29, 8017-8019 8017 Reaction of Single-Stranded DNA with Hydroxyl Radical are consistent with reaction of the hydroxyl radical with the bases in single-stranded DNA (although reaction that hydroxyl radicals may react preferentially with the nucleic acid bases in ssDNA and that reaction

  17. 1 Plasmodium falciparum SSB Tetramer Binds 2 Single-Stranded DNA Only in a Fully Wrapped Mode

    E-Print Network [OSTI]

    Lohman, Timothy M.

    1 Plasmodium falciparum SSB Tetramer Binds 2 Single-Stranded DNA Only in a Fully Wrapped Mode 3 with numerous DNA repair and replication proteins. Ec- 24 SSB tetramers can bind ssDNA in multiple DNA binding in fully wrapped complexes with site sizes of 30 52­65 nt/tetramer. Pf-SSB does not transition to the more

  18. Exploitation of the genomic double-strand breaks to reduce the reproductive power of microorganisms

    E-Print Network [OSTI]

    Sassi, Giandomenico

    2015-01-01

    It is shown how to take advantage of the frequent occurrence of double-strand breaks in the genome of prokaryotic cells, in order to reduce their high efficient reproductive capability. The analysis examines the physical status of the free ends of each break and considers how this status can interfere with an external physical apparatus, with the aim of undermining the repair processes. We indicate the biological consequences of this interaction and we give an approximate evaluation of the topological and dynamical effects that arise on the genomic material involved. The overall result suggests a significant reduction of the dynamics of the repair.

  19. Multicopy single-stranded DNA directs intestinal colonization of enteric pathogens

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; et al

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore »retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate, but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less

  20. Method for assaying clustered DNA damages

    DOE Patents [OSTI]

    Sutherland, Betsy M.

    2004-09-07

    Disclosed is a method for detecting and quantifying clustered damages in DNA. In this method, a first aliquot of the DNA to be tested for clustered damages with one or more lesion-specific cleaving reagents under conditions appropriate for cleavage of the DNA to produce single-strand nicks in the DNA at sites of damage lesions. The number average molecular length (Ln) of double stranded DNA is then quantitatively determined for the treated DNA. The number average molecular length (Ln) of double stranded DNA is also quantitatively determined for a second, untreated aliquot of the DNA. The frequency of clustered damages (.PHI..sub.c) in the DNA is then calculated.

  1. C-H..O Hydrogen Bonds in Minor Groove of A-tracts in DNA Double Helices

    E-Print Network [OSTI]

    Bansal, Manju

    C-H..O Hydrogen Bonds in Minor Groove of A-tracts in DNA Double Helices Anirban Ghosh and Manju-pair as well as cross-strand C-H..O hydrogen bonds in the minor groove. The C2-H2..O2 hydrogen bonds within leads to a narrow minor groove in these regions. # 1999 Academic Press Keywords: C-H..O hydrogen bonds

  2. Activation of double-stranded RNA-dependent protein kinase inhibits proliferation of pancreatic ?-cells

    SciTech Connect (OSTI)

    Chen, Shan-Shan [Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing (China) [Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing (China); Department of Biochemistry and Molecular Biology, Nanjing Medical University, Nanjing (China); Jiang, Teng [Department of Neurology, Qingdao Municipal Hospital, Nanjing Medical University, Nanjing (China)] [Department of Neurology, Qingdao Municipal Hospital, Nanjing Medical University, Nanjing (China); Wang, Yi; Gu, Li-Ze [Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing (China) [Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing (China); Department of Biochemistry and Molecular Biology, Nanjing Medical University, Nanjing (China); Wu, Hui-Wen [Laboratory Center for Basic Medical Sciences, Nanjing Medical University, Nanjing (China)] [Laboratory Center for Basic Medical Sciences, Nanjing Medical University, Nanjing (China); Tan, Lan [Department of Neurology, Qingdao Municipal Hospital, Nanjing Medical University, Nanjing (China)] [Department of Neurology, Qingdao Municipal Hospital, Nanjing Medical University, Nanjing (China); Guo, Jun, E-mail: Guoj@njmu.edu.cn [Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing (China) [Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing (China); Department of Biochemistry and Molecular Biology, Nanjing Medical University, Nanjing (China)

    2014-01-17

    Highlights: •PKR can be activated by glucolipitoxicity and pro-inflammatory cytokines in ?-cells. •Activated PKR inhibited ?-cell proliferation by arresting cell cycle at G1 phase. •Activated PKR fully abrogated the pro-proliferative effects of IGF-I on ?-cells. -- Abstract: Double-stranded RNA-dependent protein kinase (PKR) is revealed to participate in the development of insulin resistance in peripheral tissues in type 2 diabetes (T2DM). Meanwhile, PKR is also characterized as a critical regulator of cell proliferation. To date, no study has focused on the impact of PKR on the proliferation of pancreatic ?-cells. Here, we adopted insulinoma cell lines and mice islet ?-cells to investigate: (1) the effects of glucolipotoxicity and pro-inflammatory cytokines on PKR activation; (2) the effects of PKR on proliferation of pancreatic ?-cells and its underlying mechanisms; (3) the actions of PKR on pro-proliferative effects of IGF-I and its underlying pathway. Our results provided the first evidence that PKR can be activated by glucolipitoxicity and pro-inflammatory cytokines in pancreatic ?-cells, and activated PKR significantly inhibited cell proliferation by arresting cell cycle at G1 phase. Reductions in cyclin D1 and D2 as well as increases in p27 and p53 were associated with the anti-proliferative effects of PKR, and proteasome-dependent degradation took part in the reduction of cyclin D1 and D2. Besides, PKR activation abrogated the pro-proliferative effects of IGF-I by activating JNK and disrupting IRS1/PI3K/Akt signaling pathway. These findings indicate that the anti-proliferative actions of PKR on pancreatic ?-cells may contribute to the pathogenesis of T2DM.

  3. Can we model DNA at the mesoscale ? Comment on: Fluctuations in the DNA double helix: A critical review

    E-Print Network [OSTI]

    Peyrard, Michel

    2015-01-01

    Comment on "Fluctuations in the DNA double helix: A critical review" by Frank-Kamenetskii and Prakash

  4. Extremely low-frequency electromagnetic fields cause DNA strand breaks in normal Vero cells

    E-Print Network [OSTI]

    Cosmin Teodor Miha; Gabriela Vochita; Florin Brinza; Pincu Rotinberg

    2013-01-23

    Extremely low frequency electromagnetic fields aren't considered as a real carcinogenic agent despite the fact that some studies have showed impairment of the DNA integrity in different cells lines. The aim of this study was evaluation of the late effects of a 100 Hz and 5.6 mT electromagnetic field, applied continuously or discontinuously, on the DNA integrity of Vero cells assessed by alkaline Comet assay and by cell cycle analysis. Normal Vero cells were exposed to extremely low frequency electromagnetic fields (100 Hz, 5.6 mT) for 45 minutes. The Comet assay and cell cycle analysis were performed 48 hours after the treatment. Exposed samples presented an increase of the number of cells with high damaged DNA as compared with non-exposed cells. Quantitative evaluation of the comet assay showed a significantly ($cells. Cell cycle analysis showed an increase of the frequency of the cells in S phase, proving the occurrence of single strand breaks. The most probable mechanism of induction of the registered effects is the production of different types of reactive oxygen species.

  5. How Do Low-Energy (0.1-2 eV) Electrons Cause DNA-Strand

    E-Print Network [OSTI]

    Simons, Jack

    How Do Low-Energy (0.1-2 eV) Electrons Cause DNA-Strand Breaks? JACK SIMONS* Chemistry Department by which very low-energy (0.1-2 eV) free electrons attach to DNA and cause strong (ca. 4 eV) covalent bonds of electrons in the above energy range to base * orbitals is more likely than attachment elsewhere and (ii

  6. DNA Strand Cleavage by the Phenazine Di-N-oxide Natural Product Myxin under Both Aerobic and Anaerobic Conditions

    E-Print Network [OSTI]

    Gates, Kent. S.

    DNA Strand Cleavage by the Phenazine Di-N-oxide Natural Product Myxin under Both Aerobic: Heterocyclic N-oxides are an interesting class of antitumor agents that selectively kill the hypoxic cells found in solid tumors. The hypoxia-selective activity of the lead compound in this class, tirapazamine

  7. Hydroxyl Radical is the Active Species in Photochemical DNA Strand Scission by Bis(peroxo)vanadium(V) Phenanthroline

    E-Print Network [OSTI]

    Chanfreau, Guillaume

    Hydroxyl Radical is the Active Species in Photochemical DNA Strand Scission by Bis-N-oxide (DMPO) as spin-traps for singlet oxygen and hydroxyl radical, respectively, implicated hydroxyl radical reactions were run on the same lane. These findings identify hydroxyl radical produced from

  8. Published on Science 2.0 (http://www.science20.com) Home > Life Sciences > Genetics & Molecular Biology > News Articles > Rad51: Watching Single Strands Of DNA Being Prepped For Repair Could Help Fight Breast Cancer

    E-Print Network [OSTI]

    Kowalczykowski, Stephen C.

    Biology > News Articles > Rad51: Watching Single Strands Of DNA Being Prepped For Repair Could Help Fight Breast Cancer Rad51: Watching Single Strands Of DNA Being Prepped For Repair Could Help Fight Breast: Watching Single Strands Of DNA Being Prepped For Repair Could Help Fight Br... 6/17/2013http

  9. SOLVING LARGE DOUBLE DIGESTION PROBLEMS FOR DNA RESTRICTION MAPPING BY USING

    E-Print Network [OSTI]

    SOLVING LARGE DOUBLE DIGESTION PROBLEMS FOR DNA RESTRICTION MAPPING BY USING BRANCH;Solving Large Double Digestion Problems for DNA Restriction Mapping by Using Branch-and-Bound Integer.S.A. Abstract. The double digestion problem for DNA restriction mapping has been proved to be NP

  10. Extreme bendability of DNA double helix due to bending asymmetry

    E-Print Network [OSTI]

    Hossein Salari; B. Eslami-Mossallam; M. S. Naderi; M. R. Ejtehadi

    2015-05-23

    Experimental data of the DNA cyclization (J-factor) at short length scales, as a way to study the elastic behavior of tightly bent DNA, exceed the theoretical expectation based on the wormlike chain (WLC) model by several orders of magnitude. Here, we propose that asymmetric bending rigidity of the double helix in the groove direction can be responsible for extreme bendability of DNA at short length scales and it also facilitates DNA loop formation at these lengths. To account for the bending asymmetry, we consider the asymmetric elastic rod (AER) model which has been introduced and parametrized in an earlier study (B. Eslami-Mossallam and M. Ejtehadi, Phys. Rev. E 80, 011919 (2009)). Exploiting a coarse grained representation of DNA molecule at base pair (bp) level, and using the Monte Carlo simulation method in combination with the umbrella sampling technique, we calculate the loop formation probability of DNA in the AER model. We show that, for DNA molecule has a larger J-factor compared to the WLC model which is in excellent agreement with recent experimental data.

  11. Extreme bendability of DNA double helix due to bending asymmetry

    E-Print Network [OSTI]

    Salari, Hossein; Naderi, M S; Ejtehadi, M R

    2015-01-01

    Experimental data of the DNA cyclization (J-factor) at short length scales, as a way to study the elastic behavior of tightly bent DNA, exceed the theoretical expectation based on the wormlike chain (WLC) model by several orders of magnitude. Here, we propose that asymmetric bending rigidity of the double helix in the groove direction can be responsible for extreme bendability of DNA at short length scales and it also facilitates DNA loop formation at these lengths. To account for the bending asymmetry, we consider the asymmetric elastic rod (AER) model which has been introduced and parametrized in an earlier study (B. Eslami-Mossallam and M. Ejtehadi, Phys. Rev. E 80, 011919 (2009)). Exploiting a coarse grained representation of DNA molecule at base pair (bp) level, and using the Monte Carlo simulation method in combination with the umbrella sampling technique, we calculate the loop formation probability of DNA in the AER model. We show that, for DNA molecule has a larger J-factor compared to the WLC model w...

  12. Effects of Monovalent Anions on a Temperature-Dependent Heat Capacity Change for Escherichia coli SSB Tetramer Binding to Single-Stranded DNA

    E-Print Network [OSTI]

    Lohman, Timothy M.

    SSB Tetramer Binding to Single-Stranded DNA Alexander G. Kozlov and Timothy M. Lohman* Department, where the subscript denotes the average number of ssDNA nucleotides occluded by each bound tetramer cooperat- ivity (SSB)65 mode in which ssDNA interacts with all four subunits and wraps around the tetramer

  13. DNA purification by triplex-affinity capture and affinity capture electrophoresis

    DOE Patents [OSTI]

    Cantor, C.R.; Ito, Takashi; Smith, C.L.

    1996-01-09

    The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel. 6 figs.

  14. Mitigating security issues in the evolving DNA synthesis industry

    E-Print Network [OSTI]

    Turlington, Ralph Donald, III

    2013-01-01

    DNA synthesis technologies are advancing at exponential rates, with production of ever longer, more complex, and less expensive sequences of double stranded DNA. This has fostered development of industrial scale design, ...

  15. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOE Patents [OSTI]

    Soares, M.B.; Fatima Bonaldo, M. de

    1998-12-08

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

  16. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOE Patents [OSTI]

    Soares, Marcelo Bento (New York, NY); Bonaldo, Maria de Fatima (New York, NY)

    1998-01-01

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

  17. Carrier DNA For Yeast Transformation Preparation of high molecular weight single stranded carrier DNA for yeast transformations.

    E-Print Network [OSTI]

    Aris, John P.

    minute pulses. Chill on ice for 1 minute in between. The DNA solution should not heat above room into ice bucket to cool quickly. Keep on ice. This denaturation step also sterilizes the DNA. 10. Freeze to collect solution at bottom of tube. Place on ice. 3. Sonicate DNA solution in tube with tip sonifier

  18. Collection, focusing, and metering of DNA in microchannels using addressable electrode arrays for portable low-power bioanalysis 

    E-Print Network [OSTI]

    Shaikh, Faisal

    2008-10-10

    Deoxyribonucleic Acid dsDNA Double Stranded DNA ssDNA Single Stranded DNA EDTA Ethylene Diamine Tetracetic Acid TBE Tris-Borate EDTA BME Beta Mercapto Ethanol PCB Printed Circuit Board DI Deionized UV Ultraviolet RIE Reactive Ion Etcher CCD Charge Coupled... potential............................... 41 Figure 16 DNA visible under white light (100 bp DNA ladder in 1X TBE buffer) ............................................................................................ 45 Figure 17 Schematic...

  19. Flow cytomeric measurement of DNA and incorporated nucleoside analogs

    DOE Patents [OSTI]

    Dolbeare, Frank A. (Livermore, CA); Gray, Joe W. (Livermore, CA)

    1989-01-01

    A method is provided for simultaneously measuring total cellular DNA and incorporated nucleoside analog. The method entails altering the cellular DNA of cells grown in the presence of a nucleoside analog so that single stranded and double stranded portions are present. Separate stains are used against the two portions. An immunochemical stain is used against the single stranded portion to provide a measure of incorporated nucleoside analog, and a double strand DNA-specific stain is used against the double stranded portion to simultaneously provide a measure of total cellular DNA. The method permits rapid flow cytometric analysis of cell populations, rapid identification of cycling and noncycling subpopulations, and determination of the efficacy of S phase cytotoxic anticancer agents.

  20. The COP9 signalosome is vital for timely repair of DNA double-strand breaks

    E-Print Network [OSTI]

    Meir, Michal; Galanty, Yaron; Kashani, Lior; Blank, Michael; Khosravi, Rami; Fernández-Ávila, María Jesús; Cruz-García, Andrés; Star, Ayelet; Shochot, Lea; Thomas, Yann; Garrett, Lisa J.; Chamovitz, Daniel A.; Bodine, David M.; Kurz, Thimo; Huertas, Pablo; Ziv, Yael; Shiloh, Yosef

    2015-04-08

    is critical for proper DSB repair, and that loss of this phosphorylation site alone is sufficient to cause a DDR deficiency phenotype in the mouse. This novel branch of the DSB response thus significantly affects genome stability....

  1. Screening Tool for Providers of Double-Stranded DNA - Energy Innovation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust, High-ThroughputUpcomingmagnetoresistance | ArgonnePrinceton Plasma

  2. J.M. Butler -DNA and Biometrics June 24, 2008 http://www.cstl.nist.gov/biotech/strbase/NISTpub.htm 1

    E-Print Network [OSTI]

    Butler Margaret Kline Amy Decker Becky Hill Dave Duewer Jan Redman NIST Human Identity Project Team is Targeted and Probed for Each DNA Marker Examined chromosome cell nucleus Double stranded DNA molecule

  3. DNA Duplication Revealed in New Beginnings | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    to wrap around and bend approximately 70 base pairs of double stranded DNA (red and blue). When a replication initiator Cdc6 (green) joins ORC, the partial ring is now complete...

  4. Self-Assembly of DNA Double-Double Crossover Complexes into High-Density, Doubly Connected, Planar Structures

    E-Print Network [OSTI]

    Brun, Yuriy

    consisting of two DNA double helices connected by two reciprocal exchanges (crossovers). In 1998, Winfree et connected by a total of six reciprocal exchanges. We use DDX complexes to self-assemble high-density, doubly reciprocal exchanges connecting each pair of adjacent helices. Figure 1b shows how the complexes might tile

  5. Mechanochemistry of a Viral DNA Packaging Motor , Jeffrey Moffitt1

    E-Print Network [OSTI]

    Oster, George

    Mechanochemistry of a Viral DNA Packaging Motor Jin Yu1 , Jeffrey Moffitt1 , Craig L. Hetherington1 The pentameric ATPase motor gp16 packages double-stranded DNA into the bacteriophage 29 virus capsid to explain how the packaging motor translocates the DNA in bursts of four 2.5 bp power strokes, while

  6. J.M. Butler DNA Statistics Lockheed Martin BEACON Lecture Series

    E-Print Network [OSTI]

    Lecture Rockville, MD August 19, 2009 NIST Applied Genetics Group Margaret Kline Jan Redman Amy Decker chromosome cell nucleus Double stranded DNA molecule Individual nucleotides 22 pairs + XX or XY ~3 billion

  7. Effect of salt concentration on the stability of heterogeneous DNA

    E-Print Network [OSTI]

    Amar Singh; Navin Singh

    2015-09-28

    We study the role of cations on the stability of double stranded DNA (dsDNA) molecules.It is known that the two strands of double stranded DNA(dsDNA) have negative charge due to phosphate group. Cations in the form of salt in the solution, act as shielding agents thereby reducing the repulsion between these strands. We study several heterogeneous DNA molecules. We calculate the phase diagrams for DNA molecules in thermal as well as in force ensembles using Peyrard-Bishop-Dauxois (PBD) model. The dissociation and the stacking energies are the two most important factors that play an important role in the DNA stability. With suitable modifications in the model parameters we investigate the role of cation concentration on the stability of different heterogeneous DNA molecules. The objective of this work is to understand how these cations modify the strength of different pairs or bases along the strand. The phase diagram for the force ensemble case (a dsDNA is pulled from an end) is compared with the experimental results.

  8. Selective chemical labelling of natural T modifications in DNA

    E-Print Network [OSTI]

    Hardisty, Robyn E.; Kawasaki, Fumiko; Sahakyan, Aleksandr B.; Balasubramanian, Shankar

    2015-05-06

    enriched, we carried out experiments exploiting the selective reactions developed for probes 1, 2, and 3. A double-stranded 80-mer bearing two modifications per strand was used as a model for 5-fU (fU-DNA), while an analogous ODN containing 5-fC (f... C-DNA) and a non-modified ODN (GCAT-DNA) were used as controls (Supporting Information, Table S1). These ODNs were subjected to the biotinylation reaction followed by affinity enrichment using streptavidin- coated magnetic beads. fU-DNA was enriched over f...

  9. Rapid purification of circular DNA by triplex-mediated affinity capture

    DOE Patents [OSTI]

    Ji, Huamin (4817 Sheboygan Ave., Madison, WI 53705); Smith, Lloyd M. (1115 Amherst Dr., Madison, WI 53705)

    1997-01-01

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

  10. Rapid purification of circular DNA by triplex-mediated affinity capture

    DOE Patents [OSTI]

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  11. DNA Double-Strand Breaks Form in Bystander Cells after Microbeam Irradiation of Three-dimensional Human Tissue Models

    E-Print Network [OSTI]

    Brenner, David Jonathan

    Research Accelerator Facility, Center for Radiological Research, College of Physicians and Surgeons Department of Biological Sciences, University of Lethbridge, Lethbridge, Alberta, Canada; and 3 Radiological implications for cancer radiother- apy and diagnostic radiology as well as for human health in general

  12. Polymorphisms in genes involved in DNA double-strand break repair pathway and susceptibility to benzene-induced hematotoxicity

    E-Print Network [OSTI]

    California at Berkeley, University of

    to benzene-induced hematotoxicity Min Shen1,Ã, Qing Lan1 , Luoping Zhang2 , Stephen Chanock1,3 , Guilan Li4; Email: shenmi@mail.nih.gov Benzene is a recognized hematotoxicant and carcinogen that produces genotoxic and indirectly by benzene metabolites. DSB may lead to chromosome aberrations, apoptosis and hematopoietic

  13. J.M. Butler -DNA Quality and Biometrics (Biometric Quality Workshop II)

    E-Print Network [OSTI]

    , 2007 Pete Vallone John Butler Margaret Kline Amy Decker Becky Hill Dave Duewer Jan Redman NIST Human Butler Margaret Kline Amy Decker Becky Hill Dave Duewer Jan Redman NIST Human Identity Project Team · 19 and Probed for Each DNA Marker Examined chromosome cell nucleus Double stranded DNA molecule Individual

  14. Parallel Molecular Computations of Pairwise Exclusive-Or (XOR) Using DNA "String Tile" Self-Assembly

    E-Print Network [OSTI]

    LaBean, Thomas H.

    Parallel Molecular Computations of Pairwise Exclusive-Or (XOR) Using DNA "String Tile" Self-Assembly, we describe the first parallel molecular computation using DNA tiling self-assembly in which a large strands that self-assemble through Watson-Crick base pairing to produce two double helices which

  15. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    SciTech Connect (OSTI)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China) [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China)] [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)] [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China) [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ? To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ? ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ? PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ? The findings suggest that ELF has a protective role against PM. ? The synthetic ELF system could reduce the use of animals in PM-driven ROS testing.

  16. Repair of DNA double strand breaks and radiosensitivity: modulation of DNA repair and radiosensitivity by microRNA-335 and mtPAP

    E-Print Network [OSTI]

    Martin, Nathan

    2014-01-01

    DDR by at least three mechanisms: 1) maintaining ROS homeostasis, 2) mediating apoptotic signals, and 3) producing energy

  17. Thermodynamics of site-specific small molecular ion interactions with DNA duplex: a molecular dynamics study

    E-Print Network [OSTI]

    Ghosh, Soumadwip; Chakrabarti, Rajarshi

    2015-01-01

    The stability and dynamics of a double-stranded DNA (dsDNA) is affected by the preferential occupancy of small monovalent molecular ions. Small metal and molecular ions such as sodium and alkyl ammonium have crucial biological functions in human body, affect the thermodynamic stability of the duplex DNA and exhibit preferential binding. Here, using atomistic molecular dynamics simulations we investigate the preferential binding of metal ion such as Na+ and molecular ions such as tetramethyl ammonium (TMA+) and 2-hydroxy-N,N,N-trimethylethanaminium (CHO+) to double stranded DNA. The thermodynamic driving force for a particular molecular ion- DNA interaction is determined by decomposing the free energy of binding into its entropic and enthalpic contributions. Our simulations show that each of these molecular ions preferentially binds to the minor groove of the DNA and the extent of binding is highest for CHO+. The ion binding processes are found to be entropically favourable. In addition, the contribution of hy...

  18. Shear Unzipping of DNA

    E-Print Network [OSTI]

    Buddhapriya Chakrabarti; David R. Nelson

    2009-04-09

    We study theoretically the mechanical failure of a simple model of double stranded DNA under an applied shear. Starting from a more microscopic Hamiltonian that describes a sheared DNA, we arrive at a nonlinear generalization of a ladder model of shear unzipping proposed earlier by deGennes [deGennes P. G. C. R. Acad. Sci., Ser. IV; Phys., Astrophys. 2001, 1505]. Using this model and a combination of analytical and numerical methods, we study the DNA "unzipping" transition when the shearing force exceeds a critical threshold at zero temperature. We also explore the effects of sequence heterogeneity and finite temperature and discuss possible applications to determine the strength of colloidal nanoparticle assemblies functionalized by DNA.

  19. Photochemistry of psoralen-DNA adducts, biological effects of psoralen-DNA adducts, applications of psoralen-DNA photochemistry

    SciTech Connect (OSTI)

    Shi, Yun-bo

    1988-03-01

    This thesis consists of three main parts and totally eight chapters. In Part I, The author will present studies on the photochemistry of psoralen-DNA adducts, specifically, the wavelength dependencies for the photoreversals of thymidine-HMT (4'-hydroxymethyl-4, 5', 8-trimenthylpsoralen) monoadducts and diadduct and the same adducts incorporated in DNA helices and the wavelength dependecies for the photocrossslinking of thymidine-HMT monoadducts in double-stranded helices. In Part II, The author will report some biological effects of psoralen-DNA adducts, i.e., the effects on double-stranded DNA stability, DNA structure, and transcription by E. coli and T7 RNA polymerases. Finally, The author will focus on the applications of psoralen-DNA photochemistry to investigation of protein-DNA interaction during transcription, which includes the interaction of E. coli and T7 RNA polymerases with DNA in elongation complexes arrested at specific psoralen-DNA adduct sites as revealed by DNase I footprinting experiments. 123 refs., 52 figs., 12 tabs.

  20. Probe and method for DNA detection

    DOE Patents [OSTI]

    Yeh, Hsin-Chih; Werner, James Henry; Sharma, Jaswinder Kumar; Martinez, Jennifer Suzanne

    2013-07-02

    A hybridization probe containing two linear strands of DNA lights up upon hybridization to a target DNA using silver nanoclusters that have been templated onto one of the DNA strands. Hybridization induces proximity between the nanoclusters on one strand and an overhang on the other strand, which results in enhanced fluorescence emission from the nanoclusters.

  1. DNA translocation through nanopores with salt gradients: The role of osmotic flow

    E-Print Network [OSTI]

    Hatlo, Marius M; van Roij, René

    2010-01-01

    Recent experiments of translocation of double stranded DNA through nanopores [M. Wanunu et al. Nature Nanotech. 5, 160 (2010)] reveal that the DNA capture rate can be significantly influenced by a salt gradient across the pore. We show that osmotic flow combined with electrophoresis can quantitatively explain the experimental data on the capture rate. The osmotic flow is induced by the salt gradient across the nanopore, and can be the dominant mechanism for DNA translocation through nanopores with a salt gradient.

  2. Insights into DNA-mediated interparticle interactions from a coarse-grained model

    E-Print Network [OSTI]

    Yajun Ding; Jeetain Mittal

    2015-03-05

    DNA-functionalized particles have great potential for the design of complex self-assembled materials. The major hurdle in realizing crystal structures from DNA-functionalized particles is expected to be kinetic barriers that trap the system in metastable amorphous states. Therefore, it is vital to explore the molecular details of particle assembly processes in order to understand the underlying mechanisms. Molecular simulations based on coarse-grained models can provide a convenient route to explore these details. Most of the currently available coarse-grained models of DNA-functionalized particles ignore key chemical and structural details of DNA behavior. These models therefore are limited in scope for studying experimental phenomena. In this paper, we present a new coarse-grained model of DNA-functionalized particles which incorporates some of the desired features of DNA behavior. The coarse-grained DNA model used here provides explicit DNA representation (at the nucleotide level) and complementary interactions between Watson-Crick base pairs, which lead to the formation of single-stranded hairpin and double-stranded DNA. Aggregation between multiple complementary strands is also prevented in our model. We study interactions between two DNA- functionalized particles as a function of DNA grafting density, lengths of the hybridizing and non-hybridizing parts of DNA, and temperature. The calculated free energies as a function of pair distance between particles qualitatively resemble experimental measurements of DNA-mediated pair interactions.

  3. Electrophoretic detection and separation of mutant DNA using replaceable polymer matrices

    DOE Patents [OSTI]

    Karger, Barry L. (Newton, MA); Thilly, William G. (Winchester, MA); Foret, Frantisek (Malden, MA); Khrapko, Konstaintin (Brookline, MA); Koehavong, Phouthone (Pittsburgh, PA); Cohen, Aharon S. (Newton, MA); Giese, Roger W. (Quincy, MA)

    1997-01-01

    The disclosure relates to a method for resolving double-stranded DNA species differing by at least one base pair. Each of the species is characterized by an iso-melting domain with a unique melting temperature contiguous with a melting domain of higher thermal stability.

  4. Electrophoretic detection and separation of mutant DNA using replaceable polymer matrices

    DOE Patents [OSTI]

    Karger, B.L.; Thilly, W.G.; Foret, F.; Khrapko, K.; Koehavong, P.; Cohen, A.S.; Giese, R.W.

    1997-05-27

    The disclosure relates to a method for resolving double-stranded DNA species differing by at least one base pair. Each of the species is characterized by an iso-melting domain with a unique melting temperature contiguous with a melting domain of higher thermal stability. 18 figs.

  5. Stopped-Flow Studies of the Kinetics of Single-Stranded DNA Binding and Wrapping around the Escherichia coli SSB Tetramer

    E-Print Network [OSTI]

    Lohman, Timothy M.

    the Escherichia coli SSB Tetramer Alexander G. Kozlov and Timothy M. Lohman* Department of Biochemistry in which either one molecule of (dT)70 or two molecules of (dT)35 bind per tetramer. Stopped-flow studies. Our results indicate that initial ssDNA binding to the tetramer is very rapid, with a bimolecular rate

  6. int. j. radiat. biol 2001, vol. 77, no. 2, 155 164 DNA strand break yields after post-high LET irradiation

    E-Print Network [OSTI]

    irradiation incubation with endonuclease-III and evidence for hydroxyl radical clustering J. R. MILLIGAN*, J (DSB) yields after post-high LET irradiation incuba- conditions (Nikjoo et al. 1999), the conclusion DNA in aerobic aqueous solution was irradiated with one of ve radiation types: 137 Cs c-rays (LET

  7. A new type of optical biosensor from DNA wrapped semiconductor graphene ribbons

    E-Print Network [OSTI]

    Anh D. Phan; N. A. Viet

    2012-08-03

    Based on a model of the optical biosensors (Science 311, 508 (2006)) by wrapping a piece of double-stranded DNA around the surface of single-walled carbon nanotubes (SWCNT), we propose a new design model of this sensor, in which the SWCNT is replaced by a semiconductor graphene ribbon (SGR). Using a simple theory of exciton in SGRs, we investigated transition of DNA secondary structure from the native, right-handed B form to the alternate, left-handed Z form. This structural phase transition of DNA is the working principle of this optical biosensor at the sub cellular level from DNA and semiconductor graphene ribbons.

  8. DNA repair decline during mouse spermiogenesis results in the accumulation of heritable DNA damage

    E-Print Network [OSTI]

    Marchetti, Francesco

    2008-01-01

    male germ cells handle DNA damage? Toxicol. Appl. Pharmacol.strand breaks and DNA base damage at different cellularrelationship to genetic damage, Mutat. Res. 216 (1989) 221-

  9. DNA Repair Decline During Mouse Spermiogenesis Results in the Accumulation of Heritable DNA Damage

    E-Print Network [OSTI]

    Marchetti, Francesco

    2008-01-01

    male germ cells handle DNA damage? Toxicol. Appl. Pharmacol.strand breaks and DNA base damage at different cellularrelationship to genetic damage, Mutat. Res. 216 (1989) 221-

  10. ESI/TOF Measurements of a Noncovalent Complex between Lactose Repressor Protein (LacI) and Double-Stranded DNA Containing its Specific Operator Sequence

    E-Print Network [OSTI]

    Ens, Werner

    M buffer solution. Initial attempts to observe the protein tetramer were unsuccessful (as in the case rather broad peaks for both dimer and tetramer. The tetramer appears in two separate envelopes, suggesting that the the charge states 20 to 22 between m/z 7000 and 8000 represent the native tetramer

  11. Plasma induced DNA damage: Comparison with the effects of ionizing radiation

    SciTech Connect (OSTI)

    Lazovi?, S.; Maleti?, D.; Pua?, N.; Malovi?, G.; Petrovi?, Z. Lj.; Leskovac, A.; Filipovi?, J.; Joksi?, G.

    2014-09-22

    We use human primary fibroblasts for comparing plasma and gamma rays induced DNA damage. In both cases, DNA strand breaks occur, but of fundamentally different nature. Unlike gamma exposure, contact with plasma predominantly leads to single strand breaks and base-damages, while double strand breaks are mainly consequence of the cell repair mechanisms. Different cell signaling mechanisms are detected confirming this (ataxia telangiectasia mutated - ATM and ataxia telangiectasia and Rad3 related - ATR, respectively). The effective plasma doses can be tuned to match the typical therapeutic doses of 2?Gy. Tailoring the effective dose through plasma power and duration of the treatment enables safety precautions mainly by inducing apoptosis and consequently reduced frequency of micronuclei.

  12. DNA Sequencing Using capillary Electrophoresis

    SciTech Connect (OSTI)

    Dr. Barry Karger

    2011-05-09

    The overall goal of this program was to develop capillary electrophoresis as the tool to be used to sequence for the first time the Human Genome. Our program was part of the Human Genome Project. In this work, we were highly successful and the replaceable polymer we developed, linear polyacrylamide, was used by the DOE sequencing lab in California to sequence a significant portion of the human genome using the MegaBase multiple capillary array electrophoresis instrument. In this final report, we summarize our efforts and success. We began our work by separating by capillary electrophoresis double strand oligonucleotides using cross-linked polyacrylamide gels in fused silica capillaries. This work showed the potential of the methodology. However, preparation of such cross-linked gel capillaries was difficult with poor reproducibility, and even more important, the columns were not very stable. We improved stability by using non-cross linked linear polyacrylamide. Here, the entangled linear chains could move when osmotic pressure (e.g. sample injection) was imposed on the polymer matrix. This relaxation of the polymer dissipated the stress in the column. Our next advance was to use significantly lower concentrations of the linear polyacrylamide that the polymer could be automatically blown out after each run and replaced with fresh linear polymer solution. In this way, a new column was available for each analytical run. Finally, while testing many linear polymers, we selected linear polyacrylamide as the best matrix as it was the most hydrophilic polymer available. Under our DOE program, we demonstrated initially the success of the linear polyacrylamide to separate double strand DNA. We note that the method is used even today to assay purity of double stranded DNA fragments. Our focus, of course, was on the separation of single stranded DNA for sequencing purposes. In one paper, we demonstrated the success of our approach in sequencing up to 500 bases. Other application papers of sequencing up to this level were also published in the mid 1990's. A major interest of the sequencing community has always been read length. The longer the sequence read per run the more efficient the process as well as the ability to read repeat sequences. We therefore devoted a great deal of time to studying the factors influencing read length in capillary electrophoresis, including polymer type and molecule weight, capillary column temperature, applied electric field, etc. In our initial optimization, we were able to demonstrate, for the first time, the sequencing of over 1000 bases with 90% accuracy. The run required 80 minutes for separation. Sequencing of 1000 bases per column was next demonstrated on a multiple capillary instrument. Our studies revealed that linear polyacrylamide produced the longest read lengths because the hydrophilic single strand DNA had minimal interaction with the very hydrophilic linear polyacrylamide. Any interaction of the DNA with the polymer would lead to broader peaks and lower read length. Another important parameter was the molecular weight of the linear chains. High molecular weight (> 1 MDA) was important to allow the long single strand DNA to reptate through the entangled polymer matrix. In an important paper, we showed an inverse emulsion method to prepare reproducibility linear polyacrylamide polymer with an average MWT of 9MDa. This approach was used in the polymer for sequencing the human genome. Another critical factor in the successful use of capillary electrophoresis for sequencing was the sample preparation method. In the Sanger sequencing reaction, high concentration of salts and dideoxynucleotide remained. Since the sample was introduced to the capillary column by electrokinetic injection, these salt ions would be favorably injected into the column over the sequencing fragments, thus reducing the signal for longer fragments and hence reading read length. In two papers, we examined the role of individual components from the sequencing reaction and then developed a protocol to reduce the deleterio

  13. DNA damage in cells exhibiting radiation-induced genomic instability

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore »that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  14. Normalized cDNA libraries

    DOE Patents [OSTI]

    Soares, M.B.; Efstratiadis, A.

    1997-06-10

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  15. Normalized cDNA libraries

    DOE Patents [OSTI]

    Soares, Marcelo B. (New York, NY); Efstratiadis, Argiris (Englewood, NJ)

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  16. Physicochemical characterization of immortal strand DNA

    E-Print Network [OSTI]

    Lansita, Janice A. (Janice Ann), 1975-

    2004-01-01

    Adult tissue differentiation involves the generation of distinct cell types from adult stem cells (ASCs). Current understanding of tissue differentiation mechanisms is based on studies of protein and RNAs that asymmetrically ...

  17. DNA repair: Dynamic defenders against cancer and aging

    SciTech Connect (OSTI)

    Fuss, Jill O.; Cooper, Priscilla K.

    2006-04-01

    You probably weren't thinking about your body's cellular DNA repair systems the last time you sat on the beach in the bright sunshine. Fortunately, however, while you were subjecting your DNA to the harmful effects of ultraviolet light, your cells were busy repairing the damage. The idea that our genetic material could be damaged by the sun was not appreciated in the early days of molecular biology. When Watson and Crick discovered the structure of DNA in 1953 [1], it was assumed that DNA is fundamentally stable since it carries the blueprint of life. However, over 50 years of research have revealed that our DNA is under constant assault by sunlight, oxygen, radiation, various chemicals, and even our own cellular processes. Cleverly, evolution has provided our cells with a diverse set of tools to repair the damage that Mother Nature causes. DNA repair processes restore the normal nucleotide sequence and DNA structure of the genome after damage [2]. These responses are highly varied and exquisitely regulated. DNA repair mechanisms are traditionally characterized by the type of damage repaired. A large variety of chemical modifications can alter normal DNA bases and either lead to mutations or block transcription if not repaired, and three distinct pathways exist to remove base damage. Base excision repair (BER) corrects DNA base alterations that do not distort the overall structure of the DNA helix such as bases damaged by oxidation resulting from normal cellular metabolism. While BER removes single damaged bases, nucleotide excision repair (NER) removes short segments of nucleotides (called oligonucleotides) containing damaged bases. NER responds to any alteration that distorts the DNA helix and is the mechanism responsible for repairing bulky base damage caused by carcinogenic chemicals such as benzo [a]pyrene (found in cigarette smoke and automobile exhaust) as well as covalent linkages between adjacent pyrimidine bases resulting from the ultraviolet (UV) component of sunlight. NER can be divided into two classes based on where the repair occurs. NER occurring in DNA that is not undergoing transcription (i.e., most of the genome) is called global genome repair (GGR or GGNER), while NER taking place in the transcribed strand of active genes is called transcription-coupled repair (TCR or TC-NER). We will explore NER in more detail below. Mismatch repair (MMR) is another type of excision repair that specifically removes mispaired bases resulting from replication errors. DNA damage can also result in breaks in the DNA backbone, in one or both strands. Single-strand breaks (SSBs) are efficiently repaired by a mechanism that shares common features with the later steps in BER. Double-strand breaks (DSBs) are especially devastating since by definition there is no intact complementary strand to serve as a template for repair, and even one unrepaired DSB can be lethal [3]. In cells that have replicated their DNA prior to cell division, the missing information can be supplied by the duplicate copy, or sister chromatid, and DSBs in these cells are faithfully repaired by homologous recombination involving the exchange of strands of DNA between the two copies. However, most cells in the body are non-dividing, and in these cells the major mechanism for repairing DSBs is by non-homologous end joining (NHEJ), which as the name implies involves joining two broken DNA ends together without a requirement for homologous sequence and which therefore has a high potential for loss of genetic information.

  18. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    SciTech Connect (OSTI)

    Snodin, Benedict E. K. Mosayebi, Majid; Schreck, John S.; Romano, Flavio; Doye, Jonathan P. K.; Randisi, Ferdinando; Šulc, Petr; Ouldridge, Thomas E.; Tsukanov, Roman; Nir, Eyal; Louis, Ard A.

    2015-06-21

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na{sup +}] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.

  19. Introducing Improved Structural Properties and Salt Dependence into a Coarse-Grained Model of DNA

    E-Print Network [OSTI]

    Benedict E. K. Snodin; Ferdinando Randisi; Majid Mosayebi; Petr Sulc; John S. Schreck; Flavio Romano; Thomas E. Ouldridge; Roman Tsukanov; Eyal Nir; Ard A. Louis; Jonathan P. K. Doye

    2015-05-19

    We introduce an extended version of oxDNA, a coarse-grained model of DNA designed to capture the thermodynamic, structural and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves, and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures such as DNA origami which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na$^+$]=0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.

  20. DNA heats up : Energetics of genome ejection from phage revealed by isothermal titration calorimetry

    E-Print Network [OSTI]

    Meerim Jeembaeva; B. Jönsson; Martin Castelnovo; Alex Evilevitch

    2010-01-06

    Most bacteriophages are known to inject their double-stranded DNA into bacteria upon receptor binding in an essentially spontaneous way. This downhill thermodynamic process from the intact virion toward the empty viral capsid plus released DNA is made possible by the energy stored during active packaging of the genome into the capsid. Only indirect measurements of this energy have been available until now using either single-molecule or osmotic suppression techniques. In this paper, we describe for the first time the use of isothermal titration calorimetry to directly measure the heat released (or equivalently the enthalpy) during DNA ejection from phage lambda, triggered in solution by a solubilized receptor. Quantitative analyses of the results lead to the identification of thermodynamic determinants associated with DNA ejection. The values obtained were found to be consistent with those previously predicted by analytical models and numerical simulations. Moreover, the results confirm the role of DNA hydration in the energetics of genome confinement in viral capsids.

  1. An Investigation on Gel Electrophoresis with Quantum Dots End-labeled DNA 

    E-Print Network [OSTI]

    Chen, Xiaojia

    2009-05-15

    explored manipulating DNA fragments by end labeling DNA molecules with quantum dot nanocrystals. The quantum dot-DNA conjugates can be further modified through binding interactions with biotinylated single-stranded DNA primers. Single molecule visualization...

  2. Melatonin Protects Human Cells from Clustered DNA Damages, Killing and Acquisition of Soft Agar Growth Induced by X-rays or 970 MeV/n Fe ions

    SciTech Connect (OSTI)

    Das, B.; Sutherland, B.; Bennett, P. V.; Cutter, N. C.; Sutherland, J. C.

    2011-06-01

    We tested the ability of melatonin (N-acetyl-5 methoxytryptamine), a highly effective radical scavenger and human hormone, to protect DNA in solution and in human cells against induction of complex DNA clusters and biological damage induced by low or high linear energy transfer radiation (100 kVp X-rays, 970 MeV/nucleon Fe ions). Plasmid DNA in solution was treated with increasing concentrations of melatonin (0.0-3.5 mM) and were irradiated with X-rays. Human cells (28SC monocytes) were also irradiated with X-rays and Fe ions with and without 2 mM melatonin. Agarose plugs containing genomic DNA were subjected to Contour Clamped Homogeneous Electrophoretic Field (CHEF) followed by imaging and clustered DNA damages were measured by using Number Average length analysis. Transformation experiments on human primary fibroblast cells using soft agar colony assay were carried out which were irradiated with Fe ions with or without 2 mM melatonin. In plasmid DNA in solution, melatonin reduced the induction of single- and double-strand breaks. Pretreatment of human 28SC cells for 24 h before irradiation with 2 mM melatonin reduced the level of X-ray induced double-strand breaks by {approx}50%, of abasic clustered damages about 40%, and of Fe ion-induced double-strand breaks (41% reduction) and abasic clusters (34% reduction). It decreased transformation to soft agar growth of human primary cells by a factor of 10, but reduced killing by Fe ions only by 20-40%. Melatonin's effective reduction of radiation-induced critical DNA damages, cell killing, and striking decrease of transformation suggest that it is an excellent candidate as a countermeasure against radiation exposure, including radiation exposure to astronaut crews in space travel.

  3. Determining orientation and direction of DNA sequences

    DOE Patents [OSTI]

    Goodwin, Edwin H. (Los Alamos, NM); Meyne, Julianne (Los Alamos, NM)

    2000-01-01

    Determining orientation and direction of DNA sequences. A method by which fluorescence in situ hybridization can be made strand specific is described. Cell cultures are grown in a medium containing a halogenated nucleotide. The analog is partially incorporated in one DNA strand of each chromatid. This substitution takes place in opposite strands of the two sister chromatids. After staining with the fluorescent DNA-binding dye Hoechst 33258, cells are exposed to long-wavelength ultraviolet light which results in numerous strand nicks. These nicks enable the substituted strand to be denatured and solubilized by heat, treatment with high or low pH aqueous solutions, or by immersing the strands in 2.times.SSC (0.3M NaCl+0.03M sodium citrate), to name three procedures. It is unnecessary to enzymatically digest the strands using Exo III or another exonuclease in order to excise and solubilize nucleotides starting at the sites of the nicks. The denaturing/solubilizing process removes most of the substituted strand while leaving the prereplication strand largely intact. Hybridization of a single-stranded probe of a tandem repeat arranged in a head-to-tail orientation will result in hybridization only to the chromatid with the complementary strand present.

  4. Jefferson Lab Hosts Upcoming Science Lectures on DNA and Chocolate...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    lecture on March 29 titled DNA: The Strand That Connects Us All presented by Matt Kaplan from the Human Origins Genotyping Laboratory, Phoenix, Ariz. Kaplan will discuss how...

  5. Reactive Molecular Dynamics study on the first steps of DNA-damage by free hydroxyl radicals

    E-Print Network [OSTI]

    Abolfath, Ramin M; Brabec, Thomas

    2011-01-01

    We employ a large scale molecular simulation based on bond-order ReaxFF to simulate the chemical reaction and study the damage to a large fragment of DNA-molecule in the solution by ionizing radiation. We illustrate that the randomly distributed clusters of diatomic OH-radicals that are primary products of megavoltage ionizing radiation in water-based systems are the main source of hydrogen-abstraction as well as formation of carbonyl- and hydroxyl-groups in the sugar-moiety that create holes in the sugar-rings. These holes grow up slowly between DNA-bases and DNA-backbone and the damage collectively propagate to DNA single and double strand break.

  6. DNA Sequencing apparatus

    DOE Patents [OSTI]

    Tabor, Stanley (Cambridge, MA); Richardson, Charles C. (Chestnut Hill, MA)

    1992-01-01

    An automated DNA sequencing apparatus having a reactor for providing at least two series of DNA products formed from a single primer and a DNA strand, each DNA product of a series differing in molecular weight and having a chain terminating agent at one end; separating means for separating the DNA products to form a series bands, the intensity of substantially all nearby bands in a different series being different, band reading means for determining the position an This invention was made with government support including a grant from the U.S. Public Health Service, contract number AI-06045. The U.S. government has certain rights in the invention.

  7. Suberoylanilide Hydroxyamic Acid Modification of Chromatin Architecture Affects DNA Break Formation and Repair

    SciTech Connect (OSTI)

    Singh, Sheetal; Le Hongan; Shih, S.-J.; Ho, Bay [Department of Radiation Oncology, University of California at Davis, 4501 X St., Sacramento, California 95817 (United States); Vaughan, Andrew T., E-mail: andrew.vaughan@ucdmc.ucdavis.ed [Department of Radiation Oncology, University of California at Davis, 4501 X St., Sacramento, California 95817 (United States); Department of Veterans Affairs, Mather, California 95655 (United States)

    2010-02-01

    Purpose: Chromatin-modifying compounds that inhibit the activity of histone deacetylases have shown potency as radiosensitizers, but the action of these drugs at a molecular level is not clear. Here we investigated the effect of suberoylanilide hydroxyamic acid (SAHA) on DNA breaks and their repair and induction of rearrangements. Methods and Materials: The effect of SAHA on both clonogenic survival and repair was assessed using cell lines SCC-25, MCF7, and TK6. In order to study unique DNA double-strand breaks, anti-CD95 antibody was employed to introduce a DNA double-strand break at a known location within the 11q23 region. The effects of SAHA on DNA cleavage and rearrangements were analyzed by ligation-mediated PCR and inverse PCR, respectively. Results: SAHA acts as radiosensitizer at 1 {mu}M, with dose enhancement factors (DEFs) at 10% survival of: SCC-25 - 1.24 +- 0.05; MCF7 - 1.16 +- 0.09 and TK6 - 1.17 +- 0.05, and it reduced the capacity of SCC-25 cells to repair radiation induced lesions. Additionally, SAHA treatment diffused site-specific fragmentation over at least 1 kbp in TK6 cells. Chromosomal rearrangements produced in TK6 cells exposed to SAHA showed a reduction in microhomology at the breakpoint between 11q23 and partner chromosomes. Conclusions: SAHA shows efficacy as a radiosensitizer at clinically obtainable levels. In its presence, targeted DNA strand breaks occur over an expanded region, indicating increased chromatin access. The rejoining of such breaks is degraded by SAHA when measured as rearrangements at the molecular level and rejoining that contributes to cell survival.

  8. Procedure for normalization of cDNA libraries

    DOE Patents [OSTI]

    Bonaldo, Maria DeFatima (New York, NY); Soares, Marcelo Bento (New York, NY)

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  9. Procedure for normalization of cDNA libraries

    DOE Patents [OSTI]

    Bonaldo, M.D.; Soares, M.B.

    1997-12-30

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

  10. Genome scanning : an AFM-based DNA sequencing technique

    E-Print Network [OSTI]

    Elmouelhi, Ahmed (Ahmed M.), 1979-

    2003-01-01

    Genome Scanning is a powerful new technique for DNA sequencing. The method presented in this thesis uses an atomic force microscope with a functionalized cantilever tip to sequence single stranded DNA immobilized to a mica ...

  11. Probing the Conformational Distributions of Sub-Persistence Length DNA

    SciTech Connect (OSTI)

    Mastroianni, Alexander; Sivak, David; Geissler, Phillip; Alivisatos, Paul

    2009-06-08

    We have measured the bending elasticity of short double-stranded DNA (dsDNA) chains through small-angle X-ray scattering from solutions of dsDNA-linked dimers of gold nanoparticles. This method, which does not require exertion of external forces or binding to a substrate, reports on the equilibrium distribution of bending fluctuations, not just an average value (as in ensemble FRET) or an extreme value (as in cyclization), and in principle provides a more robust data set for assessing the suitability of theoretical models. Our experimental results for dsDNA comprising 42-94 basepairs (bp) are consistent with a simple worm-like chain model of dsDNA elasticity, whose behavior we have determined from Monte Carlo simulations that explicitly represent nanoparticles and their alkane tethers. A persistence length of 50 nm (150 bp) gave a favorable comparison, consistent with the results of single-molecule force-extension experiments on much longer dsDNA chains, but in contrast to recent suggestions of enhanced flexibility at these length scales.

  12. Method for construction of normalized cDNA libraries

    DOE Patents [OSTI]

    Soares, M.B.; Efstratiadis, A.

    1996-01-09

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  13. Method for construction of normalized cDNA libraries

    DOE Patents [OSTI]

    Soares, Marcelo B. (New York, NY); Efstratiadis, Argiris (Englewood, NJ)

    1996-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  14. Casting inorganic structures with DNA molds

    E-Print Network [OSTI]

    Sun, Wei

    We report a general strategy for designing and synthesizing inorganic nanostructures with arbitrarily prescribed three-dimensional shapes. Computationally designed DNA strands self-assemble into a stiff “nanomold” that ...

  15. Analysis of Two Widespread Versions of a Bacterial Replicative DNA Polymerase

    E-Print Network [OSTI]

    Guenther, Joel Michael

    2010-01-01

    metal) by aligning the 3'-hydroxyl of the DNA primer foranalog dUpnpp) by the 3’-hydroxyl of the DNA primer strand.the primer lacks a 3'-hydroxyl. Though the members of the

  16. A novel property of the RecA nucleoprotein filament: activation

    E-Print Network [OSTI]

    Kowalczykowski, Stephen C.

    A novel property of the RecA nucleoprotein filament: activation of double-stranded DNA for strand. Upon binding to single-stranded DNA (ssDNA), RecA protein forms a helical nucleoprotein filament. Normally, this nucleoprotein filament binds double-stranded DNA (dsDNA) and promotes exchange of base pairs

  17. Reconstitution of the cellular response to DNA damage in vitro using damage-activated extracts from mammalian cells

    SciTech Connect (OSTI)

    Roper, Katherine; Coverley, Dawn

    2012-03-10

    In proliferating mammalian cells, DNA damage is detected by sensors that elicit a cellular response which arrests the cell cycle and repairs the damage. As part of the DNA damage response, DNA replication is inhibited and, within seconds, histone H2AX is phosphorylated. Here we describe a cell-free system that reconstitutes the cellular response to DNA double strand breaks using damage-activated cell extracts and naieve nuclei. Using this system the effect of damage signalling on nuclei that do not contain DNA lesions can be studied, thereby uncoupling signalling and repair. Soluble extracts from G1/S phase cells that were treated with etoposide before isolation, or pre-incubated with nuclei from etoposide-treated cells during an in vitro activation reaction, restrain both initiation and elongation of DNA replication in naieve nuclei. At the same time, H2AX is phosphorylated in naieve nuclei in a manner that is dependent upon the phosphatidylinositol 3-kinase-like protein kinases. Notably, phosphorylated H2AX is not focal in naieve nuclei, but is evident throughout the nucleus suggesting that in the absence of DNA lesions the signal is not amplified such that discrete foci can be detected. This system offers a novel screening approach for inhibitors of DNA damage response kinases, which we demonstrate using the inhibitors wortmannin and LY294002. -- Highlights: Black-Right-Pointing-Pointer A cell free system that reconstitutes the response to DNA damage in the absence of DNA lesions. Black-Right-Pointing-Pointer Damage-activated extracts impose the cellular response to DNA damage on naieve nuclei. Black-Right-Pointing-Pointer PIKK-dependent response impacts positively and negatively on two separate fluorescent outputs. Black-Right-Pointing-Pointer Can be used to screen for inhibitors that impact on the response to damage but not on DNA repair. Black-Right-Pointing-Pointer LY294002 and wortmannin demonstrate the system's potential as a pathway focused screening approach.

  18. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOE Patents [OSTI]

    Jett, James H. (Los Alamos, NM); Keller, Richard A. (Los Alamos, NM); Martin, John C. (Los Alamos, NM); Posner, Richard G. (Los Alamos, NM); Marrone, Babetta L. (Los Alamos, NM); Hammond, Mark L. (Los Alamos, NM); Simpson, Daniel J. (Los Alamos, NM)

    1995-01-01

    Method for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand.

  19. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOE Patents [OSTI]

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Posner, R.G.; Marrone, B.L.; Hammond, M.L.; Simpson, D.J.

    1995-04-11

    A method is described for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand. 4 figures.

  20. Neural network computation with DNA strand displacement cascades

    E-Print Network [OSTI]

    Bruck, Jehoshua (Shuki)

    is Alan Turing (1 1 1 1). ? ? 0 ? 1 0 0 0 Human: The scientist I am thinking of was not born in the 20th Alan Turing 0 0 1 1 Claude Shannon 1 0 0 0 Santiago Ramon y Cajal A "read your mind" game Figure S1

  1. Control of DNA Strand Displacement Kinetics Using Toehold Exchange

    E-Print Network [OSTI]

    Zhang, David Yu

    . A. Proc. Natl. Acad. Sci. U.S.A. 2004, 101, 15275. (7) Pei, R.; Taylor, S. K.; Stefanovic, D) Kallenbach, N. R.; Ma, R. I.; Seeman, N. C. Nature 1983, 305, 829. (2) Rothemund, P. Nature 2006, 440, 297. J.; Mills, A. P.; Simmel, F. C.; Neumann, J. L. Nature 2000, 406, 605. (6) Dirks, R. M.; Pierce, N

  2. Neural network computation with DNA strand displacement cascades

    E-Print Network [OSTI]

    Winfree, Erik

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12 S5. In silico training of dual-rail monotone Hopfield associative memories . . . . . . . . . . . . . . . . . . 16 S6. A four-neuron dual-rail monotone Hopfield associative memory;ACTTCAAACCACCACTCTAC TGAGATGAAGTTTGGTGGTGAGATG S5T S2 input (w2,5) S5 T Sf fuel (w5,f) T*S5*T* S5 T S6 gate:output (G5

  3. Unidirectional Scaffold-Strand Arrangement in DNA Origami

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 - 19 Publicationsresearch reveals theUnidirectional

  4. Method for construction of normalized cDNA libraries

    DOE Patents [OSTI]

    Soares, M.B.; Efstratiadis, A.

    1998-11-03

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

  5. Method for construction of normalized cDNA libraries

    DOE Patents [OSTI]

    Soares, Marcelo B. (New York, NY); Efstratiadis, Argiris (Englewood, NJ)

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  6. Solving the Double Digestion Problem as a MixedInteger Linear Program \\Lambda

    E-Print Network [OSTI]

    Zhang, Yin

    Solving the Double Digestion Problem as a Mixed­Integer Linear Program \\Lambda Zhijun Wu y and Yin Zhang z August, 2001 Abstract. The double digestion problem for DNA restriction mapping is known­scale double digestion problems. Key Words. DNA sequencing, restriction mapping, double digestion, NP

  7. Denaturation of DNA at high salt concentrations

    E-Print Network [OSTI]

    Maity, Arghya; Singh, Navin

    2015-01-01

    Cations present in the solution are important for the stability of two negative strands of DNA molecules. Experimental as well as theoretical results show that the DNA molecule is more stable as the concentration of salt (or cations) increases. It is known that the two strands of DNA molecule carry negative charge due to phosphate group along the strands. These cations act as a shielding particles to the two like charge strands. Recently, in an experiment it is shown that there is a critical value in the concentration of salts (or cations) that can stabilize the helical structure of DNA. If one add more salt in the solution beyond this critical value, the stability of the DNA molecule will disrupt. In this work we study the stability of DNA molecules at higher concentrations. How the stability at higher concentration can be explained through some theoretical calculations is the aim of this manuscript. We consider the PBD model with proper modifications that can explain the negative stability of the molecule a...

  8. Denaturation of DNA at high salt concentrations

    E-Print Network [OSTI]

    Arghya Maity; Amar Singh; Navin Singh

    2015-08-19

    Cations present in the solution are important for the stability of two negative strands of DNA molecules. Experimental as well as theoretical results show that the DNA molecule is more stable as the concentration of salt (or cations) increases. It is known that the two strands of DNA molecule carry negative charge due to phosphate group along the strands. These cations act as a shielding particles to the two like charge strands. Recently, in an experiment it is shown that there is a critical value in the concentration of salts (or cations) that can stabilize the helical structure of DNA. If one add more salt in the solution beyond this critical value, the stability of the DNA molecule will disrupt. In this work we study the stability of DNA molecules at higher concentrations. How the stability at higher concentration can be explained through some theoretical calculations is the aim of this manuscript. We consider the PBD model with proper modifications that can explain the negative stability of the molecule at higher concentration. Our findings are in close match with the experimental results.

  9. Radiosensitivity profiles from a panel of ovarian cancer cell lines exhibiting genetic alterations in p53 and disparate DNA-dependent protein kinase activities

    SciTech Connect (OSTI)

    Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.; Nakao, Aki; Guan, Yinghui; Long, Sydney B.T.; Vonguyen, Lien; Chen, David J.; Gray, Joe W; Chen, Fanqing

    2009-09-07

    The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expression levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.

  10. Microfluidic DNA sample preparation method and device

    DOE Patents [OSTI]

    Krulevitch, Peter A. (Pleasanton, CA); Miles, Robin R. (Danville, CA); Wang, Xiao-Bo (San Diego, CA); Mariella, Raymond P. (Danville, CA); Gascoyne, Peter R. C. (Bellaire, TX); Balch, Joseph W. (Livermore, CA)

    2002-01-01

    Manipulation of DNA molecules in solution has become an essential aspect of genetic analyses used for biomedical assays, the identification of hazardous bacterial agents, and in decoding the human genome. Currently, most of the steps involved in preparing a DNA sample for analysis are performed manually and are time, labor, and equipment intensive. These steps include extraction of the DNA from spores or cells, separation of the DNA from other particles and molecules in the solution (e.g. dust, smoke, cell/spore debris, and proteins), and separation of the DNA itself into strands of specific lengths. Dielectrophoresis (DEP), a phenomenon whereby polarizable particles move in response to a gradient in electric field, can be used to manipulate and separate DNA in an automated fashion, considerably reducing the time and expense involved in DNA analyses, as well as allowing for the miniaturization of DNA analysis instruments. These applications include direct transport of DNA, trapping of DNA to allow for its separation from other particles or molecules in the solution, and the separation of DNA into strands of varying lengths.

  11. Assembling semiconductor nanocomposites using DNA replication technologies.

    SciTech Connect (OSTI)

    Heimer, Brandon W.; Crown, Kevin K.; Bachand, George David

    2005-11-01

    Deoxyribonucleic acid (DNA) molecules represent Nature's genetic database, encoding the information necessary for all cellular processes. From a materials engineering perspective, DNA represents a nanoscale scaffold with highly refined structure, stability across a wide range of environmental conditions, and the ability to interact with a range of biomolecules. The ability to mass-manufacture functionalized DNA strands with Angstrom-level resolution through DNA replication technology, however, has not been explored. The long-term goal of the work presented in this report is focused on exploiting DNA and in vitro DNA replication processes to mass-manufacture nanocomposite materials. The specific objectives of this project were to: (1) develop methods for replicating DNA strands that incorporate nucleotides with ''chemical handles'', and (2) demonstrate attachment of nanocrystal quantum dots (nQDs) to functionalized DNA strands. Polymerase chain reaction (PCR) and primer extension methodologies were used to successfully synthesize amine-, thiol-, and biotin-functionalized DNA molecules. Significant variability in the efficiency of modified nucleotide incorporation was observed, and attributed to the intrinsic properties of the modified nucleotides. Noncovalent attachment of streptavidin-coated nQDs to biotin-modified DNA synthesized using the primer extension method was observed by epifluorescence microscopy. Data regarding covalent attachment of nQDs to amine- and thiol-functionalized DNA was generally inconclusive; alternative characterization tools are necessary to fully evaluate these attachment methods. Full realization of this technology may facilitate new approaches to manufacturing materials at the nanoscale. In addition, composite nQD-DNA materials may serve as novel recognition elements in sensor devices, or be used as diagnostic tools for forensic analyses. This report summarizes the results obtained over the course of this 1-year project.

  12. Tensile and thickness swelling properties of strands from

    E-Print Network [OSTI]

    were investigated in this study. Strands from four Louisiana-grown species--willow (Salix spp.), yellow

  13. Marine Mammal Stranding Protocol 1-Do NOT Touch!

    E-Print Network [OSTI]

    Acevedo, Alejandro

    if they cannot find it! 7- Call! In Whatcom County First: Whatcom County Stranding Network (360) 303-3608 Second

  14. Slow closure of denaturation bubbles in DNA: twist matters

    E-Print Network [OSTI]

    Anil Kumar Dasanna; Nicolas Destainville; John Palmeri; Manoel Manghi

    2013-04-24

    The closure of long equilibrated denaturation bubbles in DNA is studied using Brownian dynamics simulations. A minimal mesoscopic model is used where the double-helix is made of two interacting bead-spring freely rotating strands, with a non-zero torsional modulus in the duplex state, $\\kappa_\\phi=$200 to 300 kT. For DNAs of lengths N=40 to 100 base-pairs (bps) with a large initial bubble in their middle, long closure times of 0.1 to 100 microseconds are found. The bubble starts winding from both ends until it reaches a 10 bp metastable state. The final closure is limited by three competing mechanisms depending on $\\kappa_\\phi$ and N: arms diffusion until their alignment, bubble diffusion along the DNA until one end is reached, or local Kramers process (crossing over a torsional energy barrier). For clamped ends or long DNAs, the closure occurs via this latter temperature activated mechanism, yielding for the first time a good quantitative agreement with experiments.

  15. Alternative Methods for Human Identification: Mitochondrial DNA Base Composition Profiling

    E-Print Network [OSTI]

    Perkins, Richard A.

    of nucleotides ­ Base composition of a DNA molecule can be inferred ­ An empirical formula of numbers of A, G, C) · Fully automated ­ Plate stacker holds up to 15 PCR plates ­ Desalting by magnetic bead cleanup · Cleanup are dissociated on injection · DNA molecular masses are measured ­ Forward and reverse strands measured separately

  16. Nanotechnology with DNA DNA Nanodevices

    E-Print Network [OSTI]

    Ludwig-Maximilians-Universität, München

    Nanotechnology with DNA DNA Nanodevices Friedrich C. Simmel* and Wendy U. Dittmer A DNA actuator. Introduction.............285 2. Overview: DNA Nanotechnology.......285 3. Prototypes of Nanomechanical DNA overview of DNA nanotechnology as a whole is given. The most important properties of DNA molecules

  17. Conserved Steps in Eukaryotic DNA Replication

    E-Print Network [OSTI]

    Blow, J. Julian

    and 50 car- bons of deoxyribose. The 10 carbon of the deoxyribose is linked to one of four different of DNA contains all the information necessary to produce new second strands through complementary base the input of chemical energy to break the hydrogen bonds. This energy is derived from hydrolysis of ATP

  18. DNA Mixture DNA Mixture

    E-Print Network [OSTI]

    ;Introductions J.M. Butler ­ Wisconsin DNA Mixture Training May 12, 2009 http://www.cstl.nist.gov/biotech.M. Butler ­ Wisconsin DNA Mixture Training May 12, 2009 http://www.cstl.nist.gov/biotech textbook (now in its 2nd Edition) · STRBase website: http://www.cstl.nist.gov/biotech/strbase/ · Family

  19. Reduced repair capacity of a DNA clustered damage site comprised of 8-oxo-7,8-dihydro-2'-deoxyguanosine and 2-deoxyribonolactone results in an increased mutagenic potential of these lesions

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Cunniffe, Siobhan; O’Neill, Peter; Greenberg, Marc M.; Lomax, Martine E.

    2014-04-01

    A signature of ionizing radiation is the induction of DNA clustered damaged sites. Non-double strand break (DSB) clustered damage has been shown to compromise the base excision repair pathway, extending the lifetimes of the lesions within the cluster, compared to isolated lesions. This increases the likelihood the lesions persist to replication and thus increasing the mutagenic potential of the lesions within the cluster. Lesions formed by ionizing radiation include 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) and 2-deoxyribonolactone (dL). dL poses an additional challenge to the cell as it is not repaired by the short-patch base excision repair pathway. Here we show recalcitrant dL repairmore »is reflected in mutations observed when DNA containing it and a proximal 8-oxodGuo is replicated in Escherichia coli. 8-oxodGuo in close proximity to dL on the opposing DNA strand results in an enhanced frequency of mutation of the lesions within the cluster and a 20 base sequence flanking the clustered damage site in an E. coli based plasmid assay. In vitro repair of a dL lesion is reduced when compared to the repair of an abasic (AP) site and a tetrahydrofuran (THF), and this is due mainly to a reduction in the activity of polymerase ?, leading to retarded FEN1 and ligase 1 activities. This study has given insights in to the biological effects of clusters containing dL.« less

  20. Gel Electrophoresis of Gold-DNA Nanoconjugates

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; Parak, W. J.

    2007-01-01

    Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore »diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less

  1. Hydrogen Atom Loss in Pyrimidine DNA Bases Induced by Low-Energy Electrons: Energetics Predicted by Theory

    E-Print Network [OSTI]

    Simons, Jack

    Hydrogen Atom Loss in Pyrimidine DNA Bases Induced by Low-Energy Electrons: Energetics Predicted In addition to inducing DNA strand breaks, low-energy electrons (LEEs) also have been shown to induce of a hydrogen atom from a DNA base-electron adduct initiates chemical modification of the base, which can cause

  2. Stomach contents of cetaceans stranded in the Canary Islands 19962006

    E-Print Network [OSTI]

    Pierce, Graham

    Stomach contents of cetaceans stranded in the Canary Islands 1996­2006 r. fernandez1 , m.b. santos2, Kogiidae and Ziphiidae, stranded between 1996 and 2006 in the Canary Islands. Cephalopod mandibles (beaks teuthophagous whales. Keywords: feeding, Canary Islands, cetaceans, cephalopods, plastic Submitted 5 August 2008

  3. Marine Mammal Health and Stranding Response I'rogram

    E-Print Network [OSTI]

    Marine Mammal Health and Stranding Response I'rogram: Program Devellopment Plan Prepared by Paul R. Becker, Dean Wilkinson, and Ted I. Lillestolen National Marine Fisheries Service Office of Protected Marine Fisheries Se~wict? #12;Marine Mammal Health and Stranding Response Program: Program Development

  4. Genetic variation in the 16s mitochondrial rDNA gene from Texas and Oklahoma populations of Amblyomma maculatum 

    E-Print Network [OSTI]

    Lostak, Tracy Karon

    2009-05-15

    Single-strand conformation polymorphism was used to detect different haplotypes of the 16S mitochondrial rDNA gene within samples of Gulf Coast ticks, Amblyomma maculatum Koch, collected from Payne County, Oklahoma and Brazos and Refugio Counties...

  5. Use of 2-Aminopurine Fluorescence as a probe of DNA and computational studies of a new class of base analogues 

    E-Print Network [OSTI]

    Wu, Xiaohua

    2012-06-22

    The steady-state and time-resolved fluorescence of 2-aminopurine (2AP) have been used to monitor base dynamics and base stacking interactions in DNA single strands and dinucleotides, and to investigate the interactions ...

  6. Elastic and Proton Dynamics of the DNA

    E-Print Network [OSTI]

    V. L. Golo

    2008-03-28

    The subject of this report is the dynamics of elastic system in conjunction with hydrogen bonds of the DNA. We draw attention to the draw-back of the familiar rod model of the DNA, and make a case of constructing models that could accommodate the intrinsic structure of the DNA. In this respect studying the interplay among the elastic system and the protons of the DNA, is of interest, for it could accommodate the inter-strand as well as the tunneling modes of protons. Following this direction, we come to the conclusion that the elastic-proton dynamics may have a bearing on biophysics of the DNA. The phenomenon of point mutations is discussed within this framework.

  7. Storing data encoded DNA in living organisms

    DOE Patents [OSTI]

    Wong; Pak C. (Richland, WA), Wong; Kwong K. (Sugar Land, TX), Foote; Harlan P. (Richland, WA)

    2006-06-06

    Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

  8. Reactivity studies of antitumor active dirhodium compounds with DNA oligonucleotides 

    E-Print Network [OSTI]

    Kang, Mijeong

    2007-04-25

    are clearly less stable. Reaction of cis-[Rh2(DAP)(O2CCH3)3(CH3OH)](O2CCH3) (DAP = 1,12- diazaperylene) with 5'-CTCTCAACTTCC produced a major adduct in which DAP group intercalates between 6A and 7A in the double stranded adduct with the rhodium atom...

  9. Sustainability Double Degree Double Degree Info

    E-Print Network [OSTI]

    Grünwald, Niklaus J.

    Sustainability Double Degree Double Degree Info: · 36 credits in B for graduation. Sustainability Core: Take each course below for a total of 17 -20 credits. Term/Grade Course _____ ____ *NR 350 (4) Sustainable

  10. Nucleolar exit of RNF8 and BRCA1 in response to DNA damage

    SciTech Connect (OSTI)

    Guerra-Rebollo, Marta; Mateo, Francesca; Franke, Kristin; Huen, Michael S.Y.; Lopitz-Otsoa, Fernando; Rodriguez, Manuel S.; Plans, Vanessa; Thomson, Timothy M.

    2012-11-01

    The induction of DNA double-strand breaks (DSBs) elicits a plethora of responses that redirect many cellular functions to the vital task of repairing the injury, collectively known as the DNA damage response (DDR). We have found that, in the absence of DNA damage, the DSB repair factors RNF8 and BRCA1 are associated with the nucleolus. Shortly after exposure of cells to {gamma}-radiation, RNF8 and BRCA1 translocated from the nucleolus to damage foci, a traffic that was reverted several hours after the damage. RNF8 interacted through its FHA domain with the ribosomal protein RPSA, and knockdown of RPSA caused a depletion of nucleolar RNF8 and BRCA1, suggesting that the interaction of RNF8 with RPSA is critical for the nucleolar localization of these DDR factors. Knockdown of RPSA or RNF8 impaired bulk protein translation, as did {gamma}-irradiation, the latter being partially countered by overexpression of exogenous RNF8. Our results suggest that RNF8 and BRCA1 are anchored to the nucleolus through reversible interactions with RPSA and that, in addition to its known functions in DDR, RNF8 may play a role in protein synthesis, possibly linking the nucleolar exit of this factor to the attenuation of protein synthesis in response to DNA damage. -- Highlights: Black-Right-Pointing-Pointer RNF8 and BRCA1 are associated with the nucleolus of undamaged cells. Black-Right-Pointing-Pointer Upon {gamma}-radiation, RNF8 and BRCA1 are translocated from the nucleolus to damage foci. Black-Right-Pointing-Pointer The ribosomal protein RPSA anchors RNF8 to the nucleolus. Black-Right-Pointing-Pointer RNF8 may play previously unsuspected roles in protein synthesis.

  11. Background meeting and technology demonstration: Chromium electroplating of superconductor strand

    SciTech Connect (OSTI)

    NONE

    1995-05-01

    A meeting concerned with electroplating copper onto superconducting wires was held. Topics of discussion were concerned with the market, strand cleanliness, and an improved rinsing system for the process.

  12. Characterizing marine mammal stranding events along the Texas coast 

    E-Print Network [OSTI]

    Mullins, Ruth Louise

    2008-10-10

    The Texas Marine Mammal Stranding Network (TMMSN) is a valuable data resource for the marine mammal community. Limitations of funding and personnel severely impact the ability of the Network to maintain impeccable databases. ...

  13. Characterization of Nb?Sn superconducting strand under pure bending

    E-Print Network [OSTI]

    Harris, David L., S.M. Massachusetts Institute of Technology

    2005-01-01

    Characterizing the strain-dependent behavior of technological Nb?Sn superconducting strand has been an important subject of research for the past 25 years. Most of the effort has focused on understanding the uniaxial tension ...

  14. Induction and Persistence of Large ?H2AX Foci by High Linear Energy Transfer Radiation in DNA-Dependent protein kinase–Deficient Cells

    SciTech Connect (OSTI)

    Bracalente, Candelaria; Ibañez, Irene L.; Molinari, Beatriz; Palmieri, Mónica; Kreiner, Andrés; Valda, Alejandro; and others

    2013-11-15

    Purpose: To evaluate the cell response to DNA double-strand breaks induced by low and high linear energy transfer (LET) radiations when the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), an essential protein of the nonhomologous end-joining repair pathway, lacks kinase activity. Methods and Materials: CHO10B2, a Chinese hamster ovary cell line, and its derived radiosensitive mutant cell line, irs-20, lacking DNA-PKcs activity, were evaluated after 0 to 3 Gy of ?-rays, plateau and Bragg peak protons, and lithium beams by clonogenic assay, and as a measurement of double-strand breaks, phosphorylated H2AX (?H2AX) foci number and size were quantified by immunocytofluorescence. Results: Irs-20 exhibited greater radiosensitivity and a higher amount of ?H2AX foci than CHO10B2 at 6 hours after irradiation for all types of radiations. Remarkably, CHO10B2 and irs-20 maintained their difference in radiosensitivity after high-LET radiation. Six hours after low-LET radiations, irs-20 did not reach basal levels of ?H2AX at high doses, whereas CHO10B2 recovered basal levels for all doses. After high-LET radiation, only CHO10B2 exhibited a reduction in ?H2AX foci, but it never reached basal levels. Persistent foci in irs-20 confirmed a repair deficiency. Interestingly, after 30 minutes of high-LET radiation both cell lines exhibited large foci (size >0.9 ?m{sup 2}) related to the damage nature, whereas at 6 hours irs-20 showed a higher amount of large foci than CHO10B2, with a 7-fold increase at 3 Gy, that could also be associated to radiosensitivity. Conclusions: We demonstrated, for the first time, an association between deficient DNA-PKcs activity and not only high levels of H2AX phosphorylation but also persistence and size increase of ?H2AX foci after high-LET irradiation.

  15. Elongation of discotic liquid crystal strands and lubricant effects

    E-Print Network [OSTI]

    Surjya Sarathi Bhattacharyya; Yves Galerne

    2014-05-22

    After a short review on the physics of pulled threads and their mechanical properties, the paper reports and discusses on the strand elongation of disordered columnar phases, hexagonal or lamello-columnar, of small molecules or polymers. The mechanical properties appear to be relevant to the length of the columns of molecules compared to the thread length, instead of the usual correlation length. When short, the column entanglement being taken into account, the strand exhibits rather fluid properties that may even look like nematic at a macroscopic scale. Then, the Plateau-Rayleigh instability soon breaks the thread. However, the hydrodynamic objects being the columns instead of the molecules, the viscosity is anomalously large. The observations show that the strands of columnar phases are made of filaments, or fibrils, that indeed are bundles of columns of molecules. They both explain the grooves and rings observed on the antenna or bamboo-like strand profiles. On pulling a strand, the elongation stress eventually exceeds the plasticity threshold, thus breaking columns and filaments. Cracks, more exactly, giant dislocations are thus formed. They change the strand thickness by steps of different birefringence colours. Interestingly, adding a solute may drastically change the effective viscosity of the columnar phase and its mechanical properties. Some solutes as alcanes, exhibit lubricant and detangling properties, while others as triphenylene, are quite anti-lubricant.

  16. Sequence dependent structure and thermodynamics of DNA oligonucleotides and polynucleotides: uv melting and NMR (nuclear magnetic resonance) studies

    SciTech Connect (OSTI)

    Aboul-ela, F.M.

    1987-12-01

    Thermodynamic parameters for double strand formation have been measured for the twenty-five DNA double helices made by mixing deoxyoligonucleotides of the sequence dCA/sub 3/XA/sub 3/G with the complement dCT/sub 3/YT/sub 3/G. Each of the bases A, C, G, T, and I (I = hypoxanthine) have been substituted at the positions labeled X and Y. The results are analyzed in terms of nearest neighbors. At higher temperatures the sequences containing a G)centerreverse arrowdot)C base pair become more stable than those containing only A)centerreverse arrowdot)T. All molecules containing mismatcher are destabilized with respect to those with only Watson-Crick pairing, but there is a wide range of destabilization. Large neighboring base effects upon stability were observed. For example, when (X, Y) = (I, A), the duplex is eightfold more stable than when (X, Y) = (A, I). Independent of sequence effects the order of stabilities is: I)centerreverse arrowdot)C )succ) I)centerreverse arrowdot) A)succ) I)centerreverse arrowdot)T approx. I)centerreverse arrowdot)G. All of these results are discussed within the context of models for sequence dependent DNA secondary structure, replication fidelity and mechanisms of mismatch repair, and implications for probe design. The duplex deoxyoligonucleotide d(GGATGGGAG))centerreverse arrowdot)d(CTCCCATCC) is a portion of the gene recognition sequence of the protein transcription factor IIIA. The crystal structure of this oligonucleotide was shown to be A-form The present study employs Nuclear Magnetic Resonance, optical, chemical and enzymatic techniques to investigate the solution structure of this DNA 9-mer. (157 refs., 19 figs., 10 tabs.

  17. The Crystal Structure of a Junction Between Two Z-DNA Helices

    E-Print Network [OSTI]

    Rich, Alexander

    The double helix of DNA, when composed of dinucleotide purine-pyrimidine repeats, can adopt a left-handed helical structure called Z-DNA. For reasons not entirely understood, such dinucleotide repeats in genomic sequences ...

  18. Hepatitis C virus NS3/4A protein interacts with ATM, impairs DNA repair and enhances sensitivity to ionizing radiation

    SciTech Connect (OSTI)

    Lai, Chao-Kuen; Jeng, King-Song [Institute of Molecular Biology, Academia Sinica, Taipei, 115, Taiwan (China); Machida, Keigo [Department of Molecular Microbiology and Immunology, University of Southern California, Keck School of Medicine, 2001 Zonal Avenue, Los Angeles, CA 90033 (United States); Cheng, Yi-Sheng [Institute of Molecular Biology, Academia Sinica, Taipei, 115, Taiwan (China); Lai, Michael M.C. [Institute of Molecular Biology, Academia Sinica, Taipei, 115, Taiwan (China); Department of Molecular Microbiology and Immunology, University of Southern California, Keck School of Medicine, 2001 Zonal Avenue, Los Angeles, CA 90033 (United States)], E-mail: michlai@gate.sinica.edu.tw

    2008-01-20

    Hepatitis C virus (HCV) infection is frequently associated with the development of hepatocellular carcinomas and non-Hodgkin's B-cell lymphomas. Nonstructural protein 3 (NS3) of HCV possesses serine protease, nucleoside triphosphatase, and helicase activities, while NS4A functions as a cofactor for the NS3 serine protease. Here, we show that HCV NS3/4A interacts with the ATM (ataxia-telangiectasia mutated), a cellular protein essential for cellular response to irradiation. The expression of NS3/4A caused cytoplasmic translocation of either endogenous or exogenous ATM and delayed dephosphorylation of the phosphorylated ATM and {gamma}-H2AX following ionizing irradiation. As a result, the irradiation-induced {gamma}-H2AX foci persisted longer in the NS3/4A-expressing cells. Furthermore, these cells showed increased comet tail moment in single-cell electrophoresis assay, indicating increased double-strand DNA breaks. The cells harboring an HCV replicon also exhibited cytoplasmic localization of ATM and increased sensitivity to irradiation. These results demonstrate that NS3/4A impairs the efficiency of DNA repair by interacting with ATM and renders the cells more sensitive to DNA damage. This effect may contribute to HCV oncogenesis.

  19. Nikon Instruments Inc. | Resource Center -Research Papers -New insights into DNA repair http://www.nikoninstruments.com/Resource-Center/Research-Papers/New-insights-into-DNA-repair[4/10/2012 10:42:30 AM

    E-Print Network [OSTI]

    Kowalczykowski, Stephen C.

    Nikon Instruments Inc. | Resource Center - Research Papers - New insights into DNA repair http:42:30 AM] change locationAMS EN Nikon Instruments Inc. on Facebook Like You like th Page · Ins Resource constrain available 3D conformations and slow the rate of homologous pairing while longer ssDNA strands

  20. Mechanism for Damage to DNA by Low-Energy Electrons Robyn Barrios, Piotr Skurski, and Jack Simons*

    E-Print Network [OSTI]

    Simons, Jack

    Mechanism for Damage to DNA by Low-Energy Electrons Robyn Barrios, Piotr Skurski, and Jack Simons electronic structure calculations on a portion of DNA, the results of which provide support for a mechanism that produces single-strand breaks (SSBs) with low-energy electrons. This mechanism involves attaching a low

  1. Generation of DNA-Damaging Reactive Oxygen Species via the Autoxidation of Hydrogen Sulfide under Physiologically Relevant

    E-Print Network [OSTI]

    Gates, Kent. S.

    Generation of DNA-Damaging Reactive Oxygen Species via the Autoxidation of Hydrogen Sulfide under found that micromolar concentrations of H2S generated single-strand DNA cleavage. Mechanistic studies indicate that this process involved autoxidation of H2S to generate superoxide, hydrogen peroxide, and

  2. DNA sequencing with pyrophosphatase

    DOE Patents [OSTI]

    Tabor, S.; Richardson, C.C.

    1996-03-12

    A kit or solution is disclosed for use in extension of an oligonucleotide primer having a first single-stranded region on a template molecule and having a second single-stranded region homologous to the first single-stranded region. The first agent is able to cause extension of the first single-stranded region of the primer on the second single-stranded region of the template in a reaction mixture. The second agent is able to reduce the amount of pyrophosphate in the reaction mixture below the amount produced during the extension in the absence of the second agent.

  3. Method for fabricating multi-strand superconducting cable

    DOE Patents [OSTI]

    Borden, A.R.

    1985-04-01

    Multi-strand superconducting cables adapted to be used, for example, to wind a magnet are fabricated by directing wire strands inwardly from spools disposed on the perimeter of a rotating disk and wrapping them diagonally around a tapered mandrel with a flattened cross-sectional shape with a core having a wedge-shaped channel. As the cable is pulled axially, flexibly coupled wedge-shaped pieces are continuously passed through the channel in the mandrel and inserted into the cable as an internal support therefor.

  4. Unveiling Stability Criteria of DNA-Carbon Nanotubes Constructs by Scanning Tunneling Microscopy and Computational Modeling

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kilina, Svetlana; Yarotski, Dzmitry A.; Talin, A. Alec; Tretiak, Sergei; Taylor, Antoinette J.; Balatsky, Alexander V.

    2011-01-01

    We present a combined approach that relies on computational simulations and scanning tunneling microscopy (STM) measurements to reveal morphological properties and stability criteria of carbon nanotube-DNA (CNT-DNA) constructs. Application of STM allows direct observation of very stable CNT-DNA hybrid structures with the well-defined DNA wrapping angle of 63.4 ° and a coiling period of 3.3?nm. Using force field simulations, we determine how the DNA-CNT binding energy depends on the sequence and binding geometry of a single strand DNA. This dependence allows us to quantitatively characterize the stability of a hybrid structure with an optimal ?-stacking between DNA nucleotides andmore »the tube surface and better interpret STM data. Our simulations clearly demonstrate the existence of a very stable DNA binding geometry for (6,5) CNT as evidenced by the presence of a well-defined minimum in the binding energy as a function of an angle between DNA strand and the nanotube chiral vector. This novel approach demonstrates the feasibility of CNT-DNA geometry studies with subnanometer resolution and paves the way towards complete characterization of the structural and electronic properties of drug-delivering systems based on DNA-CNT hybrids as a function of DNA sequence and a nanotube chirality. « less

  5. Double Muscling in Cattle. 

    E-Print Network [OSTI]

    Kieffer, Nat M.; Cartwright, T.C.

    1980-01-01

    ,;J Cover photo: This lO-month-old bull is the product of a two-breed cross. He shows classic symptoms of double muscling and illustrates that the double-muscled gene is the same in different breeds of cattlr Double Muscling ......... In Cattle... Nat M. Kieffer Professor T. C. Cartwright Professor The Texas Agricultural Experiment Station (Department of Animal Science) 2 Contents 2 Summary 3 Introduction 3 Historical Background 4 Physical Characteristics of Double-Muscled Cattle 4...

  6. Chromosome doubling method

    DOE Patents [OSTI]

    Kato, Akio

    2006-11-14

    The invention provides methods for chromosome doubling in plants. The technique overcomes the low yields of doubled progeny associated with the use of prior techniques for doubling chromosomes in plants such as grasses. The technique can be used in large scale applications and has been demonstrated to be highly effective in maize. Following treatment in accordance with the invention, plants remain amenable to self fertilization, thereby allowing the efficient isolation of doubled progeny plants.

  7. DNA Damage Induced by Low-Energy Electrons: Electron Transfer and Diffraction

    SciTech Connect (OSTI)

    Zheng Yi; Wagner, J. Richard; Sanche, Leon [Groupe de Recherche en Sciences des Radiations, Faculte de Medecine, Universite de Sherbrooke, Sherbrooke, QC J1H 5N4 (Canada)

    2006-05-26

    Thin films of the short single strand of DNA, GCAT, in which guanine (G) or adenine (A) have been removed, were bombarded under vacuum by 4 to 15 eV electrons. The fragments corresponding to base release and strand breaks (SB) were analyzed by high performance liquid chromatography and their yields compared with those obtained from unmodified GCAT. From such a comparison, it is shown that, using GCAT as a model system (1) most SB result from electron capture by DNA bases followed by electron transfer to the phosphate group and (2) the initial capture probability depends on the coherence of the electron wave within the tetramer.

  8. Assembly of Multi-Stranded Nanofiber Threads through AC Electrospinning

    E-Print Network [OSTI]

    Chang, Hsueh-Chia

    Assembly of Multi-Stranded Nanofiber Threads through AC Electrospinning By Siddharth Maheshwari and Hsueh-Chia Chang* Electrospinning refers to the formation of micrometer and sub-micrometer fibers under, self-assembly of individual molecules, etc., electrospinning provides a robust method to form long

  9. Tensile and dimensional properties of wood strands made from

    E-Print Network [OSTI]

    the developmentofnewstrand-basedcom- posite lumber as substitutes. The most common composite lumber products on the market, com- posite lumber has gained tremendous market share with projected production volume at 2 million m3- cally phenol-formaldehyde (PF) or emul- sified polymeric isocyanate resins. Strands applied with resin

  10. MCM ring hexamerization is a prerequisite for DNA-binding

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

    2015-09-13

    The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore »hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

  11. Optimal Choice for Number of Strands in a Litz-Wire Transformer Winding

    E-Print Network [OSTI]

    Optimal Choice for Number of Strands in a Litz-Wire Transformer Winding C. R. Sullivan Found Choice for Number of Strands in a Litz-Wire Transformer Winding Charles R. Sullivan Thayer School/inductor Abstract -- The number of strands to minimize loss in a litz-wire transformer winding is determined

  12. Supporting Information Nucleobase Orientation and Ordering in Films of Single-Stranded DNA on Gold

    E-Print Network [OSTI]

    Himpsel, Franz J.

    concentration was confirmed by UV absorption measurements. For (dT)5 and (dT)5-SH immobilization NaCl was used Measurements. The NEXAFS measurements were done in UHV at the undulator beamline 8.0.1 of the Advanced Light- levels. The custom-built setup for NEXAFS measurements has been previously described in ref 7. Briefly

  13. Scalable, Time-Responsive, Digital, Energy-Efficient Molecular Circuits using DNA Strand Displacement

    E-Print Network [OSTI]

    Doty, David

    by different types of fuel. Finally, we require input to be given according to the dual- rail convention, so expended to maintain correct output concentrations even at steady-state. In addition, our fuel species in the circuit is powered by its own specific type of fuel species. Hence different circuits must be powered

  14. The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands

    E-Print Network [OSTI]

    Winfree, Erik

    and Jeannie. I want to acknowledge all my family and friends for their support. A journey is made all the richer for having good company, and I would not have made it nearly as far without all the encouragement to obtain an analytic solution for most problem sizes of interest. Thus the primary means of exploring

  15. Distinct kinetics of human DNA ligases I, IIIalpha, IIIbeta, and IV reveal direct DNA sensing ability and differential physiological functions in DNA repair

    SciTech Connect (OSTI)

    Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.

    2009-05-11

    The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.

  16. The influence of TRP53 in the dose response of radiation-induced apoptosis, DNA repair and genomic stability in murine haematopoietic cells

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Lemon, Jennifer A.; Taylor, Kristina; Verdecchia, Kyle; Phan, Nghi; Boreham, Douglas R.

    2014-01-01

    Apoptotic and DNA damage endpoints are frequently used as surrogate markers of cancer risk, and have been well-studied in the Trp53+/- mouse model. We report the effect of differing Trp53 gene status on the dose response of ionizing radiation exposures (0.01-2 Gy), with the unique perspective of determining if effects of gene status remain at extended time points. Here we report no difference in the dose response for radiation-induced DNA double-strand breaks in bone marrow and genomic instability (MN-RET levels) in peripheral blood, between wild-type (Trp53+/+) and heterozygous (Trp53+/-) mice. The dose response for Trp53+/+ mice showed higher initial levelsmore »of radiation-induced lymphocyte apoptosis relative to Trp53+/- between 0 and 1 Gy. Although this trend was observed up to 12 hours post-irradiation, both genotypes ultimately reached the same level of apoptosis at 14 hours, suggesting the importance of late-onset p53-independent apoptotic responses in this mouse model. Expected radiation-induced G1 cell cycle delay was observed in Trp53+/+ but not Trp53+/-. Although p53 has an important role in cancer risk, we have shown its influence on radiation dose response can be temporally variable. This research highlights the importance of caution when using haematopoietic endpoints as surrogates to extrapolate radiation-induced cancer risk estimation.« less

  17. Selective transformations between nanoparticle superlattices via the reprogramming of DNA-mediated interactions

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhang, Yugang; Pal, Suchetan; Srinivasan, Babji; Vo, Thi; Kumar, Sanat; Gang, Oleg

    2015-05-25

    The rapid development of self-assembly approaches has enabled the creation of materials with desired organization of nanoscale components. However, achieving dynamic control, wherein the system can be transformed on demand into multiple entirely different states, is typically absent in atomic and molecular systems and has remained elusive in designed nanoparticle systems. Here, we demonstrate with in situ small-angle x-ray scattering that, by using DNA strands as inputs, the structure of a three-dimensional lattice of DNA-coated nanoparticles can be switched from an initial 'mother' phase into one of multiple 'daughter' phases. The introduction of different types of re-programming DNA strands modifiesmore »the DNA shells of the nanoparticles within the superlattice, thereby shifting interparticle interactions to drive the transformation into a particular daughter phase. We mapped quantitatively with free-energy calculations the selective re-programming of interactions onto the observed daughter phases.« less

  18. A new structural framework for integrating replication protein A into DNA processing machinery

    SciTech Connect (OSTI)

    Brosey, Chris; Yan, Chunli; Tsutakawa, Susan; Heller, William; Rambo, Robert; Tainer, John; Ivanov, Ivaylo; Chazin, Walter

    2013-01-17

    By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA's DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA's DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamic on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways.

  19. Improvements in strand feeding and its effect of sintering performance

    SciTech Connect (OSTI)

    Beer, H.; Kersting, K.; Werner, P. [Thyssen Stahl AG, Duisburg (Germany)

    1995-12-01

    Sintering may be considered a rather simple, counter current gas-solid process. A bed of granular solids is moved horizontally on a strand of pallets and suction is applied beneath the grate. Shortly after the sinter mix is fed onto the strand the incorporated solid fuel is ignited in the surface layer and the hot gases are drawn into the bed. The temperature of the top layer is raised high enough to burn the fuel particles while air is sucked down through it. Passing the upper, already sintered part of the bed the air is first preheated then sustains the combustion reaction. The hot, still oxygen-rich combustion gases leave the sintering zone and transfer its heat to the charge below. While the solids are preheated, carbonates, combined water, and moisture are driven off, rapidly cooling the gas. Thus, a flame front propagates through the traveling bed, generating at peak temperatures enough heat to agglomerate the bed of quasi-particles into a sinter cake. The strand speed is adjusted so that the burning through of the combustion zone coincides with the end of the suction area. To ensure stable operation this cross stream reactor has to be kept in a steady state.

  20. A New DNA Binding Protein Highly Conserved in Diverse Crenarchaeal Viruses

    SciTech Connect (OSTI)

    Larson, E.T.; Eilers, B.J.; Reiter, D.; Ortmann, A.C.; Young, M.J.; Lawrence, C.M.; /Montana State U. /Tubingen U.

    2007-07-09

    Sulfolobus turreted icosahedral virus (STIV) infects Sulfolobus species found in the hot springs of Yellowstone National Park. Its 37 open reading frames (ORFs) generally lack sequence similarity to other genes. One exception, however, is ORF B116. While its function is unknown, orthologs are found in three additional crenarchaeal viral families. Due to the central importance of this protein family to crenarchaeal viruses, we have undertaken structural and biochemical studies of B116. The structure reveals a previously unobserved fold consisting of a five-stranded beta-sheet flanked on one side by three alpha helices. Two subunits come together to form a homodimer with a 10-stranded mixed beta-sheet, where the topology of the central strands resembles an unclosed beta-barrel. Highly conserved loops rise above the surface of the saddle-shaped protein and suggest an interaction with the major groove of DNA. The predicted B116-DNA interaction is confirmed by electrophoretic mobility shift assays.

  1. APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2011, p. 76637668 Vol. 77, No. 21 0099-2240/11/$12.00 doi:10.1128/AEM.00289-11

    E-Print Network [OSTI]

    Bae, Jin-Woo

    . Amplification Methods Bias Metagenomic Libraries of Uncultured Single-Stranded and Double-Stranded DNA Viruses amplified shotgun library (LASL) and multiple displacement amplification (MDA) methods, were applied from different libraries. The resulting taxonomic classifications of the viruses, their functional

  2. BioMed Central Page 1 of 13

    E-Print Network [OSTI]

    Weller, Jennifer Walsh

    package. 21 ± 13% of the nucleotides in each probe binding site are within a double-stranded structure of a long single-stranded labeled DNA or RNA target molecule to shorter oligonu- cleotide probes

  3. Control of Strand Scission by Type IIA Topoisomerases

    E-Print Network [OSTI]

    Schmidt, Bryan Harris

    2012-01-01

    DNA synthesizer Oligo resuspension and annealing for use intag. As such, after resuspension in Buffer A (withoutFollowing a column wash in resuspension buffer, tagged topo

  4. Metal-Dependent DNA Cleavage Mechanism of the I-CreI LAGLIDADG Homing Endonuclease,

    E-Print Network [OSTI]

    Monnat, Ray

    Metal-Dependent DNA Cleavage Mechanism of the I-CreI LAGLIDADG Homing Endonuclease, Brett Chevalier-SceI indicate that three catalytic divalent metal ions are distributed across a pair of overlapping active sites, with one shared metal participating in both strand cleavage reactions. These structures differ

  5. DNA nanotechnology: understanding and optimisation through simulation

    E-Print Network [OSTI]

    Thomas E. Ouldridge

    2014-11-07

    DNA nanotechnology promises to provide controllable self-assembly on the nanoscale, allowing for the design of static structures, dynamic machines and computational architectures. In this article I review the state-of-the art of DNA nanotechnology, highlighting the need for a more detailed understanding of the key processes, both in terms of theoretical modelling and experimental characterisation. I then consider coarse-grained models of DNA, mesoscale descriptions that have the potential to provide great insight into the operation of DNA nanotechnology if they are well designed. In particular, I discuss a number of nanotechnological systems that have been studied with oxDNA, a recently developed coarse-grained model, highlighting the subtle interplay of kinetic, thermodynamic and mechanical factors that can determine behaviour. Finally, new results highlighting the importance of mechanical tension in the operation of a two-footed walker are presented, demonstrating that recovery from an unintended `overstepped' configuration can be accelerated by three to four orders of magnitude by application of a moderate tension to the walker's track. More generally, the walker illustrates the possibility of biasing strand-displacement processes to affect the overall rate.

  6. Fast DNA Sequencing via Transverse Electronic Transport

    E-Print Network [OSTI]

    Johan Lagerqvist; Michael Zwolak; Massimiliano Di Ventra

    2006-03-01

    A rapid and low-cost method to sequence DNA would usher in a revolution in medicine. We propose and theoretically show the feasibility of a protocol for sequencing based on the distributions of transverse electrical currents of single-stranded DNA while it translocates through a nanopore. Our estimates, based on the statistics of these distributions, reveal that sequencing of an entire human genome could be done with very high accuracy in a matter of hours without parallelization, e.g., orders of magnitude faster than present techniques. The practical implementation of our approach would represent a substantial advancement in our ability to study, predict and cure diseases from the perspective of the genetic makeup of each individual.

  7. Materials, Strands, and Cables for Superconducting Accelerator Magnets. Final Report

    SciTech Connect (OSTI)

    Sumption, Mike D.; Collings, Edward W.

    2014-09-19

    This report focuses on Materials, Strands and Cables for High Energy Physics Particle accelerators. In the materials area, work has included studies of basic reactions, diffusion, transformations, and phase assemblage of Nb3Sn. These materials science aspects have been married to results, in the form of flux pinning, Bc2, Birr, and transport Jc, with an emphasis on obtaining the needed Jc for HEP needs. Attention has also been paid to the “intermediate-temperature superconductor”, magnesium diboride emphasis being placed on (i) irreversibility field enhancement, (ii) critical current density and flux pinning, and (iii) connectivity. We also report on studies of Bi-2212. The second area of the program has been in the area of “Strands” in which, aside from the materials aspect of the conductor, its physical properties and their influence on performance have been studied. Much of this work has been in the area of magnetization estimation and flux jump calculation and control. One of the areas of this work was strand instabilities in high-performance Nb3Sn conductors due to combined fields and currents. Additionally, we investigated quench and thermal propagation in YBCO coated conductors at low temperatures and high fields. The last section, “Cables”, focussed on interstrand contact resistance, ICR, it origins, control, and implications. Following on from earlier work in NbTi, the present work in Nb3Sn has aimed to make ICR intermediate between the two extremes of too little contact (no current sharing) and too much (large and unacceptable magnetization and associated beam de-focussing). Interstrand contact and current sharing measurements are being made on YBCO based Roebel cables using transport current methods. Finally, quench was investigated for YBCO cables and the magnets wound from them, presently with a focus on 50 T solenoids for muon collider applications.

  8. Neutrinoless double beta decay

    E-Print Network [OSTI]

    K. Zuber

    2012-01-23

    The physics potential of neutrinoless double beta decay is discussed. Furthermore, experimental considerations are presented as well as the current status of experiments. Finally an outlook towards the future, work on nuclear matrix elements and alternative processes is given.

  9. Double Beta Decay

    E-Print Network [OSTI]

    Steven R. Elliott; Petr Vogel

    2002-02-27

    The motivation, present status, and future plans of the search for the neutrinoless double beta decay are reviewed. It is argued that, motivated by the recent observations of neutrino oscillations, there is a reasonable hope that neutrinoless double beta decay corresponding to the neutrino mass scale suggested by oscillations, of about 50 meV, actually exists. The challenges to achieve the sensitivity corresponding to this mass scale, and plans to overcome them, are described.

  10. Allostery through protein-induced DNA bubbles

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Traverso, Joseph J.; Manoranjan, Valipuram S.; Bishop, A. R.; Rasmussen, Kim Ø.; Voulgarakis, Nikolaos K.

    2015-03-12

    Allostery through DNA is increasingly recognized as an important modulator of DNA functions. Here, we show that the coalescence of protein-induced DNA bubbles can mediate allosteric interactions that drive protein aggregation. We propose that such allostery may regulate DNA's flexibility and the assembly of the transcription machinery. Mitochondrial transcription factor A (TFAM), a dual-function protein involved in mitochondrial DNA (mtDNA) packaging and transcription initiation, is an ideal candidate to test such a hypothesis owing to its ability to locally unwind the double helix. Numerical simulations demonstrate that the coalescence of TFAM-induced bubbles can explain experimentally observed TFAM oligomerization. The resultingmore »melted DNA segment, approximately 10 base pairs long, around the joints of the oligomers act as flexible hinges, which explains the efficiency of TFAM in compacting DNA. Since mitochondrial polymerase (mitoRNAP) is involved in melting the transcription bubble, TFAM may use the same allosteric interaction to both recruit mitoRNAP and initiate transcription.« less

  11. Mechanism of RNA Double Helix-Propagation at Atomic Resolution Srividya Mohan, Chiaolong Hsiao, Halena VanDeusen, Ryan Gallagher, Eric Krohn,

    E-Print Network [OSTI]

    Williams, Loren

    Mechanism of RNA Double Helix-Propagation at Atomic Resolution Srividya Mohan, Chiaolong Hsiao-strand propagation, we propose an atomic resolution reaction mechanism. This mechanism, called the stack. The stack-ratchet mechanism extends and adds detail to the classic zipper model proposed by Porschke

  12. Specificity, flexibility and valence of DNA bonds guide emulsion architecture

    E-Print Network [OSTI]

    Lang Feng; Lea-Laetitia Pontani; Remi Dreyfus; Paul Chaikin; Jasna Brujic

    2013-03-25

    The specificity and thermal reversibility of DNA interactions have enabled the self-assembly of crystal structures, self-replicating materials and colloidal molecules. Grafting DNA onto liquid interfaces of emulsions leads to exciting new architectural possibilities due to the mobility of the DNA ligands and the patches they form between bound droplets. Here we show that the size and number of these adhesion patches (valency) can be controlled. Valence 2 leads to flexible polymers of emulsion droplets, while valence above 4 leads to rigid droplet networks. A simple thermodynamic model quantitatively describes the increase in the patch size with droplet radii, DNA concentration and the stiffness of the tether to the sticky-end. The patches are formed between droplets with complementary DNA strands or alternatively with complementary colloidal nanoparticles to mediate DNA binding between droplets. This emulsion system opens the route to directed self-assembly of more complex structures through distinct DNA bonds with varying strengths and controlled valence and flexibility.

  13. Advance the DNA computing 

    E-Print Network [OSTI]

    Qiu, Zhiquan Frank

    2004-09-30

    It has been previously shown that DNA computing can solve those problems currently intractable on even the fastest electronic computers. The algorithm design for DNA computing, however, is not straightforward. A strong background in both the DNA...

  14. A matterless double slit

    E-Print Network [OSTI]

    B. King; A. Di Piazza; C. H. Keitel

    2013-01-29

    Double-slits provide incoming photons with a choice. Those that survive the passage have chosen from two possible paths which interfere to distribute them in a wave-like manner. Such wave-particle duality continues to be challenged and investigated in a broad range of disciplines with electrons, neutrons, helium atoms, C60 fullerenes, Bose-Einstein condensates and biological molecules. All variants have hitherto involved material constituents. We present a matterless double-slit scenario in which photons generated from virtual electron-positron pair annihilation in head-on collisions of a probe laser field with two ultra-intense laser beams form a double-slit interference pattern. Such electromagnetic fields are predicted to induce material-like behaviour in the vacuum, supporting elastic scattering between photons. Our double-slit scenario presents on the one hand a realisable method to observe photon-photon scattering, and demonstrates on the other, the possibility of both controlling light with light and non-locally investigating features of the quantum vacuum's structure.

  15. Double resonator cantilever accelerometer

    DOE Patents [OSTI]

    Koehler, D.R.

    1982-09-23

    A digital quartz accelerometer includes a pair of spaced double-ended tuning forks fastened at one end to a base and at the other end through a spacer mass. Transverse movement of the resonator members stresses one and compresses the other, providing a differential frequency output which is indicative of acceleration.

  16. Neutrinoless Double Beta Decay

    E-Print Network [OSTI]

    Heinrich Päs; Werner Rodejohann

    2015-07-01

    We review the potential to probe new physics with neutrinoless double beta decay $(A,Z) \\to (A,Z+2) + 2 e^-$. Both the standard long-range light neutrino mechanism as well as short-range mechanisms mediated by heavy particles are discussed. We also stress aspects of the connection to lepton number violation at colliders and the implications for baryogenesis.

  17. Neutrinoless double beta decay

    E-Print Network [OSTI]

    Petr Vogel

    2006-11-17

    The status of the search for neutrinoless double beta decay is reviewed. The effort to reach the sensitivity needed to cover the effective Majorana neutrino mass corresponding to the degenerate and inverted mass hierarchy is described. Various issues concerning the theory (and phenomenology) of the relation between the $0\

  18. Neutrinoless Double Beta Decay

    E-Print Network [OSTI]

    Päs, Heinrich

    2015-01-01

    We review the potential to probe new physics with neutrinoless double beta decay $(A,Z) \\to (A,Z+2) + 2 e^-$. Both the standard long-range light neutrino mechanism as well as short-range mechanisms mediated by heavy particles are discussed. We also stress aspects of the connection to lepton number violation at colliders and the implications for baryogenesis.

  19. Characteristics of Cu stabilized Nb3Al strands with low Cu ratio

    SciTech Connect (OSTI)

    Kikuchi, A.; Yamada, R.; Barzi, E.; Kobayashi, M.; Lamm, M.; Nakagawa, K.; Sasaki, K.; Takeuchi, T.; Turrioni, D.; Zlobin, A.V.; /NIMC, Tsukuba /Fermilab /Hitachi, Tsuchiura Works /KEK, Tsukuba

    2008-12-01

    Characteristics of recently developed F4-Nb{sub 3}Al strand with low Cu ratio are described. The overall J{sub c} of the Nb{sub 3}Al strand could be easily increased by decreasing of the Cu ratio. Although the quench of a pulse-like voltage generation is usually observed in superconducting unstable conductor, the F4 strand with a low Cu ratio of 0.61 exhibited an ordinary critical transition of gradual voltage generation. The F4 strand does not have magnetic instabilities at 4.2 K because of the tantalum interfilament matrix. The overall J{sub c} of the F4 strand achieved was 80-85% of the RRP strand. In the large mechanical stress above 100 MPa, the overall J{sub c} of the F4 strand might be comparable to that of high J{sub c} RRP-Nb{sub 3}Sn strands. The Rutherford cable with a high packing factor of 86.5% has been fabricated using F4 strands. The small racetrack magnet, SR07, was also fabricated by a 14 m F4 cable. The quench current, I{sub q}, of SR07 were obtained 22.4 kA at 4.5 K and 25.2 kA at 2.2 K. The tantalum matrix Nb{sub 3}Al strands are promising for the application of super-cooled high-field magnets as well as 4.2 K operation magnets.

  20. Inter-strand current sharing and ac loss measurements in superconducting YBCO Roebel cables

    SciTech Connect (OSTI)

    sumption, Mike; Majoros, Milan; Collings, E. W.; Van der Laan, D. C.

    2014-11-07

    A Roebel cable, one twist pitch long, was modified from its as-received state by soldering copper strips between the strands to provide inter-strand connections enabling current sharing. Various DC transport currents (representing different percentages of its critical current) were applied to a single strand of such a modified cable at 77 K in a liquid nitrogen bath. Simultaneous monitoring of I–V curves in different parts of the strand as well as in its interconnections with other strands was made using a number of sensitive Keithley nanovoltmeters in combination with a multichannel high-speed data acquisition card, all controlled via LabView software. Current sharing onset was observed at about 1.02 of strand Ic. At a strand current of 1.3Ic about 5% of the current was shared through the copper strip interconnections. A finite element method modeling was performed to estimate the inter-strand resistivities required to enable different levels of current sharing. The relative contributions of coupling and hysteretic magnetization (and loss) were compared, and for our cable and tape geometry, and at dB/dt=1 T s-1, and our inter-strand resistance of 0.77 m?, (enabling a current sharing of 5% at 1.3Ic ) the coupling component was 0.32% of the hysteretic component. However, inter-strand contact resistance values of 100–1000 times smaller (close to those of NbTi and Nb3Sn based accelerator cables) would make the coupling components comparable in size to the hysteretic components.

  1. Inter-strand current sharing and ac loss measurements in superconducting YBCO Roebel cables

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Majoros, M.; Sumption, M. D.; Collings, E. W.; Long, N. J.

    2015-04-08

    A Roebel cable, one twist pitch long, was modified from its as-received state by soldering copper strips between the strands to provide inter-strand connections enabling current sharing. Various DC transport currents (representing different percentages of its critical current) were applied to a single strand of such a modified cable at 77 K in a liquid nitrogen bath. Simultaneous monitoring of I–V curves in different parts of the strand as well as in its interconnections with other strands was made using a number of sensitive Keithley nanovoltmeters in combination with a multichannel high-speed data acquisition card, all controlled via LabView software.more »Current sharing onset was observed at about 1.02 of strand Ic. At a strand current of 1.3Ic about 5% of the current was shared through the copper strip interconnections. A finite element method modeling was performed to estimate the inter-strand resistivities required to enable different levels of current sharing. The relative contributions of coupling and hysteretic magnetization (and loss) were compared, and for our cable and tape geometry, and at dB/dt=1 T s-1, and our inter-strand resistance of 0.77 m?, (enabling a current sharing of 5% at 1.3Ic) the coupling component was 0.32% of the hysteretic component. However, inter-strand contact resistance values of 100–1000 times smaller (close to those of NbTi and Nb3Sn based accelerator cables) would make the coupling components comparable in size to the hysteretic components.« less

  2. Inter-strand current sharing and ac loss measurements in superconducting YBCO Roebel cables

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    sumption, Mike; Majoros, Milan; Collings, E. W.; Van der Laan, D. C.

    2014-11-07

    A Roebel cable, one twist pitch long, was modified from its as-received state by soldering copper strips between the strands to provide inter-strand connections enabling current sharing. Various DC transport currents (representing different percentages of its critical current) were applied to a single strand of such a modified cable at 77 K in a liquid nitrogen bath. Simultaneous monitoring of I–V curves in different parts of the strand as well as in its interconnections with other strands was made using a number of sensitive Keithley nanovoltmeters in combination with a multichannel high-speed data acquisition card, all controlled via LabView software.more »Current sharing onset was observed at about 1.02 of strand Ic. At a strand current of 1.3Ic about 5% of the current was shared through the copper strip interconnections. A finite element method modeling was performed to estimate the inter-strand resistivities required to enable different levels of current sharing. The relative contributions of coupling and hysteretic magnetization (and loss) were compared, and for our cable and tape geometry, and at dB/dt=1 T s-1, and our inter-strand resistance of 0.77 m?, (enabling a current sharing of 5% at 1.3Ic ) the coupling component was 0.32% of the hysteretic component. However, inter-strand contact resistance values of 100–1000 times smaller (close to those of NbTi and Nb3Sn based accelerator cables) would make the coupling components comparable in size to the hysteretic components.« less

  3. DNA Engine Thermal Cycler

    E-Print Network [OSTI]

    Raizada, Manish N.

    ® Peltier Thermal Cycler PTC-0200 DNA Engine Cycler Operations Manual Version 4.0 #12;ii Tech Support: 1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .vi The DNA Engine® Peltier Thermal Cycler Introduction

  4. Structural and mechanistic insights into Mcm2-7 double-hexamer assembly and function

    SciTech Connect (OSTI)

    Sun, Jingchuan; Li, Huilin; Fernandez-Cid, Alejandra; Riera, Alberto; Tognetti, Sivia; Yuan, Zuanning; Stillman, Bruce; Speck, Christian

    2014-10-15

    Eukaryotic cells license each DNA replication origin during G1 phase by assembling a prereplication complex that contains a Mcm2–7 (minichromosome maintenance proteins 2–7) double hexamer. During S phase, each Mcm2–7 hexamer forms the core of a replicative DNA helicase. However, the mechanisms of origin licensing and helicase activation are poorly understood. The helicase loaders ORC–Cdc6 function to recruit a single Cdt1–Mcm2–7 heptamer to replication origins prior to Cdt1 release and ORC–Cdc6–Mcm2–7 complex formation, but how the second Mcm2–7 hexamer is recruited to promote double-hexamer formation is not well understood. Here, structural evidence for intermediates consisting of an ORC–Cdc6–Mcm2–7 complex and an ORC–Cdc6–Mcm2–7–Mcm2–7 complex are reported, which together provide new insights into DNA licensing. Detailed structural analysis of the loaded Mcm2–7 double-hexamer complex demonstrates that the two hexamers are interlocked and misaligned along the DNA axis and lack ATP hydrolysis activity that is essential for DNA helicase activity. Moreover, we show that the head-to-head juxtaposition of the Mcm2–7 double hexamer generates a new protein interaction surface that creates a multisubunit-binding site for an S-phase protein kinase that is known to activate DNA replication. The data suggest how the double hexamer is assembled and how helicase activity is regulated during DNA licensing, with implications for cell cycle control of DNA replication and genome stability.

  5. WHY SEARCH FOR DOUBLE BETA DECAY?

    E-Print Network [OSTI]

    Kayser, B.

    2010-01-01

    the search for neutrinoless double beta decay may prove verySearching for neutrinoless double beta decay is the onlysensitivity of neutrinoless double beta decay. The potential

  6. siRNA-Like Double-Stranded RNAs Are Specifically Protected Against Degradation in Human Cell Extract

    E-Print Network [OSTI]

    Walter, Nils G.

    -access article distributed under the terms of the Creative Commons Attribution License, which permits are credited. Funding: This work was supported by a Camille Dreyfus Teacher-Scholar award and NIH grant GM

  7. Double Beta Decay Experiments

    SciTech Connect (OSTI)

    Nanal, Vandana [Dept. of Nuclear and Atomic Physics, Tata Institute of Fundamental Research, Mumbai 400 005 (India)

    2011-11-23

    At present, neutrinoless double beta decay is perhaps the only experiment that can tell us whether the neutrino is a Dirac or a Majorana particle. Given the significance of the 0{nu}{beta}{beta}, there is a widespread interest for these rare event studies employing a variety of novel techniques. This paper describes the current status of DBD experiments. The Indian effort for an underground NDBD experiment at the upcoming INO laboratory is also presented.

  8. for doubling solar panel

    E-Print Network [OSTI]

    An outline for doubling solar panel efficiency C o l o ra do S c ho o l of M i ne s Ma g a z i ne Take a look at a solar panel on a sunny Colorado day and, if you're like most people, you won't see physics professor and solar energy researcher, who admits to checking out his panels and their energy

  9. Adhesion-Induced DNA Naturation A. E. Allahverdyan,1,2

    E-Print Network [OSTI]

    Adhesion-Induced DNA Naturation A. E. Allahverdyan,1,2 Zh. S. Gevorkian,1,3,4 Chin-Kun Hu,4 and Th of the genetic information. We shall study the adsorption and surface (adhesion) induced naturation of a double some features of DNA (see below), our model predicts two mechanisms of adhesion-induced naturation

  10. Method for introducing unidirectional nested deletions

    DOE Patents [OSTI]

    Dunn, J.J.; Quesada, M.A.; Randesi, M.

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.

  11. A Variational Approach to Strand-Based Modeling of the Human Hand

    E-Print Network [OSTI]

    MacIver, Malcolm A.

    A Variational Approach to Strand-Based Modeling of the Human Hand Elliot R. Johnson2 , Karen Morris muscles and ac- tivation patterns in dynamic motions compared to static contractions, even #12;2 Elliot R

  12. SoundStrand : a tangible interface for composing music with limited degrees of freedom

    E-Print Network [OSTI]

    Shahar, Eyal

    2012-01-01

    This thesis presents SoundStrand, a novel tangible interface for composing music. A new paradigm is also presented - one that allows for music composition with limited degrees of freedom, and therefore is well suited for ...

  13. PHYTOREMEDIATION OF CHLORPYRIFOS BY POPULUS AND Keum Young Lee, Stuart E. Strand, and Sharon L. Doty

    E-Print Network [OSTI]

    Doty, Sharon Lafferty

    PHYTOREMEDIATION OF CHLORPYRIFOS BY POPULUS AND SALIX Keum Young Lee, Stuart E. Strand, and Sharon of chlorpyrifos, several plant species of poplar (Populus sp.) and willow (Salix sp.) were investigated

  14. Round and Extracted Nb3Sn Strand Tests for LARP Magnet R&D

    E-Print Network [OSTI]

    Caspi, Shlomo

    2009-01-01

    Department of Energy. ferent keystone angles were made at Lstrands and 1 degree keystone angle is shown in F i g . 2.INTRODUCTION of strands and keystone angles. Both high field

  15. Magnetization, Low Field Instability and Quench of RHQT Nb(3)Al Strands

    SciTech Connect (OSTI)

    Yamada, R.; Wake, M.; Kikuchi, A.; Velev, V.; /Fermilab

    2009-01-01

    Since 2005, we made and tested three RHQT Nb{sub 3}Al strands, one with Nb matrix and two with Ta matrix, which are fully stabilized with Cu electroplating. We observed anomalously large magnetization curves extending beyond 1 to 1.5 Tesla with the F1 Nb matrix strand at 4.2 K, when we measured its magnetization with a balanced coil magnetometer. This problem was eliminated with the Ta matrix strands operating at 4.2 K. But with these strands a similar but smaller anomalous magnetization was observed at 1.9 K. We studied these phenomena with FEM. With the F1 Nb matrix strand, it is explained that at low external field, inter-filamentary coupling currents in the outer layers of sub-elements create a shielding effect. It reduces the inside field, keeps the inside Nb matrix superconductive, and stands against a higher outside field beyond the Hc of Nb. At an even higher external field, the superconductivity of the whole Nb matrix collapses and releases a large amount of energy, which may cause a big quench. Depending on the size of the energy in the strand or the cable, a magnet could quench, causing the low field instability. Some attempt to analyze the anomaly with FEM is presented.

  16. Magnetization anomaly of Nb3Al strands and instability of Nb3Al Rutherford cables

    SciTech Connect (OSTI)

    Yamada, Ryuji; /Fermilab; Kikuchi, Akihiro; /Tsukuba Magnet Lab; Wake, Masayoshi; /KEK, Tsukuba

    2006-08-01

    Using a Cu stabilized Nb{sub 3}Al strand with Nb matrix, a 30 meter long Nb{sub 3}Al Rutherford cable was made by a collaboration of Fermilab and NIMS. Recently the strand and cable were tested. In both cases instability was observed at around 1.5 Tesla. The magnetization of this Nb{sub 3}Al strand was measured first using a balanced coil magnetometer at 4.2 K. Strands showed an anomalously large magnetization behavior around at 1.6 T, which is much higher than the usual B{sub c2} {approx} 0.5 Tesla (4.2 K) of Nb matrix. This result is compared with the magnetization data of short strand samples using a SQUID magnetometer, in which a flux-jump signal was observed at 0.5 Tesla, but not at higher field. As a possible explanation for this magnetization anomaly, the interfilament coupling through the thin Nb films in the strands is suggested. The instability problem observed in low field tests of the Nb{sub 3}Al Rutherford cables is attributed to this effect.

  17. The influence of TRP53 in the dose response of radiation-induced apoptosis, DNA repair and genomic stability in murine haematopoietic cells

    SciTech Connect (OSTI)

    Lemon, Jennifer A.; Taylor, Kristina; Verdecchia, Kyle; Phan, Nghi; Boreham, Douglas R.

    2014-01-01

    Apoptotic and DNA damage endpoints are frequently used as surrogate markers of cancer risk, and have been well-studied in the Trp53+/- mouse model. We report the effect of differing Trp53 gene status on the dose response of ionizing radiation exposures (0.01-2 Gy), with the unique perspective of determining if effects of gene status remain at extended time points. Here we report no difference in the dose response for radiation-induced DNA double-strand breaks in bone marrow and genomic instability (MN-RET levels) in peripheral blood, between wild-type (Trp53+/+) and heterozygous (Trp53+/-) mice. The dose response for Trp53+/+ mice showed higher initial levels of radiation-induced lymphocyte apoptosis relative to Trp53+/- between 0 and 1 Gy. Although this trend was observed up to 12 hours post-irradiation, both genotypes ultimately reached the same level of apoptosis at 14 hours, suggesting the importance of late-onset p53-independent apoptotic responses in this mouse model. Expected radiation-induced G1 cell cycle delay was observed in Trp53+/+ but not Trp53+/-. Although p53 has an important role in cancer risk, we have shown its influence on radiation dose response can be temporally variable. This research highlights the importance of caution when using haematopoietic endpoints as surrogates to extrapolate radiation-induced cancer risk estimation.

  18. DNA Cleavage by Photogenerated Rh2(O2CCH3)4(H2O)2 Patty K.-L. Fu, Patricia M. Bradley, and Claudia Turro*

    E-Print Network [OSTI]

    Turro, Claudia

    the subject of intense investigation since, upon light activation, they can act as reporters of DNA structure and coordination of the dirhodium core to single-stranded oligonucleotides has been observed, the mode of binding-methylpyridinium tetrafluoroborate (py+),17 results in the formation of the one-electron-oxidized complex, Rh2(O2

  19. DNA Topology: Fundamentals

    E-Print Network [OSTI]

    Mirkin, Sergei

    in Genome Functioning . Biological Role of Alternative DNA Structures Figure 1 A hypothetical circular DNA. 1ENCYCLOPEDIA OF LIFE SCIENCES / & 2001 Nature Publishing Group / www.els.net #12;topological

  20. Neutrinoless Double Phys 135c Spring 2007

    E-Print Network [OSTI]

    Golwala, Sunil

    Neutrinoless Double Beta Decay Phys 135c Spring 2007 Michael Mendenhall #12;Theory Overview #12 beta decays #12;neutrinoless double beta decays n e- p beta decay e #12;neutrinoless double beta decays n e- p beta decay e n e- p n e- p double beta decay e e #12;neutrinoless double beta decays n e- p

  1. Comparison and Analysis of Twist Pitch Length Test Methods for ITER Nb3Sn and NbTi Strands

    E-Print Network [OSTI]

    Fang Liu; Feng Long; Chao Chen; Bo Liu; Yu Wu; Huajun Liu

    2013-05-08

    A twisted multifilamentary structure is needed for Nb3Sn and NbTi strands to be used in the International Thermonuclear Experimental Reactor (ITER) magnets. As important parameters for the superconducting strands design and production, the twist pitch length and direction of strands must meet the requirements according to ITER Procurement Arrangement (PA) and this must be verified. The technical requirements are 15mm+/-2mm for twist pitch length and right hand twist for direction. The strand twist pitch and the twist direction can be measured on straight sections of strand, which is recognized by the repetition of filament bundles or by the angle of the filaments. Several test methods and results are described and compared in this paper. The accuracy, uncertainty and feasibility of different methods are analyzed and recommended measurement methods are proposed for ITER strands verification.

  2. 1.E+01 1.E+02 1.E+03 1.E+04 1.E+05 1.E+06 1.E+07 1.E+08 Concentration(c/L)

    E-Print Network [OSTI]

    . The D10 scale is a measure of absorbance and is traceable to the unit 1. The conventional conversion the slow conversion of double-stranded DNA (dsDNA) to single-stranded (ssDNA). The conventional conversion factor for dsDNA is 50 ng/µL per absorbance unit while that for ssDNA is 37 ng/uL. There was no evidence

  3. Double acting bit holder

    DOE Patents [OSTI]

    Morrell, Roger J. (Blommington, MN); Larson, David A. (Minneapolis, MN); Ruzzi, Peter L. (Eagan, MN)

    1994-01-01

    A double acting bit holder that permits bits held in it to be resharpened during cutting action to increase energy efficiency by reducing the amount of small chips produced. The holder consist of: a stationary base portion capable of being fixed to a cutter head of an excavation machine and having an integral extension therefrom with a bore hole therethrough to accommodate a pin shaft; a movable portion coextensive with the base having a pin shaft integrally extending therefrom that is insertable in the bore hole of the base member to permit the moveable portion to rotate about the axis of the pin shaft; a recess in the movable portion of the holder to accommodate a shank of a bit; and a biased spring disposed in adjoining openings in the base and moveable portions of the holder to permit the moveable portion to pivot around the pin shaft during cutting action of a bit fixed in a turret to allow front, mid and back positions of the bit during cutting to lessen creation of small chip amounts and resharpen the bit during excavation use.

  4. Double Chooz: Latest results

    E-Print Network [OSTI]

    J. I. Crespo-Anadón; for the Double Chooz collaboration

    2014-12-11

    The latest results from the Double Chooz experiment on the neutrino mixing angle $\\theta_{13}$ are presented. A detector located at an average distance of 1050 m from the two reactor cores of the Chooz nuclear power plant has accumulated a live time of 467.90 days, corresponding to an exposure of 66.5 GW-ton-year (reactor power $\\times$ detector mass $\\times$ live time). A revised analysis has boosted the signal efficiency and reduced the backgrounds and systematic uncertainties compared to previous publications, paving the way for the two detector phase. The measured $\\sin^2 2\\theta_{13} = 0.090^{+0.032}_{-0.029}$ is extracted from a fit to the energy spectrum. A deviation from the prediction above a visible energy of 4 MeV is found, being consistent with an unaccounted reactor flux effect, which does not affect the $\\theta_{13}$ result. A consistent value of $\\theta_{13}$ is measured in a rate-only fit to the number of observed candidates as a function of the reactor power, confirming the robustness of the result.

  5. Endogenous DNA Damage and Risk of Testicular Germ Cell Tumors

    SciTech Connect (OSTI)

    Cook, M B; Sigurdson, A J; Jones, I M; Thomas, C B; Graubard, B I; Korde, L; Greene, M H; McGlynn, K A

    2008-01-18

    Testicular germ cell tumors (TGCT) are comprised of two histologic groups, seminomas and nonseminomas. We postulated that the possible divergent pathogeneses of these histologies may be partially explained by variable endogenous DNA damage. To assess our hypothesis, we conducted a case-case analysis of seminomas and nonseminomas using the alkaline comet assay to quantify single-strand DNA breaks and alkali-labile sites. The Familial Testicular Cancer study and the U.S. Radiologic Technologists cohort provided 112 TGCT cases (51 seminomas & 61 nonseminomas). A lymphoblastoid cell line was cultured for each patient and the alkaline comet assay was used to determine four parameters: tail DNA, tail length, comet distributed moment (CDM) and Olive tail moment (OTM). Odds ratios (OR) and 95% confidence intervals (95%CI) were estimated using logistic regression. Values for tail length, tail DNA, CDM and OTM were modeled as categorical variables using the 50th and 75th percentiles of the seminoma group. Tail DNA was significantly associated with nonseminoma compared to seminoma (OR{sub 50th percentile} = 3.31, 95%CI: 1.00, 10.98; OR{sub 75th percentile} = 3.71, 95%CI: 1.04, 13.20; p for trend=0.039). OTM exhibited similar, albeit statistically non-significant, risk estimates (OR{sub 50th percentile} = 2.27, 95%CI: 0.75, 6.87; OR{sub 75th percentile} = 2.40, 95%CI: 0.75, 7.71; p for trend=0.12) whereas tail length and CDM showed no association. In conclusion, the results for tail DNA and OTM indicate that endogenous DNA damage levels are higher in patients who develop nonseminoma compared with seminoma. This may partly explain the more aggressive biology and younger age-of-onset of this histologic subgroup compared with the relatively less aggressive, later-onset seminoma.

  6. The detection of immortal DNA strand co-segregation as a method of adult stem cell identification

    E-Print Network [OSTI]

    Cheng, Jennifer J. (Jennifer Jay), 1979-

    2004-01-01

    The study of stem cells is one of the most fascinating topics in biology. Adult stem cells (ASC), which play the prime role in the maintenance and restoration of tissues, are thought to hold great potential for the advancement ...

  7. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOE Patents [OSTI]

    McCutchen-Maloney, Sandra L. (Pleasanton, CA)

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  8. Manganese oxide helices, rings, strands, and films, and methods for their preparation

    DOE Patents [OSTI]

    Suib, Steven L. (Storrs, CT); Giraldo, Oscar (Storrs, CT); Marquez, Manuel (Wheeling, IL); Brock, Stephanie (Detroit, MI)

    2003-01-07

    Methods for the preparation of mixed-valence manganese oxide compositions with quaternary ammonium ions are described. The compositions self-assemble into helices, rings, and strands without any imposed concentration gradient. These helices, rings, and strands, as well as films having the same composition, undergo rapid ion exchange to replace the quaternary ammonium ions with various metal ions. And the metal-ion-containing manganese oxide compositions so formed can be heat treated to form semi-conducting materials with high surface areas.

  9. Species Doubling and Chiral Lagrangians

    E-Print Network [OSTI]

    Michael Creutz; Michel Tytgat

    1996-05-15

    Coupling gauge fields to the chiral currents from an effective Lagrangian for pseudoscalar mesons naturally gives rise to a species doubling phenomenon similar to that seen with fermionic fields in lattice gauge theory.

  10. nature physics | VOL 5 | JUNE 2009 | www.nature.com/naturephysics 373 Attack of the cyberspider

    E-Print Network [OSTI]

    Antal, Tibor

    technology always seems another decade away, receding into the future almost as fast as we chase it. So far technology. The more immediate transforming technology is emerging from techniques for controlling to be called `molecular cybernetics'. Double-stranded DNA may be the basis of life, but single-stranded DNA may

  11. Introduction: DNA Electrophoresis Fralin Life Science

    E-Print Network [OSTI]

    Hopkins, William A.

    .................................... 12 Student Pre-Lab Activity: What is DNA? DNA extraction from strawberry ..... Teacher guide: DNA extraction from strawberry.................................. 14 Student guide: DNA extraction from strawberry.................................. 16

  12. Large scale DNA microsequencing device

    DOE Patents [OSTI]

    Foote, R.S.

    1997-08-26

    A microminiature sequencing apparatus and method provide a means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus cosists of a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 17 figs.

  13. Large scale DNA microsequencing device

    DOE Patents [OSTI]

    Foote, R.S.

    1999-08-31

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.

  14. EFFECTS OF RESIN AND WAX ON THE WATER UPTAKE BEHAVIOR OF WOOD STRANDS

    E-Print Network [OSTI]

    Wang, Siqun

    EFFECTS OF RESIN AND WAX ON THE WATER UPTAKE BEHAVIOR OF WOOD STRANDS Yang2hang1 Post February 2005) ABSTRACT Dimensional stability is an important property of wood composites. Both resin and wax are essential additives in the manufactureof composite panels such as OSB. Resin binds wood

  15. Cost-Constrained Selection of Strand Wire and Number in a Litz-Wire Transformer Winding

    E-Print Network [OSTI]

    Cost-Constrained Selection of Strand Wire and Number in a Litz-Wire Transformer Winding C. R. Design of litz-wire windings subject to cost constraints is analyzed. An approximation of nor- malized winding, in terms of a cost function. At the second level, results that are less general but are more

  16. Collateral damage: Evolution with displacement of fracture distribution and secondary fault strands in fault

    E-Print Network [OSTI]

    Savage, Heather M.

    Collateral damage: Evolution with displacement of fracture distribution and secondary fault strands in fault damage zones Heather M. Savage1,2 and Emily E. Brodsky1 Received 22 April 2010; revised 10 of fracture distributions as a function of displacement to determine whether damage around small and large

  17. The Chromodomains of the Chd1 Chromatin Remodeler Regulate DNA Access to the ATPase Motor

    SciTech Connect (OSTI)

    Hauk, G.; McKnight, J; Nodelman, I; Bowman, G

    2010-01-01

    Chromatin remodelers are ATP-driven machines that assemble, slide, and remove nucleosomes from DNA, but how the ATPase motors of remodelers are regulated is poorly understood. Here we show that the double chromodomain unit of the Chd1 remodeler blocks DNA binding and activation of the ATPase motor in the absence of nucleosome substrates. The Chd1 crystal structure reveals that an acidic helix joining the chromodomains can pack against a DNA-binding surface of the ATPase motor. Disruption of the chromodomain-ATPase interface prevents discrimination between nucleosomes and naked DNA and reduces the reliance on the histone H4 tail for nucleosome sliding. We propose that the chromodomains allow Chd1 to distinguish between nucleosomes and naked DNA by physically gating access to the ATPase motor, and we hypothesize that related ATPase motors may employ a similar strategy to discriminate among DNA-containing substrates.

  18. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOE Patents [OSTI]

    McCutchen-Maloney, Sandra L. (Pleasanton, CA)

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  19. Predicting Neutrinoless Double Beta Decay

    E-Print Network [OSTI]

    M. Hirsch; Ernest Ma; J. W. F. Valle; A. Villanova del Moral

    2005-07-12

    We give predictions for the neutrinoless double beta decay rate in a simple variant of the A_4 family symmetry model. We show that there is a lower bound for the neutrinoless double beta decay amplitude even in the case of normal hierarchical neutrino masses, corresponding to an effective mass parameter |m_{ee}| >= 0.17 \\sqrt{\\Delta m^2_{ATM}}. This result holds both for the CP conserving and CP violating cases. In the latter case we show explicitly that the lower bound on |m_{ee}| is sensitive to the value of the Majorana phase. We conclude therefore that in our scheme, neutrinoless double beta decay may be accessible to the next generation of high sensitivity experiments.

  20. New Double Soft Emission Theorems

    E-Print Network [OSTI]

    Freddy Cachazo; Song He; Ellis Ye Yuan

    2015-03-16

    We study the behavior of the tree-level S-matrix of a variety of theories as two particles become soft. By analogy with the recently found subleading soft theorems for gravitons and gluons, we explore subleading terms in double soft emissions. We first consider double soft scalar emissions and find subleading terms that are controlled by the angular momentum operator acting on hard particles. The order of the subleading theorems depends on the presence or not of color structures. Next we obtain a compact formula for the leading term in a double soft photon emission. The theories studied are a special Galileon, DBI, Einstein-Maxwell-Scalar, NLSM and Yang-Mills-Scalar. We use the recently found CHY representation of these theories in order to give a simple proof of the leading order part of all these theorems

  1. Neutrinoless Double Beta Decay Constraints

    E-Print Network [OSTI]

    Hiroaki Sugiyama

    2003-07-25

    A brief overview is given of theoretical analyses with neutrinoless double beta decay experiments. Theoretical bounds on the ``observable'', _betabeta, are presented. By using experimental bounds on _betabeta, allowed regions are obtained on the m_l-cos{2theta_12} plane, where m_l stands for the lightest neutrino mass. It is shown that Majorana neutrinos can be excluded by combining possible results of future neutrinoless double beta decay and {}^3H beta decay experiments. A possibility to constrain one of two Majorana phases is discussed also.

  2. Neutrinoless double beta decay experiments

    E-Print Network [OSTI]

    K. Zuber

    2006-10-04

    The study of neutrinoless double beta decay is of outmost importance for neutrino physics. It is considered to be the gold plated channel to probe the fundamental character of neutrinos and to determine the neutrino mass. From the experimental point about nine different isotopes are explored for the search. After a general introduction follows a short discussion on nuclear matrix element calculations and supportive measurements. The current experimental status of double beta searches is presented followed by a short discussion of the ideas and proposals for large scale experiments.

  3. Effective charge and free energy of DNA inside an ion channel

    E-Print Network [OSTI]

    Jingshan Zhang; B. I. Shklovskii

    2008-03-03

    Translocation of a single stranded DNA (ssDNA) through an alpha-hemolysin channel in a lipid membrane driven by applied transmembrane voltage V was extensively studied recently. While the bare charge of the ssDNA piece inside the channel is approximately 12 (in units of electron charge) measurements of different effective charges resulted in values between one and two. We explain these challenging observations by a large self-energy of a charge in the narrow water filled gap between ssDNA and channel walls, related to large difference between dielectric constants of water and lipid, and calculate effective charges of ssDNA. We start from the most fundamental stall charge $q_s$, which determines the force $F_s= q_s V/L$ stalling DNA against the voltage V (L is the length of the channel). We show that the stall charge $q_s$ is proportional to the ion current blocked by DNA, which is small due to the self-energy barrier. Large voltage V reduces the capture barrier which DNA molecule should overcome in order to enter the channel by $|q_c|V$, where $q_c$ is the effective capture charge. We expressed it through the stall charge $q_s$. We also relate the stall charge $q_s$ to two other effective charges measured for ssDNA with a hairpin in the back end: the charge $q_u$ responsible for reduction of the barrier for unzipping of the hairpin and the charge $q_e$ responsible for DNA escape in the direction of hairpin against the voltage. At small V we explain reduction of the capture barrier with the salt concentration.

  4. RNA sequencing for the study of splicing

    E-Print Network [OSTI]

    Gonza?lez-Porta, Mar

    2014-10-07

    segments in the DNA. In their experiments, they hybridised adenoviral mRNAs with complemen- tary single stranded DNA fragments, and following observation with electron microscopy (EM), they detected alternate double stranded and single stranded stretches... [Saltzman et al., 2011]. Overall, the above mentioned processes guarantee that splicing occurs in an ac- curate albeit flexible fashion. The accuracy of splicing is further increased by the many rearrangements that are required before the actual intron...

  5. Becky Hill Green Mountain DNA Conference LT-DNA Analysis

    E-Print Network [OSTI]

    Becky Hill ­ Green Mountain DNA Conference LT-DNA Analysis July 26, 2010 http of the Chief Medical Examiner, NYC Green Mountain DNA Conference Burlington, VT July 26, 2010 Low Template (LT generally aim for 0.5-2 ng 100 pg template 5 pg template #12;Becky Hill ­ Green Mountain DNA Conference LT

  6. Constraining neutrinoless double beta decay

    E-Print Network [OSTI]

    L. Dorame; D. Meloni; S. Morisi; E. Peinado; J. W. F. Valle

    2011-11-23

    A class of discrete flavor-symmetry-based models predicts constrained neutrino mass matrix schemes that lead to specific neutrino mass sum-rules (MSR). We show how these theories may constrain the absolute scale of neutrino mass, leading in most of the cases to a lower bound on the neutrinoless double beta decay effective amplitude.

  7. Physics of base-pairing dynamics in DNA

    E-Print Network [OSTI]

    Manoel Manghi; Nicolas Destainville

    2015-10-19

    As a key molecule of Life, Deoxyribonucleic acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque- driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain degrees of freedom can be integrated out, and the quasi- static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

  8. Multiplex analysis of DNA

    DOE Patents [OSTI]

    Church, George M. (Boston, MA); Kieffer-Higgins, Stephen (Dorchester, MA)

    1992-01-01

    This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

  9. Evaluation of Juvenile Fall Chinook Stranding on the Hanford Reach, 1997-1999 Interim Report.

    SciTech Connect (OSTI)

    Wagner, Paul; Nugent, John; Price, William

    1999-02-15

    Pilot work conducted in 1997 to aid the development of the study for the 1998 Evaluation of Juvenile Fall Chinook Stranding on The Hanford Reach. The objectives of the 1997 work were to: (1) identify juvenile chinook production and rearing areas..., (2) identify sampling sites and develop the statistical parameters necessary to complete the study, (3) develop a study plan..., (4) conduct field sampling activities...

  10. The impact of age, exposure and genetics on homologous recombination at the engineered repeat sequence in mice

    E-Print Network [OSTI]

    Wiktor-Brown, Dominika M

    2007-01-01

    Mitotic homologous recombination is a critical pathway for the repair of DNA double-strand breaks and broken replication forks. Although homologous recombination is generally error-free, recombination between misaligned ...

  11. J.M. Butler NIST Update for SWGDAM January 8, 2008 http://www.cstl.nist.gov/biotech/strbase/NISTpub.htm 1

    E-Print Network [OSTI]

    and Technology SWGDAM Fredericksburg, VA January 8, 2008 Pete Vallone John Butler Margaret Kline Amy Decker Becky/µL double stranded DNA. We do not know the uncertainty in this conversion. Component 260 nm error at 260nm

  12. P. M. Vallone -NIST Update for CODIS October 30, 2007 http://www.cstl.nist.gov/biotech/strbase/NISTpub.htm 1

    E-Print Network [OSTI]

    Decker Becky Hill Dave Duewer Jan Redman NIST Human Identity Project Team Our Team Mission Statement was estimated Using 1 OD = 50 ng/µL double stranded DNA. We do not know the uncertainty in this conversion

  13. Development and characterization of an in vitro culture system as a physiological model for chronic Hepatitis B infection

    E-Print Network [OSTI]

    Sams, Alexandria V. (Alexandria Victoria)

    2007-01-01

    Human Hepatitis B virus (HBV) is the prototype member of the family Hepadnaviridae that consists of enveloped, partially double stranded DNA viruses that specifically target hepatocytes for viral replication. Although a ...

  14. Studies into host macrophage transcriptional control by the African Swine Fever Virus protein A238L 

    E-Print Network [OSTI]

    Silk, Rhiannon Nicola

    2010-01-01

    African swine fever virus (ASFV) is a large double-stranded DNA virus which causes a lethal haemorrhagic fever in domestic pigs. This virus primarily infects cells from the monocyte/macrophage lineage and its ability to ...

  15. Genes and structural proteins of the phage SYN5 of the marine cyanobacteria, Synechococcus

    E-Print Network [OSTI]

    Pope, Welkin Hazel

    2005-01-01

    Bacteriophage have been proposed to be the most abundant organisms on the planet, at an estimated 10³¹ particles globally (Hendrix et al., 1999). The majority of bacteriophage isolates (96%) are double-stranded DNA tailed ...

  16. What can we learn from neutrinoless double beta decay experiments?

    E-Print Network [OSTI]

    Bahcall, John N.

    2009-01-01

    Limits From Neutrinoless Double-Beta Decay (Rev. ),” ina next generation neutrinoless double beta decay search andPARTICLES? NO NEUTRINOLESS DOUBLE BETA DECAY AND INVERTED

  17. A Search for Neutrinoless Double Beta Decay of Te-130

    E-Print Network [OSTI]

    Bryant, Adam Douglas

    2010-01-01

    far unobserved, neutrinoless double beta decay is a possibleright for the neutrinoless double beta decay of 130 Te. Thisprocess, with neutrinoless double beta decay being the most

  18. Nuclear matrix elements for double beta decay

    E-Print Network [OSTI]

    Vadim Rodin

    2009-10-30

    The present status of calculations of the nuclear matrix elements for neutrinoless double beta decay is reviewed. A proposal which allows in principle to measure the neutrinoless double beta decay Fermi matrix element is briefly described.

  19. Sound strand design : designing mechanical joints to facilitate user interaction within a physical representation of digital music

    E-Print Network [OSTI]

    Shen, Yan, S.B. Massachusetts Institute of Technology

    2011-01-01

    This project involved the mechanical design of a modular musical instrument, named the "Sound Strand." Intended to be attached end-to-end one onto another in order to produce a string of music, each module was constructed ...

  20. An analysis of how climate policies and the threat of stranded fossil fuel assets incentivize CCS deployment

    E-Print Network [OSTI]

    Clark, Victoria (Victoria Reeves)

    2015-01-01

    To be on track to stabilize climate change, scientists estimate that up to two thirds of global coal, oil, and natural gas reserves will need to remain stranded in the ground. Carbon capture and storage (CCS) is the only ...

  1. Minimal Doubling and Point Splitting

    SciTech Connect (OSTI)

    Creutz, M.

    2010-06-14

    Minimally-doubled chiral fermions have the unusual property of a single local field creating two fermionic species. Spreading the field over hypercubes allows construction of combinations that isolate specific modes. Combining these fields into bilinears produces meson fields of specific quantum numbers. Minimally-doubled fermion actions present the possibility of fast simulations while maintaining one exact chiral symmetry. They do, however, introduce some peculiar aspects. An explicit breaking of hyper-cubic symmetry allows additional counter-terms to appear in the renormalization. While a single field creates two different species, spreading this field over nearby sites allows isolation of specific states and the construction of physical meson operators. Finally, lattice artifacts break isospin and give two of the three pseudoscalar mesons an additional contribution to their mass. Depending on the sign of this mass splitting, one can either have a traditional Goldstone pseudoscalar meson or a parity breaking Aoki-like phase.

  2. Neutrinoless Double Beta Decay Experiments

    E-Print Network [OSTI]

    Alberto Garfagnini

    2014-08-11

    Neutrinoless double beta decay is the only process known so far able to test the neutrino intrinsic nature: its experimental observation would imply that the lepton number is violated by two units and prove that neutrinos have a Majorana mass components, being their own anti-particle. While several experiments searching for such a rare decay have been performed in the past, a new generation of experiments using different isotopes and techniques have recently released their results or are taking data and will provide new limits, should no signal be observed, in the next few years to come. The present contribution reviews the latest public results on double beta decay searches and gives an overview on the expected sensitivities of the experiments in construction which will be able to set stronger limits in the near future.

  3. Coarse-graining DNA for simulations of DNA nanotechnology

    E-Print Network [OSTI]

    Jonathan P. K. Doye; Thomas E. Ouldridge; Ard A. Louis; Flavio Romano; Petr Sulc; Christian Matek; Benedict E. K. Snodin; Lorenzo Rovigatti; John S. Schreck; Ryan M. Harrison; William P. J. Smith

    2013-08-18

    To simulate long time and length scale processes involving DNA it is necessary to use a coarse-grained description. Here we provide an overview of different approaches to such coarse graining, focussing on those at the nucleotide level that allow the self-assembly processes associated with DNA nanotechnology to be studied. OxDNA, our recently-developed coarse-grained DNA model, is particularly suited to this task, and has opened up this field to systematic study by simulations. We illustrate some of the range of DNA nanotechnology systems to which the model is being applied, as well as the insights it can provide into fundamental biophysical properties of DNA.

  4. Coarse-graining DNA for simulations of DNA nanotechnology

    E-Print Network [OSTI]

    Doye, Jonathan P K; Louis, Ard A; Romano, Flavio; Sulc, Petr; Matek, Christian; Snodin, Benedict E K; Rovigatti, Lorenzo; Schreck, John S; Harrison, Ryan M; Smith, William P J

    2013-01-01

    To simulate long time and length scale processes involving DNA it is necessary to use a coarse-grained description. Here we provide an overview of different approaches to such coarse graining, focussing on those at the nucleotide level that allow the self-assembly processes associated with DNA nanotechnology to be studied. OxDNA, our recently-developed coarse-grained DNA model, is particularly suited to this task, and has opened up this field to systematic study by simulations. We illustrate some of the range of DNA nanotechnology systems to which the model is being applied, as well as the insights it can provide into fundamental biophysical properties of DNA.

  5. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOE Patents [OSTI]

    Tabor, S.; Richardson, C.

    1997-03-25

    A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

  6. To understanding of the mechanisms of DNA deactivation in ion therapy of cancer cells

    E-Print Network [OSTI]

    Piatnytskyi, D V; Perepelytsya, S M; Volkov, S N

    2015-01-01

    The changes of medium in the living cell during ion beam therapy are considered as the probable reason of disruption of the cancer cells functioning. As the most probable molecular product appeared in the cell after the passage of high energy ions, the hydrogen peroxide molecule is picked out. The possibility of the formation of stable complexes of hydrogen peroxide molecules with the sites of DNA nonspecific recognition (phosphate groups of the double helix backbone) is studied. Due to the negative charge on the oxygen atoms of PO$_{4}^{-}$ the counterions that under natural conditions neutralize the DNA double helix have been also taken into consideration. The complexes consisting of oxygen atoms of DNA phosphate group, H$_2$O$_2$ and H$_2$O molecules, and Na$^{+}$ counterion have been considered. The complex energies have been determined with accounting of electrostatic and van der Waals interactions in the framework of atom-atom potential functions. The stability of various configurations of molecular com...

  7. Searching for DNA Lesions: Structural Evidence for Lower- and Higher-Affinity DNA Binding Conformations of Human Alkyladenine DNA Glycosylase

    E-Print Network [OSTI]

    Drennan, Catherine L.

    To efficiently repair DNA, human alkyladenine DNA glycosylase (AAG) must search the million-fold excess of unmodified DNA bases to find a handful of DNA lesions. Such a search can be facilitated by the ability of glycosylases, ...

  8. DNA Structural Nanotechnology Duke University

    E-Print Network [OSTI]

    Reif, John H.

    DNA Structural Nanotechnology John Reif Duke University Graduate Students: Harish Chandran&Caltech Tube Lattices #12;Ned Seeman New York University, USA Ned Seeman: Father of DNA Nanotechnology His Initial Ideas & Motivation for DNA Nanotechnology #12;Cube Chen & Seeman, Nature350:631 (1991) Truncated

  9. Final Report: MATERIALS, STRANDS, AND CABLES FOR SUPERCONDUCTING ACCELERATOR MAGNETS [Grant Number DE-SC0010312

    SciTech Connect (OSTI)

    Sumption, Mike; Collings, E.

    2014-10-29

    Our program consisted of the two components: Strand Research and Cable Research, with a focus on Nb3Sn, Bi2212, and YBCO for accelerator magnet applications. We demonstrated a method to refine the grains in Nb3Sn by a factor of two, reaching 45 nm grain sizes, and layer Jcs of 6 kA/mm2 at 12 T. W also measured conductor magnetization for field quality. This has been done both with Nb3Sn conductor, as well as Bi:2212 strand. Work in support of quench studies of YBCO coils was also performed. Cable loss studies in Nb3Sn focused on connecting and comparing persistent magnetization and coupling magnetization for considering their relative impact on HEP machines. In the area of HTS cables, we have investigated both the quench in multistrand YBCO CORC cables, as well as the magnetization of these cables for use in high field magnets. In addition, we examined the magnetic and thermal properties of large (50 T) solenoids.

  10. Neutrinoless Double Beta Decay: Present and Future

    E-Print Network [OSTI]

    Oliviero Cremonesi

    2002-10-04

    Present status, and future plans for Double Beta Decay searches are reviewed. Given the recent observations of neutrino oscillations, a possibility to observe $\\beta\\beta(0\

  11. Review of double beta decay experiments

    E-Print Network [OSTI]

    A. S. Barabash

    2014-03-12

    The brief review of current experiments on search and studying of double beta decay processes is done. Best present limits on $\\langle m_{\

  12. Double perovskite catalysts for oxidative coupling

    DOE Patents [OSTI]

    Campbell, Kenneth D. (Charleston, WV)

    1991-01-01

    Alkali metal doped double perovskites containing manganese and at least one of cobalt, iron and nickel are useful in the oxidative coupling of alkane to higher hydrocarbons.

  13. Monosporascus root rot/vine decline: a study of double-stranded (DS) RNA and its role in the pathogenesis of Monosporascus cannonballus on muskmelon 

    E-Print Network [OSTI]

    Batten, Jeffrey Samuel

    1997-01-01

    dsRNA banding patterns, (Az9O-33-, Tx93-449+, Ca9l-17"+, Tx93-529+, and Tx93-314+'-) were examined in repeated greenhouse pathogenicity trials from 1995 to 1996 to determine if a specific set of dsRNA fragments were associated with hypovirulence and...

  14. Fleet DNA (Presentation)

    SciTech Connect (OSTI)

    Walkokwicz, K.; Duran, A.

    2014-06-01

    The Fleet DNA project objectives include capturing and quantifying drive cycle and technology variation for the multitude of medium- and heavy-duty vocations; providing a common data storage warehouse for medium- and heavy-duty vehicle fleet data across DOE activities and laboratories; and integrating existing DOE tools, models, and analyses to provide data-driven decision making capabilities. Fleet DNA advantages include: for Government - providing in-use data for standard drive cycle development, R&D, tech targets, and rule making; for OEMs - real-world usage datasets provide concrete examples of customer use profiles; for fleets - vocational datasets help illustrate how to maximize return on technology investments; for Funding Agencies - ways are revealed to optimize the impact of financial incentive offers; and for researchers -a data source is provided for modeling and simulation.

  15. Cell, Vol. 92, 401413, February 6, 1998, Copyright 1998 by Cell Press TRF2 Protects Human Telomeres

    E-Print Network [OSTI]

    de Lange, Titia

    -strand tails are only present on half of the chromosome ends, consistent with their being gener- Bas van the scheduled senes- lost their single-stranded G-tails. Therefore, TRF2 may cence point (Bodnar et al., 1998 chromosome ends from dam- been identified. TRF1 was isolatedas a double-strandedaged DNA. Despite

  16. Nucleotide cleaving agents and method

    DOE Patents [OSTI]

    Que, Jr., Lawrence (Roseville, MN); Hanson, Richard S. (Falcon Heights, MN); Schnaith, Leah M. T. (Redwing, MN)

    2000-01-01

    The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

  17. DNA waves and water

    E-Print Network [OSTI]

    L. Montagnier; J. Aissa; E. Del Giudice; C. Lavallee; A. Tedeschi; G. Vitiello

    2010-12-23

    Some bacterial and viral DNA sequences have been found to induce low frequency electromagnetic waves in high aqueous dilutions. This phenomenon appears to be triggered by the ambient electromagnetic background of very low frequency. We discuss this phenomenon in the framework of quantum field theory. A scheme able to account for the observations is proposed. The reported phenomenon could allow to develop highly sensitive detection systems for chronic bacterial and viral infections.

  18. Predicting neutrinoless double beta decay

    SciTech Connect (OSTI)

    Hirsch, M.; Villanova del Moral, A.; Valle, J.W.F. [AHEP Group, Instituto de Fisica Corpuscular - C.S.I.C./Universitat de Valencia, Edificio Institutos de Paterna, Apt 22085, E-46071 Valencia (Spain); Ma, Ernest [Physics Department, University of California, Riverside, California 92521 (United States); Institute for Particle Physics Phenomenology, University of Durham, Durham, DH1 3LE (United Kingdom)

    2005-11-01

    We give predictions for the neutrinoless double beta decay rate in a simple variant of the A{sub 4} family symmetry model. We show that there is a lower bound for the {beta}{beta}{sub 0{nu}} amplitude even in the case of normal hierarchical neutrino masses, corresponding to an effective mass parameter vertical bar m{sub ee} vertical bar {>=}0.17{radical}({delta}m{sub ATM}{sup 2}). This result holds both for the CP conserving and CP violating cases. In the latter case we show explicitly that the lower bound on vertical bar m{sub ee} vertical bar is sensitive to the value of the Majorana phase. We conclude therefore that in our scheme, {beta}{beta}{sub 0{nu}} may be accessible to the next generation of high sensitivity experiments.

  19. Double-Disk Dark Matter

    E-Print Network [OSTI]

    Fan, JiJi; Randall, Lisa; Reece, Matthew

    2013-01-01

    Based on observational tests and constraints on halo structure, dark matter is generally taken to be cold and essentially collisionless. On the other hand, given the large number of particles and forces in the visible world, a more complex dark sector could be a reasonable or even likely possibility. This hypothesis leads to testable consequences, perhaps portending the discovery of a rich hidden world neighboring our own. We consider a scenario that readily satisfies current bounds that we call Partially Interacting Dark Matter (PIDM). This scenario contains self-interacting dark matter, but it is not the dominant component. Even if PIDM contains only a fraction of the net dark matter density, comparable to the baryonic fraction, the subdominant component's interactions can lead to interesting and potentially observable consequences. Our primary focus will be the special case of Double-Disk Dark Matter (DDDM), in which self-interactions allow the dark matter to lose enough energy to lead to dynamics similar ...

  20. The tropical double description method

    E-Print Network [OSTI]

    Allamigeon, Xavier; Goubault, Eric

    2010-01-01

    We develop a tropical analogue of the classical double description method allowing one to compute an internal representation (in terms of vertices) of a polyhedron defined externally (by inequalities). The heart of the tropical algorithm is a characterization of the extreme points of a polyhedron in terms of a system of constraints which define it. We show that checking the extremality of a point reduces to checking whether there is only one minimal strongly connected component in an hypergraph. The latter problem can be solved in almost linear time, which allows us to eliminate quickly redundant generators. We report extensive tests (including benchmarks from an application to static analysis) showing that the method outperforms experimentally the previous ones by orders of magnitude. The present tools also lead to worst case bounds which improve the ones provided by previous methods.

  1. Double Integrals: GENERAL REGION The main difficulty in evaluating a double integral

    E-Print Network [OSTI]

    Knopf, Dan

    Double Integrals: GENERAL REGION The main difficulty in evaluating a double integral was being able to compute the single variable integrals that arose because the double integral could written as repeated single variable integrals and either choice of order of integration used. So we could always choose

  2. Double bevel construction of a diamond anvil

    DOE Patents [OSTI]

    Moss, W.C.

    1988-10-11

    A double or multiple bevel culet geometry is used on a diamond anvil in a high pressure cell apparatus to provide increased sample pressure and stability for a given force applied to the diamond tables. Double or multiple bevel culet geometries can also be used for sapphire or other hard crystal anvils. Pressures up to and above 5 Megabars can be reached. 8 figs.

  3. Double beta decay: experiments and theory review

    E-Print Network [OSTI]

    A. Nucciotti

    2007-07-28

    Neutrinoless double beta decay is one of the most powerful tools to set the neutrino mass absolute scale and establish whether the neutrino is a Majorana particle. After a summary of the neutrinoless double beta decay phenomenology, the present status of the experimental search for this rare decay is reported and the prospects for next generation experiments are reviewed.

  4. Neutrinoless double beta decay and neutrino physics

    E-Print Network [OSTI]

    Werner Rodejohann

    2012-08-20

    The connection of neutrino physics with neutrinoless double beta decay is reviewed. After presenting the current status of the PMNS matrix and the theoretical background of neutrino mass and lepton mixing, we will summarize the various implications of neutrino physics for double beta decay. The influence of light sterile neutrinos and other exotic modifications of the three neutrino picture is also discussed.

  5. Characterization of a baculovirus lacking the DBP (DNA-binding protein) gene

    SciTech Connect (OSTI)

    Vanarsdall, Adam L. [Department of Microbiology, Nash Hall Room 220, Oregon State University, Corvallis, OR 97331-3804 (United States); Mikhailov, Victor S. [Department of Microbiology, Nash Hall Room 220, Oregon State University, Corvallis, OR 97331-3804 (United States); N.K. Koltzov Institute of Developmental Biology, Russian Academy of Sciences, Moscow 117808 (Russian Federation); Rohrmann, George F. [Department of Microbiology, Nash Hall Room 220, Oregon State University, Corvallis, OR 97331-3804 (United States)]. E-mail: rohrmanng@orst.edu

    2007-08-01

    Autographa californica multiple nucleopolyhedrovirus (AcMNPV) encodes two proteins that possess properties typical of single-stranded DNA-binding proteins (SSBs), late expression factor-3 (LEF-3), and a protein referred to as DNA-binding protein (DBP). Whereas LEF-3 is a multi-functional protein essential for viral DNA replication, transporting helicase into the nucleus, and forms a stable complex with the baculovirus alkaline nuclease, the role for DBP in baculovirus replication remains unclear. Therefore, to better understand the functional role of DBP in viral replication, a DBP knockout virus was generated from an AcMNPV bacmid and analyzed. The results of a growth curve analysis indicated that the dbp knockout construct was unable to produce budded virus indicating that dbp is essential. The lack of DBP does not cause a general shutdown of the expression of viral genes, as was revealed by accumulation of early (LEF-3), late (VP39), and very late (P10) proteins in cells transfected with the dbp knockout construct. To investigate the role of DBP in DNA replication, a real-time PCR-based assay was employed and showed that, although viral DNA synthesis occurred in cells transfected with the dbp knockout, the levels were less than that of the control virus suggesting that DBP is required for normal levels of DNA synthesis or for stability of nascent viral DNA. In addition, analysis of the viral DNA replicated by the dbp knockout by using field inversion gel electrophoresis failed to detect the presence of genome-length DNA. Furthermore, analysis of DBP from infected cells indicated that similar to LEF-3, DBP was tightly bound to viral chromatin. Assessment of the cellular localization of DBP relative to replicated viral DNA by immunoelectron microscopy indicated that, at 24 h post-infection, DBP co-localized with nascent DNA at distinct electron-dense regions within the nucleus. Finally, immunoelectron microscopic analysis of cells transfected with the dbp knockout revealed that DBP is required for the production of normal-appearing nucleocapsids and for the generation of the virogenic stroma.

  6. Reliability Estimation for Double Containment Piping

    SciTech Connect (OSTI)

    L. Cadwallader; T. Pinna

    2012-08-01

    Double walled or double containment piping is considered for use in the ITER international project and other next-generation fusion device designs to provide an extra barrier for tritium gas and other radioactive materials. The extra barrier improves confinement of these materials and enhances safety of the facility. This paper describes some of the design challenges in designing double containment piping systems. There is also a brief review of a few operating experiences of double walled piping used with hazardous chemicals in different industries. This paper recommends approaches for the reliability analyst to use to quantify leakage from a double containment piping system in conceptual and more advanced designs. The paper also cites quantitative data that can be used to support such reliability analyses.

  7. The role of correlation and solvation in ion interactions with B-DNA

    E-Print Network [OSTI]

    Sushko, Maria L; Pabit, Suzette A; Pollack, Lois; Onufriev, Alexey V; Baker, Nathan A

    2015-01-01

    The ionic atmospheres around nucleic acids play important roles in biological function. Large-scale explicit solvent simulations coupled to experimental assays such as anomalous small-angle X-ray scattering (ASAXS) can provide important insights into the structure and energetics of such atmospheres but are time- and resource-intensive. In this paper, we use classical density functional theory (cDFT) to explore the balance between ion-DNA, ion-water, and ion-ion interactions in ionic atmospheres of RbCl, SrCl$_2$, and CoHexCl$_3$ (cobalt hexammine chloride) around a B-form DNA molecule. The accuracy of the cDFT calculations was assessed by comparison between simulated and experimental ASAXS curves, demonstrating that an accurate model should take into account ion-ion correlation and ion hydration forces, DNA topology, and the discrete distribution of charges on DNA strands. As expected, these calculations revealed significant differences between monovalent, divalent, and trivalent cation distributions around D...

  8. MODULE and STRAND REVIEW 1.1 The purpose of this procedure is to ensure that there is a systematic annual

    E-Print Network [OSTI]

    Daley, Monica A.

    MODULE and STRAND REVIEW 1. PURPOSE 1.1 The purpose of this procedure is to ensure that there is a systematic annual process of review for the modules and strands, which the College provides as part of its educational provision. 2. SCOPE 2.1 This procedure currently encompasses the taught modules in the FdSc, BSc

  9. Crystal Structure of a Super Leucine Zipper an Extended Two-Stranded Super Long Coiled Coil

    SciTech Connect (OSTI)

    J Diao

    2011-12-31

    Coiled coil is a ubiquitous structural motif in proteins, with two to seven alpha helices coiled together like the strands of a rope, and coiled coil folding and assembly is not completely understood. A GCN4 leucine zipper mutant with four mutations of K3A, D7A, Y17W, and H18N has been designed, and the crystal structure has been determined at 1.6 {angstrom} resolution. The peptide monomer shows a helix trunk with short curved N- and C-termini. In the crystal, two monomers cross in 35{sup o} and form an X-shaped dimer, and each X-shaped dimer is welded into the next one through sticky hydrophobic ends, thus forming an extended two-stranded, parallel, super long coiled coil rather than a discrete, two-helix coiled coil of the wild-type GCN4 leucine zipper. Leucine residues appear at every seventh position in the super long coiled coil, suggesting that it is an extended super leucine zipper. Compared to the wild-type leucine zipper, the N-terminus of the mutant has a dramatic conformational change and the C-terminus has one more residue Glu 32 determined. The mutant X-shaped dimer has a large crossing angle of 35{sup o} instead of 18{sup o} in the wild-type dimer. The results show a novel assembly mode and oligomeric state of coiled coil, and demonstrate that mutations may affect folding and assembly of the overall coiled coil. Analysis of the formation mechanism of the super long coiled coil may help understand and design self-assembling protein fibers.

  10. Base extrusion is found at helical junctions between right- and left-handed forms of DNA and RNA

    E-Print Network [OSTI]

    Kim, Doyoun

    Base extrusion is a major structural feature at the junction between B- and Z-DNA (the B–Z junction) where a base pair is broken, and the two bases are extruded from the double helix. Despite the demonstration of base ...

  11. DNA | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler,CoalConcordiaConsumerLEDSEnergyDMS Company Ltd Jump to:DNA Jump

  12. Neutrinoless Double Beta Decay in Light of SNO Salt Data

    E-Print Network [OSTI]

    Murayama, Hitoshi

    2009-01-01

    Limits From Neutrinoless Double-Beta Decay (Rev. ),” incan also cause neutrinoless double-beta decay (see e.g. , [LBNL-53996 Neutrinoless Double Beta Decay in Light of SNO

  13. Resonance and Double Negative Behavior in Metamaterials

    E-Print Network [OSTI]

    Yue Chen; Robert P. Lipton

    2013-05-03

    A generic class of metamaterials is introduced and is shown to exhibit frequency dependent double negative effective properties. We develop a rigorous method for calculating the frequency intervals where either double negative or double positive effective properties appear and show how these intervals imply the existence of propagating Bloch waves inside sub-wavelength structures. The branches of the dispersion relation associated with Bloch modes are shown to be explicitly determined by the Dirichlet spectrum of the high dielectric phase and the generalized electrostatic spectra of the complement.

  14. Neutrinoless Double Beta Decay and Neutrino Masses

    E-Print Network [OSTI]

    Michael Duerr

    2012-06-04

    Neutrinoless double beta decay is a promising test for lepton number violating physics beyond the standard model of particle physics. There is a deep connection between this decay and the phenomenon of neutrino masses. In particular, we will discuss the relation between neutrinoless double beta decay and Majorana neutrino masses provided by the so-called Schechter--Valle theorem in a quantitative way. Furthermore, we will present an experimental cross check to discriminate neutrinoless double beta decay from unknown nuclear background using only one isotope, i.e., within one experiment.

  15. Development of double-decker pulse radiolysis

    SciTech Connect (OSTI)

    Kan, K.; Kondoh, T.; Yang, J.; Ogata, A.; Norizawa, K.; Yoshida, Y. [Institute of Scientific and Industrial Research, Osaka University, Osaka (Japan)

    2012-07-15

    Double-decker pulse radiolysis (DDPR), which utilizes double-decker electron beams, was investigated to develop a new pulse radiolysis with a high time resolution. The double-decker electron beams were generated by injecting two UV pulses into a photocathode radio-frequency gun. In the pulse radiolysis, one electron beam was used as a pump beam, and the other was converted to a probe pulse. Finally, as its first application, the DDPR was successfully used for observing solvated electrons in water, with a 10%-90% rise time of 8.6 ps.

  16. Double-reed exhaust valve engine

    DOE Patents [OSTI]

    Bennett, Charles L.

    2015-06-30

    An engine based on a reciprocating piston engine that extracts work from pressurized working fluid. The engine includes a double reed outlet valve for controlling the flow of low-pressure working fluid out of the engine. The double reed provides a stronger force resisting closure of the outlet valve than the force tending to open the outlet valve. The double reed valve enables engine operation at relatively higher torque and lower efficiency at low speed, with lower torque, but higher efficiency at high speed.

  17. Search for: "neutrinoless double beta decay" | DOE PAGES

    Office of Scientific and Technical Information (OSTI)

    neutrinoless double beta decay" Find + Advanced Search Advanced Search All Fields: "neutrinoless double beta decay" Title: Full Text: Bibliographic Data: Creator Author: Name...

  18. SciTech Connect: "neutrinoless double beta decay"

    Office of Scientific and Technical Information (OSTI)

    neutrinoless double beta decay" Find + Advanced Search Term Search Semantic Search Advanced Search All Fields: "neutrinoless double beta decay" Semantic Semantic Term Title:...

  19. Protection of cisplatin-induced spermatotoxicity, DNA damage and chromatin abnormality by selenium nano-particles

    SciTech Connect (OSTI)

    Rezvanfar, Mohammad Amin; Rezvanfar, Mohammad Ali; Shahverdi, Ahmad Reza; Ahmadi, Abbas; Baeeri, Maryam; Mohammadirad, Azadeh; Abdollahi, Mohammad

    2013-02-01

    Cisplatin (CIS), an anticancer alkylating agent, induces DNA adducts and effectively cross links the DNA strands and so affects spermatozoa as a male reproductive toxicant. The present study investigated the cellular/biochemical mechanisms underlying possible protective effect of selenium nano-particles (Nano-Se) as an established strong antioxidant with more bioavailability and less toxicity, on reproductive toxicity of CIS by assessment of sperm characteristics, sperm DNA integrity, chromatin quality and spermatogenic disorders. To determine the role of oxidative stress (OS) in the pathogenesis of CIS gonadotoxicity, the level of lipid peroxidation (LPO), antioxidant enzymes including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) and peroxynitrite (ONOO) as a marker of nitrosative stress (NS) and testosterone (T) concentration as a biomarker of testicular function were measured in the blood and testes. Thirty-two male Wistar rats were equally divided into four groups. A single IP dose of CIS (7 mg/kg) and protective dose of Nano-Se (2 mg/kg/day) were administered alone or in combination. The CIS-exposed rats showed a significant increase in testicular and serum LPO and ONOO level, along with a significant decrease in enzymatic antioxidants levels, diminished serum T concentration and abnormal histologic findings with impaired sperm quality associated with increased DNA damage and decreased chromatin quality. Coadministration of Nano-Se significantly improved the serum T, sperm quality, and spermatogenesis and reduced CIS-induced free radical toxic stress and spermatic DNA damage. In conclusion, the current study demonstrated that Nano-Se may be useful to prevent CIS-induced gonadotoxicity through its antioxidant potential. Highlights: ? Cisplatin (CIS) affects spermatozoa as a male reproductive toxicant. ? Effect of Nano-Se on CIS-induced spermatotoxicity was investigated. ? CIS-exposure induces oxidative sperm DNA damage and impairs steroidogenesis. ? Nano-Se retained sperm quality against CIS-induced free radicals toxic stress.

  20. Double-Disk Dark Matter

    E-Print Network [OSTI]

    JiJi Fan; Andrey Katz; Lisa Randall; Matthew Reece

    2013-07-31

    Based on observational constraints on large scale structure and halo structure, dark matter is generally taken to be cold and essentially collisionless. On the other hand, given the large number of particles and forces in the visible world, a more complex dark sector could be a reasonable or even likely possibility. This hypothesis leads to testable consequences, perhaps portending the discovery of a rich hidden world neighboring our own. We consider a scenario that readily satisfies current bounds that we call Partially Interacting Dark Matter (PIDM). This scenario contains self-interacting dark matter, but it is not the dominant component. Even if PIDM contains only a fraction of the net dark matter density, comparable to the baryonic fraction, the subdominant component's interactions can lead to interesting and potentially observable consequences. Our primary focus will be the special case of Double-Disk Dark Matter (DDDM), in which self-interactions allow the dark matter to lose enough energy to lead to dynamics similar to those in the baryonic sector. We explore a simple model in which DDDM can cool efficiently and form a disk within galaxies, and we evaluate some of the possible observational signatures. The most prominent signal of such a scenario could be an enhanced indirect detection signature with a distinctive spatial distribution. Even though subdominant, the enhanced density at the center of the galaxy and possibly throughout the plane of the galaxy can lead to large boost factors, and could even explain a signature as large as the 130 GeV Fermi line. Such scenarios also predict additional dark radiation degrees of freedom that could soon be detectable and would influence the interpretation of future data, such as that from Planck and from the Gaia satellite. We consider this to be the first step toward exploring a rich array of new possibilities for dark matter dynamics.

  1. A Study of Stranding of Juvenile Salmon by Ship Wakes Along the Lower Columbia River Using a Before-and-After Design: Before-Phase Results

    SciTech Connect (OSTI)

    Pearson, Walter H.; Skalski, J R.; Sobocinski, Kathryn L.; Miller, Martin C.; Johnson, Gary E.; Williams, Greg D.; Southard, John A.; Buchanan, Rebecca A.

    2006-02-01

    Ship wakes produced by deep-draft vessels transiting the lower Columbia River have been observed to cause stranding of juvenile salmon. Proposed deepening of the Columbia River navigation channel has raised concerns about the potential impact of the deepening project on juvenile salmon stranding. The Portland District of the U.S. Army Corps of Engineers requested that the Pacific Northwest National Laboratory design and conduct a study to assess stranding impacts that may be associated with channel deepening. The basic study design was a multivariate analysis of covariance of field observations and measurements under a statistical design for a before and after impact comparison. We have summarized field activities and statistical analyses for the ?before? component of the study here. Stranding occurred at all three sampling sites and during all three sampling seasons (Summer 2004, Winter 2005, and Spring 2005), for a total of 46 stranding events during 126 observed vessel passages. The highest occurrence of stranding occurred at Barlow Point, WA, where 53% of the observed events resulted in stranding. Other sites included Sauvie Island, OR (37%) and County Line Park, WA (15%). To develop an appropriate impact assessment model that accounted for relevant covariates, regression analyses were conducted to determine the relationships between stranding probability and other factors. Nineteen independent variables were considered as potential factors affecting the incidence of juvenile salmon stranding, including tidal stage, tidal height, river flow, current velocity, ship type, ship direction, ship condition (loaded/unloaded), ship speed, ship size, and a proxy variable for ship kinetic energy. In addition to the ambient and ship characteristics listed above, site, season, and fish density were also considered. Although no single factor appears as the primary factor for stranding, statistical analyses of the covariates resulted in the following equations: (1) Stranding Probability {approx} Location + Kinetic Energy Proxy + Tidal Height + Salmonid Density + Kinetic energy proxy ? Tidal Height + Tidal Height x Salmonid Density. (2) Stranding Probability {approx} Location + Total Wave Distance + Salmonid Density Index. (3) Log(Total Wave Height) {approx} Ship Block + Tidal Height + Location + Ship Speed. (4) Log(Total Wave Excursion Across the Beach) {approx} Location + Kinetic Energy Proxy + Tidal Height The above equations form the basis for a conceptual model of the factors leading to salmon stranding. The equations also form the basis for an approach for assessing impacts of dredging under the before/after study design.

  2. Double layer capacitors : automotive applications and modeling

    E-Print Network [OSTI]

    New, David Allen, 1976-

    2004-01-01

    This thesis documents the work on the modeling of double layer capacitors (DLCs) and the validation of the modeling procedure. Several experiments were conducted to subject the device under test to a variety of ...

  3. Double logarithmic asymptotic behavior in quantum chromodynamics

    SciTech Connect (OSTI)

    Kirschner, R.

    1981-08-01

    The double logarithmic contributions to the quark-(anti)quark scattering and annihilation amplitudes are summed to all orders in quantum chromodynamics. The results are a generalization of the calculations of Gorshkov et al. in the case of quantum electrodynamics.

  4. Double bevel construction of a diamond anvil

    DOE Patents [OSTI]

    Moss, W.C.

    1987-02-06

    Use of double or multiple bevel culet geometry on a diamond anvil to provide increased sample pressure and stability for a given force applied to the diamond tables. 7 figs.

  5. CP Violation in Neutrinoless Double Beta Decay

    E-Print Network [OSTI]

    T. Fukuyama; K. Matsuda; H. Nishiura

    1997-08-19

    We argue three-flavour neutrino mixing. We consider the neutrinos as Majorana particles and see how the neutrinoless double beta decay constrains the neutrino mixing angles. Our formulation is widely valid and is applied to the neutrino oscillation experiment.

  6. Phenomenology of neutrinoless double beta decay

    E-Print Network [OSTI]

    Gómez-Cadenas, J J

    2015-01-01

    This paper reviews the current status and future outlook of neutrinoless double beta decay searches, which try to provide an answer to the fundamental question of whether neutrinos are Dirac or Majorana particles.

  7. Probing neutrinoless double beta decay with SNO+

    E-Print Network [OSTI]

    Evelina Arushanova; Ashley R. Back

    2015-05-01

    Probing neutrinoless double beta decay is one of the primary goals for SNO+, SNOLAB's multi-purpose neutrino detector. In order to achieve this goal the SNO detector has been adapted so that it can be filled with Te-loaded liquid scintillator. During the initial double beta phase the target loading is 0.3% natural Te, which equates to $\\sim790$ kg of double beta isotope. Estimating the sensitivity to neutrinoless double beta decay requires a well understood background model. For SNO+ this is provided by a comprehensive study considering all possible background contributions, whether they originate from within the liquid scintillator cocktail, the surrounding parts of the detector or other irreducible backgrounds. Given these considerations, for five years running in the initial phase, the expected sensitivity is $T_{1/2}^{0\

  8. Phenomenology of neutrinoless double beta decay

    E-Print Network [OSTI]

    J. J. Gómez-Cadenas; Justo Martín-Albo

    2015-02-25

    This paper reviews the current status and future outlook of neutrinoless double beta decay searches, which try to provide an answer to the fundamental question of whether neutrinos are Dirac or Majorana particles.

  9. Probing neutrinoless double beta decay with SNO+

    E-Print Network [OSTI]

    Arushanova, Evelina

    2015-01-01

    Probing neutrinoless double beta decay is one of the primary goals for SNO+, SNOLAB's multi-purpose neutrino detector. In order to achieve this goal the SNO detector has been adapted so that it can be filled with Te-loaded liquid scintillator. During the initial double beta phase the target loading is 0.3% natural Te, which equates to $\\sim790$ kg of double beta isotope. Estimating the sensitivity to neutrinoless double beta decay requires a well understood background model. For SNO+ this is provided by a comprehensive study considering all possible background contributions, whether they originate from within the liquid scintillator cocktail, the surrounding parts of the detector or other irreducible backgrounds. Given these considerations, for five years running in the initial phase, the expected sensitivity is $T_{1/2}^{0\

  10. Double shell tank waste analysis plan

    SciTech Connect (OSTI)

    Mulkey, C.H.; Jones, J.M.

    1994-12-15

    Waste analysis plan for the double shell tanks. SD-WM-EV-053 is Superseding SD-WM-EV-057.This document provides the plan for obtaining information needed for the safe waste handling and storage of waste in the Double Shell Tank Systems. In Particular it addresses analysis necessary to manage waste according to Washington Administrative Code 173-303 and Title 40, parts 264 and 265 of the Code of Federal Regulations.

  11. Neutrinoless double beta decay with scalar bilinears

    E-Print Network [OSTI]

    H. V. Klapdor-Kleingrothaus; U. Sarkar

    2002-11-18

    One possible probe to physics beyond the standard model is to look for scalar bilinears, which couple to two fermions of the standard model. We point out that the scalar bilinears allow new diagrams contributing to the neutrinoless double beta decay. The upper bound on the neutrinoless double beta decay lifetime would then give new constraints on the ratio of the masses of these scalars to their couplings to the fermions.

  12. Neutrinoless Double Beta Decay and CP Violation

    E-Print Network [OSTI]

    Patrick J. O'Donnell; Utpal Sarkar

    1993-05-27

    We study the relation between the Majorana neutrino mass matrices and the neutrinoless double beta decay when CP is not conserved. We give an explicit form of the decay rate in terms of a rephasing invariant quantity and demonstrate that in the presence of CP violation it is impossible to have vanishing neutrinoless double beta decay in the case of two neutrino generations (or when the third generation leptons do not mix with other leptons and hence decouple).

  13. Searches for neutrinoless double beta decay

    E-Print Network [OSTI]

    B. Schwingenheuer

    2012-01-24

    Neutrinoless double beta decay is a lepton number violating process whose observation would also establish that neutrinos are their own anti-particles. There are many experimental efforts with a variety of techniques. Some (EXO, Kamland-Zen, GERDA phase I and CANDLES) started take data in 2011 and EXO has reported the first measurement of the half life for the double beta decay with two neutrinos of $^{136}$Xe. The sensitivities of the different proposals are reviewed.

  14. Wavelength-doubling optical parametric oscillator

    DOE Patents [OSTI]

    Armstrong, Darrell J. (Albuquerque, NM); Smith, Arlee V. (Albuquerque, NM)

    2007-07-24

    A wavelength-doubling optical parametric oscillator (OPO) comprising a type II nonlinear optical medium for generating a pair of degenerate waves at twice a pump wavelength and a plurality of mirrors for rotating the polarization of one wave by 90 degrees to produce a wavelength-doubled beam with an increased output energy by coupling both of the degenerate waves out of the OPO cavity through the same output coupler following polarization rotation of one of the degenerate waves.

  15. A Crystallographic Study of the Role of Sequence Context in Thymine Glycol Bypass by a Replicative DNA Polymerase Serendipitously Sheds Light on the Exonuclease Complex

    SciTech Connect (OSTI)

    Aller, Pierre; Duclos, Stéphanie; Wallace, Susan S.; Doublié, Sylvie (Vermont)

    2012-06-27

    Thymine glycol (Tg) is the most common oxidation product of thymine and is known to be a strong block to replicative DNA polymerases. A previously solved structure of the bacteriophage RB69 DNA polymerase (RB69 gp43) in complex with Tg in the sequence context 5'-G-Tg-G shed light on how Tg blocks primer elongation: The protruding methyl group of the oxidized thymine displaces the adjacent 5'-G, which can no longer serve as a template for primer elongation [Aller, P., Rould, M. A., Hogg, M, Wallace, S. S. and Doublie S. (2007). A structural rationale for stalling of a replicative DNA polymerase at the most common oxidative thymine lesion, thymine glycol. Proc. Natl. Acad. Sci. USA, 104, 814-818.]. Several studies showed that in the sequence context 5'-C-Tg-purine, Tg is more likely to be bypassed by Klenow fragment, an A-family DNA polymerase. We set out to investigate the role of sequence context in Tg bypass in a B-family polymerase and to solve the crystal structures of the bacteriophage RB69 DNA polymerase in complex with Tg-containing DNA in the three remaining sequence contexts: 5'-A-Tg-G, 5'-T-Tg-G, and 5'-C-Tg-G. A combination of several factors - including the associated exonuclease activity, the nature of the 3' and 5' bases surrounding Tg, and the cis-trans interconversion of Tg - influences Tg bypass. We also visualized for the first time the structure of a well-ordered exonuclease complex, allowing us to identify and confirm the role of key residues (Phe123, Met256, and Tyr257) in strand separation and in the stabilization of the primer strand in the exonuclease site.

  16. Ortho-positronium observation in the Double Chooz Experiment

    E-Print Network [OSTI]

    Y. Abe; J. C. dos Anjos; J. C. Barriere; E. Baussan; I. Bekman; M. Bergevin; T. J. C. Bezerra; L. Bezrukov; E. Blucher; C. Buck; J. Busenitz; A. Cabrera; E. Caden; L. Camilleri; R. Carr; M. Cerrada; P. -J. Chang; E. Chauveau; P. Chimenti; A. P. Collin; E. Conover; J. M. Conrad; J. I. Crespo-Anadon; K. Crum; A. S. Cucoanes; E. Damon; J. V. Dawson; J. Dhooghe; D. Dietrich; Z. Djurcic; M. Dracos; M. Elnimr; A. Etenko; M. Fallot; F. von Feilitzsch; J. Felde; S. M. Fernandes; V. Fischer; D. Franco; M. Franke; H. Furuta; I. Gil-Botella; L. Giot; M. Goger-Neff; L. F. G. Gonzalez; L. Goodenough; M. C. Goodman; C. Grant; N. Haag; T. Hara; J. Haser; M. Hofmann; G. A. Horton-Smith; A. Hourlier; M. Ishitsuka; J. Jochum; C. Jollet; F. Kaether; L. N. Kalousis; Y. Kamyshkov; D. M. Kaplan; T. Kawasaki; E. Kemp; H. de Kerret; D. Kryn; M. Kuze; T. Lachenmaier; C. E. Lane; T. Lasserre; A. Letourneau; D. Lhuillier; H. P. Lima Jr; M. Lindner; J. M. Lopez-Castano; J. M. LoSecco; B. Lubsandorzhiev; S. Lucht; J. Maeda; C. Mariani; J. Maricic; J. Martino; T. Matsubara; G. Mention; A. Meregaglia; T. Miletic; R. Milincic; A. Minotti; Y. Nagasaka; Y. Nikitenko; P. Novella; L. Oberauer; M. Obolensky; A. Onillon; A. Osborn; C. Palomares; I. M. Pepe; S. Perasso; P. Pfahler; A. Porta; G. Pronost; J. Reichenbacher; B. Reinhold; M. Rohling; R. Roncin; S. Roth; B. Rybolt; Y. Sakamoto; R. Santorelli; A. C. Schilithz; S. Schonert; S. Schoppmann; M. H. Shaevitz; R. Sharankova; S. Shimojima; D. Shrestha; V. Sibille; V. Sinev; M. Skorokhvatov; E. Smith; J. Spitz; A. Stahl; I. Stancu; L. F. F. Stokes; M. Strait; A. Stuken; F. Suekane; S. Sukhotin; T. Sumiyoshi; Y. Sun; R. Svoboda; K. Terao; A. Tonazzo; H. H. Trinh Thi; G. Valdiviesso; N. Vassilopoulos; C. Veyssiere; M. Vivier; S. Wagner; N. Walsh; H. Watanabe; C. Wiebusch; L. Winslow; M. Wurm; G. Yang; F. Yermia; V. Zimmer

    2014-10-07

    The Double Chooz experiment measures the neutrino mixing angle $\\theta_{13}$ by detecting reactor $\\bar{\

  17. Laminar burn rates of gun propellants measured in the high-pressure strand burner

    SciTech Connect (OSTI)

    Reaugh, J. E., LLNL

    1997-10-01

    The pressure dependence of the laminar burn rate of gun propellants plays a role in the design and behavior of high-performance guns. We have begun a program to investigate the effects of processing variables on the laminar burn rates, using our high-pressure strand burner to measure these rates at pressures exceeding 700 MPa. We have burned JA2 and M43 propellant samples, provided by Dr. Arpad Juhasz, ARL, from propellant lots previously used in round-robin tests. Our results at room temperature are in accord with other measurements. In addition, we present results measured for propellant that has been preheated to 50 C before burning. We used our thermochemical equilibrium code, CHEETAH, to help interpret the simultaneous pressure and temperature measurements taken during the testing, and show examples of its use. It has been modified to provide performance measures and equations of state for the products that are familiar to the gun-propellant community users of BLAKE.

  18. Sequence independent amplification of DNA

    DOE Patents [OSTI]

    Bohlander, S.K.

    1998-03-24

    The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example, the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei. 25 figs.

  19. Responsive Double Network Hydrogels of Interpenetrating DNA and CB[8] Host–Guest Supramolecular Systems

    E-Print Network [OSTI]

    Li, Chuang; Rowland, Matthew J.; Shao, Yu; Cao, Tianyang; Chen, Chun; Jia, Haoyang; Zhou, Xu; Yang, Zhongqiang; Scherman, Oren A.; Liu, Dongsheng

    2015-04-20

    was dissolved in a minimal amount of diethyl ether and 2 M hydrogen chloride in diethyl ether (15 mL) was added. The reaction was stirred for 4 hours and concentrated in vacuo to yield a yellow solid. The crude product was then triturated in diethyl ether... Hz and 1%, respectively, and the changes in the shear storage modulus (G’) and shear-loss modulus (G”) were measured from 20 to 70 ºC at a rate of 2 ºC min-1; iv) Flow sweep was performed at 25 Fracture with shear rate varying from 0.001 to 100 s-1...

  20. The search for neutrinoless double beta decay

    E-Print Network [OSTI]

    J. J. Gomez-Cadenas; J. Martin-Albo; M. Mezzetto; F. Monrabal; M. Sorel

    2012-01-16

    In the last two decades the search for neutrinoless double beta decay has evolved into one of the highest priorities for understanding neutrinos and the origin of mass. The main reason for this paradigm shift has been the discovery of neutrino oscillations, which clearly established the existence of massive neutrinos. An additional motivation for conducting such searches comes from the existence of an unconfirmed, but not refuted, claim of evidence for neutrinoless double decay in $^{76}\\text{Ge}$. As a consequence, a new generation of experiments, employing different detection techniques and $\\beta\\beta$ isotopes, is being actively promoted by experimental groups across the world. In addition, nuclear theorists are making remarkable progress in the calculation of the neutrinoless double beta decay nuclear matrix elements, thus eliminating a substantial part of the theoretical uncertainties affecting the particle physics interpretation of this process. In this report, we review the main aspects of the double beta decay process and some of the most relevant experiments. The picture that emerges is one where searching for neutrinoless double beta decay is recognized to have both far-reaching theoretical implications and promising prospects for experimental observation in the near future.

  1. Quantitative Analysis of Clustered DNA Damages Induced by Silicon Beams of Different Kinetic Energy

    SciTech Connect (OSTI)

    Keszenman D. J.; Keszenman, D.J.; Bennett, P.V.; Sutherland, B.M.; Wilson, P.F.

    2013-05-14

    Humans may b exposed to highly energetic charged particle radiation as a result of medical treatments, occupational activitie or accidental events. In recent years, our increasing presence and burgeoning interest in space exploration beyond low Earth orbit has led to a large increase in the research of the biological effects ofcharged particle radiation typical of that encountered in the space radiation environment. The study of the effects of these types of radiation qualities in terms ofDNA damage induction and repair is fundamental to understand mechanisms both underlying their greater biological effectiveness as we)) as the short and long term risks of health effects such as carcinogenesis, degen rative diseases and premature aging. Charged particle radiation induces a variety of DNA alterations, notably bistranded clustered damages, defined as two or more closely-opposed strand break , oxidized bases or abasic sites within a few helical turns. The induction of such highly complex DNA damage enhances the probability of incorrect or incomplete repair and thus constitutes greater potential for genomic instability, cell death and transformation.

  2. Solid-state NMR analysis of the {beta}-strand orientation of the protofibrils of amyloid {beta}-protein

    SciTech Connect (OSTI)

    Doi, Takashi [Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan)] [Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan); Masuda, Yuichi, E-mail: masuda@mail.pharm.tohoku.ac.jp [Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan) [Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan); Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai 980-8578 (Japan); Irie, Kazuhiro [Graduate School of Agriculture, Kyoto University, Kyoto 606-8502 (Japan)] [Graduate School of Agriculture, Kyoto University, Kyoto 606-8502 (Japan); Akagi, Ken-ichi; Monobe, Youko; Imazawa, Takayoshi [Section of Laboratory Equipment, Division of Biomedical Research, National Institute of Biomedical Innovation, Osaka 567-0085 (Japan)] [Section of Laboratory Equipment, Division of Biomedical Research, National Institute of Biomedical Innovation, Osaka 567-0085 (Japan); Takegoshi, K. [Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan)] [Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan)

    2012-11-30

    Highlights: Black-Right-Pointing-Pointer The supramolecular structure of A{beta}42 protofibrils was analyzed by solid-state NMR. Black-Right-Pointing-Pointer The Ala-21 residue in the A{beta}42 protofibrils is included in a slightly disordered {beta}-strand. Black-Right-Pointing-Pointer The A{beta}42 protofibrils do not form intermolecular in-register parallel {beta}-sheets. -- Abstract: Alzheimer's disease (AD) is caused by abnormal deposition (fibrillation) of a 42-residue amyloid {beta}-protein (A{beta}42) in the brain. During the process of fibrillation, the A{beta}42 takes the form of protofibrils with strong neurotoxicity, and is thus believed to play a crucial role in the pathogenesis of AD. To elucidate the supramolecular structure of the A{beta}42 protofibrils, the intermolecular proximity of the Ala-21 residues in the A{beta}42 protofibrils was analyzed by {sup 13}C-{sup 13}C rotational resonance experiments in the solid state. Unlike the A{beta}42 fibrils, an intermolecular {sup 13}C-{sup 13}C correlation was not found in the A{beta}42 protofibrils. This result suggests that the {beta}-strands of the A{beta}42 protofibrils are not in an in-register parallel orientation. A{beta}42 monomers would assemble to form protofibrils with the {beta}-strand conformation, then transform into fibrils by forming intermolecular parallel {beta}-sheets.

  3. Topics in Forensic DNA Analysis &

    E-Print Network [OSTI]

    chemistry from the University of Virginia. His dissertation research, which was conducted at the FBI Academy guest of the FBI's Scientific Working Group on DNA Analysis Methods (SWGDAM) and a member

  4. Titanium subhydride potassium perchlorate (TiH1.65/KClO4) burn rates from hybrid closed bomb-strand burner experiments.

    SciTech Connect (OSTI)

    Cooper, Marcia A.; Oliver, Michael S.

    2012-08-01

    A hybrid closed bomb-strand burner is used to measure the burning behavior of the titanium subhydride potassium perchlorate pyrotechnic with an equivalent hydrogen concentration of 1.65. This experimental facility allows for simultaneous measurement of the closed bomb pressure rise and pyrotechnic burn rate as detected by electrical break wires over a range of pressures. Strands were formed by pressing the pyrotechnic powders to bulk densities between 60% and 90% theoretical maximum density. The burn rate dependance on initial density and vessel pressure are measured. At all initial strand densities, the burn is observed to transition from conductive to convective burning within the strand. The measured vessel pressure history is further analyzed following the closed bomb analysis methods developed for solid propellants.

  5. Recent Results in Neutrinoless Double Beta Decay

    E-Print Network [OSTI]

    Lisa J. Kaufman

    2013-05-14

    The search for neutrinoless double beta decay is a rich source for new physics. The observation of this decay will lead to understanding of the absolute mass scale of neutrinos, the Majorana nature of the neutrino (whether the neutrino is its own anti-particle), and lepton number violation. Double beta decay is being investigated around the world by several experiments using different candidate isotopes. There has been much progress made in experimental techniques recently such that achieving sensitivity to neutrino masses at 50 meV and below will be possible in the near future. A summary of recent results in neutrinoless double beta decay is discussed with a look toward the experimental goals for the future.

  6. Phenomenology of neutrinoless double beta decay

    E-Print Network [OSTI]

    M. Hirsch

    2006-09-15

    Neutrinoless double beta decay violates lepton number by two units, a positive observation therefore necessarily implies physics beyond the standard model. Here, three possible contributions to neutrinoless double beta decay are briefly reviewed: (a) The mass mechanism and its connection to neutrino oscillations; (b) Left-right symmetric models and the lower limit on the right-handed W boson mass; and (c) R-parity violating supersymmetry. In addition, the recently published ``extended black box'' theorem is briefly discussed. Combined with data from oscillation experiments this theorem provides proof that the neutrinoless double beta decay amplitude must receive a non-zero contribution from the mass mechanism, if neutrinos are indeed Majorana particles.

  7. Precision Muon Reconstruction in Double Chooz

    E-Print Network [OSTI]

    Double Chooz collaboration; Y. Abe; J. C. dos Anjos; J. C. Barriere; E. Baussan; I. Bekman; M. Bergevin; T. J. C. Bezerra; L. Bezrukov; E. Blucher; C. Buck; J. Busenitz; A. Cabrera; E. Caden; L. Camilleri; R. Carr; M. Cerrada; P. -J. Chang; E. Chauveau; P. Chimenti; A. P. Collin; E. Conover; J. M. Conrad; J. I. Crespo-Anadón; K. Crum; A. Cucoanes; E. Damon; J. V. Dawson; D. Dietrich; Z. Djurcic; M. Dracos; M. Elnimr; A. Etenko; M. Fallot; F. von Feilitzsch; J. Felde; S. M. Fernandes; V. Fischer; D. Franco; M. Franke; H. Furuta; I. Gil-Botella; L. Giot; M. Göger-Neff; L. F. G. Gonzalez; L. Goodenough; M. C. Goodman; C. Grant; N. Haag; T. Hara; J. Haser; M. Hofmann; G. A. Horton-Smith; A. Hourlier; M. Ishitsuka; J. Jochum; C. Jollet; F. Kaether; L. N. Kalousis; Y. Kamyshkov; D. M. Kaplan; T. Kawasaki; E. Kemp; H. de Kerret; D. Kryn; M. Kuze; T. Lachenmaier; C. E. Lane; T. Lasserre; A. Letourneau; D. Lhuillier; H. P. Lima Jr; M. Lindner; J. M. López-Casta no; J. M. LoSecco; B. Lubsandorzhiev; S. Lucht; J. Maeda; C. Mariani; J. Maricic; J. Martino; T. Matsubara; G. Mention; A. Meregaglia; T. Miletic; R. Milincic; A. Minotti; Y. Nagasaka; Y. Nikitenko; P. Novella; M. Obolensky; L. Oberauer; A. Onillon; A. Osborn; C. Palomares; I. M. Pepe; S. Perasso; P. Pfahler; A. Porta; G. Pronost; J. Reichenbacher; B. Reinhold; M. Röhling; R. Roncin; S. Roth; B. Rybolt; Y. Sakamoto; R. Santorelli; A. C. Schilithz; S. Schönert; S. Schoppmann; M. H. Shaevitz; R. Sharankova; S. Shimojima; V. Sibille; V. Sinev; M. Skorokhvatov; E. Smith; J. Spitz; A. Stahl; I. Stancu; L. F. F. Stokes; M. Strait; A. Stüken; F. Suekane; S. Sukhotin; T. Sumiyoshi; Y. Sun; R. Svoboda; K. Terao; A. Tonazzo; H. H. Trinh Thi; G. Valdiviesso; N. Vassilopoulos; C. Veyssiere; M. Vivier; S. Wagner; H. Watanabe; C. Wiebusch; L. Winslow; M. Wurm; G. Yang; F. Yermia; V. Zimmer

    2014-08-15

    We describe a muon track reconstruction algorithm for the reactor anti-neutrino experiment Double Chooz. The Double Chooz detector consists of two optically isolated volumes of liquid scintillator viewed by PMTs, and an Outer Veto above these made of crossed scintillator strips. Muons are reconstructed by their Outer Veto hit positions along with timing information from the other two detector volumes. All muons are fit under the hypothesis that they are through-going and ultrarelativistic. If the energy depositions suggest that the muon may have stopped, the reconstruction fits also for this hypothesis and chooses between the two via the relative goodness-of-fit. In the ideal case of a through-going muon intersecting the center of the detector, the resolution is ~40 mm in each transverse dimension. High quality muon reconstruction is an important tool for reducing the impact of the cosmogenic isotope background in Double Chooz.

  8. Picornaviruses and nuclear functions: Targeting a cellular compartment distinct from the replication site of a positive-strand RNA virus

    E-Print Network [OSTI]

    Flather, D; Semler, BL

    2015-01-01

    and Semler, B. L. (2013). Cellular mRNA decay protein AUF1pore complex: hijacking cellular phosphorylation machinery.2Apro expression on cellular metabolism. Inhibition of DNA

  9. The double-beta decay: Theoretical challenges

    SciTech Connect (OSTI)

    Horoi, Mihai

    2012-11-20

    Neutrinoless double beta decay is a unique process that could reveal physics beyond the Standard Model of particle physics namely, if observed, it would prove that neutrinos are Majorana particles. In addition, it could provide information regarding the neutrino masses and their hierarchy, provided that reliable nuclear matrix elements can be obtained. The two neutrino double beta decay is an associate process that is allowed by the Standard Model, and it was observed for about ten nuclei. The present contribution gives a brief review of the theoretical challenges associated with these two process, emphasizing the reliable calculation of the associated nuclear matrix elements.

  10. On the neutrinoless double ?{sup +}/EC decays

    SciTech Connect (OSTI)

    Suhonen, Jouni

    2013-12-30

    The neutrinoless double positron-emission/electron-capture (0??{sup +}/EC) decays are studied for the magnitudes of the involved nuclear matrix elements (NMEs). Decays to the ground state, 0{sub gs}{sup +}, and excited 0{sup +} states are discussed. The participant many-body wave functions are evaluated in the framework of the quasiparticle random-phase approximation (QRPA). Effective, G-matrix-derived nuclear forces are used in realistic single-particle model spaces. The channels ?{sup +}?{sup +}, ?{sup +}EC, and the resonant neutrinoless double electron capture (R0?ECEC) are discussed.

  11. The Polymerase Chain Reaction and Branching Processes Fengzhu Sun

    E-Print Network [OSTI]

    Sun, Fengzhu - Sun, Fengzhu

    The Polymerase Chain Reaction and Branching Processes Fengzhu Sun Department of Mathematics, DRB is studied. We also study the distribution of the Hamming distance between two randomly chosen sequences long. The double-stranded DNA molecules are heated to near boiling temperature so that the double

  12. Characterization of nanoparticle-DNA conjugate and control of DNA conformation on particle surface

    E-Print Network [OSTI]

    Park, Sunho, 1976-

    2009-01-01

    Nano-science has exploited the hybridization and de-hybridization phenomena of DNA which are one of its fundamental functions. In particular, conjugates of gold nanoparticles and DNA (Au NP-DNA) have been extensively ...

  13. Regulation of DNA damage tolerance : studies of the translesion synthesis DNA ploymerase eta in Saccharomyces cerevisiae

    E-Print Network [OSTI]

    Woodruff, Rachel Van Etten

    2008-01-01

    All organisms must control the effects of DNA damage to protect the integrity of their genomes. In addition to DNA repair, this requires DNA damage tolerance pathways, which allow the continuation of essential processes ...

  14. Research article Development and usage of a NIST standard reference material

    E-Print Network [OSTI]

    quantitation of human DNA§ P.M. Vallone *, M.C. Kline, D.L. Duewer, A.E. Decker, J.W. Redman, J.C. Travis, M.0 at 260 nm equals 50 ng/mL of double stranded DNA. In addition, an interlaboratory study has been

  15. Subscriber access provided by STANFORD UNIV GREEN LIBR Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth

    E-Print Network [OSTI]

    Barron, Annelise E.

    in the electropherogram, both single- and double-stranded. Using these protocols and a panel of 11 p53 mutant DNA samples with 32P-labeled (radioactive) primers, thermal denaturation, and cooling of the resulting dsDNA to form

  16. www.landesbioscience.com GM Crops and Food: Biotechnology in Agriculture and the Food Chain 1 GM Crops and Food: Biotechnology in Agriculture and the Food Chain 3:4, 1-5; October/November/December 2012; 2012 Landes Bioscience

    E-Print Network [OSTI]

    is a strong constitutive pro- moter, generating high levels of gene expression in dicotyledon- ous plants fam- ily. CaMV was one of first plant DNA viruses to be studied, and its double-stranded circular DNA. The regulatory elements of CaMV have been used since the 1980s to express novel genes in plants;2 specifically

  17. Magnetic tweezers to studyMagnetic tweezers to studyMagnetic tweezers to studyMagnetic tweezers to study DNA motorsDNA motorsDNA motorsDNA motors

    E-Print Network [OSTI]

    Ritort, Felix

    to study DNA motorsDNA motorsDNA motorsDNA motors MariaMariaMariaMaria MañosasMañosasMañosasMañosas Ritort) · Applications: 1. Tracking DNA motors: (i) Helicases (ii) Annealing motor 2. Studying a multiprotein system: DNA hexamers (Dong et al, JBC 1995) Tracking DNA motors: (i) Helicases #12;Passive: helicase behaves

  18. The Unseen Genome: Gems among the Junk Just when scientists thought they had DNA almost figured out, they are discovering in

    E-Print Network [OSTI]

    Jacob, Eshel Ben

    celebrated the 50th anniversary of the discovery of the double helix, and the Human Genome Project announced to humans. The genome is home to many more actors than just the protein-coding genes. The extentThe Unseen Genome: Gems among the Junk Just when scientists thought they had DNA almost figured out

  19. The COBRA Double Beta Decay Experiment

    SciTech Connect (OSTI)

    Dawson, J. V. [Department of Physics and Astronomy, University of Sussex, Brighton. BN1 9QH (United Kingdom)

    2007-03-28

    The progress of the COBRA neutrinoless double beta decay experiment is discussed. Potential backgrounds are described. Estimates on the contamination levels of 214Bi in the detectors have been made using previously acquired low background data. New crystals with a different passivation material show an improved background count rate of approximately one order of magnitude.

  20. Double tracks test site characterization report

    SciTech Connect (OSTI)

    NONE

    1996-05-01

    This report presents the results of site characterization activities performed at the Double Tracks Test Site, located on Range 71 North, of the Nellis Air Force Range (NAFR) in southern Nevada. Site characterization activities included reviewing historical data from the Double Tracks experiment, previous site investigation efforts, and recent site characterization data. The most recent site characterization activities were conducted in support of an interim corrective action to remediate the Double Tracks Test Site to an acceptable risk to human health and the environment. Site characterization was performed using a phased approach. First, previously collected data and historical records sere compiled and reviewed. Generalized scopes of work were then prepared to fill known data gaps. Field activities were conducted and the collected data were then reviewed to determine whether data gaps were filled and whether other areas needed to be investigated. Additional field efforts were then conducted, as required, to adequately characterize the site. Characterization of the Double Tracks Test Site was conducted in accordance with the US Department of Energy`s (DOE) Streamlined Approach for Environmental Restoration (SAFER).

  1. Cretan Hieroglyphic Wool Units (LANA, double mina)

    E-Print Network [OSTI]

    Younger, John G.

    2005-01-01

    Minoan Hieroglyphic document CHIC *089, on analogy with Linear A and B wool documents, records the wool of a certain type of cloth as the equivalent in weight of 3 double minas, that is 1 wool unit (or the wool from 4 sheep).

  2. Scale evolution of double parton correlations

    E-Print Network [OSTI]

    Tomas Kasemets

    2014-11-17

    We review the effect of scale evolution on a number of different correlations in double parton scattering (DPS). The strength of the correlations generally decreases with the scale but at a rate which greatly varies between different types. Through studies of the evolution, an understanding of which correlations can be of experimental relevance in different processes and kinematical regions is obtained.

  3. Neutrinoless double beta decay in seesaw models

    E-Print Network [OSTI]

    Mattias Blennow; Enrique Fernandez-Martinez; Jacobo Lopez-Pavon; Javier Menendez

    2014-05-12

    We study the general phenomenology of neutrinoless double beta decay in seesaw models. In particular, we focus on the dependence of the neutrinoless double beta decay rate on the mass of the extra states introduced to account for the Majorana masses of light neutrinos. For this purpose, we compute the nuclear matrix elements as functions of the mass of the mediating fermions and estimate the associated uncertainties. We then discuss what can be inferred on the seesaw model parameters in the different mass regimes and clarify how the contribution of the light neutrinos should always be taken into account when deriving bounds on the extra parameters. Conversely, the extra states can also have a significant impact, cancelling the Standard Model neutrino contribution for masses lighter than the nuclear scale and leading to vanishing neutrinoless double beta decay amplitudes even if neutrinos are Majorana particles. We also discuss how seesaw models could reconcile large rates of neutrinoless double beta decay with more stringent cosmological bounds on neutrino masses.

  4. Double Tracks revegetation and monitoring plan

    SciTech Connect (OSTI)

    NONE

    1997-07-01

    This document is a reclamation plan for short-term and long-term stabilization of land disturbed by activities associated with interim clean-up of radionuclide-contaminated surface soil at the Double Tracks site. This document has been prepared to provide general reclamation practices and procedures that will be followed during restoration of the cleanup site. Reclamation demonstration plots were established near the site in the fall of 1994 to evaluate the performance of several native species and to evaluate different irrigation strategies. Results of the study at Double Tracks, as well as the results from numerous studies conducted at other sites (Area 11 and Area 19 of the Nevada Test Site), have been summarized and incorporated into this final reclamation plan for the interim cleanup of the Double Tracks site, located northwest of the Nevada Test Site on the Nellis Air Force Range. Surface soils at Double Tracks were contaminated as a result of the detonation of a device containing plutonium and depleted uranium using chemical explosives. The total amount of Pu deposited on the site was between 980 and 1,600 grams and was scattered downwind south of the detonation site. Short-term stabilization consists of the application of a chemical soil stabilizer that is applied immediately following excavation of the contaminated soils to minimize Pu resuspension. Long-term stabilization is accomplished by the establishment of a permanent vegetation.

  5. Double layer capacitor prospects look good

    SciTech Connect (OSTI)

    1995-07-01

    The Fourth International Seminar in Double Layer Capacitors and similar energy devices has been sponsored again by Dr. S.P. Wolsky and Dr. Nikola Marincic. The seminar was held in December 1994, at Deerfield Beach, FL. This report provides a brief description of information on supercapacitors.

  6. The Structure of DNA within Cationic Lipid/DNA Complexes

    E-Print Network [OSTI]

    Braun, Chad S.; Jas, Gouri S.; Choosakoonriang, Sirirat; Koe, Gary S.; Smith, Janet G.; Middaugh, C. Russell

    2003-02-01

    hexagonal phase of cationic liposome-DNA complexes related to DNA release and delivery. Science. 281:78–81. Koppel, D. E. 1972. Analysis of macromolecular polydispersity in inten- sity correlation spectroscopy: the method of cumulants. J. Chem. Phys. 57:4814..., DOTAP, 1,2-dioleoyl-sn-glycero-3-phosphatidyletha- nolamine, and cholesterol were purchased from Avanti Polar Lipids (Alabaster, AL). Poly(dG) Æ poly(dC) (4 kbp), poly(dA) Æ poly(dT) (;229 bp), poly(dGdC) Æ poly(dGdC) (724 bp), and poly(dAdT) Æ poly(d...

  7. Diapycnal advection by double diffusion and turbulence in the ocean

    E-Print Network [OSTI]

    St. Laurent, Louis C

    1999-01-01

    Observations of diapycnal mixing rates are examined and related to diapycnal advection for both double-diffusive and turbulent regimes. The role of double-diffusive mixing at the site of the North Atlantic Tracer Release ...

  8. The effects of double-diffusion on a baroclinic vortex

    E-Print Network [OSTI]

    Smith, Wendy Marie

    1987-01-01

    Laboratory experiments were performed to study the combined effects of double-diffusion and rotation on an oceanic intrusion. Intrusions are driven across density-compensated fronts by the divergence of the double-diffusive ...

  9. National CHP Roadmap: Doubling Combined Heat and Power Capacity...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    CHP Roadmap: Doubling Combined Heat and Power Capacity in the United States by 2010, March 2001 National CHP Roadmap: Doubling Combined Heat and Power Capacity in the United States...

  10. Identification of Novel Positive-Strand RNA Viruses by Metagenomic Analysis of Archaea-Dominated Yellowstone Hot Springs

    SciTech Connect (OSTI)

    Benjamin Bolduc; Daniel P. Shaughnessy; Yuri I. Wolf; Eugene V. Koonin; Francisco F. Roberto; Mark Young

    2012-05-01

    There are no known RNA viruses that infect Archaea. Filling this gap in our knowledge of viruses will enhance our understanding of the relationships between RNA viruses from the three domains of cellular life and, in particular, could shed light on the origin of the enormous diversity of RNA viruses infecting eukaryotes. We describe here the identification of novel RNA viral genome segments from high-temperature acidic hot springs in Yellowstone National Park in the United States. These hot springs harbor low-complexity cellular communities dominated by several species of hyperthermophilic Archaea. A viral metagenomics approach was taken to assemble segments of these RNA virus genomes from viral populations isolated directly from hot spring samples. Analysis of these RNA metagenomes demonstrated unique gene content that is not generally related to known RNA viruses of Bacteria and Eukarya. However, genes for RNA-dependent RNA polymerase (RdRp), a hallmark of positive-strand RNA viruses, were identified in two contigs. One of these contigs is approximately 5,600 nucleotides in length and encodes a polyprotein that also contains a region homologous to the capsid protein of nodaviruses, tetraviruses, and birnaviruses. Phylogenetic analyses of the RdRps encoded in these contigs indicate that the putative archaeal viruses form a unique group that is distinct from the RdRps of RNA viruses of Eukarya and Bacteria. Collectively, our findings suggest the existence of novel positive-strand RNA viruses that probably replicate in hyperthermophilic archaeal hosts and are highly divergent from RNA viruses that infect eukaryotes and even more distant from known bacterial RNA viruses. These positive-strand RNA viruses might be direct ancestors of RNA viruses of eukaryotes.

  11. Computer code for double beta decay QRPA based calculations

    E-Print Network [OSTI]

    Bertulani, Carlos A. - Department of Physics and Astronomy, Texas A&M University

    the experimental bound [11] on neutrinoless double beta decay (## 0# ). The only way out would be to have two

  12. Neutrinoless Double Beta Decay and Physics Beyond the Standard Model

    E-Print Network [OSTI]

    Frank F. Deppisch; Martin Hirsch; Heinrich Päs

    2012-08-03

    Neutrinoless double beta decay is the most powerful tool to probe not only for Majorana neutrino masses but for lepton number violating physics in general. We discuss relations between lepton number violation, double beta decay and neutrino mass, review a general Lorentz invariant parametrization of the double beta decay rate, highlight a number of different new physics models showing how different mechanisms can trigger double beta decay, and finally discuss possibilities to discriminate and test these models and mechanisms in complementary experiments.

  13. Studies of ${\\rm Nb}_{3}{\\rm Sn}$ Strands Based on the Restacked-Rod Process for High Field Accelerator Magnets

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Barzi, E.; Bossert, M.; Gallo, G.; Lombardo, V.; Turrioni, D.; Yamada, R.; Zlobin, A. V.

    2011-12-21

    A major thrust in Fermilab's accelerator magnet R&D program is the development of Nb3Sn wires which meet target requirements for high field magnets, such as high critical current density, low effective filament size, and the capability to withstand the cabling process. The performance of a number of strands with 150/169 restack design produced by Oxford Superconducting Technology was studied for round and deformed wires. To optimize the maximum plastic strain, finite element modeling was also used as an aid in the design. Results of mechanical, transport and metallographic analyses are presented for round and deformed wires.

  14. Sensitivity of CUORE to Neutrinoless Double-Beta Decay

    E-Print Network [OSTI]

    Alessandria, F.

    2013-01-01

    of CUORE to Neutrinoless Double-Beta Decay b c,:L d e f F .s t results on neutrinoless double beta decay of T e w i t hthe study of neutrinoless double beta decay, J . C r y s t .

  15. The Majorana Neutrinoless Double-Beta Decay Experiment

    E-Print Network [OSTI]

    Washington at Seattle, University of - Department of Physics, Electroweak Interaction Research Group

    The Majorana Neutrinoless Double-Beta Decay Experiment Pre-conceptual Design Proposal November 22 Motivation for Neutrinoless Double-Beta Decay Experiments . . . . . . . . . 4 2.1.1 Community Guidance Neutrinoless Double-Beta Decay Results . . . . . . . . . . . . . . . . . . . . 12 2.5 Next

  16. The Initiation of Bacterial DNA Replication

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    for this system. Instead, DnaA forms an open right-handed helix. In addition, the architecture indicates that this AAA+ superhelix will wrap coils of the DNA around its exterior,...

  17. Micropatterned cell arrays for detecting DNA damage

    E-Print Network [OSTI]

    Mittal, Sukant

    2008-01-01

    Numerous agents are capable of interacting with DNA and damaging it. Permanent changes in the DNA structure can be both mutagenic and cytotoxic; therefore, methods to measure the susceptibility of cells to mutations are ...

  18. Towards Privacy Preserving of Forensic DNA Databases 

    E-Print Network [OSTI]

    Liu, Sanmin

    2012-02-14

    Protecting privacy of individuals is critical for forensic genetics. In a kinship/identity testing, related DNA profiles between user's query and the DNA database need to be extracted. However, unrelated profiles cannot be revealed to each other...

  19. Double pulse Thomson scattering system at RTP

    SciTech Connect (OSTI)

    Beurskens, M.N.; Barth, C.J.; Chu, C.C.; Donne, A.J.; Herranz, J.A.; Lopes Cardozo, N.J.; van der Meiden, H.J.; Pijper, F.J. [FOM-Instituut voor Plasmafysica `Rijnhuizen`, Associatie Euratom-FOM, 3430 BE Nieuwegein (The Netherlands)] [FOM-Instituut voor Plasmafysica `Rijnhuizen`, Associatie Euratom-FOM, 3430 BE Nieuwegein (The Netherlands)

    1997-01-01

    In this article a double pulse multiposition Thomson scattering diagnostic, under construction at RTP, is discussed. Light from a double pulsed ruby laser (pulse separation: 10{endash}800 {mu}s, max. 2{times}12.5 J) is scattered by the free electrons of the tokamak plasma and relayed to a Littrow polychromator for spectral analysis. The spectrally resolved light is recorded by two ICCD detectors. Simulations show that the system sensitivity will be such that electron temperatures in the range of 100 eV{endash}7 keV can be determined with an accuracy as good as 2{percent}{endash}3{percent} for electron densities of 10{sup 20} m{sup {minus}3}, with a spatial resolution down to 2.6 mm. With this diagnostic the dynamics of small scale structures in the electron temperature profile will be studied. {copyright} {ital 1997 American Institute of Physics.}

  20. JUNO and Neutrinoless Double Beta Decay

    E-Print Network [OSTI]

    Shao-Feng Ge; Werner Rodejohann

    2015-07-20

    We study the impact of the precision determination of oscillation parameters in the JUNO experiment on half-life predictions for neutrinoless double beta decay. We show that the solar neutrino mixing angle can be measured by JUNO with below 1% uncertainty. This implies in particular that the minimal value of the effective mass in the inverted mass ordering will be known essentially without uncertainty. We demonstrate that this reduces the range of half-life predictions in order to test this value by a factor of two. The remaining uncertainty is caused by nuclear matrix elements. This has important consequences for future double beta decay experiments that aim at ruling out the inverted mass ordering or the Majorana nature of neutrinos.

  1. Fermion Doubling in Loop Quantum Gravity

    E-Print Network [OSTI]

    Jacob Barnett; Lee Smolin

    2015-07-05

    In this paper, we show that the Hamiltonian approach to loop quantum gravity has a fermion doubling problem. To obtain this result, we couple loop quantum gravity to a free massless scalar and a chiral fermion field, gauge fixing the many fingered time gauge invariance by interpreting the scalar field as a physical clock. We expand around a quantum gravity state based on a regular lattice and consider the limit where the bare cosmological constant is large but the fermonic excitations have energies low in Planck units. We then make the case for identifying the energy spectrum in this approximation with that of a model of lattice fermion theory which is known to double.

  2. Importance of neutrinoless double beta decay

    E-Print Network [OSTI]

    Utpal Sarkar

    2007-12-17

    A natural explanation for the smallness of the neutrino mass requires them to be Majorana particles violating lepton number by two units. Since lepton number violation can have several interesting consequences in particle physics and cosmology, it is of utmost importance to find out if there is lepton number violation in nature and what is its magnitude. The neutrinoless double beta decay experiment can answer these questions: if there is lepton number violation and if neutrinos are Majorana particles. In addition, the magnitude of neutrinoless double beta decay will constrain any other lepton number violating processes. This lepton number violation may also be relatd to the matter-antimatter asymmetry of the universe, dark matter and cosmological constant.

  3. JUNO and Neutrinoless Double Beta Decay

    E-Print Network [OSTI]

    Ge, Shao-Feng

    2015-01-01

    We study the impact of the precision determination of oscillation parameters in the JUNO experiment on half-life predictions for neutrinoless double beta decay. We show that the solar neutrino mixing angle can be measured by JUNO with below 1% uncertainty. This implies in particular that the minimal value of the effective mass in the inverted mass ordering will be known essentially without uncertainty. We demonstrate that this reduces the range of half-life predictions in order to test this value by a factor of two. The remaining uncertainty is caused by nuclear matrix elements. This has important consequences for future double beta decay experiments that aim at ruling out the inverted mass ordering or the Majorana nature of neutrinos.

  4. Recombination energy in double white dwarf formation

    E-Print Network [OSTI]

    Nandez, Jose L A; Lombardi, James C

    2015-01-01

    In this Letter we investigate the role of recombination energy during a common envelope event. We confirm that taking this energy into account helps to avoid the formation of the circumbinary envelope commonly found in previous studies. For the first time, we can model a complete common envelope event, with a clean compact double white dwarf binary system formed at the end. The resulting binary orbit is almost perfectly circular. In addition to considering recombination energy, we also show that between 1/4 and 1/2 of the released orbital energy is taken away by the ejected material. We apply this new method to the case of the double-white dwarf system WD 1101+364, and we find that the progenitor system at the start of the common envelope event consisted of a $\\sim1.5M_\\odot$ red giant star in a $\\sim 30$ day orbit with a white dwarf companion.

  5. Simulation of Double-Pulse Laser Ablation

    SciTech Connect (OSTI)

    Povarnitsyn, Mikhail E.; Khishchenko, Konstantin V.; Levashov, Pavel R. [Joint Institute for High Temperatures of RAS, Izhorskaya 13 Bldg 2, Moscow, 125412 (Russian Federation); Itina, Tatian E. [Laboratoire Hubert Curien, UMR CNRS 5516, 18 rue Benoit Lauras, Bat. F, 42000, St-Etienne (France)

    2010-10-08

    We investigate the physical reasons of a strange decrease in the ablation depth observed in femtosecond double-pulse experiments with increasing delay between the pulses. Two ultrashort pulses of the same energy produce the crater which is less than that created by a single pulse. Hydrodynamic simulation shows that the ablation mechanism is suppressed when the delay between the pulses exceeds the electron-ion relaxation time. In this case, the interaction of the second laser pulse with the expanding target material leads to the formation of the second shock wave suppressing the rarefaction wave created by the first pulse. The modeling of the double-pulse ablation for different delays between pulses confirms this explanation.

  6. Chromosome specific repetitive DNA sequences

    DOE Patents [OSTI]

    Moyzis, Robert K. (Los Alamos, NM); Meyne, Julianne (Los Alamos, NM)

    1991-01-01

    A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

  7. The Future of Forensic DNA

    E-Print Network [OSTI]

    History and Mission · National Institute of Standards and Technology (NIST) was created in 1901The Future of Forensic DNA John M. Butler, PhD National Institute of Standards and Technology.S. Department of Commerce with a mission to develop and promote measurement, standards, and technology

  8. Origami DNA model Mountain fold

    E-Print Network [OSTI]

    Csürös, Miklós

    Origami DNA model Mountain fold Solid lines are "mountains" and are to be folded away from you with the peak pointing towards you. 1. Fold all solid lines going lengthwise down the page into "mountain folds fold 2. Fold all dashed lines going lengthwise down the page into "valley folds". Mountain folds along

  9. The Future of Forensic DNA

    E-Print Network [OSTI]

    ;Checks and Controls on DNA Results Community FBI Quality Assurance Standards (and interlaboratory studies Washington D.C. Dulles Airport Reagan National Airport BWI Airport NIST FBI Lab Baltimore, MD Richmond, VA Materials (SRMs) Helps meet FBI QAS and ISO 17025 requirements Traceable standards to ensure accurate

  10. DNA Mixture Interpretation & Statistical Analysis

    E-Print Network [OSTI]

    of Standards and Technology Gaithersburg, Maryland John M. Butler CIB Forensic Science Center Training Seminar Mixture Workshop This workshop is for analysts, technical reviewers and technical leaders performing) National recommendations of the technical UK DNA working group on mixture interpretation for the NDNAD

  11. DNA sequencing protocols BN Danforth

    E-Print Network [OSTI]

    Danforth, Bryan Nicholas

    in the degradation of DNA. (7) Spin the tubes down at the end to remove condensation from tops of tubes. B. Extraction and RNA digestion. NOTE: We now skip the Rnase step. You will need: Phenol and gently invert several times. This step removes the phenol from the previous extraction. Spin

  12. Double Talk: Asturias's America in Cuculcán

    E-Print Network [OSTI]

    Unruh, Vicky

    1992-09-01

    Vicky Unruh, University of Kansas Double Talk: Asturias's America in Cuculcan^ M iguel Angel Asturias's Cuculcan, a dra- matic collage of color, sound, motion, and words, is his most overtly ethnographic play, and, as a product of his... vanguardist years, it is also the most radically experimental. Cuculcan did not appear in print until 1948,2 but Asturias de- scribed the work in progress in a 1932 journalis- tic essay, "Las posibilidades de un teatro americano."3 Although both Cuculcan...

  13. Double-clad nuclear fuel safety rod

    DOE Patents [OSTI]

    McCarthy, William H. (Los Altos, CA); Atcheson, Donald B. (Cupertino, CA); Vaidyanathan, Swaminathan (San Jose, CA)

    1984-01-01

    A device for shutting down a nuclear reactor during an undercooling or overpower event, whether or not the reactor's scram system operates properly. This is accomplished by double-clad fuel safety rods positioned at various locations throughout the reactor core, wherein melting of a secondary internal cladding of the rod allows the fuel column therein to shift from the reactor core to place the reactor in a subcritical condition.

  14. Neutrinoless Double Beta Decay and its "Inverse"

    E-Print Network [OSTI]

    Clemens A. Heusch; Peter Minkowski

    1996-11-18

    Recent considerations by these authors pointed out the attractive features which a search for the exchange of heavy Majorana neutrinos could have for solving the mass and the lepton number puzzles for all neutrinos, in TeV-level electron-electron scattering. In the present note, we show that, contrary to subsequently published arguments, non-observation of neutrinoless double beta decay has, to date, no bearing on the promise of this important task for future linear electron colliders.

  15. Tetraquark Production in Double Parton Scattering

    E-Print Network [OSTI]

    F. Carvalho; E. R. Cazaroto; V. P. Gonçalves; F. S. Navarra

    2015-11-23

    We develop a model to study tetraquark production in hadronic collisions. We focus on double parton scattering and formulate a version of the color evaporation model for the production of the $X(3872)$ and of the $T_{4c}$ tetraquark, a state composed by the $c \\bar{c} c \\bar{c}$ quarks. We find that the production cross section grows rapidly with the collision energy $\\sqrt{s}$ and make predictions for the forthcoming higher energy data of the LHC.

  16. Neutrinoless Double Beta Decay in Particle Physics

    E-Print Network [OSTI]

    Werner Rodejohann

    2010-11-22

    Neutrinoless double beta decay is a process of fundamental importance for particle physics. It can be mediated by light massive Majorana neutrinos (standard interpretation) or by something else (non-standard interpretations). We review its dependence on the neutrino parameters, its complementarity to other observables sensitive to neutrino mass, and emphasize its ability to distinguish different neutrino mass models. Then we discuss mechanisms different from light Majorana neutrino exchange, and show what can be learned from those and how they could be tested.

  17. Biological Physics of DNA Typeset by FoilTEX 1

    E-Print Network [OSTI]

    Potsdam, Universität

    fragments to ssDNA Labelling: eg radioact probe fragm & Xray film http;Packaging of DNA in bacteria 11 #12;DNA melting 12 #12;Polymerase chain reaction Heating dsDNA sample 2

  18. Vibration of Generalized Double Well Oscillators

    E-Print Network [OSTI]

    Grzegorz Litak; Marek Borowiec; Arkadiusz Syta

    2006-10-20

    We have applied the Melnikov criterion to examine a global homoclinic bifurcation and transition to chaos in a case of a double well dynamical system with a nonlinear fractional damping term and external excitation. The usual double well Duffing potential having a negative square term and positive quartic term has been generalized to a double well potential with a negative square term and a positive one with an arbitrary real exponent $q > 2$. We have also used a fractional damping term with an arbitrary power $p$ applied to velocity which enables one to cover a wide range of realistic damping factors: from dry friction $p \\to 0$ to turbulent resistance phenomena $p=2$. Using perturbation methods we have found a critical forcing amplitude $\\mu_c$ above which the system may behave chaotically. Our results show that the vibrating system is less stable in transition to chaos for smaller $p$ satisfying an exponential scaling low. The critical amplitude $\\mu_c$ as an exponential function of $p$. The analytical results have been illustrated by numerical simulations using standard nonlinear tools such as Poincare maps and the maximal Lyapunov exponent. As usual for chosen system parameters we have identified a chaotic motion above the critical Melnikov amplitude $\\mu_c$.

  19. A background free double beta decay experiment

    E-Print Network [OSTI]

    Ioannis Giomataris

    2010-12-20

    We present a new detection scheme for rejecting backgrounds in neutrino less double beta decay experiments. It relies on the detection of Cherenkov light emitted by electrons in the MeV region. The momentum threshold is tuned to reach a good discrimination between background and good events. We consider many detector concepts and a range of target materials. The most promising is a high-pressure 136Xe emitter for which the required energy threshold is easily adjusted. Combination of this concept and a high pressure Time Projection Chamber could provide an optimal solution. A simple and low cost effective solution is to use the Spherical Proportional Counter that provides two delayed signals from ionization and Cherenkov light. In solid-state double beta decay emitters, because of their higher density, the considered process is out of energy range. An alternative solution could be the development of double decay emitters with lower density by using for instance the aerogel technique. It is surprising that a technology used for particle identification in high-energy physics becomes a powerful tool for rejecting backgrounds in such low-energy experiments.

  20. Double beta decays of {sup 106}Cd

    SciTech Connect (OSTI)

    Suhonen, Jouni [Department of Physics, P.O. Box 35 (YFL), FI-40014 University of Jyvaeskylae (Finland)

    2011-12-16

    The two-neutrino (2{nu}2{beta}) and neutrinoless (0{nu}2{beta}) double beta decays of {sup 106}Cd are studied for the transitions to the ground state 0{sub gs}{sup +} and 0{sup +} and 2{sup +} excited states in {sup 106}Pd by using realistic many-body wave functions calculated in the framework of the quasiparticle random-phase approximation. Effective, G-matrix-derived nuclear forces are used in realistic single-particle model spaces. All the possible channels, {beta}{sup +}{beta}{sup +}, {beta}{sup +}EC, and ECEC, are discussed for both the 2{nu}2{beta} and 0{nu}2{beta} decays. The associated half-lives are computed and particular attention is devoted to the study of the detectability of the resonant neutrinoless double electron capture (R0{nu}ECEC) process in {sup 106}Cd. The calculations of the present article constitute the thus far most complete and up-to-date investigation of the double-beta-decay properties of {sup 106}Cd.

  1. Double-Difference Tomography for Sequestration MVA

    SciTech Connect (OSTI)

    Westman, Erik

    2008-12-31

    Analysis of synthetic data was performed to determine the most cost-effective tomographic monitoring system for a geologic carbon sequestration injection site. Double-difference tomographic inversion was performed on 125 synthetic data sets: five stages of CO2 plume growth, five seismic event regions, and five geophone arrays. Each resulting velocity model was compared quantitatively to its respective synthetic velocity model to determine an accuracy value. The results were examined to determine a relationship between cost and accuracy in monitoring, verification, and accounting applications using double-difference tomography. The geophone arrays with widely-varying geophone locations, both laterally and vertically, performed best. Additionally, double difference seismic tomography was performed using travel time data from a carbon sequestration site at the Aneth oil field in southeast Utah as part of a Department of Energy initiative on monitoring, verification, and accounting (MVA) of sequestered CO2. A total of 1,211 seismic events were recorded from a borehole array consisting of 22 geophones. Artificial velocity models were created to determine the ease with which different CO2 plume locations and sizes can be detected. Most likely because of the poor geophone arrangement, a low velocity zone in the Desert Creek reservoir can only be detected when regions of test site containing the highest ray path coverage are considered. MVA accuracy and precision may be improved through the use of a receiver array that provides more comprehensive ray path coverage.

  2. DNA extraction techniques for DNA barcoding of minute gall-inhabiting wasps

    E-Print Network [OSTI]

    extraction methods were compared to determine their efficacy in isolating DNA. Success of each methodDNA extraction techniques for DNA barcoding of minute gall-inhabiting wasps GUDRUN DITTRICH, South Africa Abstract DNA extraction from minute hymenopterans and their larvae is difficult

  3. DNA Word Design Strategy for Creating Sets of Non-interacting Oligonucleotides for DNA Microarrays

    E-Print Network [OSTI]

    DNA Word Design Strategy for Creating Sets of Non-interacting Oligonucleotides for DNA Microarrays mismatches with the complements of all the other members in the set. These "DNA word" sets are denoted as nbm. To achieve good discrimination between each DNA word in each set generated using the template-map strategy

  4. MATERIALS AND METHODS 1) DNA extraction

    E-Print Network [OSTI]

    Collins, Gary S.

    MATERIALS AND METHODS 1) DNA extraction · DNA was extracted from the ileo-cecal nodes of 475 Holstein cows from two herds using the Qiagen DNA extraction kit (Valencia, CA). 2) Map detection · Map was extracted from ileo-cecal nodes using Ambion's MagMAX Total Nucleic Acid Isolation kit (Austin, TX

  5. Exploring the Neutrinoless Double Beta Decay in the Inverted Neutrino Hierarchy with Bolometric Detectors

    E-Print Network [OSTI]

    Artusa, D. R.

    2014-01-01

    Exploring the Neutrinoless Double Beta Decay in the InvertedC. Giunti, Neutrinoless double-beta decay. A brief review,el- ements for neutrinoless double-beta decay and double-

  6. Mechanisms of radiation-induced gene responses

    SciTech Connect (OSTI)

    Woloschak, G.E.; Paunesku, T.

    1996-10-01

    In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts; however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.

  7. Electromagnetic Signals from Bacterial DNA

    E-Print Network [OSTI]

    A. Widom; J. Swain; Y. N. Srivastava; S. Sivasubramanian

    2012-02-09

    Chemical reactions can be induced at a distance due to the propagation of electromagnetic signals during intermediate chemical stages. Although is is well known at optical frequencies, e.g. photosynthetic reactions, electromagnetic signals hold true for muck lower frequencies. In E. coli bacteria such electromagnetic signals can be generated by electric transitions between energy levels describing electrons moving around DNA loops. The electromagnetic signals between different bacteria within a community is a "wireless" version of intercellular communication found in bacterial communities connected by "nanowires". The wireless broadcasts can in principle be of both the AM and FM variety due to the magnetic flux periodicity in electron energy spectra in bacterial DNA orbital motions.

  8. Fleet DNA Project (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2012-10-01

    The Fleet DNA Project - designed by the U.S. Department of Energy's National Renewable Energy Laboratory (NREL) in partnership with Oak Ridge National Laboratory - aims to accelerate the evolution of advanced vehicle development and support the strategic deployment of market-ready technologies that reduce costs, fuel consumption, and emissions. At the heart of the Fleet DNA Project is a clearinghouse of medium- and heavy-duty commercial fleet transportation data for optimizing the design of advanced vehicle technologies or for selecting a given technology to invest in. An easy-to-access online database will help vehicle manufacturers and fleets understand the broad operational range for many of today's commercial vehicle vocations.

  9. Channel plate for DNA sequencing

    DOE Patents [OSTI]

    Douthart, R.J.; Crowell, S.L.

    1998-01-13

    This invention is a channel plate that facilitates data compaction in DNA sequencing. The channel plate has a length, a width and a thickness, and further has a plurality of channels that are parallel. Each channel has a depth partially through the thickness of the channel plate. Additionally an interface edge permits electrical communication across an interface through a buffer to a deposition membrane surface. 15 figs.

  10. Optical double-slit particle measuring system

    DOE Patents [OSTI]

    Tichenor, D.A.; Wang, J.C.F.; Hencken, K.R.

    1982-03-25

    A method for in situ measurement of particle size is described. The size information is obtained by scanning an image of the particle across a double-slit mask and observing the transmitted light. This method is useful when the particle size of primary interest is 3..mu..m and larger. The technique is well suited to applications in which the particles are non-spherical and have unknown refractive index. It is particularly well suited to high temperature environments in which the particle incandescence provides the light source.

  11. Optical double-slit particle measuring system

    DOE Patents [OSTI]

    Hencken, Kenneth R. (Pleasanton, CA); Tichenor, Daniel A. (Freemont, CA); Wang, James C. F. (Livermore, CA)

    1984-01-01

    A method for in situ measurement of particle size is described. The size information is obtained by scanning an image of the particle across a double-slit mask and observing the transmitted light. This method is useful when the particle size of primary interest is 3 .mu.m and larger. The technique is well suited to applications in which the particles are non-spherical and have unknown refractive index. It is particularly well suited to high temperature environments in which the particle incandescence provides the light source.

  12. Neutrinoless double beta decay and QCD corrections

    E-Print Network [OSTI]

    Namit Mahajan

    2014-01-30

    We consider one loop QCD corrections and renormalization group running of the neutrinoless double beta decay amplitude focusing on the short-range part of the amplitude (without the light neutrino exchange) and find that these corrections can be sizeable. Depending on the operator under consideration, there can be moderate to large cancellations or significant enhancements. We discuss several specific examples in this context. Such large corrections will lead to significant shifts in the half-life estimates which currently are known to be plagued with the uncertainties due to nuclear physics inputs to the physical matrix elements.

  13. Neutrinoless double beta decay and neutrino masses

    SciTech Connect (OSTI)

    Duerr, Michael [Max-Planck-Institut fuer Kernphysik, Saupfercheckweg 1, 69117 Heidelberg (Germany)

    2012-07-27

    Neutrinoless double beta decay (0{nu}{beta}{beta}) is a promising test for lepton number violating physics beyond the standard model (SM) of particle physics. There is a deep connection between this decay and the phenomenon of neutrino masses. In particular, we will discuss the relation between 0{nu}{beta}{beta} and Majorana neutrino masses provided by the so-called Schechter-Valle theorem in a quantitative way. Furthermore, we will present an experimental cross check to discriminate 0{nu}{beta}{beta} from unknown nuclear background using only one isotope, i.e., within one experiment.

  14. NGC 4340: Double Bar + Fossil Nuclear Ring

    E-Print Network [OSTI]

    P. Erwin; J. C. Vega Beltran; J. E. Beckman

    2000-10-03

    NGC 4340 is a double-barred SB0 galaxy in the Virgo cluster (Wozniak et al. 1995). Here, we present evidence that this galaxy also posseses a luminous stellar nuclear ring of relatively old stars with little or no gas. The ring lies just outside the inner bar, at the probable inner inner Lindblad resonance (IILR) of the outer bar. Careful inspection of the isophotes and unsharp masks shows that the two bars are slightly misaligned, which suggests they may be independently rotating.

  15. Double acting stirling engine phase control

    SciTech Connect (OSTI)

    Berchowitz, David M.

    1983-01-01

    A mechanical device for effecting a phase change between the expansion and compression volumes of a double-acting Stirling engine uses helical elements which produce opposite rotation of a pair of crankpins when a control rod is moved, so the phase between two pairs of pistons is changed by +.psi. and the phase between the other two pairs of pistons is changed by -.psi.. The phase can change beyond .psi.=90.degree. at which regenerative braking and then reversal of engine rotation occurs.

  16. The double contact nature of TT Herculis

    SciTech Connect (OSTI)

    Terrell, Dirk; Nelson, Robert H. E-mail: bob.nelson@shaw.ca

    2014-03-01

    We present new radial velocities and photometry of the short-period Algol TT Herculis. Previous attempts to model the light curves of the system have met with limited success, primarily because of the lack of a reliable mass ratio. Our spectroscopic observations are the first to result in radial velocities for the secondary star, and thus provide a spectroscopic mass ratio. Simultaneous analysis of the radial velocities and new photometry shows that the system is a double contact binary, with a rapidly rotating primary that fills its limiting lobe.

  17. A Microscopic Double-Slit Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries Print Lithium-ionAA Microscopic Double-Slit

  18. A Microscopic Double-Slit Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries Print Lithium-ionAA Microscopic Double-SlitA

  19. A Microscopic Double-Slit Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries Print Lithium-ionAA Microscopic Double-SlitAA

  20. A Microscopic Double-Slit Experiment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries Print Lithium-ionAA Microscopic Double-SlitAAA

  1. Double Coil Condenser Apparatus - Energy Innovation Portal

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit theCovalentLaboratory |Sector Full reportTown2008DonaldEnergyDouble

  2. Double Field Theory on Group Manifolds (Thesis)

    E-Print Network [OSTI]

    Hassler, Falk

    2015-01-01

    This thesis deals with Double Field Theory (DFT), an effective field theory capturing the low energy dynamics of closed strings on a torus. It renders T-duality on a torus manifest by adding $D$ winding coordinates in addition to the $D$ space time coordinates. An essential consistency constraint of the theory, the strong constraint, only allows for field configurations which depend on half of the coordinates of the arising doubled space. I derive DFT${}_\\mathrm{WZW}$, a generalization of the current formalism. It captures the low energy dynamics of a closed bosonic string propagating on a compact group manifold. Its classical action and the corresponding gauge transformations arise from Closed String Field Theory up to cubic order in the massless fields. These results are rewritten in terms of a generalized metric and extended to all orders in the fields. There is an explicit distinction between background and fluctuations. For the gauge algebra to close, the latter have to fulfill a modified strong constrai...

  3. Double parton scattering at high energies

    E-Print Network [OSTI]

    Antoni Szczurek

    2015-04-24

    We discuss a few examples of rich newly developing field of double parton scattering. We start our presentation from production of two pairs of charm quark-antiquark and argue that it is the golden reaction to study the double parton scattering effects. In addition to the DPS we consider briefly also mechanism of single parton scattering and show that it gives much smaller contribution to the $c \\bar c c \\bar c$ final state. Next we discuss a perturbative parton-splitting mechanism which should be included in addition to the conventional DPS mechanism. We show that the presence of this mechanism unavoidably leads to collision energy and other kinematical variables dependence of so-called $\\sigma_{eff}$ parameter being extracted from different experiments. Next we briefly discuss production of four jets. We concentrate on estimation of the contribution of DPS for jets remote in rapidity. Understanding of this contribution is very important in the context of searches for BFKL effects known under the the name Mueller-Navelet jets. We discuss the situation in a more general context. Finally we briefly mention about DPS effects in production of $W^+ W^-$. Outlook closes the presentation.

  4. Renormalization of a Lorentz invariant doubled worldsheet theory

    E-Print Network [OSTI]

    Nibbelink, Stefan Groot; Patalong, Peter

    2013-01-01

    Manifestly T-duality covariant worldsheet string models can be constructed by doubling the coordinate fields. We describe the underlying gauge symmetry of a recently proposed Lorentz invariant doubled worldsheet theory that makes half of the worldsheet degrees of freedom redundant. By shifting the Lagrange multiplier, that enforces the gauge fixing condition, the worldsheet action can be cast into various guises. We investigate the renormalization of this theory using a non-linear background/quantum split by employing a normal coordinate expansion adapted to the gauge-fixed theory. The propagator of the doubled coordinates contains a projection operator encoding that half of them do not propagate. We determine the doubled target space equations of motion by requiring one-loop Weyl invariance. Some of them are generalizations of the conventional sigma model beta-functions, while others seem to be novel to the doubled theory: In particular, a dilaton equation seems related to the strong constraint of double fie...

  5. COMM-OPINION-ORDER, 76 FERC 61,347, Promoting Wholesale Competition Through Open-Access Non-discriminatory Transmission Services by Public Utilities, Docket No. RM95-8-000, Recovery of Stranded Costs by

    E-Print Network [OSTI]

    Laughlin, Robert B.

    -discriminatory Transmission Services by Public Utilities, Docket No. RM95-8-000, Recovery of Stranded Costs by Public Utilities and Transmitting Utilities, Docket No. RM94-7-001, (Sep. 27, 1996) COPYRIGHT 1999, CCH by Public Utilities, Docket No. RM95-8-000, Recovery of Stranded Costs by Public Utilities and Transmitting

  6. The dynamic interplay between DNA damage and metabolism : the metabolic fate and transport of DNA lesions and novel DNA damage derived from intermediary metabolism

    E-Print Network [OSTI]

    Jumpathong, Watthanachai

    2014-01-01

    The work presented in this thesis explores two novel and complementary facets of endogenous DNA damage: the development of biomarkers of inflammation based on metabolites of DNA damage products and the formation of DNA ...

  7. Neutrinoless double beta decay search with the NEMO 3 experiment

    E-Print Network [OSTI]

    Irina Nasteva; for the NEMO 3 Collaboration

    2008-10-03

    The NEMO 3 experiment searches for neutrinoless double beta decay and makes precision measurements of two-neutrino double beta decay in seven isotopes. The latest two-neutrino half-life results are presented, together with the limits on neutrinoless half-lives and the corresponding effective Majorana neutrino masses. Also given are the limits obtained on neutrinoless double beta decay mediated by Rp-violating SUSY, right-hand currents and different Majoron emission modes.

  8. Neutrinoless double beta decay search with the NEMO 3 experiment

    SciTech Connect (OSTI)

    Nasteva, Irina [Particle Physics Group, School of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom)

    2008-11-23

    The NEMO 3 experiment searches for neutrinoless double beta decay and makes precision measurements of two-neutrino double beta decay in seven isotopes. The latest two-neutrino half-life results are presented, together with the limits on neutrinoless half-lives and the corresponding effective Majorana neutrino masses. Also given are the limits obtained on neutrinoless double beta decay mediated by R{sub p}-violating SUSY, right-hand currents and different Majoron emission modes.

  9. Search for neutrinoless double beta decay with NEMO 3 experiment

    E-Print Network [OSTI]

    Zornitza Daraktchieva

    2009-01-18

    NEMO 3 experiment is designed to search for neutrinoless double beta decay. It is located in the Modane Underground Laboratory (LSM) and has been taking data since February 2003. The half- lives of two neutrino beta decay have been measured for seven isotopes. No evidence of neutrinoless double beta decay has been found. The limits on both the half-lives of the neutrinoless double beta decay and the corresponding Majorana effective masses are derived

  10. Neutrinoless Double Beta Decay in Supersymmetric Seesaw model

    E-Print Network [OSTI]

    Tai-Fu Feng; Xue-Qian Li; Yan-An Luo

    2002-09-26

    Inspired by the recent HEIDELBERG-MOSCOW double beta decay experiment, we discuss the neutrinoless double beta decay in the supersymmetric seesaw model. Our numerical analysis indicates that we can naturally explain the data of the observed neutrinoless double beta decay, as well as that of the solar and atmospheric neutrino experiments with at least one Majorana-like sneutrino of middle energy scale in the model.

  11. Radiochemical tracers as a mix diagnostic for the ignition double...

    Office of Scientific and Technical Information (OSTI)

    for the ignition double-shell capsule One of the most important challenges confronting laser-driven capsule implosion experiments will be a quantitative evaluation of the...

  12. Majorana Neutrino Masses from Neutrinoless Double Beta Decay and Cosmology

    E-Print Network [OSTI]

    V. Barger; K. Whisnant

    1999-04-08

    When three Majorana neutrinos describe the solar and atmospheric neutrino data via oscillations, a nonzero measurement of neutrinoless double beta ($0\

  13. Neutrinoless double beta decay can constrain neutrino dark matter

    E-Print Network [OSTI]

    V. Barger; S. L. Glashow; D. Marfatia; K. Whisnant

    2002-02-26

    We examine how constraints can be placed on the neutrino component of dark matter by an accurate measurement of neutrinoless double beta ($0\

  14. T-686: IBM Tivoli Integrated Portal Java Double Literal Denial...

    Broader source: Energy.gov (indexed) [DOE]

    password) PLATFORM: Tivoli versions prior to 1.1.1.15. ABSTRACT: IBM Tivoli Integrated Portal Java Double Literal Denial of Service Vulnerability. reference LINKS: IBM ID: 1508061...

  15. 75 years of double beta decay: yesterday, today and tomorrow

    E-Print Network [OSTI]

    A. S. Barabash

    2011-01-24

    In this report I will briefly review the motivation and history of double beta decay search since the first consideration of two neutrino process (2$\\beta(2\

  16. DUF6 Project Doubles Production in 2013 | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    year 2013 goal by converting 13,679 metric tons of depleted uranium hexafluoride (DUF6), more than doubling production a year earlier. EM's Portsmouth Paducah Project Office...

  17. Neutron Interactions in the CUORE Neutrinoless Double Beta Decay...

    Office of Scientific and Technical Information (OSTI)

    Interactions in the CUORE Neutrinoless Double Beta Decay Experiment Dolinski, M J 72 PHYSICS OF ELEMENTARY PARTICLES AND FIELDS; 73 NUCLEAR PHYSICS AND RADIATION PHYSICS;...

  18. The MAJORANA DEMONSTRATOR: A Search for Neutrinoless Double-beta...

    Office of Scientific and Technical Information (OSTI)

    Conference: The MAJORANA DEMONSTRATOR: A Search for Neutrinoless Double-beta Decay of Germanium-76 Citation Details In-Document Search Title: The MAJORANA DEMONSTRATOR: A Search...

  19. Full Quantum Theory of ${C_{60}}$ Double-slit Diffraction

    E-Print Network [OSTI]

    Xiang-Yao Wu; Ji Ma; Bo-Jun Zhang; Hong Li; Xiao-Jing Liu; Nuo Ba; Si-Qi Zhang; Jing Wang; He Dong; Xin-Guo Yin

    2013-05-10

    In this paper, we apply the full new method of quantum theory to study the double-slit diffraction of ${C_{60}}$ molecules. We calculate the double-slit wave functions of ${C_{60}}$ molecules by Schr\\"{o}dinger equation, and calculate the diffraction wave function behind the slits with the Feynman path integral quantum theory, and then give the relation between the diffraction intensity of double-slit and diffraction pattern position. We compare the calculation results with two different double-slit diffraction experiments. When the decoherence effects are considered, the calculation results are in good agreement with the two experimental data.

  20. Systematics of quarkonium production at the LHC and double parton...

    Office of Scientific and Technical Information (OSTI)

    Systematics of quarkonium production at the LHC and double parton fragmentation Citation Details In-Document Search Title: Systematics of quarkonium production at the LHC and...

  1. Half-lives of Double $?^+$-decay with Two Neutrinos

    E-Print Network [OSTI]

    Yuejiao Ren; Zhongzhou Ren

    2015-01-07

    Nuclear double $\\beta ^-$-decays with two neutrinos were observed for many years and a systematic law describing the relation between their half-lives and decay energies was also proposed recently [Phys. Rev. C89, 064603 (2014)]. However, double $\\beta ^+$-decay ($\\beta ^+\\beta^+)$ with emission of both two positrons and two neutrinos has not been observed up to date. In this article, we perform a systematic analysis on the candidates of double $\\beta ^+$-decay, based on the 2012 nuclear mass table. Eight nuclei are found to be the good candidates for double $\\beta ^+$-decay and their half-lives are predicted according to the generalization of the systematic law to double $\\beta ^+$-decay. As far as we know, there is no theoretical result on double $\\beta ^+$-decay of nucleus $^{154}Dy$ and our result is the first prediction on this nucleus. This is also the first complete research on eight double $\\beta ^+$-decay candidates based on the available data of nuclear masses. It is expected that the calculated half-lives of double $\\beta ^+$-decay in this article will be useful for future experimental search of double $\\beta ^+$-decay.

  2. Enhancing the DNA Patent Database

    SciTech Connect (OSTI)

    Walters, LeRoy B.

    2008-02-18

    Final Report on Award No. DE-FG0201ER63171 Principal Investigator: LeRoy B. Walters February 18, 2008 This project successfully completed its goal of surveying and reporting on the DNA patenting and licensing policies at 30 major U.S. academic institutions. The report of survey results was published in the January 2006 issue of Nature Biotechnology under the title “The Licensing of DNA Patents by US Academic Institutions: An Empirical Survey.” Lori Pressman was the lead author on this feature article. A PDF reprint of the article will be submitted to our Program Officer under separate cover. The project team has continued to update the DNA Patent Database on a weekly basis since the conclusion of the project. The database can be accessed at dnapatents.georgetown.edu. This database provides a valuable research tool for academic researchers, policymakers, and citizens. A report entitled Reaping the Benefits of Genomic and Proteomic Research: Intellectual Property Rights, Innovation, and Public Health was published in 2006 by the Committee on Intellectual Property Rights in Genomic and Protein Research and Innovation, Board on Science, Technology, and Economic Policy at the National Academies. The report was edited by Stephen A. Merrill and Anne-Marie Mazza. This report employed and then adapted the methodology developed by our research project and quoted our findings at several points. (The full report can be viewed online at the following URL: http://www.nap.edu/openbook.php?record_id=11487&page=R1). My colleagues and I are grateful for the research support of the ELSI program at the U.S. Department of Energy.

  3. DNA

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit theCovalent Bonding Low-Cost Ground8 GasDEVELOPMENTS E P I IT h it cdrives

  4. DNA

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    blueprint of a bacterium's "molecular machinery," showing how bacterial immune systems fight off the viruses that infect them. By tracking down how bacterial defense systems work,...

  5. Base Excision by Thymine DNA Glycosylase Mediates DNA-Directed Cytotoxicity of 5-Fluorouracil 

    E-Print Network [OSTI]

    Selfridge J.; Schar P.; Lettieri T.; Schuermann D.; Saito Y.; Focke F.; Kunz C.

    2009-04-01

    5-Fluorouracil (5-FU), a chemotherapeutic drug commonly used in cancer treatment, imbalances nucleotide pools, thereby favoring misincorporation of uracil and 5-FU into genomic DNA. The processing of these bases by DNA repair activities was proposed...

  6. Protein-DNA Interactions Determine the Shapes of DNA Toroids Condensed in Virus Capsids

    E-Print Network [OSTI]

    Podgornik, Rudolf

    Protein-DNA Interactions Determine the Shapes of DNA Toroids Condensed in Virus Capsids Ame (13), or the virus capsid itself (14­16), either upon addition of spermine (Spm4þ ) or in a monovalent

  7. DNA binding specificity of the p73 DNA-binding domain

    E-Print Network [OSTI]

    Tse, Pui Wah

    2011-01-01

    of DNA recognition by p53 tetramers. Mol Cell 22, 741-753.site as a self-assembled tetramer. Structure 18, 246- Chene,structure of a p53 core tetramer bound to DNA. Oncogene 28,

  8. DNA-guided nanoparticle assemblies

    DOE Patents [OSTI]

    Gang, Oleg; Nykypanchuk, Dmytro; Maye, Mathew; van der Lelie, Daniel

    2013-07-16

    In some embodiments, DNA-capped nanoparticles are used to define a degree of crystalline order in assemblies thereof. In some embodiments, thermodynamically reversible and stable body-centered cubic (bcc) structures, with particles occupying <.about.10% of the unit cell, are formed. Designs and pathways amenable to the crystallization of particle assemblies are identified. In some embodiments, a plasmonic crystal is provided. In some aspects, a method for controlling the properties of particle assemblages is provided. In some embodiments a catalyst is formed from nanoparticles linked by nucleic acid sequences and forming an open crystal structure with catalytically active agents attached to the crystal on its surface or in interstices.

  9. DNA sequencing using fluorescence background electroblotting membrane

    DOE Patents [OSTI]

    Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

    1992-05-12

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

  10. SnapShot: DNA Polymerases II Mammals

    E-Print Network [OSTI]

    Foti, James J.

    DNA polymerases ensure the faithful duplication of genetic information inside the nuclease and mitochondria of eukaryotic cells and the nucleoid of prokaryotic cells. These remarkable enzymes synthesize polynucleotide ...

  11. Double-Slit Experiments with Microwave Billiards

    E-Print Network [OSTI]

    S. Bittner; B. Dietz; M. Miski-Oglu; P. Oria Iriarte; A. Richter; F. Schäfer

    2011-07-27

    Single and double-slit experiments are performed with two microwave billiards with the shapes of a rectangle, respectively, a quarter stadium. The classical dynamics of the former is regular, that of the latter is chaotic. Microwaves can leave the billiards via slits in the boundary, forming interference patterns on a screen. The aim is to determine the effect of the billiard dynamics on their structure. For this the development of a method for the construction of a directed wave packet by means of an array of multiple antennas was crucial. The interference patterns show a sensitive dependence not only on the billiard dynamics but also on the initial position and direction of the wave packet.

  12. Correlations and the neutrinoless double beta decay

    SciTech Connect (OSTI)

    Menendez, J.; Poves, A. [Departamento de Fisica Teorica, and IFT, UAM-CSIC, Universidad Autonoma de Madrid, 28049-Madrid (Spain); Caurier, E.; Nowacki, F. [IPHC, IN2P3-CNRS/Universite Louis Pasteur, 67037-Strasbourg (France)

    2009-11-09

    We explore the influence of the deformation on the nuclear matrix elements of the neutrinoless double beta decay (NME), concluding that the difference in deformation -or more generally on the amount of quadrupole correlations- between parent and grand daughter nuclei quenchs strongly the decay. We discuss how varies the nuclear matrix element of {sup 76}Ge decay when the wave functions of the two nuclei involved in the transition are constrained to reproduce the experimental occupancies. In the Interacting Shell Model description the value of the NME is enhanced about 15% compared to previous calculations, whereas in the QRPA the NME's are reduced by 20%-30%, thus, the discrepancies between both approaches diminish.

  13. Neutrinoless Double Beta Decay with SNO+

    E-Print Network [OSTI]

    J. Hartnell; for the SNO+ collaboration

    2012-01-30

    SNO+ will search for neutrinoless double beta decay by loading 780 tonnes of linear alkylbenzene liquid scintillator with O(tonne) of neodymium. Using natural Nd at 0.1% loading will provide 43.7 kg of 150Nd given its 5.6% abundance and allow the experiment to reach a sensitivity to the effective neutrino mass of 100-200 meV at 90% C.L in a 3 year run. The SNO+ detector has ultra low backgrounds with 7000 tonnes of water shielding and self-shielding of the scintillator. Distillation and several other purification techniques will be used with the aim of achieving Borexino levels of backgrounds. The experiment is fully funded and data taking with light-water will commence in 2012 with scintillator data following in 2013.

  14. Double beta decay and neutrino mass models

    E-Print Network [OSTI]

    Helo, J C; Ota, T; Santos, F A Pereira dos

    2015-01-01

    Neutrinoless double beta decay allows to constrain lepton number violating extensions of the standard model. If neutrinos are Majorana particles, the mass mechanism will always contribute to the decay rate, however, it is not a priori guaranteed to be the dominant contribution in all models. Here, we discuss whether the mass mechanism dominates or not from the theory point of view. We classify all possible (scalar-mediated) short-range contributions to the decay rate according to the loop level, at which the corresponding models will generate Majorana neutrino masses, and discuss the expected relative size of the different contributions to the decay rate in each class. We also work out the phenomenology of one concrete 2-loop model in which both, mass mechanism and short-range diagram, might lead to competitive contributions, in some detail.

  15. Double Shell Tank (DST) Utilities Specification

    SciTech Connect (OSTI)

    SUSIENE, W.T.

    2000-04-27

    This specification establishes the performance requirements and provides the references to the requisite codes and standards to he applied during the design of the Double-Shell Tank (DST) Utilities Subsystems that support the first phase of waste feed delivery (WFD). The DST Utilities Subsystems provide electrical power, raw/potable water, and service/instrument air to the equipment and structures used to transfer low-activity waste (LAW) and high-level waste (HLW) to designated DST staging tanks. The DST Utilities Subsystems also support the equipment and structures used to deliver blended LAW and HLW feed from these staging tanks to the River Protection Project (RPP) Privatization Contractor facility where the waste will be immobilized. This specification is intended to be the basis for new projects/installations. This specification is not intended to retroactively affect previously established project design criteria without specific direction by the program.

  16. Double-rotor rotary engine and turbine

    SciTech Connect (OSTI)

    Lin, A.S.

    1990-04-03

    This patent describes a double-rotor engine. It comprises: a base; a housing rotatably mounted to the base and forming a radial cylinder; an output shaft rotatably mounted concentric with the housing and having an arm rigidly extending therefrom within the housing; a piston slidingly engaging the cylinder and forming a combustion chamber with the cylinder; means for admitting a fuel-air mixture into the cylinder; means for releasing combustion products from the cylinder following operation of the expanding means; turbine means operatively connected between the base and the housing, the turbine means providing a torque reaction against the housing in response to flow of the combustion products from the releasing means; and stop means on the shaft for limiting the relative movement between the shaft and the housing.

  17. Heterotic $?$'-corrections in Double Field Theory

    E-Print Network [OSTI]

    Oscar A. Bedoya; Diego Marques; Carmen Nunez

    2014-12-15

    We extend the generalized flux formulation of Double Field Theory to include all the first order bosonic contributions to the $\\alpha '$ expansion of the heterotic string low energy effective theory. The generalized tangent space and duality group are enhanced by $\\alpha'$ corrections, and the gauge symmetries are generated by the usual (gauged) generalized Lie derivative in the extended space. The generalized frame receives derivative corrections through the spin connection with torsion, which is incorporated as a new degree of freedom in the extended bein. We compute the generalized fluxes and find the Riemann curvature tensor with torsion as one of their components. All the four-derivative terms of the action, Bianchi identities and equations of motion are reproduced. Using this formalism, we obtain the first order $\\alpha'$ corrections to the heterotic Buscher rules. The relation of our results to alternative formulations in the literature is discussed and future research directions are outlined.

  18. Neutrinoless Double Beta Decay in Gauge Theories

    E-Print Network [OSTI]

    J. D. Vergados

    1999-07-12

    Neutrinoless double beta decay is a very important process both from the particle and nuclear physics point of view. Its observation will severely constrain the existing models and signal that the neutrinos are massive Majorana particles. From the elementary particle point of view it pops up in almost every model. In addition to the traditional mechanisms, like the neutrino mass, the admixture of right handed currents etc, it may occur due to the R-parity violating supersymmetric (SUSY) interactions. From the nuclear physics point of view it is challenging, because: 1) The relevant nuclei have complicated nuclear structure. 2) The energetically allowed transitions are exhaust a small part of all the strength. 3) One must cope with the short distance behavior of the transition operators, especially when the intermediate particles are heavy (eg in SUSY models). Thus novel effects, like the double beta decay of pions in flight between nucleons, have to be considered. 4) The intermediate momenta involved are about 100 MeV. Thus one has to take into account possible momentum dependent terms in the nucleon current. We find that, for the mass mechanism, such modifications of the nucleon current for light neutrinos reduce the nuclear matrix elements by about 25 per cent, almost regardless of the nuclear model. In the case of heavy neutrinos the effect is much larger and model dependent. Taking the above effects into account, the available nuclear matrix elements for the experimentally interesting nuclei A = 76, 82, 96, 100, 116, 128, 130, 136 and 150 and the experimental limits on the life times we have extracted new stringent limits on the average neutrino mass and on the R-parity violating coupling for various SUSY models.

  19. DNA Profiling Using Solid-State Nanopores: Detection of DNA-Binding

    E-Print Network [OSTI]

    Meller, Amit

    a 3.5 nm pore results from threading of a dye-intercalated DNA molecule, as compared to the typical for drug development, necessitating new in vitro methods for rapid and low-cost assessment of the binding molecules, which give the DNA/intercalator complex a bulkier structure than that of native DNA. Furthermore

  20. Ancient DNA Chronology within Sediment Deposits: Are Paleobiological Reconstructions Possible and Is DNA Leaching a Factor?

    E-Print Network [OSTI]

    Nielsen, Rasmus

    Ancient DNA Chronology within Sediment Deposits: Are Paleobiological Reconstructions Possible reported the successful extraction of ancient DNA (aDNA) from both frozen and nonfrozen sediments (even sediments up to 3300 years old at 2 cave sites in the North Island of New Zealand. These sites are ideal

  1. Dellaporta DNA Extraction Citation: Stephen L. Dellaporta,Jonathan Wood , James B. Hicks. A plant DNA

    E-Print Network [OSTI]

    Wurtele, Eve Syrkin

    1 Dellaporta DNA Extraction Citation: Stephen L. Dellaporta,Jonathan Wood , James B. Hicks. A plant supernatant and lightly dry DNA pellets by inverting the tubes on paper towels for 10 min. #12;4 12. Redissolve each DNA pellet with 0.7 mL EB2. May need to let sit overnight at 4°C if having trouble dissolving

  2. Double-nonlinear metamaterials Rongcao Yang1,2,a

    E-Print Network [OSTI]

    Double-nonlinear metamaterials Rongcao Yang1,2,a and Ilya V. Shadrivov1 1 Nonlinear Physics Centre 10 December 2010 We study a double-nonlinear metamaterial composed of a mixture of both nonlinear electric and nonlinear magnetic resonators. We predict multistable behavior in such metamaterial

  3. Countering Trusting Trust through Diverse Double-Compiling

    E-Print Network [OSTI]

    Sandhu, Ravi

    1 Countering Trusting Trust through Diverse Double-Compiling David A. Wheeler February 28, 2006 · Inadequate solutions & related work · Solution: Diverse double-compiling (DDC) ­ What it is ­ Why it works & broader implications 3 Trusting trust attack Compiler executable (malicious) Critical program (malicious

  4. Significant neutrinoless double beta decay with quasi-Dirac neutrinos

    E-Print Network [OSTI]

    Pei-Hong Gu

    2012-09-13

    A significant signal of neutrinoless double beta decay can be consistent with the existence of light quasi-Dirac neutrinos. To demonstrate this possibility, we consider a realistic model where the neutrino masses and the neutrinoless double beta decay can be simultaneously generated after a Peccei-Quinn symmetry breaking.

  5. Designing Truthful Spectrum Double Auctions with Local Markets

    E-Print Network [OSTI]

    Li, Baochun

    Designing Truthful Spectrum Double Auctions with Local Markets Wei Wang, Student Member, IEEE, Ben pieces in the market. We design a spectrum double auction that incorporates such locality in spectrum markets, while keeping the auction economically robust and computationally efficient. Our designs

  6. Maximal Matching for Double Auction Dengji Zhao1,2

    E-Print Network [OSTI]

    Zhang, Dongmo

    the problem of mechanism design for a double auc- tion market where multiple buyers and sellers buy and sell Design) platform, we show with experiments that the new matching method not only increases market price). Similar to the design of other market mechanisms, the main concerns of double auction design

  7. DoubleSpeed Safe Prime Generation David Naccache

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    prime generation is thus divided by two at the cost of generating primes of size k or k + 1 with equalDouble­Speed Safe Prime Generation David Naccache Gemplus Card International Applied Research method for doubling the speed of safe prime generation. The method is particularly suited to settings

  8. Double-Speed Safe Prime Generation David Naccache

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    at the cost of generating primes of size k or k + 1 with equal probability. The generation of RSA moduliDouble-Speed Safe Prime Generation David Naccache Gemplus Card International Applied Research method for doubling the speed of safe prime generation. The method is particularly suited to settings

  9. technology offer HPC/UHPC double wall elements

    E-Print Network [OSTI]

    Arnold, Anton

    buildings and towers like wind turbines, power plants or cooling towers. Fig. 1: UHPC double wall element to 20-45 mm in an easy and cost efficient way. Background Double wall elements are precast reinforced · Savings in material and weight · Savings in transport and crane costs · Dense structure of the precast

  10. Matched slow pulses using double electromagnetically induced transparency

    E-Print Network [OSTI]

    Lvovsky, Alexander

    Matched slow pulses using double electromagnetically induced transparency Andrew MacRae,* Geoff, 2008 We implement double electromagnetically induced transparency (DEIT) in rubidium vapor using Optical Society of America OCIS codes: 270.1670, 270.5585, 190.5530. Electromagnetically induced

  11. DNA Nanomechanical Switches under Folding Kinetics Control

    E-Print Network [OSTI]

    Meller, Amit

    DNA Nanomechanical Switches under Folding Kinetics Control Virgile Viasnoff,, Amit Meller operate at equilibrium under changes in solution composition. We propose an alternative DNA switch design after heat denaturation drives the switch to its lowest energy conformation, while rapid cooling (>100

  12. Dynamics and control of DNA sequence amplification

    SciTech Connect (OSTI)

    Marimuthu, Karthikeyan [Department of Chemical Engineering and Center for Advanced Process Decision-Making, Carnegie Mellon University, Pittsburgh, Pennsylvania 15213 (United States); Chakrabarti, Raj, E-mail: raj@pmc-group.com, E-mail: rajc@andrew.cmu.edu [Department of Chemical Engineering and Center for Advanced Process Decision-Making, Carnegie Mellon University, Pittsburgh, Pennsylvania 15213 (United States); Division of Fundamental Research, PMC Advanced Technology, Mount Laurel, New Jersey 08054 (United States)

    2014-10-28

    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reaction are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.

  13. Recombinant DNA encoding a desulfurization biocatalyst

    DOE Patents [OSTI]

    Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.

    1994-10-18

    This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.

  14. Prospects & Overviews Integrating DNA barcode data and

    E-Print Network [OSTI]

    DeSalle, Rob

    , and description Paul Z. Goldstein and Rob DeSalleà DNA barcodes, like traditional sources of taxonomic information interpretation. The role of DNA barcoding in generating hypotheses of new taxa in need of formal taxonomic information but also for our comprehension of the magnitude of species diversity and its disappearance

  15. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis

    SciTech Connect (OSTI)

    Stella, Stefano; Cascio, Duilio; Johnson, Reid C.

    2010-06-21

    The bacterial nucleoid-associated protein Fis regulates diverse reactions by bending DNA and through DNA-dependent interactions with other control proteins and enzymes. In addition to dynamic nonspecific binding to DNA, Fis forms stable complexes with DNA segments that share little sequence conservation. Here we report the first crystal structures of Fis bound to high- and low-affinity 27-base-pair DNA sites. These 11 structures reveal that Fis selects targets primarily through indirect recognition mechanisms involving the shape of the minor groove and sequence-dependent induced fits over adjacent major groove interfaces. The DNA shows an overall curvature of {approx}65{sup o}, and the unprecedented close spacing between helix-turn-helix motifs present in the apodimer is accommodated by severe compression of the central minor groove. In silico DNA structure models show that only the roll, twist, and slide parameters are sufficient to reproduce the changes in minor groove widths and recreate the curved Fis-bound DNA structure. Models based on naked DNA structures suggest that Fis initially selects DNA targets with intrinsically narrow minor grooves using the separation between helix-turn-helix motifs in the Fis dimer as a ruler. Then Fis further compresses the minor groove and bends the DNA to generate the bound structure.

  16. Programmable DNA-mediated multitasking processor

    E-Print Network [OSTI]

    Shu, Jian-Jun; Yong, Kian-Yan; Shao, Fangwei; Lee, Kee Jin

    2015-01-01

    Because of DNA appealing features as perfect material, including minuscule size, defined structural repeat and rigidity, programmable DNA-mediated processing is a promising computing paradigm, which employs DNAs as information storing and processing substrates to tackle the computational problems. The massive parallelism of DNA hybridization exhibits transcendent potential to improve multitasking capabilities and yield a tremendous speed-up over the conventional electronic processors with stepwise signal cascade. As an example of multitasking capability, we present an in vitro programmable DNA-mediated optimal route planning processor as a functional unit embedded in contemporary navigation systems. The novel programmable DNA-mediated processor has several advantages over the existing silicon-mediated methods, such as conducting massive data storage and simultaneous processing via much fewer materials than conventional silicon devices.

  17. Method for sequencing DNA base pairs

    DOE Patents [OSTI]

    Sessler, A.M.; Dawson, J.

    1993-12-14

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

  18. Particulate Carrier Systems for Mucosal DNA Vaccine Delivery

    E-Print Network [OSTI]

    Borchard, Gerrit

    2006-10-26

    Streptomyces griseus Stop solution: 1M KOH In humans: degradation by lysozyme Incubation with chitosanase (1) GPEN 2006 Free DNA chitoplexes Incubation with chitosanase, 37?C Intact DNA ? Degraded chitosan Intact DNA ? Extraction with phenol: chloroform... Streptomyces griseus Stop solution: 1M KOH In humans: degradation by lysozyme Incubation with chitosanase (1) GPEN 2006 Free DNA chitoplexes Incubation with chitosanase, 37?C Intact DNA ? Degraded chitosan Intact DNA ? Extraction with phenol: chloroform...

  19. Microfluidics: Kinetics of Hybridized DNA With Fluid Flow Variations...

    Office of Scientific and Technical Information (OSTI)

    Conference: Microfluidics: Kinetics of Hybridized DNA With Fluid Flow Variations. Citation Details In-Document Search Title: Microfluidics: Kinetics of Hybridized DNA With Fluid...

  20. Protein Bridges DNA Base and Nucleotide Excision Repair Pathways

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Bridges DNA Base and Nucleotide Excision Repair Pathways Print Alkyltransferase proteins (AGT) protect cells from the biological effects of DNA damage caused by the addition...

  1. IN VITRO MUTAGENIC AND DNA AND CHROMOSOMAL DAMAGE ACTIVITY BY...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    IN VITRO MUTAGENIC AND DNA AND CHROMOSOMAL DAMAGE ACTIVITY BY SURFACTANT DISPERSION OR SOLVENT EXTRACT OF A REFERENCE DIESEL EXHAUST PARTICULATE MATERIAL IN VITRO MUTAGENIC AND DNA...

  2. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked...

  3. First results on neutrinoless double beta decay of Te-130 with the calorimetric cuoricino experiment

    E-Print Network [OSTI]

    2003-01-01

    Results on Neutrinoless Double Beta Decay of 130 Te with theEvidence for Neutrinoless Double Beta Decay” arXiv:hep-on “Evidence for neutrinoless double beta decay”- arXiv:hep-

  4. An Investigation and Characterization of Metal Foam Filled Double-Pipe Heat Exchangers

    E-Print Network [OSTI]

    Chen, Xi

    2014-01-01

    a metal foam filled double-pipe heat exchanger: a) Pressurein a metal foam filled double-pipe heat exchanger witha plain double-pipe heat exchanger: a) Total heat transfer

  5. Multivalent ion-mediated nucleic acid helix-helix interactions: RNA versus DNA

    E-Print Network [OSTI]

    Yuan-Yan Wu; Zhong-Liang Zhang; Jin-Si Zhang; Xiao-Long Zhu; Zhi-Jie Tan

    2015-07-10

    Ion-mediated interaction is critical to the structure and stability of nucleic acids. Recent experiments suggest that the multivalent ion-induced aggregation of double-stranded (ds) RNAs and DNAs may strongly depend on the topological nature of helices, while there is still lack of an understanding on the relevant ion-mediated interactions at atomistic level. In this work, we have directly calculated the potentials of mean force (PMF) between two dsRNAs and between two dsDNAs in Cobalt Hexammine ion (Co-Hex) solutions by the atomistic molecular dynamics simulations. Our calculations show that at low [Co-Hex], the PMFs between B-DNAs and between A-RNAs are both (strongly) repulsive.However, at high [Co-Hex], the PMF between B-DNAs is strongly attractive, while those between A-RNAs and between A-DNAs are still (weakly) repulsive. The microscopic analyses show that for A-form helices, Co-Hex would become internal binding into the deep major groove and consequently cannot form the evident ion-bridge between adjacent helices, while for B-form helices without deep grooves, Co-Hex would exhibit external binding to strongly bridge adjacent helices. In addition, our further calculations show that, the PMF between A-RNAs could become strongly attractive either at very high [Co-Hex] or when the bottom of deep major groove is fixed with a layer of water.

  6. Coronal electron confinement by double layers

    SciTech Connect (OSTI)

    Li, T. C.; Drake, J. F.; Swisdak, M.

    2013-12-01

    In observations of flare-heated electrons in the solar corona, a longstanding problem is the unexplained prolonged lifetime of the electrons compared to their transit time across the source. This suggests confinement. Recent particle-in-cell (PIC) simulations, which explored the transport of pre-accelerated hot electrons through ambient cold plasma, showed that the formation of a highly localized electrostatic potential drop, in the form of a double layer (DL), significantly inhibited the transport of hot electrons. The effectiveness of confinement by a DL is linked to the strength of the DL as defined by its potential drop. In this work, we investigate the scaling of the DL strength with the hot electron temperature by PIC simulations and find a linear scaling. We demonstrate that the strength is limited by the formation of parallel shocks. Based on this, we analytically determine the maximum DL strength, and also find a linear scaling with the hot electron temperature. The DL strength obtained from the analytic calculation is comparable to that from the simulations. At the maximum strength, the DL is capable of confining a significant fraction of hot electrons in the source.

  7. Double-duct liquid metal magnetohydrodynamic engine

    DOE Patents [OSTI]

    Haaland, Carsten M. (Oak Ridge, TN)

    1995-01-01

    An internal combustion, liquid metal (LM) magnetohydrodynamic (MHD) engine and an alternating current (AC) magnetohydrodynamic generator, are used in combination to provide useful AC electric energy output. The engine design has-four pistons and a double duct configuration, with each duct containing sodium potassium liquid metal confined between free pistons located at either end of the duct. The liquid metal is forced to flow back and forth in the duct by the movement of the pistons, which are alternatively driven by an internal combustion process. In the MHD generator, the two LM-MHD ducts pass in close proximity through a Hartmann duct with output transformer. AC power is produced by operating the engine with the liquid metal in the two generator ducts always flowing in counter directions. The amount of liquid metal maintained in the ducts may be varied. This provides a variable stroke length for the pistons. The engine/generator provides variable AC power at variable frequencies that correspond to the power demands of the vehicular propulsion. Also the engine should maintain nearly constant efficiency throughout the range of power usage. Automobiles and trucks could be powered by the invention, with no transmission or power converter devices being required.

  8. Double-duct liquid metal magnetohydrodynamic engine

    DOE Patents [OSTI]

    Haaland, Carsten M. (Oak Ridge, TN)

    1997-01-01

    An internal combustion, liquid metal (LM) magnetohydrodynamic (MHD) engine and an alternating current (AC) magnetohydrodynamic generator, are used in combination to provide useful AC electric energy output. The engine design has four pistons and a double duct configuration, with each duct containing sodium potassium liquid metal confined between free pistons located at either end of the duct. The liquid metal is forced to flow back and forth in the duct by the movement of the pistons, which are alternatively driven by an internal combustion process. In the MHD generator, the two LM-MHD ducts pass in close proximity through a Hartmann duct with output transformer. AC power is produced by operating the engine with the liquid metal in the two generator ducts always flowing in counter directions. The amount of liquid metal maintained in the ducts may be varied. This provides a variable stroke length for the pistons. The engine/generator provides variable AC power at variable frequencies that correspond to the power demands of the vehicular propulsion. Also the engine should maintain nearly constant efficiency throughout the range of power usage. Automobiles and trucks could be powered by the invention, with no transmission or power converter devices being required.

  9. Double Wick rotating Green-Schwarz strings

    E-Print Network [OSTI]

    Gleb Arutyunov; Stijn J. van Tongeren

    2015-05-05

    Via an appropriate field redefinition of the fermions, we find a set of conditions under which light cone gauge fixed world sheet theories of strings on two different backgrounds are related by a double Wick rotation. These conditions take the form of a set of transformation laws for the background fields, complementing a set of transformation laws for the metric and B field we found previously with a set for the dilaton and RR fields, and are compatible with the supergravity equations of motion. Our results prove that at least to second order in fermions, the AdS_5 x S^5 mirror model which plays an important role in the field of integrability in AdS/CFT, represents a string on `mirror AdS_5 x S^5', the background that follows from our transformations. We discuss analogous solutions for AdS_3 x S^3 x T^4 and AdS_2 x S^2 x T^6. The main ingredient in our derivation is the light cone gauge fixed action for a string on an (almost) completely generic background, which we explicitly derive to second order in fermions.

  10. Pionic contribution to neutrinoless double beta decay

    SciTech Connect (OSTI)

    Vergados, J. D. [Physics Department, University of Ioannina, Ioannina, GR 451 10 (Greece); Theory Division, CERN, Geneva (Switzerland); Faessler, Amand [Institute fuer Theoretische Physik, Universitaet Tuebingen (Germany); Toki, H. [RCNP, Osaka University, Osaka, 567-0047 (Japan)

    2010-02-01

    It is well known that neutrinoless double decay is going to play a crucial role in settling the neutrino properties, which cannot be extracted from the neutrino oscillation data. It is, in particular, expected to settle the absolute scale of neutrino mass and determine whether the neutrinos are Majorana particles, i.e. they coincide with their own antiparticles. In order to extract the average neutrino mass from the data, one must be able to estimate the contribution of all possible high mass intermediate particles. The latter, which occur in practically all extensions of the standard model, can, in principle, be differentiated from the usual mass term, if data from various targets are available. One, however, must first be able to reliably calculate the corresponding nuclear matrix elements. Such calculations are extremely difficult since the effective transition operators are very short ranged. For such operators processes like pionic contributions, which are usually negligible, turn out to be dominant. We study such an effect in a nonrelativistic quark model for the pion and the nucleon.

  11. Experimental research of double beta decay of atomic nuclei

    E-Print Network [OSTI]

    F. A. Danevich

    2011-12-26

    Results of several double beta decay experiments, performed with the help of low background crystal scintillators, are presented. In particular, the half-life value of the two-neutrino double beta decay of 116-Cd has been measured as 2.9 10^{19} yr, and the new half-life limit on the neutrinoless double beta decay of 116-Cd has been established as >1.7 10^{23} yr at 90%, which corresponds to a restriction on the neutrino mass <1.7 eV. New half-life bounds on the level of 10^{17}-10^{21} yr were set for double beta processes in 64-Zn, 70-Zn, 106-Cd, 108-Cd, 114-Cd, 136-Ce, 138-Ce, 142-Ce, 160-Gd, 180-W, and 186-W by using low-background CdWO4, GSO, and ZnWO4 crystal scintillators. The claim of discovery of the neutrinoless double beta decay of 76-Ge [Mod. Phys. Lett. A 16 (2001) 2409] was analyzed. The demands of the future high sensitivity double beta decay experiments, aiming to observe the neutrinoless double beta decay or to advance restrictions on the neutrino mass to < 0.01 eV, were considered. Requirements for their sensitivity and discovery potential were formulated. Two projects of double beta experiments with a sensitivity on the level of 10^{26}-10^{27} yr (CAMEO and CARVEL projects) were discussed. Scintillation properties and radioactive contamination of CaWO4, ZnWO4, CdWO4, PbWO4, GSO(Ce), CeF3, yttrium-aluminum garnet doped with neodymium (YAG:Nd) crystal scintillators were studied. Applicability of these scintillators to search for double beta decay was discussed.

  12. The classical double copy for Taub-NUT spacetime

    E-Print Network [OSTI]

    Luna, A; O'Connell, D; White, C D

    2015-01-01

    The double copy is a much-studied relationship between gauge theory and gravity amplitudes. Recently, this was generalised to an infinite family of classical solutions to Einstein's equations, namely stationary Kerr-Schild geometries. In this paper, we extend this to the Taub-NUT solution in gravity, which has a double Kerr-Schild form. The single copy of this solution is a dyon, whose electric and magnetic charges are related to the mass and NUT charge in the gravity theory. Finally, we find hints that the classical double copy extends to curved background geometries.

  13. Fabrication and Measurements of 500 MHz Double Spoke Cavity

    SciTech Connect (OSTI)

    Park, HyeKyoung; Hopper, Christopher S.; Delayen, Jean R.

    2014-12-01

    A 500 MHz ?0=1 double spoke cavity has been designed and optimized for a high velocity application such as a compact electron accelerator at the Center for Accelerator Science at Old Dominion University [1] and the fabrication was recently completed at Jefferson Lab. The geometry specific to the double spoke cavity required a variety of tooling and fixtures. Also a number of asymmetric weld joints were expected to make it difficult to maintain minimal geometric deviation from the design. This paper will report the fabrication procedure, resulting tolerance from the design, initial test results and the lessons learned from the first ?0=1 double spoke cavity fabrication.

  14. Matched Slow Pulses Using Double Electromagnetically Induced Transparency

    E-Print Network [OSTI]

    Andrew MacRae; Geoff Campbell; A. I. Lvovsky

    2008-09-29

    We implement double electromagnetically-induced transparency (double EIT) in rubidium vapor, using a tripod-shaped energy level scheme consisting of hyperfine and magnetic sublevels of the 5S1/2 to 5P1/2 transition. We show experimentally that through the use of double EIT one can control the contrast of transparency windows as well as group velocities of the two signal fields. In particular, the group velocities can be equalized, which holds promise to greatly enhance nonlinear optical interaction between these fields.

  15. Double, Double Toil and Trouble: Tungsten Burns and Helium Bubbles | U.S.

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit theCovalentLaboratory |Sector FullDOE Office of Science (SC) Double,

  16. Method of quantitating dsDNA

    DOE Patents [OSTI]

    Stark, Peter C. (Los Alamos, NM); Kuske, Cheryl R. (Los Alamos, NM); Mullen, Kenneth I. (Los Alamos, NM)

    2002-01-01

    A method for quantitating dsDNA in an aqueous sample solution containing an unknown amount of dsDNA. A first aqueous test solution containing a known amount of a fluorescent dye-dsDNA complex and at least one fluorescence-attenutating contaminant is prepared. The fluorescence intensity of the test solution is measured. The first test solution is diluted by a known amount to provide a second test solution having a known concentration of dsDNA. The fluorescence intensity of the second test solution is measured. Additional diluted test solutions are similarly prepared until a sufficiently dilute test solution having a known amount of dsDNA is prepared that has a fluorescence intensity that is not attenuated upon further dilution. The value of the maximum absorbance of this solution between 200-900 nanometers (nm), referred to herein as the threshold absorbance, is measured. A sample solution having an unknown amount of dsDNA and an absorbance identical to that of the sufficiently dilute test solution at the same chosen wavelength is prepared. Dye is then added to the sample solution to form the fluorescent dye-dsDNA-complex, after which the fluorescence intensity of the sample solution is measured and the quantity of dsDNA in the sample solution is determined. Once the threshold absorbance of a sample solution obtained from a particular environment has been determined, any similarly prepared sample solution taken from a similar environment and having the same value for the threshold absorbance can be quantified for dsDNA by adding a large excess of dye to the sample solution and measuring its fluorescence intensity.

  17. Nanopores formed by DNA origami: a review

    E-Print Network [OSTI]

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2014-06-10

    , coated with hydrophobic moieties, into a lipid bilayer. Recent work in these two branches is now discussed. Hybrid nanopores formed by trapping DNA origami onto a solid state nanopore The combination of DNA origami and solid state nanopores was first... (1982) Nucleic acid junctions and lattices. J. Theor. Biol. 99, 237–47. 28 Rothemund PWK (2006) Folding DNA to create nanoscale shapes and patterns. Nature 440, 297– 302. 29 Kuzyk A, Schreiber R, Fan Z, Pardatscher G, Roller E-M, Högele A, Simmel FC...

  18. Complete Genome Sequence of Pseudomonas Aeruginosa Phage vB_PaeM_CEB_DP1

    E-Print Network [OSTI]

    Pires, Diana P.

    vB_PaeM_CEB_DP1 is a Pseudomonas aeruginosa bacteriophage (phage) belonging to the Pbunalikevirus genus of the Myoviridae family of phages. It was isolated from hospital sewage. vB_PaeM_CEB_DP1 is a double-stranded DNA ...

  19. Computational Chemistry DOI: 10.1002/anie.200501671

    E-Print Network [OSTI]

    Simons, Jack

    and Environmental Research, Low Dose Radiation Research Program (M.G.), and the Polish State Committee-energy radiation. Recent experiments suggested that single- and double-strand breaks develop in DNA exposed to low acid bases may be formed by trapping low- energy electrons produced in living cells by high

  20. Development and Usage of a NIST Standard Reference Material for Real Time PCR Quantitation of Human DNANational Institute of Standards and Technology

    E-Print Network [OSTI]

    : petev@nist.gov Peter M. Vallone, Margaret C. Kline, David L. Duewer, Amy E. Decker, Janette W. Redman an absorbance of 1.0 at 260 nm equals 50 ng/µL of double stranded DNA. In addition, an interlaboratory study has

  1. Posttranscriptional gene silencing in nuclei Paul Hoffera

    E-Print Network [OSTI]

    Pikaard, Craig

    (1). RNAi can be divided into two major categories: transcriptional gene silencing (TGS) and posttranscriptional gene silencing (PTGS). Both TGS and PTGS depend on small interfering RNAs (siRNA) or microRNAs (miRNA) that are produced from double-stranded RNA (dsRNA) precursors. TGS occurs in nuclei via DNA methylation and histone

  2. Small RNA analysis using the Genome SequencerTM The Genome SequencerTM FLX System from 454 Life SciencesTM and Roche Applied Science is a

    E-Print Network [OSTI]

    Cai, Long

    collection of molecules with several important biological functions. Genome Sequencer technology is ideally Genome Sequencer FLX DNA library preparation protocol. The Genome Sequencer process­specific A and B molecules.The resulting double-stranded library is transferred to the emulsion PCR (emPCRTM) step for clonal

  3. Journal of the Mechanics and Physics of Solids 51 (2003) 18151847

    E-Print Network [OSTI]

    Ortiz, Michael

    2003-01-01

    -50, Pasadena, CA 91125, USA. Fax: +1-626-449-6359. E-mail address: ortiz@aero.caltech.edu (M. Ortiz). 1 A virus years, the structure of the portal motor which translocates double-stranded DNA into the capsid

  4. EA-1136: Double Tracks Test Site, Nye County, Nevada

    Broader source: Energy.gov [DOE]

    This EA evaluates the environmental impacts of the proposal for the U.S. Department of Energy Nevada Operations Office to conduct environmental restoration operations at the Double Tracks test site...

  5. Electrochemical Double-Layer Capacitors Using Carbon Nanotube Electrode Structures

    E-Print Network [OSTI]

    Schindall, Joel E.

    The structure and behavior of the electrical double-layer capacitor (EDLC) are described. The use of activated carbon electrodes is discussed and the limitations on voltage and accessible surface area are presented. Metrics ...

  6. Double beta decay experiments: beginning of a new era

    E-Print Network [OSTI]

    A. S. Barabash

    2012-09-19

    The review of current experiments on search and studying of double beta decay processes is done. Results of the most sensitive experiments are discussed and values of modern limits on effective Majorana neutrino mass ($) are given. New results on two neutrino double beta decay are presented. The special attention is given to new current experiments with mass of studied isotopes more than 100 kg, EXO--200 and KamLAND--Zen. These experiments open a new era in research of double beta decay. In the second part of the review prospects of search for neutrinoless double beta decay in new experiments with sensitivity to $$ at the level of $\\sim 0.01-0.1$ eV are discussed. Parameters and characteristics of the most perspective projects (CUORE, GERDA, MAJORANA, SuperNEMO, EXO, KamLAND--Zen, SNO+) are given.

  7. Evaluation of short-day onion doubled haploid lines 

    E-Print Network [OSTI]

    Walker, Ryan Lee

    2009-05-15

    Molecular marker analysis of seven putative onion (Allium cepa) doubled haploid (DH) lines developed at Texas A&M University was conducted to verify genetic homozygosity. Analysis was also conducted on five equivalent ...

  8. Comment on "Evidence for Neutrinoless Double Beta Decay"

    E-Print Network [OSTI]

    C. E. Aalseth; F. T. Avignone III; A. Barabash; F. Boehm; R. L. Brodzinski; J. I. Collar; P. J. Doe; H. Ejiri; S. R. Elliott; E. Fiorini; R. J. Gaitskell; G. Gratta; R. Hazama; K. Kazkaz; G. S. King III; R. T. Kouzes; H. S. Miley; M. K. Moe; A. Morales; J. Morales; A. Piepke; R. G. H. Robertson; W. Tornow; P. Vogel; R. A. Warner; J. F. Wilkerson

    2002-05-22

    We comment on the recent claim for the experimental observation of neutrinoless double-beta decay. We discuss several limitations in the analysis provided in that paper and conclude that there is no basis for the presented claim.

  9. Predicting an ultraviolet-tetraherz double resonance spectrum of formaldehyde

    E-Print Network [OSTI]

    Fenn, Emily E. (Emily Elizabeth)

    2006-01-01

    In preparation for performing a triple resonance experiment to study the Rydberg states of calcium monofluoride (CaF), a double resonance spectrum of formaldehyde will be recorded. A dye laser will populate a level in ...

  10. Nebraska: Company More than Doubles Annual Sales and Employees...

    Broader source: Energy.gov (indexed) [DOE]

    than doubled their employees from 119 to 269 since 2010. Leveraging its EERE-supported hydrogen storage tank development, Hexagon is now an active player in the natural gas...

  11. The gauge algebra of double field theory and Courant brackets

    E-Print Network [OSTI]

    Hull, Chris

    We investigate the symmetry algebra of the recently proposed field theory on a doubled torus that describes closed string modes on a torus with both momentum and winding. The gauge parameters are constrained fields on the ...

  12. Performance of a double pass solar air collector

    SciTech Connect (OSTI)

    Ramani, B.M.; Gupta, Akhilesh; Kumar, Ravi

    2010-11-15

    Double pass counter flow solar air collector with porous material in the second air passage is one of the important and attractive design improvement that has been proposed to improve the thermal performance. This paper presents theoretical and experimental analysis of double pass solar air collector with and without porous material. A mathematical model has been developed based on volumetric heat transfer coefficient. Effects of various parameters on the thermal performance and pressure drop characteristics have been discussed. Comparison of results reveals that the thermal efficiency of double pass solar air collector with porous absorbing material is 20-25% and 30-35% higher than that of double pass solar air collector without porous absorbing material and single pass collector respectively. (author)

  13. Band Tunneling through Double Barrier in Bilayer Graphene

    E-Print Network [OSTI]

    Hasan A. Alshehab; Hocine Bahlouli; Abderrahim El Mouhafid; Ahmed Jellal

    2014-01-20

    By taking into account the full four band energy spectrum, we calculate the transmission probability and conductance of electrons across symmetric and asymmetric double potential barrier with a confined interlayer potential difference in bilayer graphene. For energies less than the interlayer coupling \\gamma_{1}, E \\gamma_{1}, we obtain four possible ways for transmission resulting from the two propagating modes. We compute the associated transmission probabilities as well as their contribution to the conductance, study the effect of the double barrier geometry.

  14. Energy levels of double triangular graphene quantum dots

    SciTech Connect (OSTI)

    Liang, F. X.; Jiang, Z. T. Zhang, H. Y.; Li, S.; Lv, Z. T.

    2014-09-28

    We investigate theoretically the energy levels of the coupled double triangular graphene quantum dots (GQDs) based on the tight-binding Hamiltonian model. The double GQDs including the ZZ-type, ZA-type, and AA-type GQDs with the two GQDs having the zigzag or armchair boundaries can be coupled together via different interdot connections, such as the direct coupling, the chains of benzene rings, and those of carbon atoms. It is shown that the energy spectrum of the coupled double GQDs is the amalgamation of those spectra of the corresponding two isolated GQDs with the modification triggered by the interdot connections. The interdot connection is inclined to lift up the degeneracies of the energy levels in different degree, and as the connection changes from the direct coupling to the long chains, the removal of energy degeneracies is suppressed in ZZ-type and AA-type double GQDs, which indicates that the two coupled GQDs are inclined to become decoupled. Then we consider the influences on the spectra of the coupled double GQDs induced by the electric fields applied on the GQDs or the connection, which manifests as the global spectrum redistribution or the local energy level shift. Finally, we study the symmetrical and asymmetrical energy spectra of the double GQDs caused by the substrates supporting the two GQDs, clearly demonstrating how the substrates affect the double GQDs' spectrum. This research elucidates the energy spectra of the coupled double GQDs, as well as the mechanics of manipulating them by the electric field and the substrates, which would be a significant reference for designing GQD-based devices.

  15. No-neutrino double beta decay: more than one neutrino

    SciTech Connect (OSTI)

    Rosen, S.P.

    1983-01-01

    Interference effects between light and heavy Majorana neutrinos in the amplitude for no-neutrino double beta decay are discussed. The effects include an upper bound on the heavy neutrino mass, and an A dependence for the effective mass extracted from double beta decay. Thus the search for the no-neutrino decay mode should be pursued in several nuclei, and particularly in Ca/sup 48/, where the effective mass may be quite large.

  16. NEMO 3 double beta decay experiment: latest results

    E-Print Network [OSTI]

    A. S. Barabash

    2008-07-17

    The double beta decay experiment NEMO~3 has been taking data since February 2003. The aim of this experiment is to search for neutrinoless decay and investigate two neutrino double beta decay in seven different enriched isotopes ($^{100}$Mo,$^{82}$Se, $^{48}$Ca, $^{96}$Zr, $^{116}$Cd, $^{130}$Te and $^{150}$Nd). After analysis of the data corresponding to 693 days, no evidence for $0\

  17. Effect of nuclear deformation on double beta decay

    SciTech Connect (OSTI)

    Rodin, Vadim [Institute fuer Theoretische Physik der Universitaet Tuebingen, D-72076 Tuebingen (Germany)

    2009-11-09

    The existing ways of accounting for deformation in recent calculations of neutrinoless double beta decay matrix elements are discussed. From an analysis of relevant experimental data it is argued that only {sup 150}Nd reveals convincing evidences of strong static deformation, which should eventually be taken into account in QRPA calculations. A proposal which allows in principle to measure the neutrino less double beta decay Fermi matrix element is briefly described.

  18. Overconstrained estimates of neutrinoless double beta decay within the QRPA

    E-Print Network [OSTI]

    Amand Faessler; Gianluigi Fogli; Eligio Lisi; Vadim Rodin; Anna Maria Rotunno; Fedor Simkovic

    2008-05-29

    Estimates of nuclear matrix elements for neutrinoless double beta decay (0nu2beta) based on the quasiparticle random phase approximations (QRPA) are affected by theoretical uncertainties, which can be substantially reduced by fixing the unknown strength parameter g_pp of the residual particle-particle interaction through one experimental constraint - most notably through the two-neutrino double beta decay (2nu2beta) lifetime. However, it has been noted that the g_pp adjustment via 2\

  19. Deformed quantum double realization of the toric code and beyond

    E-Print Network [OSTI]

    Pramod Padmanabhan; Juan Pablo Ibieta Jimenez; Miguel Jorge Bernabé Ferreira; Paulo Teotonio-Sobrinho

    2015-12-10

    Quantum double models, such as the toric code, can be constructed from transfer matrices of lattice gauge theories with discrete gauge groups and parametrized by the center of the gauge group algebra and its dual. For general choices of these parameters the transfer matrix contains operators acting on links which can also be thought of as perturbations to the quantum double model driving it out of its topological phase and destroying the exact solvability of the quantum double model. We modify these transfer matrices with perturbations and extract exactly solvable models which remain in a quantum phase, thus nullifying the effect of the perturbation. The algebra of the modified vertex and plaquette operators now obey a deformed version of the quantum double algebra. The Abelian cases are shown to be in the quantum double phase whereas the non-Abelian phases are shown to be in a modified phase of the corresponding quantum double phase. These are illustrated with the groups $\\mathbb{Z}_n$ and $S_3$. The quantum phases are determined by studying the excitations of these systems namely their fusion rules and the statistics. We then go further to construct a transfer matrix which contains the other $\\mathbb{Z}_2$ phase namely the double semion phase. More generally for other discrete groups these transfer matrices contain the twisted quantum double models. These transfer matrices can be thought of as being obtained by introducing extra parameters into the transfer matrix of lattice gauge theories. These parameters are central elements belonging to the tensor products of the algebra and its dual and are associated to vertices and volumes of the three dimensional lattice. As in the case of the lattice gauge theories we construct the operators creating the excitations in this case and study their braiding and fusion properties.

  20. Neutrinoless Double Beta Decay with Negligible Neutrino Mass

    E-Print Network [OSTI]

    Biswajoy Brahmachari; Ernest Ma

    2002-02-27

    If the electron neutrino has an effective nonzero Majorana mass, then neutrinoless double beta decay will occur. However, the latter is possible also with a negligible neutrino mass. We show how this may happen in a simple model of scalar diquarks and dileptons. This possibility allows neutrino masses to be small and hierarchical, without conflicting with the possible experimental evidence of neutrinoless double beta decay.