Powered by Deep Web Technologies
Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Data Processing Procedures and Methodology for Estimating Trip Distances for the 1995 American Travel Survey (ATS)  

SciTech Connect

The 1995 American Travel Survey (ATS) collected information from approximately 80,000 U.S. households about their long distance travel (one-way trips of 100 miles or more) during the year of 1995. It is the most comprehensive survey of where, why, and how U.S. residents travel since 1977. ATS is a joint effort by the U.S. Department of Transportation (DOT) Bureau of Transportation Statistics (BTS) and the U.S. Department of Commerce Bureau of Census (Census); BTS provided the funding and supervision of the project, and Census selected the samples, conducted interviews, and processed the data. This report documents the technical support for the ATS provided by the Center for Transportation Analysis (CTA) in Oak Ridge National Laboratory (ORNL), which included the estimation of trip distances as well as data quality editing and checking of variables required for the distance calculations.

Hwang, H.-L.; Rollow, J.

2000-05-01T23:59:59.000Z

2

3Solar Energy and the Distance to Juno from the Sun As the Juno spacecraft travels to Jupiter,  

E-Print Network (OSTI)

at its maximum distance from the sun? Space Math http://spacemath.gsfc.nasa.gov #12;Answer Key 3 Problem, it gets farther from the sun every day. Because the spacecraft generates its electrical power using solar(r)? Problem 3 ­ For what angle, , will the spacecraft be able to generate only ¼ of the electrical power

3

Travel Medicine  

NLE Websites -- All DOE Office Websites (Extended Search)

SCOPE OF PROBLEM SCOPE OF PROBLEM * 21% of U.S. Adult Population Travel for Business * 1.4 million International Travelers Daily * Numbers will Increase * Include Workers in Planning TRAVEL AND INFECTIOUS DISEASE * Endemic Exotic Diseases * Antimicrobial Resistance *Non-Specific Presentation of Disease * Emergence/ Re-emergence of Infectious Agents * Importation/ Exportation of Infection Mary L. Doyle, MPH, RN, COHN-S/CM DOE Headquarters January 17,2002 INTERNATIONAL TRAVEL * Economic Expansion * Globalization of Companies * Extended * Extended & Short-tenn Assignments * Multi-National Travel * Circle Globe in Three Days * Incubation Period for Infectious Diseases * Employee Needs Advice from OHN HEALTH ASSESSMENT * Potential Travel Illnesses * Employee Health Risks

4

Travel Visa  

Science Conference Proceedings (OSTI)

Please note that the Department of Homeland Security is implementing the Electronic System for Travel Authorization, which is expected to be mandatory for

5

Travel Reimbursement  

NLE Websites -- All DOE Office Websites (Extended Search)

Fund. TRAVEL RESOURCES Albuquerque Sunport Albuquerque Sunport Car Rental Center Atomic City Transit FastPark and Relax Albuquerque Airport Parking GSA Domestic Per Diem...

6

Zero Energy Travel  

E-Print Network (OSTI)

It is fundamentally possible to travel with zero energy based on Newton Laws of Motion. According to the first law of motion, a body will continue to travel for infinite distance unless it is acted upon by another force. For a body in motion, the force which stops perpetual motion is friction. However, there are many circumstances that friction is zero, for example in space, where there is vacuum. On earth, gravity makes objects to be in constant contact with each other generating friction but technology exists to separate them in the air using powerful magnetic forces. At low speeds, the friction caused by air is minimal but we can create vacuum even on land for high speed travel. Another condition for travelling is for it to stop at its destination. On land, we can recover the kinetic energy back into electrical energy using brushless permanent magnet generators. These generators can also convert electric energy into kinetic energy in order to provide motion. This article reviews technologies that will allow us to travel with zero energy. It is easier to do it on land but in the air, it is not obvious.

Othman Ahmad; Aroland Kiring; Ali Chekima

2011-09-17T23:59:59.000Z

7

Travel | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Travel Travel Travel The Travel Services Team serves as the Headquarters POC for the following services: Headquarters Travel Management Center (TMC) Official Travel, Domestic and Foriegn Foreign Travel Management System (FTMS) Official Travel Regulations and Guidelines U.S. Passports and Visa Services (Official and Diplomatic) Non-Refundable Airfare Guidance International Insurance for DOE Officials (MEDEX) RezProfiler Instructions Car Rental Hotel Reservations Travel FAQs For questions about Travel Services or the Travel Management Center, see the Contact Us, Travel Services Section Travel Management Center (TMC) The Travel Services Team oversees the Travel Management Center (TMC), which is operated by ADTRAV Travel Management. Office Hours - 8:00 a.m. to 5:00 p.m. Office Location - Forrestal, Room GE-180

8

Travel Award Program  

Science Conference Proceedings (OSTI)

Travel Award Program. What is the travel award? The CNST has a Cooperative Agreement with the University of Maryland Nanocenter. ...

2010-11-16T23:59:59.000Z

9

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Vehicle Usage Number of trips 773,602 Total distance traveled (mi) 5,558,155 Avg trip distance (mi) 7.2 Avg distance traveled per day when the vehicle was driven (mi) 30.2 Avg...

10

Information for Travelers  

Science Conference Proceedings (OSTI)

Information for Travelers. Background Notes of Countries and International Organizations; Centers for Disease Control Health Information; ...

2012-09-19T23:59:59.000Z

11

Travel Notes - World Market Update  

Science Conference Proceedings (OSTI)

Travel notes, air travel, rail travel. Travel Notes - World Market Update Biofuels and Bioproducts and Biodiesel Processing Elearning Olive oil Industry Events Industrial Oil Products Abstracts Program Travel Hotel Short Courses Exhibits Regi

12

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

13

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

14

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

15

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

16

TMS Intl Travel Visa  

Science Conference Proceedings (OSTI)

Please note that the Department of Homeland Security is implementing the Electronic System for Travel Authorization, which is expected to be mandatory for

17

Segmenting the mature travel market by motivation  

Science Conference Proceedings (OSTI)

The purpose of this study was to segment mature travellers based on their motivations and to profile the similarities and differences between mature travel market segments according to their sociodemographic and travel-related characteristics. A ... Keywords: USA, United States, cluster analysis, data analysis, educational travellers, factor analysis, mature markets, mature travellers, personal travellers, segmentation, social travellers, sociodemographics, travel market segments, travel motivation

Yawei Wang; Yanli Zhang; John Xia; Zhongxian Wang

2008-11-01T23:59:59.000Z

18

A Joint Household Travel Distance Generation and Car Ownership Model  

E-Print Network (OSTI)

at a~ljustmentsof car ownership usage that representare from previous car ownership, train usage, and bus-tram-car usageare moreimportantthan the laggedeffects of public transport usage.

Golob, Thomas F.; Van Wissen , Leo

1989-01-01T23:59:59.000Z

19

A Joint Household Travel Distance Generation And Car Ownership Model  

E-Print Network (OSTI)

at a~ljustmentsof car ownership usage that representare from previous car ownership, train usage, and bus-tram-car usageare moreimportantthan the laggedeffects of public transport usage.

Golob, Thomas F.; Van Wissen, Leo

1989-01-01T23:59:59.000Z

20

Travel Request Form  

NLE Websites -- All DOE Office Websites (Extended Search)

Lodging Lodging Transportation SNAP COLLABORATION MEETING JUNE 1 - 3, 2006 TRAVEL FUNDING REQUEST FORM If you require Travel funding support from LBNL to attend the SNAP Collaboration Meeting, please fill out the travel request form below and click on the "SEND" button. As an alternative, you can simply email the requested information on the form to snap@lbl.gov Deadline: Please submit your request NLT Wednesday, May 10, 2006. Disclaimer: Please note that the submission of this request does not automatically constitute funding approval. 1. First Name Last Name 2. Has this travel funding support been pre-approved by the SNAP management? Yes No 3. If answer to #2 is "Yes": a) Approval by whom? b) What was the maximum reimbursement amount from SNAP?

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Interviewee Travel Regulations Scope  

NLE Websites -- All DOE Office Websites (Extended Search)

3/2012 3/2012 Interviewee Travel Regulations Scope These regulations apply to the reimbursement of round-trip travel expenses incurred by interviewees. These regulations do not apply to applicants who live within a 50-mile radius of Los Alamos based on the Rand McNally Standard Highway Mileage Guide. Reimbursement With the exception of airfare, interviewees will be reimbursed for travel expenses according to Federal travel regulations. For interviewees, airfare reimbursement is limited to the lesser of the standard coach airfare or the actual amount paid. The lowest available airfare should be obtained based on the official business dates and locations. The reimbursement amount will be based on the most direct route available between the interviewee's residence and the laboratory. Costs incurred over the lowest available fare will be the

22

Traveling-wave photodetector  

DOE Patents (OSTI)

The traveling-wave photodetector of the present invention combines an absorptive optical waveguide and an electrical transmission line, in which optical absorption in the waveguide results in a photocurrent at the electrodes of the electrical transmission line. The optical waveguide and electrical transmission line of the electrically distributed traveling-wave photodetector are designed to achieve matched velocities between the light in the optical waveguide and electrical signal generated on the transmission line. This velocity synchronization provides the traveling-wave photodetector with a large electrical bandwidth and a high quantum efficiency, because of the effective extended volume for optical absorption. The traveling-wave photodetector also provides large power dissipation, because of its large physical size. 4 figures.

Hietala, V.M.; Vawter, G.A.

1993-12-14T23:59:59.000Z

23

Traveling-wave photodetector  

DOE Patents (OSTI)

The traveling-wave photodetector of the present invention combines an absorptive optical waveguide and an electrical transmission line, in which optical absorption in the waveguide results in a photocurrent at the electrodes of the electrical transmission line. The optical waveguide and electrical transmission line of the electrically distributed traveling-wave photodetector are designed to achieve matched velocities between the light in the optical waveguide and electrical signal generated on the transmission line. This velocity synchronization provides the traveling-wave photodetector with a large electrical bandwidth and a high quantum efficiency, because of the effective extended volume for optical absorption. The traveling-wave photodetector also provides large power dissipation, because of its large physical size.

Hietala, V.M.; Vawter, G.A.

1992-12-31T23:59:59.000Z

24

Traveling-wave photodetector  

DOE Patents (OSTI)

The traveling-wave photodetector of the present invention combines an absorptive optical waveguide and an electrical transmission line, in which optical absorption in the waveguide results in a photocurrent at the electrodes of the electrical transmission line. The optical waveguide and electrical transmission line of the electrically distributed traveling-wave photodetector are designed to achieve matched velocities between the light in the optical waveguide and electrical signal generated on the transmission line. This velocity synchronization provides the traveling-wave photodetector with a large electrical bandwidth and a high quantum efficiency, because of the effective extended volume for optical absorption. The traveling-wave photodetector also provides large power dissipation, because of its large physical size.

Hietala, Vincent M. (Placitas, NM); Vawter, Gregory A. (Albuquerque, NM)

1993-01-01T23:59:59.000Z

25

University of Kansas Travel Handbook  

E-Print Network (OSTI)

...................................................................................................................5 Future Employees Traveling Before Start Date .....................................................................................................................................6 Transportation Expenses.................................................................................................................................6 Reimbursable Transportation

Peterson, Blake R.

26

Transferring 2001 National Household Travel Survey  

Science Conference Proceedings (OSTI)

Policy makers rely on transportation statistics, including data on personal travel behavior, to formulate strategic transportation policies, and to improve the safety and efficiency of the U.S. transportation system. Data on personal travel trends are needed to examine the reliability, efficiency, capacity, and flexibility of the Nation's transportation system to meet current demands and to accommodate future demand. These data are also needed to assess the feasibility and efficiency of alternative congestion-mitigating technologies (e.g., high-speed rail, magnetically levitated trains, and intelligent vehicle and highway systems); to evaluate the merits of alternative transportation investment programs; and to assess the energy-use and air-quality impacts of various policies. To address these data needs, the U.S. Department of Transportation (USDOT) initiated an effort in 1969 to collect detailed data on personal travel. The 1969 survey was the first Nationwide Personal Transportation Survey (NPTS). The survey was conducted again in 1977, 1983, 1990, 1995, and 2001. Data on daily travel were collected in 1969, 1977, 1983, 1990 and 1995. In 2001, the survey was renamed the National Household Travel Survey (NHTS) and it collected both daily and long-distance trips. The 2001 survey was sponsored by three USDOT agencies: Federal Highway Administration (FHWA), Bureau of Transportation Statistics (BTS), and National Highway Traffic Safety Administration (NHTSA). The primary objective of the survey was to collect trip-based data on the nature and characteristics of personal travel so that the relationships between the characteristics of personal travel and the demographics of the traveler can be established. Commercial and institutional travel were not part of the survey. Due to the survey's design, data in the NHTS survey series were not recommended for estimating travel statistics for categories smaller than the combination of Census division (e.g., New England, Middle Atlantic, and Pacific), MSA size, and the availability of rail. Extrapolating NHTS data within small geographic areas could risk developing and subsequently using unreliable estimates. For example, if a planning agency in City X of State Y estimates travel rates and other travel characteristics based on survey data collected from NHTS sample households that were located in City X of State Y, then the agency could risk developing and using unreliable estimates for their planning process. Typically, this limitation significantly increases as the size of an area decreases. That said, the NHTS contains a wealth of information that could allow statistical inferences about small geographic areas, with a pre-determined level of statistical certainty. The question then becomes whether a method can be developed that integrates the NHTS data and other data to estimate key travel characteristics for small geographic areas such as Census tract and transportation analysis zone, and whether this method can outperform other, competing methods.

Hu, Patricia S [ORNL; Reuscher, Tim [ORNL; Schmoyer, Richard L [ORNL; Chin, Shih-Miao [ORNL

2007-05-01T23:59:59.000Z

27

2005 PTM Travel Information - TMS  

Science Conference Proceedings (OSTI)

TRAVEL INFORMATION SOCIAL EVENTS & TOURS VISA INFORMATION ... Wind: SSW at 7 mph. Airport Delays Beach Conditions Pollen Reports...

28

Travel plans: opportunities for ICT  

Science Conference Proceedings (OSTI)

Site-based mobility management or 'travel plans' address the transport problem by engaging with those organisations such as employers that are directly responsible for generating the demand for travel, and hence have the potential to have a major impact ... Keywords: ict, market niche, sustainable transport, travel plans

Marcus P. Enoch

2012-06-01T23:59:59.000Z

29

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

30

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

31

2001 New York State NHTS: Travel Patterns of Special Populations  

SciTech Connect

Policymakers rely on transportation statistics, including data on personal travel behavior, to formulate strategic transportation policies, and to improve the safety and efficiency of the U.S. transportation system. Data on personal travel trends are needed to examine the reliability, efficiency, capacity, and flexibility of the Nation's transportation system to meet current demands and accommodate future demands; to assess the feasibility and efficiency of alternative congestion-alleviating technologies (e.g., high-speed rail, magnetically levitated trains, intelligent vehicle and highway systems); to evaluate the merits of alternative transportation investment programs; and to assess the energy-use and air-quality impacts of various policies. To address these data needs, the U.S. Department of Transportation (USDOT) initiated an effort in 1969 to collect detailed data on personal travel. The 1969 survey was the first Nationwide Personal Transportation Survey (NPTS). The survey was conducted again in 1977, 1983, 1990, 1995, and 2001. Data on daily travel were collected in 1969, 1977, 1983, 1990 and 1995. Longer-distance travel was collected in 1977 and 1995. The 2001 National Household Travel Survey (NHTS) collected both daily and longer-distance trips in one survey. The 2001 survey was sponsored by three USDOT agencies: Federal Highway Administration (FHWA), Bureau of Transportation Statistics (BTS), and National Highway Traffic Safety Administration (NHTSA). The primary objective of the survey was to collect trip-based data on the nature and characteristics of personal travel so that the relationships between the characteristics of personal travel and the demographics of the traveler can be established. Commercial and institutional travel was not part of the survey. New York State participated in the 2001 NHTS by procuring additional 12,000 sample households. These additional sample households allowed New York State to address transportation planning issues pertinent to geographic areas that are significantly smaller than what the national NHTS data allowed. The final sample size for New York State was 13,423 usable households. In this report, Oak Ridge National Laboratory (ORNL) identifies and analyzes differences, if any, in travel patterns that are attributable to demographic characteristics (e.g., gender, age, race and ethnicity), household characteristics (e.g., low income households, zero and one car households), modal characteristics and geographic location. Travel patterns of those who work at home are examined and compared to those of conventional workers, as well as those who do not work. Focus is given to trip frequency, travel by time of day, trip purpose, and mode choice. For example, included in this analysis is the mobility of the elderly population in New York State. The American society is undergoing a major demographic transformation that is resulting in a greater percentage of older individuals in the population. In addition to demographic changes, recent travel surveys show that an increasing number of older individuals are licensed to drive and that they drive more than their same age cohort did a decade ago. Cohort differences in driving are particularly apparent - not only are more of today's elderly population licensed to drive than their age cohort two decades ago, they also drive more. Equally important are the increase in immigration and in racial and cultural diversity. This report also discusses vehicle availability, socioeconomic characteristics, travel trends (e.g., miles travelled, distance driven, commute patterns), and the transportation accessibility of these populations. Specifically, this report addresses in detail the travel behavior of the following special populations: (1) the elderly, defined as those who were 65 years old or older, (2) low-income households, (3) ethnic groups and immigrants, and (4) those who worked at home.

Hu, Patricia S [ORNL; Reuscher, Tim [ORNL

2010-03-01T23:59:59.000Z

32

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

74 74 Number of trips 399 Distance traveled (mi) 148 Percent of total distance traveled (%) 73% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 6.3 Average Stops per mile 35.5 Percent of Regen Braking Energy Recovery (%) 11% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 423 Number of trips 27 Distance traveled (mi) 54 Percent of total distance traveled (%) 27% Average Trip Distance (mi) 2.0 Average Driving Speed (mph) 20.7 Average Stops per mile 3.5 Percent of Regen Braking Energy Recovery (%) 15% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 0 Number of trips 0 Distance traveled (mi) 0 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.0 Average Driving Speed (mph)

33

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 493 Distance traveled (mi) 189 Percent of total distance traveled (%) 38% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 4.9 Average Stops per mile 28.7 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 377 Number of trips 67 Distance traveled (mi) 275 Percent of total distance traveled (%) 56% Average Trip Distance (mi) 4.1 Average Driving Speed (mph) 17.9 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 438 Number of trips 1 Distance traveled (mi) 29 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 28.7 Average Driving Speed (mph)

34

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

505 505 Number of trips 601 Distance traveled (mi) 245 Percent of total distance traveled (%) 62% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.4 Average Stops per mile 34.8 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 373 Number of trips 35 Distance traveled (mi) 124 Percent of total distance traveled (%) 31% Average Trip Distance (mi) 3.5 Average Driving Speed (mph) 23.0 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 319 Number of trips 3 Distance traveled (mi) 25 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 8.5 Average Driving Speed (mph)

35

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

613 613 Number of trips 89 Distance traveled (mi) 9 Percent of total distance traveled (%) 30% Average Trip Distance (mi) 0.1 Average Driving Speed (mph) 7.0 Average Stops per mile 44.5 Percent of Regen Braking Energy Recovery (%) 9% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 8 Distance traveled (mi) 5 Percent of total distance traveled (%) 16% Average Trip Distance (mi) 0.6 Average Driving Speed (mph) 25.0 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 6% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 7 Distance traveled (mi) 16 Percent of total distance traveled (%) 54% Average Trip Distance (mi) 2.3 Average Driving Speed (mph)

36

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 1,610 Distance traveled (mi) 372 Percent of total distance traveled (%) 72% Average Trip Distance (mi) 0.2 Average Driving Speed (mph) 5.2 Average Stops per mile 32.1 Percent of Regen Braking Energy Recovery (%) 13% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 383 Number of trips 114 Distance traveled (mi) 144 Percent of total distance traveled (%) 28% Average Trip Distance (mi) 1.3 Average Driving Speed (mph) 18.3 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 16% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 549 Number of trips 5 Distance traveled (mi) 2 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.4 Average Driving Speed (mph)

37

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

530 530 Number of trips 1,308 Distance traveled (mi) 495 Percent of total distance traveled (%) 69% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.6 Average Stops per mile 31.4 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 471 Number of trips 91 Distance traveled (mi) 175 Percent of total distance traveled (%) 24% Average Trip Distance (mi) 1.9 Average Driving Speed (mph) 16.6 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 357 Number of trips 2 Distance traveled (mi) 49 Percent of total distance traveled (%) 7% Average Trip Distance (mi) 24.7 Average Driving Speed (mph)

38

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

39

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi)¹ 45 Overall DC electrical energy consumption (DC Wh/mi)² 22 Total number of trips 1,585 Total distance traveled (mi) 14,910 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 34 DC electrical energy consumption (DC Wh/mi) 49 Number of trips 883 Percent of trips city | highway 81% | 19% Distance traveled (mi) 4,778 Percent of total distance traveled 32%

40

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

4 4 Overall AC electrical energy consumption (AC Wh/mi)¹ 64 Overall DC electrical energy consumption (DC Wh/mi)² 31 Total number of trips 831 Total distance traveled (mi) 7,559 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 35 DC electrical energy consumption (DC Wh/mi) 54 Number of trips 541 Percent of trips city | highway 79% | 21% Distance traveled (mi) 3,402 Percent of total distance traveled 45%

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Travel Demand Modeling  

SciTech Connect

This chapter describes the principal types of both passenger and freight demand models in use today, providing a brief history of model development supported by references to a number of popular texts on the subject, and directing the reader to papers covering some of the more recent technical developments in the area. Over the past half century a variety of methods have been used to estimate and forecast travel demands, drawing concepts from economic/utility maximization theory, transportation system optimization and spatial interaction theory, using and often combining solution techniques as varied as Box-Jenkins methods, non-linear multivariate regression, non-linear mathematical programming, and agent-based microsimulation.

Southworth, Frank [ORNL; Garrow, Dr. Laurie [Georgia Institute of Technology

2011-01-01T23:59:59.000Z

42

PRICM 8: Housing and Travel  

Science Conference Proceedings (OSTI)

Please note that the Department of Homeland Security is implementing the Electronic System for Travel Authorization, which is expected to be mandatory for

43

1999 EMC: Travel Information - TMS  

Science Conference Proceedings (OSTI)

Jul 2, 1999 ... Travel by Train: Amtrak provides daily service from San Francisco and Los Angeles. The station is located in downtown Santa Barbara.

44

d. volunteer leader travel policy  

Science Conference Proceedings (OSTI)

the name of the event, who is attending, and a projected cost for budgetary purposes. The proposed volunteer leader travel budget will be approved by the...

45

Travel and Entertainment All Airlines  

E-Print Network (OSTI)

, Flying Fields Travel Agencies and Tour Operators Bridge and Road Fees, Tolls Services (Utilities) Wire Institutions Securities Brokers /Dealers Insurance Sales, Underwriting and Premiums Lodging Hotels, Motels

Castillo, Steven P.

46

Optimal distance separating halfspace  

E-Print Network (OSTI)

Plastria & Carrizosa / Optimal distance separating halfspace. 2. 1 Gauge Distance to a Hyperplane. Let ? be a gauge on Rd with unit ball B, i.e. B is a compact...

47

Distance in architecture  

E-Print Network (OSTI)

The document which follows represents an exploration of distance and its connection to architecture. This exploration is threefold. On one level it regards distance as an ontological question, researching for precedent ...

Criparacos, George C

1987-01-01T23:59:59.000Z

48

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

49

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

50

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

51

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

52

New York Household Travel Patterns: A Comparison Analysis  

SciTech Connect

In 1969, the U. S. Department of Transportation began collecting detailed data on personal travel to address various transportation planning issues. These issues range from assessing transportation investment programs to developing new technologies to alleviate congestion. This 1969 survey was the birth of the Nationwide Personal Transportation Survey (NPTS). The survey was conducted again in 1977, 1983, 1990 and 1995. Longer-distance travel was collected in 1977 and 1995. In 2001, the survey was renamed to the National Household Travel Survey (NHTS) and collected both daily and longer-distance trips in one survey. In addition to the number of sample households that the national NPTS/NHTS survey allotted to New York State (NYS), the state procured an additional sample of households in both the 1995 and 2001 surveys. In the 1995 survey, NYS procured an addition sample of more than 9,000 households, increasing the final NY NPTS sample size to a total of 11,004 households. Again in 2001, NYS procured 12,000 additional sample households, increasing the final New York NHTS sample size to a total of 13,423 households with usable data. These additional sample households allowed NYS to address transportation planning issues pertinent to geographic areas significantly smaller than for what the national NPTS and NHTS data are intended. Specifically, these larger sample sizes enable detailed analysis of twelve individual Metropolitan Planning Organizations (MPOs). Furthermore, they allowed NYS to address trends in travel behavior over time. In this report, travel data for the entire NYS were compared to those of the rest of the country with respect to personal travel behavior and key travel determinants. The influence of New York City (NYC) data on the comparisons of the state of New York to the rest of the country was also examined. Moreover, the analysis examined the relationship between population density and travel patterns, and the similarities and differences among New York MPOs. The 1995 and 2001 survey data make it possible to examine and identify travel trends over time. This report does not address, however, the causes of the differences and/or trends.

Hu, Patricia S [ORNL; Reuscher, Tim [ORNL

2007-05-01T23:59:59.000Z

53

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

54

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

55

PMP-III 2008: Travel - TMS  

Science Conference Proceedings (OSTI)

PMP-III: Travel. For Thailand and Bangkok travel information, visit the Tourism Authority of Thailand. AIRORT TRANSPORTATION. Public metered taxi is the...

56

TAKING A TRIP? Travel Management Contracts  

E-Print Network (OSTI)

to airline/rail reservations, hotel lodging, airport transportation, and car rentals. #12;TRAVEL MGMT, car rentals, incidentals. Improper usage examples include movies, utility bills, alcohol. Non travel

Zobin, Nahum

57

Stable operating regime for traveling wave devices  

DOE Patents (OSTI)

Autophase stability is provided for a traveling wave device (TWD) electron beam for amplifying an RF electromagnetic wave in walls defining a waveguide for said electromagnetic wave. An off-axis electron beam is generated at a selected energy and has an energy noise inherently arising from electron gun. The off-axis electron beam is introduced into the waveguide. The off-axis electron beam is introduced into the waveguide at a second radius. The waveguide structure is designed to obtain a selected detuning of the electron beam. The off-axis electron beam has a velocity and the second radius to place the electron beam at a selected distance from the walls defining the waveguide, wherein changes in a density of the electron beam due to the RF electromagnetic wave are independent of the energy of the electron beam to provide a concomitant stable operating regime relative to the energy noise.

Carlsten, Bruce E. (Los Alamos, NM)

2000-01-01T23:59:59.000Z

58

Globular Cluster Distance Determinations  

E-Print Network (OSTI)

The present status of the distance scale to Galactic globular clusters is reviewed. Six distance determination techniques which are deemed to be most reliable are discussed in depth. These different techniques are used to calibrate the absolute magnitude of the RR Lyrae stars. The various calibrations fall into three groups. Main sequence fitting using Hipparcos parallaxes, theoretical HB models and the RR Lyrae in the LMC all favor a bright calibration, implying a `long' globular cluster distance scale. White dwarf fitting and the astrometric distances yield a somewhat fainter RR Lyrae calibration, while the statistical parallax solution yields faint RR Lyrae stars implying a `short' distance scale to globular clusters. Various secondary distance indicators discussed all favor the long distance scale. The `long' and `short' distance scales differ by (0.31+/-0.16) mag. Averaging together all of the different distance determinations yields Mv(RR) = (0.23+/-0.04)([Fe/H] + 1.6) + (0.56+/-0.12) mag.

Brian Chaboyer

1998-08-19T23:59:59.000Z

59

A Quantum Mechanical Travelling Salesman  

E-Print Network (OSTI)

A quantum simulation of a travelling salesman is described. A vector space for a graph is defined together with a sequence of operators which transform a special initial state into a superposition states representing Hamiltonian tours. The quantum amplitude for any tour is a function of the classical cost of travelling along the edges in that tour. Tours with the largest quantum amplitude may be different than those with the smallest classically-computed cost.

Ravindra N. Rao

2011-08-23T23:59:59.000Z

60

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

6 6 Overall AC electrical energy consumption (AC Wh/mi) 175 Average Trip Distance 12.2 Total distance traveled (mi) 272,366 Average Ambient Temperature (deg F) 54.1 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 368 Distance traveled (mi) 129,389 Percent of total distance traveled 47.5% Average driving style efficiency (distance weighted)¹ 75% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.0 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 142,977 Percent of total distance traveled 52.4% Average driving style efficiency (distance weighted)¹ 77% City³ Highway³ Percent of miles in EV operation (%) 65.1% 31.1% Percent Number of trips 85.5% 14.5% Average trip distance (mi)

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

4.8 4.8 Overall AC electrical energy consumption (AC Wh/mi) 185 Average Trip Distance 13.1 Total distance traveled (mi) 208,165 Average Ambient Temperature (deg F) 77.6 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 369 Distance traveled (mi) 104,687 Percent of total distance traveled 50.3% Average driving style efficiency (distance weighted)¹ 87% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 37.2 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 103,478 Percent of total distance traveled 49.7% Average driving style efficiency (distance weighted)¹ 82% City³ Highway³ Percent of miles in EV operation (%) 69.8% 33.9% Percent Number of trips 85.0% 15.0% Average trip distance (mi)

62

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

2.5 2.5 Overall AC electrical energy consumption (AC Wh/mi) 166 Average Trip Distance 12.1 Total distance traveled (mi) 385,849 Average Ambient Temperature (deg F) 78.2 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 332 Distance traveled (mi) 193,336 Percent of total distance traveled 50.1% Average driving style efficiency (distance weighted)¹ 85% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.2 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 192,512 Percent of total distance traveled 49.9% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 67.2% 31.5% Percent Number of trips 86.7% 13.3% Average trip distance (mi)

63

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

7.8 7.8 Overall AC electrical energy consumption (AC Wh/mi) 180 Average Trip Distance 12.8 Total distance traveled (mi) 346,409 Average Ambient Temperature (deg F) 51.5 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 384 Distance traveled (mi) 161,982 Percent of total distance traveled 46.8% Average driving style efficiency (distance weighted)¹ 74% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.1 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 184,427 Percent of total distance traveled 53.2% Average driving style efficiency (distance weighted)¹ 76% City³ Highway³ Percent of miles in EV operation (%) 63.8% 28.4% Percent Number of trips 85.7% 14.3% Average trip distance (mi)

64

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Overall AC electrical energy consumption (AC Wh/mi) 174 Average Trip Distance 12.6 Total distance traveled (mi) 1,243,988 Average Ambient Temperature (deg F) 63.2 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 352 Distance traveled (mi) 615,161 Percent of total distance traveled 49.5% Average driving style efficiency (distance weighted)¹ 80% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.4 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 628,828 Percent of total distance traveled 50.5% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.8% 31.7% Percent Number of trips 85.5% 14.5% Average trip distance (mi)

65

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

71.0 71.0 Overall AC electrical energy consumption (AC Wh/mi) 169 Average Trip Distance 12.5 Total distance traveled (mi) 1,661,080 Average Ambient Temperature (deg F) 67.1 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 340 Distance traveled (mi) 826,775 Percent of total distance traveled 49.8% Average driving style efficiency (distance weighted)¹ 81% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.7 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 834,306 Percent of total distance traveled 50.2% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.9% 31.6% Percent Number of trips 85.8% 14.2% Average trip distance (mi)

66

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi) 170 Average Trip Distance 12.4 Total distance traveled (mi) 2,041,556 Average Ambient Temperature (deg F) 64.4 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 345 Distance traveled (mi) 1,002,495 Percent of total distance traveled 49.1% Average driving style efficiency (distance weighted)¹ 80% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 1,039,061 Percent of total distance traveled 50.9% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.2% 31.0% Percent Number of trips 86.0% 14.0% Average trip distance (mi)

67

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

1.1 1.1 Overall AC electrical energy consumption (AC Wh/mi) 182 Average Trip Distance 11.8 Total distance traveled (mi) 355,058 Average Ambient Temperature (deg F) 46.0 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 416 Distance traveled (mi) 155,080 Percent of total distance traveled 43.7% Average driving style efficiency (distance weighted)¹ 69% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 34.4 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 199,978 Percent of total distance traveled 56.3% Average driving style efficiency (distance weighted)¹ 74% City³ Highway³ Percent of miles in EV operation (%) 60.5% 27.0% Percent Number of trips 86.3% 13.7% Average trip distance (mi)

68

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

6.6 6.6 Overall AC electrical energy consumption (AC Wh/mi) 171 Average Trip Distance 11.9 Total distance traveled (mi) 370,316 Average Ambient Temperature (deg F) 53.8 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 371 Distance traveled (mi) 170,860 Percent of total distance traveled 46.1% Average driving style efficiency (distance weighted)¹ 75% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 199,456 Percent of total distance traveled 53.9% Average driving style efficiency (distance weighted)¹ 77% City³ Highway³ Percent of miles in EV operation (%) 63.2% 28.1% Percent Number of trips 86.7% 13.3% Average trip distance (mi)

69

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi) 157 Average Trip Distance 12.3 Total distance traveled (mi) 407,245 Average Ambient Temperature (deg F) 67.9 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 338 Distance traveled (mi) 189,426 Percent of total distance traveled 46.5% Average driving style efficiency (distance weighted)¹ 82% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.5 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 217,819 Percent of total distance traveled 53.5% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 65.2% 28.3% Percent Number of trips 86.5% 13.5% Average trip distance (mi)

70

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

73.7 73.7 Overall AC electrical energy consumption (AC Wh/mi) 170 Average Trip Distance 12.6 Total distance traveled (mi) 370,987 Average Ambient Temperature (deg F) 71.0 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 341 Distance traveled (mi) 185,282 Percent of total distance traveled 49.9% Average driving style efficiency (distance weighted)¹ 83% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 185,705 Percent of total distance traveled 50.1% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 68.0% 32.4% Percent Number of trips 85.4% 14.6% Average trip distance (mi)

71

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

72

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

73

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

74

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

75

Solar Decathlon 2013: Going the Distance | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Going the Distance Going the Distance Solar Decathlon 2013: Going the Distance September 17, 2013 - 4:26pm Addthis Toggle Routes on/off Return to map → Solar Decathlon Journeys Visualizing the distances that each Solar Decathlon house travelled Click competitors to toggle their journeys on and off. All routes and distances are approximate. Rebecca Matulka Rebecca Matulka Digital Communications Specialist, Office of Public Affairs Solar Decathlon 2013: In our new blog series, we're going behind the scenes to show you what it takes to compete in the Solar Decathlon. First up: Meet the teams competing this year and learn how they were selected. Part two looks at how the teams must master the art of fundraising. What does it take to design an energy-efficient, solar-powered house? Part three looks at creating a winning design.

76

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

77

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

with battery state of charge below 90% (for charging events with SOC reported) Vehicle Usage Number of trips 3,364 Total distance traveled (mi) 21,706 Avg trip distance (mi) 5.8...

78

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

45 45 Overall DC electrical energy consumption (DC Wh/mi)² 29 Total number of trips 1,839 Total distance traveled (mi) 21,089 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 61 Number of trips 654 Percent of trips city | highway 66% | 34% Distance traveled (mi) 5,717 Percent of total distance traveled 27% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 38 DC electrical energy consumption (DC Wh/mi) 57 Number of trips 117 Percent of trips city | highway 39% | 62% Distance traveled (mi) 3,683 Percent of total distance traveled 17% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 33 Number of trips 1,068 Percent of trips city | highway 71% | 30% Distance traveled (mi)

79

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

36 36 Overall DC electrical energy consumption (DC Wh/mi)² 18 Total number of trips 1,290 Total distance traveled (mi) 13,023 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 58 Number of trips 432 Percent of trips city | highway 75% | 25% Distance traveled (mi) 2,835 Percent of total distance traveled 22% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 41 DC electrical energy consumption (DC Wh/mi) 48 Number of trips 52 Percent of trips city | highway 31% | 69% Distance traveled (mi) 1,613 Percent of total distance traveled 12% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips 806 Percent of trips city | highway 73% | 27% Distance traveled (mi)

80

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

49 49 Overall DC electrical energy consumption (DC Wh/mi)² 27 Total number of trips 927 Total distance traveled (mi) 9,301 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 66 Number of trips 313 Percent of trips city | highway 68% | 32% Distance traveled (mi) 2,138 Percent of total distance traveled 23% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 41 DC electrical energy consumption (DC Wh/mi) 63 Number of trips 46 Percent of trips city | highway 30% | 70% Distance traveled (mi) 1,462 Percent of total distance traveled 16% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips 568 Percent of trips city | highway 75% | 25% Distance traveled (mi)

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

50 50 Overall DC electrical energy consumption (DC Wh/mi)² 22 Total number of trips 730 Total distance traveled (mi) 9,164 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 40 DC electrical energy consumption (DC Wh/mi) 61 Number of trips 225 Percent of trips city | highway 68% | 32% Distance traveled (mi) 1,768 Percent of total distance traveled 19% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 36 DC electrical energy consumption (DC Wh/mi) 53 Number of trips 40 Percent of trips city | highway 23% | 78% Distance traveled (mi) 1,638 Percent of total distance traveled 18% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 35 Number of trips 465 Percent of trips city | highway 70% | 30% Distance traveled (mi)

82

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

53 53 Overall DC electrical energy consumption (DC Wh/mi)² 34 Total number of trips 1,515 Total distance traveled (mi) 15,617 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 37 DC electrical energy consumption (DC Wh/mi) 65 Number of trips 739 Percent of trips city | highway 74% | 26% Distance traveled (mi) 4,915 Percent of total distance traveled 31% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 38 DC electrical energy consumption (DC Wh/mi) 58 Number of trips 93 Percent of trips city | highway 38% | 62% Distance traveled (mi) 2,842 Percent of total distance traveled 18% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 33 Number of trips 683 Percent of trips city | highway 72% | 28% Distance traveled (mi)

83

Evaluation of an Urban Travel Training for Older Adults  

E-Print Network (OSTI)

of life. Travel training programs designed to increaseevaluation of a travel training program that educated olderservices. Travel training programs that instruct older

Babka, Rhianna JoIris; Cooper, Jill F.; Ragland, David R.

2009-01-01T23:59:59.000Z

84

DOE Tribal Leader Solar Energy Forum - Travel Fact Sheet | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tribal Leader Solar Energy Forum - Travel Fact Sheet DOE Tribal Leader Solar Energy Forum - Travel Fact Sheet Travel Fact Sheet Palm Springs Dec 2011.pdf More Documents &...

85

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

9 4876 47783 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 59 2317 11750 Percent of trips city highway Percent of total distance traveled 24.59% 81.00%...

86

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

7 3902 45779 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 57 1758 8306 Percent of trips city highway Percent of total distance traveled 18.15% 85.00% 15.00%...

87

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

500 79963 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 70 3596 17063 Percent of trips city highway Percent of total distance traveled 21.3% 86.4% 13.6% ...

88

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

731 77160 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 69 3809 16711 Percent of trips city highway Percent of total distance traveled 21.7% 86.8% 13.2% ...

89

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

90

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

91

Traveling Between Iranian and American Identities  

E-Print Network (OSTI)

D aily life in Shiraz, Iran Traveling Between Iranian andpudding (samanu) symbolic of Irans 2000-year-old culturalwriters and my travels to Iran during the past summer. As an

Pazargadi, Leila

2007-01-01T23:59:59.000Z

92

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi)¹ 111 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 61 Total number of trips 1,135 Total distance traveled (mi) 4,408 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 296 Number of trips 264 Percent of trips city | highway 100% | 0% Distance traveled (mi) 781 Percent of total distance traveled 18% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 19 DC electrical energy consumption (DC Wh/mi) 141 Number of trips 44 Percent of trips city | highway 96% | 4% Distance traveled CD | CS (mi) 333 | 389 Percent of total distance traveled CD | CS

93

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 Overall AC electrical energy consumption (AC Wh/mi)¹ 93 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 40 Total number of trips 11,047 Total distance traveled (mi) 119,879 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 25 DC electrical energy consumption (DC Wh/mi) 208 Number of trips 4,491 Percent of trips city | highway 92% | 8% Distance traveled (mi) 30,376 Percent of total distance traveled 25% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 71 Number of trips 1,352 Percent of trips city | highway 69% | 31% Distance traveled CD | CS (mi) 12,772 | 20,001 Percent of total distance traveled CD | CS

94

Creating a Virtual HVAC Laboratory for Continuing/Distance Education  

E-Print Network (OSTI)

Facilities engineering is one technical field where lab-based continuing education programs can be delivered in a distance learning format. The widespread use of computer controls for optimizing the efficiency of a building's mechanical and electrical systems has made the "distance" element possible. Rather than traveling to individual buildings to make pressure, temperature, and flow measurements in person, facility engineers routinely access performance data over the Internet. This networking capability has been used in an educational setting to deliver interactive technical training to large numbers of undergraduate students and professional facilities engineers. Many students can access real time data from a single piece of HVAC equipment over the Internet.

William J. Hutzel

2001-01-01T23:59:59.000Z

95

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

96

Approximating geodesic tree distance  

Science Conference Proceedings (OSTI)

Billera, Holmes, and Vogtmann introduced an intriguing new phylogenetic tree metric for weighted trees with useful properties related to statistical analysis. However, the best known algorithm for calculating this distance is exponential in the number ... Keywords: Analysis of algorithms, Phylogeny, Tree metric

Nina Amenta; Matthew Godwin; Nicolay Postarnakevich; Katherine St. John

2007-07-01T23:59:59.000Z

97

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

98

Plasma Colloquium Travel Grant Program  

SciTech Connect

OAK B188 Plasma Colloquium Travel Grant Program. The purpose of the Travel Grant Program is to increase the awareness of plasma research. The new results and techniques of plasma research in fusion plasmas, plasma processing space plasmas, basic plasma science, etc, have broad applicability throughout science. The benefits of these results are limited by the relatively low awareness and appreciation of plasma research in the larger scientific community. Whereas spontaneous interactions between plasma scientists and other scientists are useful, a focused effort in education and outreach to other scientists is efficient and is needed. The academic scientific community is the initial focus of this effort, since that permits access to a broad cross-section of scientists and future scientists including undergraduates, graduate students, faculty, and research staff.

Hazeltine, R.D.

1998-09-14T23:59:59.000Z

99

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

100

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Travel  

Science Conference Proceedings (OSTI)

... Train - Amtrak runs to the Rockville and Union Station stops, from which you can get on the Metro and take the Red line to Shady Grove, from which ...

2013-03-23T23:59:59.000Z

102

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 Overall AC electrical energy consumption (AC Wh/mi)¹ 148 Overall DC electrical energy consumption (DC Wh/mi)² 104 Total number of trips 1,212 Total distance traveled (mi) 11,846 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 58 DC electrical energy consumption (DC Wh/mi) 160 Number of trips 823 Percent of trips city | highway 81% | 19% Distance traveled (mi) 5,559 Percent of total distance traveled 47% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 46 DC electrical energy consumption (DC Wh/mi) 85 Number of trips 195 Percent of trips city | highway 40% | 61% Distance traveled (mi) 4,217 Percent of total distance traveled 36% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips

103

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Usage Usage Overall fuel economy (mpg) 139 Overall electrical energy consumption (AC Wh/mi) 293 Number of trips¹ 76,425 Total distance traveled (mi) 609,737 Avg trip distance (mi) 8.0 Avg distance traveled per day when the vehicle was driven (mi) 36.4 Avg number of trips between charging events 3.0 Avg distance traveled between charging events (mi) 24.1 Avg number of charging events per day when the vehicle was driven 1.5

104

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 14% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 380 Number of trips 106 Distance traveled (mi) 237 Percent...

105

EnergyCS Prius Altairnano 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...

106

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 15% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 414 Number of trips 152 Distance traveled (mi) 131 Percent...

107

EnergyCS Prius Valence 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...

108

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 15% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 410 Number of trips 94 Distance traveled (mi) 307 Percent of...

109

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

through December 2012 Vehicle Usage Overall fuel economy (mpg) 126 Overall electrical energy consumption (AC Whmi) 229 Number of trips 369,118 Total distance traveled (mi)...

110

Greenhouse Earth: A Traveling Exhibition  

SciTech Connect

The Franklin Institute Science Museum provided an exhibit entitled the Greenhouse Earth: A Traveling Exhibition. This 3500 square-foot exhibit on global climate change was developed in collaboration with the Association of Science-Technology Centers. The exhibit opened at The Franklin Institute on February 14, 1992, welcoming 291,000 visitors over its three-month stay. During its three-year tour, Greenhouse Earth will travel to ten US cities, reaching two million visitors. Greenhouse Earth aims to deepen public understanding of the scientific issues of global warming and the conservation measures that can be taken to slow its effects. The exhibit features hands-on exhibitry, interactive computer programs and videos, a theater production, a demonstration cart,'' guided tours, and lectures. supplemental educational programs at the Institute included a teachers preview, a symposium on climate change, and a satellite field trip.'' The development of Greenhouse Earth included front-end and formative evaluation procedures. Evaluation includes interviews with visitors, prototypes, and summative surveys for participating museums. During its stay in Philadelphia, Greenhouse Earth was covered by the local and national press, with reviews in print and broadcast media. Greenhouse Earth is the first large-scale museum exhibit to address global climate change.

Booth, W.H.; Caesar, S.

1992-09-01T23:59:59.000Z

111

Is Interstellar Space Travel Possible?  

E-Print Network (OSTI)

It is shown that space travel, even in the most distant future, will remain confined to our own planetary system, and a similar conclusion will hold forth for any other civilization, no matter how advanced it might be, unless those extra-terrestrial species have life spans order of magnitude longer than ours. Even in such a case it is unlikely that they will travel much farther than their immediate stellar neighbourhood, as each such excursion will exhaust the resources of their home planet so much that those will dwindle rather fast and there might not be much left for the further scientific and technological advancements. So the science-fiction fancy of a "Galactic Empire" may ever remain in our fantasies only. And as for the mythical UFOs, whose quiet appearances do get reported in the press once in a while, recent explorations have shown no evidence that any such thing could have an origination within our own solar system itself. And a "quiet trip" back and forth from a distant star is almost impossible a...

Singal, Tanmay

2013-01-01T23:59:59.000Z

112

2003 TMS Annual Meeting: Travel Information  

Science Conference Proceedings (OSTI)

This service accesses all major airlines and Amtrak. Public buses, trolleys, and coasters provide transportation throughout the city and county with travel to and...

113

Structural Equation Modeling For Travel Behavior Research  

E-Print Network (OSTI)

variables. However, car usage was found to be complementaryconcerning reductions in car usage, and feelings related toPre-commitment and usage: Season tickets, cars and travel.

Golob, Thomas F.

2001-01-01T23:59:59.000Z

114

Structural Equation Modeling for Travel Behavior Research  

E-Print Network (OSTI)

variables. However, car usage was found to be complementaryconcerning reductions in car usage, and feelings related toPre-commitment and usage: Season tickets, cars and travel.

Golob, Thomas F.

2001-01-01T23:59:59.000Z

115

Structural Equation Modeling For Travel Behavior Research  

E-Print Network (OSTI)

variables. However, car usage was found to be complementaryconcerning reductions in car usage, and feelings related toPre-commitment and usage: Season tickets, cars and travel.

Golob, Thomas F.

2011-01-01T23:59:59.000Z

116

Travel Resources | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

Travel Resources Home > About Us > Our Programs > Defense Programs > Future Science & Technology Programs > Office of Advanced Simulation and Computing Institutional Research...

117

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

118

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

119

Non-Motorized Travel Study.pub  

NLE Websites -- All DOE Office Websites (Extended Search)

Motorized Travel Study: Motorized Travel Study: Identifying Factors that Influence Communities to Walk and Bike and to Examine Why, or Why Not, Travelers Walk and Bike in Their Communities Oak Ridge National Laboratory managed by UT-Battelle, LLC for the U.S. Department of Energy under Contract number DE-AC05-00OR22725 Research Areas Freight Flows Passenger Flows Supply Chain Efficiency Transportation: Energy Environment Safety Security Vehicle Technologies Research Brief T he idea of livable communities suggests that people should have the option to utilize non-motorized travel (NMT), specifically walking and bicycling, to conduct their daily tasks. Forecasting personal travel by walk and bike is necessary as part of regional transportation planning, and requires fine

120

TRAVEL POLICY AND UMBC #VIII-11.00.01  

E-Print Network (OSTI)

be utilized whenever possible for airline, train or bus tickets as well as hotel accommodations and car Reimbursements Ticketing Hotel Reservations Meals Travel by Car Travel by Private Airplane Travel Advances

Maryland, Baltimore County, University of

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

122

Professional Preface, 8 (2): Traveling to Seattle! - TMS  

Science Conference Proceedings (OSTI)

Traveling to Seattle! TMS and its technical divisions are proud to again offer the Student Travel Scholarship Program. Three technical divisions, Electronic,...

123

Secretary Chu and Energy Department Officials to Travel Across...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Travel Across America to Discuss the Obama Administration's Commitment to Energy Innovation and Manufacturing Secretary Chu and Energy Department Officials to Travel Across America...

124

Rural Schools and Distance Education  

Science Conference Proceedings (OSTI)

In 2006, the author began research on current issues in rural education in which teachers recounted narratives of teaching. As deficits, they spoke of an inability to retain teachers, too little diversity in student programming, and lack of access to ... Keywords: Distance Education, Distance Education Technologies, Educational Technology, Rural Schools, Teacher Practices

Barbara G. Barter

2011-01-01T23:59:59.000Z

125

Travel Resources | National Nuclear Security Administration  

NLE Websites -- All DOE Office Websites (Extended Search)

Travel Resources | National Nuclear Security Administration Travel Resources | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog The National Nuclear Security Administration Travel Resources Home > About Us > Our Programs > Defense Programs > Future Science & Technology Programs > Office of Advanced Simulation and Computing and Institutional R&D Programs > Russia Tri-Lab S&T Collaborations > Travel

126

'Fun with Science' travels north to Alaska  

NLE Websites -- All DOE Office Websites (Extended Search)

312science 12132012 'Fun with Science' travels north to Alaska Linda A Lucchetti, LLNL, (925) 422-5815, lucchetti1@llnl.gov Printer-friendly Students in Noorvik, Alaska...

127

TrojanTravel2014 Mystical Bhutan  

E-Print Network (OSTI)

SCierge Service .....24 Attention Crystal Cruisers ..............24 University Travel Disclaimer ............ 25 in russia's Far east and the Aleutian Islands. our other trips include an Amazon river cruise, a month

Zhou, Chongwu

128

The domestic travel sector in China  

E-Print Network (OSTI)

China is already the largest domestic tourism market in the world. Chinese citizens made as many as 800 million overnight domestic trips in 2005. While travel is not a new concept in China, the disposable income they wield, ...

Anders, Jeff, M.B.A. Massachusetts Institute of Technology

2007-01-01T23:59:59.000Z

129

2002 TMS Annual Meeting & Exhibition: Travel Information  

Science Conference Proceedings (OSTI)

It is one of five stops along the electric bus tunnel that serves downtown Seattle. ... Washington State Convention & Trade Center (~1.11 Mb); Sheraton Seattle ... These special rates are applicable for travel from the continental United States.

130

Chapter 3. Vehicle-Miles Traveled  

U.S. Energy Information Administration (EIA) Indexed Site

3. Vehicle-Miles Traveled 3. Vehicle-Miles Traveled Chapter 3. Vehicle-Miles Traveled Vehicle-miles traveled--the number of miles that residential vehicles are driven--is probably the most important information collected by the Residential Transportation Energy Consumption Survey. Using the data on vehicle-miles traveled allows analysts to answer such questions as: "Are minivans driven more than passenger cars?" "Do people in the West drive more than people elsewhere?" "Do people conserve their new cars by driving them less?" "Who drives more--people in households with children, or other people?" "At what ages do people drive the most?" "How does growing income affect the amount of driving?" In addition to answering those kinds of questions, analysts also use the number of vehicle-miles traveled to compute estimated, on-road vehicle fuel consumption, economy, and expenditures, all of which have important implications for U.S. energy policy and national security (see Chapter 4).

131

DOE O 551.1D, Official Foreign Travel  

Directives, Delegations, and Requirements

The order establishes requirements and responsibilities governing official foreign travel by Federal and contractor employees.

2012-04-02T23:59:59.000Z

132

Alternative Fuels Data Center: State Employee Travel Policy  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

State Employee Travel State Employee Travel Policy to someone by E-mail Share Alternative Fuels Data Center: State Employee Travel Policy on Facebook Tweet about Alternative Fuels Data Center: State Employee Travel Policy on Twitter Bookmark Alternative Fuels Data Center: State Employee Travel Policy on Google Bookmark Alternative Fuels Data Center: State Employee Travel Policy on Delicious Rank Alternative Fuels Data Center: State Employee Travel Policy on Digg Find More places to share Alternative Fuels Data Center: State Employee Travel Policy on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type State Employee Travel Policy All state agencies and institutions must develop and adopt travel policies that include strategies to reduce petroleum consumption, such as carpooling

133

Identify Strategies to Reduce Business Travel for Greenhouse Gas Mitigation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Strategies to Reduce Business Travel for Greenhouse Gas Strategies to Reduce Business Travel for Greenhouse Gas Mitigation Identify Strategies to Reduce Business Travel for Greenhouse Gas Mitigation October 7, 2013 - 1:34pm Addthis YOU ARE HERE The tables below illustrate some of the more common strategies that can enable employees to travel less and travel more efficiently for business. The "Purpose of Travel" analysis in the previous step can be used with the guidance below to help determine what type of trips may be most appropriately substituted with each business travel alternative. Table 1. Strategies that Enable Employees to Travel Less Business Travel Strategy Best Potential Application Best Practices Web meetings/webinars, including option for video Purpose of travel: training, conferences.

134

Characteristics of Travellers from Bosnia and Herzegovina to Africa  

E-Print Network (OSTI)

Introduction: Travellers from Bosnia and Herzegovina (B&H) travel to different world countries. The awareness of people is changing every day and nowadays travellers seek advices related to their travel and destination more often than before. In the previous years, travellers came to Travel Clinics almost only to get the vaccines which were obligatory for entry into a country. In B&H travel clinics are a part of public health institutes. The largest Travel Clinic which provides service for the highest number of travellers is in the Public Health Institute of Sarajevo Canton, in the city of Sarajevo, which is the capital of B&H. In the last years we have seen an increasing interest for travel to Africa because the highest number of

unknown authors

2013-01-01T23:59:59.000Z

135

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

136

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

137

About Carlson Wagonlit Travel (CWT) CWT is a global leader specialized in managing business travel and  

E-Print Network (OSTI)

AT&T network for consistent, high-quality voice and data communication. Home-based travel counselors&T remote access service connects home-based travel counselors to the CWT global network · Business Value Reliable connections enable cost-effective, customer- pleasing home-based work while handling traffic

Greenberg, Albert

138

An investigation of the information needs of air passengers traveling to the airport  

E-Print Network (OSTI)

According to the U.S. Department of Transportation, Bureau of Transportation Statistics, nearly 200 million person-trips over 100 miles one-way were taken by airplane in 1995, a 186 percent increase since 1977 (Bureau of Transportation Statistics, 1998). As the popularity of air travel continues to increase, the number of trips to and from the airport will inevitably rise also. Passengers will need accurate information about all modes on a total trip basis. This includes the modes of access to and from the airport in addition to the long distance segment of the trip (Sverdrup & Parcel Consultants, Inc., et al., 1996). The purpose of this study was to determine the specific information needs of departing air travelers with regard to the pre-trip and en-route phases of their trip to the airport. Based on the results of this research, effective plans for providing supplementary information in support of ground-side travel can be developed by local, state, and national agencies. To gain an understanding of air passenger information needs, personal interviews were conducted with 216 passengers at George Bush Intercontinental Airport in Houston, Texas. One major finding from this research was that in general, passengers are content with the existing types of real-time travel information that are available. Specifically, the survey results showed that passengers currently use and would prefer to have access to flight information including, confirmed schedules, flight delays, and gate assignments. It was also found that most passengers would prefer to receive travel information earlier in their trip (i.e., before beginning their trip). This could possibly be so that they have the information earlier in their decision-making process and thus would have adequate time to evaluate their options. Finally, based on the survey results, air passengers indicated they would prefer to use e-mail, pagers, telephones, and the Internet when making future travel information inquiries. In particular, business travelers were found to have a higher affinity toward e-mail and pagers, while younger travelers simply preferred newer technologies to receive travel information. As a result, these population categories are prime targets for marketing of information services. Overall, each of these findings was similar to and backed up the results from previous studies.

Burdette, Debra Arlene

2000-01-01T23:59:59.000Z

139

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

140

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

142

Enabling time travel for the scholarly web  

NLE Websites -- All DOE Office Websites (Extended Search)

Enabling time travel for the scholarly web Enabling time travel for the scholarly web Enabling time travel for the scholarly web An international team of information scientists has begun a study to investigate how web links in scientific and other academic articles fail to lead to the resources being referenced. July 16, 2013 Herbert Van de Sompel, a Los Alamos National Laboratory information scientist, describes the information pathway involved in preventing "reference rot" in scientific material linked to the web. Herbert Van de Sompel, a Los Alamos National Laboratory information scientist, describes the information pathway involved in preventing "reference rot" in scientific material linked to the web. Contact Nancy Ambrosiano Communications Office (505) 667-0471 Email "Increasingly, scientific papers contain links to web pages containing,

143

Travelling waves in hybrid chemotaxis models  

E-Print Network (OSTI)

Hybrid models of chemotaxis combine agent-based models of cells with partial differential equation models of extracellular chemical signals. In this paper, travelling wave properties of hybrid models of bacterial chemotaxis are investigated. Bacteria are modelled using an agent-based (individual-based) approach with internal dynamics describing signal transduction. In addition to the chemotactic behaviour of the bacteria, the individual-based model also includes cell proliferation and death. Cells consume the extracellular nutrient field (chemoattractant) which is modelled using a partial differential equation. Mesoscopic and macroscopic equations representing the behaviour of the hybrid model are derived and the existence of travelling wave solutions for these models is established. It is shown that cell proliferation is necessary for the existence of non-transient (stationary) travelling waves in hybrid models. Additionally, a numerical comparison between the wave speeds of the continuum models and the hybr...

Franz, Benjamin; Painter, Kevin J; Erban, Radek

2013-01-01T23:59:59.000Z

144

Nano Portfolio student travel award guidelines 1. Travel grants will be made up to $1,000 for conference travel, including  

E-Print Network (OSTI)

Nano Portfolio student travel award guidelines 1. Travel grants will be made up to $1 for either a poster or oral presentation at the conference. 6. The research to be presented must be nano will not be considered. 10.Travel awards will be decided by a committee of CNM-affiliated faculty. #12;Nano Portfolio

Ben-Yakar, Adela

145

Nano Portfolio student travel award guidelines 1. Travel grants will be made up to $1,000 for conference travel, including  

E-Print Network (OSTI)

Nano Portfolio student travel award guidelines 1. Travel grants will be made up to $1. The research to be presented must be nano-related. 7. The award cannot be used to subsidize conference travel: ____________________________ Department: ___________________ Years in graduate school: __________________ Years in Nano Doctoral Por

Ben-Yakar, Adela

146

Greenhouse Gas Mitigation Planning for Business Travel | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Business Travel Business Travel Greenhouse Gas Mitigation Planning for Business Travel October 7, 2013 - 1:20pm Addthis Business travel is among the largest sources of Scope 3 greenhouse gas (GHG) emissions accounted for by Federal agencies. For some agencies, business travel can represent up to 60% of Scope 3 emissions, but represents about 20% of Scope 3 emissions for the Federal sector as whole. While other emissions categories have been the focus of efficiency improvements for several years, few agencies have been actively planning to manage business travel for GHG reduction purposes. Travel management due to budgetary constraints has typically been more common for Federal agencies in the past. Because air travel emissions are the biggest source of travel emissions for most agencies, this guidance focuses on planning for

147

Road less traveled vital to operational success  

Science Conference Proceedings (OSTI)

PNNL's Monthly Economic Diversity column for the Tri-City Herald Business section. Excerpt follows: Things aren't always what they seem. Sometimes the path less traveled--although it can be exhausting if not scary to think about navigating its unknowns--really is the best way to go. And not just because Robert Frost said so. Patric Sazama, Regional Project Director for Impact Washington, would agree as well. He recently spoke to the Three Rivers Entrepreneur Network about achieving operational success by addressing the less tangible elements of an organization, the company's own less traveled path.

Madison, Alison L.

2012-01-08T23:59:59.000Z

148

Random Distances Associated with Rhombuses  

E-Print Network (OSTI)

Parallelograms are one of the basic building blocks in two-dimensional tiling. They have important applications in a wide variety of science and engineering fields, such as wireless communication networks, urban transportation, operations research, etc. Different from rectangles and squares, the coordinates of a random point in parallelograms are no longer independent. As a case study of parallelograms, the explicit probability density functions of the random Euclidean distances associated with rhombuses are given in this report, when both endpoints are randomly distributed in 1) the same rhombus, 2) two parallel rhombuses sharing a side, and 3) two rhombuses having a common diagonal, respectively. The accuracy of the distance distribution functions is verified by simulation, and the correctness is validated by a recursion and a probabilistic sum. The first two statistical moments of the random distances, and the polynomial fit of the density functions are also given in this report for practical uses.

Yanyan Zhuang; Jianping Pan

2011-06-07T23:59:59.000Z

149

Water-to-Cement Distance Analysis Software  

Science Conference Proceedings (OSTI)

Water-to-Cement Distance Analysis Software. Description/Summary: ... Type of software: Analysis Software of Water-to-Cement Distance Analysis. ...

2013-06-11T23:59:59.000Z

150

Academic Strategies for Distance Education  

Science Conference Proceedings (OSTI)

Education all over the world is of paramount importance as it provides economies with opportunities for development and growth. Education is important for both-developed and developing economies-for the former to maintain their lead position and for ... Keywords: Academic, Distance Education, Education, Knowledge, Learning, Quality, Standards, Strategies

Neeta Baporikar

2012-07-01T23:59:59.000Z

151

Distance indexing on road networks  

Science Conference Proceedings (OSTI)

The processing of kNN and continuous kNN queries on spatial network databases (SNDB) has been intensively studied recently. However, there is a lack of systematic study on the computation of network distances, which is the most fundamental difference ...

Haibo Hu; Dik Lun Lee; Victor C. S. Lee

2006-09-01T23:59:59.000Z

152

Transmission line protection based on travelling waves  

Science Conference Proceedings (OSTI)

Major problem of tripping signal of a relay based on steady state component does not warranty faster tripping schemes for protection of extra high voltage transmission lines. Proposed work has made an attempt to find solution to the problem of fault ... Keywords: postfault voltage, relaying signals, surge impedence, transmission line protection, travelling waves

Anuradha S. Deshpande; Grishma S. Shah

2011-12-01T23:59:59.000Z

153

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

Total number of trips 46 17088 152906 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 61 9239 47037 Percent of trips city highway Percent of total distance...

154

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

Total number of trips 50 8833 73569 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 70 4028 16574 Percent of trips city highway Percent of total distance...

155

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

Total number of trips 52 6728 59423 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 67 3472 16226 Percent of trips city highway Percent of total distance...

156

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

Total number of trips 47 5791 60007 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 55 2858 14977 Percent of trips city highway Percent of total distance...

157

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

3 Total number of trips 51 15726 143695 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 66 8674 38188 Percent of trips city highway Percent of total distance...

158

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

Total number of trips 52 6894 62248 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 68 3685 15315 Percent of trips city highway Percent of total distance...

159

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

160

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

A Review and Discussion of the Literature on Travel Time and Money Expenditures  

E-Print Network (OSTI)

Expenditure of Time and Money on Travel. Transport RoadExpenditure of Time and Money on Travel. Transp. Research6 I.2.4.2. Travel Money Expenditure ..

Chen, Cynthia; Mokhtarian, Patricia

2008-01-01T23:59:59.000Z

162

Advanced Information Techniques And Paratransit Services To Enhance Mobility Of Elderly And Disabled Travelers  

E-Print Network (OSTI)

Mobility of Elderly and Disabled Travelers: Initial SurveyKEYWORDS elderly and disabled travelers, transit,to Enhance Mobility of Disabled Travelers. Klaver, K, W.

Chen, Wan-Hui; Klaver, Kelley; Uwaine, Rochelle; Jovanis, Paul P.

1998-01-01T23:59:59.000Z

163

Implementing Innovation in Planning Practice: The Case of Travel Demand Forecasting  

E-Print Network (OSTI)

Urban Travel Demand Forecasting Project. Institute ofTRB. Metropolitan Travel Forecasting: Current Practice andPurvis. Regional Travel Forecasting Model System for the San

Newmark, Gregory Louis

2011-01-01T23:59:59.000Z

164

Exact solutions to combinatorial optimizations and the traveling baseball fan problem.  

E-Print Network (OSTI)

?? The traveling baseball fan problem is an extension of the classic traveling salesman problem, in which a sports fan wishes to travel to the (more)

Terrell, Neal D.

2013-01-01T23:59:59.000Z

165

Forecasting 65+ travel : an integration of cohort analysis and travel demand modeling  

E-Print Network (OSTI)

Over the next 30 years, the Boomers will double the 65+ population in the United States and comprise a new generation of older Americans. This study forecasts the aging Boomers' travel. Previous efforts to forecast 65+ ...

Bush, Sarah, 1973-

2003-01-01T23:59:59.000Z

166

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

167

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

168

Supplemental Guidance Regarding Compensatory Time Off for Travel |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Supplemental Guidance Regarding Compensatory Time Off for Travel Supplemental Guidance Regarding Compensatory Time Off for Travel Supplemental Guidance Regarding Compensatory Time Off for Travel Questions and answers on issues that supplement the final regulations on compensatory time for travel issued by the Office of Personnel Management. In addition, a sample worksheet is attached to assist travelers in determining and documenting their travel time that may be credited for compensatory time for travel. This information will be incorporated in Appendix D of the DOE Handbook on Overtime when the handbook is updated. Supplemental Guidance Regarding Compensatory Time Off for Travel Responsible Contacts Bruce Murray HR Policy Advisor E-mail bruce.murray@hq.doe.gov Phone 202-586-3372 More Documents & Publications DOE Handbook on Overtime

169

Encoding network-constrained travel trajectories using routing algorithms  

Science Conference Proceedings (OSTI)

This study proposes a generic encoder for network-constrained travel trajectories, and it implements two encoders by combining the proposed generic encoder with two routing algorithms, which reduce the size of a travel trajectory's path along ...

Pablo Martinez Lerin; Daisuke Yamamoto; Naohisa Takahashi

2013-03-01T23:59:59.000Z

170

Quantum mechanics of time travel through post-selected teleportation  

E-Print Network (OSTI)

This paper discusses the quantum mechanics of closed-timelike curves (CTCs) and of other potential methods for time travel. We analyze a specific proposal for such quantum time travel, the quantum description of CTCs based ...

Maccone, Lorenzo

171

Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Vehicle Miles Traveled Vehicle Miles Traveled Tax Feasibility Evaluation to someone by E-mail Share Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on Facebook Tweet about Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on Twitter Bookmark Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on Google Bookmark Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on Delicious Rank Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on Digg Find More places to share Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type

172

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

173

Microsoft Word - Student Travel Request Form.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

neup@inl.gov | Fax: (208) 526-8076 | Phone: (208) 526-1336 neup@inl.gov | Fax: (208) 526-8076 | Phone: (208) 526-1336 FELLOWSHIP TRAVEL REQUEST FORM Student Name: _____________________________ Date of Request: _________________________ University: ________________________________ Email Address: ___________________________ Phone: ___________________________________ In-State Travel Out-of-State Travel Event Name: ___________________________________________________________________________ Destination: ___________________________________________________________________________ Justification: ___________________________________________________________________________ *Presentation/Poster Title: _______________________________________________________________ Departure Date: _________________________ Return Date: _________________________

174

TERMS FOR TRAVEL & EXCHANGE SCHOLARSHIPS As of December 3, 2013  

E-Print Network (OSTI)

TERMS FOR TRAVEL & EXCHANGE SCHOLARSHIPS As of December 3, 2013 Q:\\Awards\\In-course\\Travel\\2013-14\\Travel Terms.docx Page 1 of 5 The University Senate, acting on behalf of generous benefactors and donors terms attached to individual academic awards. The general conditions and terms have been established

Thompson, Michael

175

Travel Time Estimation Using Floating Car Data  

E-Print Network (OSTI)

This report explores the use of machine learning techniques to accurately predict travel times in city streets and highways using floating car data (location information of user vehicles on a road network). The aim of this report is twofold, first we present a general architecture of solving this problem, then present and evaluate few techniques on real floating car data gathered over a month on a 5 Km highway in New Delhi.

Sevlian, Raffi

2010-01-01T23:59:59.000Z

176

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

177

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

178

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

179

DOE Honors WIPP Representative for Cutting Travel Costs, Greenhouse Gas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE Honors WIPP Representative for Cutting Travel Costs, Greenhouse DOE Honors WIPP Representative for Cutting Travel Costs, Greenhouse Gas Emissions DOE Honors WIPP Representative for Cutting Travel Costs, Greenhouse Gas Emissions June 29, 2012 - 12:19pm Addthis Judy McLemore from the Waste Isolation Pilot Plant led efforts to reduce the DOE’s vehicle fleet by 20 percent, improving sustainability and saving money. Under her leadership, greenhouse gas emissions associated with business travel were reduced by 63 percent and travel costs were reduced by greater than 60 percent. Judy McLemore from the Waste Isolation Pilot Plant led efforts to reduce the DOE's vehicle fleet by 20 percent, improving sustainability and saving money. Under her leadership, greenhouse gas emissions associated with business travel were reduced by 63 percent and travel costs were

180

Assess Potential Changes in Business Travel that Impact Greenhouse Gas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Changes in Business Travel that Impact Greenhouse Changes in Business Travel that Impact Greenhouse Gas Emissions Assess Potential Changes in Business Travel that Impact Greenhouse Gas Emissions October 7, 2013 - 1:22pm Addthis YOU ARE HERE Step 1 For a Federal agency, changes in the demand for business travel can be difficult to predict. Changes in the nature of the agency's work may have a substantial impact on the demand for business travel. It is therefore important to account for these changes when planning for greenhouse gas (GHG) emissions reduction. Conditions that may contribute to a significant increase or decrease in the agency's business travel, beyond specific efforts to reduce business travel demand, include: Significant changes in the agency's budget Addition or completion of major program activities that require

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

DOE Honors WIPP Representative for Cutting Travel Costs, Greenhouse Gas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE Honors WIPP Representative for Cutting Travel Costs, Greenhouse DOE Honors WIPP Representative for Cutting Travel Costs, Greenhouse Gas Emissions DOE Honors WIPP Representative for Cutting Travel Costs, Greenhouse Gas Emissions June 29, 2012 - 12:19pm Addthis Judy McLemore from the Waste Isolation Pilot Plant led efforts to reduce the DOE’s vehicle fleet by 20 percent, improving sustainability and saving money. Under her leadership, greenhouse gas emissions associated with business travel were reduced by 63 percent and travel costs were reduced by greater than 60 percent. Judy McLemore from the Waste Isolation Pilot Plant led efforts to reduce the DOE's vehicle fleet by 20 percent, improving sustainability and saving money. Under her leadership, greenhouse gas emissions associated with business travel were reduced by 63 percent and travel costs were

182

Going Green: Traveling in an Environmentally Responsible Manner |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Green: Traveling in an Environmentally Responsible Manner Green: Traveling in an Environmentally Responsible Manner Going Green: Traveling in an Environmentally Responsible Manner September 27, 2010 - 7:30am Addthis John Lippert My wife and I recently took a trip to Virginia Beach. I wanted to visit a research center there. I spent a lot of time at the center, including attending a 3-hour conference session. So really-a main reason for the trip was not leisure. I do admit, however, that my wife and I couldn't go there over a long weekend without squeezing in some time for the ocean. Travel and tourism is one of America's largest industries, responsible for more than $1 trillion in the U.S. economy. According to the U.S. Travel Association, one out of every nine jobs in the United States depends on travel and tourism. The U.S. travel and tourism industry is made up of

183

Going Green: Traveling in an Environmentally Responsible Manner |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Going Green: Traveling in an Environmentally Responsible Manner Going Green: Traveling in an Environmentally Responsible Manner Going Green: Traveling in an Environmentally Responsible Manner September 27, 2010 - 7:30am Addthis John Lippert My wife and I recently took a trip to Virginia Beach. I wanted to visit a research center there. I spent a lot of time at the center, including attending a 3-hour conference session. So really-a main reason for the trip was not leisure. I do admit, however, that my wife and I couldn't go there over a long weekend without squeezing in some time for the ocean. Travel and tourism is one of America's largest industries, responsible for more than $1 trillion in the U.S. economy. According to the U.S. Travel Association, one out of every nine jobs in the United States depends on travel and tourism. The U.S. travel and tourism industry is made up of

184

Prioritize Greenhouse Gas Mitigation Strategies for Business Travel |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Business Travel Business Travel Prioritize Greenhouse Gas Mitigation Strategies for Business Travel October 7, 2013 - 1:38pm Addthis YOU ARE HERE Based on the guidance in steps 3 in evaluating strategies and step 4 in estimating the cost of implementing those strategies, the agency can define a program of communications, policy and management, and technological and infrastructure support activities that it believes are necessary to support travel reductions. Because business travel can be such a challenging areas to address, effective travel reduction programs will ensure that all of these elements are in place to enable the desired outcomes. Prioritization of those business travel management strategies will instead focus on how broadly the program can be deployed across the agency. The

185

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

186

Metrics and methods for social distance  

E-Print Network (OSTI)

Distance measures are important for scientists because they illustrate the dynamics of geospatial topologies for physical and social processes. Two major types of distance are generally used for this purpose: Euclidean ...

Andris, Clio

2011-01-01T23:59:59.000Z

187

Adaptive multi-stage distance join processing  

Science Conference Proceedings (OSTI)

A spatial distance join is a relatively new type of operation introduced for spatial and multimedia database applications. Additional requirements for ranking and stopping cardinality are often combined with the spatial distance join in on-line query ...

Hyoseop Shin; Bongki Moon; Sukho Lee

2000-06-01T23:59:59.000Z

188

Normalized Compression Distance of Multiples  

E-Print Network (OSTI)

Normalized compression distance (NCD) is a parameter-free similarity measure based on compression. The NCD between pairs of objects is not sufficient for all applications. We propose an NCD of finite multisets (multiples) of objacts that is metric and is better for many applications. Previously, attempts to obtain such an NCD failed. We use the theoretical notion of Kolmogorov complexity that for practical purposes is approximated from above by the length of the compressed version of the file involved, using a real-world compression program. We applied the new NCD for multiples to retinal progenitor cell questions that were earlier treated with the pairwise NCD. Here we get significantly better results. We also applied the NCD for multiples to synthetic time sequence data. The preliminary results are as good as nearest neighbor Euclidean classifier.

Cohen, Andrew R

2012-01-01T23:59:59.000Z

189

Local discriminative distance metrics ensemble learning  

Science Conference Proceedings (OSTI)

The ultimate goal of distance metric learning is to incorporate abundant discriminative information to keep all data samples in the same class close and those from different classes separated. Local distance metric methods can preserve discriminative ... Keywords: Distance metrics learning, Local learning

Yang Mu; Wei Ding; Dacheng Tao

2013-08-01T23:59:59.000Z

190

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

191

Foreign Travel Health & Wellness Information | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Wellness Programs » Foreign Travel Health Wellness Programs » Foreign Travel Health & Wellness Information Foreign Travel Health & Wellness Information All travelers should take the following precautions, no matter the destination: Wash hands often with soap and water. Because motor vehicle crashes are a leading cause of injury among travelers, walk and drive defensively; avoid travel at night if possible and always use seat belts. Don't eat or drink dairy products unless you know they have been pasteurized. Never eat undercooked ground beef and poultry, raw eggs, and unpasteurized dairy products; raw shellfish is particularly dangerous to persons who have liver disease or compromised immune systems. Don't eat food purchased from street vendors; do not drink beverages with ice. Don't handle animals, including dogs and cats, to avoid bites and

192

ADMF-007 EOTA Pre-Travel Authorization 11_0221  

NLE Websites -- All DOE Office Websites (Extended Search)

7 EOTA Pre-Travel Authorization 11_0221 7 EOTA Pre-Travel Authorization 11_0221 11_0221 Deleted extraneous redundant areas and updated chart. EOTA - Business Form Document Title: EOTA Pre-Travel Authorization Form Document Number: ADMF-007 Rev. 11_0221 Document Owner: Approvers: Elizabeth Sousa Melissa Otero Backup Owner: Melissa Otero Referenced Documents: N/A Parent Document: Notify of Changes: ADMP-004, Travel Process ADM MGT 08_0314 Changed name to EOTA Pre-Travel..., added area to identify if a detailed trip report is required, moved FMT signature block. 08_0523 Changed form to mirror the Prime Contractor form as all information is necessary for all authorized travel. Revision History: Rev. Description of Change A Initial Release. 11_0105 Added a refundable/non-refundable approval 08_0606 Added Company Name to form. Merged cells to reveal required text for Yes/No approval.

193

Recent progress on system studies for long distance power transmission  

SciTech Connect

Two possible applications of helium-cooled underground cables for power transmission were studied to determine network characteristics and estimated costs. The first involved power transmission at 345 kV from a Long Island nuclear power plant to a substation 43 miles away. The second appication examined the feasibility of a 350 mi-long 550 kV transmission line from Western Pennsylvania to Allentown and Philadelphia. For both systems computer simulations were used to study operating characteristics. A detailed cost analysis was made. The Long Island study concluded that helium-cooled cables were well suited for high-power transmission in a suburban area, that such a system using two trenches and separate refrigerator stations would be more reliable than a single trench system, and that cost could be optimized by using a less expensive cryogenic envelope. The Pennsylvania study showed that the helium-cooled cable was technically capable of performing as well as overhead power lines, but the cost of the underground cryogenic system is so much greater that such a system could not be economically justified for long distance transmission across open country-side. (LCL)

Forsyth, E B

1976-01-01T23:59:59.000Z

194

SFU Travel Claim Form - Burnaby - CECM - Simon Fraser University  

E-Print Network (OSTI)

Credit card slips will only be accepted for restaurant charges and gas. - List names of all travelers and/or guests for which expenses are claimed. - Foreign...

195

DOE Honors WIPP Representative for Cutting Travel Costs, Greenhouse...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

document reviews with regulators instead of meeting in person and reduced rental car usage by standardizing travel arrangements so that only one rental car is necessary...

196

Traveling Wave Thermoacoustic-Piezoelectric Energy Harvester: Theory and Experiment.  

E-Print Network (OSTI)

??This thesis presents a theoretical and experimental investigation of a piezoelec- tric energy harvester coupled to a traveling wave thermoacoustic engine (TWTAE). By simplifying the (more)

Roshwalb, Andrew Zvi

2011-01-01T23:59:59.000Z

197

Traveling Salesman Problem Formulations with $N \\log N$ Number ...  

E-Print Network (OSTI)

Feb 13, 2013 ... Traveling Salesman Problem Formulations with $N \\log N$ Number of Binary Variables. Thomas A. Pogiatzis(tp309 ***at*** cam.ac.uk)

198

Maximal covering location problem (MCLP) with fuzzy travel times  

Science Conference Proceedings (OSTI)

This paper presents a fuzzy maximal covering location problem (FMCLP) in which travel time between any pair of nodes is considered to be a fuzzy variable. A fuzzy expected value maximization model is designed for such a problem. Moreover, a hybrid algorithm ... Keywords: Credibility theory, Facility location, Fuzzy travel times, Maximal covering location problem (MCLP), Simulation

Soheil Davari; Mohammad Hossein Fazel Zarandi; Ahmad Hemmati

2011-11-01T23:59:59.000Z

199

A New Memetic Algorithm for the Asymmetric Traveling Salesman Problem  

Science Conference Proceedings (OSTI)

This paper introduces a new memetic algorithm specialized for the asymmetric instances of the traveling salesman problem (ATSP). The method incorporates a new local search engine and many other features that contribute to its effectiveness, such as: ... Keywords: asymmetric traveling salesman problem, local search, memetic algorithms, metaheuristics

Luciana Buriol; Paulo M. Frana; Pablo Moscato

2004-09-01T23:59:59.000Z

200

UNALLOWABLE EXPENSES Some common unallowable TRAVEL expenses on University  

E-Print Network (OSTI)

travel agencies. Those agencies are knowledgeable of State airline contracts, available fares and billing of the State contracted rental car agencies is mandatory. Car rentals must be paid with the State Travel Card provides the list of awarded rental car agencies as well as a list of awarded cities by vendor: http://www.state

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

EUCLIDEAN DISTANCE MATRIX COMPLETION PROBLEMS June ...  

E-Print Network (OSTI)

Jun 6, 2010 ... part by NSF Grant CCF 0514213 and DOE Grant DESC0002218. REFERENCES . [1] A. Y. Alfakih, On the uniqueness of Euclidean distance...

202

Supplemental Guidance Regarding Compensatory Time Off for Travel  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SUPPLEMENTAL GUIDANCE SUPPLEMENTAL GUIDANCE REGARDING COMPENSATORY TIME OFF FOR TRAVEL (Revised October 27, 2008) Following are questions and answers on issues that supplement the final regulations effective this date on compensatory time for travel issued by the Office of Personnel Management on April 17, 2007. In addition, a sample worksheet is attached to assist travelers in determining and documenting their travel time that may be credited for compensatory time for travel. This information will be incorporated in Appendix D of the DOE Handbook on Overtime when the handbook is updated. Q1. Who is eligible for this benefit? A1. All employees are eligible except the following: the Secretary, SESs, employees covered by other forms of overtime compensation, including law enforcement

203

Checklist for Medical Issues When Traveling Overseas | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Benefits » Wellness Programs » Foreign Travel Health Benefits » Wellness Programs » Foreign Travel Health & Wellness Information » Checklist for Medical Issues When Traveling Overseas Checklist for Medical Issues When Traveling Overseas Before the Trip A written confirmation from an appropriate manager, i.e., a Travel Authorization or memorandum, that identifies the employee and country(ies) that will be visited should be provided the medical support staff 4-8 weeks prior to the trip or, if less than 4 weeks, as soon as management or the employee becomes aware of it. The medical staff will identify what vaccinations are recommended for each country and discuss the current health issues for each country with the employee. Some vaccinations take several weeks to become effective. The medical staff will review and update the employee's routine

204

Petroleum Reduction Strategies to Reduce Vehicle Miles Traveled |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Reduce Vehicle Miles Traveled Reduce Vehicle Miles Traveled Petroleum Reduction Strategies to Reduce Vehicle Miles Traveled October 7, 2013 - 11:52am Addthis YOU ARE HERE: Step 3 For reducing greenhouse gas emissions, the table below describes petroleum reduction strategies to reduce vehicle miles traveled, as well as guidance and best practices for each strategy. Table 1. Determining When and How to Promote the Use of Strategies to Reduce Vehicle Miles Traveled Strategy When Applicable Best Practices Consolidate trips Applicable to all vehicles, regardless of ownership or vehicle and fuel type Target vehicle operators who take longer trips Seek vehicle operator input and collaboration to identify regular or occasional trips that involve similar routes. Determine whether trips on multiple days or times can be consolidated into a single trip.

205

Increase in the period of waves traveling over large distances : with applications to tsunamis, swell, and seismic surface waves  

E-Print Network (OSTI)

to the tsunami from the Aleutian earthquake of 1st April,c ohhe tsunami Prom the Aleutian earthmake oi' 1st April

Munk, Walter H

1946-01-01T23:59:59.000Z

206

Increase in the period of waves traveling over large distances : with applications to tsunamis, swell, and seismic surface waves  

E-Print Network (OSTI)

25) seduce to tho wall-horn Porn aoco~ding .to wkiieh the ~oan now be written in the Porn If the bottom profile along

Munk, Walter H

1946-01-01T23:59:59.000Z

207

Storage assignment problem with travel distance and blocking considerations for a picker-to-part order picking system  

Science Conference Proceedings (OSTI)

Order picking is a key operation in managing a warehouse efficiently. Most previous studies on picking only considered single-picker operation; however, many pickers frequently work concurrently in the same region. Since congestion may occur in such ... Keywords: Multi-picker operations, Order picking, Storage assignment policy, Warehouse management

Jason Chao-Hsien Pan; Po-Hsun Shih; Ming-Hung Wu

2012-03-01T23:59:59.000Z

208

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

209

Hamiltonian Graphs and the Traveling Salesman Problem  

E-Print Network (OSTI)

A new characterization of Hamiltonian graphs using f-cutset matrix is proposed. A new exact polynomial time algorithm for the traveling salesman problem (TSP) based on this new characterization is developed. We then define so called ordered weighted adjacency list for given weighted complete graph and proceed to the main result of the paper, namely, the exact algorithm based on utilization of ordered weighted adjacency list and the simple properties that any path or circuit must satisfy. This algorithm performs checking of sub-lists, containing (p-1) entries (edge pairs) for paths and p entries (edge pairs) for circuits, chosen from ordered adjacency list in a well defined sequence to determine exactly the shortest Hamiltonian path and shortest Hamiltonian circuit in a weighted complete graph of p vertices. The procedure has intrinsic advantage of landing on the desired solution in quickest possible time and even in worst case in polynomial time. A new characterization of shortest Hamiltonian tour for a weighted complete graph satisfying triangle inequality (i.e. for tours passing through every city on a realistic map of cities where cities can be taken as points on a Euclidean plane) is also proposed. Finally, we discuss a novel classical algorithm for unstructured search and its effect on any of the NP-Complete problems.

Dhananjay P. Mehendale

2007-04-27T23:59:59.000Z

210

ITS Information And Services To Enhance The Mobility Of Disabled Travelers  

E-Print Network (OSTI)

Mobility of Elderly and Disabled Travelers: Initial Surveyto understand the needs of the disabled population, it isto Enhance the Mobility of Disabled Travelers Wan-Hui Chen,

Chen, Wan-hui; Uwaine, Rochelle; Klaver, Kelley; Kurani, Ken; Jovanis, Paul P.

1998-01-01T23:59:59.000Z

211

DOE O 552.1A Admin Chg 1, Travel Policy and Procedures  

Directives, Delegations, and Requirements

The Order supplements the Federal Travel Regulation as principal source of policy for Federal employee travel and relocation and establishes DOE M 552.1-1A, ...

2006-02-17T23:59:59.000Z

212

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 49 89,494 825,358 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 57 42...

213

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 47 8,056 75,381 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 54 37...

214

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 48 11,690 113,476 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 53 39...

215

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 49 11,977 110,783 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 55 40...

216

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 44 9,485 89,378 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 52 38...

217

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 47 10,148 96,085 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 56 41...

218

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 48 11,151 103,642 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 56 40...

219

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

(CD) mode Total number of trips 46 9,988 93,994 Total distance traveled (mi) Overall gasoline fuel economy (mpg) Overall AC electrical energy consumption (AC Whmi) 54 40...

220

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

18 Overall DC electrical energy consumption (DC Whmi) 84 Total number of trips 1,919 Total distance traveled (mi) 20,128 Trips in Charge Depleting (CD) mode Gasoline fuel...

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

5 Overall DC electrical energy consumption (DC Whmi) 72 Total number of trips 14,961 Total distance traveled (mi) 168,067 Trips in Charge Depleting (CD) mode Gasoline fuel...

222

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

03 Overall DC electrical energy consumption (DC Whmi) 65 Total number of trips 959 Total distance traveled (mi) 10,425 Trips in Charge Depleting (CD) mode Gasoline fuel...

223

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

2 Overall DC electrical energy consumption (DC Whmi) 75 Total number of trips 1,394 Total distance traveled (mi) 18,639 Trips in Charge Depleting (CD) mode Gasoline fuel...

224

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

136 Overall DC electrical energy consumption (DC Whmi) 93 Total number of trips 1,476 Total distance traveled (mi) 16,266 Trips in Charge Depleting (CD) mode Gasoline fuel...

225

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

11 Overall DC electrical energy consumption (DC Whmi) 74 Total number of trips 1,027 Total distance traveled (mi) 10,669 Trips in Charge Depleting (CD) mode Gasoline fuel...

226

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

8 Overall DC electrical energy consumption (DC Whmi) 63 Total number of trips 1,388 Total distance traveled (mi) 16,479 Trips in Charge Depleting (CD) mode Gasoline fuel...

227

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

126 Overall DC electrical energy consumption (DC Whmi) 86 Total number of trips 470 Total distance traveled (mi) 4,017 Trips in Charge Depleting (CD) mode Gasoline fuel...

228

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 14% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 402 Number of trips 694 Distance traveled (mi) 1,450 Percent...

229

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

09 Overall DC electrical energy consumption (DC Whmi) 73 Total number of trips 1,476 Total distance traveled (mi) 17,810 Trips in Charge Depleting (CD) mode Gasoline fuel...

230

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

6 Overall DC electrical energy consumption (DC Whmi) 73 Total number of trips 15,434 Total distance traveled (mi) 172,132 Trips in Charge Depleting (CD) mode Gasoline fuel...

231

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

9 Overall DC electrical energy consumption (DC Whmi) 61 Total number of trips 1,509 Total distance traveled (mi) 19,521 Trips in Charge Depleting (CD) mode Gasoline fuel...

232

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

14 Overall DC electrical energy consumption (DC Whmi) 76 Total number of trips 800 Total distance traveled (mi) 9,275 Trips in Charge Depleting (CD) mode Gasoline fuel economy...

233

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

93 Overall DC electrical energy consumption (DC Whmi) 65 Total number of trips 1,811 Total distance traveled (mi) 24,662 Trips in Charge Depleting (CD) mode Gasoline fuel...

234

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

78 Overall DC electrical energy consumption (DC Whmi) 37 Total number of trips 1,084 Total distance traveled (mi) 9,876 Trips in Charge Depleting (CD) mode Gasoline fuel...

235

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

88 Overall DC electrical energy consumption (DC Whmi) 59 Total number of trips 1,097 Total distance traveled (mi) 15,333 Trips in Charge Depleting (CD) mode Gasoline fuel...

236

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

24 Overall DC electrical energy consumption (DC Whmi) 87 Total number of trips 1,325 Total distance traveled (mi) 15,061 Trips in Charge Depleting (CD) mode Gasoline fuel...

237

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

5 Overall DC electrical energy consumption (DC Whmi) 63 Total number of trips 1,314 Total distance traveled (mi) 19,332 Trips in Charge Depleting (CD) mode Gasoline fuel...

238

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

4 Overall AC electrical energy consumption (AC Whmi) 94 Overall DC electrical energy consumption (DC Whmi) 60 Total number of trips 1,077 Total distance traveled (mi) 15,138...

239

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

03 Overall DC electrical energy consumption (DC Whmi) 68 Total number of trips 1,269 Total distance traveled (mi) 13,444 Trips in Charge Depleting (CD) mode Gasoline fuel...

240

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

36 Overall DC electrical energy consumption (DC Whmi) 11 Total number of trips 1,083 Total distance traveled (mi) 12,432 Trips in Charge Depleting (CD) mode Gasoline fuel...

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

10 Overall DC electrical energy consumption (DC Whmi) 75 Total number of trips 1,586 Total distance traveled (mi) 16,990 Trips in Charge Depleting (CD) mode Gasoline fuel...

242

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

3 Overall DC electrical energy consumption (DC Whmi) 55 Total number of trips 1,120 Total distance traveled (mi) 13,603 Trips in Charge Depleting (CD) mode Gasoline fuel...

243

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

23 Overall DC electrical energy consumption (DC Whmi) 83 Total number of trips 1,535 Total distance traveled (mi) 17,701 Trips in Charge Depleting (CD) mode Gasoline fuel...

244

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

74 Overall DC electrical energy consumption (DC Whmi) 44 Total number of trips 722 Total distance traveled (mi) 8,574 Trips in Charge Depleting (CD) mode Gasoline fuel economy...

245

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

10 Overall DC electrical energy consumption (DC Whmi) 77 Total number of trips 1,661 Total distance traveled (mi) 14,806 Trips in Charge Depleting (CD) mode Gasoline fuel...

246

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

46 Overall DC electrical energy consumption (DC Whmi) 25 Total number of trips 1,425 Total distance traveled (mi) 15,478 Trips in Charge Depleting (CD) mode Gasoline fuel...

247

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 Overall DC electrical energy consumption (DC Whmi) 56 Total number of trips 1,579 Total distance traveled (mi) 20,195 Trips in Charge Depleting (CD) mode Gasoline fuel...

248

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

8 Overall DC electrical energy consumption (DC Whmi) 65 Total number of trips 1,160 Total distance traveled (mi) 11,521 Trips in Charge Depleting (CD) mode Gasoline fuel...

249

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

12 Overall DC electrical energy consumption (DC Whmi) 72 Total number of trips 973 Total distance traveled (mi) 12,099 Trips in Charge Depleting (CD) mode Gasoline fuel...

250

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

03 Overall DC electrical energy consumption (DC Whmi) 73 Total number of trips 1,427 Total distance traveled (mi) 17,582 Trips in Charge Depleting (CD) mode Gasoline fuel...

251

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

90 Overall DC electrical energy consumption (DC Whmi) 36 Total number of trips 700 Total distance traveled (mi) 6,684 Trips in Charge Depleting (CD) mode Gasoline fuel economy...

252

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

9 Overall DC electrical energy consumption (DC Whmi) 65 Total number of trips 1,440 Total distance traveled (mi) 17,617 Trips in Charge Depleting (CD) mode Gasoline fuel...

253

_MainReportPerVehicle  

NLE Websites -- All DOE Office Websites (Extended Search)

35 Overall DC electrical energy consumption (DC Whmi) 21 Total number of trips 1,492 Total distance traveled (mi) 14,935 Trips in Charge Depleting (CD) mode Gasoline fuel...

254

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

85 Overall DC electrical energy consumption (DC Whmi) 54 Total number of trips 813 Total distance traveled (mi) 10,029 Trips in Charge Depleting (CD) mode Gasoline fuel...

255

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

6 Overall DC electrical energy consumption (DC Whmi) 64 Total number of trips 1,266 Total distance traveled (mi) 16,125 Trips in Charge Depleting (CD) mode Gasoline fuel...

256

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

111 Overall DC electrical energy consumption (DC Whmi) 70 Total number of trips 1,023 Total distance traveled (mi) 14,654 Trips in Charge Depleting (CD) mode Gasoline fuel...

257

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

1 Overall DC electrical energy consumption (DC Whmi) 54 Total number of trips 1,830 Total distance traveled (mi) 22,888 Trips in Charge Depleting (CD) mode Gasoline fuel...

258

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

17 Overall DC electrical energy consumption (DC Whmi) 74 Total number of trips 976 Total distance traveled (mi) 12,487 Trips in Charge Depleting (CD) mode Gasoline fuel...

259

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

88 Overall DC electrical energy consumption (DC Whmi) 60 Total number of trips 1,528 Total distance traveled (mi) 18,774 Trips in Charge Depleting (CD) mode Gasoline fuel...

260

MonthlyReportAll  

NLE Websites -- All DOE Office Websites (Extended Search)

Original Pack) 7 Total number of trips 38 2737 20475 Distance traveled (mi) Gasoline fuel economy (mpg) Number of trips 40 2104 12131 Percent of trips city highway Percent of...

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 Overall DC electrical energy captured from regenerative braking (DC Whmi) 43 Total number of trips 12,106 Total distance traveled (mi) 110,949 Trips in Charge Depleting (CD)...

262

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

2 Overall DC electrical energy captured from regenerative braking (DC Whmi) 44 Total number of trips 36,749 Total distance traveled (mi) 343,675 Trips in Charge Depleting (CD)...

263

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

7 Overall DC electrical energy consumption (DC Whmi) 74 Total number of trips 14,233 Total distance traveled (mi) 159,409 Trips in Charge Depleting (CD) mode Gasoline fuel...

264

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

8 Overall DC electrical energy consumption (DC Whmi) 75 Total number of trips 10,798 Total distance traveled (mi) 118,394 Trips in Charge Depleting (CD) mode Gasoline fuel...

265

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

9 Overall DC electrical energy consumption (DC Whmi) 76 Total number of trips 13,110 Total distance traveled (mi) 145,669 Trips in Charge Depleting (CD) mode Gasoline fuel...

266

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

267

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

268

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

269

Researchers test novel power system for space travel  

NLE Websites -- All DOE Office Websites (Extended Search)

Power system for space travel Power system for space travel Researchers test novel power system for space travel The research team recently demonstrated the first use of a heat pipe to cool a small nuclear reactor and power a Stirling engine. November 26, 2012 John Bounds of Los Alamos National Laboratory's Advanced Nuclear Technology Division makes final adjustments on the DUFF experiment, a demonstration of a simple, robust fission reactor prototype that could be used as a power system for space travel. DUFF is the first demonstration of a space nuclear reactor system to produce electricity in the United States since 1965. John Bounds of Los Alamos National Laboratory's Advanced Nuclear Technology Division makes final adjustments on the DUFF experiment, a demonstration of a simple, robust fission reactor prototype that could be used as a power

270

Deputy Secretary Poneman to Travel to Russia | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Poneman to Travel to Russia Poneman to Travel to Russia Deputy Secretary Poneman to Travel to Russia December 3, 2010 - 12:00am Addthis Washington, D.C. - On Monday, December 6, U.S. Deputy Secretary of Energy Daniel Poneman will travel to Russia as part of the ongoing cooperation between the two countries on nuclear security and peaceful nuclear energy issues. On Tuesday, Deputy Secretary Poneman will co-chair the U.S.-Russia Nuclear Energy and Nuclear Security Working Group Plenary Meeting with Director General of the State Atomic Energy Corporation "Rosatom" Sergei Kiriyenko. The Working Group was established under the U.S.-Russia Bilateral Presidential Commission at the July 2009 Presidential Summit. Last fall, Director Kiriyenko visited the United States for the first meetings of the

271

Novel power system demonstrated for space travel | National Nuclear  

NLE Websites -- All DOE Office Websites (Extended Search)

Novel power system demonstrated for space travel | National Nuclear Novel power system demonstrated for space travel | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > Novel power system demonstrated for space travel Novel power system demonstrated for space travel Posted By Office of Public Affairs John Bounds, Los Alamos National Laboratory

272

Sec. Chu Travels to Houston | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Sec. Chu Travels to Houston Sec. Chu Travels to Houston Sec. Chu Travels to Houston February 2, 2012 - 5:19pm Addthis The Houston Medical Center Thermal Energy Corporation Control Room. | Photo Courtesy of the Texas Medical Center The Houston Medical Center Thermal Energy Corporation Control Room. | Photo Courtesy of the Texas Medical Center Ginny Simmons Ginny Simmons Former Managing Editor for Energy.gov, Office of Public Affairs Secretary Chu traveled to Houston, Texas, today to meet with executives from various oil and gas companies, host a State of the Union Town Hall with students from Houston Community College, and tour the Texas Medical Center -- which recently completed a series of major energy efficiency upgrades. As part of his blueprint to build an economy to last, President Obama has

273

Novel power system demonstrated for space travel | National Nuclear  

National Nuclear Security Administration (NNSA)

Novel power system demonstrated for space travel | National Nuclear Novel power system demonstrated for space travel | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > Novel power system demonstrated for space travel Novel power system demonstrated for space travel Posted By Office of Public Affairs John Bounds, Los Alamos National Laboratory

274

DOE Honors WIPP Representative for Cutting Travel Costs, Greenhouse Gas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WIPP Representative for Cutting Travel Costs, Greenhouse WIPP Representative for Cutting Travel Costs, Greenhouse Gas Emissions DOE Honors WIPP Representative for Cutting Travel Costs, Greenhouse Gas Emissions June 1, 2012 - 12:00pm Addthis Secretary Chu presents the Secretary of Energy's Appreciation Award to Judy A. McLemore. Secretary Chu presents the Secretary of Energy's Appreciation Award to Judy A. McLemore. WASHINGTON, D.C. - A representative of the Waste Isolation Pilot Plant (WIPP) near Carlsbad, N.M., on Tuesday received the Secretary of Energy's Appreciation Award for her efforts to improve sustainability and reduce travel costs and the number of fleet vehicles. Judy A. McLemore, who works for URS Regulatory and Environmental Services, based in Carlsbad, was honored for helping advance DOE's management and

275

A Striking Example of the Atmosphere's Leading Traveling Pattern  

Science Conference Proceedings (OSTI)

Conventional and complex empirical orthogonal function (EOF) techniques show that for at least four months during the fall and winter of 1979/80 a large-amplitude, large-scale, traveling flow anomaly existed in the troposphere and stratosphere. ...

Grant Branstator

1987-08-01T23:59:59.000Z

276

Defining business strategy for development of travel and tourism industry  

E-Print Network (OSTI)

Many studies conducted on Travel and Tourism industry consider tourism an economic phenomenon. Providing a customer-satisfaction-based analysis, this thesis deals with both economic and social aspects. Economic data on ...

Davari, Dordaneh

2011-01-01T23:59:59.000Z

277

SunShot Concentrating Solar Power Program Review 2013 - Travel...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

SunShot Concentrating Solar Power Program Review 2013 April 23-25, 2013 Phoenix, Arizona Skip navigation to main content Menu Home About Agenda Register Venue Presentations Travel...

278

How ORISE is Making a Difference: Travelers' Health Campaign  

NLE Websites -- All DOE Office Websites (Extended Search)

online outreach. Campaign themes include "Prevention can be Travel-Sized" and "Stop, Wash and Go." Among THC's core messages, the CDC is urging people to take the following...

279

Passenger travel behavior model in railway network simulation  

Science Conference Proceedings (OSTI)

Transportation planners and public transport operators alike have become increasingly aware of the need to diffuse the concentration of the peak period travel. Differentiated pricing is one possible method to even out the demand and reduce peak load ...

Ting Li; Eric van Heck; Peter Vervest; Jasper Voskuilen; Freek Hofker; Fred Jansma

2006-12-01T23:59:59.000Z

280

Odometer Versus Self-Reported Estimates of Vehicle Miles Traveled  

Reports and Publications (EIA)

The findings described here compare odometer readings with self-reported estimates of Vehicle Miles Traveled (VMT) to investigate to what extent self-reported VMT is a reliable surrogate for odometer-based VMT.

Information Center

2000-08-01T23:59:59.000Z

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Understanding transit travel behavior : value added by smart cards  

E-Print Network (OSTI)

Travel behavior represents a particularly complex area of research in transportation given the interaction between transport supply characteristics and the user perceptions which guide his/her decisions. Thanks to the ...

Gupta, Saumya, S.M. Massachusetts Institute of Technology

2006-01-01T23:59:59.000Z

282

Travel and migration associated infectious diseases morbidity in Europe, 2008  

E-Print Network (OSTI)

Infect 2009, 11:1177-1185. 19. NaTHNaC Clinical Update: Tropical Cyclone Nargis in Myanmar - advice for relief workers and other travellers to affected areas. 2008 [http:// www.nathnac.org/pro/clinical_updates/cyclonemyanmar_070508.htm], (Accessed January... ://www.eurotravnet.eu, a network of clinical specialists in tropical and travel medicine was founded in 2008, to assist the European Centre for Dis- ease Prevention & Control (ECDC) for the detection, verification, assessment and communication of commu- nicable diseases...

Field, Vanessa; Gautret, Philippe; Schlagenhauf, Patricia; Burchard, Gerd-Dieter; Caumes, Eric; Jensenius, Mogens; Castelli, Francesco; Gkrania-Klotsas, Effrossyni; Weld, Leisa; Lopez-Velez, Rogelio; de Vries, Peter; von Sonnenburg, Frank; Loutan, Louis; Parola, Philippe; Network, the EuroTravNet

2010-11-17T23:59:59.000Z

283

Optimal expected-distance separating halfspace  

E-Print Network (OSTI)

If a different norm is used for each data set in order to measure distances to ... In practical settings, one usually has a data set D = {(x1,y1),..., (xp,yp)} ?. Rd {?1

284

Sensor fault detection using the Mahalanobis distance  

Science Conference Proceedings (OSTI)

A method is described by which a localized sensor abnormality can be detected using the Mahalanobis distance. The Mahalanobis distance is approximately the weighted distance from the hyperplane formed by the principal components to the particular observation. Qualitatively, the principal components correspond to the physical laws that govern the behavior of the systems and constraints placed on the system. If there are more sensors than principal components, there are redundant measurements. This redundancy can be used to detect abnormalities that are due either to sensor failure or a localized change in the system being measured. The method compares the distribution of the Mahalanobis distance during normal operation with the distribution during the current operation. A likelihood ratio test is then used to determine if a sensor has gone bad or if operations in the reactor are different from normal. The sensor whose value is not normal is identified by comparing Mahalanobis distances computed with one sensor masked. When the abnormal sensor is masked, the Mahalanobis distance for this subset of sensors will be within prespecified bounds. The method is demonstrated on 20 subassembly output thermocouples in the core of Experimental Breeder Reactor II.

White, A.M.; Gross, K.C. (Argonne National Lab., IL (United States)); Kubic, W.L (Los Alamos National Lab., NM (United States))

1993-01-01T23:59:59.000Z

285

The sources of e-business competitive advantages between travel agencies and online travel service firms in China  

Science Conference Proceedings (OSTI)

Knowledge about the most important sources of e-business competitive advantages in the travel industry would help to focus efforts in both academic and practical areas. This study develops a framework based on the resource-based view (RBV) ...

Zhen Zhu; Jing Zhao

2011-07-01T23:59:59.000Z

286

Assessing Energy Impact of Plug-In Hybrid Electric Vehicles: Significance of Daily Distance Variation over Time and Among Drivers  

Science Conference Proceedings (OSTI)

Accurate assessment of the impact of plug-in hybrid electric vehicles (PHEVs) on petroleum and electricity consumption is a necessary step toward effective policies. Variations in daily vehicle miles traveled (VMT) over time and among drivers affect PHEV energy impact, but the significance is not well understood. This paper uses a graphical illustration, a mathematical derivation, and an empirical study to examine the cause and significance of such an effect. The first two methods reveal that ignoring daily variation in VMT always causes underestimation of petroleum consumption and overestimation of electricity consumption by PHEVs; both biases increase as the assumed PHEV charge-depleting (CD) range moves closer to the average daily VMT. The empirical analysis based on national travel survey data shows that the assumption of uniform daily VMT over time and among drivers causes nearly 68% underestimation of expected petroleum use and nearly 48% overestimation of expected electricity use by PHEVs with a 40-mi CD range (PHEV40s). Also for PHEV40s, consideration of daily variation in VMT over time but not among drivers similar to the way the utility factor curve is derived in SAE Standard SAE J2841 causes underestimation of expected petroleum use by more than 24% and overestimation of expected electricity use by about 17%. Underestimation of petroleum use and overestimation of electricity use increase with larger-battery PHEVs.

Lin, Zhenhong [ORNL; Greene, David L [ORNL

2012-01-01T23:59:59.000Z

287

Short-Distance Structure of Nuclei  

Science Conference Proceedings (OSTI)

One of Jefferson Lab's original missions was to further our understanding of the short-distance structure of nuclei. In particular, to understand what happens when two or more nucleons within a nucleus have strongly overlapping wave-functions; a phenomena commonly referred to as short-range correlations. Herein, we review the results of the (e,e'), (e,e'p) and (e,e'pN) reactions that have been used at Jefferson Lab to probe this short-distance structure as well as provide an outlook for future experiments.

Douglas Higinbotham, Eliazer Piasetzky, Stephen Wood

2011-06-01T23:59:59.000Z

288

Bounds on distance distributions in codes of known size  

Science Conference Proceedings (OSTI)

We treat the problem of bounding components of the possible distance distributions of codes given the knowledge of their size and possibly minimum distance. Using the Beckner inequality from harmonic analysis, we derive upper bounds on distance distribution ...

A. E. Ashikhmin; G. D. Cohen; M. Krivelevich; S. N. Litsyn

2005-01-01T23:59:59.000Z

289

Have You Seen Renewable Energy Projects While Traveling? | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Seen Renewable Energy Projects While Traveling? Seen Renewable Energy Projects While Traveling? Have You Seen Renewable Energy Projects While Traveling? July 7, 2011 - 8:32am Addthis Since we blog about energy efficiency and renewable energy, it seems fitting that we would notice it even when we're not at work. This past Tuesday, Chris shared his first-hand views of Hawaii's renewable energy efforts while on vacation, including wind and solar, and did some post-vacation research that revealed some great information about how Hawaii is using renewable resources to achieve 70% clean energy by 2030. We're curious: Have you ever been on vacation or a business trip and noticed how another state is using renewable energy? Each Thursday, you have the chance to share your thoughts on a question about energy efficiency or renewable energy for consumers. E-mail your

290

MONDAY: Secretary Chu Travels to New Jersey and Philadelphia | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MONDAY: Secretary Chu Travels to New Jersey and Philadelphia MONDAY: Secretary Chu Travels to New Jersey and Philadelphia MONDAY: Secretary Chu Travels to New Jersey and Philadelphia September 24, 2010 - 12:00am Addthis WASHINGTON - On Monday, September 27, 2010, U.S. Energy Secretary Steven Chu and Representative Rush Holt will tour Applied Photovoltaics. With help from a Recovery Act-funded $1.1 million clean energy manufacturing tax credit, Applied Photovoltaics will manufacture solar energy modules for use in building-integrated photovoltaics. In the afternoon, Secretary Chu will tour the Princeton Plasma Physics Laboratory and speak to employees. He will then join Pennsylvania Governor Ed Rendell, Philadelphia Mayor Michael Nutter and other officials in an event highlighting the Energy Innovation Hub for energy-efficient buildings

291

Secretary Chu Travels to Memphis | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Travels to Memphis Travels to Memphis Secretary Chu Travels to Memphis January 31, 2011 - 2:33pm Addthis Ginny Simmons Ginny Simmons Former Managing Editor for Energy.gov, Office of Public Affairs What does this project do? The Sharp solar manufacturing plant has produced more than 2 million solar panels since 2002, increased its staff from 300 to 480 employees over the last year, and produces enough solar paneling to power more than 140,000 homes. Worldwide, FedEx Express is operating 329 hybrid and 19 all-electric vehicles, reducing fuel use by almost 300,000 gallons and carbon dioxide emissions by approximately 3,000 metric tons. Hero_CHU_Sharp Secretary Steven Chu with Sharp executive T.C. Jones, standing in front of some of Sharp's solar panels. Following the State of the Union on Tuesday and his online town hall on

292

Secretary Chu to Travel to Houston Today | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to Travel to Houston Today to Travel to Houston Today Secretary Chu to Travel to Houston Today July 8, 2010 - 12:00am Addthis Washington, D.C. - At the direction of President Obama, as part of the Administration's ongoing oil spill response efforts U.S. Energy Secretary Steven Chu is making his fifth trip to Houston today to continue to help identify strategies for containing the oil and ultimately killing the well. Secretary Chu and his scientific team are coordinating their work with National Incident Commander Admiral Thad Allen, who is leading the administration-wide response and directing all interagency activities. Information on the work that the Secretary, Department of Energy staff and independent scientists have done to date on the oil spill response can be found on DOE's BP Oil Spill page.

293

Solar Decathlon 2013: Going the Distance | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Going the Distance Solar Decathlon 2013: Going the Distance September 17, 2013 - 4:26pm Addthis Toggle Routes onoff Return to map Solar Decathlon Journeys Visualizing the...

294

Semantic distances for technology landscape visualization  

Science Conference Proceedings (OSTI)

This paper presents a novel approach to the visualization of research domains in science and technology. The proposed methodology is based on the use of bibliometrics; i.e., analysis is conducted using information regarding trends and patterns ... Keywords: Clustering, Data mining, Semantic distance, Technology forecasting

Wei Lee Woon; Stuart Madnick

2012-08-01T23:59:59.000Z

295

The Department of Energy's Management of Foreign Travel, IG-0872  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The Department of Energy's Management of Foreign Travel DOE/IG-0872 October 2012 U.S. Department of Energy Office of Inspector General Office of Audits and Inspections Department of Energy Washington, DC 20585 October 16, 2012 MEMORANDUM FOR THE SECRETARY FROM: Gregory H. Friedman Inspector General SUBJECT: INFORMATION: Management Alert: "The Department of Energy's Management of Foreign Travel" INTRODUCTION The Department of Energy and its workforce of 116,000 Federal and contractor personnel have numerous international exchanges and interactions at different levels and for a variety of important programmatic and other purposes. The Office of Inspector General is currently reviewing the Department's management of international offices and foreign assignments. As

296

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

297

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

298

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

299

Exact graph search algorithms for generalized traveling salesman path problems  

Science Conference Proceedings (OSTI)

The Generalized Traveling Salesman Path Problem (GTSPP) involves finding the shortest path from a location s to a location t that passes through at least one location from each of a set of generalized location categories (e.g., gas stations, ...

Michael N. Rice; Vassilis J. Tsotras

2012-06-01T23:59:59.000Z

300

Travel Planning Online for Dummies, 2nd edition  

Science Conference Proceedings (OSTI)

From the Publisher:Find out how you can quickly and easily book plane tickets, rent a car and find a hotel room -- all with a few clicks of the mouse! Whether you're going on a short business strip or planning your dream vacation, Travel Planning ...

Noah Vadnai; Julian Smith

2000-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Building robust Reputation Systems for travel-related services  

Science Conference Proceedings (OSTI)

There is a serious robust issue of building Reputation Systems for travel-related services, such as hotel, restaurant, etc. This paper proposes an advanced clustering approach, Suspicion Degree Meter (SDM), to rank suspects with respect to manipulative ... Keywords: Silicon,Indexes,Robustness,Analytical models,Feature extraction,Buildings,Context

Huiying Duan; Peng Yang

2012-07-01T23:59:59.000Z

302

Comparison of heuristics for the colourful travelling salesman problem  

Science Conference Proceedings (OSTI)

In the colourful travelling salesman problem CTSP, given a graph G with a not necessarily distinct label colour assigned to each edge, a Hamiltonian tour with the minimum number of different labels is sought. The problem is a variant of the well-known ...

J. Silberholz; A. Raiconi; R. Cerulli; M. Gentili; B. Golden; S. Chen

2013-05-01T23:59:59.000Z

303

Long working distance incoherent interference microscope  

DOE Patents (OSTI)

A full-field imaging, long working distance, incoherent interference microscope suitable for three-dimensional imaging and metrology of MEMS devices and test structures on a standard microelectronics probe station. A long working distance greater than 10 mm allows standard probes or probe cards to be used. This enables nanometer-scale 3-dimensional height profiles of MEMS test structures to be acquired across an entire wafer while being actively probed, and, optionally, through a transparent window. An optically identical pair of sample and reference arm objectives is not required, which reduces the overall system cost, and also the cost and time required to change sample magnifications. Using a LED source, high magnification (e.g., 50.times.) can be obtained having excellent image quality, straight fringes, and high fringe contrast.

Sinclair, Michael B. (Albuquerque, NM); De Boer, Maarten P. (Albuquerque, NM)

2006-04-25T23:59:59.000Z

304

OFA2013_Storage@Distance.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

NERSC Storage Systems Group NERSC Storage Systems Group Storage at a Distance --- 1 --- Open F abrics A lliance U ser D ay What is storage at a distance? * Data i s n ot l ocal t o t he u ser/resource * Processing a nd w orkflow n eeds a re n ear r eal---7me - Don't w ant t o w ait u n9l d ata t ransfer i s c omplete - Need t o s ee r esults, m ake a djustments, a nd t ry a gain * Network w ill b ecome p art o f t he i nstruments - Telescopes a nd t heir d ata - Sequencers a nd t heir g enome d ata - Light s ources a nd t heir d ata * Is t here a n a rchitecture/protocol t hat i s n ecessary today for successfully providing storage at a distance? - Ethernet v s. I B - ROCE v s. R DMA v s. I P --- 2 --- Open F abrics A lliance U ser D ay Use case 1: Instruments (beam lines) * ShiB w ork ( 24hr c overage) - Scien9sts fl y i n a nd u se t he i nstrument

305

Effect of distance to radiation treatment facility on use of radiation therapy after mastectomy in elderly women  

Science Conference Proceedings (OSTI)

Purpose: We sought to study the effect of distance to the nearest radiation treatment facility on the use of postmastectomy radiation therapy (PMRT) in elderly women. Methods and Materials: Using data from the linked Surveillance, Epidemiology, and End Results-Medicare (SEER-Medicare) database, we analyzed 19,787 women with Stage I or II breast cancer who received mastectomy as definitive surgery during 1991 to 1999. Multivariable logistic regression was used to investigate the association of distance with receipt of PMRT after adjusting for clinical and sociodemographic factors. Results: Overall 2,075 patients (10.5%) treated with mastectomy received PMRT. In addition to cancer and patient characteristics, in our primary analysis, increasing distance to the nearest radiation treatment facility was independently associated with a decreased likelihood of receiving PMRT (OR 0.996 per additional mile, p = 0.01). Secondary analyses revealed that the decline in PMRT use appeared at distances of more than 25 miles and was statistically significant for those patients living more than 75 miles from the nearest radiation facility (odds of receiving PMRT of 0.58 [95% CI 0.34-0.99] vs. living within 25 miles of such a facility). The effect of distance on PMRT appeared to be more pronounced with increasing patient age (>75 years). Variation in the effect of distance on radiation use between regions of the country and nodal status was also identified. Conclusions: Oncologists must be cognizant of the potential barrier to quality care that is posed by travel distance, especially for elderly patients; and policy makers should consider this fact in resource allocation decisions about radiation treatment centers.

Punglia, Rinaa S. [Department of Radiation Oncology, Dana-Farber Cancer Institute, Boston, MA (United States)]. E-mail: rpunglia@lroc.harvard.edu; Weeks, Jane C. [Division of Medical Oncology, Center for Outcomes and Policy Research, Dana-Farber Cancer Institute, Boston, MA (United States); Neville, Bridget A. [Division of Medical Oncology, Center for Outcomes and Policy Research, Dana-Farber Cancer Institute, Boston, MA (United States); Earle, Craig C. [Division of Medical Oncology, Center for Outcomes and Policy Research, Dana-Farber Cancer Institute, Boston, MA (United States)

2006-09-01T23:59:59.000Z

306

The New Suburbs: Evolving travel behavior, the built environment, and subway investments in Mexico City  

E-Print Network (OSTI)

analysis of built environment characteristics on householdTravel and the Built Environment -- A Meta-Analysis. Journalnon-work travel. Built Environment, 18(4), 253267. Hess, D.

Guerra, Erick

2013-01-01T23:59:59.000Z

307

Secretaries Chu and Locke to Travel to China Next Week | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretaries Chu and Locke to Travel to China Next Week Secretaries Chu and Locke to Travel to China Next Week July 6, 2009 - 12:00am Addthis WASHINGTON -- Energy Secretary Steven...

308

Enterprise design for services : a systems approach for the Boeing next generation corporate travel system architecture  

E-Print Network (OSTI)

Typically a company's second largest controllable expense, corporate travel affects many employees at Boeing. A challenge when implementing improvements in the travel and expense system, which is actually comprised of a ...

Silva, Hector E

2010-01-01T23:59:59.000Z

309

Energy Secretary Steven Chu to Travel to Bay Area to Highlight...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Steven Chu to Travel to Bay Area to Highlight State of the Union Address, Commitment to Clean Energy Energy Secretary Steven Chu to Travel to Bay Area to Highlight State of the...

310

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

311

Travelers Rest, South Carolina: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Travelers Rest, South Carolina: Energy Resources Travelers Rest, South Carolina: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 34.9676167°, -82.4434548° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.9676167,"lon":-82.4434548,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

312

Spent fuel utilization in a compact traveling wave reactor  

SciTech Connect

In recent years, several innovative designs of nuclear reactors are proposed. One of them is Traveling Wave Reactor (TWR). The unique characteristic of a TWR is the capability of breeding its own fuel in the reactor. The reactor is fueled by mostly depleted, natural uranium or spent nuclear fuel and a small amount of enriched uranium to initiate the fission process. Later on in the core, the reactor gradually converts the non-fissile material into the fissile in a process like a traveling wave. In this work, a TWR with spent nuclear fuel blanket was studied. Several parameters such as reactivity coefficients, delayed neutron fraction, prompt neutron generation lifetime, and fission power, were analyzed. The discharge burnup composition was also analyzed. The calculation is performed by a continuous energy Monte Carlo code McCARD.

Hartanto, Donny; Kim, Yonghee [Korea Advanced Institute of Science and Technology 373-1 Kusong-dong, Yuseong-gu, Daejeon, 305-701 (Korea, Republic of)

2012-06-06T23:59:59.000Z

313

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

314

Dendritic Actin Filament Nucleation Causes Traveling Waves and Patches  

E-Print Network (OSTI)

The polymerization of actin via branching at a cell membrane containing nucleation-promoting factors is simulated using a stochastic-growth methodology. The polymerized-actin distribution displays three types of behavior: a) traveling waves, b) moving patches, and c) random fluctuations. Increasing actin concentration causes a transition from patches to waves. The waves and patches move by a treadmilling mechanism which does not require myosin II. The effects of downregulation of key proteins on actin wave behavior are evaluated.

Anders E. Carlsson

2010-05-28T23:59:59.000Z

315

Inspection of the Secretary of Energy`s foreign travel  

SciTech Connect

On December 9, 1995, the Secretary of Energy requested that the Department`s Inspector General (IG) conduct a thorough examination of all Secretarial foreign travel from 1993 to December 1995 to include the purpose of each trip, the activities of each Federal participant in each trip, the funding of each trip, and claims for reimbursements for expenses by Federal trip participants. The Secretary also requested that the review include an assessment of travel authorization, voucher, traveler reimbursement, and auditing systems employed by the Department to identify steps that could be taken to reduce errors and improve accounting oversight. Additionally, the Secretary requested that the Inspector General conduct a thorough examination of the establishment and filling of the Department`s Ombudsman position. The Office of Inspector General (OIG) initiated a review into these matters and assigned primary responsibility for the review to the Office of Inspections. The purpose of this inspection was to conduct a thorough examination of the 16 Secretarial foreign trips from June 1993 to December 1995. This report focuses on the four trade missions because of their extent and cost. We examined a number of Departmental management systems and processes involved in planning and executing the 16 foreign trips. To determine the actual cost of the 16 trips, it was necessary to determine who participated in the trips and to identify the individual travel costs. We were required to perform extensive reviews of records and conduct a large number of interviews because the Department could not provide any specific documents that could accurately account for who actually participated on the 16 trips. Having identified who participated, it was then necessary to examine key aspects of the Department`s management systems. Our report contains 31 recommendations for corrective action.

1996-10-07T23:59:59.000Z

316

Laboratory Evaluation of Fine-mesh Traveling Water Screens  

Science Conference Proceedings (OSTI)

This report presents final results of four years of laboratory evaluations on performance of fine-mesh traveling water screens to protect larval fish at cooling water intake structures (CWISs). Prior to this study, the biological effectiveness of fine-mesh screens was uncertain because performance data from the few existing facilities that use fine-mesh screens have been highly variable. This project is producing additional data necessary to determine biological efficacy of fine-mesh screens.

2010-12-21T23:59:59.000Z

317

Molten metal feed system controlled with a traveling magnetic field  

DOE Patents (OSTI)

A continuous metal casting system in which the feed of molten metal is controlled by means of a linear induction motor capable of producing a magnetic traveling wave in a duct that connects a reservoir of molten metal to a caster. The linear induction motor produces a traveling magnetic wave in the duct in opposition to the pressure exerted by the head of molten metal in the reservoir so that p.sub.c =p.sub.g -p.sub.m where p.sub.c is the desired pressure in the caster, p.sub.g is the gravitational pressure in the duct exerted by the force of the head of molten metal in the reservoir, and p.sub.m is the electromagnetic pressure exerted by the force of the magnetic field traveling wave produced by the linear induction motor. The invention also includes feedback loops to the linear induction motor to control the casting pressure in response to measured characteristics of the metal being cast.

Praeg, Walter F. (Palos Park, IL)

1991-01-01T23:59:59.000Z

318

Molten metal feed system controlled with a traveling magnetic field  

DOE Patents (OSTI)

An apparatus for controlling the feed of molten metal in a continuous metal casting system comprising a linear induction motor capable of producing a magnetic traveling wave in a duct that connects a reservoir of molten metal to a caster. The linear induction motor produces a traveling magnetic wave in the duct in opposition to the pressure exerted by the head of molten metal in the reservoir so that p{sub c} = p{sub g} {minus} p{sub m} where p{sub c} is the desired pressure in the caster, p{sub g} is the gravitational pressure in the duct exerted by the force of the head of molten metal in the reservoir, and p{sub m} is the electromagnetic pressure exerted by the force of the magnetic field traveling wave produced by the linear induction motor. The invention also includes feedback loops to the linear induction motor to control the casting pressure in response to measured characteristic of the metal being cast. 8 figs.

Praeg, W.F.

1989-03-06T23:59:59.000Z

319

Travel determinants and multi-scale transferability of national activity patterns to local populations  

Science Conference Proceedings (OSTI)

The ability to transfer national travel patterns to a local population is of interest when attempting to model megaregions or areas that exceed metropolitan planning organization (MPO) boundaries. At the core of this research are questions about the connection between travel behavior and land use, urban form, and accessibility. As a part of this process, a group of land use variables have been identified to define activity and travel patterns for individuals and households. The 2001 National Household Travel Survey (NHTS) participants are divided into categories comprised of a set of latent cluster models representing persons, travel, and land use. These are compared to two sets of cluster models constructed for two local travel surveys. Comparison of means statistical tests are used to assess differences among sociodemographic groups residing in localities with similar land uses. The results show that the NHTS and the local surveys share mean population activity and travel characteristics. However, these similarities mask behavioral heterogeneity that are shown when distributions of activity and travel behavior are examined. Therefore, data from a national household travel survey cannot be used to model local population travel characteristics if the goal to model the actual distributions and not mean travel behavior characteristics.

Henson, Kriste M [Los Alamos National Laboratory; Gou; ias, Konstadinos G [UCSB

2010-11-30T23:59:59.000Z

320

How Do You Go Green When You Travel? | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Go Green When You Travel? Go Green When You Travel? How Do You Go Green When You Travel? September 30, 2010 - 7:30am Addthis On Monday, John told you about green travel and a program in his area that allows lodging facilities to verify that they are practicing green activities. Many of the activities, however, require that travelers take the step to be green. Choices such as less frequent linen service are opportunities to save water and energy while traveling. How do you go green when you travel? E-mail your responses to the Energy Saver team at consumer.webmaster@nrel.gov. Addthis Related Articles How Do You Reduce the Amount of Energy Used by Your Televisions? How Would You Use a Smart Meter to Manage Your Energy Use? How Has a Ceiling Fan Affected the Way You Heat and Cool Your Home

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Job Access, Commute, and Travel Burden Among Welfare Recipients  

E-Print Network (OSTI)

to Single Mothers after AFDC? Focus, 17(2), pp. 13-15.access on commute distance among AFDC recipients and furtherlabor market where most AFDC recipients are located. Given

Ong, Paul M.; Blumenberg, Evelyn

1997-01-01T23:59:59.000Z

322

2D Euclidean distance transform algorithms: A comparative survey  

Science Conference Proceedings (OSTI)

The distance transform (DT) is a general operator forming the basis of many methods in computer vision and geometry, with great potential for practical applications. However, all the optimal algorithms for the computation of the exact Euclidean DT (EDT) ... Keywords: Dijkstra's algorithm, Distance transform, computational geometry, exact Euclidean distance map, performance evaluation, shape analysis

Ricardo Fabbri; Luciano Da F. Costa; Julio C. Torelli; Odemir M. Bruno

2008-02-01T23:59:59.000Z

323

Time--Distance Helioseismology Data Analysis Pipeline for Helioseismic and Magnetic Imager onboard Solar Dynamics Observatory (SDO/HMI) and Its Initial Results  

E-Print Network (OSTI)

The Helioseismic and Magnetic Imager onboard the Solar Dynamics Observatory (SDO/HMI) provides continuous full-disk observations of solar oscillations. We develop a data-analysis pipeline based on the time-distance helioseismology method to measure acoustic travel times using HMI Doppler-shift observations, and infer solar interior properties by inverting these measurements. The pipeline is used for routine production of near-real-time full-disk maps of subsurface wave-speed perturbations and horizontal flow velocities for depths ranging from 0 to 20 Mm, every eight hours. In addition, Carrington synoptic maps for the subsurface properties are made from these full-disk maps. The pipeline can also be used for selected target areas and time periods. We explain details of the pipeline organization and procedures, including processing of the HMI Doppler observations, measurements of the travel times, inversions, and constructions of the full-disk and synoptic maps. Some initial results from the pipeline, includin...

Zhao, J; Bogart, R S; Parchevsky, K V; Birch, A C; Duvall, T L; Beck, J G; Kosovichev, A G; Scherrer, P H

2011-01-01T23:59:59.000Z

324

www.elsevier.com/locate/trc Willingness to pay for travel information  

E-Print Network (OSTI)

Improved travel information received via electronic sources can inform people about travel conditions and help them make travel decisions. The personal benefits of high quality travel information may motivate individuals to pay for information. This study analyzes travelers willingness to pay for better quality information received from a traveler information system offered through a publicprivate partnership in the San Francisco Bay Area. The data were collected in 1997 through a computer-aided telephone interview of individuals who called traveler advisory telephone system (TATS) and were willing to be interviewed (N 511). The survey results indicate that the average number of times per month the respondents called TATS was 4.80 (TATS was a free service at the time). The average use of the system would decline if the service was not improved but a service charge was initiated. People indicated that they were more willing to pay for a customized service. The impacts of travel information, travel context and socioeconomic variables on willingness to pay for information were analyzed by estimating a random-effects negative binomial regression model of revealed and stated TATS calling frequency. The results indicate that customized travel information, longer trips, worktrips, and listening to radio trafficreports are associated with higher TATS calling frequency and with greater willingness to pay for information. Overall, the consumer response to

Asad J. Khattak A; Youngbin Yim

2000-01-01T23:59:59.000Z

325

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

326

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

327

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

328

Distance Is Not Dead: Social Interaction and Geographical Distance in the Internet Era  

E-Print Network (OSTI)

The Internet revolution has made long-distance communication dramatically faster, easier, and cheaper than ever before. This, it has been argued, has decreased the importance of geographic proximity in social interactions, transforming our world into a global village with a borderless society. We argue for the opposite: while technology has undoubtedly increased the overall level of communication, this increase has been most pronounced for local social ties. We show that the volume of electronic communications is inversely proportional to geographic distance, following a Power Law. We directly study the importance of physical proximity in social interactions by analyzing the spatial dissemination of new baby names. Counter-intuitively, and in line with the above argument, the importance of geographic proximity has dramatically increased with the internet revolution.

Goldenberg, Jacob

2009-01-01T23:59:59.000Z

329

U. S. DEPARTMENT OF ENERGY REQUEST AND AUTHORIZATION FOR OFFICIAL TRAVEL (Change of Station)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

REQUEST AND AUTHORIZATION FOR OFFICIAL TRAVEL (Change of Station) REQUEST AND AUTHORIZATION FOR OFFICIAL TRAVEL (Change of Station) (Do Not Remove Carbons) DOE F 1510.9 (07-93) (Previously CR-279A) (07-89 edition may be used) 1. Amendment 2. Division/Office Code 3. (Leave Blank) Authorization Number 4. Employee's Name (First name, middle initial and last name) 5. Spouse Plans To: 6. No. of Dependents Age 12 and Over Traveling with Employee (excluding spouse) 7. No. of Dependents Under 12 Traveling with Employee 8. No. of Dependents Age 12 and Over Traveling Separately (excluding spouse) 9. No. of Dependents Under 12 Traveling Separately 10. Estimate in Whole Dollars (For Administrative Services Use) 11. Present Duty Station i. Total Items e. thru h. 12. Date 1 - Yr. Agreement

330

Modal shifts in short-haul passenger travel and the consequent energy impacts. [Intercity travel under 500 miles  

SciTech Connect

A study was performed to evaluate the impacts of strategies to effect modal shifts in short-haul passenger travel (defined herein as intercity travel under 500 miles) from energy-intensive modes to those modes that are less energy-intensive. A series of individual strategies, ranging from incentives to the less energy-intensive modes (bus, rail) to penalties to the more energy-intensive modes (auto, air) was examined to determine energy saved and policy implications relative to strategy implementation. The most effective of the individual strategies were then combined in all permutations, and the analysis was repeated. As part of the analytical process, effects of factors other than energy (user cost and time, emissions, government subsidy, and travel fatailities) were examined in a benefit/cost analysis. Finally, energy savings, benefit/cost impacts, implementation considerations, and policy implications were evaluated to arrive at conclusions as to the effectiveness of the more-influential strategies and to the overall effectiveness of induced modal shifts. The principal conclusion of the study is that the maximum 1980 energy saving that might be realized by modal shifts, discounting the concurrent effects of demand suppression and improvement of mode efficiency, is approximately 83 x 10/sup 12/ Btu (46,500 bbl gasoline per day), 3.8% of the total projected 1980 energy consumption in the short-haul transportation sector and 0.23% of the total US petroleum use. It was also concluded that strategies to achieve these small savings by modal shifts would result in significant economic, social, and business disruptions.

Not Available

1980-03-01T23:59:59.000Z

331

Highway travel and fuel comsumption from 1970 to 1980  

Science Conference Proceedings (OSTI)

The change in fuel price and availability (1970-80) has had a profound impact on the way and the extent of travel. Within the decade there were two precipitous increases in fuel price among a posture of steadily rising energy costs. In response to these price increases, a number of public policies were enacted. For instance, the 55-mph speed limit was imposed in 1974. At the end of that same year, the Federal Energy Administration and the Energy Policy and Conservation Act (EPCA) were formulated to prescribe certain conservation guidelines for states to follow in formulating their own programs. Specifically, EPCA established a program for the development of plans designed for the promotion of energy conservation and a reduction of the energy demand growth rate. Parallel to the conservation measures are technological improvements in vehicle fuel consumption. EPCA mandated that automobile manufacturers achieve fuel efficiency incrementally through 1985 to reach an average fuel economy of 27.5 mpg. This article reviews the historical impact of these factors from 1970 through 1980. Its objective is to observe the relative significance of each of these energy-saving alternatives on the growth rate of travel and fuel use. This historical perspective is particularly interesting since it presents the before-and-after effects of two ''crises'' occurring during this 10-year period. 1 figure, 10 tables.

Chan, Y.

1985-01-01T23:59:59.000Z

332

The New Suburbs: Evolving travel behavior, the built environment, and subway investments in Mexico City  

E-Print Network (OSTI)

analysis of built environment characteristics on householdand public policies. Environment and Planning A, 39(9),Travel and the Built Environment -- A Meta-Analysis. Journal

Guerra, Erick Strom

2013-01-01T23:59:59.000Z

333

The New Suburbs: Evolving travel behavior, the built environment, and subway investment in Mexico City  

E-Print Network (OSTI)

analysis of built environment characteristics on householdand public policies. Environment and Planning A, 39(9),Travel and the Built Environment -- A Meta-Analysis. Journal

Guerra, Erick Strom

2013-01-01T23:59:59.000Z

334

Video Transit Training for Older Travelers: A Case Study of the Rossmoor Senior Adult Community, California  

E-Print Network (OSTI)

Video Transit Training for Older Travelers Case Study of theto develop a transit training video for residents of themunity in California. The video features familiar community

Shaheen, Susan A; Rodier, Caroline J

2008-01-01T23:59:59.000Z

335

Video Transit Training for Older Travelers: A Case Study of the Rossmoor Senior Adult Community, California  

E-Print Network (OSTI)

Video Transit Training for Older Travelers Case Study of theto develop a transit training video for residents of themunity in California. The video features familiar community

Shaheen, Susan; Rodier, Caroline J.

2007-01-01T23:59:59.000Z

336

KCP installs steel cable mesh that can stop a 20 pound item traveling...  

NLE Websites -- All DOE Office Websites (Extended Search)

item traveling 240 mph Posted By Office of Public Affairs Construction of the Kansas City Plant at the new National Security Campus has included some unique building...

337

Design of traveling wave windows for the PEP-II RF coupling network  

SciTech Connect

The waveguide windows in the PEP-II RF coupling network have to withstand high power of 500 kW. Traveling wave windows have lower power dissipation than conventional self-matched windows, thus rendering the possibility of less stringent mechanical design. The traveling wave behavior is achieved by providing a reflecting iris on each side of the window, and depending on the configuration of the irises, traveling wave windows are characterized as inductive or capacitive types. A numerical design procedure using MAFIA has been developed for traveling wave windows. The relative advantages of inductive and capacitive windows are discussed. Furthermore, the issues of bandwidth and multipactoring are also addressed.

Kroll, N.M.; Ng, C.K.; Judkins, J.; Neubauer, M.

1995-05-01T23:59:59.000Z

338

DOE M 552.1-1A, U.S. Department of Energy Travel Manual  

Directives, Delegations, and Requirements

The Manual supplements information in the Federal Travel Regulation (FTR) by providing further clarification and establishing Department of Energy (DOE) policy ...

2006-02-17T23:59:59.000Z

339

Potential Impacts of Climate Change on Urban Flooding: Implications for Transportation Infrastructure and Travel Disruption  

E-Print Network (OSTI)

hydrology. Transportation infrastructure and travel patternsnot only damaged various infrastructures but also disruptednot hold true in new infrastructure design and management (

Chang, Heejun; Lafrenz, Martin; Jung, II-Won; Figliozzi, Miguell; Platman, Deena

2009-01-01T23:59:59.000Z

340

A California Statewide Exploratory Analysis Correlating Land Use Density, Infrastructure Supply and Travel Behavior  

E-Print Network (OSTI)

Land Use Density, Infrastructure Supply and Travel Behaviorof employment and infrastructure supply are used togetherCalifonia. Land use and infrastructure have a significant,

Yoon, Seo Youn; Golob, Thomas F.; Goulias, Konstadinos G.

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Journeys in the Palimpsest: British women's travel to Greece,1840-1914.  

E-Print Network (OSTI)

??Discussions of British travel to Greece in the nineteenth century have been dominated by the work of Lord Byron. Byrons contemporary Greeks were Orientalised, while (more)

Mahn, Churnjeet Kaur

2007-01-01T23:59:59.000Z

342

Preference accommodating and preference shaping : incorporating traveler preferences into transportation planning  

E-Print Network (OSTI)

This dissertation examines the psychological factors that influence travel behavior such as people's personality traits, environmental attitudes, car pride and perceptions of convenience and comfort. Despite the recognition ...

Zhao, Jinhua, 1977-

2009-01-01T23:59:59.000Z

343

Secretary Bodman to Travel to the Middle East to Advance International...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

efficiency. Secretary Bodman will depart on Monday, January 14, 2008 and travel to Jordan, Saudi Arabia, United Arab Emirates, Qatar and Egypt. "To increase global energy...

344

On electric resistances for distance-regular graphs  

E-Print Network (OSTI)

We investigate the behavior of electric potentials on distance-regular graphs, and extend some results of a prior paper. Our main result, Theorem 4, shows(together with Corollary 3) that if distance is measured by the electric resistance between points then all points are close to being equidistant on a distance-regular graph with large valency. A number of auxiliary results are also presented.

Koolen, Jack; Park, Jongyook

2011-01-01T23:59:59.000Z

345

Hazardous Waste Minimum Distance Requirements (Connecticut) | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minimum Distance Requirements (Connecticut) Minimum Distance Requirements (Connecticut) Hazardous Waste Minimum Distance Requirements (Connecticut) < Back Eligibility Agricultural Commercial Construction Fed. Government Fuel Distributor General Public/Consumer Industrial Installer/Contractor Institutional Investor-Owned Utility Local Government Low-Income Residential Multi-Family Residential Municipal/Public Utility Nonprofit Residential Retail Supplier Rural Electric Cooperative Schools State/Provincial Govt Systems Integrator Transportation Tribal Government Utility Program Info State Connecticut Program Type Siting and Permitting Provider Department of Energy and Environmental Protection These regulations set minimum distance requirements between certain types of facilities that generate, process, store, and dispose of hazardous waste

346

Spatial chemical distance based on atomic property fields  

E-Print Network (OSTI)

009-9316-x Spatial chemical distance based on atomicSimilarity of compound chemical structures often leads tonot always true, as distinct chemical scaffolds can exhibit

Grigoryan, A. V.; Kufareva, I.; Totrov, M.; Abagyan, R. A.

2010-01-01T23:59:59.000Z

347

Consumer Adoption of Online Banking: Does Distance Matter?  

E-Print Network (OSTI)

Adoption of Online Banking: Does Distance Matter? Beethikaand Goolsbee, Austan (2002). "Does the Internet Make Marketsto the closest bank branch does not affect the likelihood of

Khan, Beethika S.

2004-01-01T23:59:59.000Z

348

Brain teasers traveling exhibit opens at Los Alamos National Laboratory's  

NLE Websites -- All DOE Office Websites (Extended Search)

Brain teasers exhibit opens at museum Brain teasers exhibit opens at museum Brain Teasers traveling exhibit opens at Los Alamos National Laboratory's Bradbury Science Museum The interactive exhibit is a collection of more than 20 puzzles and mind benders. December 4, 2008 Los Alamos National Laboratory sits on top of a once-remote mesa in northern New Mexico with the Jemez mountains as a backdrop to research and innovation covering multi-disciplines from bioscience, sustainable energy sources, to plasma physics and new materials. Los Alamos National Laboratory sits on top of a once-remote mesa in northern New Mexico with the Jemez mountains as a backdrop to research and innovation covering multi-disciplines from bioscience, sustainable energy sources, to plasma physics and new materials. Contact

349

Tiny travelers from deep space could assist in healing Fukushima's  

NLE Websites -- All DOE Office Websites (Extended Search)

Fukushima Daiichi nuclear reactors Fukushima Daiichi nuclear reactors Tiny travelers from deep space could assist in healing Fukushima's nuclear scar Researchers have devised a method to use cosmic rays to gather detailed information from inside the damaged cores of the Fukushima Daiichi nuclear reactors. October 17, 2012 Los Alamos National Laboratory Muon Radiography team members stand in front of the damaged Fukushima Daiichi reactor complex during a visit to determine evaluate whether Los Alamos' Scattering Method for cosmic-ray radiography could be used to image the location of nuclear materials within the reactor buildings. Los Alamos National Laboratory Muon Radiography team members stand in front of the damaged Fukushima Daiichi reactor complex during a visit to determine evaluate whether Los Alamos' Scattering Method for cosmic-ray

350

Secretary Bodman Travels to Russia to Advance Energy Security | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Russia to Advance Energy Security Russia to Advance Energy Security Secretary Bodman Travels to Russia to Advance Energy Security March 15, 2006 - 12:20pm Addthis Promotes Transparent Markets and Clean Energy Technologies; Participates in G8 Energy Ministerial and Delivers Remarks on the Global Nuclear Energy Partnership MOSCOW, RUSSIA-U.S. Secretary of Energy Samuel W. Bodman today began a two-day visit to Russia where he will lead the U.S. delegation to the G8 Energy Ministerial. During his visit the Secretary will promote greater energy security through the use of advanced energy technologies, the promotion of stable and transparent investment climates, and increased conservation and energy efficiency. Secretary Bodman will also deliver remarks to the Carnegie Center on the Global Nuclear Energy Partnership

351

Secretary Bodman Travels to Saudi Arabia to Discuss Global Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Saudi Arabia to Discuss Global Energy Saudi Arabia to Discuss Global Energy Investments Secretary Bodman Travels to Saudi Arabia to Discuss Global Energy Investments January 19, 2007 - 10:38am Addthis Furthers Strategic Energy Dialogue between the Nations and Highlights U.S. - Saudi Scientific Innovation RIYADH, SAUDI ARABIA - U.S. Secretary of Energy Samuel W. Bodman today continued his six-nation visit to the Middle East and Europe with a two-day stop in Saudi Arabia where he met with Saudi Arabia's Minister of Petroleum and Mineral Resources Ali Ibrahim Al-Naimi to discuss joint energy cooperation. Secretary Bodman also toured the King Abdul-Aziz City for Science and Technology (KACST) and will tour the King Abdullah University of Science and Technology during his visit. "The United States and Saudi Arabia enjoy a relationship of global

352

Secretary Bodman Travels to the Middle East | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

the Middle East the Middle East Secretary Bodman Travels to the Middle East November 10, 2005 - 2:22pm Addthis Four-nation swing to emphasize domestic energy needs and goals WASHINGTON, DC - Secretary of Energy Samuel W. Bodman embarked upon a four-nation tour through the Middle East to enhance the United States' relationship with major oil-producing nations, promote economic liberalization and increased foreign investment in the region, and reaffirm U.S. energy policy goals. "Both consumers and producers of energy depend on a vibrant, growing world economy. By working together we can increase the energy and economic security of the United States and our international partners and pursue continued growth and prosperity in developed and developing nations," Secretary Bodman said.

353

Traveling-wave device with mass flux suppression  

DOE Patents (OSTI)

A traveling-wave device is provided with the conventional moving pistons eliminated. Acoustic energy circulates in a direction through a fluid within a torus. A side branch may be connected to the torus for transferring acoustic energy into or out of the torus. A regenerator is located in the torus with a first heat exchanger located on a first side of the regenerator downstream of the regenerator relative to the direction of the circulating acoustic energy; and a second heat exchanger located on an upstream side of the regenerator. The improvement is a mass flux suppressor located in the torus to minimize time-averaged mass flux of the fluid. In one embodiment, the device further includes a thermal buffer column in the torus to thermally isolate the heat exchanger that is at the operating temperature of the device.

Swift, Gregory W. (Santa Fe, NM); Backhaus, Scott N. (Los Alamos, NM); Gardner, David L. (White Rock, NM)

2000-01-01T23:59:59.000Z

354

Neutron damage reduction in a traveling wave reactor  

Science Conference Proceedings (OSTI)

Traveling wave reactors are envisioned to run on depleted or natural uranium with no need for enrichment or reprocessing, and in a manner which requires little to no operator intervention. If feasible, this type of reactor has significant advantages over conventional nuclear power systems. However, a practical implementation of this concept is challenging as neutron irradiation levels many times greater than those in conventional reactors appear to be required for a fission wave to propagate. Radiation damage to the fuel and cladding materials presents a significant obstacle to a practical design. One possibility for reducing damage is to soften the neutron energy spectrum. Here we show that using a uranium oxide fuel form will allow a shift in the neutron spectrum that can result in at least a three fold decrease in dpa levels for fuel cladding and structural steels within the reactor compared with the dpa levels expected when using a uranium metal fuel. (authors)

Osborne, A. G.; Deinert, M. R. [Dept. of Mechanical Engineering, Univ. of Texas at Austin, Austin, TX (United States)

2012-07-01T23:59:59.000Z

355

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

356

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

357

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

358

An extreme-distance approach to multiple criteria ranking  

Science Conference Proceedings (OSTI)

A distance approach based on extreme points, or predefined ideal and anti-ideal points, is proposed to improve on the TOPSIS (Technique for Order Performance [or Ordered Preference] by Similarity to Ideal Solution) method of multiple criteria ranking. ... Keywords: Comparative study, Distance-based ranking, Multiple criteria decision analysis, Multiple criteria ranking, TOPSIS

Ye Chen; D. Marc Kilgour; Keith W. Hipel

2011-03-01T23:59:59.000Z

359

Computing the Frchet distance between piecewise smooth curves  

Science Conference Proceedings (OSTI)

We consider the Frechet distance between two curves which are given as a sequence of m+n curved pieces. If these pieces are sufficiently well-behaved, we can compute the Frechet distance in O(mnlog(mn)) time. The decision version of the problem can be ... Keywords: Shape matching

Gnter Rote

2007-08-01T23:59:59.000Z

360

A Novel Distributed Simulation Approach in Adaptive Distance Relaying  

Science Conference Proceedings (OSTI)

In this paper, an adaptive distance relaying strategy based on the global network simulation (GNS) concept is presented. The GNS concept is actually a distributed simulation approach (DSA) for piecewise analysis of large-scale power grids using diakoptics ... Keywords: adaptive distance relaying, coordination rules, diakoptics, distributed simulation approach (DSA), global network simulation (GNS), large change sensitivity (LCS), mutually coupled lines

V. Gohari Sadr; S.M. Kouhsari

2009-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Optimal selection of robots by using distance based approach method  

Science Conference Proceedings (OSTI)

A deterministic quantitative model based on Distance Based Approach (DBA) method has been developed for evaluation, selection and ranking of robots, which is a concept hitherto not employed in selection problem of this kind. As a significant development ... Keywords: Distance based approach, Optimized selection, Ranking, Robots

Rishi Kumar; R. K. Garg

2010-10-01T23:59:59.000Z

362

A Collaborative Case Study System for Distance Learning  

Science Conference Proceedings (OSTI)

Distance Learning from Case Studies involves enabling collaboration between two or more learners at a distance on a case study activity. In this paper we present an empirical qualitative study that simulates a learning scenario in which a pair of subjects ...

Marta C. Rosatelli; John A. Self

2004-01-01T23:59:59.000Z

363

Measuring Dialect Distance Phonetically John Nerbonne and Wilbert Heeringa  

E-Print Network (OSTI)

- tance, both simple (based on atomic char- acters) and complex (based on feature vec- tors). The measurements using feature vec- tors varied according to whether city-block distance, Euclidean distance or (a sensitive, that city-block dis- tance is a good measure of phonetic over- lap of feature vectors

364

Measurements of the travel?time bias caused by internal waves  

Science Conference Proceedings (OSTI)

Theoretical work and computer simulations predict that the travel?time of acoustic signals is biased by the ocean internal wave field. The path integral theory for scattering predicts that the size of the travel time bias depends on the logarithm of the center frequency of the acoustic signal. A recent experiment

Matthew Dzieciuch; the AST Group

1998-01-01T23:59:59.000Z

365

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

366

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

26 26 Overall electrical energy consumption (AC Wh/mi) 253 Number of trips¹ 526,156 Total distance traveled (mi) 4,369,753 Avg trip distance (mi)² 8.2 Avg distance traveled per day when the vehicle was driven (mi) 39.4 Avg number of trips between charging events 3.4 Avg distance traveled between charging events (mi) 27.9 Avg number of charging events per day when the vehicle was driven 1.4 EV Project Chevrolet Volt Vehicle Summary Report Region: ALL Number of vehicles: 1766 Reporting period: January 2013 through March 2013 Charging Location Home charging location³ Away-from-home charging locations Unknown charging locations Total number of charging events 124,954 21,973 7,718 Percent of all charging events 81% 14% 5% 1 A trip is defined as all the driving done between consecutive "key-on" and "key-off" events when some distance was traveled.

367

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

26 26 Overall electrical energy consumption (AC Wh/mi) 229 Number of trips¹ 369,118 Total distance traveled (mi) 3,001,976 Avg trip distance (mi) 8.1 Avg distance traveled per day when the vehicle was driven (mi) 40.5 Avg number of trips between charging events 3.5 Avg distance traveled between charging events (mi) 28.2 Avg number of charging events per day when the vehicle was driven 1.4 EV Project Chevrolet Volt Vehicle Summary Report Region: ALL Number of vehicles: 1021 Reporting period: October 2012 through December 2012 Charging Location and Type Home charging location² Away-from- home charging locations³ Unknown charging locations Number of charging events 86,264 13,547 6,698 Percent of all charging events 81% 13% 6% 1 A trip is defined as all the driving done between consecutive "key-on" and "key-off" events when some distance was traveled.

368

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

55 55 Overall electrical energy consumption (AC Wh/mi) 242 Number of trips¹ 147,886 Total distance traveled (mi) 1,184,265 Avg trip distance (mi) 8.0 Avg distance traveled per day when the vehicle was driven (mi) 39.6 Avg number of trips between charging events 3.2 Avg distance traveled between charging events (mi) 26.0 Avg number of charging events per day when the vehicle was driven 1.5 EV Project Chevrolet Volt Vehicle Summary Report Region: ALL Number of vehicles: 408 Reporting period: April 2012 through June 2012 Charging Location and Type Home charging location² Away-from- home charging locations³ Unknown charging locations Number of charging events 36,015 6,374 3,179 Percent of all charging events 79% 14% 7% 1 A trip is defined as all the driving done between consecutive "key-on" and "key-off" events when some distance was traveled.

369

Alaska North Slope Tundra Travel Model and Validation Study  

SciTech Connect

The Alaska Department of Natural Resources (DNR), Division of Mining, Land, and Water manages cross-country travel, typically associated with hydrocarbon exploration and development, on Alaska's arctic North Slope. This project is intended to provide natural resource managers with objective, quantitative data to assist decision making regarding opening of the tundra to cross-country travel. DNR designed standardized, controlled field trials, with baseline data, to investigate the relationships present between winter exploration vehicle treatments and the independent variables of ground hardness, snow depth, and snow slab thickness, as they relate to the dependent variables of active layer depth, soil moisture, and photosynthetically active radiation (a proxy for plant disturbance). Changes in the dependent variables were used as indicators of tundra disturbance. Two main tundra community types were studied: Coastal Plain (wet graminoid/moist sedge shrub) and Foothills (tussock). DNR constructed four models to address physical soil properties: two models for each main community type, one predicting change in depth of active layer and a second predicting change in soil moisture. DNR also investigated the limited potential management utility in using soil temperature, the amount of photosynthetically active radiation (PAR) absorbed by plants, and changes in microphotography as tools for the identification of disturbance in the field. DNR operated under the assumption that changes in the abiotic factors of active layer depth and soil moisture drive alteration in tundra vegetation structure and composition. Statistically significant differences in depth of active layer, soil moisture at a 15 cm depth, soil temperature at a 15 cm depth, and the absorption of photosynthetically active radiation were found among treatment cells and among treatment types. The models were unable to thoroughly investigate the interacting role between snow depth and disturbance due to a lack of variability in snow depth cover throughout the period of field experimentation. The amount of change in disturbance indicators was greater in the tundra communities of the Foothills than in those of the Coastal Plain. However the overall level of change in both community types was less than expected. In Coastal Plain communities, ground hardness and snow slab thickness were found to play an important role in change in active layer depth and soil moisture as a result of treatment. In the Foothills communities, snow cover had the most influence on active layer depth and soil moisture as a result of treatment. Once certain minimum thresholds for ground hardness, snow slab thickness, and snow depth were attained, it appeared that little or no additive effect was realized regarding increased resistance to disturbance in the tundra communities studied. DNR used the results of this modeling project to set a standard for maximum permissible disturbance of cross-country tundra travel, with the threshold set below the widely accepted standard of Low Disturbance levels (as determined by the U.S. Fish and Wildlife Service). DNR followed the modeling project with a validation study, which seemed to support the field trial conclusions and indicated that the standard set for maximum permissible disturbance exhibits a conservative bias in favor of environmental protection. Finally DNR established a quick and efficient tool for visual estimations of disturbance to determine when investment in field measurements is warranted. This Visual Assessment System (VAS) seemed to support the plot disturbance measurements taking during the modeling and validation phases of this project.

Harry R. Bader; Jacynthe Guimond

2006-03-01T23:59:59.000Z

370

Three-cell traveling wave superconducting test structure  

Science Conference Proceedings (OSTI)

Use of a superconducting traveling wave accelerating (STWA) structure with a small phase advance per cell rather than a standing wave structure may provide a significant increase of the accelerating gradient in the ILC linac. For the same surface electric and magnetic fields the STWA achieves an accelerating gradient 1.2 larger than TESLA-like standing wave cavities. The STWA allows also longer acceleration cavities, reducing the number of gaps between them. However, the STWA structure requires a SC feedback waveguide to return the few hundreds of MW of circulating RF power from the structure output to the structure input. A test single-cell cavity with feedback was designed, manufactured and successfully tested demonstrating the possibility of a proper processing to achieve a high accelerating gradient. These results open way to take the next step of the TW SC cavity development: to build and test a travelingwave three-cell cavity with a feedback waveguide. The latest results of the single-cell cavity tests are discussed as well as the design of the test 3-cell TW cavity.

Avrakhov, Pavel; Kanareykin, Alexei; /Euclid Techlabs, Solon; Kazakov, Sergey; Solyak, Nikolay; Wu, Genfa; Yakovlev, Vyacheslav P.; /Fermilab

2011-03-01T23:59:59.000Z

371

PARTICLE ENERGY SPECTRA AT TRAVELING INTERPLANETARY SHOCK WAVES  

Science Conference Proceedings (OSTI)

We have searched for evidence of significant shock acceleration of He ions of {approx}1-10 MeV amu{sup -1} in situ at 258 interplanetary traveling shock waves observed by the Wind spacecraft. We find that the probability of observing significant acceleration, and the particle intensity observed, depends strongly upon the shock speed and less strongly upon the shock compression ratio. For most of the 39 fast shocks with significant acceleration, the observed spectral index agrees with either that calculated from the shock compression ratio or with the spectral index of the upstream background, when the latter spectrum is harder, as expected from diffusive shock theory. In many events the spectra are observed to roll downward at higher energies, as expected from Ellison-Ramaty and from Lee shock-acceleration theories. The dearth of acceleration at {approx}85% of the shocks is explained by (1) a low shock speed, (2) a low shock compression ratio, and (3) a low value of the shock-normal angle with the magnetic field, which may cause the energy spectra that roll downward at energies below our observational threshold. Quasi-parallel shock waves are rarely able to produce measurable acceleration at 1 AU. The dependence of intensity on shock speed, seen here at local shocks, mirrors the dependence found previously for the peak intensities in large solar energetic-particle events upon speeds of the associated coronal mass ejections which drive the shocks.

Reames, Donald V., E-mail: dvreames@umd.edu [Institute for Physical Science and Technology, University of Maryland, College Park, MD 20742 (United States)

2012-09-20T23:59:59.000Z

372

On some essential peculiarities of the traveling wave reactor operation  

E-Print Network (OSTI)

On the basis of conditions for existence of nuclear burning wave in neutron-multiplicating media (U-Pu and Th-U cycles) we show the possibility of surmounting so-called dpa-parameter problem, or in other words, an algorithm of optimal nuclear burning wave mode is proposed yielding parameters of the wave (fluence/neutron flux, width and speed of nuclear burning wave) satisfying the dpa-condition, characterizing the tolerable level of radioactive stability of reactor materials, in particular the cladding materials. It is shown for the first time that capture and fission cross-sections of 238U and 239Pu increase with temperature within 1000-3000K range, that under certain conditions may lead to global loss of stability of nuclear burning wave. Some variants of possible stability loss due to so-called blow-up modes, or in other words, anomalous nuclear fuel temperature and neutron flow evolution are discussed and are found to possibly become a reason for trivial violation of internal safety of traveling wave reac...

Rusov, V D; Sharf, I V; Vaschenko, V M; Linnik, E P; Zelentsova, T N; Beglaryan, M E; Chernegenko, S A; Kosenko, S I; Molchinikolov, P A; Smolyar, V P; Grechan, E V

2012-01-01T23:59:59.000Z

373

On some essential peculiarities of the traveling wave reactor operation  

E-Print Network (OSTI)

On the basis of conditions for existence of nuclear burning wave in neutron-multiplicating media (U-Pu and Th-U cycles) we show the possibility of surmounting so-called dpa-parameter problem, or in other words, an algorithm of optimal nuclear burning wave mode is proposed yielding parameters of the wave (fluence/neutron flux, width and speed of nuclear burning wave) satisfying the dpa-condition, characterizing the tolerable level of radioactive stability of reactor materials, in particular the cladding materials. It is shown for the first time that capture and fission cross-sections of 238U and 239Pu increase with temperature within 1000-3000K range, that under certain conditions may lead to global loss of stability of nuclear burning wave. Some variants of possible stability loss due to so-called blow-up modes, or in other words, anomalous nuclear fuel temperature and neutron flow evolution are discussed and are found to possibly become a reason for trivial violation of internal safety of traveling wave reactor.

V. D. Rusov; V. A. Tarasov; I. V. Sharf; V. M. Vaschenko; E. P. Linnik; T. N. Zelentsova; M. E. Beglaryan; S. A. Chernegenko; S. I. Kosenko; P. A. Molchinikolov; V. P. Smolyar; E. V. Grechan

2012-07-16T23:59:59.000Z

374

Incident detection using the Standard Normal Deviate model and travel time information from probe vehicles  

E-Print Network (OSTI)

One application of travel time information explored in this thesis is freeway incident detection. It is vital to develop reliable methods for automatically detecting incidents to facilitate the quick response and removal of incidents before they cause breakdowns in traffic flow. The use of real-time travel time data to monitor freeway conditions has the advantages over conventional loop detectors of taking into account the dynamic, longitudinal nature of traffic flow and requiring data from only a portion of the traffic stream. This study employed the Standard Normal Deviate (SND) Model to test the feasibility of using travel time data to detect lane blocking incidents. The fundamental concept of the SND Model was based on the comparison of real-time travel time data to historical travel time data for given freeway segments during specified times. The travel time and incident reports used were collected through the Real-Time Traffic Information System (RTTIS) in the north freeway corridor of Houston, Texas using probe vehicles equipped with cellular telephones. The data were compiled on 39 freeway links from October 1991 through August 1992 on weekdays during morning and afternoon data collection periods. The results of incident detection tests, applying the SND Model to incident and travel time me data from the North Freeway, indicated high successful incident detection rates. However, high false alarm rates also resulted from the SND Model test applications. An optimum SND value of 2.0 was observed for the North Freeway test data. At this value the SND tests produced successful incident detection rates of 70 percent and higher during both the morning and afternoon periods. False alarm rates were also 70 percent. The best results were achieved on those freeway sections where the most incident and travel time data had been collected. The overall results of the incident detection tests on the North Freeway demonstrated that the SND Model was a feasible incident detection algorithm, but required an extensive historical travel time data base.

Mountain, Christopher Eugene

1993-01-01T23:59:59.000Z

375

TTB or not TTB, that is the question: a review and analysis of the empirical literature on travel time (and money) budgets  

E-Print Network (OSTI)

for the Allocation of Time and Money. Unpublished Ph.D.Expenditure of Time and Money on Travel. Transportationin Travel Time and Money Expenditures. Transportation

Mokhtarian, Patricia L; Chen, C

2004-01-01T23:59:59.000Z

376

Distance visualization of ultrascale data with explorable images  

Science Conference Proceedings (OSTI)

This talk presents a new approach to distance visualization of very large data sets output from scientific supercomputing. The processing power of massively parallel supercomputers increases at a rather fast rate, about an order of magnitude faster every ...

Kwan-Liu Ma; Anna Tikhonova; Carlos D. Correa

2010-07-01T23:59:59.000Z

377

Redshift-Independent Distances to Type Ia Supernovae  

E-Print Network (OSTI)

We describe a procedure for accurately determining luminosity distances to Type Ia supernovae (SNe Ia) without knowledge of redshift. This procedure, which may be used as an extension of any of the various distance determination methods currently in use, is based on marginalizing over redshift, removing the requirement of knowing $z$ a priori. We demonstrate that the Hubble diagram scatter of distances measured with this technique is approximately equal to that of distances derived from conventional redshift-specific methods for a set of 60 nearby SNe Ia. This indicates that accurate distances for cosmological SNe Ia may be determined without the requirement of spectroscopic redshifts, which are typically the limiting factor for the number of SNe that modern surveys can collect. Removing this limitation would greatly increase the number of SNe for which current and future SN surveys will be able to accurately measure distance. The method may also be able to be used for high-$z$ SNe Ia to determine cosmological density parameters without redshift information.

Brian J. Barris; John L. Tonry

2004-08-04T23:59:59.000Z

378

SBF Distances to Leo and Virgo using the HST  

E-Print Network (OSTI)

We have used archive HST WFPC2 data for three elliptical galaxies (NGC 3379 in the Leo I group, and NGC 4472 and NGC 4406 in the Virgo cluster) to determine their distances using the Surface Brightness Fluctuation (SBF) method as described by Tonry and Schneider (1988). A comparison of the HST results with the SBF distance moduli of Ciardullo et al (1993) shows significant disagreement and suggests that the r.m.s. error on these ground-based distance moduli is actually as large as +-0.25 mag. The agreement is only slightly improved when we compare our results with the HST and ground-based SBF distances from Ajhar et al (1997) and Tonry et al (1997); the comparison suggests that a lower limit on the error of the HST SBF distance moduli is +-0.17 mag. Overall, these results suggest that previously quoted measurement errors may underestimate the true error in SBF distance moduli by at least a factor of 2-3.

P. W. Morris; T. Shanks

1998-02-05T23:59:59.000Z

379

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

380

Statement on U.S. Secretary of Energy Ernest Moniz's Travel to Istanbul,  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

on U.S. Secretary of Energy Ernest Moniz's Travel to on U.S. Secretary of Energy Ernest Moniz's Travel to Istanbul, Turkey Statement on U.S. Secretary of Energy Ernest Moniz's Travel to Istanbul, Turkey November 19, 2013 - 9:48am Addthis NEWS MEDIA CONTACT (202) 586-4940 "U.S. Secretary of Energy Ernest Moniz will travel to Istanbul, Turkey November 20 to 23 and give opening remarks at the 5th Atlantic Council Energy Summit. Secretary Moniz will also attend the Ministerial meeting on 'Energy Efficiency for Economic Growth' with industry leaders, experts, and other government representatives. "During his stay in Istanbul, Secretary Moniz will meet with senior Turkish officials on a broad range of issues including clean energy, energy efficiency, and energy security. "Secretary Moniz is committed to maintain and grow the strong trade and

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Secretary Bodman to Travel to the Middle East to Advance International  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to Travel to the Middle East to Advance to Travel to the Middle East to Advance International Energy Cooperation Secretary Bodman to Travel to the Middle East to Advance International Energy Cooperation January 10, 2008 - 10:23am Addthis WASHINGTON, DC - U.S. Secretary of Energy Samuel W. Bodman next week will embark on a five-nation tour through the Middle East to enhance the United States' relationship with oil-producing nations, promote sustained investment in conventional and alternative energy sources, and encourage improvements in global energy efficiency. Secretary Bodman will depart on Monday, January 14, 2008 and travel to Jordan, Saudi Arabia, United Arab Emirates, Qatar and Egypt. "To increase global energy security, producing and consuming nations alike must make robust investments in a diversity of energy sources, accelerate

382

Secretary Bodman To Travel to Vienna, Austria for Second GNEP Ministerial  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Bodman To Travel to Vienna, Austria for Second GNEP Secretary Bodman To Travel to Vienna, Austria for Second GNEP Ministerial and IAEA General Conference Secretary Bodman To Travel to Vienna, Austria for Second GNEP Ministerial and IAEA General Conference A letter issued by the Department of Energy's Office of Public Affairs detailling the mission behind the U.S. Secretary of Energy Samuel W. Bodman's trip to Vienna, Austria, to chair the second Global Nuclear Energy Partnership (GNEP) Ministerial on Sunday, September 16, 2007, with partner countries: China, France, Japan, and Russia. Secretary Bodman To Travel to Vienna, Austria for Second GNEP Ministerial and IAEA General Conference More Documents & Publications GNEP-IAEA_Conference_Announcement.pdf Senior Delegation Officials From All GNEP Participants

383

Energy Secretary Bodman Travels to Moscow, Baku, Kiev to Discuss Energy and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Travels to Moscow, Baku, Kiev to Discuss Travels to Moscow, Baku, Kiev to Discuss Energy and Nuclear Security Energy Secretary Bodman Travels to Moscow, Baku, Kiev to Discuss Energy and Nuclear Security May 20, 2005 - 12:49pm Addthis Trip Will Focus on World Energy Security, Energy Resource Development, and Nuclear Nonproliferation WASHINGTON, DC -- Secretary of Energy Samuel Bodman next week will travel to Moscow, Russia; Baku, Azerbaijan; and Kiev, Ukraine, where he will hold discussions with senior officials on a variety of energy and nuclear safety issues, including encouraging the development of diverse energy resources, promoting market transparency and investment, and advancing nuclear nonproliferation. "A healthy, vibrant and transparent global energy market is critical to the economic success of America and all nations," Secretary Bodman said.

384

Secretary Chu To Travel to Scotland and Ireland | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

To Travel to Scotland and Ireland To Travel to Scotland and Ireland Secretary Chu To Travel to Scotland and Ireland November 1, 2010 - 12:00am Addthis Washington, D.C. - This week, Secretary Chu will travel to Scotland and Ireland where he will meet with government and academic leaders, as well as American and Irish business leaders who are engaged in clean energy industries. Both Scotland and Ireland share similar energy challenges and resources with the United States, including significant offshore wind energy potential. These countries have set rigorous renewable energy goals, including wind and water power, towards meeting the European Union's target of 20 percent energy from renewable sources by 2020. Glasgow, Scotland On Tuesday, November 2, Secretary Chu will deliver a keynote address at the

385

Secretary Chu and Energy Department Officials to Travel Across America to  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu and Energy Department Officials to Travel Across Secretary Chu and Energy Department Officials to Travel Across America to Discuss the Obama Administration's Commitment to Energy Innovation and Manufacturing Secretary Chu and Energy Department Officials to Travel Across America to Discuss the Obama Administration's Commitment to Energy Innovation and Manufacturing January 24, 2012 - 3:47pm Addthis Washington D.C. - This week, Energy Secretary Steven Chu, Deputy Secretary Daniel Poneman and other senior Energy Department officials will participate in events across the country to highlight President Obama's State of the Union address and discuss the Obama Administration's commitment to energy innovation and advanced manufacturing. On Thursday, January 26, Secretary of Energy Steven Chu will travel to Albuquerque, N.M., to tour renewable energy research facilities at Sandia

386

Secretary Chu will Travel to China to Highlight Clean Energy Partnerships |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chu will Travel to China to Highlight Clean Energy Chu will Travel to China to Highlight Clean Energy Partnerships Secretary Chu will Travel to China to Highlight Clean Energy Partnerships April 28, 2010 - 12:00am Addthis WASHINGTON - U.S. Energy Secretary Steven Chu will travel to China from May 24th to 28th to highlight the benefit of U.S.-China partnerships and cooperation in the clean energy sector. He will visit with government officials, academia and members of the private sector in both Beijing and Shanghai to learn more about ways in which the two countries can work together on clean energy research and technology development. "As the world's two top energy consumers, energy producers and greenhouse gas emitters, the United States and China have already begun to look at innovative ways our two countries can benefit from working together and

387

Secretaries Chu and Locke to Travel to China Next Week | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Locke to Travel to China Next Week Locke to Travel to China Next Week Secretaries Chu and Locke to Travel to China Next Week July 6, 2009 - 12:00am Addthis WASHINGTON -- Energy Secretary Steven Chu and Commerce Secretary Gary Locke will travel to China from July 14 to 17. The two secretaries will highlight the tremendous potential for mutually beneficial relationships in the clean energy sector. "Clean energy will drive the economy of the future, both in the United States and around the world," Chu said. "From renewable energy to more efficient buildings to carbon capture and storage, clean energy technologies can create millions of jobs. Working together, we can accomplish more than acting alone. It's in our interest and China's to explore ways to cooperate for our mutual benefit -- by promoting renewable

388

Assessing the Benefits and Costs of Intelligent Transportation Systems: The Value of Advanced Traveler Information Systems  

E-Print Network (OSTI)

Navigation, Full Cost of Transportation, Social CostsThe Social Costs of Intercity Passenger Transportation: ATransportation, Advanced Traveler Information Systems Introduction Recent literature has extensively discussed the social costs

Levinson, David; Gillen, David; Chang, Elva

1999-01-01T23:59:59.000Z

389

Electronically controllable transmission line design for traveling wave array antenna feed network  

E-Print Network (OSTI)

In this thesis, an electronically controllable transmission line (ECTL) is presented. By modulating the conductivity of a doped Si modulator in the ECTL, the wave propagation constant in the ECTL is controlled. Measured results show a phase change in the ECTL at a single frequency when non-zero bias voltage is applied. This ECTL is implemented in order to feed a traveling wave array antenna, which is composed of 8 aperture-coupled microstrip antenna elements. It is demonstrated that phase change in an ECTL feed line has applications as a traveling wave array antenna with beam steering. S-parameter measurements are presented which demonstrate phase change in an ECTL and main beam steering of an 8-element traveling wave array antenna. The design procedure for an aperture-coupled microstrip antenna with a specific input impedance at the resonant frequency and a matching circuit design for a traveling wave array antenna are discussed in detail.

Shin, Chang-Seok

2002-01-01T23:59:59.000Z

390

Figure 72. Vehicle miles traveled per licensed driver, 1970-2040 ...  

U.S. Energy Information Administration (EIA)

Sheet3 Sheet2 Sheet1 Figure 72. Vehicle miles traveled per licensed driver, 1970-2040 (thousand miles) History Reference case 1970.00 $8.69 1971.00 $9.01

391

On complexity of the optimal recombination for the travelling salesman problem  

Science Conference Proceedings (OSTI)

The computational complexity of the optimal recombination for the Travelling Salesman Problem is considered both in the symmetric and in the general cases. Strong NP-hardness of these optimal recombination problems is proven and solving approaches are ...

Anton V. Eremeev

2011-04-01T23:59:59.000Z

392

The Dynamics of Household Travel Time Expenditures and Car Ownership Decisions  

E-Print Network (OSTI)

or more of the others (say, car usage as a function of carnumberof workers, explains car usage, but not car ownership;locations imply higher car usage in terms of travel times

Golob, Thomas F.

1990-01-01T23:59:59.000Z

393

Report on Inspection of the Secretary of Energy's Foreign Travel, DOE/IG-0397  

Energy.gov (U.S. Department of Energy (DOE))

Inspectorl General (IG) conduct a thorough examination of all Secretarial foreign travel from 1993 to December 1995 to include the purpose of each trip, the activities of each Federal participant...

394

Implementation of advanced transit traveler information systems in the United States and Canada : practice and prospects  

E-Print Network (OSTI)

Over the past few years, public transit agencies across the United States and Canada have increasingly implemented methods for passengers to access traveler information using new media and personal mobile communications ...

Rizos, Anthony Charles

2010-01-01T23:59:59.000Z

395

Rebound 2007: Analysis of U.S. Light-Duty Vehicle Travel Statistics  

SciTech Connect

U.S. national time series data on vehicle travel by passenger cars and light trucks covering the period 1966 2007 are used to test for the existence, size and stability of the rebound effect for motor vehicle fuel efficiency on vehicle travel. The data show a statistically significant effect of gasoline price on vehicle travel but do not support the existence of a direct impact of fuel efficiency on vehicle travel. Additional tests indicate that fuel price effects have not been constant over time, although the hypothesis of symmetry with respect to price increases and decreases is not rejected. Small and Van Dender (2007) model of a declining rebound effect with income is tested and similar results are obtained.

Greene, David L [ORNL

2010-01-01T23:59:59.000Z

396

A needs-based approach to activity generation for travel demand analysis/  

E-Print Network (OSTI)

This thesis develops a needs-based framework for behavioral enhancement of conventional activity-based travel demand models. Operational activity-based models specify activity generation models based on empirical considerations ...

Pattabhiraman, Varun R. (Varun Ramakrishna)

2012-01-01T23:59:59.000Z

397

Grouping Travelers on the Basis of their Different Car and Transit Levels of Use  

E-Print Network (OSTI)

Elgar, A. , Bekhor, S. : Car-rider segmentation according tostatus and investment in car mobility. Transp. Res. Rec.people talk about bus and car travel. Transp. Res. A Jensen,

Diana, Marco; Mokhtarian, Patricia L

2009-01-01T23:59:59.000Z

398

Grouping travelers on the basis of their different car and transit levels of use  

E-Print Network (OSTI)

Elgar, A. , Bekhor, S. : Car-rider segmentation according tostatus and investment in car mobility. Transp. Res. Rec.people talk about bus and car travel. Transp. Res. A Jensen,

Diana, Marco; Mokhtarian, Patricia L.

2009-01-01T23:59:59.000Z

399

Secretary Chu to Travel to India and China to Promote Clean Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu to Travel to India and China to Promote Clean Energy Secretary Chu to Travel to India and China to Promote Clean Energy Partnerships Secretary Chu to Travel to India and China to Promote Clean Energy Partnerships November 10, 2009 - 12:00am Addthis Washington, DC - The Department of Energy announced today that Energy Secretary Steven Chu will travel to India and China from Thursday, November 12 to Wednesday, November 18 as part of the Department's efforts to advance opportunities for international clean energy cooperation. During the China portion of the visit, Secretary Chu will join with President Barack Obama as part of the official White House delegation. "China and India will play central roles in the world's energy future." Secretary Chu said. "By working together we can promote clean energy

400

Secretary Chu to Travel to Russia Next Week | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to Travel to Russia Next Week to Travel to Russia Next Week Secretary Chu to Travel to Russia Next Week June 3, 2011 - 12:00am Addthis WASHINGTON - U.S. Energy Secretary Steven Chu will travel to Russia from June 6-11 where he will highlight the tremendous potential for mutually beneficial cooperation and shared economic opportunities with Russia in the areas of innovative clean energy technology, safe and reliable civilian nuclear power, best practices in energy efficiency, and nuclear non-proliferation. The visit will promote continued collaboration between U.S. and Russian scientists, technical experts, and energy sector businesses. It will also pave the way for U.S. investment and clean technology exports to Russia. "From clean energy to nuclear security, the United States and Russia have a

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

EMERGENCY CONTACT INFORMATION FOR DVM AND GRADUATE STUDENTS TRAVELING ABROAD ON UNIVERSITY-RELATED ACTIVITY  

E-Print Network (OSTI)

EMERGENCY CONTACT INFORMATION FOR DVM AND GRADUATE STUDENTS TRAVELING ABROAD ON UNIVERSITY: ________________________________________________________________________ Emergency Contact Name: ___________________________________ Relationship: ________________________________________________________________________ I authorize the SVM to contact this person in the event of an emergency. Site Contact Organization

Sheridan, Jennifer

402

Secretary Chu To Travel to China and Japan | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

To Travel to China and Japan To Travel to China and Japan Secretary Chu To Travel to China and Japan November 5, 2010 - 12:00am Addthis Washington, D.C. -U.S. Energy Secretary Steven Chu will travel to China and Japan November 14 - 19 to meet with government officials, business leaders and others to discuss the Department's ongoing clean energy and scientific collaboration with both countries. More information about the trip is as follows: Shanghai, China On Sunday, November 14, Secretary Chu will tour clean energy businesses, including Huaneng Power's carbon capture and storage project. That evening, he will participate in a Clean Energy Research Center (CERC) Steering Committee meeting with senior government officials. On Monday, November 15, Secretary Chu will tour Tongji University and

403

Combination of evidence in recommendation systems characterized by distance functions  

SciTech Connect

Recommendation systems for different Document Networks (DN) such as the World Wide Web (WWW), Digitnl Libarries, or Scientific Databases, often make use of distance functions extracted from relationships among documents and between documents and semantic tags. For instance, documents In the WWW are related via a hyperlink network, while documents in bibliographic databases are related by citation and collaboration networks.Furthermore, documents can be related to semantic tags such as keywords used to describe their content, The distance functions computed from these relations establish associative networks among items of the DN, and allow recommendation systems to identify relevant associations for iudividoal users. The process of recommendation can be improved by integrating associative data from different sources. Thus we are presented with a problem of combining evidence (about assochaons between items) from different sonrces characterized by distance functions. In this paper we summarize our work on (1) inferring associations from semi-metric distance functions and (2) combining evidence from different (distance) associative DN.

Rocha, L. M. (Luis Mateus)

2002-01-01T23:59:59.000Z

404

FastMeasure Distance Measuring Tools | Open Energy Information  

Open Energy Info (EERE)

FastMeasure Distance Measuring Tools FastMeasure Distance Measuring Tools Jump to: navigation, search Logo: FastMeasure Distance Measuring Tools Name FastMeasure Distance Measuring Tools Address 2890 Cherokee Lane Place Riverwoods, Illinois Zip 60015 Sector Vehicles Product Distance Measuring Instrument Year founded 2008 Number of employees 11-50 Phone number (888) 876-6050 Website http://www.fast-measure.com Coordinates 42.181686°, -87.898862° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.181686,"lon":-87.898862,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

405

CAKE Goes 'The Distance' with Solar | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CAKE Goes 'The Distance' with Solar CAKE Goes 'The Distance' with Solar CAKE Goes 'The Distance' with Solar February 2, 2011 - 10:00am Addthis April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs CAKE. Whether it takes the form of cupcakes, birthday cake, the ever-popular cheesecake or even gluten-free - it unfailingly brightens up almost anyone's day. CAKE the band, however, has taken the sweetness to another level with their newest album Showroom of Compassion, which was produced using 100 percent solar energy. The group formed in 1991 and took the Northern California music scene by storm in the mid-nineties. Since then, they've become internationally renowned headliners. Earlier this month, CAKE released their sixth album, recorded in a studio in Sacramento powered entirely by solar power.

406

Short-distance contribution to the spectrum of Hawking radiation  

E-Print Network (OSTI)

The Hawking effect can be rederived in terms of two-point functions and in such a way that it makes it possible to estimate, within the conventional semiclassical theory, the contribution of ultrashort distances to the Planckian spectrum. For Schwarzschild black holes of three solar masses the analysis shows that Hawking radiation is very robust up to frequencies of 96 T_H or 270 T_H for bosons and fermions, respectively. For primordial black holes (with masses around 10^{15} g) these frequencies turn out to be of order 52T_H and 142 T_H. Only at these frequencies and above do we find that the contribution of Planck distances is of order of the total spectrum itself. Below this scale, the contribution of ultrashort distances to the spectrum is negligible. This suggests that only above these frequencies could an underlying quantum theory of gravity potentially predict significant deviations from Hawking's semiclassical result.

I. Agullo; J. Navarro-Salas; Gonzalo J. Olmo; Leonard Parker

2006-11-30T23:59:59.000Z

407

Levenshtein Distance Technique in Dictionary Lookup Methods: An Improved Approach  

E-Print Network (OSTI)

Dictionary lookup methods are popular in dealing with ambiguous letters which were not recognized by Optical Character Readers. However, a robust dictionary lookup method can be complex as apriori probability calculation or a large dictionary size increases the overhead and the cost of searching. In this context, Levenshtein distance is a simple metric which can be an effective string approximation tool. After observing the effectiveness of this method, an improvement has been made to this method by grouping some similar looking alphabets and reducing the weighted difference among members of the same group. The results showed marked improvement over the traditional Levenshtein distance technique.

Haldar, Rishin

2011-01-01T23:59:59.000Z

408

Evidence against correlations between nuclear decay rates and Earth-Sun distance  

E-Print Network (OSTI)

distance of the source to the Sun. This work was supportedNuclear Decay Rates and Earth-Sun Distance Eric B. Normanand 241 Am and the Earth-Sun distance. We find no evidence

Norman, Eric B.

2009-01-01T23:59:59.000Z

409

Distance between quantum states in the presence of initial qubit-environment correlations: A comparative study  

Science Conference Proceedings (OSTI)

The time evolution of the trace distance between two states of an open quantum system may increase due to initial system-environment correlations, thus exhibiting a breakdown of distance contractivity of the reduced dynamics. We analyze how the time evolution of the distance depends on the chosen distance measure. Here we elucidate the behavior of the trace distance, the Hilbert-Schmidt distance, the Bures distance, the Hellinger distance, and the quantum Jensen-Shannon divergence for two system-environment setups, namely a qubit bilinearly coupled to an infinite and a finite-size environment with the latter composed of harmonic oscillators.

Dajka, Jerzy; Luczka, Jerzy; Haenggi, Peter [Institute of Physics, University of Silesia, 40-007 Katowice (Poland); Institute of Physics, University of Augsburg, D-86135 Augsburg (Germany)

2011-09-15T23:59:59.000Z

410

Auctions by price and distance via cellular phones  

Science Conference Proceedings (OSTI)

We consider e-commerce auctions via cellular phones in which the winner is selected based on two factors: the requested price and the promise to provide a service on time. The auctioneer can verify that the bidder intends to provide the service by tracking ... Keywords: Auctions, Cellular, Distance, Electronic commerce, Multi-attribute, Simulation, Strategies

Yosi Ben Asher; Mohsen Abu Saleh

2011-03-01T23:59:59.000Z

411

A proposal for detecting hidden explosives to high distance  

Science Conference Proceedings (OSTI)

In this paper author describes a proposal for an apparatus utilising o nuclear physics techniques to identify hidden explosives to a distance of several tenth of meters. The apparatus uses a modified PFNA (Pulsed Fast neutron Analysis) with the gamma ... Keywords: application of nuclear physics, electronic instrumentation, explosives detection, security apparatus

Carlo Artemi

2008-07-01T23:59:59.000Z

412

Computing the Edit-Distance between Unrooted Ordered Trees  

Science Conference Proceedings (OSTI)

An ordered tree is a tree in which each node's incident edges are cyclically ordered; think of the tree as being embedded in the plane. Let A and B be two ordered trees. The edit distance between A and B is the minimum cost ...

Philip N. Klein

1998-08-01T23:59:59.000Z

413

Move-to-Front, Distance Coding, and Inversion Frequencies revisited  

Science Conference Proceedings (OSTI)

Move-to-Front, Distance Coding and Inversion Frequencies are three simple and effective techniques used to process the output of the Burrows-Wheeler Transform. In this paper we provide the first complete comparative analyses of these techniques, establishing ... Keywords: Burrows-Wheeler Transform, Data Compression, Empirical entropy

Travis Gagie; Giovanni Manzini

2010-06-01T23:59:59.000Z

414

Free Energy Surfaces from Single-Distance Information Philipp Schuetz,  

E-Print Network (OSTI)

Free Energy Surfaces from Single-Distance Information Philipp Schuetz, Rene´ Wuttke, Benjamin We propose a network-based method for determining basins and barriers of complex free energy surfaces for the iterative determination of individual basins by the minimum-cut-based free energy profile, a barrier

Caflisch, Amedeo

415

Weighted Distance Transforms for Images Using Elongated Voxel Grids  

Science Conference Proceedings (OSTI)

In this paper we investigate weighted distance transforms in 3D images using elongated voxel grids. We use a local neighbourhood of size 3 3 3 and assume a voxel grid with equal resolution along two axes and lower along the third. The weights (local ...

Ida-Maria Sintorn; Gunilla Borgefors

2002-04-01T23:59:59.000Z

416

UHF measurement of breathing and heartbeat at a distance  

Science Conference Proceedings (OSTI)

The detection of breathing and heartbeat from a distance is important for medical triage and mass casualty events as well as routine monitoring of higher-risk patients. Typical approaches include wiring up patients to devices and wearable devices, but ... Keywords: UHF, breathing, heartbeat, radar

Jerry Silvious; David Tahmoush

2010-01-01T23:59:59.000Z

417

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

418

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

419

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

420

Assessment of Smolt Condition for Travel Time Analysis, 1991-1992 Annual Report.  

Science Conference Proceedings (OSTI)

Regression techniques were used to determine the effects of several biotic and abiotic variables on the migration rates of juvenile spring chinook salmon and steelhead in the Columbia and Snake rivers. Comparisons of the effects of river flow and smoltification, assessed using gill Na{sup +}-K{sup +} ATPase activity, were of primary interest. Day of the year, water temperature, change in flow, condition factor, and fork length were also considered as independent variables. Groups of fish were sampled to assess smoltification 2-3 times per week during the spring outmigrations during 1989-1992. These groups were assumed to be representative of other fish which were PIT-tagged and released as a part of the Smolt Monitoring Program in the Columbia Basin. River flow, gill ATPase activity, condition factor, water temperature, and change in flow were significant variables in regressions predicting the time for juvenile spring chinook salmon to travel between specific points (travel time), whereas river flow was the only significant contributor to models describing travel times of steelhead. Predicted travel times of wild steelhead were shorter than those of hatchery steelhead. River flow was the only variable common to all regression equations. Based on the characteristic, changes in river flow would be the most logical means to decrease travel times of both juvenile spring chinook salmon and steelhead in the Columbia and Snake rivers.

Maule, Alec G.; Beeman, John W.; Schrock, Robin M. (Seattle National Fishery Research Center, Columbia River Field Station, Cook, WA)

1994-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Using GPS Travel Data to Assess the Real World Driving Energy Use of Plug-In Hybrid Electric Vehicles (PHEVs)  

DOE Green Energy (OSTI)

Highlights opportunities using GPS travel survey techniques and systems simulation tools for plug-in hybrid vehicle design improvements, which maximize the benefits of energy efficiency technologies.

Gonder, J.; Markel, T.; Simpson, A.; Thornton, M.

2007-05-01T23:59:59.000Z

422

Hym Prius Personal-use Ch and Dr 9-2008 to 3-2010.xlsx  

NLE Websites -- All DOE Office Websites (Extended Search)

Personal-use Personal-use Charging rate: Level 1 Number of households: Charge control: Uncontrolled Date range: Sep 2008 - Mar 2010 Battery Capacity: 5 kWh Weekday Weekend Number of trips Total distance driven (mi) Number of charging events Charging energy consumed (AC kWh) Charge depleting (CD) distance driven (mi) Percent of total distance Charge sustaining (CS) distance driven (mi) Percent of total distance Driving segments between charging events 1 67 1,285 373 7,596 1,828 1,735 510 14,142 5,026 401 130 Overall 2,245 531 1,659 19,168 9,425 49% 9,743 51% 54% 36% 6,545 3,198 46% 64% Vehicle Technologies Program 0 2000 4000 6000 8000 10000 12000 14000 16000 Weekday Weekend Distance traveled (mi) Distance Traveled by Operating Mode CS CD 0% 20% 40% 60% f total distance driven driving segment bin Miles-weighted Distribution of Distance

423

Cut Gas Costs This Holiday Traveling Season with Three Easy Tips |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Cut Gas Costs This Holiday Traveling Season with Three Easy Tips Cut Gas Costs This Holiday Traveling Season with Three Easy Tips Cut Gas Costs This Holiday Traveling Season with Three Easy Tips November 26, 2013 - 9:23am Addthis Turning off your engine while waiting in the parking lot is a great way to save money on gas. | Photo courtesy of Kristy Keel-Blackmon, NREL/21196. Turning off your engine while waiting in the parking lot is a great way to save money on gas. | Photo courtesy of Kristy Keel-Blackmon, NREL/21196. Jason Lutterman Communications Specialist, Office of Energy Efficiency and Renewable Energy How can I participate? Drive smart this holiday season and stay informed with tools such as the speed penalty calculator on fueleconomy.gov. Yesterday you learned from Becky about three tools to help you save on fuel

424

Cut Gas Costs This Holiday Traveling Season with Three Easy Tips |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Cut Gas Costs This Holiday Traveling Season with Three Easy Tips Cut Gas Costs This Holiday Traveling Season with Three Easy Tips Cut Gas Costs This Holiday Traveling Season with Three Easy Tips November 26, 2013 - 9:23am Addthis Turning off your engine while waiting in the parking lot is a great way to save money on gas. | Photo courtesy of Kristy Keel-Blackmon, NREL/21196. Turning off your engine while waiting in the parking lot is a great way to save money on gas. | Photo courtesy of Kristy Keel-Blackmon, NREL/21196. Jason Lutterman Communications Specialist, Office of Energy Efficiency and Renewable Energy How can I participate? Drive smart this holiday season and stay informed with tools such as the speed penalty calculator on fueleconomy.gov. Yesterday you learned from Becky about three tools to help you save on fuel

425

A Set of Comparable Carbon Footprints for Auto, Truck and Transit Travel in Metropolitan America  

NLE Websites -- All DOE Office Websites (Extended Search)

Set of Comparable Carbon Footprints for Highway Travel in Set of Comparable Carbon Footprints for Highway Travel in Metropolitan America by Frank Southworth* and Anthon Sonnenberg** August 31, 2009 *Corresponding author: Senior R&D Staff, Oak Ridge National Laboratory and Principal Research Scientist Georgia Institute of Technology 790 Atlantic Drive SEB Building, Room 324 Atlanta, GA 30332-0355 E-mail: frank.southworth@ce.gatech.edu ** PhD Student, Georgia Institute of Technology School of Civil and Environmental Engineering Georgia Institute of Technology 1 Abstract The authors describe the development of a set of carbon dioxide emissions estimates for highway travel by automobile, truck, bus and other public transit vehicle movements within the nation's 100 largest metropolitan areas, in calendar year 2005. Considerable variability is found to exist

426

Weighted distance transforms generalized to modules and their computation on point lattices  

Science Conference Proceedings (OSTI)

This paper presents the generalization of weighted distances to modules and their computation through the chamfer algorithm on general point lattices. The first part is dedicated to formalization of definitions and properties (distance, metric, norm) ... Keywords: Chamfer algorithm, Distance transform, Non-standard grids, Weighted distance

Cline Fouard; Robin Strand; Gunilla Borgefors

2007-09-01T23:59:59.000Z

427

Luminosity distance and redshift in the Szekeres inhomogeneous cosmological models  

E-Print Network (OSTI)

The Szekeres inhomogeneous models can be used to model the true lumpy universe that we observe. This family of exact solutions to Einstein's equations was originally derived with a general metric that has no symmetries. In this work, we develop and use a framework to integrate the angular diameter and luminosity distances in the general Szekeres models. We use the affine null geodesic equations in order to derive a set of first-order ordinary differential equations that can be integrated numerically to calculate the partial derivatives of the null vector components. These equations allow the integration in all generality of the distances in the Szekeres models and some examples are given. The redshift is determined from simultaneous integration of the null geodesic equations. This work does not assume spherical or axial symmetry, and the results will be useful for comparisons of the general Szekeres inhomogeneous models to current and future cosmological data.

Anthony Nwankwo; Mustapha Ishak; John Thompson

2010-05-17T23:59:59.000Z

428

Shortcut estimation of safety distances of pipelines from explosives  

SciTech Connect

Purposely or accidentally detonating explosives near pressurized gas pipelines may have severe consequences on them, ranging from permanent deformation to gas loss or even violent rupture. Owing to lack of analytical prediction models, a shortcut is proposed in this article by which conservative estimations can be obtained of the safety distance of a pipeline from an explosion source, when explosive quantity is known. Alternatively, the maximum allowable explosive quantity can be calculated, provided distance is given. If both explosive quantity and distance are given, stresses on the pipeline may be estimated. Experimentally determined ratios of circumferential to longitudinal strains found in the literature are used. This ratio depends on soil peak particle velocity in contact with the pipeline. For total stress estimations on the pipeline, either biaxial or Huber-Hencky-Mises stresses are used, the latter being more conservative. Validation of proposed method is obtained against experimental observations and results. In this prediction model the characteristics of the explosion source, of the soil, and of the pipeline are taken into account.

Rigas, F.; Sebos, I. [National Technical Univ. of Athens (Greece)

1998-03-01T23:59:59.000Z

429

Leaning-based travel interfaces revisited: frontal versus sidewise stances for flying in 3D virtual spaces  

Science Conference Proceedings (OSTI)

In this paper we revisit the design of leaning-based travel interfaces and propose a design space to categorize existing implementations. Within the design space, frontal and sidewise stances when using a flying surfboard interface were compared through ... Keywords: 3d virtual spaces., leaning-based travel interface, navigation, stance

Jia Wang; Rob Lindeman

2012-12-01T23:59:59.000Z

430

Travel and Electricity Demand Analysis of Potential U.S. High-Speed Rail and Maglev Corridors  

Science Conference Proceedings (OSTI)

Highway and air travel continue to increase steadily every year, with the number of air flights growing almost three times faster than automobile trips. High-speed rail trains and magnetically levitated vehicles can potentially provide viable intercity travel alternatives to airplanes and automobiles. This report assesses the possible ridership and the potential electrical loads created by these high-speed ground transportation systems.

1994-03-01T23:59:59.000Z

431

Hym Prius Commercial-use Ch and Dr All 2009.xlsx  

NLE Websites -- All DOE Office Websites (Extended Search)

Commercial-use Commercial-use Charging rate: Level 1 Number of vehicles: Charge control: Uncontrolled Date range: Jan - Dec 2009 Battery Capacity: 5 kWh Weekday Weekend Number of trips Total distance driven (mi) Number of charging events Charging energy consumed (AC kWh) Charge depleting (CD) distance driven (mi) Percent of total distance Charge sustaining (CS) distance driven (mi) Percent of total distance Driving segments between charging events 1 153 32,253 3,478 179,351 15,767 61,134 5,309 575,891 58,893 12,902 1,461 Overall 66,443 634,784 14,363 35,731 195,118 31% 439,667 69% 31% 27% 396,540 43,127 69% 73% Vehicle Technologies Program 0 100000 200000 300000 400000 500000 600000 700000 Weekday Weekend Distance traveled (mi) Distance Traveled by Operating Mode CS CD 0% 20% 40% 60% 80% f total distance driven driving segment

432

Tangible interaction based on personal objects for collecting and sharing travel experience  

Science Conference Proceedings (OSTI)

The paper presents a case study which addresses the design of a system which supports the recollection of memories and the creation of storytelling by combining physical objects with digital resources. The purpose of our research is twofold. The first ... Keywords: RFID technology, case study, human-computer interaction, personal object, souvenir, tangible user interface, travel activity

Elena Mugellini; Elisa Rubegni; Omar Abou Khaled

2007-07-01T23:59:59.000Z

433

You Can Lead Travelers to the Bus Stop, But You Can't Make Them Ride  

E-Print Network (OSTI)

socioeconomic characteristics, such as gender, income, education, etc. Travel mode choices for work and non possession, and demographic characteristics denoting gender, marital status and parenthood. The proportion, 201-222. Davis, S. C., Diegel, S. W., and Boundy, R. G. (2011), "Transportation energy data book: 30th

Kammen, Daniel M.

434

Using Travel Time Reliability Measures to Improve Regional Transportation Planning and URS Corporation  

E-Print Network (OSTI)

, connectivity, and safety to evaluate the transportation system's health and determine where future investmentsUsing Travel Time Reliability Measures to Improve Regional Transportation Planning and Operations of the Transportation Research Board January 13­17, 2008 Revised November 3, 2007 TRB 2008 Annual Meeting CD-ROM Paper

Bertini, Robert L.

435

Greening North Carolina Travel and Tourism Tips for Sustainable Practices in Tourism  

E-Print Network (OSTI)

with the NC Division of Tourism, Film and Sports Development & Department of the Environment and Natural Out Of the Gas Sting Green Destinations Greening at a Destination Level It's Electric How does your travel market Green Lodging Examining Increased Guest Satisfaction at Green Hotels Linen Reuse might

436

Energy Flux from Traveling Hurricanes to the Oceanic Internal Wave Field  

Science Conference Proceedings (OSTI)

The generation of long interval waves by traveling hurricanes on an f plane is studied within the context of linear theory. The emphasis of the present work is on the interval wave power, that is, the fraction of the energy input from the ...

Johan Nilsson

1995-04-01T23:59:59.000Z

437

Short communication Travelling salesman problem on dilute lattices : visit to a  

E-Print Network (OSTI)

of cities P. Sen and B.K. Chakrabarti Saha Institute of Nuclear Physics, 92 Acharya Prafulla Chandra Road the cities are represented by random lattice sites, occupied with concentration p, and the salesman intends to visit a finite fraction f of the total number of cities. The variation of the average optimal travel

Paris-Sud XI, Université de

438

SPECIAL REPORT 298: EFFECTS OF LAND DEVELOPMENT PATTERNS ON MOTORIZED TRAVEL, ENERGY, AND CO2 EMISSIONS  

E-Print Network (OSTI)

SPECIAL REPORT 298: EFFECTS OF LAND DEVELOPMENT PATTERNS ON MOTORIZED TRAVEL, ENERGY, AND CO2 by significant fuel economy legislation, energy taxes, household-level carbon budgets, and cooperative behavior alternative to gasoline and diesel, achieving significant GHG and petroleum savings. However, biofuels

Kockelman, Kara M.

439

Assessment of Smolt Condition for Travel Time Analysis, 1993-1994 Annual Report.  

SciTech Connect

The assessment of smolt condition for travel time analysis (ASCTTA) project provided information on the level of smoltification in Columbia River hatchery and wild salmonid stocks to the Fish Passage Center (FPC), for the primary purpose of in-river management of flows.

Schrock, Robin M; Beeman, John W; VanderKooi, Scott P [US Geological Survey, Western Fisheries Research Center, Columbia River Research Laboratory, Cook, WA

1999-02-01T23:59:59.000Z

440

Beyond Travel & Tourism competitiveness ranking using DEA, GST, ANN and Borda count  

Science Conference Proceedings (OSTI)

Travel & Tourism competitiveness rankings are helpful when we wish to consider the issue of how to enrich the global competitiveness of tourism destinations. However, even if a ranking is obtained from a highly reputed institute, it is important to evaluate ... Keywords: Artificial neural network, Borda count, Data envelopment analysis, Grey system theory, Ranking trustworthiness

Wei-Wen Wu

2011-09-01T23:59:59.000Z

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Using Social Networks for Exchanging Valuable Real Time Public Transport Information among Travellers  

Science Conference Proceedings (OSTI)

Public transport users are increasingly connected in real time through mobile devices to social networks, such as Twitter and Facebook. This allows them both to access and to provide valuable operational and emotional information from and to fellow travellers. ... Keywords: mobile, transport, social network, service science, innovation, business model, serious game

Antonio A. Nunes; Teresa Galvao; Joao Falcao e Cunha; Jeremy V. Pitt

2011-09-01T23:59:59.000Z

442

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

443

Development of Improved Traveler Survey Methods for High-Speed Intercity Passenger Rail Planning  

E-Print Network (OSTI)

High-speed passenger rail is seen by many in the U.S. transportation policy and planning communities as an ideal solution for fast, safe, and resource-efficient mobility in high-demand intercity corridors. To expand the body of knowledge for high-speed intercity passenger rail in the U.S., the overall goal of this dissertation was to better understand the demand for high-speed intercity passenger rail services in small- or medium-sized intermediate communities and improve planners' ability to estimate such demand through traveler surveys; specifically, the use of different experimental designs for stated preference questions and the use of images to describe hypothetical travel alternatives in traveler surveys. In pursuit of this goal, an Internet-based survey was distributed to residents of Waco and Temple, two communities located along the federally-designated South Central High-Speed Rail Corridor in Central Texas. A total of 1,160 surveys were obtained from residents of the two communities. Mixed logit travel mode choice models developed from the survey data revealed valuable findings that can inform demand estimates and the design of traveler surveys for high-speed intercity passenger rail planning activities. Based on the analysis presented in this dissertation, ridership estimates for new high-speed intercity passenger rail lines that are planned to serve intermediate communities should not assume that residents of these communities have similar characteristics and values. The d-efficient stated preference experimental design was found to provide a mode choice model with a better fit and greater significance on key policy variables than the adaptive design and therefore is recommended for use in future surveys. Finally, it is recommended that surveys should consider the use of images of proposed train services to aid respondent decision-making for stated preference questions, but only if the images used in the survey depict equipment that could be realistically deployed in the corridor.

Sperry, Benjamin

2012-05-01T23:59:59.000Z

444

High speed, long distance, data transmission multiplexing circuit  

DOE Patents (OSTI)

A high speed serial data transmission multiplexing circuit, which is operable to accurately transmit data over long distances (up to 3 Km), and to multiplex, select and continuously display real time analog signals in a bandwidth from DC to 100 Khz. The circuit is made fault tolerant by use of a programmable flywheel algorithm, which enables the circuit to tolerate one transmission error before losing synchronization of the transmitted frames of data. A method of encoding and framing captured and transmitted data is used which has a low overhead and prevents some particular transmitted data patterns from locking an included detector/decoder circuit.

Mariotti, Razvan (Boulder, CO)

1991-01-01T23:59:59.000Z

445

A high speed, long distance, data transmission multiplexing circuit  

DOE Patents (OSTI)

A high speed serial data transmission multiplexing circuit, which is operable to accurately transmit data over long distances (up to 3 Km), and to multiplex, select and continuously display real time analog signals in a bandwidth from DC to 100Khz. The circuit is made fault tolerant by use of a programmable flywheel algorithm, which enables the circuit to tolerate one transmission error before losing synchronization of the transmitted frames of data. A method of encoding and framing captured and transmitted data is used which has a low overhead and prevents some particular transmitted data patterns from locking an included detector/decoder circuit. 9 figs.

Mariotti, R.

1990-01-30T23:59:59.000Z

446

Gamma ray burst distances and the timescape cosmology  

E-Print Network (OSTI)

Gamma ray bursts can potentially be used as distance indicators, providing the possibility of extending the Hubble diagram to redshifts ~7. Here we follow the analysis of Schaefer (2007), with the aim of distinguishing the timescape cosmological model from the \\LambdaCDM model by means of the additional leverage provided by GRBs in the range 2 < z < 7. We find that the timescape model fits the GRB sample slightly better than the \\LambdaCDM model, but that the systematic uncertainties are still too little understood to distinguish the models.

Peter R. Smale

2011-07-27T23:59:59.000Z

447

Understanding the differences in the development and use of advanced traveler information systems for vehicles (ATIS/V) in the U.S., Germany, and Japan  

E-Print Network (OSTI)

Traffic congestion is becoming a serious problem. As a solution, advanced traveler information systems (ATIS) mitigate traffic congestion by providing real-time traffic information to travelers. ATIS includes various ...

Sugawara, Yoshihiko

2007-01-01T23:59:59.000Z

448

A comparison of standard evasion scenarios at near regional distances  

SciTech Connect

We performed numerical simulations of three nuclear testing evasion scenarios. These calculations were done in two parts. The first part was done near source (within 10 km) with a non-linear weapons effects code. Particle velocity histories from the non-linear code were linked to an elastic linear finite-difference code for the second part. Seismic waveforms from the evasion scenario calculations were compared with the waveforms for a non-evasive explosion calculation at near regional distances. The results of this comparison suggest that it may be important to include realistic stratigraphy in such simulations: the overall wave amplitude in the present simulations is reduced by only a factor of 3-5 in contradiction to factors of 20-100 in {open_quotes}classical{close_quotes} decoupling analyses for ideal (i.e., unlayered) media. Two of the evasion scenarios simulated retain explosive waveform characteristics at near regional distances, while the third scenario indicates that certain source geometries might lead to more non-explosive (i.e., earthquake-like) seismic signals.

Bos, R.; App, F.; Jones, E.; Dey, T.; Kamm, J.

1997-01-01T23:59:59.000Z

449

Obtaining oblique technique source-to-skin distances for irregular field (Clarkson) calculations: The Mayo Off-axis Distance Indicator  

Science Conference Proceedings (OSTI)

Significant dose inhomogeneities may exist between the supraclavicular fossa (SCF) and the internal mammary chain (IMC) regions in the irregular L-shaped (hockey stick) field associated with breast cancer treatments. This dose inhomogeneity exists, in part, because of a positive air gap in the SCF and a negative air gap in the IMC locations. Independent of treatment technique, (i.e., whether anterior-posterior (AP) or oblique fields are used), accurate source-to-skin distance (SSD) values for the SCF, IMC, and axilla are necessary when doing an irregular field (Clarkson) dose calculation. However, when an oblique technique is used to treat the hockey stick field, obtaining non-central-axis SSDs is not as straightforward as when an AP technique is employed. The Mayo Off-axis Distance Indicator was constructed to slide into the blocking tray slot of the simulator or treatment machine. This mechanical measuring device provides quick and accurate SSD measurements for non-central-axis points under either AP or, more importantly, oblique treatment conditions.

Lajoie, W.N. (Mayo Medical Center, Rochester, MN (USA))

1988-09-01T23:59:59.000Z

450

Imaging the Solar Tachocline by Time-Distance Helioseismology  

E-Print Network (OSTI)

The solar tachocline at the bottom of the convection zone is an important region for the dynamics of the Sun and the solar dynamo. In this region, the sound speed inferred by global helioseismology exhibits a bump of approximately 0.4% relative to the standard solar model. Global helioseismology does not provide any information on possible latitudinal variations or asymmetries between the Northern and Southern hemisphere. Here, we develop a time-distance helioseismology technique, including surface- and deep-focusing measurement schemes and a combination of both, for two-dimensional tomographic imaging of the solar tachocline that infers radial and latitudinal variations in the sound speed. We test the technique using artificial solar oscillation data obtained from numerical simulations. The technique successfully recovers major features of the simplified tachocline models. The technique is then applied to SOHO/MDI medium-l data and provides for the first time a full two-dimensional sound-speed perturbation i...

Zhao, Junwei; Kosovichev, A G; Mansour, N N

2009-01-01T23:59:59.000Z

451

Answer extraction as sequence tagging with tree edit distance  

E-Print Network (OSTI)

Our goal is to extract answers from preretrieved sentences for Question Answering (QA). We construct a linear-chain Conditional Random Field based on pairs of questions and their possible answer sentences, learning the association between questions and answer types. This casts answer extraction as an answer sequence tagging problem for the first time, where knowledge of shared structure between question and source sentence is incorporated through features based on Tree Edit Distance (TED). Our model is free of manually created question and answer templates, fast to run (processing 200 QA pairs per second excluding parsing time), and yields an F1 of 63.3 % on a new public dataset based on prior TREC QA evaluations. The developed system is open-source, and includes an implementation of the TED model that is state of the art in the task of ranking QA pairs. 1

Xuchen Yao; Benjamin Van Durme; Chris Callison-burch; Peter Clark

2013-01-01T23:59:59.000Z

452

DOE Solar Decathlon: Tuskegee University: Going the Distance  

NLE Websites -- All DOE Office Websites (Extended Search)

Tuskegee University house on the National Mall in Washington, D.C., during Solar Decathlon 2002. Tuskegee University house on the National Mall in Washington, D.C., during Solar Decathlon 2002. Enlarge image The Tuskegee Solar Decathlon team got its inspiration from traditional Southern architecture, which relies on passive cooling strategies such as the dogtrot, a central shaded breezeway that runs through the house. (Credit: Paul Norton/U.S. Department of Energy Solar Decathlon) Who: Tuskegee University What: Solar house Where: Tuskegee University 1200 W. Montgomery Road Tuskegee, AL 36088 Map This House Public tours: Not available Solar Decathlon 2002 Tuskegee University: Going the Distance Tuskegee University students successfully overcame funding and time limitations to make the trip to Washington, D.C., for the U.S. Department of Energy Solar Decathlon 2002. Now, with time back on its side, the

453

Energy Secretary Steven Chu to Travel to the Middle East Next Week |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

the Middle East Next Week the Middle East Next Week Energy Secretary Steven Chu to Travel to the Middle East Next Week February 18, 2010 - 12:00am Addthis WASHINGTON - Next week U.S. Energy Secretary Steven Chu will travel to the Middle East to meet with senior government officials, research and scientific leaders, and members of the private sector as part of the Administration's efforts to continue strengthening U.S. partnerships within the region. Secretary Chu will discuss a range of energy issues, including energy security and the importance of investing in a broad portfolio of energy technologies as part of the global economic recovery. Secretary Chu will visit Riyadh and Jeddah, Saudia Arabia; Abu Dhabi, United Arab Emirates; and Doha, Qatar. Riyadh, Saudi Arabia On Monday, February 22, Secretary Chu will meet with Minister of Petroleum

454

Beam loading compensation of traveling wave linacs through the time dependence of the rf drive  

SciTech Connect

Beam loading in traveling-wave linear accelerating structures leads to unacceptable spread of particle energies across an extended train of bunched particles due to beam-induced field and dispersion. Methods for modulating the rf power driving linacs are effective at reducing energy spread, but for general linacs do not have a clear analytic foundation. We report here methods for calculating how to modulate the rf drive in arbitrarily nonuniform traveling-wave linacs within the convective-transport (power-diffusion) model that results in no additional energy spread due to beam loading (but not dispersion). Varying group velocity, loss factor, and cell quality factor within a structure, and nonzero particle velocity, are handled.

Towne N.; Rose J.

2011-09-30T23:59:59.000Z

455

Assessment of Smolt Condition for Travel Time Analysis, 1990 Annual Report.  

DOE Green Energy (OSTI)

As a part of the Northwest Power Planning Council`s Fish and Wildlife Program, the Fish Passage Center collects information on the migrational characteristics of juvenile salmon and steelhead (Oncorhynchus sp.) in the Columbia River basin. This information is collected through the Smolt Monitoring Program, and is used as a tool in the management and evaluation of the Water Budget. The Water Budget is a volume of water used to enhance environmental conditions (flows) to aid in the seaward migration of juvenile salmon and steelhead. Implicit in the Water Budget concept is that by augmenting flows, travel time of juvenile salmonids will be decreased, thereby increasing survival via reductions in delayed migration and exposure to predators. This study was initiated to (1) provide physiological information about the juvenile salmonids used for these travel time estimates, (2) to analyze the physiological data, and (3) to determine if an ``index`` of smolt condition could be developed to aid in management of the Water Budget.

Beeman, John W.; Rondorf, Dennis W.; Faler, Joyce C. (Seattle National Fishery Research Center, Columbia River Field Station, Cook, WA)

1991-12-01T23:59:59.000Z

456

Drones, information technology, and distance: mapping the moral epistemology of remote fighting  

Science Conference Proceedings (OSTI)

Ethical reflection on drone fighting suggests that this practice does not only create physical distance, but also moral distance: far removed from one's opponent, it becomes easier to kill. This paper discusses this thesis, frames it as a moral-epistemological ... Keywords: Distance, Drones, Ethics, Information technology, Military robotics, Phenomenology

Mark Coeckelbergh

2013-06-01T23:59:59.000Z

457

Improvement of the disc harmonic moments descriptor by an exponentially decaying distance transform  

Science Conference Proceedings (OSTI)

The authors propose an improvement of a recent region-based shape descriptor inspired by the 3D spherical harmonics: the Disk Harmonic Moments Descriptor (DHMD). The binary image is weighted by an exponentially decaying distance transform (EDDT) before ... Keywords: content-based image, distance transform, legendre polynomials, region-based shape descriptor, retrieval, salience distance transform, spherical harmonics

Noureddine Ennahnahi; Mohammed Oumsis; Mohammed Meknassi

2010-08-01T23:59:59.000Z

458

Adaptive feedback generation to support teachers in web-based distance education  

Science Conference Proceedings (OSTI)

This work examines the application of user-adapted technologies to address problems experienced in web-based distance education. We have proposed an approach to support distance learning instructors by offering advice that points at problems faced by ... Keywords: (Semi-)automatic advice generation, Distance learning, Empirical evaluation, Intelligent course management systems, Personalised feedback, Teacher support/help

Essam Kosba; Vania Dimitrova; Roger Boyle

2007-09-01T23:59:59.000Z

459

A Stochastic/Perturbation Global Optimization Algorithm for Distance Geometry Problems  

Science Conference Proceedings (OSTI)

We present a new global optimization approach for solving exactly or inexactly constrained distance geometry problems. Distance geometry problems are concerned with determining spatial structures from measurements of internal distances. They arise ... Keywords: Lennard-Jones cluster, Molecular conformation, global optimization

Zhihong Zou; Richard H. Bird; Robert B. Schnabel

1997-07-01T23:59:59.000Z

460

A wavelet-tree-based watermarking method using distance vector of binary cluster  

Science Conference Proceedings (OSTI)

This paper proposes a wavelet-tree-based watermarking method using distance vector of binary cluster for copyright protection. In the proposed method, wavelet trees are classified into two clusters using the distance vector to denote binary watermark ... Keywords: Blind watermarking method, Copyright protection, Distance vector, Significant coefficient, Watermark, Wavelet tree

Wei-Hung Lin; Yuh-Rau Wang; Shi-Jinn Horng

2009-08-01T23:59:59.000Z

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

The influence of animal mobility on the assumption of uniform distances in aerial line transect surveys  

E-Print Network (OSTI)

for estimating animal density from aerial surveys. Analysis of line transect distance data usually relies test evidence for non- uniformity using double-observer distance data from two aerial surveys of five in Queensland. Key words: aerial surveys, double platform distance sampling, independent observers, responsive

Buckland, Steve

462

Dust removal in radio-frequency plasmas by a traveling potential modulation  

Science Conference Proceedings (OSTI)

The dust contamination in plasma deposition processes plays a crucial role in the quality and the yield of the products. To improve the quality and the yield of plasma processing, a favorable way is to remove the dust particles actively from the plasma reactors.Our recent experiments in the striped electrode device show that a traveling plasma modulation allows for a systematic particle removal independent of the reactor size. Besides the rf powered electrode, the striped electrode device includes a segmented electrode that consists of 100 electrically insulated narrow stripes. A traveling potential profile is produced by the modulation of the voltage signals applied on the stripes. The dust particles are trapped in the potential wells and transported with the traveling of the potential profile.The particle-in-cell (PIC) simulation on the potential above the segmented electrode indicates that the traveling potential profile can be realized either by applying low-frequency (0.1-10 Hz) voltage signals with a fixed phase shift between adjacent stripes or high-frequency (10 kHz a circumflex AS 100 MHz) signals with the amplitudes modulated by a low-frequency envelope. The transportation of the dust particles is simulated with a two-dimensional molecular dynamics (MD) code with the potential profile obtained from the PIC simulation. The MD results reproduce the experimental observations successfully.This technology allows for an active removal of the contaminating particles in processing plasmas and it is independent of the reactor size. The removal velocity is controllable by adjusting the parameters for the modulation.

Li Yangfang; Jiang Ke; Thomas, Hubertus M.; Morfill, Gregor E. [Max-Planck-Institute for Extraterrestrial Physics, 85748 Garching (Germany)

2010-06-16T23:59:59.000Z

463

Engineering and Biological Assessment of Fine Mesh Fish Protection-Modified Traveling Water Screens  

Science Conference Proceedings (OSTI)

This report describes the results of a study that examined: (1) the protection afforded to early life stages (eggs, larvae, and juveniles) of fish and shellfish by different traveling water screen (TWS) mesh sizes and (2) the engineering challenges, operational and maintenance (O&M) issues, and installation costs that power plants may experience if fine-mesh modified TWSs are identified as a site-specific best technology available (BTA) for minimizing entrainment mortality in accordance with a ...

2013-05-08T23:59:59.000Z

464

Alleged Wasteful Spending Regarding International Travel for the Department of Energy's Deputy Secretary, INS-SR-13-01  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Wasteful Spending Regarding Wasteful Spending Regarding International Travel by the Department of Energy's Deputy Secretary INS-SR-13-01 January 2013 Department of Energy Washington, DC 20585 January 31, 2013 MEMORANDUM FOR THE SECRETARY FROM: Gregory H. Friedman Inspector General SUBJECT: INFORMATION: Special Inquiry on "Alleged Wasteful Spending Regarding International Travel by the Department of Energy's Deputy Secretary" BACKGROUND The Department of Energy's Deputy Secretary represents the U.S. Government, the Department and the Secretary in many high-level international and ministerial meetings. In this role, the Deputy Secretary receives executive protection while on international travel for security purposes, to reduce the risk of harm and aid mission accomplishment. During such travel, the

465

Utilizing automatically collected data to infer travel behavior : a case study of the East London Line extension  

E-Print Network (OSTI)

Utilizing automatically collected data sources, this research strengthens the understanding of changes in user travel behavior caused by the introduction of the extended East London Line (ELL) into London's public ...

Muhs, Kevin J. (Kevin Joseph)

2012-01-01T23:59:59.000Z

466

Final Report Phase I Study to Characterize the Market Potential for Non-Motorized Travel  

SciTech Connect

The idea of livable communities suggests that people should have the option to utilize non-motorized travel (NMT), specifically walking and bicycling, to conduct their daily tasks. Forecasting personal travel by walk and bike is necessary as part of regional transportation planning, and requires fine detail not only about individual travel, but also on transportation and neighborhood infrastructure. In an attempt to characterize the 'market' potential for NMT, the Office of Planning, Federal Highway Administration (FHWA) funded the Center for Transportation Analysis (CTA) of the Oak Ridge National Laboratory (ORNL) to conduct a study. The objectives of this effort were to identify factors that influence communities to walk and bike and to examine why, or why not, travelers walk and bike in their communities. This study relied on information collected under the 2009 National Household Travel Survey (NHTS) as the major source of data, and was supplemented with data from the American Community Survey (ACS), educational survey, health, employment, and others. Initial statistical screening methods were applied to sort through over 400 potential predictor variables, and examined with various measures (e.g., walk trip per person, walk mileage per person, bike trip per person, bike mileage per person) as the dependent variables. The best geographic level of detail used in the modeling for this study was determined to be the Census block group level for walking and Census tract level for biking. The need for additional supplemental private data (i.e., Walk Scores and Nielsen employment data), and geospatial information that reflects land use and physical environments, became evident after an examination of findings from the initial screening models. To be feasible, in terms of costs and time, the geographic scale of the study region was scaled down to nine selected NHTS add-on regions. These regions were chosen based on various criteria including transit availability, population size, and a mix of geographic locations across the nation. Given the similarities in modeling results from walk trips and walk mileages, additional modeling efforts conducted under the later part of this study were focused on walk trips per person. Bike models were limited only with the stepwise logistic models using Census tracts in the selected regions. Due to NHTS sampling limitations, only about 12% of these tracts have bike trips recorded from NHTS sampled households. The modeling with NHTS bike data proved to be more challenging and time consuming than what was anticipated. Along with the late arrival of Nielsen employment data, the project team had to limit the modeling effort to focus on walking. Therefore, the final modeling and discriminant analysis was conducted only for walking trips.

Hwang, Ho-Ling [ORNL; Reuscher, Tim [Macrosys; Wilson, Daniel W [ORNL; Schmoyer, Richard L [ORNL

2012-06-01T23:59:59.000Z

467

Distance-Scaled Water Concentrations versus Mass-Median Drop Size, Temperature, and Altitude in Supercooled Clouds  

Science Conference Proceedings (OSTI)

About 28 000 nautical miles (n mi) of select in-flight measurements of liquid water content (LWC), droplet sizes, temperature, and other variables in supercooled clouds from a variety of research projects over portions of North America, Europe, ...

Richard K. Jeck

2008-07-01T23:59:59.000Z

468

Analysis of the Argonne distance tabletop exercise method.  

Science Conference Proceedings (OSTI)

The purpose of this report is to summarize and evaluate the Argonne Distance Tabletop Exercise (DISTEX) method. DISTEX is intended to facilitate multi-organization, multi-objective tabletop emergency response exercises that permit players to participate from their own facility's incident command center. This report is based on experience during its first use during the FluNami 2007 exercise, which took place from September 19-October 17, 2007. FluNami 2007 exercised the response of local public health officials and hospitals to a hypothetical pandemic flu outbreak. The underlying purpose of the DISTEX method is to make tabletop exercising more effective and more convenient for playing organizations. It combines elements of traditional tabletop exercising, such as scenario discussions and scenario injects, with distance learning technologies. This distance-learning approach also allows playing organizations to include a broader range of staff in the exercise. An average of 81.25 persons participated in each weekly webcast session from all playing organizations combined. The DISTEX method required development of several components. The exercise objectives were based on the U.S. Department of Homeland Security's Target Capabilities List. The ten playing organizations included four public health departments and six hospitals in the Chicago area. An extent-of-play agreement identified the objectives applicable to each organization. A scenario was developed to drive the exercise over its five-week life. Weekly problem-solving task sets were designed to address objectives that could not be addressed fully during webcast sessions, as well as to involve additional playing organization staff. Injects were developed to drive play between webcast sessions, and, in some cases, featured mock media stories based in part on player actions as identified from the problem-solving tasks. The weekly 90-minute webcast sessions were discussions among the playing organizations that were moderated by a highly-qualified public health physician, who reviewed key scenario developments and player actions, as well as solicited input from each playing organization. The exercise control structure included trusted agents who oversaw exercise planning, playing organization points of contact to ensure exercise coordination, and exercise controller/evaluators to initiate and oversee exercise play. A password-protected exercise website was designed for FluNami 2007 to serve as a compartmentalized central information source, and for transmitting exercise documents. During the course of FluNami 2007, feedback on its quality was collected from players and controller/evaluators. Player feedback was requested at the conclusion of each webcast, upon completion of each problem-solving task, and on October 17, 2007, after the final webcast session had ended. The overall average score given to FluNami 2008 by the responding players was 3.9 on a five-point scale. In addition, suggestions for improving the process were provided by Argonne controller/evaluators after the exercise concluded. A series of recommendations was developed based on feedback from the players and controller/evaluators. These included improvements to the exercise scope and objectives, the problem-solving tasks, the scenarios, exercise control, the webcast sessions, the exercise website, and the player feedback process.

Tanzman, E. A.; Nieves, L. A.; Decision and Information Sciences

2008-02-14T23:59:59.000Z

469

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

470

An Econometric Analysis of the Elasticity of Vehicle Travel with Respect to Fuel Cost per Mile Using RTEC Survey Data  

Science Conference Proceedings (OSTI)

This paper presents the results of econometric estimation of the ''rebound effect'' for household vehicle travel in the United States based on a comprehensive analysis of survey data collected by the U.S. Energy Information Administration (EIA) at approximately three-year intervals over a 15-year period. The rebound effect is defined as the percent change in vehicle travel for a percent change in fuel economy. It summarizes the tendency to ''take back'' potential energy savings due to fuel economy improvements in the form of increased vehicle travel. Separate vehicles use models were estimated for one-, two-, three-, four-, and five-vehicle households. The results are consistent with the consensus of recently published estimates based on national or state-level data, which show a long-run rebound effect of about +0.2 (a ten percent increase in fuel economy, all else equal, would produce roughly a two percent increase in vehicle travel and an eight percent reduction in fuel use). The hypothesis that vehicle travel responds equally to changes in fuel cost-per-mile whether caused by changes in fuel economy or fuel price per gallon could not be rejected. Recognizing the interdependency in survey data among miles of travel, fuel economy and price paid for fuel for a particular vehicle turns out to be crucial to obtaining meaningful results.

Greene, D.L.; Kahn, J.; Gibson, R.

1999-03-01T23:59:59.000Z

471

Travel Arrangements  

NLE Websites -- All DOE Office Websites (Extended Search)

Week 2 - Argonne National Laboratory Social Activities Friday, June 24 - ReceptionBanquet at the Argonne Guest House Saturday, June 25 - Student Closing Picnic Scientific...

472

Travel Arrangements  

NLE Websites -- All DOE Office Websites (Extended Search)

Week 2 - Argonne National Laboratory Social Activities Friday, June 12 - ReceptionBanquet at the Argonne Guest House Saturday, June 13 - Student Closing Picnic Scientific...

473

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st

474

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS

475

Theoretical Antineutrino Detection, Direction and Ranging at Long Distances  

E-Print Network (OSTI)

In this paper we introduce the concept of what we call "NUDAR" (NeUtrino Direction and Ranging), making the point that measurements of the observed energy and direction vectors can be employed to passively deduce the exact three-dimensional location and thermal power of geophysical and anthropogenic neutrino sources from even a single detector. We present the most precise background estimates to date, all handled in full three dimensions, as functions of depth and geographical location. For the present calculations, we consider a hypothetical 138 kiloton detector which can be transported to an ocean site and deployed to an operational depth. We present a Bayesian estimation framework to incorporate any a priori knowledge of the reactor that we are trying to detect, as well as the estimated uncertainty in the background and the oscillation parameters. Most importantly, we fully employ the knowledge of the reactor spectrum and the distance-dependent effects of neutrino oscillations on such spectra. The latter, in particular, makes possible determination of range from one location, given adequate signal statistics. Further, we explore the rich potential of improving detection with even modest improvements in individual neutrino direction determination. We conclude that a 300 MWth reactor can indeed be geolocated, and its operating power estimated with one or two detectors in the hundred kiloton class at ranges out to a few hundred kilometers. We note that such detectors would have natural and non-interfering utility for scientific studies of geo-neutrinos, neutrino oscillations, and astrophysical neutrinos. This motivates the development of cost effective methods of constructing and deploying such next generation detectors.

Glenn R. Jocher; Daniel A. Bondy; Brian M. Dobbs; Stephen T. Dye; James A. Georges III; John G. Learned; Christopher L. Mulliss; Shawn Usman

2013-07-09T23:59:59.000Z

476

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

477

Construction and testing of an 11.4 GHz dielectric structure based travelling wave accelerator.  

Science Conference Proceedings (OSTI)

One major challenge in constructing a dielectric loaded traveling wave accelerator powered by an external rf power source is the difficulty in achieving efficient coupling. In this paper, we report that we have achieved high efficiency broadband coupling by using a combination of a tapered dielectric section and a carefully adjusted coupling slot. We are currently constructing an 11.4 GHz accelerator structure loaded with a permitivity=20 dielectric. Bench testing has demonstrated a coupling efficiency in excess of 95% with bandwidth of 600 MHz. The final setup will be tested at high power at SLAC using an X-band klystron rf source.

Gai, W.; Konecny, R.; Wong, T.; Zou, P.

1999-03-26T23:59:59.000Z

478

Iterative method to compute the Fermat points and Fermat distances of multiquarks  

E-Print Network (OSTI)

The multiquark confining potential is proportional to the total distance of the fundamental strings linking the quarks and antiquarks. We address the computation of the total string distance an of the Fermat points where the different strings meet. For a meson (quark-antiquark system) the distance is trivially the quark-antiquark distance. For a baryon (three quark system) the problem was solved geometrically from the onset, by Fermat and by Torricelli. The geometrical solution can be determined just with a rule and a compass, but translation of the geometrical solution to an analytical expression is not as trivial. For tetraquarks, pentaquarks, hexaquarks, etc, the geometrical solution is much more complicated. Here we provide an iterative method, converging fast to the correct Fermat points and the total distances, relevant for the multiquark potentials. We also review briefly the geometrical methods leading to the Fermat points and to the total distances.

P. Bicudo; M. Cardoso

2008-12-03T23:59:59.000Z

479

Bounded-distance multi-clusterhead formation in wireless ad hoc networks  

Science Conference Proceedings (OSTI)

We present a clustering technique addressing redundancy for bounded-distance clusters, which means being able to determine the minimum number of cluster-heads per node, and the maximum distance from nodes to their cluster-heads. This problem is similar ... Keywords: (k,r)-dominating sets, Ad hoc networks, Clustering, Distance domination, Domination in graphs, Multi-core multicast protocols, Multicast protocols, Multiple domination

Marco Aurlio Spohn; J. J. Garcia-Luna-Aceves

2007-05-01T23:59:59.000Z

480

A NOTE ON THE DISTANCE SET PROBLEM IN THE PLANE THEMIS MITSIS  

E-Print Network (OSTI)

Abstract. We use a simple geometric-combinatorial argument to establish a quantitative relation between the generalized Hausdorff measure of a set and its distance set, extending a result originally due to Falconer. Let A be a subset of the plane. The distance set D(A) is defined as the set of all distances between points of A. Namely D(A) ={|x ? y | : x, y ? A}. It follows from the work of Falconer [2] (see also Mattila [3]) that 1

Communicated David Preiss

2001-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "distance traveled mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Calibration of the distance scale from galactic Cepheids: I Calibration based on the GFG sample  

E-Print Network (OSTI)

New estimates of the distances of 36 nearby galaxies are presented based on accurate distances of galactic Cepheids obtained by Gieren, Fouque and Gomez (1998) from the geometrical Barnes-Evans method. The concept of 'sosie' is applied to extend the distance determination to extragalactic Cepheids without assuming the linearity of the PL relation. Doing so, the distance moduli are obtained in a straightforward way. The correction for extinction is made using two photometric bands (V and I) according to the principles introduced by Freedman and Madore (1990). Finally, the statistical bias due to the incompleteness of the sample is corrected according to the precepts introduced by Teerikorpi (1987) without introducing any free parameters (except the distance modulus itself in an iterative scheme). The final distance moduli depend on the adopted extinction ratio {R_V}/{R_I} and on the limiting apparent magnitude of the sample. A comparison with the distance moduli recently published by the Hubble Space Telescope Key Project (HSTKP) team reveals a fair agreement when the same ratio {R_V}/{R_I} is used but shows a small discrepancy at large distance. In order to bypass the uncertainty due to the metallicity effect it is suggested to consider only galaxies having nearly the same metallicity as the calibrating Cepheids (i.e. Solar metallicity). The internal uncertainty of the distances is about 0.1 magnitude but the total uncertainty may reach 0.3 magnitude.

G. Paturel; G. Theureau; P. Fouque; J. N. Terry; I. Musella; T. Ekholm

2002-01-21T23:59:59.000Z

482

Semi-supervised Learning with Density Based Distances Avleen S. Bijral  

E-Print Network (OSTI)

Semi-supervised Learning with Density Based Distances Avleen S. Bijral Toyota Technological Institute Chicago, IL 60637 Nathan Ratliff Google Inc. Pittsburg, PA 15206 Nati Srebro Toyota Technological

Srebro, Nathan

483

Single-photon frequency upconversion for long-distance quantum teleportation and communication  

E-Print Network (OSTI)

Entanglement generation, single-photon detection, and frequency translation that preserves the polarization quantum state of the photons are essential technologies for long distance quantum communication protocols. This ...

Albot?, Marius A., 1974-

2006-01-01T23:59:59.000Z

484

Long distance symmetries for nuclear forces and the similarity renormalization group  

Science Conference Proceedings (OSTI)

In this work we study the emergence of long distance symmetries for nuclear forces within the framework of the similarity renormalization group approach.

Szpigel, S. [Faculdade de Computacao e Informatica, Universidade Presbiteriana Mackenzie, 01302-907, Sao Paulo - SP (Brazil); Timoteo, V. S. [Faculdade de Tecnologia, Universidade Estadual de Campinas, 13484-332, Limeira - SP (Brazil); Arriola, E. R. [Departamento de Fisica Atomica, Molecular y Nuclear and Instituto Carlos I de Fisica Teorica y Computacional, Universidad de Granada, E-18071, Granada (Spain)

2013-03-25T23:59:59.000Z

485

The iBP algorithm for the discretizable molecular distance geometry ...  

E-Print Network (OSTI)

Jan 6, 2011 ... wireless sensors given some of the distances (estimated by monitoring the ..... this operation for all the amino acids forming a protein, then the...

486

Characterizing Walk Trips in communities by Using Data from 2009 National Household Travel Survey, American Community Survey, and Other Sources  

SciTech Connect

Non-motorized travel (i.e. walking and bicycling) are of increasing interest to the transportation profession, especially in context with energy consumption, reducing vehicular congestion, urban development patterns, and promotion of healthier life styles. This research project aimed to identify factors impacting the amount of travel for both walk and bike trips at the Census block group or tract level, using several public and private data sources. The key survey of travel behavior is the 2009 National Household Travel Survey (NHTS) which had over 87,000 walk trips for persons 16 and over, and over 6000 bike trips for persons 16 and over. The NHTS, in conjunction with the Census Bureau s American Community Survey, street density measures using Census Bureau TIGER, WalkScore , Nielsen Claritas employment estimates, and several other sources were used for this study. Stepwise Logistic Regression modeling techniques as well as Discriminant Analysis were applied using the integrated data set. While the models performed reasonably well for walk trips, travel by bike was abandoned due to sparseness of data. This paper discusses data sources utilized and modeling processes conducted under this study. It also presents a summary of findings and addresses data challenges and lesson-learned from this research effort.

Hwang, Ho-Ling [ORNL; Reuscher, Tim [Macrosys; Wilson, Daniel W [ORNL; Murakami, Elaine [FHWA USDOT

2013-01-01T23:59:59.000Z

487

Assessment of Smolt Condition for Travel Time Analysis, 1989 Annual Report.  

DOE Green Energy (OSTI)

The Water Budget is a volume of water used to enhance environmental conditions (flows) in the Columbia and Snake rivers for juvenile salmonids during their seaward migration. To manage the Water Budget, the Fish Passage Center estimates travel times of juvenile salmonids in index reaches of the main-stem rivers, using information on river flows and the migrational characteristics of the juvenile salmonids. This study was initiated to provide physiological information on the juvenile salmonids used for these travel time estimates. The physiological ability to respond to stressors was evaluated by measuring concentrations of plasma cortisol, glucose, and chlorides before and after a 30-s handling-stress challenge test. The development of smoltification was assessed by measuring gill Na{sup +}--K{sup +} ATPase activity and plasma thyroxine concentrations. Prevalence of bacterial kidney disease in spring chinook salmon was generally higher than in 1988, ranging from 81--100{percent} using an enzyme-linked immunosorbent assay (ELISA) method. Fish from Snake River hatcheries had more severe infections than those from mid-Columbia hatcheries. 42 refs., 19 figs., 4 tabs.

Beeman, John W.; Rondorf, Dennis W.; Faler, Joyce C. (Seattle National Fishery Research Center, Columbia River Field Station, Cook, WA)

1990-11-01T23:59:59.000Z

488

Greenhouse Earth: A Traveling Exhibition. Final report, September 1, 1991--August 31, 1992  

SciTech Connect

The Franklin Institute Science Museum provided an exhibit entitled the Greenhouse Earth: A Traveling Exhibition. This 3500 square-foot exhibit on global climate change was developed in collaboration with the Association of Science-Technology Centers. The exhibit opened at The Franklin Institute on February 14, 1992, welcoming 291,000 visitors over its three-month stay. During its three-year tour, Greenhouse Earth will travel to ten US cities, reaching two million visitors. Greenhouse Earth aims to deepen public understanding of the scientific issues of global warming and the conservation measures that can be taken to slow its effects. The exhibit features hands-on exhibitry, interactive computer programs and videos, a theater production, a ``demonstration cart,`` guided tours, and lectures. supplemental educational programs at the Institute included a teachers preview, a symposium on climate change, and a ``satellite field trip.`` The development of Greenhouse Earth included front-end and formative evaluation procedures. Evaluation includes interviews with visitors, prototypes, and summative surveys for participating museums. During its stay in Philadelphia, Greenhouse Earth was covered by the local and national press, with reviews in print and broadcast media. Greenhouse Earth is the first large-scale museum exhibit to address global climate change.

Booth, W.H.; Caesar, S.

1992-09-01T23:59:59.000Z

489

Travel grant program for the IX International Congresses of Mycology and Bacteriology -- Final report  

SciTech Connect

In 1999, the American Society for Microbiology (ASM) and the National Academy of Sciences' U.S. National Committee for the International Union of Microbiological Sciences (IUMS) jointly organized a competitive travel grant program to support the participation of U.S. scientists in the 9th International Congresses of the Bacteriological and Applied Microbiology, Mycology and Virology Divisions of the IUMS in Sydney, Australia, August 16-20, 1999. Funding was solicited for the program, and the ASM Minority and International Activities department administered the $40,000 raised. Travel grants in the amount of $2,000 were offered to U.S. investigators (citizens, including federal employees, and permanent residents working in the United States) in the early stages of their careers who planned to attend and present their research at the Congress. Teams of established and new investigators who applied jointly were eligible to received a combined $3,000 award. IUMS developed a questionnaire th at each applicant were required to complete and return, which asked each award recipient about their experience at the Congresses. Questionnaire results are included.

Granigan, Marion

2000-05-25T23:59:59.000Z

490

Racial and demographic differences in household travel and fuel purchase behavior  

Science Conference Proceedings (OSTI)

Monthly fuel purchase logs from the Residential Energy Consumption Survey's Household Transportation Panel (TP) were analyzed to determine the relationship between various household characteristics and purchase frequency, tank inventories, vehicle-miles traveled, and fuel expenditures. Multiple classification analysis (MCA) was used to relate observed differences in dependent variables to such index-type household characteristics as income and residence location, and sex, race and age of household head. Because it isolates the net effect of each parameter, after accounting for the effects of all other parameters, MCA is particularly appropriate for this type of analysis. Results reveal clear differences in travel and fuel purchase behavior for four distinct groups of vehicle-owning households. Black households tend to own far fewer vehicles with lower fuel economy, to use them more intensively, to purchase fuel more frequently, and to maintain lower fuel inventories than white households. Similarly, poor households own fewer vehicles with lower fuel economy, but they drive them less intensively, purchase fuel more frequently, and maintain lower fuel inventories than nonpoor households. Elderly households also own fewer vehicles with lower fuel economy. But since they drive them much less intensively, their fuel purchases are much less frequent and their fuel inventories are higher than nonelderly households. Female-headed households also own fewer vehicles but with somewhat higher fuel economy. They drive them less intensively, maintain higher fuel inventories, and purchase fuel less frequently than male-headed households. 13 refs., 8 tabs.

Gur, Y.; Millar, M.

1987-01-01T23:59:59.000Z

491

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

492

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

493

[Trip report of travel to Las Vegas to consider specification for the Integrated Data System (IDS) with administrative memos]. Volume 1, FY92--FY93  

SciTech Connect

This document is a compilation of travel reports and memorandums that are the results of planning between Los Alamos National Laboratory and Computer Applications Group, Inc.

Hall, J. [Computer Applications Group, Inc., Carlton, OR (United States)

1994-12-15T23:59:59.000Z

494

A conceptual model of the cognitive processing of environmental distance information  

Science Conference Proceedings (OSTI)

I review theories and research on the cognitive processing of environmental distance information by humans, particularly that acquired via direct experience in the environment. The cognitive processes I consider for acquiring and thinking about environmental ... Keywords: cognitive processing, distance information, spatial cognition

Daniel R. Montello

2009-09-01T23:59:59.000Z

495

On accurate orientation extraction and appropriate distance measure for low-resolution palmprint recognition  

Science Conference Proceedings (OSTI)

Orientation feature has been demonstrated to be one of the most effective features for low resolution palmprint recognition. In this paper, using steerable filter, we investigate the accurate orientation extraction and appropriate distance measure problems ... Keywords: Distance measure, Feature extraction, Palmprint verification, Steerable filter

Wangmeng Zuo; Feng Yue; David Zhang

2011-04-01T23:59:59.000Z

496

Tactile distance feedback for firefighters: design and preliminary evaluation of a sensory augmentation glove  

Science Conference Proceedings (OSTI)

In this paper, we describe the design and preliminary evaluation of a vibrotactile glove for distance display in low vision search contexts. Specifically, this glove was developed for firefighting applications in which users experience compromised vision ... Keywords: distance sensing, glove, sensory augmentation, smart clothing, vibrotactile display, wearable technology

Anthony Carton; Lucy E. Dunne

2013-03-01T23:59:59.000Z

497

Visualising student tracking data to support instructors in web-based distance education  

Science Conference Proceedings (OSTI)

This paper presents a novel approach of using web log data generated by course management systems (CMS) to help instructors become aware of what is happening in distance learning classes. Specifically, techniques from Information Visualization are used ... Keywords: Web-based distance education, information visualization, student tracking

Riccardo Mazza; Vania Dimitrova

2004-05-01T23:59:59.000Z

498

Impacts of deregulation and competitive entry on telecommunication networks: long distance telephone service  

Science Conference Proceedings (OSTI)

Over the past thirty years, the long distance telephone sector has been revolutionised by a series of technical and regulatory developments. In 1996, Congress passed the Telecommunications Act 1996, which substantially deregulated the telecommunications ... Keywords: economic regulation, long distance service, regression models, telecommunications

K. H. Tiedemann

2008-08-01T23:59:59.000Z

499

Community detection algorithm based on centrality and node distance in scale-free networks  

Science Conference Proceedings (OSTI)

In this paper, we present a method for detecting community structures based on centrality value and node distance. Many real world networks possess a scale-free property and this property makes community detection difficult especially on algorithms that ... Keywords: centrality value, community detection, node distance, scale-free network

Sorn Jarukasemratana; Tsuyoshi Murata; Xin Liu

2013-05-01T23:59:59.000Z

500

Including cognitive biases and distance-based rewards in a connectionist model of complex problem solving  

Science Conference Proceedings (OSTI)

We present a cognitive, connectionist-based model of complex problem solving that integrates cognitive biases and distance-based and environmental rewards under a temporal-difference learning mechanism. The model is tested against experimental data obtained ... Keywords: Cognitive biases, Computational modeling, Distance-reduction heuristic, Problem solving, Reinforcement learning, Temporal-difference learning

Frdric Dandurand; Thomas R. Shultz; Arnaud Rey

2012-01-01T23:59:59.000Z