Powered by Deep Web Technologies
Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Evaluation of the role of location and distance in recruitment in respondent-driven sampling  

E-Print Network (OSTI)

of recruitment may there- fore be more complex in urban settings. They are never- theless likely to include many of the same basic patterns (eg recruiters recruiting contacts who are geographically more accessible to them in some way), and so the con- clusions... , 37 :151-207. 6. Volz E, Heckathorn D: Probability Based Estimation Theory for Respondent Driven Sampling. Journal of Official Statistics 2008, 24 :79-97. 7. Toledo L, Codešo CT, Bertoni N, Albuquerque E, Malta M, Bastos FI, Misuse obotBMSGoD: Putting...

McCreesh, Nicky; Johnston, Lisa G; Copas, Andrew; Sonnenberg, Pam; Seeley, Janet; Hayes, Richard J; Frost, Simon DW; White, Richard G



Energetics of gas-driven limnic and volcanic eruptions Department of Geological Sciences, The University of Michigan, Ann Arbor, MI 48109-1063, USA  

E-Print Network (OSTI)

and when equilibrium is reached between the gas and liquid phases Natural silicate melts often contain two.3. Dynamics of reversible gas-driven eruptions through a fluid medium Because buoyancy plays an important roleEnergetics of gas-driven limnic and volcanic eruptions Y. Zhang* Department of Geological Sciences

Zhang, Youxue



SciTech Connect

We perform four numerical magnetohydrodynamic simulations in 2.5 dimensions (2.5D) of fast coronal mass ejections (CMEs) and their associated shock fronts between 10 Rs and 300 Rs. We investigate the relative change in the shock standoff distance, {Delta}, as a fraction of the CME radial half-width, D {sub OB} (i.e., {Delta}/D {sub OB}). Previous hydrodynamic studies have related the shock standoff distance for Earth's magnetosphere to the density compression ratio (DR; {rho} {sub u}/{rho} {sub d}) measured across the bow shock. The DR coefficient, k {sub dr}, which is the proportionality constant between the relative standoff distance ({Delta}/D {sub OB}) and the compression ratio, was semi-empirically estimated as 1.1. For CMEs, we show that this value varies linearly as a function of heliocentric distance and changes significantly for different radii of curvature of the CME's leading edge. We find that a value of 0.8 {+-} 0.1 is more appropriate for small heliocentric distances (<30 Rs) which corresponds to the spherical geometry of a magnetosphere presented by Seiff. As the CME propagates its cross section becomes more oblate and the k {sub dr} value increases linearly with heliocentric distance, such that k {sub dr} = 1.1 is most appropriate at a heliocentric distance of about 80 Rs. For terrestrial distances (215 Rs) we estimate k {sub dr} = 1.8 {+-} 0.3, which also indicates that the CME cross-sectional structure is generally more oblate than that of Earth's magnetosphere. These alterations to the proportionality coefficients may serve to improve investigations into the estimates of the magnetic field in the corona upstream of a CME as well as the aspect ratio of CMEs as measured in situ.

Savani, N. P. [University Corporation for Atmospheric Research (UCAR), Boulder, CO 80307 (United States); Shiota, D. [Computational Astrophysics Laboratory, Advanced Science Institute, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Kusano, K. [Solar-Terrestrial Environment Laboratory, Nagoya University, Nagoya 464-8601 (Japan); Vourlidas, A. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Lugaz, N., E-mail: neel.savani02@imperial.ac.uk [Experimental Space Plasma Group, University of New Hampshire, Durham, NH 03824 (United States)




SciTech Connect

We report on the determination of radial magnetic field strength in the heliocentric distance range from 6 to 120 solar radii (R {sub Sun }) using data from Coronagraph 2 (COR2) and Heliospheric Imager I (HI1) instruments on board the Solar Terrestrial Relations Observatory spacecraft following the standoff-distance method of Gopalswamy and Yashiro. We measured the shock standoff distance of the 2008 April 5 coronal mass ejection (CME) and determined the flux-rope curvature by fitting the three-dimensional shape of the CME using the Graduated Cylindrical Shell model. The radial magnetic field strength is computed from the Alfven speed and the density of the ambient medium. We also compare the derived magnetic field strength with in situ measurements made by the Helios spacecraft, which measured the magnetic field at the heliocentric distance range from 60 to 215 R {sub Sun }. We found that the radial magnetic field strength decreases from 28 mG at 6 R {sub Sun} to 0.17 mG at 120 R {sub Sun }. In addition, we found that the radial profile can be described by a power law.

Poomvises, Watanachak; Gopalswamy, Nat; Yashiro, Seiji; Kwon, Ryun-Young [NASA GSFC, Greenbelt, MD 20771 (United States); Olmedo, Oscar [Space Science Division, U.S. Naval Research Laboratory, Washington, DC 20375 (United States)



Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.



NLE Websites -- All DOE Office Websites (Extended Search)

Vehicle Usage Number of trips 773,602 Total distance traveled (mi) 5,558,155 Avg trip distance (mi) 7.2 Avg distance traveled per day when the vehicle was driven (mi) 30.2 Avg...


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Optimal distance separating halfspace  

E-Print Network (OSTI)

Plastria & Carrizosa / Optimal distance separating halfspace. 2. 1 Gauge Distance to a Hyperplane. Let ? be a gauge on Rd with unit ball B, i.e. B is a compactá...


Distance in architecture  

E-Print Network (OSTI)

The document which follows represents an exploration of distance and its connection to architecture. This exploration is threefold. On one level it regards distance as an ontological question, researching for precedent ...

Criparacos, George C



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Globular Cluster Distance Determinations  

E-Print Network (OSTI)

The present status of the distance scale to Galactic globular clusters is reviewed. Six distance determination techniques which are deemed to be most reliable are discussed in depth. These different techniques are used to calibrate the absolute magnitude of the RR Lyrae stars. The various calibrations fall into three groups. Main sequence fitting using Hipparcos parallaxes, theoretical HB models and the RR Lyrae in the LMC all favor a bright calibration, implying a `long' globular cluster distance scale. White dwarf fitting and the astrometric distances yield a somewhat fainter RR Lyrae calibration, while the statistical parallax solution yields faint RR Lyrae stars implying a `short' distance scale to globular clusters. Various secondary distance indicators discussed all favor the long distance scale. The `long' and `short' distance scales differ by (0.31+/-0.16) mag. Averaging together all of the different distance determinations yields Mv(RR) = (0.23+/-0.04)([Fe/H] + 1.6) + (0.56+/-0.12) mag.

Brian Chaboyer



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Approximating geodesic tree distance  

Science Conference Proceedings (OSTI)

Billera, Holmes, and Vogtmann introduced an intriguing new phylogenetic tree metric for weighted trees with useful properties related to statistical analysis. However, the best known algorithm for calculating this distance is exponential in the number ... Keywords: Analysis of algorithms, Phylogeny, Tree metric

Nina Amenta; Matthew Godwin; Nicolay Postarnakevich; Katherine St. John



Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mńkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Science-Driven Network  

NLE Websites -- All DOE Office Websites (Extended Search)

Science-Driven Network Requirements for ESnet Update to the 2002 Office of Science Networking Requirements Workshop Report February 21, 2006 1-1 Science-Driven Network Requirements...


Model Driven Security Functional Testing  

Science Conference Proceedings (OSTI)

Model Driven Security Functional Testing. Summary: Model-Driven Engineering (MDE) is emerging as a promising approach ...



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Analysis Driven Field Testing  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ANALYSIS DRIVEN FIELD TESTING ANALYSIS DRIVEN FIELD TESTING Greg Barker, MEP Paul Norton, NERD C.E. Hancock, MEP Building America Residential Energy Efficiency Stakeholder Meeting Austin, TX March 2, 2012 MODELING DRIVEN FIELD TESTING Greg Barker, MEP Paul Norton, NERD C.E. Hancock, MEP Building America Residential Energy Efficiency Stakeholder Meeting Austin, TX March 2, 2012 MODELING DRIVEN MEASUREMENTS Greg Barker, MEP Paul Norton, NERD C.E. Hancock, MEP Building America Residential Energy Efficiency Stakeholder Meeting Austin, TX March 2, 2012 Building America Residential Energy Efficiency Stakeholder Meeting Austin, TX March 2, 2012 "Modeling without measuring lacks credibility. Measuring without modeling lacks generality." Ed Hancock


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Entanglement replication in driven-dissipative many body systems  

E-Print Network (OSTI)

We study the dissipative dynamics of two independent arrays of many-body systems, locally driven by a common entangled field. We show that in the steady state the entanglement of the driving field is reproduced in an arbitrarily large series of inter-array entangled pairs over all distances. Local nonclassical driving thus realizes a scale-free entanglement replication and long-distance entanglement distribution mechanism that has immediate bearing on the implementation of quantum communication networks.

S. Zippilli; M. Paternostro; G. Adesso; F. Illuminati


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Rural Schools and Distance Education  

Science Conference Proceedings (OSTI)

In 2006, the author began research on current issues in rural education in which teachers recounted narratives of teaching. As deficits, they spoke of an inability to retain teachers, too little diversity in student programming, and lack of access to ... Keywords: Distance Education, Distance Education Technologies, Educational Technology, Rural Schools, Teacher Practices

Barbara G. Barter



St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



Examining Fire Fighting Tactics Under Wind Driven ...  

Science Conference Proceedings (OSTI)

Examining Fire Fighting Tactics Under Wind Driven Conditions: Laboratory Experiments. ... Wind Driven Fire Measurement Tests. Objectives: ...



DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Random Distances Associated with Rhombuses  

E-Print Network (OSTI)

Parallelograms are one of the basic building blocks in two-dimensional tiling. They have important applications in a wide variety of science and engineering fields, such as wireless communication networks, urban transportation, operations research, etc. Different from rectangles and squares, the coordinates of a random point in parallelograms are no longer independent. As a case study of parallelograms, the explicit probability density functions of the random Euclidean distances associated with rhombuses are given in this report, when both endpoints are randomly distributed in 1) the same rhombus, 2) two parallel rhombuses sharing a side, and 3) two rhombuses having a common diagonal, respectively. The accuracy of the distance distribution functions is verified by simulation, and the correctness is validated by a recursion and a probabilistic sum. The first two statistical moments of the random distances, and the polynomial fit of the density functions are also given in this report for practical uses.

Yanyan Zhuang; Jianping Pan



Water-to-Cement Distance Analysis Software  

Science Conference Proceedings (OSTI)

Water-to-Cement Distance Analysis Software. Description/Summary: ... Type of software: Analysis Software of Water-to-Cement Distance Analysis. ...



Academic Strategies for Distance Education  

Science Conference Proceedings (OSTI)

Education all over the world is of paramount importance as it provides economies with opportunities for development and growth. Education is important for both-developed and developing economies-for the former to maintain their lead position and for ... Keywords: Academic, Distance Education, Education, Knowledge, Learning, Quality, Standards, Strategies

Neeta Baporikar



Distance indexing on road networks  

Science Conference Proceedings (OSTI)

The processing of kNN and continuous kNN queries on spatial network databases (SNDB) has been intensively studied recently. However, there is a lack of systematic study on the computation of network distances, which is the most fundamental difference ...

Haibo Hu; Dik Lun Lee; Victor C. S. Lee



DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435┬░, -100.665669┬░ Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Autonomous Exploration: Driven by Uncertainty  

E-Print Network (OSTI)

Autonomous Exploration: Driven by Uncertainty Peter Whaite and Frank P. Ferrie TR-CIM-93-17 1993-6319 Telex: 05 268510 FAX: 514 398-7348 Email: cim@cim.mcgill.ca #12;Autonomous Exploration: Driven

Dudek, Gregory


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Gas-driven microturbine  

DOE Patents (OSTI)

This paper describes an invention which relates to microtechnology and the fabrication process for developing microelectrical systems. It describes a means for fabricating a gas-driven microturbine capable of providing autonomous propulsion in which the rapidly moving gases are directed through a micromachined turbine to power devices by direct linkage or turbo-electric generators components in a domain ranging from tenths of micrometers to thousands of micrometers.

Sniegowski, J.J.; Rodgers, M.S.; McWhorter, P.J.; Aeschliman, D.P.; Miller, W.M.



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani




NLE Websites -- All DOE Office Websites (Extended Search)

Usage Usage Overall fuel economy (mpg) 139 Overall electrical energy consumption (AC Wh/mi) 293 Number of trips┬╣ 76,425 Total distance traveled (mi) 609,737 Avg trip distance (mi) 8.0 Avg distance traveled per day when the vehicle was driven (mi) 36.4 Avg number of trips between charging events 3.0 Avg distance traveled between charging events (mi) 24.1 Avg number of charging events per day when the vehicle was driven 1.5


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)




Science Conference Proceedings (OSTI)

Accurately determining the escape rate from a planet's atmosphere is critical for determining its evolution. A large amount of Cassini data is now available for Titan's upper atmosphere and a wealth of data is expected within the next decade on escape from Pluto, Mars, and extra-solar planets. Escape can be driven by upward thermal conduction of energy deposited well below the exobase, as well as by nonthermal processes produced by energy deposited in the exobase region. Recent applications of a model for escape driven by upward thermal conduction, called the slow hydrodynamic escape model, have resulted in surprisingly large loss rates for the atmosphere of Titan, Saturn's largest moon. Based on a molecular kinetic simulation of the exobase region, these rates appear to be orders of magnitude too large. Therefore, the slow hydrodynamic model is evaluated here. It is shown that such a model cannot give a reliable description of the atmospheric temperature profile unless it is coupled to a molecular kinetic description of the exobase region. Therefore, the present escape rates for Titan and Pluto must be re-evaluated using the atmospheric model described here.

Johnson, Robert E., E-mail: rej@virginia.ed [Engineering Physics, Thornton Hall B102, University of Virginia, Charlottesville, VA 22902 (United States); Physics Department, New York University, New York, NY 10003 (United States)



Metrics and methods for social distance  

E-Print Network (OSTI)

Distance measures are important for scientists because they illustrate the dynamics of geospatial topologies for physical and social processes. Two major types of distance are generally used for this purpose: Euclidean ...

Andris, Clio



Adaptive multi-stage distance join processing  

Science Conference Proceedings (OSTI)

A spatial distance join is a relatively new type of operation introduced for spatial and multimedia database applications. Additional requirements for ranking and stopping cardinality are often combined with the spatial distance join in on-line query ...

Hyoseop Shin; Bongki Moon; Sukho Lee



Normalized Compression Distance of Multiples  

E-Print Network (OSTI)

Normalized compression distance (NCD) is a parameter-free similarity measure based on compression. The NCD between pairs of objects is not sufficient for all applications. We propose an NCD of finite multisets (multiples) of objacts that is metric and is better for many applications. Previously, attempts to obtain such an NCD failed. We use the theoretical notion of Kolmogorov complexity that for practical purposes is approximated from above by the length of the compressed version of the file involved, using a real-world compression program. We applied the new NCD for multiples to retinal progenitor cell questions that were earlier treated with the pairwise NCD. Here we get significantly better results. We also applied the NCD for multiples to synthetic time sequence data. The preliminary results are as good as nearest neighbor Euclidean classifier.

Cohen, Andrew R



Local discriminative distance metrics ensemble learning  

Science Conference Proceedings (OSTI)

The ultimate goal of distance metric learning is to incorporate abundant discriminative information to keep all data samples in the same class close and those from different classes separated. Local distance metric methods can preserve discriminative ... Keywords: Distance metrics learning, Local learning

Yang Mu; Wei Ding; Dacheng Tao



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Muscle-driven nanogenerators  

SciTech Connect

In a method of generating electricity, a plurality of living cells are grown on an array of piezoelectric nanowires so that the cells engage the piezoelectric nanowires. Induced static potentials are extracted from at least one of the piezoelectric nanowires when at least one of the cells deforms the at least one of the piezoelectric nanowires. A cell-driven electrical generator that includes a substrate and a plurality of spaced-apart piezoelectric nanowires disposed on the substrate. A plurality of spaced-apart conductive electrodes interact with the plurality of piezoelectric nanowires. A biological buffer layer that is configured to promote growth of cells is disposed on the substrate so that cells placed on the substrate will grow and engage the piezoelectric nanowires.

Wang, Zhong L. (Marietta, GA); Yang, Rusen (Atlanta, GA)



Recent progress on system studies for long distance power transmission  

SciTech Connect

Two possible applications of helium-cooled underground cables for power transmission were studied to determine network characteristics and estimated costs. The first involved power transmission at 345 kV from a Long Island nuclear power plant to a substation 43 miles away. The second appication examined the feasibility of a 350 mi-long 550 kV transmission line from Western Pennsylvania to Allentown and Philadelphia. For both systems computer simulations were used to study operating characteristics. A detailed cost analysis was made. The Long Island study concluded that helium-cooled cables were well suited for high-power transmission in a suburban area, that such a system using two trenches and separate refrigerator stations would be more reliable than a single trench system, and that cost could be optimized by using a less expensive cryogenic envelope. The Pennsylvania study showed that the helium-cooled cable was technically capable of performing as well as overhead power lines, but the cost of the underground cryogenic system is so much greater that such a system could not be economically justified for long distance transmission across open country-side. (LCL)

Forsyth, E B



Data-driven trajectory smoothing  

Science Conference Proceedings (OSTI)

Motivated by the increasing availability of large collections of noisy GPS traces, we present a new data-driven framework for smoothing trajectory data. The framework, which can be viewed of as a generalization of the classical moving average technique, ... Keywords: data-driven techniques, smoothing, trajectories

Frederic Chazal; Daniel Chen; Leonidas Guibas; Xiaoye Jiang; Christian Sommer



Magnetically Driven Accretion  

E-Print Network (OSTI)

We carried out 2.5-dimensional resistive magnetohydrodynamic simulations to study the effects of magnetic diffusivity on magnetically driven mass accretion and jet formation. The initial state is a constant angular-momentum torus threaded by large-scale vertical magnetic fields. Since the angular momentum of the torus is extracted due to magnetic braking, the torus medium falls toward the central region. The infalling matter twists the large-scale magnetic fields and drives bipolar jets. We found that (1) when the normalized magnetic diffusivity, »? ? ?/(r0VK0), where VK0 is the Keplerian rotation speed at a reference radius r = r0, is small (»? ? 10 ?3), mass accretion and jet formation take place intermittently; (2) when 10 ?3 ? »? ? 10 ?2, the system evolves toward a quasi-steady state; and (3) when »? ? 10 ?2 the accretion/mass 1 outflow rate decreases with »? and approaches 0. The results of these simulations indicate that in the center of a galaxy which has a super-massive ( ? 10 9 M?) black hole, a massive ( ? 10 8 M?) gas torus and magnetic braking provide a mass accretion rate which is sufficient to explain the activity of AGNs when »? ? 5 Î 10?2.

Takuhito Kuwabara; Kazunari Shibata; Takahiro Kudoh




E-Print Network (OSTI)

Jun 6, 2010 ... part by NSF Grant CCF 0514213 and DOE Grant DESC0002218. REFERENCES . [1] A. Y. Alfakih, On the uniqueness of Euclidean distanceá...


Wind-Driven House Fire, Texas, 2009  

Science Conference Proceedings (OSTI)

Wind-Driven House Fire, Texas 2009. ... Selected Publications. Simulation of the Dynamics of a Wind-Driven Fire in a Ranch-Style House - Texas. ...



Salinity driven oceanographic upwelling  

DOE Patents (OSTI)

The salinity driven oceanographic upwelling is maintained in a mariculture device that includes a long main duct in the general shape of a cylinder having perforated cover plates at each end. The mariculture device is suspended vertically in the ocean such that one end of the main duct is in surface water and the other end in relatively deep water that is cold, nutrient rich and relatively fresh in comparison to the surface water which is relatively warm, relatively nutrient deficient and relatively saline. A plurality of elongated flow segregating tubes are disposed in the main duct and extend from the upper cover plate beyond the lower cover plate into a lower manifold plate. The lower manifold plate is spaced from the lower cover plate to define a deep water fluid flow path to the interior space of the main duct. Spacer tubes extend from the upper cover plate and communicate with the interior space of the main duct. The spacer tubes are received in an upper manifold plate spaced from the upper cover plate to define a surface water fluid flow path into the flow segregating tubes. A surface water-deep water counterflow is thus established with deep water flowing upwardly through the main duct interior for discharge beyond the upper manifold plate while surface water flows downwardly through the flow segregating tubes for discharge below the lower manifold plate. During such counterflow heat is transferred from the downflowing warm water to the upflowing cold water. The flow is maintained by the difference in density between the deep water and the surface water due to their differences in salinity. The upwelling of nutrient rich deep water is used for marifarming by fertilizing the nutrient deficient surface water.

Johnson, David H. (Lakewood, CO)



Salinity driven oceanographic upwelling  

DOE Patents (OSTI)

The salinity driven oceanographic upwelling is maintained in a mariculture device that includes a long main duct in the general shape of a cylinder having perforated cover plates at each end. The mariculture device is suspended vertically in the ocean such that one end of the main duct is in surface water and the other end in relatively deep water that is cold, nutrient rich and relatively fresh in comparison to the surface water which is relatively warm, relatively nutrient deficient and relatively saline. A plurality of elongated flow segregating tubes are disposed in the main duct and extend from the upper cover plate beyond the lower cover plate into a lower manifold plate. The lower manifold plate is spaced from the lower cover plate to define a deep water fluid flow path to the interior space of the main duct. Spacer tubes extend from the upper cover plate and communicate with the interior space of the main duct. The spacer tubes are received in an upper manifold plate spaced from the upper cover plate to define a surface water fluid flow path into the flow segregating tubes. A surface water-deep water counterflow is thus established with deep water flowing upwardly through the main duct interior for discharge beyond the upper manifold plate while surface water flows downwardly through the flow segregating tubes for discharge below the lower manifold plate. During such counterflow heat is transferred from the downflowing warm water to the upflowing cold water. The flow is maintained by the difference in density between the deep water and the surface water due to their differences in salinity. The upwelling of nutrient rich deep water is used for marifarming by fertilizing the nutrient deficient surface water. 1 fig.

Johnson, D.H.



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Wind-Driven Circulation on the North West Shelf of Australia  

Science Conference Proceedings (OSTI)

In this study, the wind-driven circulation of the North West Shelf of Australia is examined. Along its length, the offshore distance to the 200 m isobath is generally greater than 150 km, which means the shelf is relatively wide compared to other ...

Ian Webster



ITL's Evaluation-Driven Approach to Information Retrieval is ...  

Science Conference Proceedings (OSTI)

ITL's Evaluation-Driven Approach to Information Retrieval is Expanding Internationally. The evaluation-driven approach ...

Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: ┬Ě Hot handling ┬Ě Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Data-driven batch schuduling  

SciTech Connect

In this paper, we develop data-driven strategies for batch computing schedulers. Current CPU-centric batch schedulers ignore the data needs within workloads and execute them by linking them transparently and directly to their needed data. When scheduled on remote computational resources, this elegant solution of direct data access can incur an order of magnitude performance penalty for data-intensive workloads. Adding data-awareness to batch schedulers allows a careful coordination of data and CPU allocation thereby reducing the cost of remote execution. We offer here new techniques by which batch schedulers can become data-driven. Such systems can use our analytical predictive models to select one of the four data-driven scheduling policies that we have created. Through simulation, we demonstrate the accuracy of our predictive models and show how they can reduce time to completion for some workloads by as much as 80%.

Bent, John [Los Alamos National Laboratory; Denehy, Tim [GOOGLE; Arpaci - Dusseau, Remzi [UNIV OF WISCONSIN; Livny, Miron [UNIV OF WISCONSIN; Arpaci - Dusseau, Andrea C [NON LANL



Optimal expected-distance separating halfspace  

E-Print Network (OSTI)

If a different norm is used for each data set in order to measure distances to ... In practical settings, one usually has a data set D = {(x1,y1),..., (xp,yp)} ?. Rd Î {?1


Sensor fault detection using the Mahalanobis distance  

Science Conference Proceedings (OSTI)

A method is described by which a localized sensor abnormality can be detected using the Mahalanobis distance. The Mahalanobis distance is approximately the weighted distance from the hyperplane formed by the principal components to the particular observation. Qualitatively, the principal components correspond to the physical laws that govern the behavior of the systems and constraints placed on the system. If there are more sensors than principal components, there are redundant measurements. This redundancy can be used to detect abnormalities that are due either to sensor failure or a localized change in the system being measured. The method compares the distribution of the Mahalanobis distance during normal operation with the distribution during the current operation. A likelihood ratio test is then used to determine if a sensor has gone bad or if operations in the reactor are different from normal. The sensor whose value is not normal is identified by comparing Mahalanobis distances computed with one sensor masked. When the abnormal sensor is masked, the Mahalanobis distance for this subset of sensors will be within prespecified bounds. The method is demonstrated on 20 subassembly output thermocouples in the core of Experimental Breeder Reactor II.

White, A.M.; Gross, K.C. (Argonne National Lab., IL (United States)); Kubic, W.L (Los Alamos National Lab., NM (United States))



Antimatter Driven Sail for Deep Space Missions  

Science Conference Proceedings (OSTI)

The concept of the Antimatter Driven Sail (ADS) has been examined in three major areas: Mission Architecture

Steven D. Howe; Gerald P. Jackson



Short-Distance Structure of Nuclei  

Science Conference Proceedings (OSTI)

One of Jefferson Lab's original missions was to further our understanding of the short-distance structure of nuclei. In particular, to understand what happens when two or more nucleons within a nucleus have strongly overlapping wave-functions; a phenomena commonly referred to as short-range correlations. Herein, we review the results of the (e,e'), (e,e'p) and (e,e'pN) reactions that have been used at Jefferson Lab to probe this short-distance structure as well as provide an outlook for future experiments.

Douglas Higinbotham, Eliazer Piasetzky, Stephen Wood



Bounds on distance distributions in codes of known size  

Science Conference Proceedings (OSTI)

We treat the problem of bounding components of the possible distance distributions of codes given the knowledge of their size and possibly minimum distance. Using the Beckner inequality from harmonic analysis, we derive upper bounds on distance distribution ...

A. E. Ashikhmin; G. D. Cohen; M. Krivelevich; S. N. Litsyn



Stochastic Event-Driven Molecular Dynamics  

Science Conference Proceedings (OSTI)

A novel Stochastic Event-Driven Molecular Dynamics (SEDMD) algorithm is developed for the simulation of polymer chains suspended in a solvent. SEDMD combines event-driven molecular dynamics (EDMD) with the Direct Simulation Monte Carlo (DSMC) method. ... Keywords: Complex flow, DSMC, Event-driven molecular dynamics, Polymer suspension

Aleksandar Donev; Alejandro L. Garcia; Berni J. Alder



Solar Decathlon 2013: Going the Distance | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Going the Distance Solar Decathlon 2013: Going the Distance September 17, 2013 - 4:26pm Addthis Toggle Routes onoff Return to map Solar Decathlon Journeys Visualizing the...


Semantic distances for technology landscape visualization  

Science Conference Proceedings (OSTI)

This paper presents a novel approach to the visualization of research domains in science and technology. The proposed methodology is based on the use of bibliometrics; i.e., analysis is conducted using information regarding trends and patterns ... Keywords: Clustering, Data mining, Semantic distance, Technology forecasting

Wei Lee Woon; Stuart Madnick



miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Long working distance incoherent interference microscope  

DOE Patents (OSTI)

A full-field imaging, long working distance, incoherent interference microscope suitable for three-dimensional imaging and metrology of MEMS devices and test structures on a standard microelectronics probe station. A long working distance greater than 10 mm allows standard probes or probe cards to be used. This enables nanometer-scale 3-dimensional height profiles of MEMS test structures to be acquired across an entire wafer while being actively probed, and, optionally, through a transparent window. An optically identical pair of sample and reference arm objectives is not required, which reduces the overall system cost, and also the cost and time required to change sample magnifications. Using a LED source, high magnification (e.g., 50.times.) can be obtained having excellent image quality, straight fringes, and high fringe contrast.

Sinclair, Michael B. (Albuquerque, NM); De Boer, Maarten P. (Albuquerque, NM)



Actively driven thermal radiation shield  

DOE Patents (OSTI)

A thermal radiation shield for cooled portable gamma-ray spectrometers. The thermal radiation shield is located intermediate the vacuum enclosure and detector enclosure, is actively driven, and is useful in reducing the heat load to mechanical cooler and additionally extends the lifetime of the mechanical cooler. The thermal shield is electrically-powered and is particularly useful for portable solid-state gamma-ray detectors or spectrometers that dramatically reduces the cooling power requirements. For example, the operating shield at 260K (40K below room temperature) will decrease the thermal radiation load to the detector by 50%, which makes possible portable battery operation for a mechanically cooled Ge spectrometer.

Madden, Norman W. (Livermore, CA); Cork, Christopher P. (Pleasant Hill, CA); Becker, John A. (Alameda, CA); Knapp, David A. (Livermore, CA)



Responsibility-Driven Explanation Engineering  

E-Print Network (OSTI)

We describe an approach for developing explanation facilities for cognitive architectures based on techniques drawn from object- and aspect-oriented software engineering. We examine the use of responsibility-driven design augmented with scenario-based techniques and classresponsibility -collaboration (CRC) cards to identify explanation behaviors for cognitive model elements, and discuss the explanation benefits derived from encapsulating model behaviors within aspects. Soar is used an example cognitive architecture, but the methods and results as illustrated would apply to any of the other architectures commonly used to development psychologically plausible intelligent systems.

For Cognitive Models; Steven R. Haynes; Isaac G. Councill; Frank E. Ritter




NLE Websites -- All DOE Office Websites (Extended Search)

NERSC Storage Systems Group NERSC Storage Systems Group Storage at a Distance --- 1 --- Open F abrics A lliance U ser D ay What is storage at a distance? * Data i s n ot l ocal t o t he u ser/resource * Processing a nd w orkflow n eeds a re n ear r eal---7me - Don't w ant t o w ait u n9l d ata t ransfer i s c omplete - Need t o s ee r esults, m ake a djustments, a nd t ry a gain * Network w ill b ecome p art o f t he i nstruments - Telescopes a nd t heir d ata - Sequencers a nd t heir g enome d ata - Light s ources a nd t heir d ata * Is t here a n a rchitecture/protocol t hat i s n ecessary today for successfully providing storage at a distance? - Ethernet v s. I B - ROCE v s. R DMA v s. I P --- 2 --- Open F abrics A lliance U ser D ay Use case 1: Instruments (beam lines) * ShiB w ork ( 24hr c overage) - Scien9sts fl y i n a nd u se t he i nstrument


Ballistic Focusing of Polyenergetic Protons Driven by Petawatt Laser Pulses  

Science Conference Proceedings (OSTI)

By using a thick (250 {mu}m) target with 350 {mu}m radius of curvature, the intense proton beam driven by a petawatt laser is focused at a distance of {approx}1 mm from the target for all detectable energies up to {approx}25 MeV. The thickness of the foil facilitates beam focusing as it suppresses the dynamic evolution of the beam divergence caused by peaked electron flux distribution at the target rear side. In addition, reduction in inherent beam divergence due to the target thickness relaxes the curvature requirement for short-range focusing. Energy resolved mapping of the proton beam trajectories from mesh radiographs infers the focusing and the data agree with a simple geometrical modeling based on ballistic beam propagation.

Kar, S.; Borghesi, M.; Zepf, M. [Centre for Plasma Physics, School of Mathematics and Physics, Queen's University Belfast, BT7 1NN (United Kingdom); Markey, K. [Centre for Plasma Physics, School of Mathematics and Physics, Queen's University Belfast, BT7 1NN (United Kingdom); Central Laser Facility, Rutherford Appleton Laboratory, OX11 0QX (United Kingdom); Carroll, D. C; McKenna, P.; Quinn, M. N. [SUPA, Department of Physics, University of Strathclyde, Glasgow, G4 0NG (United Kingdom); Neely, D. [Central Laser Facility, Rutherford Appleton Laboratory, OX11 0QX (United Kingdom)


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Asynchronous Event-Driven Particle Algorithms  

Science Conference Proceedings (OSTI)

We present, in a unifying way, the main components of three asynchronous event-driven algorithms for simulating physical systems of interacting particles. The first example, hard-particle molecular dynamics (MD), is well-known. We also present a recently-developed diffusion kinetic Monte Carlo (DKMC) algorithm, as well as a novel stochastic molecular-dynamics algorithm that builds on the Direct Simulation Monte Carlo (DSMC). We explain how to effectively combine event-driven and classical time-driven handling, and discuss some promises and challenges for event-driven simulation of realistic physical systems.

Donev, A



Asynchronous Event-Driven Particle Algorithms  

Science Conference Proceedings (OSTI)

We present in a unifying way the main components of three examples of asynchronous event-driven algorithms for simulating physical systems of interacting particles. The first example, hard-particle molecular dynamics (MD), is well-known. We also present a recently-developed diffusion kinetic Monte Carlo (DKMC) algorithm, as well as a novel event-driven algorithm for Direct Simulation Monte Carlo (DSMC). Finally, we describe how to combine MD with DSMC in an event-driven framework, and discuss some promises and challenges for event-driven simulation of realistic physical systems.

Donev, A



Boron Nanotechnology-driven Cancer Therapy  

Science Conference Proceedings (OSTI)

Presentation Title, Boron Nanotechnology-driven Cancer Therapy ... Current research focuses on both the design and synthesis of high boron containingá...


h. tms mission-driven development guidelines  

Science Conference Proceedings (OSTI)

Guidelines on Mission-Driven Development within TMS ... in compliance with existing TMS articles of incorporation, bylaws, policies, practices, and procedures .


Electrically driven nanopyramid green light emitting diode  

Science Conference Proceedings (OSTI)

An electrically driven nanopyramid green light emitting diode(LED) was demonstrated. The nanopyramid arrays were fabricated from a GaN substrate by patterned nanopillar etch

S.-P. Chang; Y.-C. Chen; J.-K. Huang; Y.-J. Cheng; J.-R. Chang; K.-P. Sou; Y.-T. Kang; H.-C. Yang; T.-C. Hsu; H.-C. Kuo; C.-Y. Chang



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Light-driven phase shifter  

DOE Patents (OSTI)

A light-driven phase shifter is provided for modulating a transmission light beam. A gaseous medium such as argon is provided with electron energy states excited to populate a metastable state. A tunable dye laser is selected with a wavelength effective to deplete the metastable electron state and may be intensity modulated. The dye laser is directed through the gaseous medium to define a first optical path having an index of refraction determined by the gaseous medium having a depleted metastable electron state. A transmission laser beam is also directed through the gaseous medium to define a second optical path at least partially coincident with the first optical path. The intensity of the dye laser beam may then be varied to phase modulate the transmission laser beam. 2 figs.

Early, J.W.



Light-driven phase shifter  

DOE Patents (OSTI)

A light-driven phase shifter is provided for modulating a transmission light beam. A gaseous medium such as argon is provided with electron energy states excited to populate a metastable state. A tunable dye laser is selected with a wavelength effective to deplete the metastable electron state and may be intensity modulated. The dye laser is directed through the gaseous medium to define a first optical path having an index of refraction determined by the gaseous medium having a depleted metastable electron state. A transmission laser beam is also directed through the gaseous medium to define a second optical path at least partially coincident with the first optical path. The intensity of the dye laser beam may then be varied to phase modulate the transmission laser beam.

Early, James W. (Los Alamos, NM)



Laser-driven fusion reactor  

DOE Patents (OSTI)

A laser-driven fusion reactor consisting of concentric spherical vessels in which the thermonuclear energy is derived from a deuterium-tritium (D + T) burn within a pellet'', located at the center of the vessels and initiated by a laser pulse. The resulting alpha -particle energy and a small fraction of the neutron energy are deposited within the pellet; this pellet energy is eventually transformed into sensible heat of lithium in a condenser outside the vessels. The remaining neutron energy is dissipated in a lithium blanket, located within the concentric vessels, where the fuel ingredient, tritium, is also produced. The heat content of the blanket and of the condenser lithium is eventually transferred to a conventional thermodynamic plant where the thermal energy is converted to electrical energy in a steam Rankine cycle. (Official Gazette)

Hedstrom, J.C.



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Asynchronous Event-Driven Particle Algorithms  

Science Conference Proceedings (OSTI)

We present, in a unifying way, the main components of three asynchronous event-driven algorithms for simulating physical systems of interacting particles. The first example, hard-particle molecular dynamics, is well known. We also present a recently ... Keywords: Asynchronous, event-driven, kinetic Monte Carlo, molecular dynamics, particle systems

Aleksandar Donev



Ontology-driven, unsupervised instance population  

Science Conference Proceedings (OSTI)

The Semantic Web's need for machine understandable content has led researchers to attempt to automatically acquire such content from a number of sources, including the web. To date, such research has focused on ''document-driven'' systems that individually ... Keywords: Classification, Confidence assessment, Instance population, Ontology-driven, Semantic Web

Luke K. McDowell; Michael Cafarella



Pattern Language Verification in Model Driven Design  

Science Conference Proceedings (OSTI)

This paper addresses the problem of verifying the application of a Pattern Language in a design that is built based upon the patterns of the language in a model-driven approach. We propose a process named Pattern Language Verifier (PLV) which consists ... Keywords: Model Driven Engineering, Pattern Language Verification

Bahman Zamani, Greg Butler



Simple data-driven modeling of brushes  

Science Conference Proceedings (OSTI)

We present a new and simple data-driven technique for modeling 3D brushes for use in realistic painting programs. Our technique simplifies and accelerates simulation of the constrained dynamics of brushes by using a small lookup table that efficiently ... Keywords: data-driven, deformation, dynamics, example-based, optimization, painting systems, physically based modeling

William Baxter; Naga Govindaraju



The Economics of Yield-Driven Processes  

E-Print Network (OSTI)

iThUiM@ti_@* it 5i? t||)@? @*)ttL? | iigiU|tLu@*|ih? @|iThL_tti_@MLiciMi*ii| tT@Tih @tTL*|U@* 4T*U@|L? t hÇ? _? }tt }}t| tL4i}i? ih@*_tU ttL? @? _i @4T*itLu)i*__hi? ThLUittit5iU|

Roger E. Bohn; Christian Terwiesch



2D Euclidean distance transform algorithms: A comparative survey  

Science Conference Proceedings (OSTI)

The distance transform (DT) is a general operator forming the basis of many methods in computer vision and geometry, with great potential for practical applications. However, all the optimal algorithms for the computation of the exact Euclidean DT (EDT) ... Keywords: Dijkstra's algorithm, Distance transform, computational geometry, exact Euclidean distance map, performance evaluation, shape analysis

Ricardo Fabbri; Luciano Da F. Costa; Julio C. Torelli; Odemir M. Bruno



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



Distance Is Not Dead: Social Interaction and Geographical Distance in the Internet Era  

E-Print Network (OSTI)

The Internet revolution has made long-distance communication dramatically faster, easier, and cheaper than ever before. This, it has been argued, has decreased the importance of geographic proximity in social interactions, transforming our world into a global village with a borderless society. We argue for the opposite: while technology has undoubtedly increased the overall level of communication, this increase has been most pronounced for local social ties. We show that the volume of electronic communications is inversely proportional to geographic distance, following a Power Law. We directly study the importance of physical proximity in social interactions by analyzing the spatial dissemination of new baby names. Counter-intuitively, and in line with the above argument, the importance of geographic proximity has dramatically increased with the internet revolution.

Goldenberg, Jacob


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Research Trends in Information-Driven Manufacturing  

NLE Websites -- All DOE Office Websites (Extended Search)

Research Trends in Information-Driven Manufacturing Speaker(s): Steven Ray Date: October 30, 2008 - 12:00pm Location: 90-3122 Seminar HostPoint of Contact: Arun Majumdar Recent...


Unsteady Thermally Driven Flows on Gentle Slopes  

Science Conference Proceedings (OSTI)

The theoretical and laboratory studies on mean velocity and temperature fields of an unsteady atmospheric boundary layer on sloping surfaces reported here were motivated by recent field observations on thermally driven circulation in very wide ...

J. C. R. Hunt; H. J. S. Fernando; M. Princevac



Thermally Driven Circulations in Small Oceanic Basins  

Science Conference Proceedings (OSTI)

A linear, steady model of the circulation of a small (f plane) oceanic basin driven by heating or cooling at the surface is considered in order to examine the partition of upwelling (heating) or downwelling (cooling) between the basin's interior ...

Joseph Pedlosky



Gravity-Driven Intrusions in Stratified Fluids  

E-Print Network (OSTI)

5.5.1 Five interleaving interfacial gravity currents 5.5.2Ten interleaving interfacial gravity currents . 5.6in Iceland showing multiple gravity-driven intrusions c ┤

Maurer, Benjamin D.



Prototype-driven learning for sequence models  

Science Conference Proceedings (OSTI)

We investigate prototype-driven learning for primarily unsupervised sequence modeling. Prior knowledge is specified declaratively, by providing a few canonical examples of each target annotation label. This sparse prototype information is then ...

Aria Haghighi; Dan Klein



Error driven paraphrase annotation using Mechanical Turk  

Science Conference Proceedings (OSTI)

The source text provided to a machine translation system is typically only one of many ways the input sentence could have been expressed, and alternative forms of expression can often produce a better translation. We introduce here error driven paraphrasing ...

Olivia Buzek; Philip Resnik; Benjamin B. Bederson



Thermal-Instability-Driven Turbulent Mixing in Galactic Disks: I. Effective Mixing of Metals  

E-Print Network (OSTI)

Observations show that radial metallicity gradients in disk galaxies are relatively shallow, if not flat, especially at large galactocentric distances and for galaxies in the high-redshift universe. Given that star formation and metal production are centrally concentrated, this requires a mechanism to redistribute metals. However, the nature of this mechanism is poorly understood, let alone quantified. To address this problem, we conduct magnetohydrodynamical simulations of a local shearing sheet of a thin, thermally unstable, gaseous disk driven by a background stellar spiral potential, including metals modeled as passive scalar fields. Contrary to what a simple \\alpha\\ prescription for the gas disk would suggest, we find that turbulence driven by thermal instability is very efficient at mixing metals, regardless of the presence or absence of stellar spiral potentials or magnetic fields. The timescale for homogenizing randomly distributed metals is comparable to or less than the local orbital time in the dis...

Yang, Chao-Chin



On electric resistances for distance-regular graphs  

E-Print Network (OSTI)

We investigate the behavior of electric potentials on distance-regular graphs, and extend some results of a prior paper. Our main result, Theorem 4, shows(together with Corollary 3) that if distance is measured by the electric resistance between points then all points are close to being equidistant on a distance-regular graph with large valency. A number of auxiliary results are also presented.

Koolen, Jack; Park, Jongyook



Hazardous Waste Minimum Distance Requirements (Connecticut) | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minimum Distance Requirements (Connecticut) Minimum Distance Requirements (Connecticut) Hazardous Waste Minimum Distance Requirements (Connecticut) < Back Eligibility Agricultural Commercial Construction Fed. Government Fuel Distributor General Public/Consumer Industrial Installer/Contractor Institutional Investor-Owned Utility Local Government Low-Income Residential Multi-Family Residential Municipal/Public Utility Nonprofit Residential Retail Supplier Rural Electric Cooperative Schools State/Provincial Govt Systems Integrator Transportation Tribal Government Utility Program Info State Connecticut Program Type Siting and Permitting Provider Department of Energy and Environmental Protection These regulations set minimum distance requirements between certain types of facilities that generate, process, store, and dispose of hazardous waste


Spatial chemical distance based on atomic property fields  

E-Print Network (OSTI)

009-9316-x Spatial chemical distance based on atomicSimilarity of compound chemical structures often leads tonot always true, as distinct chemical scaffolds can exhibit

Grigoryan, A. V.; Kufareva, I.; Totrov, M.; Abagyan, R. A.



Consumer Adoption of Online Banking: Does Distance Matter?  

E-Print Network (OSTI)

Adoption of Online Banking: Does Distance Matter? Beethikaand Goolsbee, Austan (2002). "Does the Internet Make Marketsto the closest bank branch does not affect the likelihood of

Khan, Beethika S.



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 ├Ś 599 pixels. Other resolution: 464 ├Ś 600 pixels. Full resolution ÔÇÄ(1,275 ├Ś 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 ├Ś 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Vortex-Driven Sensitivity in Deformation Flow  

Science Conference Proceedings (OSTI)

A sensitivity mechanism for the interaction of two vortices in a two-dimensional deformation background flow is explored. A nonlinear model describing the vortex interaction up to a critical merging distance is developed. This model shows that in ...

Zhiyuan Liu; Paul J. Roebber



An extreme-distance approach to multiple criteria ranking  

Science Conference Proceedings (OSTI)

A distance approach based on extreme points, or predefined ideal and anti-ideal points, is proposed to improve on the TOPSIS (Technique for Order Performance [or Ordered Preference] by Similarity to Ideal Solution) method of multiple criteria ranking. ... Keywords: Comparative study, Distance-based ranking, Multiple criteria decision analysis, Multiple criteria ranking, TOPSIS

Ye Chen; D. Marc Kilgour; Keith W. Hipel



Computing the FrÚchet distance between piecewise smooth curves  

Science Conference Proceedings (OSTI)

We consider the Frechet distance between two curves which are given as a sequence of m+n curved pieces. If these pieces are sufficiently well-behaved, we can compute the Frechet distance in O(mnlog(mn)) time. The decision version of the problem can be ... Keywords: Shape matching

GŘnter Rote



A Novel Distributed Simulation Approach in Adaptive Distance Relaying  

Science Conference Proceedings (OSTI)

In this paper, an adaptive distance relaying strategy based on the global network simulation (GNS) concept is presented. The GNS concept is actually a distributed simulation approach (DSA) for piecewise analysis of large-scale power grids using diakoptics ... Keywords: adaptive distance relaying, coordination rules, diakoptics, distributed simulation approach (DSA), global network simulation (GNS), large change sensitivity (LCS), mutually coupled lines

V. Gohari Sadr; S.M. Kouhsari



Optimal selection of robots by using distance based approach method  

Science Conference Proceedings (OSTI)

A deterministic quantitative model based on Distance Based Approach (DBA) method has been developed for evaluation, selection and ranking of robots, which is a concept hitherto not employed in selection problem of this kind. As a significant development ... Keywords: Distance based approach, Optimized selection, Ranking, Robots

Rishi Kumar; R. K. Garg



A Collaborative Case Study System for Distance Learning  

Science Conference Proceedings (OSTI)

Distance Learning from Case Studies involves enabling collaboration between two or more learners at a distance on a case study activity. In this paper we present an empirical qualitative study that simulates a learning scenario in which a pair of subjects ...

Marta C. Rosatelli; John A. Self


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Measuring Dialect Distance Phonetically John Nerbonne and Wilbert Heeringa  

E-Print Network (OSTI)

- tance, both simple (based on atomic char- acters) and complex (based on feature vec- tors). The measurements using feature vec- tors varied according to whether city-block distance, Euclidean distance or (a sensitive, that city-block dis- tance is a good measure of phonetic over- lap of feature vectors


Solar Decathlon 2013: Going the Distance | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Going the Distance Going the Distance Solar Decathlon 2013: Going the Distance September 17, 2013 - 4:26pm Addthis Toggle Routes on/off Return to map Ôćĺ Solar Decathlon Journeys Visualizing the distances that each Solar Decathlon house travelled Click competitors to toggle their journeys on and off. All routes and distances are approximate. Rebecca Matulka Rebecca Matulka Digital Communications Specialist, Office of Public Affairs Solar Decathlon 2013: In our new blog series, we're going behind the scenes to show you what it takes to compete in the Solar Decathlon. First up: Meet the teams competing this year and learn how they were selected. Part two looks at how the teams must master the art of fundraising. What does it take to design an energy-efficient, solar-powered house? Part three looks at creating a winning design.


Structurally-driven metal-insulator transition in Ca{sub 2}Ru{sub 1-x}Cr{sub x}O{sub 4} (0{<=}x<0.14): A single crystal X-ray diffraction study  

Science Conference Proceedings (OSTI)

Correlation between structure and transport properties are investigated in high-quality single-crystals of Ca{sub 2}Ru{sub 1-x}Cr{sub x}O{sub 4} with 013.5% and the system behaves as an insulator. Such a large, sharp metal-insulator transition and tuneable transition temperature may have potential applications in electronic devices. -- Graphical abstract: The metal-insulator transition temperature (T{sub MI}) was drastically reduced by Cr doping, and is closely related to the distortion of structure. Display Omitted Research highlights: {yields} The metal-insulator transition temperature (T{sub MI}) was drastically reduced by doping Cr into Ca{sub 2}RuO{sub 4} single crystal. {yields} Detailed single crystal structural analysis provided important insight into this structurally-driven metal-insulator transition. {yields} Negative Volume Thermal Expansion (NVTE) was observed with increasing temperature.

Qi, T.F., E-mail: tqi2@uky.ed [Center for Advanced Materials, University of Kentucky, Lexington, KY 40506 (United States); Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States); Ge, M. [Center for Advanced Materials, University of Kentucky, Lexington, KY 40506 (United States); High Magnetic Field Laboratory, University of Science and Technology of China, Hefei, Anhui 230026 (China); Korneta, O.B. [Center for Advanced Materials, University of Kentucky, Lexington, KY 40506 (United States); Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States); Parkin, S. [Center for Advanced Materials, University of Kentucky, Lexington, KY 40506 (United States); Department of Chemistry, University of Kentucky, Lexington, KY 40506 (United States); De Long, L.E.; Cao, G. [Center for Advanced Materials, University of Kentucky, Lexington, KY 40506 (United States); Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States)



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Motor driven microtubule shape fluctuations - force from within the lattice  

E-Print Network (OSTI)

We develop a general theory of microtubule (MT) deformations by molecular motors generating internal force doublets within the MT lattice. We describe two basic internal excitations, the S and V shape, and compare them with experimental observations from literature. We explain the special role of tubulin vacancies and the dramatic deformation amplifying effect observed for katanin acting at positions of defects. Experimentally observed shapes are used to determine the ratio of MT shear and stretch moduli ($\\approx 6\\times10^{-5}$) and to estimate the forces induced in the MT lattice by katanin (10's of pN). For many motors acting on a single MT we derive expressions for the end-to-end distance reduction and provide criteria for dominance of this new effect over thermal fluctuations. We conclude that molecular motors if acting cooperatively can ''animate'' MTs from within the lattice and induce slack even without cross-bridging to other structures, a scenario very much reminiscent of the motor driven axoneme.

Herve Mohrbach; Igor M. Kulic



Data-driven control of flapping flight  

Science Conference Proceedings (OSTI)

We present a physically based controller that simulates the flapping behavior of a bird in flight. We recorded the motion of a dove using marker-based optical motion capture and high-speed video cameras. The bird flight data thus acquired allow us to ... Keywords: Bird flight, animal locomotion, data-driven control, flapping, motion capture, physically based simulation

Eunjung Ju, Jungdam Won, Jehee Lee, Byungkuk Choi, Junyong Noh, Min Gyu Choi



Model interoperability via Model Driven Development  

Science Conference Proceedings (OSTI)

Among the factors that contribute to the inherent complexity of the software development process is the gap between the design and the formal analysis domains. Software design is often considered a human oriented task while the analysis phase draws on ... Keywords: Model Driven Development, Model interoperability, Petri Nets, Software development, UML

Mohamed A. Ameedeen; Behzad Bordbar; Rachid Anane



Light modulated electron beam driven radiofrequency emitter  

DOE Patents (OSTI)

The disclosure relates to a light modulated electron beam-driven radiofrequency emitter. Pulses of light impinge on a photoemissive device which generates an electron beam having the pulse characteristics of the light. The electron beam is accelerated through a radiofrequency resonator which produces radiofrequency emission in accordance with the electron, hence, the light pulses.

Wilson, M.T.; Tallerico, P.J.



High-explosive driven crowbar switch  

SciTech Connect

The disclosure relates to a compact explosive driven switch for use as a low resistance, low inductance crowbar switch. A high-explosive charge extrudes a deformable conductive metallic plate through a polyethylene insulating layer to achieve a hard current contact with a supportive annular conductor.

Dike, Robert S. (Los Alamos, NM); Kewish, Jr., Ralph W. (Los Alamos, NM)



Performance-driven mapping for CPLD architectures  

Science Conference Proceedings (OSTI)

In this paper we present a performance-driven mapping algorithm, PLAmap, for CPLD architectures which consist of a large number of PLA-style logic cells. The primary goal of our mapping algorithm is to minimize the depth of the mapped circuit. Meanwhile, ... Keywords: CPLD, FPGA, PLA-style logic cells, delay optimization, technology mapping

Deming Chen; Jason Cong; Milos D. Ercegovac; Zhijun Huang



Microwave-driven ultraviolet light sources  

DOE Patents (OSTI)

A microwave-driven ultraviolet (UV) light source is provided. The light source comprises an over-moded microwave cavity having at least one discharge bulb disposed within the microwave cavity. At least one magnetron probe is coupled directly to the microwave cavity.

Manos, Dennis M. (Williamsburg, VA); Diggs, Jessie (Norfolk, VA); Ametepe, Joseph D. (Roanoke, VA)



Improved water-driven lpg slug process  

SciTech Connect

The economics of oil recovery by the LPG-slug process depends upon increasing the sweep efficiency and recovering the injected LPG. There are 2 basic forms of the LPG-slug processes--the gas-driven and the water-driven. The pressure required for miscibility between dry gas and LPG prohibits the use of the gas-driven LPG process in shallow reservoirs. The water-driven LPG slug process normally exhibits good sweep efficiency. However, displacement of the LPG by water is poor. An improvement in this process appears possible by injecting a slug of carbon dioxide between the LPG slug and the water drive. Laboratory experiments were conducted in linear core systems to determine the effect of pressure on the various displacement zones. A displacement test was conducted with LPG and carbon dioxide slugs large enough to avoid interference between the oil-LPG, LPG-carbon dioxide and carbon dioxide- water displacement zones. Under these conditions, essentially complete oil and LPG recovery was obtained. However, a substantial amount of carbon dioxide was left in the core at water breakthrough.

Thompson, J.L.



Distance visualization of ultrascale data with explorable images  

Science Conference Proceedings (OSTI)

This talk presents a new approach to distance visualization of very large data sets output from scientific supercomputing. The processing power of massively parallel supercomputers increases at a rather fast rate, about an order of magnitude faster every ...

Kwan-Liu Ma; Anna Tikhonova; Carlos D. Correa



Building Technologies Office: Market-Driven Research Solutions  

NLE Websites -- All DOE Office Websites (Extended Search)

Market-Driven Research Market-Driven Research Solutions to someone by E-mail Share Building Technologies Office: Market-Driven Research Solutions on Facebook Tweet about Building Technologies Office: Market-Driven Research Solutions on Twitter Bookmark Building Technologies Office: Market-Driven Research Solutions on Google Bookmark Building Technologies Office: Market-Driven Research Solutions on Delicious Rank Building Technologies Office: Market-Driven Research Solutions on Digg Find More places to share Building Technologies Office: Market-Driven Research Solutions on AddThis.com... About Take Action to Save Energy Partner With DOE Activities Solar Decathlon Building America Research Innovations Research Tools Building Science Education Climate-Specific Guidance Solution Center Partnerships



E-Print Network (OSTI)


Sharp, W. M.



A Model of Wind- and Buoyancy-Driven Ocean Circulation  

Science Conference Proceedings (OSTI)

A layered model of steady geostrophic ocean circulation driven by wind stress and buoyancy flux at the surface is derived. Potential vorticity, or thickness, of the two near-surface layers is driven by Ekman pumping and buoyancy pumping. The ...

Roland A. De Szoeke



Scenario-Driven Training | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

Scenario-Driven Training Scenario-Driven Training An initial entry team member assesses the overall hazards in a clandestine lab. Y-12's Nuclear and Radiological Field Training...


Redshift-Independent Distances to Type Ia Supernovae  

E-Print Network (OSTI)

We describe a procedure for accurately determining luminosity distances to Type Ia supernovae (SNe Ia) without knowledge of redshift. This procedure, which may be used as an extension of any of the various distance determination methods currently in use, is based on marginalizing over redshift, removing the requirement of knowing $z$ a priori. We demonstrate that the Hubble diagram scatter of distances measured with this technique is approximately equal to that of distances derived from conventional redshift-specific methods for a set of 60 nearby SNe Ia. This indicates that accurate distances for cosmological SNe Ia may be determined without the requirement of spectroscopic redshifts, which are typically the limiting factor for the number of SNe that modern surveys can collect. Removing this limitation would greatly increase the number of SNe for which current and future SN surveys will be able to accurately measure distance. The method may also be able to be used for high-$z$ SNe Ia to determine cosmological density parameters without redshift information.

Brian J. Barris; John L. Tonry



SBF Distances to Leo and Virgo using the HST  

E-Print Network (OSTI)

We have used archive HST WFPC2 data for three elliptical galaxies (NGC 3379 in the Leo I group, and NGC 4472 and NGC 4406 in the Virgo cluster) to determine their distances using the Surface Brightness Fluctuation (SBF) method as described by Tonry and Schneider (1988). A comparison of the HST results with the SBF distance moduli of Ciardullo et al (1993) shows significant disagreement and suggests that the r.m.s. error on these ground-based distance moduli is actually as large as +-0.25 mag. The agreement is only slightly improved when we compare our results with the HST and ground-based SBF distances from Ajhar et al (1997) and Tonry et al (1997); the comparison suggests that a lower limit on the error of the HST SBF distance moduli is +-0.17 mag. Overall, these results suggest that previously quoted measurement errors may underestimate the true error in SBF distance moduli by at least a factor of 2-3.

P. W. Morris; T. Shanks



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy-Driven Pattern Formation Robert V. Kohn  

E-Print Network (OSTI)

Energy-Driven Pattern Formation Robert V. Kohn Grad Student and Postdoc Seminar April 22, 2011 Robert V. Kohn Energy-Driven Pattern Formation #12;Overview What is energy-driven pattern formation? Hard by singular perturbation Statics: minimum energy scaling laws Dynamics: patterns induced by steepest


A practice-driven systematic review of dependency analysis solutions  

Science Conference Proceedings (OSTI)

When following architecture-driven strategies to develop large software-intensive systems, the analysis of the dependencies is not an easy task. In this paper, we report a systematic literature review on dependency analysis solutions. Dependency analysis ... Keywords: Architecture-driven, Dependency analysis, Evolvability, Large software-intensive systems, Practice-driven, Systematic review

Trosky B. Callo Arias; Pieter Spek; Paris Avgeriou



Battery driven vehicle and recharging system  

SciTech Connect

A battery-driven car which has an electrical system including a minimum number of electric storage batteries as the power source, a high-voltage converter with a high-voltage capacitor bank for driving a direct current impulse motor combined with a generator for supplying current to motor/generator sets respectively integrated with the wheels of the vehicle to drive the same or for recharging the batteries in accordance with a microprocessor control system, the wheel-actuated generators providing recharging current for the batteries whenever the motor component is not being energized and in addition, said electrical system also including an air-driven turbine generator component for recharging the batteries when the vehicle reaches a predetermined speed in accordance with the microprocessor controls.

Arbisi, D. S.



Science as an Anomaly-Driven Enterprise  

E-Print Network (OSTI)

Anomalous data lead to scientific discoveries. Although machine learning systems can be forced to resolve anomalous data, these systems use general learning algorithms to do so. To determine whether anomaly-driven approaches to discovery produce more accurate models than the standard approaches, we built a program called Kalpana. We also used Kalpana to explore means for identifying those anomaly resolutions that are acceptable to domain experts. Our experiments indicated that anomaly-driven approaches can lead to a richer set of model revisions than standard methods. Additionally we identified semantic and syntactic measures that are significantly correlated with the acceptability of model revisions. These results suggest that by interpreting data within the context of a model and by interpreting model revisions within the context of domain knowledge, discovery systems can more readily suggest accurate and acceptable anomaly resolutions.

Will Bridewell; Will Bridewell Phd



Importance-driven compositing window management  

E-Print Network (OSTI)

In this paper we present importance-driven compositing window management, which considers windows not only as basic rectangular shapes but also integrates the importance of the windows ĺ content using a bottom-up visual attention model. Based on this information, importance-driven compositing optimizes the spatial window layout for maximum visibility and interactivity of occluded content in combination with see-through windows. We employ this technique for emerging window manager functions to minimize information overlap caused by popping up windows or floating toolbars and to improve the access to occluded window content. An initial user study indicates that our technique provides a more effective and satisfactory access to occluded information than the well-adopted Alt+Tab window switching technique and see-through windows without optimized spatial layout. Author Keywords compositing window management, visual saliency, space

Manuela Waldner; Markus Steinberger; Raphael Grasset; Dieter Schmalstieg



Laser-driven fusion etching process  

SciTech Connect

The surfaces of solid ionic substrates are etched by a radiation-driven chemical reaction. The process involves exposing an ionic substrate coated with a layer of a reactant material on its surface to radiation, e.g. a laser, to induce localized melting of the substrate which results in the occurrance of a fusion reaction between the substrate and coating material. The resultant reaction product and excess reactant salt are then removed from the surface of the substrate with a solvent which is relatively inert towards the substrate. The laser-driven chemical etching process is especially suitable for etching ionic salt substrates, e.g., a solid inorganic salt such as LiNbO.sub.3, such as used in electro-optical/acousto-optic devices. It is also suitable for applications wherein the etching process is required to produce an etched ionic substrate having a smooth surface morphology or when a very rapid etching rate is desired.

Ashby, Carol I. H. (Edgewood, NM); Brannon, Paul J. (Albuquerque, NM); Gerardo, James B. (Albuquerque, NM)



Surface chemistry driven actuation in nanoporous gold  

SciTech Connect

Although actuation in biological systems is exclusively powered by chemical energy, this concept has not been realized in man-made actuator technologies, as these rely on generating heat or electricity first. Here, we demonstrate that surface-chemistry driven actuation can be realized in high surface area materials such as nanoporous gold. For example, we achieve reversible strain amplitudes in the order of a few tenths of a percent by alternating exposure of nanoporous Au to ozone and carbon monoxide. The effect can be explained by adsorbate-induced changes of the surface stress, and can be used to convert chemical energy directly into a mechanical response thus opening the door to surface-chemistry driven actuator and sensor technologies.

Biener, J; Wittstock, A; Zepeda-Ruiz, L; Biener, M M; Zielasek, V; Kramer, D; Viswanath, R N; Weissmuller, J; Baumer, M; Hamza, A V



ac-driven atomic quantum motor  

E-Print Network (OSTI)

We invent an ac-driven quantum motor consisting of two different, interacting ultracold atoms placed into a ring-shaped optical lattice and submerged in a pulsating magnetic field. While the first atom carries a current, the second one serves as a quantum starter. For fixed zero-momentum initial conditions the asymptotic carrier velocity converges to a unique non-zero value. We also demonstrate that this quantum motor performs work against a constant load.

A. V. Ponomarev; S. Denisov; P. Hanggi



ac-driven atomic quantum motor  

E-Print Network (OSTI)

We invent an ac-driven quantum motor consisting of two different, interacting ultracold atoms placed into a ring-shaped optical lattice and submerged in a pulsating magnetic field. While the first atom carries a current, the second one serves as a quantum starter. For fixed zero-momentum initial conditions the asymptotic carrier velocity converges to a unique non-zero value. We also demonstrate that this quantum motor performs work against a constant load.

Ponomarev, A V; Hńnggi, P



Photonic laser-driven accelerator for GALAXIE  

SciTech Connect

We report on the design and development of an all-dielectric laser-driven accelerator to be used in the GALAXIE (GV-per-meter Acce Lerator And X-ray-source Integrated Experiment) project's compact free-electron laser. The approach of our working design is to construct eigenmodes, borrowing from the field of photonics, which yield the appropriate, highly demanding dynamics in a high-field, short wavelength accelerator. Topics discussed include transverse focusing, power coupling, bunching, and fabrication.

Naranjo, B.; Ho, M.; Hoang, P.; Putterman, S.; Valloni, A.; Rosenzweig, J. B. [UCLA Dept. of Physics and Astronomy Los Angeles, CA 90095-1547 (United States)



A User Driven Dynamic Circuit Network Implementation  

Science Conference Proceedings (OSTI)

The requirements for network predictability are becoming increasingly critical to the DoE science community where resources are widely distributed and collaborations are world-wide. To accommodate these emerging requirements, the Energy Sciences Network has established a Science Data Network to provide user driven guaranteed bandwidth allocations. In this paper we outline the design, implementation, and secure coordinated use of such a network, as well as some lessons learned.

Guok, Chin; Robertson, David; Chaniotakis, Evangelos; Thompson, Mary; Johnston, William; Tierney, Brian



Wave-driven Countercurrent Plasma Centrifuge  

SciTech Connect

A method for driving rotation and a countercurrent flow in a fully ionized plasma centrifuge is described. The rotation is produced by radiofrequency waves near the cyclotron resonance. The wave energy is transferred into potential energy in a manner similar to the ? channeling effect. The countercurrent flow may also be driven by radiofrequency waves. By driving both the rotation and the flow pattern using waves instead of electrodes, physical and engineering issues may be avoided.

A.J. Fetterman and N.J. Fisch



Combination of evidence in recommendation systems characterized by distance functions  

SciTech Connect

Recommendation systems for different Document Networks (DN) such as the World Wide Web (WWW), Digitnl Libarries, or Scientific Databases, often make use of distance functions extracted from relationships among documents and between documents and semantic tags. For instance, documents In the WWW are related via a hyperlink network, while documents in bibliographic databases are related by citation and collaboration networks.Furthermore, documents can be related to semantic tags such as keywords used to describe their content, The distance functions computed from these relations establish associative networks among items of the DN, and allow recommendation systems to identify relevant associations for iudividoal users. The process of recommendation can be improved by integrating associative data from different sources. Thus we are presented with a problem of combining evidence (about assochaons between items) from different sonrces characterized by distance functions. In this paper we summarize our work on (1) inferring associations from semi-metric distance functions and (2) combining evidence from different (distance) associative DN.

Rocha, L. M. (Luis Mateus)



FastMeasure Distance Measuring Tools | Open Energy Information  

Open Energy Info (EERE)

FastMeasure Distance Measuring Tools FastMeasure Distance Measuring Tools Jump to: navigation, search Logo: FastMeasure Distance Measuring Tools Name FastMeasure Distance Measuring Tools Address 2890 Cherokee Lane Place Riverwoods, Illinois Zip 60015 Sector Vehicles Product Distance Measuring Instrument Year founded 2008 Number of employees 11-50 Phone number (888) 876-6050 Website http://www.fast-measure.com Coordinates 42.181686┬░, -87.898862┬░ Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.181686,"lon":-87.898862,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Modeling beam-driven and laser-driven plasma Wakefield accelerators with XOOPIC  

SciTech Connect

We present 2-D particle-in-cell simulations of both beam-driven and laser-driven plasma wakefield accelerators, using the object-oriented code XOOPIC, which is time explicit, fully electromagnetic, and capable of running on massively parallel supercomputers. Simulations of laser-driven wakefields with low ({approximately} 10{sup 16} W/cm{sup 2}) and high ({approximately} 10{sup 18} W/cm{sup 2}) peak intensity laser pulses are conducted in slab geometry, showing agreement with theory. Simulations of the E-157 beam wakefield experiment at the Stanford Linear Accelerator Center, in which a 30 GeV electron beam passes through 1 m of preionized lithium plasma, are conducted in cylindrical geometry, obtaining good agreement with previous work. We briefly describe some of the more significant modifications to XOOPIC required by this work, and summarize the issues relevant to modeling electron-neutral collisions in a particle-in-cell code.

Bruhwiler, David L.; Giacone, Rodolfo; Cary, John R.; Verboncoeur, John P.; Mardahl, Peter; Esarey, Eric; Leemans, Wim



CAKE Goes 'The Distance' with Solar | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CAKE Goes 'The Distance' with Solar CAKE Goes 'The Distance' with Solar CAKE Goes 'The Distance' with Solar February 2, 2011 - 10:00am Addthis April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs CAKE. Whether it takes the form of cupcakes, birthday cake, the ever-popular cheesecake or even gluten-free - it unfailingly brightens up almost anyone's day. CAKE the band, however, has taken the sweetness to another level with their newest album Showroom of Compassion, which was produced using 100 percent solar energy. The group formed in 1991 and took the Northern California music scene by storm in the mid-nineties. Since then, they've become internationally renowned headliners. Earlier this month, CAKE released their sixth album, recorded in a studio in Sacramento powered entirely by solar power.


Short-distance contribution to the spectrum of Hawking radiation  

E-Print Network (OSTI)

The Hawking effect can be rederived in terms of two-point functions and in such a way that it makes it possible to estimate, within the conventional semiclassical theory, the contribution of ultrashort distances to the Planckian spectrum. For Schwarzschild black holes of three solar masses the analysis shows that Hawking radiation is very robust up to frequencies of 96 T_H or 270 T_H for bosons and fermions, respectively. For primordial black holes (with masses around 10^{15} g) these frequencies turn out to be of order 52T_H and 142 T_H. Only at these frequencies and above do we find that the contribution of Planck distances is of order of the total spectrum itself. Below this scale, the contribution of ultrashort distances to the spectrum is negligible. This suggests that only above these frequencies could an underlying quantum theory of gravity potentially predict significant deviations from Hawking's semiclassical result.

I. Agullo; J. Navarro-Salas; Gonzalo J. Olmo; Leonard Parker



Proposed Laser-driven, Dielectric Microstructure Few-cm Long Undulator for Attosecond Coherent X-rays  

SciTech Connect

This article presents the concept of an all-dielectric laser-driven undulator for the generation of coherent X-rays. The proposed laser-driven undulator is expected to produce internal deflection forces equivalent to a several-Tesla magnetic field acting on a speed-of-light particle. The key idea for this laser-driven undulator is its ability to provide phase synchronicity between the deflection force and the electron beam for a distance that is much greater than the laser wavelength. The potential advantage of this undulator is illustrated with a possible design example that assumes a small laser accelerator which delivers a 2 GeV, 1 pC, 1 kHz electron bunch train to a 10 cm long, 1/2 mm period laser-driven undulator. Such an undulator could produce coherent X-ray pulses with {approx}10{sup 9} photons of 64 keV energy. The numerical modeling for the expected X-ray pulse shape was performed with GENESIS, which predicts X-ray pulse durations in the few-attosecond range. Possible applications for nonlinear electromagnetic effects from these X-ray pulses are briefly discussed.

Plettner, T; Byer, R.L.; /Stanford U., Ginzton Lab.



Creating a Virtual HVAC Laboratory for Continuing/Distance Education  

E-Print Network (OSTI)

Facilities engineering is one technical field where lab-based continuing education programs can be delivered in a distance learning format. The widespread use of computer controls for optimizing the efficiency of a building's mechanical and electrical systems has made the "distance" element possible. Rather than traveling to individual buildings to make pressure, temperature, and flow measurements in person, facility engineers routinely access performance data over the Internet. This networking capability has been used in an educational setting to deliver interactive technical training to large numbers of undergraduate students and professional facilities engineers. Many students can access real time data from a single piece of HVAC equipment over the Internet.

William J. Hutzel



Levenshtein Distance Technique in Dictionary Lookup Methods: An Improved Approach  

E-Print Network (OSTI)

Dictionary lookup methods are popular in dealing with ambiguous letters which were not recognized by Optical Character Readers. However, a robust dictionary lookup method can be complex as apriori probability calculation or a large dictionary size increases the overhead and the cost of searching. In this context, Levenshtein distance is a simple metric which can be an effective string approximation tool. After observing the effectiveness of this method, an improvement has been made to this method by grouping some similar looking alphabets and reducing the weighted difference among members of the same group. The results showed marked improvement over the traditional Levenshtein distance technique.

Haldar, Rishin


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Hym Prius Personal-use Ch and Dr 9-2008 to 3-2010.xlsx  

NLE Websites -- All DOE Office Websites (Extended Search)

Personal-use Personal-use Charging rate: Level 1 Number of households: Charge control: Uncontrolled Date range: Sep 2008 - Mar 2010 Battery Capacity: 5 kWh Weekday Weekend Number of trips Total distance driven (mi) Number of charging events Charging energy consumed (AC kWh) Charge depleting (CD) distance driven (mi) Percent of total distance Charge sustaining (CS) distance driven (mi) Percent of total distance Driving segments between charging events 1 67 1,285 373 7,596 1,828 1,735 510 14,142 5,026 401 130 Overall 2,245 531 1,659 19,168 9,425 49% 9,743 51% 54% 36% 6,545 3,198 46% 64% Vehicle Technologies Program 0 2000 4000 6000 8000 10000 12000 14000 16000 Weekday Weekend Distance traveled (mi) Distance Traveled by Operating Mode CS CD 0% 20% 40% 60% f total distance driven driving segment bin Miles-weighted Distribution of Distance


Evidence against correlations between nuclear decay rates and Earth-Sun distance  

E-Print Network (OSTI)

distance of the source to the Sun. This work was supportedNuclear Decay Rates and Earth-Sun Distance Eric B. Normanand 241 Am and the Earth-Sun distance. We find no evidence

Norman, Eric B.



Fluctuations in combustion-driven MHD generators  

DOE Green Energy (OSTI)

Results of an experimental and theoretical investigation of inherent fluctuations that occur within combustion-driven MHD generators are presented. The primary concern was to determine the presence and effects of axially-propagating, linear hydrodynamic traveling-waves of the magnetoacoustic and magnetoentropic types. The possible development of large fluctuations in high magnetic interaction MHD generators caused by hydrodynamic traveling-waves propagating with increasing amplitude was considered. Experimentally, time-resolved measurements of pressures, electrode currents, and internal differential voltages within a laboratory-scale, combustion-driven MHD generator facility were analyzed. A special probe-tube microphone provided a sensitive measurement of the pressure fluctuations within a combustion-driven MHD generator duct. The time-resolved measurements were analyzed in terms of statistical properties such as relative fluctuation levels, spectraldensity functions, cross-correlation coefficients, and coherence and relative phase functions. The presence and subsequent electrical effects of axially-propagating acoustic and entropy waves were observed. At low mean fluid velocities during MHD generator operation with high current densities, 1.0 Amp/cm/sup 2/, and with applied magnetic field, 2.4 Tesla, fluctuations in the current-magnetic field interaction force caused by the electrical conductivity variations associated with the entropy waves resulted in a threefold increase in pressure fluctuation levels within the upstream part of the MHD duct. Hydrodynamic traveling-waves within an MHD duct were theoretically investigated by considering a first-order linearization analysis of the controlling, quasi-one dimensional fluid and electrical equations of an MHD generator. Comparisons between experimental results and a theoretical model were in qualitative agreement.

Barton, J.P.



Energy-beam-driven rapid fabrication system  

DOE Patents (OSTI)

An energy beam driven rapid fabrication system, in which an energy beam strikes a growth surface to form a molten puddle thereon. Feed powder is then injected into the molten puddle from a converging flow of feed powder. A portion of the feed powder becomes incorporated into the molten puddle, forcing some of the puddle contents to freeze on the growth surface, thereby adding an additional layer of material. By scanning the energy beam and the converging flow of feed powder across the growth surface, complex three-dimensional shapes can be formed, ready or nearly ready for use. Nearly any class of material can be fabricated using this system.

Keicher, David M. (Albuquerque, NM); Atwood, Clinton L. (Albuquerque, NM); Greene, Donald L. (Corrales, NM); Griffith, Michelle L. (Albuquerque, NM); Harwell, Lane D. (Albuquerque, NM); Jeantette, Francisco P. (Albuquerque, NM); Romero, Joseph A. (Albuquerque, NM); Schanwald, Lee P. (Albuquerque, NM); Schmale, David T. (Albuquerque, NM)



Oscillatory instability in a driven granular gas  

E-Print Network (OSTI)

We discovered an oscillatory instability in a system of inelastically colliding hard spheres, driven by two opposite "thermal" walls at zero gravity. The instability, predicted by a linear stability analysis of the equations of granular hydrodynamics, occurs when the inelasticity of particle collisions exceeds a critical value. Molecular dynamic simulations support the theory and show a stripe-shaped cluster moving back and forth in the middle of the box away from the driving walls. The oscillations are irregular but have a single dominating frequency that is close to the frequency at the instability onset, predicted from hydrodynamics.

Evgeniy Khain; Baruch Meerson



Advanced motor driven clamped borehole seismic receiver  

DOE Patents (OSTI)

A borehole seismic tool is described including a borehole clamp which only moves perpendicular to the borehole. The clamp is driven by an electric motor, via a right angle drive. When used as a seismic receiver, the tool has a three part housing, two of which are hermetically sealed. Accelerometers or geophones are mounted in one hermetically sealed part, the electric motor in the other hermetically sealed part, and the clamp and right angle drive in the third part. Preferably the tool includes cable connectors at both ends. Optionally a shear plate can be added to the clamp to extend the range of the tool.

Engler, B.P.; Sleefe, G.E.; Striker, R.P.



Electric Driven Heat Pumps in Distillation Processes  

E-Print Network (OSTI)

Radian Corporation, under contract to the Electric Power Research Institute, has recently completed a study of the potential range of application for retrofitting electric driven heat pumps to existing distillation columns. A computerized evaluation program was developed, consisting of simulation, cost estimation, and economics analysis. The simulations were done using the PROCESS simulation package, while the cost and economics analysis routines were developed by Radian. This paper summarizes the results of the evaluations of retrofits to four generic distillation processes. In addition, the bases of the evaluation programs and the results of several peripheral tasks are described briefly.

Harris, G. E.



Distance to the scaling law: a useful approach for unveiling relationships between crime and urban metrics  

E-Print Network (OSTI)

We report on a quantitative analysis of relationships between the number of homicides, population size and other ten urban metrics. By using data from Brazilian cities, we show that well defined average scaling laws with the population size emerge when investigating the relations between population and number of homicides as well as population and urban metrics. We also show that the fluctuations around the scaling laws are log-normally distributed, which enabled us to model these scaling laws by a stochastic-like equation driven by a multiplicative and log-normally distributed noise. Because of the scaling laws, we argue that it is better to employ logarithms in order to describe the number of homicides in function of the urban metrics via regression analysis. In addition to the regression analysis, we propose an approach to correlate crime and urban metrics via the evaluation of the distance between the actual value of the number of homicides (as well as the value of the urban metrics) and the value that is...

Alves, Luiz G A; Lenzi, Ervin K; Mendes, Renio S



Distance between quantum states in the presence of initial qubit-environment correlations: A comparative study  

Science Conference Proceedings (OSTI)

The time evolution of the trace distance between two states of an open quantum system may increase due to initial system-environment correlations, thus exhibiting a breakdown of distance contractivity of the reduced dynamics. We analyze how the time evolution of the distance depends on the chosen distance measure. Here we elucidate the behavior of the trace distance, the Hilbert-Schmidt distance, the Bures distance, the Hellinger distance, and the quantum Jensen-Shannon divergence for two system-environment setups, namely a qubit bilinearly coupled to an infinite and a finite-size environment with the latter composed of harmonic oscillators.

Dajka, Jerzy; Luczka, Jerzy; Haenggi, Peter [Institute of Physics, University of Silesia, 40-007 Katowice (Poland); Institute of Physics, University of Augsburg, D-86135 Augsburg (Germany)



Auctions by price and distance via cellular phones  

Science Conference Proceedings (OSTI)

We consider e-commerce auctions via cellular phones in which the winner is selected based on two factors: the requested price and the promise to provide a service on time. The auctioneer can verify that the bidder intends to provide the service by tracking ... Keywords: Auctions, Cellular, Distance, Electronic commerce, Multi-attribute, Simulation, Strategies

Yosi Ben Asher; Mohsen Abu Saleh



A proposal for detecting hidden explosives to high distance  

Science Conference Proceedings (OSTI)

In this paper author describes a proposal for an apparatus utilising o nuclear physics techniques to identify hidden explosives to a distance of several tenth of meters. The apparatus uses a modified PFNA (Pulsed Fast neutron Analysis) with the gamma ... Keywords: application of nuclear physics, electronic instrumentation, explosives detection, security apparatus

Carlo Artemi



Computing the Edit-Distance between Unrooted Ordered Trees  

Science Conference Proceedings (OSTI)

An ordered tree is a tree in which each node's incident edges are cyclically ordered; think of the tree as being embedded in the plane. Let A and B be two ordered trees. The edit distance between A and B is the minimum cost ...

Philip N. Klein



Move-to-Front, Distance Coding, and Inversion Frequencies revisited  

Science Conference Proceedings (OSTI)

Move-to-Front, Distance Coding and Inversion Frequencies are three simple and effective techniques used to process the output of the Burrows-Wheeler Transform. In this paper we provide the first complete comparative analyses of these techniques, establishing ... Keywords: Burrows-Wheeler Transform, Data Compression, Empirical entropy

Travis Gagie; Giovanni Manzini



Free Energy Surfaces from Single-Distance Information Philipp Schuetz,  

E-Print Network (OSTI)

Free Energy Surfaces from Single-Distance Information Philipp Schuetz, Rene┬┤ Wuttke, Benjamin We propose a network-based method for determining basins and barriers of complex free energy surfaces for the iterative determination of individual basins by the minimum-cut-based free energy profile, a barrier

Caflisch, Amedeo


Weighted Distance Transforms for Images Using Elongated Voxel Grids  

Science Conference Proceedings (OSTI)

In this paper we investigate weighted distance transforms in 3D images using elongated voxel grids. We use a local neighbourhood of size 3 Î 3 Î 3 and assume a voxel grid with equal resolution along two axes and lower along the third. The weights (local ...

Ida-Maria Sintorn; Gunilla Borgefors



UHF measurement of breathing and heartbeat at a distance  

Science Conference Proceedings (OSTI)

The detection of breathing and heartbeat from a distance is important for medical triage and mass casualty events as well as routine monitoring of higher-risk patients. Typical approaches include wiring up patients to devices and wearable devices, but ... Keywords: UHF, breathing, heartbeat, radar

Jerry Silvious; David Tahmoush



Stochastic Event-Driven Molecular Dynamics  

Science Conference Proceedings (OSTI)

A novel Stochastic Event-Driven Molecular Dynamics (SEDMD) algorithm is developed for the simulation of polymer chains suspended in a solvent. SEDMD combines event-driven molecular dynamics (EDMD) with the Direct Simulation Monte Carlo (DSMC) method. The polymers are represented as chains of hard-spheres tethered by square wells and interact with the solvent particles with hard-core potentials. The algorithm uses EDMD for the simulation of the polymer chain and the interactions between the chain beads and the surrounding solvent particles. The interactions between the solvent particles themselves are not treated deterministically as in EDMD, rather, the momentum and energy exchange in the solvent is determined stochastically using DSMC. The coupling between the solvent and the solute is consistently represented at the particle level retaining hydrodynamic interactions and thermodynamic fluctuations. However, unlike full MD simulations of both the solvent and the solute, in SEDMD the spatial structure of the solvent is ignored. The SEDMD algorithm is described in detail and applied to the study of the dynamics of a polymer chain tethered to a hard-wall subjected to uniform shear. SEDMD closely reproduces results obtained using traditional EDMD simulations with two orders of magnitude greater efficiency. Results question the existence of periodic (cycling) motion of the polymer chain.

Donev, Aleksandar [Lawrence Livermore National Laboratory, P.O. Box 808, Livermore, CA 94551-9900 (United States)], E-mail: aleks.donev@gmail.com; Garcia, Alejandro L. [Department of Physics, San Jose State University, San Jose, CA 95192 (United States); Alder, Berni J. [Lawrence Livermore National Laboratory, P.O. Box 808, Livermore, CA 94551-9900 (United States)



Integrated Nucleosynthesis in Neutrino Driven Winds  

E-Print Network (OSTI)

Although they are but a small fraction of the mass ejected in core-collapse supernovae, neutrino-driven winds (NDWs) from nascent proto-neutron stars (PNSs) have the potential to contribute significantly to supernova nucleosynthesis. In previous works, the NDW has been implicated as a possible source of r-process and light p-process isotopes. In this paper we present time-dependent hydrodynamic calculations of nucleosynthesis in the NDW which include accurate weak interaction physics coupled to a full nuclear reaction network. Using two published models of PNS neutrino luminosities, we predict the contribution of the NDW to the integrated nucleosynthetic yield of the entire supernova. For the neutrino luminosity histories considered, no true r-process occurs in the most basic scenario. The wind driven from an older $1.4 M_\\odot$ model for a PNS is moderately neutron-rich at late times however, and produces $^{87}$Rb, $^{88}$Sr, $^{89}$Y, and $^{90}$Zr in near solar proportions relative to oxygen. The wind fro...

Roberts, L F; Hoffman, R D



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



Network-Driven Demand Side Management Website | Open Energy Informatio...  

Open Energy Info (EERE)

Side Management Website Jump to: navigation, search Name Network-Driven Demand Side Management Website Abstract This task of the International Energy Agency is a broad,...



E-Print Network (OSTI)

sea-level changes and geomagnetic reversals, then we have athe dynamo theory of the geomagnetic field is incorrect.preprint LBL-20131 Geomagnetic Reversals Driven by Abrupt

Muller, R.A.



Wind-driven sediment suspension controls light availability in a ...  

Science Conference Proceedings (OSTI)

Waves and currents in Hog Island Bay responded strongly to wind forcing, with bottom stresses from wind driven waves dominant for 60% of the modeled areaá...


Save Energy Now in Your Motor-Driven Systems  

SciTech Connect

This DOE Industrial Technologies Program fact sheet describes how manufacturing plants can save energy and money by making energy efficiency improvements to their industrial motor-driven systems.



CESC-Webinar: Building an Innovation and Entrepreneurship Driven...  

Open Energy Info (EERE)

Innovation and Entrepreneurship Driven Economy: How Policies Can Foster Risk Capital Investment in Renewable Energy Jump to: navigation, search Logo: Building an Innovation and...


CAD-driven microassembly and visual servoing  

Science Conference Proceedings (OSTI)

This paper describes current research and development on a robotic visual servoing system for assembly of LIGA (Lithography Galvonoforming Abforming) parts. The workcell consists of an AMTI robot, precision stage, long working distance microscope, and LIGA fabricated tweezers for picking up the parts. Fourier optics methods are used to generate synthetic microscope images from CAD drawings. These synthetic images are used off-line to test image processing routines under varying magnifications and depths of field, They also provide reference image features which are used to visually servo the part to the desired position.

Feddema, J.T.; Simon, R.W.



Hym Prius Commercial-use Ch and Dr All 2009.xlsx  

NLE Websites -- All DOE Office Websites (Extended Search)

Commercial-use Commercial-use Charging rate: Level 1 Number of vehicles: Charge control: Uncontrolled Date range: Jan - Dec 2009 Battery Capacity: 5 kWh Weekday Weekend Number of trips Total distance driven (mi) Number of charging events Charging energy consumed (AC kWh) Charge depleting (CD) distance driven (mi) Percent of total distance Charge sustaining (CS) distance driven (mi) Percent of total distance Driving segments between charging events 1 153 32,253 3,478 179,351 15,767 61,134 5,309 575,891 58,893 12,902 1,461 Overall 66,443 634,784 14,363 35,731 195,118 31% 439,667 69% 31% 27% 396,540 43,127 69% 73% Vehicle Technologies Program 0 100000 200000 300000 400000 500000 600000 700000 Weekday Weekend Distance traveled (mi) Distance Traveled by Operating Mode CS CD 0% 20% 40% 60% 80% f total distance driven driving segment


A combined Event-Driven/Time-Driven molecular dynamics algorithm for the simulation of shock waves in rarefied gases  

Science Conference Proceedings (OSTI)

A novel combined Event-Driven/Time-Driven (ED/TD) algorithm to speed-up the Molecular Dynamics simulation of rarefied gases using realistic spherically symmetric soft potentials is presented. Due to the low density regime, the proposed method correctly ... Keywords: 47.11.Mn, 47.40.Ki, 47.45.-n, 47.61.Cb, Event-Driven MD, Molecular Dynamics, Non-continuum effects, Shock Waves

Paolo Valentini; Thomas E. Schwartzentruber



Turbulence driven particle transport in Texas Helimak  

E-Print Network (OSTI)

We analyze the turbulence driven particle transport in Texas Helimak (K. W. Gentle and Huang He, Plasma Sci. and Technology, 10, 284 (2008)), a toroidal plasma device with one-dimensional equilibrium with magnetic curvature and shear. Alterations on the radial electric field, through an external voltage bias, change spectral plasma characteristics inducing a dominant frequency for negative bias values and a broad band frequency spectrum for positive bias values. For negative biased plasma discharges, the transport is high where the waves propagate with phase velocities near the plasma flow velocity, an indication that the transport is strongly affected by a wave particle resonant interaction. On the other hand, for positive bias the plasma has a reversed shear flow and we observe that the transport is almost zero in the shearless radial region, an evidence of a transport barrier in this region.

Toufen, Dennis L; Caldas, Iberŕ L; Marcus, Francisco A; Gentle, Kenneth W



Shock Driven Twinning in Tantalum Single Crystals  

Science Conference Proceedings (OSTI)

Recovery based observations of high pressure material behavior generated under high explosively driven flyer based loading conditions are reported. Two shock pressures, 25, and 55 GPa and four orientations {l_brace}(100), (110), (111), (123){r_brace} were considered. Recovered material was characterized using electron backscatter diffraction along with a limited amount of transmission electron microscopy to assess the occurrence of twinning under each test condition. Material recovered from 25 GPa had a very small fraction of twinning for the (100), (110), and (111) oriented crystals while a more noticeable fraction of the (123) oriented crystal was twinned. Material recovered from 55 GPa showed little twinning for (100) orientation slightly more for the (111) orientation and a large area fraction for the (123) orientation. The EBSD and TEM observations of the underlying deformation substructure are rationalized by comparing with previous static and dynamic results.

McNaney, J M; HSUING, L M; Barton, N R; Kumar, M



Variable Interactions in Query-Driven Visualization  

SciTech Connect

One fundamental element of scientific inquiry is discoveringrelationships, particularly the interactions between different variablesin observed or simulated phenomena. Building upon our prior work in thefield of Query-Driven Visualization, where visual data analysisprocessing is focused on subsets of large data deemed to be"scientifically interesting," this new work focuses on a novel knowledgediscovery capability suitable for use with petascale class datasets. Itenables visual presentation of the presence or absence of relationships(correlations) between variables in data subsets produced by Query-Drivenmethodologies. This technique holds great potential for enablingknowledge discovery from large and complex datasets currently emergingfrom SciDAC and INCITE projects. It is sufficiently generally to beapplicable to any time of complex, time-varying, multivariate data fromstructured, unstructured or adaptive grids.

Bethel, E. Wes; Gosink, Luke J.; Anderson, John C.; Joy, Kenneth I.



Systems analyses of fusion-driven fission  

SciTech Connect

Fusion-driven fissioning systems possess unique advantages not available in either pure fusion or pure fission systems. These systems can set a reasonably low maximum price for fissionable fuel, prevent the necessity of mining low-grade uranium ores, and possibly lead to the best way to exploit the vast fuel potential of our depleted uranium reserves. These systems are less demanding on the characteristics of the fusion systems making the advanced fusion fuels more accessible. By relieving the fission lattice of the need for criticality, more attractive fission system characteristics are allowed. Accurate economic predictions are not yet possible due to continuing uncertainty about the transport properties of reactor-grade plasmas. Hybrid systems have the potential to avoid the causes of most of the criticisms of nuclear power.

Mills, R.G.



Turbulence driven particle transport in Texas Helimak  

SciTech Connect

We analyze the turbulence driven particle transport in Texas Helimak [K. W. Gentle and H. He, Plasma Sci. Technol. 10, 284 (2008)], a toroidal plasma device with a one-dimensional equilibrium with magnetic curvature and shear. Alterations on the radial electric field, through an external voltage bias, change the spectral plasma characteristics inducing a dominant frequency for negative bias values and a broad band frequency spectrum for positive bias values. When applying a negative bias, the transport is high where the waves propagate with phase velocities near the plasma flow velocity, an indication that the transport is strongly affected by a wave particle resonant interaction. On the other hand, for positive bias values, the plasma has a reversed shear flow, and we observe that the transport is almost zero in the shearless radial region, an evidence of a transport barrier in this region.

Toufen, D. L. [Institute of Physics, University of Sao Paulo, C.P. 66318, 05315-970 Sao Paulo, Sao Paulo (Brazil); Federal Institute of Education, Science and Technology of Sao Paulo--IFSP, 07115-000 Guarulhos, Sao Paulo (Brazil); Guimaraes-Filho, Z. O.; Marcus, F. A. [Aix-Marseille Univ., International Institute for Fusion Science, CNRS-PIIM UMR 7345, Marseille (France); Caldas, I. L. [Institute of Physics, University of Sao Paulo, C.P. 66318, 05315-970 Sao Paulo, Sao Paulo (Brazil); Gentle, K. W. [Department of Physics and Institute for Fusion Studies, University of Texas at Austin, Austin, Texas 78712 (United States)



Weighted distance transforms generalized to modules and their computation on point lattices  

Science Conference Proceedings (OSTI)

This paper presents the generalization of weighted distances to modules and their computation through the chamfer algorithm on general point lattices. The first part is dedicated to formalization of definitions and properties (distance, metric, norm) ... Keywords: Chamfer algorithm, Distance transform, Non-standard grids, Weighted distance

CÚline Fouard; Robin Strand; Gunilla Borgefors



Luminosity distance and redshift in the Szekeres inhomogeneous cosmological models  

E-Print Network (OSTI)

The Szekeres inhomogeneous models can be used to model the true lumpy universe that we observe. This family of exact solutions to Einstein's equations was originally derived with a general metric that has no symmetries. In this work, we develop and use a framework to integrate the angular diameter and luminosity distances in the general Szekeres models. We use the affine null geodesic equations in order to derive a set of first-order ordinary differential equations that can be integrated numerically to calculate the partial derivatives of the null vector components. These equations allow the integration in all generality of the distances in the Szekeres models and some examples are given. The redshift is determined from simultaneous integration of the null geodesic equations. This work does not assume spherical or axial symmetry, and the results will be useful for comparisons of the general Szekeres inhomogeneous models to current and future cosmological data.

Anthony Nwankwo; Mustapha Ishak; John Thompson



Magnetically-driven explosions of rapidly-rotating white dwarfs following Accretion-Induced Collapse  

E-Print Network (OSTI)

We present 2D multi-group flux-limited diffusion magnetohydrodynamics (MHD) simulations of the Accretion-Induced Collapse (AIC) of a rapidly-rotating white dwarf. We focus on the dynamical role of MHD processes after the formation of a millisecond-period protoneutron star. We find that including magnetic fields and stresses can lead to a powerful explosion with an energy of a few Bethe, rather than a weak one of at most 0.1 Bethe, with an associated ejecta mass of ~0.1Msun, instead of a few 0.001Msun. The core is spun down by ~30% within 500ms after bounce, and the rotational energy extracted from the core is channeled into magnetic energy that generates a strong magnetically-driven wind, rather than a weak neutrino-driven wind. Baryon loading of the ejecta, while this wind prevails, precludes it from becoming relativistic. This suggests that a GRB is not expected to emerge from such AICs during the early protoneutron star phase, except in the unlikely event that the massive white dwarf has sufficient mass to lead to black hole formation. In addition, we predict both negligible 56Ni-production (that should result in an optically-dark, adiabatically-cooled explosion) and the ejection of 0.1Msun of material with an electron fraction of 0.1-0.2. Such pollution by neutron-rich nuclei puts strong constraints on the possible rate of such AICs. Moreover, being free from ``fallback,'' such highly-magnetized millisecond-period protoneutron stars may later become magnetars, and the magnetically-driven winds may later transition to Poynting-flux-dominated, relativistic winds, eventually detectable as GRBs at cosmological distances. However, the low expected event rate of AICs will constrain them to be, at best, a small subset of GRB and/or magnetar progenitors.

Luc Dessart; Adam Burrows; Eli Livne; Christian Ott



Shortcut estimation of safety distances of pipelines from explosives  

SciTech Connect

Purposely or accidentally detonating explosives near pressurized gas pipelines may have severe consequences on them, ranging from permanent deformation to gas loss or even violent rupture. Owing to lack of analytical prediction models, a shortcut is proposed in this article by which conservative estimations can be obtained of the safety distance of a pipeline from an explosion source, when explosive quantity is known. Alternatively, the maximum allowable explosive quantity can be calculated, provided distance is given. If both explosive quantity and distance are given, stresses on the pipeline may be estimated. Experimentally determined ratios of circumferential to longitudinal strains found in the literature are used. This ratio depends on soil peak particle velocity in contact with the pipeline. For total stress estimations on the pipeline, either biaxial or Huber-Hencky-Mises stresses are used, the latter being more conservative. Validation of proposed method is obtained against experimental observations and results. In this prediction model the characteristics of the explosion source, of the soil, and of the pipeline are taken into account.

Rigas, F.; Sebos, I. [National Technical Univ. of Athens (Greece)



Product derivation for solution-driven product line engineering  

Science Conference Proceedings (OSTI)

Solution-driven product line engineering is a project business where products are created for each customer individually. Although reuse of results from former projects is widely done, configuration and integration of the results currently is often a ... Keywords: feature modeling, software product line development, solution-driven software development

Christoph Elsner; Daniel Lohmann; Wolfgang Schr÷der-Preikschat



Test driven: practical tdd and acceptance tdd for java developers  

Science Conference Proceedings (OSTI)

In test driven development, you first write an executable test of what your application code must do. Only then do you write the code itself and, with the test spurring you on, you improve your design. In acceptance test driven development (ATDD), you ...

Lasse Koskela


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


2, 4378, 2006 Ice-driven CO2  

E-Print Network (OSTI)

- dred thousand years, CO2 and ice volume (marine 18 O) have varied in phase both at the 41 000-yearCPD 2, 43┬ş78, 2006 Ice-driven CO2 feedback on ice volume W. F. Ruddiman Title Page Abstract Discussions is the access reviewed discussion forum of Climate of the Past Ice-driven CO2 feedback on ice

Paris-Sud XI, Universit├ę de


Overview of nonlinear theory of kinetically driven instabilities  

Science Conference Proceedings (OSTI)

An overview is presented of the theory for the nonlinear behavior of instabilities driven by the resonant wave particle interaction. The approach should be applicable to a wide variety of kinetic systems in magnetic fusion devices and accelerators. Here the authors emphasize application to Alfven were driven instability, and the principles of the theory are used to interpret experimental data.

Berk, H.L.; Breizman, B.N.



Community-Driven Development Decision Tools for Rural Development Programs  

Open Energy Info (EERE)

Community-Driven Development Decision Tools for Rural Development Programs Community-Driven Development Decision Tools for Rural Development Programs Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Community-driven Development Decision Tools for Rural Development Programs Agency/Company /Organization: International Fund for Agricultural Development Topics: Policies/deployment programs Resource Type: Guide/manual, Training materials Website: www.ifad.org/english/cdd/pub/decisiontools.pdf Community-driven Development Decision Tools for Rural Development Programs Screenshot References: Community-Driven Development Decision Tools[1] Overview "The CDD Decision Tools is the final outcome of a series of studies conducted from 2003-08 by IFAD on the CDD activities and approaches it sponsors in a number of countries in Western and Central Africa (WCA). The


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Data flow machine for data driven computing  

DOE Patents (OSTI)

A data flow computer and method of computing is disclosed which utilizes a data driven processor node architecture. The apparatus in a preferred embodiment includes a plurality of First-In-First-Out (FIFO) registers, a plurality of related data flow memories, and a processor. The processor makes the necessary calculations and includes a control unit to generate signals to enable the appropriate FIFO register receiving the result. In a particular embodiment, there are three FIFO registers per node: an input FIFO register to receive input information from an outside source and provide it to the data flow memories; an output FIFO register to provide output information from the processor to an outside recipient; and an internal FIFO register to provide information from the processor back to the data flow memories. The data flow memories are comprised of four commonly addressed memories. A parameter memory holds the A and B parameters used in the calculations; an opcode memory holds the instruction; a target memory holds the output address; and a tag memory contains status bits for each parameter. One status bit indicates whether the corresponding parameter is in the parameter memory and one status bit to indicate whether the stored information in the corresponding data parameter is to be reused. The tag memory outputs a ''fire'' signal (signal R VALID) when all of the necessary information has been stored in the data flow memories, and thus when the instruction is ready to be fired to the processor. 11 figs.

Davidson, G.S.; Grafe, V.G.




SciTech Connect

We study gaseous outflows from disk galaxies driven by radiation pressure on dust grains. We include the effect of bulge and dark matter halo and show that the existence of such an outflow implies a maximum value of disk mass-to-light ratio. We show that the terminal wind speed is proportional to the disk rotation speed in the limit of a cold gaseous outflow, and that in general there is a contribution from the gas sound speed. Using the mean opacity of dust grains and the evolution of the luminosity of a simple stellar population, we then show that the ratio of the wind terminal speed (v{sub {infinity}}) to the galaxy rotation speed (v{sub c}) ranges between 2 and 3 for a period of {approx}10 Myr after a burst of star formation, after which it rapidly decays. This result is independent of any free parameter and depends only on the luminosity of the stellar population and the relation between disk and dark matter halo parameters. We briefly discuss the possible implications of our results.

Sharma, Mahavir; Nath, Biman B. [Raman Research Institute, Sadashiva Nagar, Bangalore 560080 (India); Shchekinov, Yuri, E-mail: mahavir@rri.res.in, E-mail: biman@rri.res.in, E-mail: yus@sfedu.ru [Department of Physics, Southern Federal University, Rostov on Don 344090 (Russian Federation)



Implementation and qualification of neutronic calculation methodology in subcritical reactors driven by external neutron sources and applications.  

E-Print Network (OSTI)

??This works had as goal to investigate calculational methodologies on subcritical source driven reactor, such as Accelerator Driven Subcritical Reactor (ADSR) and Fusion Driven Subcriticalů (more)

Thiago Carluccio



High speed, long distance, data transmission multiplexing circuit  

DOE Patents (OSTI)

A high speed serial data transmission multiplexing circuit, which is operable to accurately transmit data over long distances (up to 3 Km), and to multiplex, select and continuously display real time analog signals in a bandwidth from DC to 100 Khz. The circuit is made fault tolerant by use of a programmable flywheel algorithm, which enables the circuit to tolerate one transmission error before losing synchronization of the transmitted frames of data. A method of encoding and framing captured and transmitted data is used which has a low overhead and prevents some particular transmitted data patterns from locking an included detector/decoder circuit.

Mariotti, Razvan (Boulder, CO)



A high speed, long distance, data transmission multiplexing circuit  

DOE Patents (OSTI)

A high speed serial data transmission multiplexing circuit, which is operable to accurately transmit data over long distances (up to 3 Km), and to multiplex, select and continuously display real time analog signals in a bandwidth from DC to 100Khz. The circuit is made fault tolerant by use of a programmable flywheel algorithm, which enables the circuit to tolerate one transmission error before losing synchronization of the transmitted frames of data. A method of encoding and framing captured and transmitted data is used which has a low overhead and prevents some particular transmitted data patterns from locking an included detector/decoder circuit. 9 figs.

Mariotti, R.



Gamma ray burst distances and the timescape cosmology  

E-Print Network (OSTI)

Gamma ray bursts can potentially be used as distance indicators, providing the possibility of extending the Hubble diagram to redshifts ~7. Here we follow the analysis of Schaefer (2007), with the aim of distinguishing the timescape cosmological model from the \\LambdaCDM model by means of the additional leverage provided by GRBs in the range 2 < z < 7. We find that the timescape model fits the GRB sample slightly better than the \\LambdaCDM model, but that the systematic uncertainties are still too little understood to distinguish the models.

Peter R. Smale



A comparison of standard evasion scenarios at near regional distances  

SciTech Connect

We performed numerical simulations of three nuclear testing evasion scenarios. These calculations were done in two parts. The first part was done near source (within 10 km) with a non-linear weapons effects code. Particle velocity histories from the non-linear code were linked to an elastic linear finite-difference code for the second part. Seismic waveforms from the evasion scenario calculations were compared with the waveforms for a non-evasive explosion calculation at near regional distances. The results of this comparison suggest that it may be important to include realistic stratigraphy in such simulations: the overall wave amplitude in the present simulations is reduced by only a factor of 3-5 in contradiction to factors of 20-100 in {open_quotes}classical{close_quotes} decoupling analyses for ideal (i.e., unlayered) media. Two of the evasion scenarios simulated retain explosive waveform characteristics at near regional distances, while the third scenario indicates that certain source geometries might lead to more non-explosive (i.e., earthquake-like) seismic signals.

Bos, R.; App, F.; Jones, E.; Dey, T.; Kamm, J.



Monoenergetic Proton Beams Accelerated by a Radiation Pressure Driven Shock  

DOE Green Energy (OSTI)

We report on the acceleration of impurity-free quasimononenergetic proton beams from an initially gaseous hydrogen target driven by an intense infrared ({lambda} = 10 {micro}m) laser. The front surface of the target was observed by optical probing to be driven forward by the radiation pressure of the laser. A proton beam of MeV energy was simultaneously recorded with narrow energy spread ({sigma}-4%), low normalized emittance (-8 nm), and negligible background. The scaling of proton energy with the ratio of intensity over density (I/n) confirms that the acceleration is due to the radiation pressure driven shock.

Palmer, C.A.; Pogorelsky, I.; Dover, N.P.; Babzien, M.; Dudnikova, G.I.; Ispiriyan, M.; Polyanskiy, M.N.; Schreiber, J.; Shkolnikov, P.; Yakimenko, V.; Najmudin, Z.



Video of Simulation of the Dynamics of a Wind-Driven Fire in a ...  

Science Conference Proceedings (OSTI)

Simulation of the Dynamics of a Wind-Driven Fire in a Ranch-Style House ľ Texas. Wind Driven Fire in Home, Texas, 2009. ...



The Transportation Greenhouse Gas Inventory: A First Step Toward City-Driven Emissions Rationalization  

E-Print Network (OSTI)

for greenhouse gas emissions, Department of Chemical andStep Toward City-Driven Emissions Rationalization ChrisStep toward City-Driven Emissions Rationalization Submitted

Ganson, Chris



Free-electron laser driven by the LBNL laser-plasma accelerator  

E-Print Network (OSTI)

OF AN XUV FEL DRIVEN BY THE LASER-PLASMA ACCELERATOR AT THEFree-electron laser driven bythe LBNL laser-plasma accelerator C. B. Schroeder ? , W. M.

Schroeder, C. B.



The evolution of information-driven safeguards  

Science Conference Proceedings (OSTI)

From the adoption of the Model Additional Protocol and integrated safeguards in the 1990s, to current International Atomic Energy Agency (IAEA) efforts to deal with cases of noncompliance, the question of how the Agency can best utilize all the information available to it remains of great interest and increasing importance. How might the concept of 'information-driven' safeguards (IDS) evolve in the future? The ability of the Agency to identify and resolve anomalies has always been important and has emerged as a core Agency function in recent years as the IAEA has had to deal with noncompliance in Iran and the Democratic People's Republic of Korea (DPRK). Future IAEA safeguards implementation should be designed with the goal of facilitating and enhancing this vital capability. In addition, the Agency should utilize all the information it possesses, including its in-house assessments and expertise, to direct its safeguards activities. At the State level, knowledge of proliferation possibilities is currently being used to guide the analytical activities of the Agency and to develop inspection plans. How far can this approach be extended? Does it apply across State boundaries? Should it dictate a larger fraction of safeguards activities? Future developments in IDS should utilize the knowledge resident within the Agency to ensure that safeguards resources flow to where they are most needed in order to address anomalies first and foremost, but also to provide greater confidence in conclusions regarding the absence of undeclared nuclear activities. The elements of such a system and related implementation issues are assessed in this paper.

Budlong-sylvester, Kory W [Los Alamos National Laboratory; Pilat, Joseph F [Los Alamos National Laboratory



Aging in attraction-driven colloidal glasses  

E-Print Network (OSTI)

Aging in an attraction-driven colloidal glass is studied by computer simulations. The system is equilibrated without attraction and instantaneously ``quenched'', at constant colloid volume fraction, to one of two states beyond the glass transition; one is close to the transition, and the other one deep in the glass. The evolution of structural properties shows that bonds form in the system, increasing the local density, creating density deficits (holes) elsewhere. This process slows down with the time elapsed since the quench. As a consequence of bond formation, there is a slowing down of the dynamics, as measured by the mean squared displacement and the density, bond, and environment correlation functions. The density correlations can be time-rescaled to collapse their long time (structural) decay. The time scale for structural relaxation shows for both quenches a super-linear dependence on waiting time; it grows faster than the bond lifetime, showing the collective origin of the transition. At long waiting times and high attraction strength, we observe {\\rem completely} arrested dynamics for more than three decades in time, although individual bonds are not permanent on this time scale. The localization length decreases as the state moves deeper in the glass; the non-ergodicity parameter oscillates in phase with the structure factor. Our main results are obtained for systems with a barrier in the pair potential that inhibits phase separation. However, when this barrier is removed for the case of a deep quench, we find changes in the static structure but almost none in the dynamics. Hence our results for the aging behavior remain relevant to experiments in which the glass transition competes with phase separation.

Antonio M. Puertas; Matthias Fuchs; Michael E. Cates



1. Accelerator Driven Systems and Their Applications 1.1 History of Accelerator Driven System Activities  

E-Print Network (OSTI)

Since the early 1990ĺs, accelerator driven systems (ADS) ľ subcritical assemblies driven by high power proton accelerators through a spallation target which is neutronically coupled to the core ľ have been proposed for addressing certain missions in advanced nuclear fuel cycles. Institutes throughout the world have conducted numerous programs evaluating the role of ADS in nuclear waste transmutation and energy production. In 1995, the National Research Council (NRC) issued a report on transmutation technologies [1], which included an evaluation of one ADS concept that was under study at that time: a large-scale system that proposed using a ~100-MW accelerator to drive a thermal, molten salt subcritical core. The NRC recognized the numerous complexities associated with the system, including the fact that, at that time, much of the high-power accelerator technology required for that ADS system had yet to be demonstrated. Consequently, the NRC report did not look favorably upon ADS. In 1999 the US Congress directed the DOE to evaluate Accelerator Transmutation of Waste (ATW) concepts and prepare a ôroadmap ö to develop the technology. This roadmap [2] identified the technical issues to be resolved, assessed the impact of ATW on high-level waste disposition, and estimated the scale and cost of deploying ATW to close the fuel cycle. It also recommended that Congress fund a $281M six-year program of trade studies and R&D on key technology issues that would support a future

Mueller G; S. Nagaitsev C; J. Nolen A; E. Pitcher E; R. Rimmer F; R. Sheffield E; M. Todosow B



Obtaining oblique technique source-to-skin distances for irregular field (Clarkson) calculations: The Mayo Off-axis Distance Indicator  

Science Conference Proceedings (OSTI)

Significant dose inhomogeneities may exist between the supraclavicular fossa (SCF) and the internal mammary chain (IMC) regions in the irregular L-shaped (hockey stick) field associated with breast cancer treatments. This dose inhomogeneity exists, in part, because of a positive air gap in the SCF and a negative air gap in the IMC locations. Independent of treatment technique, (i.e., whether anterior-posterior (AP) or oblique fields are used), accurate source-to-skin distance (SSD) values for the SCF, IMC, and axilla are necessary when doing an irregular field (Clarkson) dose calculation. However, when an oblique technique is used to treat the hockey stick field, obtaining non-central-axis SSDs is not as straightforward as when an AP technique is employed. The Mayo Off-axis Distance Indicator was constructed to slide into the blocking tray slot of the simulator or treatment machine. This mechanical measuring device provides quick and accurate SSD measurements for non-central-axis points under either AP or, more importantly, oblique treatment conditions.

Lajoie, W.N. (Mayo Medical Center, Rochester, MN (USA))



Track C - Market-Driven Research Solutions | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

C - Market-Driven Research Solutions C - Market-Driven Research Solutions Track C - Market-Driven Research Solutions Presentations from Track C, Market-Driven Research Solutions of the U.S. Department of Energy Building America program's 2012 Residential Energy Efficiency Stakeholder Meeting are provided below as Adobe Acrobat PDFs. These presentations for this track covered the following topics: Outreach Initiatives; Case Studies; Technical Approach to Home Energy Management; Valuing Energy Efficiency; Software Accuracy Issues in Poorly Insulated, Leaky Homes; and New Additions to Codes. customer_focused_deploy.pdf building_america_pubs.pdf public_private_media.pdf higher_perf_cost_neutral.pdf cnt_energy_savers.pdf home_retrofits_southeast.pdf brillion_technology.pdf nonintrusive_load_monitor.pdf

Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


CESC-Webinar: Building an Innovation and Entrepreneurship Driven Economy:  

Open Energy Info (EERE)

CESC-Webinar: Building an Innovation and Entrepreneurship Driven Economy: CESC-Webinar: Building an Innovation and Entrepreneurship Driven Economy: How Policies Can Foster Risk Capital Investment in Renewable Energy Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Building an Innovation and Entrepreneurship Driven Economy: How Policies Can Foster Risk Capital Investment in Renewable Energy Agency/Company /Organization: Clean Energy Solutions Center, National Renewable Energy Laboratory Sector: Energy Focus Area: Renewable Energy Topics: Finance, Market analysis, Policies/deployment programs Resource Type: Video, Presentation, Webinar, Training materials Website: cleanenergysolutions.org/online_training/webinars/BuildingInnovationEn Cost: Free References: Building an Innovation and Entrepreneurship Driven Economy: How Policies Can Foster Risk Capital Investment in Renewable Energy[1]


Using laser-driven neutrons to stop nuclear smugglers  

NLE Websites -- All DOE Office Websites (Extended Search)

Using laser-driven neutrons to stop nuclear smugglers Using laser-driven neutrons to stop nuclear smugglers Using laser-driven neutrons to stop nuclear smugglers Researchers have successfully demonstrated for the first time that laser-generated neutrons can be enlisted as a useful tool in the War on Terror. June 4, 2013 A burst of laser energy 50 times greater than the worldwide output of electrical power slams into an extremely thin foil target to produce neutrons at Los Alamos National Laboratory's TRIDENT laser facility during a recent experiment, which proved that laser-driven neutrons can be used to detect and interdict smuggled nuclear materials. A burst of laser energy 50 times greater than the worldwide output of electrical power slams into an extremely thin foil target to produce neutrons at Los Alamos National Laboratory's TRIDENT laser facility during


A UI-Driven lightweight framework for developing web applications  

Science Conference Proceedings (OSTI)

Due to the increasing complexity of Web applications, systematic processes and supporting tools are required for the development of Web applications. In this paper, we propose a UI-driven lightweight framework for building Web applications. This framework ...

Keeyoull Lee; Sanghyun Park; Chunwoo Lee; Woosung Jung; Wookjin Lee; Byungjeong Lee; Heechern Kim; Chisu Wu



A Laboratory Model of Vertical Ocean Circulation Driven by Mixing  

Science Conference Proceedings (OSTI)

A model of deep ocean circulation driven by turbulent mixing is produced in a long, rectangular laboratory tank. The salinity difference is substituted for the thermal difference between tropical and polar regions. Freshwater gently flows in at ...

J. A. Whitehead; Wei Wang



Business Driven Information Systems with Premium Content Card, 2 edition  

Science Conference Proceedings (OSTI)

The Baltzan and Phillips approach in Business Driven Information Systems discusses various business initiatives first and how technology supports those initiatives second. The premise for this unique approach is that business initiatives drive technology ...

Paige Baltzan; Amy Phillips



Diffusion driven object propulsion in density stratified fluids  

E-Print Network (OSTI)

An experimental study was conducted in order to verify the appropriateness of a two dimensional model of the flow creating diffusion driven object propulsion in density stratified fluids. Initial flow field experiments ...

Lenahan, Conor (Conor P.)



Bubble-induced damping in displacement-driven microfluidic flows  

E-Print Network (OSTI)

Bubble damping in displacement-driven microfluidic flows was theoretically and experimentally investigated for a Y-channel microfluidic network. The system was found to exhibit linear behavior for typical microfluidic flow ...

Lee, Jongho


Noise robust speech recognition applied to voice-driven wheelchair  

Science Conference Proceedings (OSTI)

Conventional voice-driven wheelchairs usually employ headset microphones that are capable of achieving sufficient recognition accuracy, even in the presence of surrounding noise. However, such interfaces require users to wear sensors such as a headset ...

Akira Sasou; Hiroaki Kojima



Modeling buoyancy-driven airflow in ventilation shafts  

E-Print Network (OSTI)

Naturally ventilated buildings can significantly reduce the required energy for cooling and ventilating buildings by drawing in outdoor air using non-mechanical forces. Buoyancy-driven systems are common in naturally ...

Ray, Stephen D. (Stephen Douglas)




E-Print Network (OSTI)

of the University of California, nor any of their employees,of the University of California. The views and opinions ofof the University of California. DEVELOPMENT OF SOLAR DRIVEN

Dao, K.



Sensor data driven proactive management of infrastructure systems  

Science Conference Proceedings (OSTI)

In a paper presented at the ASCE International Conference on Computing in Civil Engineering in Cancun, Mexico, a vision was laid out for sensor data-driven, proactive management of infrastructure systems in which information and communication technology ...

James H. Garrett; Burcu Akinci; Scott Matthews; Chris Gordon; Hongjun Wang; Vipul Singhvi



Chemically driven carbon-nanotube-guided thermopower waves  

E-Print Network (OSTI)

Theoretical calculations predict that by coupling an exothermic chemical reaction with a nanotube or nanowire possessing a high axial thermal conductivity, a self-propagating reactive wave can be driven along its length. ...

Choi, Wonjoon


A Tip Driven Fan Based on SERAPHIM Technology  

SciTech Connect

SERAPHIM technology appears capable of efficiently driving a tip driven fan. If the motor is powered using an inverter and resonant circuit, the size and weight could be considerably below that of a comparable rotary electric motor.




Study of Buoyancy-Driven Turbulent Nuclear Burning and Validation...  

NLE Websites -- All DOE Office Websites (Extended Search)

Study of Buoyancy-Driven Turbulent Nuclear Burning and Validation of Type Ia Supernova Models PI Name: Don Lamb PI Email: lamb@oddjob.uchicago.edu Institution: ASCAlliance Flash...


Study of Buoyancy-Driven Turbulent Nuclear Burning and Validation...  

NLE Websites -- All DOE Office Websites (Extended Search)

created from a simulation run on the Blue GeneP at the Argonne Leadership Computing Facility in 2009. Study of Buoyancy-Driven Turbulent Nuclear Burning and Validation of Type Ia...


Model-driven development of multi-core embedded software  

Science Conference Proceedings (OSTI)

Model-driven development is worthy of further research because of its proven capabilities in increasing productivity and ensuring correctness. However, it has not yet been explored for multi-core processor-based embedded systems, whose programming is ...

Pao-Ann Hsiung; Shang-Wei Lin; Yean-Ru Chen; Nien-Lin Hsueh; Chih-Hung Chang; Chih-Hsiong Shih; Chorng-Shiuh Koong; Chao-Sheng Lin; Chun-Hsien Lu; Sheng-Ya Tong; Wan-Ting Su; William C. Chu



Buoyancy-driven Abyssal Circulation in a Circumpolar Ocean  

Science Conference Proceedings (OSTI)

Simple models are developed to describe the abyssal circulation in a circumpolar ocean driven by localized annual sources of water representing convection events. Models are based on a geostrophic reduced-gravity formulation and are located on a ...

Daniel G. Wright; Andrew J. Willmott



Track C - Market-Driven Research Solutions | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Track C - Market-Driven Research Solutions Track C - Market-Driven Research Solutions Track C - Market-Driven Research Solutions Presentations from Track C, Market-Driven Research Solutions of the U.S. Department of Energy Building America program's 2012 Residential Energy Efficiency Stakeholder Meeting are provided below as Adobe Acrobat PDFs. These presentations for this track covered the following topics: Outreach Initiatives; Case Studies; Technical Approach to Home Energy Management; Valuing Energy Efficiency; Software Accuracy Issues in Poorly Insulated, Leaky Homes; and New Additions to Codes. customer_focused_deploy.pdf building_america_pubs.pdf public_private_media.pdf higher_perf_cost_neutral.pdf cnt_energy_savers.pdf home_retrofits_southeast.pdf brillion_technology.pdf nonintrusive_load_monitor.pdf


Convectively Driven Mixing in the Bottom Boundary Layer  

Science Conference Proceedings (OSTI)

Closely spaced vertical profiles through the bottom boundary layer over a sloping continental shelf during relaxation from coastal upwelling reveal structure that is consistent with convectively driven mixing. Parcels of fluid were observed ...

J. N. Moum; A. Perlin; J. M. Klymak; M. D. Levine; T. Boyd; P. M. Kosro



Laser-driven polarized targets of hydrogen and deuterium  

DOE Green Energy (OSTI)

An optical pumping technique used in a laser-driven source of polarized hydrogen or deuterium is described and measurements of the achievable polarization as a function of flow for both hydrogen and deuterium are presented. Ongoing tests of the feasibility of using a laser-driven polarized deuterium source coupled to a storage cell as a polarized internal target, including direct measurements of the nuclear polarization, are discussed.

Jones, C.E.; Coulter, K.P.; Holt, R.J.; Kowalczyk, R.S.; O`Neill, T.G.; Poelker, M.; Zeidman, B.


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


High Performance Visualization using Query-Driven Visualizationand Analytics  

Science Conference Proceedings (OSTI)

Query-driven visualization and analytics is a unique approach for high-performance visualization that offers new capabilities for knowledge discovery and hypothesis testing. The new capabilities akin to finding needles in haystacks are the result of combining technologies from the fields of scientific visualization and scientific data management. This approach is crucial for rapid data analysis and visualization in the petascale regime. This article describes how query-driven visualization is applied to a hero-sized network traffic analysis problem.

Bethel, E. Wes; Campbell, Scott; Dart, Eli; Shalf, John; Stockinger, Kurt; Wu, Kesheng



Imaging the Solar Tachocline by Time-Distance Helioseismology  

E-Print Network (OSTI)

The solar tachocline at the bottom of the convection zone is an important region for the dynamics of the Sun and the solar dynamo. In this region, the sound speed inferred by global helioseismology exhibits a bump of approximately 0.4% relative to the standard solar model. Global helioseismology does not provide any information on possible latitudinal variations or asymmetries between the Northern and Southern hemisphere. Here, we develop a time-distance helioseismology technique, including surface- and deep-focusing measurement schemes and a combination of both, for two-dimensional tomographic imaging of the solar tachocline that infers radial and latitudinal variations in the sound speed. We test the technique using artificial solar oscillation data obtained from numerical simulations. The technique successfully recovers major features of the simplified tachocline models. The technique is then applied to SOHO/MDI medium-l data and provides for the first time a full two-dimensional sound-speed perturbation i...

Zhao, Junwei; Kosovichev, A G; Mansour, N N



Answer extraction as sequence tagging with tree edit distance  

E-Print Network (OSTI)

Our goal is to extract answers from preretrieved sentences for Question Answering (QA). We construct a linear-chain Conditional Random Field based on pairs of questions and their possible answer sentences, learning the association between questions and answer types. This casts answer extraction as an answer sequence tagging problem for the first time, where knowledge of shared structure between question and source sentence is incorporated through features based on Tree Edit Distance (TED). Our model is free of manually created question and answer templates, fast to run (processing 200 QA pairs per second excluding parsing time), and yields an F1 of 63.3 % on a new public dataset based on prior TREC QA evaluations. The developed system is open-source, and includes an implementation of the TED model that is state of the art in the task of ranking QA pairs. 1

Xuchen Yao; Benjamin Van Durme; Chris Callison-burch; Peter Clark



DOE Solar Decathlon: Tuskegee University: Going the Distance  

NLE Websites -- All DOE Office Websites (Extended Search)

Tuskegee University house on the National Mall in Washington, D.C., during Solar Decathlon 2002. Tuskegee University house on the National Mall in Washington, D.C., during Solar Decathlon 2002. Enlarge image The Tuskegee Solar Decathlon team got its inspiration from traditional Southern architecture, which relies on passive cooling strategies such as the dogtrot, a central shaded breezeway that runs through the house. (Credit: Paul Norton/U.S. Department of Energy Solar Decathlon) Who: Tuskegee University What: Solar house Where: Tuskegee University 1200 W. Montgomery Road Tuskegee, AL 36088 Map This House Public tours: Not available Solar Decathlon 2002 Tuskegee University: Going the Distance Tuskegee University students successfully overcame funding and time limitations to make the trip to Washington, D.C., for the U.S. Department of Energy Solar Decathlon 2002. Now, with time back on its side, the


Science-Driven Computing: NERSC's Plan for 2006-2010  

Science Conference Proceedings (OSTI)

NERSC has developed a five-year strategic plan focusing on three components: Science-Driven Systems, Science-Driven Services, and Science-Driven Analytics. (1) Science-Driven Systems: Balanced introduction of the best new technologies for complete computational systems--computing, storage, networking, visualization and analysis--coupled with the activities necessary to engage vendors in addressing the DOE computational science requirements in their future roadmaps. (2) Science-Driven Services: The entire range of support activities, from high-quality operations and user services to direct scientific support, that enable a broad range of scientists to effectively use NERSC systems in their research. NERSC will concentrate on resources needed to realize the promise of the new highly scalable architectures for scientific discovery in multidisciplinary computational science projects. (3) Science-Driven Analytics: The architectural and systems enhancements and services required to integrate NERSC's powerful computational and storage resources to provide scientists with new tools to effectively manipulate, visualize, and analyze the huge data sets derived from simulations and experiments.

Simon, Horst D.; Kramer, William T.C.; Bailey, David H.; Banda,Michael J.; Bethel, E. Wes; Craw, James M.; Fortney, William J.; Hules,John A.; Meyer, Nancy L.; Meza, Juan C.; Ng, Esmond G.; Rippe, Lynn E.; Saphir, William C.; Verdier, Francesca; Walter, Howard A.; Yelick,Katherine A.



Drones, information technology, and distance: mapping the moral epistemology of remote fighting  

Science Conference Proceedings (OSTI)

Ethical reflection on drone fighting suggests that this practice does not only create physical distance, but also moral distance: far removed from one's opponent, it becomes easier to kill. This paper discusses this thesis, frames it as a moral-epistemological ... Keywords: Distance, Drones, Ethics, Information technology, Military robotics, Phenomenology

Mark Coeckelbergh



Improvement of the disc harmonic moments descriptor by an exponentially decaying distance transform  

Science Conference Proceedings (OSTI)

The authors propose an improvement of a recent region-based shape descriptor inspired by the 3D spherical harmonics: the Disk Harmonic Moments Descriptor (DHMD). The binary image is weighted by an exponentially decaying distance transform (EDDT) before ... Keywords: content-based image, distance transform, legendre polynomials, region-based shape descriptor, retrieval, salience distance transform, spherical harmonics

Noureddine Ennahnahi; Mohammed Oumsis; Mohammed Meknassi



Adaptive feedback generation to support teachers in web-based distance education  

Science Conference Proceedings (OSTI)

This work examines the application of user-adapted technologies to address problems experienced in web-based distance education. We have proposed an approach to support distance learning instructors by offering advice that points at problems faced by ... Keywords: (Semi-)automatic advice generation, Distance learning, Empirical evaluation, Intelligent course management systems, Personalised feedback, Teacher support/help

Essam Kosba; Vania Dimitrova; Roger Boyle



A Stochastic/Perturbation Global Optimization Algorithm for Distance Geometry Problems  

Science Conference Proceedings (OSTI)

We present a new global optimization approach for solving exactly or inexactly constrained distance geometry problems. Distance geometry problems are concerned with determining spatial structures from measurements of internal distances. They arise ... Keywords: Lennard-Jones cluster, Molecular conformation, global optimization

Zhihong Zou; Richard H. Bird; Robert B. Schnabel



A wavelet-tree-based watermarking method using distance vector of binary cluster  

Science Conference Proceedings (OSTI)

This paper proposes a wavelet-tree-based watermarking method using distance vector of binary cluster for copyright protection. In the proposed method, wavelet trees are classified into two clusters using the distance vector to denote binary watermark ... Keywords: Blind watermarking method, Copyright protection, Distance vector, Significant coefficient, Watermark, Wavelet tree

Wei-Hung Lin; Yuh-Rau Wang; Shi-Jinn Horng



The influence of animal mobility on the assumption of uniform distances in aerial line transect surveys  

E-Print Network (OSTI)

for estimating animal density from aerial surveys. Analysis of line transect distance data usually relies test evidence for non- uniformity using double-observer distance data from two aerial surveys of five in Queensland. Key words: aerial surveys, double platform distance sampling, independent observers, responsive

Buckland, Steve


Report Notes  

NLE Websites -- All DOE Office Websites (Extended Search)

Notes Notes 1 "Overall AC electrical energy consumption (AC Wh/mi)" is based on AC electricity consumed during charging events which began during the reporting period and distance driven during all trips in the reporting period. 2 "Overall DC electrical energy consumption (DC Wh/mi)" is based on net DC electricity discharged from or charged to the plug-in battery pack and distance driven during all trips in the reporting period. DC Wh/mi may not be comparable to AC Wh/mi if AC electricity charged prior to the reporting period was discharged during driving within the reporting period, or if AC electricity charged during the reporting period was not discharged during driving within the reporting period. 3 Trips when the plug-in battery pack charge was depleted to propel the vehicle throughout


Ford Escape Advanced Research Vehicle Report Notes  

NLE Websites -- All DOE Office Websites (Extended Search)

Advanced Research Vehicle Advanced Research Vehicle Report Notes 1 "Overall AC electrical energy consumption (AC Wh/mi)" is based on AC electricity consumed during charging events which began during the reporting period and distance driven during all trips in the reporting period. 2 "Overall DC electrical energy consumption (DC Wh/mi)" is based on net DC electricity discharged from or charged to the plug-in battery pack and distance driven during all trips in the reporting period. DC Wh/mi may not be comparable to AC Wh/mi if AC electricity charged prior to the reporting period was discharged during driving within the reporting period, or if AC electricity charged during the reporting period was not discharged during driving within the reporting period.


Performance of Gas-Engine Driven Heat Pump Unit  

SciTech Connect

Air-conditioning (cooling) for buildings is the single largest use of electricity in the United States (U.S.). This drives summer peak electric demand in much of the U.S. Improved air-conditioning technology thus has the greatest potential impact on the electric grid compared to other technologies that use electricity. Thermally-activated technologies (TAT), such as natural gas engine-driven heat pumps (GHP), can provide overall peak load reduction and electric grid relief for summer peak demand. GHP offers an attractive opportunity for commercial building owners to reduce electric demand charges and operating expenses. Engine-driven systems have several potential advantages over conventional single-speed or single-capacity electric motor-driven units. Among them are variable speed operation, high part load efficiency, high temperature waste heat recovery from the engine, and reduced annual operating costs (SCGC 1998). Although gas engine-driven systems have been in use since the 1960s, current research is resulting in better performance, lower maintenance requirements, and longer operating lifetimes. Gas engine-driven systems are typically more expensive to purchase than comparable electric motor-driven systems, but they typically cost less to operate, especially for commercial building applications. Operating cost savings for commercial applications are primarily driven by electric demand charges. GHP operating costs are dominated by fuel costs, but also include maintenance costs. The reliability of gas cooling equipment has improved in the last few years and maintenance requirements have decreased (SCGC 1998, Yahagi et al. 2006). Another advantage of the GHP over electric motor-driven is the ability to use the heat rejected from the engine during heating operation. The recovered heat can be used to supplement the vapor compression cycle during heating or to supply other process loads, such as water heating. The use of the engine waste heat results in greater operating efficiency compared to conventional electric motor-driven units (SCGC 1998). In Japan, many hundreds of thousands of natural gas-driven heat pumps have been sold (typically 40,000 systems annually) (Yahagi et al. 2006). The goal of this program is to develop dependable and energy efficient GHPs suitable for U.S. commercial rooftop applications (the single largest commercial product segment). This study describes the laboratory performance evaluation of an integrated 10-ton GHP rooftop unit (a 900cc Daihatsu-Aisin natural gas engine) which uses R410A as the refrigerant (GEDAC No.23). ORNL Thermally-Activated Heat Pump (TAHP) Environmental Chambers were used to evaluate this unit in a controlled laboratory environment.

Abdi Zaltash; Randy Linkous; Randall Wetherington; Patrick Geoghegan; Ed Vineyard; Isaac Mahderekal; Robert Gaylord



Shocktube driven BiF visible chemical laser. I - Numerical modeling of combustion driven shocktube experiments  

SciTech Connect

Calculations to determine the utility of an HF combustion-driven shocktube in the development of BiF(A-X) visible chemical lasers are presented. The calculations were performed with a one-dimensional reactive-flow Euler solver. The Euler solver uses a time-step split algorithm to advance the calculation over a time interval. A robust design can be developed that will simulate the heating produced in the FN3/TMB/He laser-gas mixture by a CO2 laser. Small amounts of water need to be included in the H2/F2/He driver gas mixture to assist in the thermalization of the vibrationally hot HF. 8 refs.

Smith, W.; Acebal, R.; Benard, D.J.; Graves, B. (Science Applications International Corp., Marietta, GA (United States) Rockwell International Science Center, Thousand Oaks, CA (United States) U.S. Army, Missile Command, Redstone Arsenal, AL (United States))



Distance-Scaled Water Concentrations versus Mass-Median Drop Size, Temperature, and Altitude in Supercooled Clouds  

Science Conference Proceedings (OSTI)

About 28 000 nautical miles (n mi) of select in-flight measurements of liquid water content (LWC), droplet sizes, temperature, and other variables in supercooled clouds from a variety of research projects over portions of North America, Europe, ...

Richard K. Jeck



Analysis of the Argonne distance tabletop exercise method.  

Science Conference Proceedings (OSTI)

The purpose of this report is to summarize and evaluate the Argonne Distance Tabletop Exercise (DISTEX) method. DISTEX is intended to facilitate multi-organization, multi-objective tabletop emergency response exercises that permit players to participate from their own facility's incident command center. This report is based on experience during its first use during the FluNami 2007 exercise, which took place from September 19-October 17, 2007. FluNami 2007 exercised the response of local public health officials and hospitals to a hypothetical pandemic flu outbreak. The underlying purpose of the DISTEX method is to make tabletop exercising more effective and more convenient for playing organizations. It combines elements of traditional tabletop exercising, such as scenario discussions and scenario injects, with distance learning technologies. This distance-learning approach also allows playing organizations to include a broader range of staff in the exercise. An average of 81.25 persons participated in each weekly webcast session from all playing organizations combined. The DISTEX method required development of several components. The exercise objectives were based on the U.S. Department of Homeland Security's Target Capabilities List. The ten playing organizations included four public health departments and six hospitals in the Chicago area. An extent-of-play agreement identified the objectives applicable to each organization. A scenario was developed to drive the exercise over its five-week life. Weekly problem-solving task sets were designed to address objectives that could not be addressed fully during webcast sessions, as well as to involve additional playing organization staff. Injects were developed to drive play between webcast sessions, and, in some cases, featured mock media stories based in part on player actions as identified from the problem-solving tasks. The weekly 90-minute webcast sessions were discussions among the playing organizations that were moderated by a highly-qualified public health physician, who reviewed key scenario developments and player actions, as well as solicited input from each playing organization. The exercise control structure included trusted agents who oversaw exercise planning, playing organization points of contact to ensure exercise coordination, and exercise controller/evaluators to initiate and oversee exercise play. A password-protected exercise website was designed for FluNami 2007 to serve as a compartmentalized central information source, and for transmitting exercise documents. During the course of FluNami 2007, feedback on its quality was collected from players and controller/evaluators. Player feedback was requested at the conclusion of each webcast, upon completion of each problem-solving task, and on October 17, 2007, after the final webcast session had ended. The overall average score given to FluNami 2008 by the responding players was 3.9 on a five-point scale. In addition, suggestions for improving the process were provided by Argonne controller/evaluators after the exercise concluded. A series of recommendations was developed based on feedback from the players and controller/evaluators. These included improvements to the exercise scope and objectives, the problem-solving tasks, the scenarios, exercise control, the webcast sessions, the exercise website, and the player feedback process.

Tanzman, E. A.; Nieves, L. A.; Decision and Information Sciences



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Event:Building an Innovation and Entrepreneurship Driven Economy: How  

Open Energy Info (EERE)

an Innovation and Entrepreneurship Driven Economy: How an Innovation and Entrepreneurship Driven Economy: How Policies Can Foster Risk Capital Investment in Renewable Energy Jump to: navigation, search Calendar.png Building an Innovation and Entrepreneurship Driven Economy: How Policies Can Foster Risk Capital Investment in Renewable Energy: on 2011/05/04 Listen to an expert panel explore how countries have used policies to build a clean energy economy by stimulating venture capital investments in new renewable energy companies. The panel will include government, industry, and financial experts from countries across several continents. Panelists will briefly discuss policy experiences and approaches from their own countries including business competitions and coaching, state-owned venture funds, tax incentives, and loan guarantees, as well as perspectives on best


Department of Energy Announces First Entry for Market- Driven  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Announces First Entry for Market- Driven Announces First Entry for Market- Driven High-Efficiency Commercial Air Conditioners Challenge Department of Energy Announces First Entry for Market- Driven High-Efficiency Commercial Air Conditioners Challenge October 4, 2011 - 12:02pm Addthis Washington, D.C. - The U.S. Department of Energy (DOE) today announced that it has received the first official submission by a manufacturer to a voluntary challenge for a new generation of high-efficiency cost-effective air conditioners for commercial buildings. The Department will begin testing the new Daikin McQuay "Rebel" unit from McQuay International to determine whether it meets the high energy-efficiency performance levels outlined by the challenge. The challenge aims to reduce energy use by as much as 50 to 60 percent over current equipment and is part of DOE's

Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Department of Energy Announces First Entry for Market- Driven  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

First Entry for Market- Driven First Entry for Market- Driven High-Efficiency Commercial Air Conditioners Challenge Department of Energy Announces First Entry for Market- Driven High-Efficiency Commercial Air Conditioners Challenge October 4, 2011 - 12:02pm Addthis Washington, D.C. - The U.S. Department of Energy (DOE) today announced that it has received the first official submission by a manufacturer to a voluntary challenge for a new generation of high-efficiency cost-effective air conditioners for commercial buildings. The Department will begin testing the new Daikin McQuay "Rebel" unit from McQuay International to determine whether it meets the high energy-efficiency performance levels outlined by the challenge. The challenge aims to reduce energy use by as much as 50 to 60 percent over current equipment and is part of DOE's


Bootstrap currents in radio-frequency-driven tokamak equilibria  

SciTech Connect

Interest in the bootstrap current arising from neoclassical transport in tokamaks has increased recently in view of certain experimental observations. In this study, the bootstrap current is calculated for a number of rf current-driven tokamaks. Two-dimensional, self-consistent, steady-state tokamak MHD equilibria are obtained by including both the transport-driven bootstrap current and the externally driven rf current. The self-consistency is acomplished by iterating between two-dimensional MHD equilibrium calculations and the current calculations (including bootstrap and rf ray-tracing). Calculations for other reactor parameters of interest are also carried out. It is found that for reactor-grade plasmas, the bootstrap current contribution to the toroidal current is, in general, important. An approxiamte scaling law for GAMMA, based on parametric survey performed, is also obtained. 16 refs., 8 figs., 1 tab.

Hsiao, Ming-Yuan; Ehst, D.A.; Evans, K. Jr.



"Cracking-the-whip" effect stretches driven polymers  

E-Print Network (OSTI)

Cracking the whip accelerates the tail of a chain to hit the air loudly and clearly. We proved that the similar acceleration effect causes coil deformation of driven chain-like polymers. We first preformed Monte Carlo simulations of a single driven polymer coil to demonstrate its deformation in company with faster or slower deviations of velocities. We then performed parallel Brownian Dynamics simulations to demonstrate that the coil deformation can be caused by the so-called "cracking-the-whip" effect due to non-synchronous biased Brownian motions of monomers inherited in Monte Carlo simulations. Since such non-synchronous motions represent random perturbations in the environmentally dependent potential energy landscape or mobility, reflecting heterogeneous dynamics of polymers in the liquid phase, our observations bring new insights into the non-linear dynamics of driven chain-like polymers.

Juan Li; Wenbing Hu



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS


Theoretical Antineutrino Detection, Direction and Ranging at Long Distances  

E-Print Network (OSTI)

In this paper we introduce the concept of what we call "NUDAR" (NeUtrino Direction and Ranging), making the point that measurements of the observed energy and direction vectors can be employed to passively deduce the exact three-dimensional location and thermal power of geophysical and anthropogenic neutrino sources from even a single detector. We present the most precise background estimates to date, all handled in full three dimensions, as functions of depth and geographical location. For the present calculations, we consider a hypothetical 138 kiloton detector which can be transported to an ocean site and deployed to an operational depth. We present a Bayesian estimation framework to incorporate any a priori knowledge of the reactor that we are trying to detect, as well as the estimated uncertainty in the background and the oscillation parameters. Most importantly, we fully employ the knowledge of the reactor spectrum and the distance-dependent effects of neutrino oscillations on such spectra. The latter, in particular, makes possible determination of range from one location, given adequate signal statistics. Further, we explore the rich potential of improving detection with even modest improvements in individual neutrino direction determination. We conclude that a 300 MWth reactor can indeed be geolocated, and its operating power estimated with one or two detectors in the hundred kiloton class at ranges out to a few hundred kilometers. We note that such detectors would have natural and non-interfering utility for scientific studies of geo-neutrinos, neutrino oscillations, and astrophysical neutrinos. This motivates the development of cost effective methods of constructing and deploying such next generation detectors.

Glenn R. Jocher; Daniel A. Bondy; Brian M. Dobbs; Stephen T. Dye; James A. Georges III; John G. Learned; Christopher L. Mulliss; Shawn Usman




SciTech Connect

We present evidence of large-scale outflows from three low-mass (log(M {sub *}/M {sub Sun }) {approx} 9.75) star-forming (SFR > 4 M {sub Sun} yr{sup -1}) galaxies observed at z = 1.24, z = 1.35, and z = 1.75 in the 3D-HST Survey. Each of these galaxies is located within a projected physical distance of 60 kpc around the sight line to the quasar SDSS J123622.93+621526.6, which exhibits well-separated strong (W {sup {lambda}2796} {sub r} {approx}> 0.8 A) Mg II absorption systems matching precisely to the redshifts of the three galaxies. We derive the star formation surface densities from the H{alpha} emission in the WFC3 G141 grism observations for the galaxies and find that in each case the star formation surface density well exceeds 0.1 M {sub Sun} yr{sup -1} kpc{sup -2}, the typical threshold for starburst galaxies in the local universe. From a small but complete parallel census of the 0.65 < z < 2.6 galaxies with H {sub 140} {approx}< 24 proximate to the quasar sight line, we detect Mg II absorption associated with galaxies extending to physical distances of 130 kpc. We determine that the W{sub r} > 0.8 A Mg II covering fraction of star-forming galaxies at 1 < z < 2 may be as large as unity on scales extending to at least 60 kpc, providing early constraints on the typical extent of starburst-driven winds around galaxies at this redshift. Our observations additionally suggest that the azimuthal distribution of W{sub r} > 0.4 A Mg II absorbing gas around star-forming galaxies may evolve from z {approx} 2 to the present, consistent with recent observations of an increasing collimation of star-formation-driven outflows with time from z {approx} 3.

Lundgren, Britt F.; Van Dokkum, Pieter; Bezanson, Rachel; Momcheva, Ivelina; Nelson, Erica; Skelton, Rosalind E.; Wake, David; Whitaker, Katherine [Astronomy Department, Yale University, New Haven, CT 06511 (United States); Brammer, Gabriel [European Southern Observatory, Alonso de Cordova 3107, Casilla 19001, Vitacura, Santiago (Chile); Franx, Marijn; Fumagalli, Mattia; Labbe, Ivo; Patel, Shannon [Leiden Observatory, Leiden University, NL-2300 RA Leiden (Netherlands); Da Cunha, Elizabete; Rix, Hans Walter; Schmidt, Kasper [Max Planck Institute for Astronomy (MPIA), Koenigstuhl 17, D-69117, Heidelberg (Germany); Erb, Dawn K. [Department of Physics, University of Wisconsin-Milwaukee, P.O. Box 413, Milwaukee, WI 53201 (United States); Fan Xiaohui [Steward Observatory, University of Arizona, Tucson, AZ 85721 (United States); Kriek, Mariska [Department of Astronomy, University of California, Berkeley, CA 94720 (United States); Marchesini, Danilo [Physics and Astronomy Department, Tufts University, Medford, MA 02155 (United States); and others



title Estimating Policy Driven Greenhouse Gas Emissions Trajectories  

NLE Websites -- All DOE Office Websites (Extended Search)

Estimating Policy Driven Greenhouse Gas Emissions Trajectories Estimating Policy Driven Greenhouse Gas Emissions Trajectories in California The California Greenhouse Gas Inventory Spreadsheet GHGIS Model year month institution Lawrence Berkeley National Laboratory address Berkeley abstract p A California Greenhouse Gas Inventory Spreadsheet GHGIS model was developed to explore the impact of combinations of state policies on state greenhouse gas GHG and regional criteria pollutant emissions The model included representations of all GHGemitting sectors of the California economy including those outside the energy sector such as high global warming potential gases waste treatment agriculture and forestry in varying degrees of detail and was carefully calibrated using available data and projections from multiple state agencies and


Viscoelastic Suppression of Gravity-Driven Counterflow Instability  

E-Print Network (OSTI)

Attempts to achieve ``top kill'' of actively flowing oil wells by insertion of dense drilling ``muds'', i.e., slurries of dense minerals, from above will fail if the Kelvin-Helmholtz instability in the gravity-driven counterflow produces turbulence that breaks up the denser fluid into small droplets. Here we estimate the droplet size to be sub-mm for fast flows and suggest the addition of a shear-thickening polymer to suppress turbulence. Laboratory experiments show a progression from droplet formation to complete turbulence suppression at the relevant high velocities, illustrating rich new physics accessible by using a shear-thickening liquid in gravity driven counter-streaming flows.

Beiersdorfer, P; Layne, D; Magee, E W



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 ľ 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Iterative method to compute the Fermat points and Fermat distances of multiquarks  

E-Print Network (OSTI)

The multiquark confining potential is proportional to the total distance of the fundamental strings linking the quarks and antiquarks. We address the computation of the total string distance an of the Fermat points where the different strings meet. For a meson (quark-antiquark system) the distance is trivially the quark-antiquark distance. For a baryon (three quark system) the problem was solved geometrically from the onset, by Fermat and by Torricelli. The geometrical solution can be determined just with a rule and a compass, but translation of the geometrical solution to an analytical expression is not as trivial. For tetraquarks, pentaquarks, hexaquarks, etc, the geometrical solution is much more complicated. Here we provide an iterative method, converging fast to the correct Fermat points and the total distances, relevant for the multiquark potentials. We also review briefly the geometrical methods leading to the Fermat points and to the total distances.

P. Bicudo; M. Cardoso



Energetic electron propagation in solid targets driven by the intense electric fields of femtosecond laser pulses  

Science Conference Proceedings (OSTI)

An analytical model is used to interpret experimental data on the propagation of energetic electrons perpendicular to and parallel to the propagation direction of intense femtosecond laser pulses that are incident on solid targets. The pulses with {approx_equal}10{sup 20} W/cm{sup 2} intensity are incident normal onto a gadolinium or tungsten wire embedded in an aluminum substrate, and MeV electrons generated in the focal spot propagate along the laser direction into the irradiated wire. Electrons also propagate laterally from the focal spot through the aluminum substrate and into a dysprosium or hafnium spectator wire at a distance up to 1 mm from the irradiated wire. The ratio of the K shell emission from the spectator and irradiated wires is a measure of the numbers and energies of the MeV electrons propagating parallel to and perpendicular to the intense oscillating electric field of the laser pulse. It is found that the angular distribution of electrons from the focal spot is highly non-isotropic, and approximately twice as many electrons are driven by the electric field toward the spectator wire as into the irradiated wire. This quantitative result is consistent with the qualitative experimental observation that the oscillating electric field of an intense femtosecond laser pulse, when interacting with a heavy metal target, preferentially drives energetic electrons in the electric field direction as compared to perpendicular to the field.

Seely, J. F. [Naval Research Laboratory, 4555 Overlook Avenue SW, Washington, DC 20375 (United States); Szabo, C. I. [Artep, Inc., 2922 Excelsior Spring Circle, Ellicott City, Maryland 21042 (United States); Audebert, P.; Brambrink, E. [Laboratoire pour L'Utilisation des Lasers Intenses (LULI), Ecole Polytechnique, 91128 Palaiseau Cedex (France)




Science Conference Proceedings (OSTI)

Whether protoplanetary disks accrete at observationally significant rates by the magnetorotational instability (MRI) depends on how well ionized they are. Disk surface layers ionized by stellar X-rays are susceptible to charge neutralization by small condensates, ranging from {approx}0.01 {mu}m sized grains to angstrom-sized polycyclic aromatic hydrocarbons (PAHs). Ion densities in X-ray-irradiated surfaces are so low that ambipolar diffusion weakens the MRI. Here we show that ionization by stellar far-ultraviolet (FUV) radiation enables full-blown MRI turbulence in disk surface layers. Far-UV ionization of atomic carbon and sulfur produces a plasma so dense that it is immune to ion recombination on grains and PAHs. The FUV-ionized layer, of thickness 0.01-0.1 g cm{sup -2}, behaves in the ideal magnetohydrodynamic limit and can accrete at observationally significant rates at radii {approx}> 1-10 AU. Surface layer accretion driven by FUV ionization can reproduce the trend of increasing accretion rate with increasing hole size seen in transitional disks. At radii {approx}<1-10 AU, FUV-ionized surface layers cannot sustain the accretion rates generated at larger distance, and unless turbulent mixing of plasma can thicken the MRI-active layer, an additional means of transport is needed. In the case of transitional disks, it could be provided by planets.

Perez-Becker, Daniel [Department of Physics, University of California, Berkeley, CA 94720 (United States); Chiang, Eugene [Departments of Astronomy and Earth and Planetary Science, University of California, Berkeley, CA 94720 (United States)



Experimental characterization of railgun-driven supersonic plasma jets motivated by high energy density physics applications  

Science Conference Proceedings (OSTI)

We report experimental results on the parameters, structure, and evolution of high-Mach-number (M) argon plasma jets formed and launched by a pulsed-power-driven railgun. The nominal initial average jet parameters in the data set analyzed are density Almost-Equal-To 2 Multiplication-Sign 10{sup 16} cm{sup -3}, electron temperature Almost-Equal-To 1.4 eV, velocity Almost-Equal-To 30 km/s, M Almost-Equal-To 14, ionization fraction Almost-Equal-To 0.96, diameter Almost-Equal-To 5 cm, and length Almost-Equal-To 20 cm. These values approach the range needed by the Plasma Liner Experiment, which is designed to use merging plasma jets to form imploding spherical plasma liners that can reach peak pressures of 0.1-1 Mbar at stagnation. As these jets propagate a distance of approximately 40 cm, the average density drops by one order of magnitude, which is at the very low end of the 8-160 times drop predicted by ideal hydrodynamic theory of a constant-M jet.

Hsu, S. C.; Moser, A. L.; Awe, T. J.; Davis, J. S.; Dunn, J. P. [Physics Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Merritt, E. C.; Adams, C. S. [Physics Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); University of New Mexico, Albuquerque, New Mexico 87131 (United States); Brockington, S. J. E.; Case, A.; Messer, S. J.; Witherspoon, F. D. [HyperV Technologies Corp., Chantilly, Virginia 20151 (United States); Cassibry, J. T. [Propulsion Research Center, University of Alabama in Huntsville, Huntsville, Alabama 35899 (United States); Gilmore, M. A.; Lynn, A. G. [University of New Mexico, Albuquerque, New Mexico 87131 (United States)



Bounded-distance multi-clusterhead formation in wireless ad hoc networks  

Science Conference Proceedings (OSTI)

We present a clustering technique addressing redundancy for bounded-distance clusters, which means being able to determine the minimum number of cluster-heads per node, and the maximum distance from nodes to their cluster-heads. This problem is similar ... Keywords: (k,r)-dominating sets, Ad hoc networks, Clustering, Distance domination, Domination in graphs, Multi-core multicast protocols, Multicast protocols, Multiple domination

Marco AurÚlio Spohn; J. J. Garcia-Luna-Aceves




E-Print Network (OSTI)

Abstract. We use a simple geometric-combinatorial argument to establish a quantitative relation between the generalized Hausdorff measure of a set and its distance set, extending a result originally due to Falconer. Let A be a subset of the plane. The distance set D(A) is defined as the set of all distances between points of A. Namely D(A) ={|x ? y | : x, y ? A}. It follows from the work of Falconer [2] (see also Mattila [3]) that 1

Communicated David Preiss



Turbulence in the sub-Alfv\\'enic solar wind driven by reflection of low-frequency Alfv\\'en waves  

E-Print Network (OSTI)

We study the formation and evolution of a turbulent spectrum of Alfv\\'en waves driven by reflection off the solar wind density gradients, starting from the coronal base up to 17 solar radii, well beyond the Alfv\\'enic critical point. The background solar wind is assigned and 2D shell models are used to describe nonlinear interactions. We find that the turbulent spectra are influenced by the nature of reflected waves. Close to the base, these give rise to a flatter and steeper spectrum for the outgoing and reflected waves respectively. At higher heliocentric distance both spectra evolve toward an asymptotic Kolmogorov spectrum. The turbulent dissipation is found to account for at least half of the heating required to sustain the background imposed solar wind and its shape is found to be determined by the reflection-determined turbulent heating below 1.5 solar radii. Therefore reflection and reflection-driven turbulence are shown to play a key role in the accelerationof the fast solar wind and origin of the tur...

Verdini, A; Buchlin, E



Calibration of the distance scale from galactic Cepheids: I Calibration based on the GFG sample  

E-Print Network (OSTI)

New estimates of the distances of 36 nearby galaxies are presented based on accurate distances of galactic Cepheids obtained by Gieren, Fouque and Gomez (1998) from the geometrical Barnes-Evans method. The concept of 'sosie' is applied to extend the distance determination to extragalactic Cepheids without assuming the linearity of the PL relation. Doing so, the distance moduli are obtained in a straightforward way. The correction for extinction is made using two photometric bands (V and I) according to the principles introduced by Freedman and Madore (1990). Finally, the statistical bias due to the incompleteness of the sample is corrected according to the precepts introduced by Teerikorpi (1987) without introducing any free parameters (except the distance modulus itself in an iterative scheme). The final distance moduli depend on the adopted extinction ratio {R_V}/{R_I} and on the limiting apparent magnitude of the sample. A comparison with the distance moduli recently published by the Hubble Space Telescope Key Project (HSTKP) team reveals a fair agreement when the same ratio {R_V}/{R_I} is used but shows a small discrepancy at large distance. In order to bypass the uncertainty due to the metallicity effect it is suggested to consider only galaxies having nearly the same metallicity as the calibrating Cepheids (i.e. Solar metallicity). The internal uncertainty of the distances is about 0.1 magnitude but the total uncertainty may reach 0.3 magnitude.

G. Paturel; G. Theureau; P. Fouque; J. N. Terry; I. Musella; T. Ekholm



Semi-supervised Learning with Density Based Distances Avleen S. Bijral  

E-Print Network (OSTI)

Semi-supervised Learning with Density Based Distances Avleen S. Bijral Toyota Technological Institute Chicago, IL 60637 Nathan Ratliff Google Inc. Pittsburg, PA 15206 Nati Srebro Toyota Technological

Srebro, Nathan


Single-photon frequency upconversion for long-distance quantum teleportation and communication  

E-Print Network (OSTI)

Entanglement generation, single-photon detection, and frequency translation that preserves the polarization quantum state of the photons are essential technologies for long distance quantum communication protocols. This ...

Albot?, Marius A., 1974-


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Long distance symmetries for nuclear forces and the similarity renormalization group  

Science Conference Proceedings (OSTI)

In this work we study the emergence of long distance symmetries for nuclear forces within the framework of the similarity renormalization group approach.

Szpigel, S. [Faculdade de Computacao e Informatica, Universidade Presbiteriana Mackenzie, 01302-907, Sao Paulo - SP (Brazil); Timoteo, V. S. [Faculdade de Tecnologia, Universidade Estadual de Campinas, 13484-332, Limeira - SP (Brazil); Arriola, E. R. [Departamento de Fisica Atomica, Molecular y Nuclear and Instituto Carlos I de Fisica Teorica y Computacional, Universidad de Granada, E-18071, Granada (Spain)



The iBP algorithm for the discretizable molecular distance geometry ...  

E-Print Network (OSTI)

Jan 6, 2011 ... wireless sensors given some of the distances (estimated by monitoring the ..... this operation for all the amino acids forming a protein, then theá...


Solar cycle properties described by simple convection-driven dynamos  

E-Print Network (OSTI)

Solar cycle properties described by simple convection-driven dynamos Radostin D Simitev1 a realistic description of the solar cycle, but through a physically motivated change in the boundary be reversed at least at low latitudes. Keywords: self-consistent MHD dynamos, solar dynamo 1. Introduction

Simitev, Radostin D


Current-induced torque driven ferromagnetic resonance in magnetic microstructures  

E-Print Network (OSTI)

to be mapped within materials. In Chapter 3, an all-electrical, on-chip driven FMR experiment on sub- micron (Ga,Mn)As stripes is described, using a method similar to that used by Costache et al. [83, 84]. With this technique, the magnetisation...

Fang, Dong



Efficient event-driven simulation of parallel processor architectures  

Science Conference Proceedings (OSTI)

In this paper we present a new approach for generating high-speed optimized event-driven instruction set level simulators for adaptive massively parallel processor architectures. The simulator generator is part of a methodology for the systematic mapping, ... Keywords: embedded tools, modeling, processor arrays, simulation

Alexey Kupriyanov; Dmitrij Kissler; Frank Hannig; JŘrgen Teich



Transformer: a functional-driven cycle-accurate multicore simulator  

Science Conference Proceedings (OSTI)

Full-system simulators are extremely useful in evaluating design alternatives for multicore. However, state-of-the-art multicore simulators either lack good extensibility due to their tightly-coupled design between functional model (FM) and timing model ... Keywords: extension, full-system, functional-driven, multicore simulation

Zhenman Fang; Qinghao Min; Keyong Zhou; Yi Lu; Yibin Hu; Weihua Zhang; Haibo Chen; Jian Li; Binyu Zang



Live documents with contextual, data-driven information components  

Science Conference Proceedings (OSTI)

We introduce the notion of a live document and we describe our concept of live documents with contextual, data driven information components. The dynamic and interactive features of live documents provide a consistent data source for multimedia presentations ... Keywords: Microsoft Office, live documents, repurposing, reverse engineering, scalable vector graphics, single sourcing, software engineering, systems documentation

Anke Weber; Holger M. Kienle; Hausi A. MŘller



Thin Films and the Systems-Driven Approach  

DOE Green Energy (OSTI)

A systems-driven approach is used to discern tradeoffs between cost and efficiency improvements for various thin-film module technologies and designs. Prospects for reduced system cost via such strategies are enhanced as balance-of-systems costs decline, and some strategies are identified for greater research focus.

Zweibel, K.



The test data challenge for database-driven applications  

Science Conference Proceedings (OSTI)

Business applications rely typically on databases for storing and processing their data (database-driven applications, or DBAPs). Testing DBAPs requires testing the application logic plus the interaction between the application logic and the database. ... Keywords: databases, information systems, test coverage, test data, testing

Klaus Haller



Supporting Energy-driven Adaptations in Distributed Environments  

E-Print Network (OSTI)

Supporting Energy-driven Adaptations in Distributed Environments Adel Noureddine, Romain Rouvoy of energy techniques and in different contexts. The distributed nature of our approach fits in a ubiquitous Middleware, Energy awareness, Distributed Environments 1. INTRODUCTION With the increase in the usage

Paris-Sud XI, Universit├ę de


Document driven certification of computational science and engineering software  

Science Conference Proceedings (OSTI)

This paper presents a documentation and development methodology to facilitate the certification of Computational Science and Engineering (CSE) software that is produced by professional end user developers to solve mathematical models of physical systems. ... Keywords: computational science and engineering, document driven design, literate programming, software engineering, software requirements specification

Spencer Smith, Nirmitha Koothoor, Nedialko Nedialkov



A Simple Model of the Wind-Driven Tropical Ocean  

Science Conference Proceedings (OSTI)

A simple analytic theory for some aspects of the wind-driven circulation in the tropical oceans is described. The nearly geostrophic subsurface currants and the pressure field are studied by means of a single-layer model. The flow is forced by ...

P. J. Phlips



PROMETHEE II: A knowledge-driven method for copper exploration  

Science Conference Proceedings (OSTI)

This paper describes the application of a well-known Multi Criteria Decision Making (MCDM) technique called Preference Ranking Organization METHod for Enrichment Evaluation (PROMETHEE II) to explore porphyry copper deposits. Various raster-based evidential ... Keywords: Knowledge-driven method, Mineral prospectivity mapping, Now Chun deposit, PROMETHEE II, Porphyry copper, Various geo-datasets

Maysam Abedi; S. Ali Torabi; Gholam-Hossain Norouzi; Mohammad Hamzeh; Gholam-Reza Elyasi



Plugin driven architecture for intelligent management of building  

Science Conference Proceedings (OSTI)

In the present work an innovative solution based on a middleware framework is introduced which simplifies the modeling of a software for intelligent management of buildings and allows a multistandard and multiprotocol integration of sensors and actuators. ... Keywords: building automation, model driven architecture

Alessandro Olivi; Roberto Borsini; Alessandro Bastari



Dynamo: dynamic, data-driven character control with adjustable balance  

Science Conference Proceedings (OSTI)

Dynamo (DYNAmic MOtion capture) is an approach to controlling animated characters in a dynamic virtual world. Leveraging existing methods, characters are simultaneously physically simulated and driven to perform kinematic motion (from mocap or other ... Keywords: animation, motion capture, physical simulation, rag doll

Pawel Wrotek; Odest Chadwicke Jenkins; Morgan McGuire



PRESTO: feedback-driven data management in sensor networks  

Science Conference Proceedings (OSTI)

This paper presents PRESTO, a novel two-tier sensor data management architecture comprising proxies and sensors that cooperate with one another for acquiring data and processing queries. PRESTO proxies construct time-series models of observed trends ... Keywords: data management, model-driven push, sensor networks, time-series models

Ming Li; Deepak Ganesan; Prashant Shenoy



Frameworks for model-driven development of web applications  

Science Conference Proceedings (OSTI)

This paper describes model driven development of dynamic web application using a few different frameworks. Those are the following open source Java frameworks: Modelibra, ModelibraWicket and Wicket. Modelibra is a domain model framework. ModelibraWicket ... Keywords: application development, framework, model, web component

Vensada Okanovi?; Dzenana Donko; Tadej Mateljan



On a data-driven environment for multiphysics applications  

Science Conference Proceedings (OSTI)

The combination of the recent advances in computational and distributed sensor network technologies provide a unique opportunity for focused efforts on high confidence modelling and simulation of multiphysics systems. Responding to this opportunity, ... Keywords: Data-driven, Distributed computing, Distributed sensors, Heterogeneous networks, Multidisciplinary problem solving environment, Multiphysics

J. Michopoulos; P. Tsompanopoulou; E. Houstis; C. Farhat; M. Lesoinne; J. Rice; A. Joshi



On a data-driven environment for multiphysics applications  

Science Conference Proceedings (OSTI)

The combination of the recent advances in computational and distributed sensor network technologies provide a unique opportunity for focused efforts on high confidence modelling and simulation of multiphysics systems. Responding to this opportunity, ... Keywords: data-driven, distributed computing, distributed sensors, heterogeneous networks, multidisciplinary problem solving environment, multiphysics

J. Michopoulos; P. Tsompanopoulou; E. Houstis; C. Farhat; M. Lesoinne; J. Rice; A. Joshi



Characterisation of electron beams from laser-driven particle accelerators  

Science Conference Proceedings (OSTI)

The development, understanding and application of laser-driven particle accelerators require accurate measurements of the beam properties, in particular emittance, energy spread and bunch length. Here we report measurements and simulations showing that laser wakefield accelerators can produce beams of quality comparable to conventional linear accelerators.

Brunetti, E.; Manahan, G. G.; Shanks, R. P.; Islam, M. R.; Ersfeld, B.; Anania, M. P.; Cipiccia, S.; Issac, R. C.; Vieux, G.; Welsh, G. H.; Wiggins, S. M.; Jaroszynski, D. A. [Physics Department, University of Strathclyde, Glasgow G4 0NG (United Kingdom)


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


On the Vertical Structure of Wind-Driven Sea Currents  

Science Conference Proceedings (OSTI)

The vertical structure of wind-driven sea surface currents and the role of wind-wave breaking in its formation are investigated by means of both field experiments and modeling. Analysis of drifter measurements of surface currents in the uppermost ...

Vladimir Kudryavtsev; Victor Shrira; Vladimir Dulov; Vladimir Malinovsky




E-Print Network (OSTI)

TAE SATURATION OF ALPHA PARTICLE DRIVEN INSTABILITY IN TFTR N. N. Gorelenkovy, Y. Chen, R. B. White. In this paper we apply a recently developed nonlinear theory of kinetic instabilities [5] to calculate calculation had been added to allow an accurate numerical integration of Eq.(14) over the phase space


Ion-beam-driven resonant ion cyclotron instability  

SciTech Connect

The resonant ion-beam-driven electrostatic ion cyclotron instability is identified. Measured dispersion relation and onset vs. beam energy and density agree with numerical calculations based on a theory which includes beam acoustic terms. After amplitude saturation, velocity space diffusion of the beam ions is observed. (auth)

Hendel, H.W.; Yamada, M.; Seiler, S.W.; Ikezi, H.



Critical success factors for event driven service oriented architecture  

Science Conference Proceedings (OSTI)

Over the past few years, the IT community has recognized the benefits of Service-Oriented Architectures, wholeheartedly embracing the move away from monolithic applications to applications built from systems of loosely coupled services. Apart from that, ... Keywords: complex event processing, event driven service oriented architecture, service oriented architecture

Sadhana Yogesh Ghalsasi



Convection-driven hydromagnetic waves in planetary fluid cores  

Science Conference Proceedings (OSTI)

We study hydromagnetic waves driven by thermal convection in a self-gravitating, rapidly rotating fluid spherical shell permeated by both poloidal and toroidal axisymmetric magnetic fields. The imposed magnetic fields satisfy electrically insulating ... Keywords: Geodynamo, Magnetoconvection, Magnetohydrodynamic waves, Tangent cylinder

K. Zhang; D. Gubbins



Traceability-centric model-driven object-oriented engineering  

Science Conference Proceedings (OSTI)

Context: Object-oriented (OO) development method is a popular paradigm in developing target systems. However, the current practices of OO analysis and design (OOAD) and implementation largely rely on human developers' experience and expertise, making ... Keywords: Model-driven, Object-orientation, Traceability, Transformation

Jin Sun Her; Hao Yuan; Soo Dong Kim



Effective race detection for event-driven programs  

Science Conference Proceedings (OSTI)

Like shared-memory multi-threaded programs, event-driven programs such as client-side web applications are susceptible to data races that are hard to reproduce and debug. Race detection for such programs is hampered by their pervasive use of ad hoc synchronization, ... Keywords: asynchrony, concurrency, nondeterminism, race detection, web

Veselin Raychev, Martin Vechev, Manu Sridharan



Wind-Driven Response of Ocean Surface Infrared Signals  

Science Conference Proceedings (OSTI)

In the course of archiving positions of the edge of the Loop Current from satellite infrared (IR) data, we have found a substantial amount of energy at periods in the ôwind-driven band.ö Using a technique patterned after that of Price et al., we ...

W. Sturges; S. Welsh



Wind-Driven Motion near a Shelf-Slope Front  

Science Conference Proceedings (OSTI)

A two-dimensional, two-layered frontal system is used to examine the wind-driven motion near a shelf-slope front. In the linear regime, the along-frontal current is characterized by barotropic perturbations. The front is dynamically passive and ...

Hsien Wang Ou



Density inhomogeneity driven electrostatic shock waves in planetary rings  

SciTech Connect

Dust inertia and background density driven dust drift shock waves are theoretically studied in a rotating planetary environment and are subsequently applied to the planetary rings where the collisional effects are pronounced. It has been found that the system under consideration admits significant shock formation if the collision frequency is of the order of or less than the rotational frequency of the Saturn's rings.

Masood, W.; Siddiq, M. [Theoretical Plasma Physics Division (TPPD), PINSTECH, P. O. Nilore, Islamabad 44000 (Pakistan); National Center for Physics (NCP), Islamabad 44000 (Pakistan); Rizvi, H.; Haque, Q. [Theoretical Plasma Physics Division (TPPD), PINSTECH, P. O. Nilore, Islamabad 44000 (Pakistan); Hasnain, H. [NILOP, P. O. Nilore, Islamabad 44000 (Pakistan); PIEAS, P. O. Nilore, Islamabad 44000 (Pakistan)



Wire-driven Parallel Robot: Permitting Collisions Between Wires  

Science Conference Proceedings (OSTI)

In spatial designs of wire-driven parallel robots, collisions between wires by limiting platform trajectories. The common practice for avoiding collisions between wires is by limiting the moving platform trajectories. However, as opposed to rigid ... Keywords: cable robot, collision, tangling, wire robot, workspace

Yonatan Wischnitzer; Nir Shvalb; Moshe Shoham



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: ę 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Cerenkov Radiator Driven by a Superconducting RF Electron Gun  

SciTech Connect

The Naval Postgraduate School (NPS), Niowave, Inc., and Boeing have recently demonstrated operation of the first superconducting RF electron gun based on a quarter wave resonator structure. In preliminary tests, this gun has produced 10 ps long bunches with charge in excess of 78 pC, and with beam energy up to 396 keV. Initial testing occurred at Niowave's Lansing, MI facility, but the gun and diagnostic beam line are planned for installation in California in the near future. The design of the diagnostic beam line is conducive to the addition of a Cerenkov radiator without interfering with other beam line operations. Design and simulations of a Cerenkov radiator, consisting of a dielectric lined waveguide will be presented. The dispersion relation for the structure is determined and the beam interaction is studied using numerical simulations. The characteristics of the microwave radiation produced in both the short and long bunch regimes will be presented.

Poole, B R; Harris, J R



A conceptual model of the cognitive processing of environmental distance information  

Science Conference Proceedings (OSTI)

I review theories and research on the cognitive processing of environmental distance information by humans, particularly that acquired via direct experience in the environment. The cognitive processes I consider for acquiring and thinking about environmental ... Keywords: cognitive processing, distance information, spatial cognition

Daniel R. Montello



On accurate orientation extraction and appropriate distance measure for low-resolution palmprint recognition  

Science Conference Proceedings (OSTI)

Orientation feature has been demonstrated to be one of the most effective features for low resolution palmprint recognition. In this paper, using steerable filter, we investigate the accurate orientation extraction and appropriate distance measure problems ... Keywords: Distance measure, Feature extraction, Palmprint verification, Steerable filter

Wangmeng Zuo; Feng Yue; David Zhang



Tactile distance feedback for firefighters: design and preliminary evaluation of a sensory augmentation glove  

Science Conference Proceedings (OSTI)

In this paper, we describe the design and preliminary evaluation of a vibrotactile glove for distance display in low vision search contexts. Specifically, this glove was developed for firefighting applications in which users experience compromised vision ... Keywords: distance sensing, glove, sensory augmentation, smart clothing, vibrotactile display, wearable technology

Anthony Carton; Lucy E. Dunne



Visualising student tracking data to support instructors in web-based distance education  

Science Conference Proceedings (OSTI)

This paper presents a novel approach of using web log data generated by course management systems (CMS) to help instructors become aware of what is happening in distance learning classes. Specifically, techniques from Information Visualization are used ... Keywords: Web-based distance education, information visualization, student tracking

Riccardo Mazza; Vania Dimitrova



Impacts of deregulation and competitive entry on telecommunication networks: long distance telephone service  

Science Conference Proceedings (OSTI)

Over the past thirty years, the long distance telephone sector has been revolutionised by a series of technical and regulatory developments. In 1996, Congress passed the Telecommunications Act 1996, which substantially deregulated the telecommunications ... Keywords: economic regulation, long distance service, regression models, telecommunications

K. H. Tiedemann



Community detection algorithm based on centrality and node distance in scale-free networks  

Science Conference Proceedings (OSTI)

In this paper, we present a method for detecting community structures based on centrality value and node distance. Many real world networks possess a scale-free property and this property makes community detection difficult especially on algorithms that ... Keywords: centrality value, community detection, node distance, scale-free network

Sorn Jarukasemratana; Tsuyoshi Murata; Xin Liu


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Including cognitive biases and distance-based rewards in a connectionist model of complex problem solving  

Science Conference Proceedings (OSTI)

We present a cognitive, connectionist-based model of complex problem solving that integrates cognitive biases and distance-based and environmental rewards under a temporal-difference learning mechanism. The model is tested against experimental data obtained ... Keywords: Cognitive biases, Computational modeling, Distance-reduction heuristic, Problem solving, Reinforcement learning, Temporal-difference learning

FrÚdÚric Dandurand; Thomas R. Shultz; Arnaud Rey



EIMD: a new congestion control for fast long-distance networks  

Science Conference Proceedings (OSTI)

In fast long-distance networks, TCP fails to fully utilize the bandwidth due to its congestion control mechanism A plethora of congestion control schemes that may enhance the performance of the transport protocol in fast long-distance networks have been ...

Eunho Yang; Seong-il Ham; Seongho Cho; Chong-kwon Kim; Pillwoo Lee



Estimating Thematic Similarity of Scholarly Papers with Their Resistance Distance in an Electric Network Model  

E-Print Network (OSTI)

We calculate resistance distances between papers in a nearly bipartite citation network of 492 papers and the sources cited by them. We validate that this is a realistic measure of thematic distance if each citation link has an electric resistance equal to the geometric mean of the number of the paper's references and the citation number of the cited source.

Havemann, Frank; Glńser, Jochen; Struck, Alexander



A Power Transmission Line Fault Distance Estimation VLSI Chip: Design and Defect Tolerance  

Science Conference Proceedings (OSTI)

This paper presents a system-on-a-chip for fault detection and fault-distance-estimation for power transmission lines in the smart grid. Toward this goal we have designed and fabricated three chips: PGS4, PGS5 and PGS6, each successively more advanced ... Keywords: Smart grid, fault distance, arcing fault, system on a chip, defect tolerance, Radojevic algorithm.

E. MacLean; V. K. Jain




NLE Websites -- All DOE Office Websites (Extended Search)

26 26 Overall electrical energy consumption (AC Wh/mi) 253 Number of trips┬╣ 526,156 Total distance traveled (mi) 4,369,753 Avg trip distance (mi)┬▓ 8.2 Avg distance traveled per day when the vehicle was driven (mi) 39.4 Avg number of trips between charging events 3.4 Avg distance traveled between charging events (mi) 27.9 Avg number of charging events per day when the vehicle was driven 1.4 EV Project Chevrolet Volt Vehicle Summary Report Region: ALL Number of vehicles: 1766 Reporting period: January 2013 through March 2013 Charging Location Home charging location┬│ Away-from-home charging locations Unknown charging locations Total number of charging events 124,954 21,973 7,718 Percent of all charging events 81% 14% 5% 1 A trip is defined as all the driving done between consecutive "key-on" and "key-off" events when some distance was traveled.



NLE Websites -- All DOE Office Websites (Extended Search)

26 26 Overall electrical energy consumption (AC Wh/mi) 229 Number of trips┬╣ 369,118 Total distance traveled (mi) 3,001,976 Avg trip distance (mi) 8.1 Avg distance traveled per day when the vehicle was driven (mi) 40.5 Avg number of trips between charging events 3.5 Avg distance traveled between charging events (mi) 28.2 Avg number of charging events per day when the vehicle was driven 1.4 EV Project Chevrolet Volt Vehicle Summary Report Region: ALL Number of vehicles: 1021 Reporting period: October 2012 through December 2012 Charging Location and Type Home charging location┬▓ Away-from- home charging locations┬│ Unknown charging locations Number of charging events 86,264 13,547 6,698 Percent of all charging events 81% 13% 6% 1 A trip is defined as all the driving done between consecutive "key-on" and "key-off" events when some distance was traveled.



NLE Websites -- All DOE Office Websites (Extended Search)

55 55 Overall electrical energy consumption (AC Wh/mi) 242 Number of trips┬╣ 147,886 Total distance traveled (mi) 1,184,265 Avg trip distance (mi) 8.0 Avg distance traveled per day when the vehicle was driven (mi) 39.6 Avg number of trips between charging events 3.2 Avg distance traveled between charging events (mi) 26.0 Avg number of charging events per day when the vehicle was driven 1.5 EV Project Chevrolet Volt Vehicle Summary Report Region: ALL Number of vehicles: 408 Reporting period: April 2012 through June 2012 Charging Location and Type Home charging location┬▓ Away-from- home charging locations┬│ Unknown charging locations Number of charging events 36,015 6,374 3,179 Percent of all charging events 79% 14% 7% 1 A trip is defined as all the driving done between consecutive "key-on" and "key-off" events when some distance was traveled.


Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Formation of metal nanoparticles by short-distance sputter deposition in a reactive ion etching chamber  

Science Conference Proceedings (OSTI)

A new method is reported to form metal nanoparticles by sputter deposition inside a reactive ion etching chamber with a very short target-substrate distance. The distribution and morphology of nanoparticles are found to be affected by the distance, the ion concentration, and the sputtering time. Densely distributed nanoparticles of various compositions were fabricated on the substrates that were kept at a distance of 130 mum or smaller from the target. When the distance was increased to 510 mum, island structures were formed, indicating the tendency to form continuous thin film with longer distance. The observed trend for nanoparticle formation is opposite to the previously reported mechanism for the formation of nanoparticles by sputtering. A new mechanism based on the seeding effect of the substrate is proposed to interpret the experimental results.

Nie Min; Meng, Dennis Desheng [Department of Mechanical Engineering and Engineering Mechanics, Michigan Technological University, Houghton, Michigan 49931 (United States); Sun Kai [Department of Materials Science and Engineering, University of Michigan, Ann Arbor, Michigan 48109 (United States)



Two-Way Feedback Interaction between the Thermohaline and Wind-Driven Circulations  

Science Conference Proceedings (OSTI)

The thermohaline circulation (THC) affects the meridional atmospheric temperature gradient and therefore the atmospheric wind and the wind-driven ocean circulation. The wind-driven circulation (WDC), in turn, affects the THC by the advection of ...

Douglas G. MacMynowski; Eli Tziperman



Chromatin-driven de novo discovery of DNA binding motifs in the human malaria parasite  

E-Print Network (OSTI)

as: Harris et al. : Chromatin-driven de novo discovery ofARTICLE Open Access Chromatin-driven de novo discovery ofis now evidence that the chromatin architecture plays an

Harris, Elena Y; Ponts, Nadia; Le Roch, Karine G; Lonardi, Stefano



Design Optimization for an X-Ray Free Electron Laser Driven by SLAC Linac  

E-Print Network (OSTI)

FREE ELECTRON LASER DRIVEN BY SLAC LINAC Ming Xie, LawrenceLaser (FEL) driven by the SLAC linac. The study assumes theis carried out for the SLAC FEL over all independent system

Xie, Ming



Net primary energy balance of a solar-driven photo-electrochemical...  

NLE Websites -- All DOE Office Websites (Extended Search)

Net primary energy balance of a solar-driven photo-electrochemical water-splitting device Title Net primary energy balance of a solar-driven photo-electrochemical water-splitting...



SciTech Connect

Using the H I emission/absorption method, we resolve the kinematic distance ambiguity and derive distances for 149 of 182 (82%) H II regions discovered by the Green Bank Telescope H II Region Discovery Survey (GBT HRDS). The HRDS is an X-band (9 GHz, 3 cm) GBT survey of 448 previously unknown H II regions in radio recombination line and radio continuum emission. Here, we focus on HRDS sources from 67 Degree-Sign {>=} l {>=} 18 Degree-Sign , where kinematic distances are more reliable. The 25 HRDS sources in this zone that have negative recombination line velocities are unambiguously beyond the orbit of the Sun, up to 20 kpc distant. They are the most distant H II regions yet discovered. We find that 61% of HRDS sources are located at the far distance, 31% at the tangent-point distance, and only 7% at the near distance. 'Bubble' H II regions are not preferentially located at the near distance (as was assumed previously) but average 10 kpc from the Sun. The HRDS nebulae, when combined with a large sample of H II regions with previously known distances, show evidence of spiral structure in two circular arc segments of mean Galactocentric radii of 4.25 and 6.0 kpc. We perform a thorough uncertainty analysis to analyze the effect of using different rotation curves, streaming motions, and a change to the solar circular rotation speed. The median distance uncertainty for our sample of H II regions is only 0.5 kpc, or 5%. This is significantly less than the median difference between the near and far kinematic distances, 6 kpc. The basic Galactic structure results are unchanged after considering these sources of uncertainty.

Anderson, L. D. [Department of Physics, West Virginia University, Morgantown, WV 26506 (United States); Bania, T. M. [Institute for Astrophysical Research, Department of Astronomy, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Balser, Dana S. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22903-2475 (United States); Rood, Robert T., E-mail: Loren.Anderson@mail.wvu.edu [Astronomy Department, University of Virginia, P.O. Box 3818, Charlottesville, VA 22903-0818 (United States)



High Rise Fire Study Provides Insight Into Deadly Wind-Driven ...  

Science Conference Proceedings (OSTI)

High Rise Fire Study Provides Insight Into Deadly Wind-Driven Fires. From NIST Tech Beat: May 5, 2009. ...



A systematic review of research on integration of ontologies with the model-driven approach  

Science Conference Proceedings (OSTI)

Despite years of research, dealing with software complexity is still considered to be a challenging problem in Software Engineering. Software development is a complex process which requires the creation and management of a great deal of artefacts. In ... Keywords: MDA, MDE, model-driven architecture, model-driven engineering, model-driven software development, ontologies, software complexity, software engineering

Maria-Cruz Valiente



Model driven software development: a practitioner takes stock and looks into future  

Science Conference Proceedings (OSTI)

We discuss our experience in use of models and model-driven techniques for developing large business applications. Benefits accrued and limitations observed are highlighted. We describe possible means of overcoming some of the limitations and experience ... Keywords: meta modeling, model driven engineering workbench, model driven enterprise, model transformation, modeling, separation of concerns, software product lines

Vinay Kulkarni



Reaction-Driven Restructuring of Bimetallic Nanoparticle Catalysts  

NLE Websites -- All DOE Office Websites (Extended Search)

Reaction-Driven Restructuring of Bimetallic Nanoparticle Catalysts Print Reaction-Driven Restructuring of Bimetallic Nanoparticle Catalysts Print Catalytic systems based on bimetallic particles with controlled size, composition, and structure dispersed on a high-surface-area support are widely used for catalytic reforming, pollution control, alcohol oxidation, and electrocatalysis in fuel cells. Owing to the nanoscale size of the particles, the modification of the surface structure and composition that may occur when reaction conditions change can have dramatic effects on catalyst activity and selectivity. Working at the ALS, a University of California, Berkeley-Berkeley Lab group has used an ambient-pressure x-ray photoelectron spectroscopy (APXPS) apparatus to demonstrate that bimetallic nanoparticle catalysts can undergo profound structural and chemical changes in response to reactive environments at ambient pressures, thereby opening the way for engineering catalysts with enhanced activity and selectivity.


Reaction-Driven Restructuring of Bimetallic Nanoparticle Catalysts  

NLE Websites -- All DOE Office Websites (Extended Search)

Reaction-Driven Restructuring of Bimetallic Nanoparticle Catalysts Print Reaction-Driven Restructuring of Bimetallic Nanoparticle Catalysts Print Catalytic systems based on bimetallic particles with controlled size, composition, and structure dispersed on a high-surface-area support are widely used for catalytic reforming, pollution control, alcohol oxidation, and electrocatalysis in fuel cells. Owing to the nanoscale size of the particles, the modification of the surface structure and composition that may occur when reaction conditions change can have dramatic effects on catalyst activity and selectivity. Working at the ALS, a University of California, Berkeley-Berkeley Lab group has used an ambient-pressure x-ray photoelectron spectroscopy (APXPS) apparatus to demonstrate that bimetallic nanoparticle catalysts can undergo profound structural and chemical changes in response to reactive environments at ambient pressures, thereby opening the way for engineering catalysts with enhanced activity and selectivity.

Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Estimating Policy-Driven Greenhouse Gas Emissions Trajectories in  

NLE Websites -- All DOE Office Websites (Extended Search)

Estimating Policy-Driven Greenhouse Gas Emissions Trajectories in Estimating Policy-Driven Greenhouse Gas Emissions Trajectories in California: The California Greenhouse Gas Inventory Spreadsheet (GHGIS) Model Jeffery Greenblatt November 2013 For decades, California has used groundbreaking tools to collect and analyze emissions data from a variety of sources to establish a scientific basis for policy making. As its scope has expanded to include greenhouse gas (GHG) reductions, it has sought out similar tools to use to achieve the goals of legislation such as the Global Warming Solutions Act of 2006 (AB 32). To support this effort, Lawrence Berkeley National Laboratory developed a California Greenhouse Gas Inventory Spreadsheet (GHGIS) model funded by the California Air Resources Board (ARB), to explore the impact of combinations


Reaction-Driven Restructuring of Bimetallic Nanoparticle Catalysts  

NLE Websites -- All DOE Office Websites (Extended Search)

Reaction-Driven Restructuring of Bimetallic Nanoparticle Catalysts Print Reaction-Driven Restructuring of Bimetallic Nanoparticle Catalysts Print Catalytic systems based on bimetallic particles with controlled size, composition, and structure dispersed on a high-surface-area support are widely used for catalytic reforming, pollution control, alcohol oxidation, and electrocatalysis in fuel cells. Owing to the nanoscale size of the particles, the modification of the surface structure and composition that may occur when reaction conditions change can have dramatic effects on catalyst activity and selectivity. Working at the ALS, a University of California, Berkeley-Berkeley Lab group has used an ambient-pressure x-ray photoelectron spectroscopy (APXPS) apparatus to demonstrate that bimetallic nanoparticle catalysts can undergo profound structural and chemical changes in response to reactive environments at ambient pressures, thereby opening the way for engineering catalysts with enhanced activity and selectivity.


Physics of Laser-driven plasma-based acceleration  

SciTech Connect

The physics of plasma-based accelerators driven by short-pulse lasers is reviewed. This includes the laser wake-field accelerator, the plasma beat wave accelerator, the self-modulated laser wake-field accelerator, and plasma waves driven by multiple laser pulses. The properties of linear and nonlinear plasma waves are discussed, as well as electron acceleration in plasma waves. Methods for injecting and trapping plasma electrons in plasma waves are also discussed. Limits to the electron energy gain are summarized, including laser pulse direction, electron dephasing, laser pulse energy depletion, as well as beam loading limitations. The basic physics of laser pulse evolution in underdense plasmas is also reviewed. This includes the propagation, self-focusing, and guiding of laser pulses in uniform plasmas and plasmas with preformed density channels. Instabilities relevant to intense short-pulse laser-plasma interactions, such as Raman, self-modulation, and hose instabilities, are discussed. Recent experimental results are summarized.

Esarey, Eric; Schroeder, Carl B.




Science Conference Proceedings (OSTI)

This work is devoted to the construction of a data-driven model for the study of the dynamic evolution of the global corona that can respond continuously to the changing of the photospheric magnetic field. The data-driven model consists of a surface flux transport (SFT) model and a global three-dimensional (3D) magnetohydrodynamic (MHD) coronal model. The SFT model is employed to produce the global time-varying and self-consistent synchronic snapshots of the photospheric magnetic field as the input to drive our 3D numerical global coronal AMR-CESE-MHD model on an overset grid of Yin-Yang overlapping structure. The SFT model and the 3D global coronal model are coupled through the boundary condition of the projected characteristic method. Numerical results of the coronal evolution from 1996 September 4 to October 29 provide a good comparison with multiply observed coronal images.

Feng Xueshang; Jiang Chaowei; Xiang Changqing [SIGMA Weather Group, State Key Laboratory for Space Weather, Center for Space Science and Applied Research, Chinese Academy of Sciences, Beijing 100190 (China); Zhao Xuepu [W. W. Hansen Experimental Physics Laboratory, Stanford University, Stanford, CA 94305 (United States); Wu, S. T., E-mail: fengx@spaceweather.ac.cn, E-mail: cwjiang@spaceweather.ac.cn, E-mail: cqxiang@spaceweather.ac.cn, E-mail: xpzhao@sun.stanford.edu, E-mail: wus@uah.edu [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)




SciTech Connect

We calculated the influence of the limb-darkened finite-disk correction factor in the theory of radiation-driven winds from massive stars. We solved the one-dimensional m-CAK hydrodynamical equation of rotating radiation-driven winds for all three known solutions, i.e., fast, {Omega}-slow, and {delta}-slow. We found that for the fast solution, the mass-loss rate is increased by a factor of {approx}10%, while the terminal velocity is reduced about 10%, when compared with the solution using a finite-disk correction factor from a uniformly bright star. For the other two slow solutions, the changes are almost negligible. Although we found that the limb darkening has no effects on the wind-momentum-luminosity relationship, it would affect the calculation of synthetic line profiles and the derivation of accurate wind parameters.

Cure, M. [Departamento de Fisica y Astronomia, Facultad de Ciencias, Universidad de Valparaiso, Av. Gran Bretana 1111, Casilla 5030, Valparaiso (Chile); Cidale, L. [Departamento de Espectroscopia, Facultad de Ciencias Astronomicas y Geofisicas, Universidad Nacional de La Plata (UNLP), Paseo del Bosque S/N, 1900 La Plata (Argentina); Rial, D. F., E-mail: michel.cure@uv.cl, E-mail: lydia@fcaglp.unlp.edu.ar, E-mail: drial@dm.uba.ar [Departamento de Matematicas, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires (Argentina)



Strongly driven one-atom laser and decoherence monitoring  

Science Conference Proceedings (OSTI)

We propose the implementation of a strongly driven one-atom laser, based on the off-resonant interaction of a three-level atom in {lambda} configuration with a single cavity mode and three laser fields. We show that the system can be described equivalently by a two-level atom resonantly coupled to the cavity and driven by a strong effective coherent field. The effective dynamics can be solved exactly, including a thermal field bath, allowing an analytical description of field statistics and entanglement properties. We also show the possible generation of quantum superposition (Schroedinger cat) states for the whole atom-field system and for the field alone after atomic measurement. We propose a way to monitor the system decoherence by measuring atomic populations. Finally, we confirm the validity of our model through numerical solutions.

Lougovski, P. [Hearne Institute for Theoretical Physics, Department of Physics and Astronomy, Louisiana State University, 202 Nicholson Hall, Baton Rouge, Louisiana 70803 (United States); Casagrande, F.; Lulli, A. [Dipartimento di Fisica, Universita di Milano, Via Celoria 16, 20133 Milan (Italy); Solano, E. [Physics Department, ASC, and CeNS, Ludwig-Maximilians-Universitaet, Theresienstrasse 37, 80333 Munich (Germany); Seccion Fisica, Departamento de Ciencias, Pontificia Universidad Catolica del Peru, Apartado 1761, Lima (Peru)



Strongly-Driven One-Atom Laser and Decoherence Monitoring  

E-Print Network (OSTI)

We propose the implementation of a strongly-driven one-atom laser, based on the off-resonant interaction of a three-level atom in $\\Lambda$-configuration with a single cavity mode and three laser fields. We show that the system can be described equivalently by a two-level atom resonantly coupled to the cavity and driven by a strong effective coherent field. The effective dynamics can be solved exactly, including a thermal field bath, allowing an analytical description of field statistics and entanglement properties. We also show the possible generation of Schr\\"odinger cat states for the whole atom-field system and for the field alone after atomic measurement. We propose a way to monitor the system decoherence by measuring atomic population. Finally, we confirm the validity of our model through numerical solutions.

P. Lougovski; F. Casagrande; A. Lulli; E. Solano



Drift and ion acoustic wave driven vortices with superthermal electrons  

SciTech Connect

Linear and nonlinear analysis of coupled drift and acoustic mode is presented in an inhomogeneous electron-ion plasma with {kappa}-distributed electrons. A linear dispersion relation is found which shows that the phase speed of both the drift wave and the ion acoustic wave decreases in the presence of superthermal electrons. Several limiting cases are also discussed. In the nonlinear regime, stationary solutions in the form of dipolar and monopolar vortices are obtained. It is shown that the condition for the boundedness of the solution implies that the speed of drift wave driven vortices reduces with increase in superthermality effect. Ignoring density inhomogeniety, it is investigated that the lower and upper limits on the speed of the ion acoustic driven vortices spread with the inclusion of high energy electrons. The importance of results with reference to space plasmas is also pointed out.

Ali Shan, S. [Theoretical Plasma Physics Division, PINSTECH, P.O. Nilore, Islamabad (Pakistan); National Centre For Physics (NCP), Shahdra Valley Road, QAU Campus, 44000 Islamabad (Pakistan); Pakistan Institute of Engineering and Applied Sciences (PIEAS), Islamabad (Pakistan); Haque, Q. [Theoretical Plasma Physics Division, PINSTECH, P.O. Nilore, Islamabad (Pakistan); National Centre For Physics (NCP), Shahdra Valley Road, QAU Campus, 44000 Islamabad (Pakistan)



Inertial Fusion Driven by Intense Heavy-Ion Beams  

NLE Websites -- All DOE Office Websites (Extended Search)

INERTIAL FUSION DRIVEN BY INTENSE HEAVY-ION BEAMS INERTIAL FUSION DRIVEN BY INTENSE HEAVY-ION BEAMS * W. M. Sharp # , A. Friedman, D. P. Grote, J. J. Barnard, R. H. Cohen, M. A. Dorf, S. M. Lund, L. J. Perkins, M. R. Terry, LLNL, Livermore, CA, USA B. G. Logan, F. M. Bieniosek, A. Faltens, E. Henestroza, J.-Y. Jung, J. W. Kwan, E. P. Lee, S. M. Lidia, P. A. Ni, L. L. Reginato, P. K. Roy, P. A. Seidl, J. H. Takakuwa, J.-L. Vay, W. L. Waldron, LBNL, Berkeley, CA, USA R. C. Davidson, E. P. Gilson, I. D. Kaganovich, H. Qin, E. Startsev, PPPL, Princeton, NJ, USA I. Haber, R. A. Kishek, University of Maryland, College Park, MD, USA A. E. Koniges, NERSC, Berkeley, CA, USA Abstract Intense heavy-ion beams have long been considered a promising driver option for inertial-fusion energy production. This paper briefly compares inertial


Ontology-driven web-based semantic similarity  

Science Conference Proceedings (OSTI)

Estimation of the degree of semantic similarity/distance between concepts is a very common problem in research areas such as natural language processing, knowledge acquisition, information retrieval or data mining. In the past, many similarity measures ... Keywords: Information content, Knowledge discovery, Ontologies, Semantic similarity, Web

David Sßnchez; Montserrat Batet; Aida Valls; Karina Gibert



Wave-driven Rotation in Supersonically Rotating Mirrors  

SciTech Connect

Supersonic rotation in mirrors may be produced by radio frequency waves. The waves produce coupled diffusion in ion kinetic and potential energy. A population inversion along the diffusion path then produces rotation. Waves may be designed to exploit a natural kinetic energy source or may provide the rotation energy on their own. Centrifugal traps for fusion and isotope separation may benefit from this wave-driven rotation.

A. Fetterman and N.J. Fisch




DOE Green Energy (OSTI)

A hydrogen rich, low density liquid, contained within the internal volume of a cylindrical liner, was requested of the Polymers and Coatings Group (MST-7) of the Los Alamos Materials Science Division for one of the last liner driven experiments conducted on the Los Alamos Pegasus facility. The experiment was a continuation of the Raleigh-Taylor hydrodynamics series of experiments and associated liners that have been described previously [1,2].




Instability in gravity-driven flow over uneven surfaces  

Science Conference Proceedings (OSTI)

We consider the gravity-driven laminar flow of a shallow fluid layer down an uneven incline with the principal objective of investigating the effect of bottom topography and surface tension on the stability of the flow. The equations of motion are approximations to the NavierľStokes equations which exploit the assumed relative shallowness of the fluid layer. Included in these equations are diffusive terms that are second order relative to the shallowness parameter. These terms

S. J. D. DĺAlessio; J. P. Pascal; H. A. Jasmine



Waste heat driven absorption refrigeration process and system  

DOE Patents (OSTI)

Absorption cycle refrigeration processes and systems are provided which are driven by the sensible waste heat available from industrial processes and other sources. Systems are disclosed which provide a chilled water output which can be used for comfort conditioning or the like which utilize heat from sensible waste heat sources at temperatures of less than 170.degree. F. Countercurrent flow equipment is also provided to increase the efficiency of the systems and increase the utilization of available heat.

Wilkinson, William H. (Columbus, OH)



Liquid butane filled load for a liner driven Pegasus experiment.  

SciTech Connect

A hydrogen rich, low density liquid, contained within the internal volume of a cylindrical liner, was requested of the Polymers and Coatings Group (MST-7) of the Los Alamos Materials Science Division for one of the last liner driven experiments conducted on the Los Alamos Pegasus facility. The experiment (Fig.1) was a continuation of the Raleigh-Taylor hydrodynamics series of experiments and associated liners that have been described previously.

Salazar, M. A. (Mike A.); Armijo, E. V. (Elfino V.); Anderson, W. E. (Wallace E.); Atchison, W. L. (Walter L.); Bartos, J. J. (Jacob J.); Garcia, F. (Fermin); Randolph, B. (Blaine); Sheppard, M. G. (Maurice G.); Stokes, J. L. (John L.)




SciTech Connect

Detecting the signature of Alfven waves in the solar atmosphere remains an observational challenge. At the same time, it could also be an important key to gaining critical understanding of the solar wind and especially of the near-Earth space weather formation. Here, we investigate the plausibility of using inhomogeneous flow-driven compressional fluctuations as a diagnostics tool for Alfven waves in the solar corona. The nature of the fluctuations driven by transverse Alfven waves in inhomogeneous flows was recently investigated by Kaghashvili et al., and analytical solutions that accurately link driven waves to the Alfvenic driver were found. The novelty of this mechanism is that the analysis of the detected compressional fluctuations can provide a clue about the Alfven waves that are otherwise difficult to detect. We review this physical process in a low-beta approximation relevant to solar coronal conditions and outline basic reasons why it can be one of the major processes that comes about as outflowing plasma emerges from divergent coronal holes. After establishing a quantitative link, we consider an example with coronal hole plasma parameters similar to the ones reported recently where evidence for Alfven waves in solar X-ray jets was discussed. We show how this diagnostics tool can be used to analyze the detected intensity fluctuations.

Kaghashvili, Edisher Kh.; Quinn, Richard A. [Atmospheric and Environmental Research, Inc., 131 Hartwell Avenue, Lexington, MA 02421 (United States); Hollweg, Joseph V., E-mail: ekaghash@aer.co [Space Science Center, University of New Hampshire, Durham, NH 03824 (United States)



Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices  

Science Conference Proceedings (OSTI)

Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E



LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN


LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance


Preparation For Laser Wakefield Experiments Driven by the Texas Petawatt Laser System  

Science Conference Proceedings (OSTI)

Laboratories around the world are planning petawatt laser driven experiments. The Texas petawatt laser offers the ability to demonstrate laser wake field acceleration (LWFA) in a unique regime with pulse duration ({approx}160 fs) shorter than other petawatt scale systems currently in operation or under development. By focusing the 1.25 PW, 200 J, 160 fs pulses to peak intensity {approx}10{sup 19} W/cm{sup 2}, multi-GeV electron bunches can be produced from a low density He gas jet. The rarefied plasma density (5x10{sup 16}-10{sup 17} cm{sup -3}) required for near-resonant LWFA minimizes plasma lensing and offers long dephasing length for electron acceleration over distances ({approx}10 cm) exceeding the Rayleigh range. Because of the high power, the laser can be focused to a spot (r{sub 0}{approx}100 microns) greater than the plasma wavelength (r{sub 0}>{lambda}{sub p}), thus minimizing radial propagation effects. Together these properties enable the laser pulse to self-guide without the use of a preformed channel lending simplicity and stability to the overall acceleration process. Particle-in-cell (PIC) simulations show the laser experiences self-focusing which, because of ultrashort pulse duration, does not lead to a collapse of the wakefield and can generate over 3 GeV electron energy. The presented material will include details of initial measurements of the Texas petawatt laser system, simulations of laser wakefield acceleration for the given laser parameters and the experimental setup currently under construction.

Reed, S. A.; Kalmykov, S.; Gaul, E.; Martinez, M.; Henderson, W.; Dong, P.; Gao, X.; Sanders, J. C.; Wang, X.; Shvets, G.; Ditmire, T.; Downer, M. [Department of Physics and Institute for Fusion Studies, University of Texas at Austin, Austin, Texas 78712 (United States)


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Generation of Optimal Unit Distance Codes for Rotary Encoders through Simulated Evolution  

Science Conference Proceedings (OSTI)

An evolutionary algorithm is used to generate unit distance codes for absolute rotary encoders. The target is to obtain a code suitable for disk size reduction, or for resolution increase, thus overcoming the limitations of conventional Gray codes. Obtained ...

Stefano Gregori; Roberto Rossi; Guido Torelli; Valentino Liberali



Visualisation of influenza A protein segments in distance invariant self-organising map  

Science Conference Proceedings (OSTI)

Due to the lateral gene transfer, the phylogenetic tree could be inadequate for representing the evolution of virus. This paper employs the distance invariant manifold (Cheng and Liou, 2009) to display the collection of influenza A in a cubic space. ...

Wei-Chen Cheng; Cheng-Yuan Liou



Decisionmaking in hospital earthquake evacuation: Does distance from the epicenter matter?  

E-Print Network (OSTI)

status of hospitals that does not depend on intactis one option. This study does not have the ability toUsing larger distances does not make sense, as no hospital

Schultz, Carl H. MD; Koenig, Kristi L. MD; Lewis, Roger J. MD, PhD



A preliminary comparison of synchronous venues for distance learning: traditional videoconferencing vs. web-based conferencing  

Science Conference Proceedings (OSTI)

Synchronous venues are often preferred in distance learning settings as they most closely approximate the face-to-face experience. This paper examines two synchronous venues: videoconferencing and web-based conferencing. Both are compared, ...

Norman A. Garrett



Standoff Spectroscopy Using a Conditioned Target Identifies Hazardous Materials at a Distance  

A safer method for the standoff (long distance) detection and identification ofmolecules on a surface has been invented by researchers at ORNL and the Universityof Tennessee. This invention avoids the necessity of close and potentially ...


Web services model for mobile, distance and distributed learning using service-oriented architecture  

Science Conference Proceedings (OSTI)

This paper describes web services and service-oriented architecture and how these new technologies could be exploited to develop integrated software for mobile, distance and distributed learning. The paper also provides details of a prototype translator ... Keywords: VLE, distance learning, distributed learning, interoperability, m-learning, mobile communications, mobile learning, online education, online learning, service-oriented architecture, virtual learning environments, web services, web-based education

Sushil K. Sharma; Fred L. Kitchens; Queen Esther Booker; Huinan Xu



Photon flux and distance from the source: consequences for quantum foundations and technologies  

E-Print Network (OSTI)

The paper explores the fundamental physical principles of quantum mechanics (in fact, quantum field theory) which limit the bit rate for long distances. Propagation of photons in optical fibers is modeled using methods of quantum electrodynamics. We define photon "duration" as the standard deviation of the photon arrival time; we find its asymptotics for long distances and then obtain the main result of the paper: the linear dependence of photon duration on the distance. This effect puts the limit to joint increasing of the photon flux and the distance from the source and it has important consequences both for quantum information technologies and quantum foundations. Once quantum communication develops into a real technology, it would be appealing to the engineers to increase both the photon flux and the distance. And here our "photon flux/distance effect" has to be taken into account (at least if successively emitted photons are considered as independent). This effect also has to be taken into account in a loophole free test of Bell's type -- to close jointly the detection and locality loopholes.

Andrei Khrennikov; B÷rje Nilsson; Sven Nordebo; Igor Volovich



Long-Distance Debris Transport by Tornadic Thunderstorms.Part I: The 7 May 1995 Supercell Thunderstorm  

Science Conference Proceedings (OSTI)

On 7 May 1995, during VORTEX 95, the Tornado Debris Project at the University of Oklahoma collected debris transported up to 190 km (120 mi) in association with an isolated tornadic thunderstorm which moved over north Texas and southern/central ...

Michael A. Magsig; John T. Snow



Transmission thresholds in time-periodically driven nonlinear disordered systems  

E-Print Network (OSTI)

We study energy propagation in locally time-periodically driven disordered nonlinear chains. For frequencies inside the band of linear Anderson modes, three different regimes are observed with increasing driver amplitude: 1) Below threshold, localized quasiperiodic oscillations and no spreading; 2) Three different regimes in time close to threshold, with almost regular oscillations initially, weak chaos and slow spreading for intermediate times, and finally strong diffusion; 3) Immediate spreading for strong driving. The thresholds are due to simple bifurcations, obtained analytically for a single oscillator, and numerically as turning-points of the nonlinear response manifold for a full chain. Generically, the threshold is nonzero also for infinite chains.

Magnus Johansson; Georgios Kopidakis; Stefano Lepri; Serge Aubry



Particle physics with a laser-driven positronium atom  

E-Print Network (OSTI)

A detailed quantum-electrodynamic calculation of muon pair creation in laser-driven electron-positron collisions is presented. The colliding particles stem from a positronium atom exposed to a superintense laser wave of linear polarization, which allows for high luminosity. The threshold laser intensity of this high-energy reaction amounts to a few 10^22 W/cm^2 in the near-infrared frequency range. The muons produced form an ultrarelativistic, strongly collimated beam, which is explicable in terms of a classical simple-man's model. Our results indicate that the process can be observed at high positronium densities with the help of present-day laser technology.

Carsten MŘller; Karen Z. Hatsagortsyan; Christoph H. Keitel



The Nonlinear Landau Damping Rate of a Driven Plasma Wave  

Science Conference Proceedings (OSTI)

In this Letter, we discuss the concept of the nonlinear Landau damping rate, {nu}, of a driven electron plasma wave, and provide a very simple, practical, analytic formula for {nu} which agrees very well with results inferred from Vlasov simulations of stimulated Raman scattering. {nu} actually is more complicated an operator than a plain damping rate, and it may only be seen as such because it assumes almost constant values before abruptly dropping to 0. The decrease of {nu} to 0 is moreover shown to occur later when the wave amplitude varies in the direction transverse to its propagation.

Benisti, D; Strozzi, D J; Gremillet, L; Morice, O



Asymmetry-driven structure formation in pair plasmas  

SciTech Connect

The nonlinear propagation of electromagnetic waves in pair plasmas, in which the electrostatic potential plays a very important but subdominant role of a 'binding glue' is investigated. Several mechanisms for structure formation are investigated, in particular, the 'asymmetry' in the initial temperatures of the constituent species. It is shown that the temperature asymmetry leads to a (localizing) nonlinearity that is qualitatively different from the ones originating in ambient mass or density difference. The temperature-asymmetry-driven focusing-defocusing nonlinearity supports stable localized wave structures in 1-3 dimensions, which, for certain parameters, may have flat-top shapes.

Mahajan, S. M.; Shatashvili, N. L.; Berezhiani, V. I. [Institute for Fusion Studies, University of Texas at Austin, Austin, Texas 78712 (United States); Andronikashvili Institute of Physics, Tbilisi 0177 (Georgia) and Faculty of Exact and Natural Sciences, Department of Physics, Javakhishvili Tbilisi State University, Tbilisi 0128 (Georgia)



Dynamics of electrostatically driven granular media: Effects of humidity  

SciTech Connect

We performed experimental studies of the effect of humidity on the dynamics of electrostatically driven granular materials. Both conducting and dielectric particles undergo a phase transition from an immobile state (granular solid) to a fluidized state (granular gas) with increasing applied field. Spontaneous precipitation of solid clusters from the gas phase occurs as the external driving is decreased. The clustering dynamics in conducting particles is primarily controlled by screening of the electric field but is aided by cohesion due to humidity. It is shown that humidity effects dominate the clustering process with dielectric particles.

Howell, D. W.; Aronson, Igor S.; Crabtree, G. W.



Responsibility-driven explanation engineering for cognitive models  

E-Print Network (OSTI)

We describe an approach for developing explanation facilities for cognitive architectures based on techniques drawn from object- and aspect-oriented software engineering. We examine the use of responsibility-driven design augmented with scenario-based techniques and classresponsibility-collaboration (CRC) cards to identify explanation behaviors for cognitive model elements, and discuss the explanation benefits derived from encapsulating model behaviors within aspects. Soar is used an example cognitive architecture, but the methods and results as illustrated would apply to any of the other architectures commonly used to development psychologically plausible intelligent systems.

Steven R. Haynes; Isaac G. Councill; Frank E. Ritter



Diagnostic measurements related to laser driven inertial confinement fusion  

SciTech Connect

Scientists at the Lawrence Livermore Laboratory have been conducting laser driven inertial confinement fusion experiments for over five years. The first proof of the thermonuclear burn came at the Janus target irradiation facility in the spring of 1975. Since that time three succeedingly higher energy facilities have been constructed at Livermore, Cyclops, Argus and Shiva, where increased fusion efficiency has been demonstrated. A new facility, called Nova, is now in the construction phase and we are hopeful that scientific break even (energy released compared to incident laser energy on target) will be demonstrated here in early 1980's. Projected progress of the Livermore program is shown.

Campbell, D.E.



Z-petawatt driven ion beam radiography development.  

SciTech Connect

Laser-driven proton radiography provides electromagnetic field mapping with high spatiotemporal resolution, and has been applied to many laser-driven High Energy Density Physics (HEDP) experiments. Our report addresses key questions about the feasibility of ion radiography at the Z-Accelerator (%E2%80%9CZ%E2%80%9D), concerning laser configuration, hardware, and radiation background. Charged particle tracking revealed that radiography at Z requires GeV scale protons, which is out of reach for existing and near-future laser systems. However, it might be possible to perform proton deflectometry to detect magnetic flux compression in the fringe field region of a magnetized liner inertial fusion experiment. Experiments with the Z-Petawatt laser to enhance proton yield and energy showed an unexpected scaling with target thickness. Full-scale, 3D radiation-hydrodynamics simulations, coupled to fully explicit and kinetic 2D particle-in-cell simulations running for over 10 ps, explain the scaling by a complex interplay of laser prepulse, preplasma, and ps-scale temporal rising edge of the laser.

Schollmeier, Marius; Geissel, Matthias; Rambo, Patrick K.; Schwarz, Jens; Sefkow, Adam B.



Entropy driven multi-photon frequency up-conversion  

E-Print Network (OSTI)

Frequency up-conversion of few low-energy photons into a single high-energy photon, greatly contributes to imaging, light sources, detection and other fields of research. However, it offers negligible efficiency when up-converting many photons. This is because coherent process are fundamentally limited due to momentum conservation requirements, while in incoherent up-conversion the finite intermediate states lifetime requires huge intensities. Thermodynamically, conventional incoherent up-conversion is driven by the internal energy of the incoming photons. However, a system can also drive work through change in its collective properties such as entropy. Here we experimentally demonstrate entropy driven ten-fold up-conversion from 10.6{\\mu} to 1{\\mu}m at internal efficiency above 27% and total efficiency above 10%. In addition, the emitted radiance at 1{\\mu}m exceeds the maximal possible Black-Body radiance of our device, indicating emitter's effective-temperature that is considerably above the bulk-temperatur...

Manor, Assaf; Rotschild, Carmel



Quantitative Measurements of CME-driven Shocks from LASCO Observations  

E-Print Network (OSTI)

In this paper, we demonstrate that CME-driven shocks can be detected in white light coronagraph images and in which properties such as the density compression ratio and shock direction can be measured. Also, their propagation direction can be deduced via simple modeling. We focused on CMEs during the ascending phase of solar cycle 23 when the large-scale morphology of the corona was simple. We selected events which were good candidates to drive a shock due to their high speeds (V>1500 km/s). The final list includes 15 CMEs. For each event, we calibrated the LASCO data, constructed excess mass images and searched for indications of faint and relatively sharp fronts ahead of the bright CME front. We found such signatures in 86% (13/15) of the events and measured the upstream/downstream densities to estimate the shock strength. Our values are in agreement with theoretical expectations and show good correlations with the CME kinetic energy and momentum. Finally, we used a simple forward modeling technique to estimate the 3D shape and orientation of the white light shock features. We found excellent agreement with the observed density profiles and the locations of the CME source regions. Our results strongly suggest that the observed brightness enhancements result from density enhancements due to a bow-shock structure driven by the CME.

Veronica Ontiveros; Angelos Vourlidas



Fluid-driven reciprocating apparatus and valving for controlling same  

DOE Patents (OSTI)

A control valve assembly for alternately actuating a pair of fluid-driven free-piston devices by using fluid pressure communication therebetween. Each control valve is switched by a pressure signal depending on the state of its counterpart's piston. The communication logic is arranged to provide overlap of the forward strokes of the pistons, so that at least one of the pair will always be pressurized. Thus, uninterrupted pumping of liquid is made possible from a pair of free-piston pumps. In addition, the speed and frequency of piston stroking is entirely dependent on the mechanical power load applied. In the case of a pair of pumps, this enables liquid delivery at a substantially constant pressure over the full range of flow rates, from zero to maximum flow. One embodiment of the invention utilized two pairs of fluid-driven free-piston devices whereby a bipropellant liquid propulsion system may be operated, so as to provide continuous flow of both fuel and oxidizer liquids when used in rocket applications, for example.

Whitehead, John C. (Davis, CA); Toews, Hans G. (East Aurora, NY)



Z-Pinch Driven Isentropic Compression for Inertial Fusion  

Science Conference Proceedings (OSTI)

The achievement of high gain with inertial fusion requires the compression of hydrogen isotopes to high density and temperatures. High densities can be achieved most efficiently by isentropic compression. This requires relatively slow pressure pulses on the order of 10-20 nanoseconds; however, the pressure profile must have the appropriate time. We present 1-D numerical simulations that indicate such a pressure profile can be generated by using pulsed power driven z pinches. Although high compression is calculated, the initial temperature is too low for ignition. Ignition could be achieved by heating a small portion of this compressed fuel with a short (-10 ps) high power laser pulse as previously described. Our 1-D calculations indicate that the existing Z-accelerator could provide the driving current (-20 MA) necessary to compress fuel to roughly 1500 times solid density. At this density the required laser energy is approximately 10 kJ. Multidimensional effects such as the Rayleigh-Taylor were not addressed in this brief numerical study. These effects will undoubtedly lower fuel compression for a given chive current. Therefore it is necessary to perform z-pinch driven compression experiments. Finally, we present preliminary experimental data from the Z-accelerator indicating that current can be efficiently delivered to appropriately small loads (- 5 mm radius) and that VISAR can be used measure high pressure during isentropic compression.

Asay, J.R.; Hall, C.A.; Holland, K.G.; Slutz, S.A.; Spielman, R.B.; Stygar, W.A.


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Shock driven jamming and periodic fracture of particulate rafts  

E-Print Network (OSTI)

A tenuous monolayer of hydrophobic particles at the air-water interface often forms a scum or raft. When such a monolayer is disturbed by the localized introduction of a surfactant droplet, a radially divergent surfactant shock front emanates from the surfactant origin and packs the particles into a jammed, compact, annular band with a packing fraction that saturates at a peak packing fraction $\\phi^*$. As the resulting two-dimensional, disordered elastic band grows with time and is driven radially outwards by the surfactant, it fractures to form periodic triangular cracks with robust geometrical features. We find the number of cracks $N$ and the compaction band radius $R^*$ at fracture onset vary monotonically with the initial packing fraction ($\\phi_{init}$). However, its width $W^*$ is constant for all $\\phi_{init}$. A simple geometric theory that treats the compaction band as an elastic annulus, and accounts for mass conservation allows us to deduce that $N \\simeq 2\\pi R^*/W^* \\simeq 4\\pi \\phi_{RCP}/\\phi_{init}$, a result we verify both experimentally and numerically. We show the essential ingredients for this phenomenon are an initially low enough particulate packing fraction that allows surfactant driven advection to cause passive jamming and eventual fracture of the hydrophobic particulate interface.

M. M. Bandi; T. Tallinen; L. Mahadevan



The extragalactic distance scale Key Project. III. The discovery of Cepheids and a new distance to M101 using the {ital Hubble} {ital Space} {ital Telescope}  

Science Conference Proceedings (OSTI)

We report on the discovery of 29 Cepheid variables in the galaxy M101 using the original Wide Field Camera (WFC) and the new Wide Field and Planetary Camera 2 (WFPC2) on the {ital Hubble} {ital Space} {ital Telescope}. We observed a field in M101 at 17 independent epochs in {ital V} (F555W), five epochs in {ital I} (F785LP/F814W), and one epoch in {ital B} (F439W), with a time interval baseline of 381 days. We have found Cepheids with periods ranging from 10 to 60 days. The data have been calibrated using WFPC2 observations with zero points derived from {omega} Cen, Pal 4, and NGC 2419 observations. This calibration has been verified by using the Medium Deep Survey (MDS) WFC photometric zero points, and ground-based secondary standards in {ital V} and {ital I}. The {ital V} calibrations agree to {plus_minus}0.06 mag, and the {ital I} calibrations agree to {plus_minus}0.04 mag. We have constructed {ital V} and {ital I} period-luminosity (PL) relations and have derived apparent distance moduli based on a distance modulus for the Large Magellanic Cloud (LMC) of 18.50 mag and a reddening of {ital E}({ital B}{minus}{ital V})=0.10 mag to the LMC Cepheids. Period-residual minimization was used to minimize the effects of Malmquist bias on the period-luminosity relation fitting process. Using a Galactic extinction law and the apparent {ital V} and {ital I} distance moduli, we have found a mean reddening for the M101 sample of {ital E}({ital B}{minus}{ital V})=0.03 mag and a true distance modulus to M101 of 29.34{plus_minus}0.17 mag, corresponding to a distance of 7.4{plus_minus}0.6 Mpc. The sources of error have been rigorously tracked through an error budget; systematic and random errors contribute roughly equally to the quoted error. The mean gas-phase metal abundances in the LMC and in the M101 outer field are similar so we expect metallicity effects to be minimal. (Abstract Truncated)

Kelson, D.D.; Illingworth, G.D. [UCO/Lick Observatory, University of California, Santa Cruz, California 95064 (United States); Freedman, W.F. [Carnegie Observatories, 813 Santa Barbara Street, Pasadena, California 91101 (United States); Graham, J.A. [Department of Terrestrial Magnetism, Carnegie Institution of Washington, 5241 Broad Branch Road NW, Washington, District of Columbia 20015 (United States); Hill, R. [Carnegie Observatories, 813 Santa Barbara Street, Pasadena, California 91101 (United States); Madore, B.F. [NASA/IPAC Extragalactic Database, Infrared Processing and Analysis Center, Jet Propulsion Laboratory, California Institute of Technology, Pasadena, California 91125 (United States); Saha, A. [Space Telescope Institute, Homewood Campus, Baltimore, Maryland 21218 (United States); Stetson, P.B. [Dominion Astrophysical Observatory, National Research Council, 5071 West Saanich Road, Victoria, BC, V8X 4M6 (CANADA); Kennicutt, R.C. Jr. [Steward Observatory, University of Arizona, Tucson, Arizona 85721 (United States); Mould, J.R. [Mt. Stromlo and Siding Springs Observatories, Private Bag, Weston Creek Post Office ACT 2611 (Australia); Hughes, S.M. [Royal Greenwich Observatory, Madingley Road, Cambridge, (United Kingdom) CB3 0EZ; Ferrarese, L. [Space Telescope Institute, Homewood Campus, Baltimore, Maryland 21218 (United States)]|[Department of Physics and Astronomy, Bloomberg 501, Johns Hopkins University, 3400 North Charles Street, Baltimore, Maryland 21218 (United States); Phelps, R. [Carnegie Observatories, 813 Santa Barbara Street, Pasadena, California 91101 (United States); Turner, A. [Steward Observatory, University of Arizona, Tucson, Arizona 85721 (United States); Cook, K.H. [Lawrence Livermore National Laboratory, Mississippi L-401, P.O. Box 808, Livermore, California 94550 (United States); Ford, H. [Space Telescope Institute, Homewood Campus, Baltimore, Maryland 21218 (United States)



Design Considerations for Plasma Accelerators Driven by Lasers or Particle Beams  

SciTech Connect

Plasma accelerators may be driven by the ponderomotive force of an intense laser or the space-charge force of a charged particle beam. The implications for accelerator design and the different physical mechanisms of laser-driven and beam-driven plasma acceleration are discussed. Driver propagation is examined, as well as the effects of the excited plasma wave phase velocity. The driver coupling to subsequent plasma accelerator stages for high-energy physics applications is addressed.

Schroeder, C. B.; Esarey, E.; Benedetti, C.; Toth, Cs.; Geddes, C. G. R.; Leemans, W.P.



Agile enterprise software development using domain-driven design and test first  

Science Conference Proceedings (OSTI)

In this paper we present the experience gained and lessons learned when the IT department at Statoil ASA, a large Oil and Gas company in Norway, applied Domain-Driven design techniques in combination with agile software development practices to assess ... Keywords: PL/SQL, agile software development, domain-driven design, object databases, object-relational mapping, oracle, relational databases, test driven design, test first, versant

Einar Landre; Harald Wesenberg; Jorn Olmheim



Basis and objectives of the Los Alamos Accelerator?Driven Transmutation technology project  

Science Conference Proceedings (OSTI)

The Accelerator?Driven Transmutation Technology (ADTT) Project carries three approaches for dealing with waste from the defense and commercial nuclear energy enterprise. First

Charles D. Bowman



Plasma ignition schemes for the SNS radio-frequency driven H- source  

E-Print Network (OSTI)

on the Spallation Neutron Source (SNS) Project,ö EPAC Ĺ98,ignition schemes for the SNS radio-frequency driven H -the Spallation Neutron Source (SNS) is a cesiated, radio-



Buoyancy-Driven Ventilation of Hydrogen from Buildings: Laboratory Test and Model Validation  

DOE Green Energy (OSTI)

Passive, buoyancy-driven ventilation is one approach to limiting hydrogen concentration. We explored the relationship between leak rate, ventilation design, and hydrogen concentrations.

Barley, C. D.; Gawlik, K.



Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Data Processing Procedures and Methodology for Estimating Trip Distances for the 1995 American Travel Survey (ATS)  

SciTech Connect

The 1995 American Travel Survey (ATS) collected information from approximately 80,000 U.S. households about their long distance travel (one-way trips of 100 miles or more) during the year of 1995. It is the most comprehensive survey of where, why, and how U.S. residents travel since 1977. ATS is a joint effort by the U.S. Department of Transportation (DOT) Bureau of Transportation Statistics (BTS) and the U.S. Department of Commerce Bureau of Census (Census); BTS provided the funding and supervision of the project, and Census selected the samples, conducted interviews, and processed the data. This report documents the technical support for the ATS provided by the Center for Transportation Analysis (CTA) in Oak Ridge National Laboratory (ORNL), which included the estimation of trip distances as well as data quality editing and checking of variables required for the distance calculations.

Hwang, H.-L.; Rollow, J.



Estimation and validation of mode distances for the 1993 Commodity Flow Survey  

SciTech Connect

The 1993 Commodity Flow Survey (CFS) collected shipment data from a sample of approximately 200,000 domestic business establishments. Each selected establishment provided information on origin, destination, commodity, shipment weight and value, and modes of transport for a sample of its outbound shipments. One data item not reported by CFS participants was shipment distance. This important piece of information was estimated by simulating probable routes using computer models of the highway, rail, air, waterway, and pipeline networks and their interconnections. This paper describes the nature of the shipment distance estimation problem, the procedures used to estimate mode-specific distances between origin and destination ZIP codes, and the techniques used to validate the results.

Middendorf, D.P.; Bronzini, M. S.; Peterson, B.; Liu, Cheng; Chin, Shih-Miao



Cam-driven valve system for steam turbines  

SciTech Connect

This patent describes, in a steam turbine system including a source of motive steam and a turbine adapted to operate at less than a full load, the turbine including an improved cam-driven valve system for activating a varying number of steam control valves to permit transferring between a maximum arc-admission mode and a minimum arc-admission mode. It comprises: a steam chest for receiving the motive steam from the source, the steam chest including a plurality of valves connected to a corresponding turbine section and set for a minimum admission of motive steam into the turbine below 100 percent; a first cam lift means for actuating a portion of the valves and second cam lift means for actuating the remainder of the valves.

Silvestri, G.J. Jr.



Gas flow driven by thermal creep in dusty plasma  

Science Conference Proceedings (OSTI)

Thermal creep flow (TCF) is a flow of gas driven by a temperature gradient along a solid boundary. Here, TCF is demonstrated experimentally in a dusty plasma. Stripes on a glass box are heated by laser beam absorption, leading to both TCF and a thermophoretic force. The design of the experiment allows isolating the effect of TCF. A stirring motion of the dust particle suspension is observed. By eliminating all other explanations for this motion, we conclude that TCF at the boundary couples by drag to the bulk gas, causing the bulk gas to flow, thereby stirring the suspension of dust particles. This result provides an experimental verification, for the field of fluid mechanics, that TCF in the slip-flow regime causes steady-state gas flow in a confined volume.

Flanagan, T. M.; Goree, J. [Department of Physics and Astronomy, University of Iowa, Iowa City, Iowa 52242 (United States)



Thermophoresis of Brownian particles driven by coloured noise  

E-Print Network (OSTI)

The Brownian motion of microscopic particles is driven by the collisions with the molecules of the surrounding fluid. The noise associated with these collisions is not white, but coloured due, e.g., to the presence of hydrodynamic memory. The noise characteristic time scale is typically of the same order as the time over which the particle's kinetic energy is lost due to friction (inertial time scale). We demonstrate theoretically that, in the presence of a temperature gradient, the interplay between these two characteristic time scales can have measurable consequences on the particle long-time behaviour. Using homogenization theory, we analyse the infinitesimal generator of the stochastic differential equation describing the system in the limit where the two characteristic times are taken to zero; from this generator, we derive the thermophoretic transport coefficient, which, we find, can vary in both magnitude and sign, as observed in experiments. Furthermore, studying the long-term stationary particle dist...

Hottovy, Scott; Wehr, Jan



3-D Simulations of Ergospheric Disk Driven Poynting Jets  

E-Print Network (OSTI)

This Letter reports on 3-dimensional simulations of Kerr black hole magnetospheres that obey the general relativistic equations of perfect magnetohydrodynamics (MHD). In particular, we study powerful Poynting flux dominated jets that are driven from dense gas in the equatorial plane in the ergosphere. The physics of which has been previously studied in the simplified limit of an ergopsheric disk. For high spin black holes, $a/M > 0.95$, the ergospheric disk is prominent in the 3-D simulations and is responsible for greatly enhanced Poynting flux emission. Any large scale poloidal magnetic flux that is trapped in the equatorial region leads to an enormous release of electromagnetic energy that dwarfs the jet energy produced by magnetic flux threading the event horizon. The implication is that magnetic flux threading the equatorial plane of the ergosphere is a likely prerequisite for the central engine of powerful FRII quasars.

Brian Punsly



IEMDC - In-Line Electric Motor Driven Compressor  

Science Conference Proceedings (OSTI)

This report covers the fifth quarter (01/01/04 to 03/31/04) of the In-Line Electric Motor Driven Compressor (IEMDC) project. Design efforts on the IEMDC continued with compressor efforts focused on performing aerodynamic analyses. These analyses were conducted using computational fluid dynamics. Compressor efforts also entailed developing mechanical designs of components through the use of solid models and working on project deliverables. Electric motor efforts focused on the design of the magnetic bearing system, motor pressure housing, and the motor-compressor interface. The mechanical evaluation of the main interface from both the perspective of the compressor manufacturer and electric motor manufacturer indicates that an acceptable design has been achieved. All mechanical and aerodynamic design efforts have resulted in considerable progress being made towards the completion of the compressor and electric motor design and towards the successful completion of the IEMDC unit.

Michael J. Crowley



Entropy production for mechanically or chemically driven biomolecules  

E-Print Network (OSTI)

Entropy production along a single stochastic trajectory of a biomolecule is discussed for two different sources of non-equilibrium. For a molecule manipulated mechanically by an AFM or an optical tweezer, entropy production (or annihilation) occurs in the molecular conformation proper or in the surrounding medium. Within a Langevin dynamics, a unique identification of these two contributions is possible. The total entropy change obeys an integral fluctuation theorem and a class of further exact relations, which we prove for arbitrarily coupled slow degrees of freedom including hydrodynamic interactions. These theoretical results can therefore also be applied to driven colloidal systems. For transitions between different internal conformations of a biomolecule involving unbalanced chemical reactions, we provide a thermodynamically consistent formulation and identify again the two sources of entropy production, which obey similar exact relations. We clarify the particular role degenerate states have in such a description.

Tim Schmiedl; Thomas Speck; Udo Seifert



Continuous measurement of a microwave-driven solid state qubit  

E-Print Network (OSTI)

We analyze the dynamics of a continuously observed, damped, microwave driven solid state charge qubit. The qubit consists of a single electron in a double well potential, coupled to an oscillating electric field, and which is continuously observed by a nearby point contact electrometer. The microwave field induces transitions between the qubit eigenstates, which have a profound effect on the detector output current. We show that useful information about the qubit dynamics, such as dephasing and relaxation rates, and the Rabi frequency, can be extracted from the DC detector conductance and the detector output noise power spectrum. We also demonstrate that these phenomena can be used for single shot electron \\emph{spin} readout, for spin based quantum information processing.

S. D. Barrett; T. M. Stace



Finite-Size Scaling in the Driven Lattice Gas  

E-Print Network (OSTI)

We present a Monte Carlo study of the high-temperature phase of the two-dimensional driven lattice gas at infinite driving field. We define a finite-volume correlation length, verify that this definition has a good infinite-volume limit independent of the lattice geometry, and study its finite-size-scaling behavior. The results for the correlation length are in good agreement with the predictions based on the field theory proposed by Janssen, Schmittmann, Leung, and Cardy. The theoretical predictions for the susceptibility and the magnetization are also well verified. We show that the transverse Binder parameter vanishes at the critical point in all dimensions $d\\ge 2$ and discuss how such result should be expected in the theory of Janssen et al. in spite of the existence of a dangerously irrelevant operator. Our results confirm the Gaussian nature of the transverse excitations.

Sergio Caracciolo; Andrea Gambassi; Massimiliano Gubinelli; Andrea Pelissetto



Separations technology development to support accelerator-driven transmutation concepts  

SciTech Connect

This is the final report of a one-year Laboratory-Directed Research and Development (LDRD) Project at the Los Alamos National Laboratory (LANL). This project investigated separations technology development needed for accelerator-driven transmutation technology (ADTT) concepts, particularly those associated with plutonium disposition (accelerator-based conversion, ABC) and high-level radioactive waste transmutation (accelerator transmutation of waste, ATW). Specific focus areas included separations needed for preparation of feeds to ABC and ATW systems, for example from spent reactor fuel sources, those required within an ABC/ATW system for material recycle and recovery of key long-lived radionuclides for further transmutation, and those required for reuse and cleanup of molten fluoride salts. The project also featured beginning experimental development in areas associated with a small molten-salt test loop and exploratory centrifugal separations systems.

Venneri, F.; Arthur, E.; Bowman, C. [and others



A VO-driven Astronomical Data Grid in China  

E-Print Network (OSTI)

With the implementation of many ambitious observation projects, including LAMOST, FAST, and Antarctic observatory at Doom A, observational astronomy in China is stepping into a brand new era with emerging data avalanche. In the era of e-Science, both these ambitious projects and traditional astronomy research need much powerful data management, sharing and interoperability. Based on data-grid concept, taking advantages of IVOA interoperability technologies, China-VO is developing a VO-driven astronomical data grid environment to enable multi-wavelength science and large database science. In the paper, latest progress and data flow of the LAMOST, architecture of the data grid, and its supports to the VO are discussed.

Cui, Chenzhou; Yang, Yang; Zhao, Yongheng


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Development of a high-explosive driven crowbar switch  

DOE Green Energy (OSTI)

A compact explosively-driven, metal-to-metal contact, solid dielectric switch was developed for use as a low-resistance, <10- mu OMEGA , low- inductance, < 10-nH, crowbar switch. A l00-milligram high-explosive charge is used to extrude a 0.090-in. plate through 0.040-in. polyethylene and achieve a hard current contact with a 0.625-in.-diameter die plate. The closure time, from the signal, which initiates the charge, to beginning of current rise in the switch, is 11.0 mu sec plus or minus 0.3 mu sec. In crowbar application the switch has carried 180 to 330 kA, which decays with a 1/e time of approximately 1.2 msec. (auth)

Dike, R.S.; Kewish, R.W. Jr.



Compact Couplers for Photonic Crystal Laser-Driven Accelerator Structures  

SciTech Connect

Photonic crystal waveguides are promising candidates for laser-driven accelerator structures because of their ability to confine a speed-of-light mode in an all-dielectric structure. Because of the difference between the group velocity of the waveguide mode and the particle bunch velocity, fields must be coupled into the accelerating waveguide at frequent intervals. Therefore efficient, compact couplers are critical to overall accelerator efficiency. We present designs and simulations of high-efficiency coupling to the accelerating mode in a three-dimensional photonic crystal waveguide from a waveguide adjoining it at 90{sup o}. We discuss details of the computation and the resulting transmission. We include some background on the accelerator structure and photonic crystal-based optical acceleration in general.

Cowan, Benjamin; /Tech-X, Boulder; Lin, M.C.; /Tech-X, Boulder; Schwartz, Brian; /Tech-X, Boulder; Byer, Robert; /Stanford U., Phys. Dept.; McGuinness, Christopher; /Stanford U., Phys. Dept.; Colby, Eric; /SLAC; England, Robert; /SLAC; Noble, Robert; /SLAC; Spencer, James; /SLAC



Laser-driven Sisyphus cooling in an optical dipole trap  

Science Conference Proceedings (OSTI)

We propose a laser-driven Sisyphus-cooling scheme for atoms confined in a far-off resonance optical dipole trap. Utilizing the differential trap-induced ac Stark shift, two electronic levels of the atom are resonantly coupled by a cooling laser preferentially near the trap bottom. After absorption of a cooling photon, the atom loses energy by climbing the steeper potential, and then spontaneously decays preferentially away from the trap bottom. The proposed method is particularly suited to cooling alkaline-earth-metal-like atoms where two-level systems with narrow electronic transitions are present. Numerical simulations for the cases of {sup 88}Sr and {sup 174}Yb demonstrate the expected recoil and Doppler temperature limits. The method requires a relatively small number of scattered photons and can potentially lead to phase-space densities approaching quantum degeneracy in subsecond time scales.

Ivanov, Vladyslav V.; Gupta, Subhadeep [Physics Department, University of Wisconsin, Madison, Wisconsin 53706 (United States); Physics Department, University of Washington, Seattle, Washington 98195 (United States)



Distributed monitoring system for electric-motor-driven compressors  

SciTech Connect

Personnel in the Instrumentation and Controls Division at the Oak Ridge National Laboratory, in association with the United States Enrichment corporation (USEC), the Navy, and various Department of Energy sponsors, have been involved in the development and application of motor-current signature analysis (CSA) for several years. In that time CSA has proven to not only be useful for manually applied periodic monitoring of electrically driven equipment but it has also been demonstrated to be well suited for dedicated monitoring systems in industrial settings. Recent work has resulted in the development and installation of a system that can monitor up to 640 motor and compressor stages for various aerodynamic conditions in the gas compressors and electrical problems in the drive motors. This report describes a demonstration of that technology installed on 80 stages at each of the two USEC uranium enrichment plants.

Castleberry, K.N.




SciTech Connect

This annual report summarizes the activities of the Cornell Center for Pulsed-Power-Driven High-Energy-Density Plasma Studies, for the 12-month period October 1, 2005-September 30, 2006. This period corresponds to the first year of the two-year extension (awarded in October, 2005) to the original 3-year NNSA/DOE Cooperative Agreement with Cornell, DE-FC03-02NA00057. As such, the period covered in this report also corresponds to the fourth year of the (now) 5-year term of the Cooperative Agreement. The participants, in addition to Cornell University, include Imperial College, London (IC), the University of Nevada, Reno (UNR), the University of Rochester (UR), the Weizmann Institute of Science (WSI), and the P.N. Lebedev Physical Institute (LPI), Moscow. A listing of all faculty, technical staff and students, both graduate and undergraduate, who participated in Center research activities during the year in question is given in Appendix A.

Professor Bruce R. Kusse; Professor David A. Hammer



Retail Product Prices Are Driven By Crude Oil  

Gasoline and Diesel Fuel Update (EIA)

6 6 Notes: Retail prices for both gasoline and diesel fuel have risen strongly over the past two years, driven mostly by the rise in world crude oil prices to their highest levels since the Persian Gulf War. Of course, there are a number of other significant factors that impact retail product prices, the most important of which is the supply/demand balance for each product. But the point of this slide is to show that generally speaking, as world crude oil prices rise and fall, so do retail product prices. Because of the critical importance of crude oil price levels, my presentation today will look first at global oil supply and demand, and then at the factors that differentiate the markets for each product. I'll also talk briefly about natural gas, and the impact that gas


Data-Driven Mailing Helps Heat Up Untapped Seattle Market  

NLE Websites -- All DOE Office Websites (Extended Search)

Focus Series Focus Series Data-Driven Mailing Helps Heat Up Untapped Seattle Market Recognizing owners of oil-heated homes in Seattle, Washington, as a long-untapped market, Community Power Works engaged them through a direct mail campaign in April 2012. Not only did the mailing generate hundreds of sign-ups, but the number of oil-heated homes initiating upgrades increased to 50% in the six months after the mailing. In the interview below, Community Power Works Project Manager Ruth Bell and Program/System Analyst Vince Schueler of the Washington State University (WSU) Energy Program 1 provide a summary of the successes and lessons learned. Following the interview is an example letter used by Community Power Works in its direct mail outreach. Q. Why focus on oil-heated homes in Seattle?


(Whose) value-sensitive design: a study of long- distance relationships in an Arabic cultural context  

Science Conference Proceedings (OSTI)

This paper describes a qualitative study of how 11 Arab individuals use technology in the context of their long-distance romantic relationships. Our participants' communication practices bear similarities to previous findings on the mediation of intimacy ... Keywords: communication, culture, feminism, intimacy, values

Tamara Alsheikh; Jennifer A. Rode; SiÔn E. Lindley



The proximity factor: impact of distance on co-located collaboration  

Science Conference Proceedings (OSTI)

Groups collaborating around a large wall display can do so in a variety of arrangements, positioning themselves at different distances from the display and from each other. We examined the impact of proximity on the effectiveness and enjoyment of co-located ... Keywords: co-located collaboration, direct input, indirect input, large displays, proximity, single-display groupware (SDG), wall display

Kirstie Hawkey; Melanie Kellar; Derek Reilly; Tara Whalen; Kori M. Inkpen



3-D chamfer distances and norms in anisotropic grids Celine Fouarda,b,c,*, Gregoire Malandaina  

E-Print Network (OSTI)

U N C O R R EC TED PR O O F 3-D chamfer distances and norms in anisotropic grids Ce┬┤line Fouarda the center lines of the vessels and to compute their radii [5]. Clearly this volume of data cannot will approximately double the volume of input data (here from 450 to 900 Mb). While modern computer disk capacity

Ayache, Nicholas


Trace distance and linear entropy of qubit states: Role of initial qubit-environment correlations  

E-Print Network (OSTI)

The role of initial qubit-environment correlations on trace distance between two qubit states is studied in the framework of non--Markovian pure dephasing. The growth of mixedness of reduced state quantified by linear entropy is shown to be related to the degree of initial qubit--environment correlations.

Jerzy Dajka; Jerzy Luczka



An accelerated zone 2 trip algorithm for non-pilot distance relays  

Science Conference Proceedings (OSTI)

This paper presents an algorithm able to accelerate the zone 2 trip of non-pilot distance relays by detecting remote breaker operation following a zone 2 fault. It is based on monitoring changes in proposed composite signals. The performance of the proposed ... Keywords: accelerated trip (AT), real time digital simulator (RTDS), sequential accelerated trip (SAT), total fault clearing time (TFCT)

German Rosas Ortiz; Tarlochan S. Sidhu



Distance Dependence of Electron Transfer in DNA: The Role of the Reorganization Energy and Free Energy  

E-Print Network (OSTI)

Distance Dependence of Electron Transfer in DNA: The Role of the Reorganization Energy and Free of the solvent reorganization energy and free energy in the heterogeneous DNA environment. DNA is modeled represents water. Model calculations show the importance of including the reorganization energy and the free

Fayer, Michael D.


Reducing the Plagiarism Detection Search Space on the Basis of the Kullback-Leibler Distance  

E-Print Network (OSTI)

Reducing the Plagiarism Detection Search Space on the Basis of the Kullback-Leibler Distance, jbenedi}@dsic.upv.es http://www.dsic.upv.es/grupos/nle/ Abstract. Automatic plagiarism detection the plagiarised fragments to their potential source. Publications on this task often assume that the search space

Rosso, Paolo


A sequential minimal optimization algorithm for the all-distances support vector machine  

Science Conference Proceedings (OSTI)

The All-Distances SVM is a single-objective light extension of the binary Á-SVM for multi-category classification that is competitive against multi-objective SVMs, such as One-against-the-Rest SVMs and One-against-One SVMs. Although the model takes ... Keywords: kernel machines, multi-category classification, sequential minimal optimization, support vector machines

Diego Candel; Ricardo Đanculef; Carlos Concha; HÚctor Allende



Magnetic hose: Routing and Long-distance Transportation of Magnetic Fields  

E-Print Network (OSTI)

Magnetism is a fundamental interaction shaping our physical world, at the basis of technologies such as magnetic recording or energy generation. Unlike electromagnetic waves, which can be routed and transmitted with waveguides to long distances, magnetic fields rapidly decay with distance. Here we show the concept, design, and properties of a magnetic hose which enables to transfer the static magnetic field generated by a source to an arbitrary distance, and along any given trajectory. Using transformation optics, adapted to static magnetic fields, we first introduce an ideal scheme displaying the basic mechanism behind our proposal and allowing for a perfect transfer. Then we present a simplified approach, which allows to construct a magnetic hose using two available materials: a superconducting shell with a ferromagnetic core. Such a magnetic hose can guide and transport magnetic fields to large distances, unlike ferromagnets- the conventional existing method-, for which transmitted fields decay quickly with the ferromagnetic length. As a proof of pinciple experiment, we demonstrate the field transmission through superconducting-ferromagnetic hoses with lengths up to 140mm, which improve the transmission of an analogous ferromagnet by a 400% factor. Magnetic hoses may provide new solutions in enhancing spin couplings in all-magnetic logic schemes and in harnessing quantum systems by addressable magnetic fields, in the context of quantum information processing.

Carles Navau; Jordi Prat-Camps; Oriol Romero-Isart; J. Ignacio Cirac; Alvaro Sanchez



Effectiveness of a Virtual Laboratory as a preparatory resource for Distance Education chemistry students  

Science Conference Proceedings (OSTI)

Many have argued that interactive 3D virtual environments have great educational potential due to their ability to engage learners in the exploration, construction and manipulation of virtual objects, structures and metaphorical representations of ideas. ... Keywords: Chemistry education, Distance Education, Interactive learning environments, Post-secondary education, Simulations, Virtual reality

Barney Dalgarno; Andrea G. Bishop; William Adlong; Danny R. Bedgood, Jr.



Geomagnetic Precursor Z Component Diurnal Variation Phase Anomaly Recognition based on the Pattern Distance  

Science Conference Proceedings (OSTI)

Geomagnetic precursor is one of many earthquake precursors, which have better effects on earthquake prediction, while the diurnal variation anomaly of geomagnetic precursor Z component is an important one in short-impending anomalies. Basing on the pattern ... Keywords: Geomagnetic Precursor, Diurnal Variation, Pattern Distance, Anomaly Recognition

Shaochun Wu; Tongyu Yuan; Yan Tang; Bofeng Zhang; Daming Wei



Improved multicriteria spanners for Ad-Hoc networks under energy and distance metrics  

Science Conference Proceedings (OSTI)

We study the problem of spanner construction in wireless ad-hoc networks through power assignments under two spanner modelsŚdistance and energy. In particular, we are interested in asymmetric power assignments so that the induced communication ... Keywords: Geometric and energy spanners, approximation algorithms

Hanan Shpungin, Michael Segal



Combining lexical resources with tree edit distance for recognizing textual entailment  

Science Conference Proceedings (OSTI)

This paper addresses Textual Entailment (i.e. recognizing that the meaning of a text entails the meaning of another text) using a Tree Edit Distance algorithm between the syntactic trees of the two texts. A key aspect of the approach is the estimation ...

Milen Kouylekov; Bernardo Magnini


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Final Technical Report: Discovering the Nature of Dark Energy: Towards Better Distances from Type Ia Supernovae  

Science Conference Proceedings (OSTI)

The final technical report from the project "Discovering the Nature of Dark Energy: Towards Better Distances from Type Ia Supernovae" led at Rutgers the State University of New Jersey by Prof. Saurabh W. Jha is presented, including all publications resulting from this award.

Saurabh W. Jha



Geomagnetic imprinting: A unifying hypothesis of long-distance natal homing in salmon and sea turtles  

E-Print Network (OSTI)

Geomagnetic imprinting: A unifying hypothesis of long-distance natal homing in salmon and sea geomagnetic polarity reversals, may affect ecological processes by disrupting natal homing, resulting the globe before reentering the planet in the northern hemisphere. Several geomagnetic elements vary pre

Lohmann, Kenneth J.


A model-driven ontology approach for manufacturing system interoperability and knowledge sharing  

Science Conference Proceedings (OSTI)

The requirements for the interoperability of semantics and knowledge have become increasingly important in Product Lifecycle Management (PLM), in the drive towards knowledge-driven decision support in the manufacturing industry. This article presents ... Keywords: Knowledge sharing, Model Driven Architecture, Ontologies, Product Lifecycle Management

Nitishal Chungoora; Robert I. Young; George Gunendran; Claire Palmer; Zahid Usman; Najam A. Anjum; Anne-FranšOise Cutting-Decelle; Jennifer A. Harding; Keith Case



A discontinuous Galerkin method for gravity-driven viscous fingering instabilities in porous media  

Science Conference Proceedings (OSTI)

We present a new approach to the simulation of gravity-driven viscous fingering instabilities in porous media flow. These instabilities play a very important role during carbon sequestration processes in brine aquifers. Our approach is based on a nonlinear ... Keywords: Discontinuous Galerkin method, Gravity-driven flows, Porous media flows, Viscous fingering

G. Scovazzi; A. Gerstenberger; S. S. Collis



A Complexity O(1) priority queue for event driven molecular dynamics simulations  

Science Conference Proceedings (OSTI)

We propose and implement a priority queue suitable for use in event driven molecular dynamics simulations. All operations on the queue take on average O(1) time per collision. In comparison, previously studied queues for event driven molecular dynamics ... Keywords: Molecular dynamics, Priority queue

Gerald Paul



Assisting decision making in the event-driven enterprise using wavelets  

Science Conference Proceedings (OSTI)

This paper discusses issues related to data-driven decision support systems in event-driven enterprises and proposes Discrete Wavelet Transformation (DWT) as a method to improve these systems. DWT is proposed as a method of data reduction that reduces ... Keywords: Decision analysis, Decision support systems, Visualization, Wavelets

Stephen Russell; Aryya Gangopadhyay; Victoria Yoon



A multi-sensor based occupancy estimation model for supporting demand driven HVAC operations  

Science Conference Proceedings (OSTI)

Heating, ventilation, and air conditioning (HVAC) is a major energy consumer in buildings, and implementing demand driven HVAC operations is a way to reduce HVAC related energy consumption. This relies on the availability of occupancy information, which ... Keywords: HVAC, building energy consumption, demand driven, non-intrusive sensor, occupancy estimation

Zheng Yang; Nan Li; Burcin Becerik-Gerber; Michael Orosz



Pol: specification-driven synthesis of architectural code frameworks for platform-based applications  

Science Conference Proceedings (OSTI)

Developing applications that use complex platforms for functionalities such as authentication and messaging is hard. Model-driven engineering promises to help, but transformation systems are themselves hard to produce. We contribute a new approach ... Keywords: alloy, architecture, model-driven, platform, synthesis

Hamid Bagheri; Kevin Sullivan



Driver or Passenger? An Analysis of Citizen-Driven eGovernment  

Science Conference Proceedings (OSTI)

eGovernment is often put forward as a transformation supporting empowerment and democracy, building on principles such as `citizen-driven' and `citizen-centered' development. In addition it is often symbolized by a technology-laden and romantic progressivism. ... Keywords: accountability, citizen-driven eGovernment, relationistic perspective

Katarina Lindblad-Gidlund



Ad Hoc Distributed Dynamic Data-Driven Simulations of Surface Transportation Systems  

Science Conference Proceedings (OSTI)

An ad hoc distributed dynamic data-driven simulation is a collection of autonomous online simulations brought together to model an operational system. They offer the potential of increased accuracy, responsiveness, and robustness compared to centralized ... Keywords: ad hoc distributed simulation, dynamic data-driven application system, microscopic simulation model, online simulation

Michael Hunter; Hoe Kyoung Kim; Wonho Suh; Richard Fujimoto; Jason Sirichoke; Mahesh Palekar



ISABELA-QA: query-driven analytics with ISABELA-compressed extreme-scale scientific data  

Science Conference Proceedings (OSTI)

Efficient analytics of scientific data from extreme-scale simulations is quickly becoming a top-notch priority. The increasing simulation output data sizes demand for a paradigm shift in how analytics is conducted. In this paper, we argue that query-driven ... Keywords: compression, data reduction, data-intensive computing, high performance applications, query-driven analytics

Sriram Lakshminarasimhan; John Jenkins; Isha Arkatkar; Zhenhuan Gong; Hemanth Kolla; Seung-Hoe Ku; Stephane Ethier; Jackie Chen; C. S. Chang; Scott Klasky; Robert Latham; Robert Ross; Nagiza F. Samatova



Data-driven dynamic emulation modelling for the optimal management of environmental systems  

Science Conference Proceedings (OSTI)

The optimal management of large environmental systems is often limited by the high computational burden associated to the process-based models commonly adopted to describe such systems. In this paper we propose a novel data-driven Dynamic Emulation Modelling ... Keywords: Data-driven models, Emulation modelling, Process-based models, Variable selection, Water resources planning and management

A. Castelletti; S. Galelli; M. Restelli; R. Soncini-Sessa



iManage: Policy-Driven Self-management for Enterprise-Scale Systems  

E-Print Network (OSTI)

iManage: Policy-Driven Self-management for Enterprise-Scale Systems Vibhore Kumar, Brian F. Cooper of an adminis- trator's needs. In our iManage system we have developed a policy-driven system modeling framework that aims to bridge the gap between manageable compo- nents and manageable systems. In particular, iManage

Eisenhauer, Greg S.


The Application of Diode-Clamped Cascaded Inverter in the Direct-Driven Wind Power System  

Science Conference Proceedings (OSTI)

Power inverter is widely used in direct-driven variable speed constant frequency (VSVF) wind power system. With the level of wind power jumping from the kilowatt to megawatt, topologies and control of inverter have a corresponding change. Considering ... Keywords: direct-driven wind power, multi-level inverter, diode-clamped cascaded inverter, PD-SPWM and CPS-SPWM

Xianglian Xu; Pingting Xu; Zilin Tang; Gang Tang; Xiaole Ye



A Performance Analysis of Transposition-Table-Driven Work Scheduling in Distributed Search  

Science Conference Proceedings (OSTI)

This paper discusses a new work-scheduling algorithm for parallel search of single-agent state spaces, called Transposition-Table-Driven Work Scheduling, that places the transposition table at the heart of the parallel work scheduling. The scheme results ... Keywords: Distributed search, single-agent search, work pushing, Transposition-Table-Driven Work Scheduling (TDS), IDA*

John W. Romein; Henri E. Bal; Jonathan Schaeffer; Aske Plaat



Performance driven design and simulation interfaces: a multi-objective parametric optimization process  

Science Conference Proceedings (OSTI)

Despite the continuous development and integration of simulation interfacing tools in current architectural research, the availability and operability of off-the-shelf tools has still not met the timeframes and performance requirements of current architectural ... Keywords: environmentally driven fašade, integrated design strategy, multi-objective optimization, parametric modeling, performance driven design, simulation interfacing tool

Angelos Chronis; Martha Tsigkari; Evangelos Giouvanos; Francis Aish; Anis Abou Zaki



Data-driven user simulation for automated evaluation of spoken dialog systems  

Science Conference Proceedings (OSTI)

This paper proposes a novel integrated dialog simulation technique for evaluating spoken dialog systems. A data-driven user simulation technique for simulating user intention and utterance is introduced. A novel user intention modeling and generating ... Keywords: Data-driven, Dialog simulation, Dialog system, Evaluation, Spoken dialog system, User simulation

Sangkeun Jung; Cheongjae Lee; Kyungduk Kim; Minwoo Jeong; Gary Geunbae Lee



How much are Chevrolet Volts in The EV Project driven in EV Mode?  

Science Conference Proceedings (OSTI)

This report summarizes key conclusions from analysis of data collected from Chevrolet Volts participating in The EV Project. Topics include how many miles are driven in EV mode, how far vehicles are driven between charging events, and how much energy is charged from the electric grid per charging event.

John Smart



Model-Driven Engineering of Complex Embedded Systems: Concepts and Tools  

E-Print Network (OSTI)

Model-Driven Engineering of Complex Embedded Systems: Concepts and Tools Fl┬┤avio Rech Wagner- neering methods till Model-Driven Engineering (MDE). Then, it introduces the basic principles of MDE Architecture), Software Factories, and MIC (Model Integrated Computing), are explained, and we provide a short

Wagner, Flávio Rech


The Effects of Thermohaline Circulation on Wind-Driven Circulation in the South China Sea  

Science Conference Proceedings (OSTI)

The dynamic influence of thermohaline circulation on wind-driven circulation in the South China Sea (SCS) is studied using a simple reduced gravity model, in which the upwelling driven by mixing in the abyssal ocean is treated in terms of an ...

Guihua Wang; Rui Xin Huang; Jilan Su; Dake Chen


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Technology-Based Tools That Facilitate Data-Driven Decision Making  

Science Conference Proceedings (OSTI)

In this paper, we describe how technology-based tools support data-driven decision making in US schools. We examine how three different applications used in six different school districts either impede or facilitate decision making by educators across ... Keywords: Data-Driven Decision Making, Technology Applications, Theoretical Model

Ellen B. Mandinach; Margaret Honey; Daniel Light; Juliette Heinze; Luz Rivas



Demo Abstract: Toward Data-driven Demand-Response Optimization in a Campus Microgrid  

E-Print Network (OSTI)

Demo Abstract: Toward Data-driven Demand-Response Optimization in a Campus Microgrid Yogesh Simmhan-driven demand response optimization (DR) in the USC campus microgrid, as part of the Los An- geles Smart Grid consumer in Los Angeles, is serving as a campus microgrid testbed and ex- ploring informatics

Prasanna, Viktor K.


Control Challenges of Fuel Cell-Driven Distributed Valery Knyazkin, Lennart Soder Claudio Canizares  

E-Print Network (OSTI)

%) can be achieved if the hot exhaust from the fuel cell is used to power a gas turbine [8]. It is argued1 Control Challenges of Fuel Cell-Driven Distributed Generation Valery Knyazkin, Lennart S-- This paper discusses the load following capability of fuel cell-driven power plants. A linear model

Ca├▒izares, Claudio A.



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Constructive episodic simulation: temporal distance and detail of past and future events modulate hippocampal engagement  

E-Print Network (OSTI)

ABSTRACT: Behavioral, lesion and neuroimaging evidence show striking commonalities between remembering past events and imagining future events. In a recent event-related fMRI study, we instructed participants to construct a past or future event in response to a cue. Once an event was in mind, participants made a button press, then generated details (elaboration) and rated them. The elaboration of past and future events recruited a common neural network. However, regions within this network may respond differentially to event characteristics, such as the amount of detail generated and temporal distance, depending on whether the event is in the past or future. To investigate this further, we conducted parametric modulation analyses, with temporal distance and detail as covariates, and focused on the medial temporal lobes and frontopolar cortex. The analysis of detail (independent of temporal distance) showed that the left posterior hippocampus was responsive to the amount of detail comprising both past and future events. In contrast, the left anterior hippocampus responded differentially to the amount of detail comprising future events, possibly reflecting the recombination of details into a novel future event. The analysis of temporal distance revealed that the increasing recency of past events correlated with activity in the right parahippocampus gyrus (Brodmann area (BA) 35/36), while activity in the bilateral hippocampus was significantly correlated with the increasing remoteness of future events. We propose that the hippocampal response to the distance of future events reflects the increasing disparateness of details likely included in remote future events, and the intensive relational processing required for integrating such details into a coherent episodic simulation of the future. These findings provide further support for the constructive episodic simulation hypothesis (Schacter and Addis (2007) Philos Trans R Soc Lond B Biol Sci 362:773ľ786) and highlight the involvement of the hippocampus in relational processing during elaboration of future events. VC 2007 Wiley-Liss, Inc. KEY WORDS: episodic; autobiographical memory; future; fMRI; parametric modulation

Donna Rose Addis; Daniel L. Schacter



Estimating Policy-Driven Greenhouse Gas Emissions Trajectories in  

NLE Websites -- All DOE Office Websites (Extended Search)

Estimating Policy-Driven Greenhouse Gas Emissions Trajectories in Estimating Policy-Driven Greenhouse Gas Emissions Trajectories in California: The California Greenhouse Gas Inventory Spreadsheet (GHGIS) Model Title Estimating Policy-Driven Greenhouse Gas Emissions Trajectories in California: The California Greenhouse Gas Inventory Spreadsheet (GHGIS) Model Publication Type Report LBNL Report Number LBNL-6541E Year of Publication 2013 Authors Greenblatt, J. Date Published 10/2013 Publisher Lawrence Berkeley National Laboratory City Berkeley Abstract A California Greenhouse Gas Inventory Spreadsheet (GHGIS) model was developed to explore the impact of combinations of state policies on state greenhouse gas (GHG) and regional criteria pollutant emissions. The model included representations of all GHGemitting sectors of the California economy (including those outside the energy sector, such as high global warming potential gases, waste treatment, agriculture and forestry) in varying degrees of detail, and was carefully calibrated using available data and projections from multiple state agencies and other sources. Starting from basic drivers such as population, numbers of households, gross state product, numbers of vehicles, etc., the model calculated energy demands by type (various types of liquid and gaseous hydrocarbon fuels, electricity and hydrogen), and finally calculated emissions of GHGs and three criteria pollutants: reactive organic gases (ROG), nitrogen oxides (NOx), and fine (2.5 ╬╝m) particulate matter (PM2.5). Calculations were generally statewide, but in some sectors, criteria pollutants were also calculated for two regional air basins: the South Coast Air Basin (SCAB) and the San Joaquin Valley (SJV). Three scenarios were developed that attempt to model: (1) all committed policies, (2) additional, uncommitted policy targets and (3) potential technology and market futures. Each scenario received extensive input from state energy planning agencies, in particular the California Air Resources Board. Results indicate that all three scenarios are able to meet the 2020 statewide GHG targets, and by 2030, statewide GHG emissions range from between 208 and 396 MtCO2/yr. However, none of the scenarios are able to meet the 2050 GHG target of 85 MtCO2/yr, with emissions ranging from 188 to 444 MtCO2/yr, so additional policies will need to be developed for California to meet this stringent future target. A full sensitivity study of major scenario assumptions was also performed. In terms of criteria pollutants, targets were less well-defined, but while all three scenarios were able to make significant reductions in ROG, NOx and PM2.5 both statewide and in the two regional air basins, they may nonetheless fall short of what will be required by future federal standards. Specifically, in Scenario 1, regional NOx emissions are approximately three times the estimated targets for both 2023 and 2032, and in Scenarios 2 and 3, NOx emissions are approximately twice the estimated targets. Further work is required in this area, including detailed regional air quality modeling, in order to determine likely pathways for attaining these stringent targets.


Study of a multi-beam accelerator driven thorium reactor  

DOE Green Energy (OSTI)

The primary advantages that accelerator driven systems have over critical reactors are: (1) Greater flexibility regarding the composition and placement of fissile, fertile, or fission product waste within the blanket surrounding the target, and (2) Potentially enhanced safety brought about by operating at a sufficiently low value of the multiplication factor to preclude reactivity induced events. The control of the power production can be achieved by vary the accelerator beam current. Furthermore, once the beam is shut off the system shuts down. The primary difference between the operation of an accelerator driven system and a critical system is the issue of beam interruptions of the accelerator. These beam interruptions impose thermo-mechanical loads on the fuel and mechanical components not found in critical systems. Studies have been performed to estimate an acceptable number of trips, and the value is significantly less stringent than had been previously estimated. The number of acceptable beam interruptions is a function of the length of the interruption and the mission of the system. Thus, for demonstration type systems and interruption durations of 1sec < t < 5mins, and t > 5mins 2500/yr and 50/yr are deemed acceptable. However, for industrial scale power generation without energy storage type systems and interruption durations of t < 1sec., 1sec < t < 10secs., 10secs < t < 5mins, and t > 5mins, the acceptable number of interruptions are 25000, 2500, 250, and 3 respectively. However, it has also been concluded that further development is required to reduce the number of trips. It is with this in mind that the following study was undertaken. The primary focus of this study will be the merit of a multi-beam target system, which allows for multiple spallation sources within the target/blanket assembly. In this manner it is possible to ameliorate the effects of sudden accelerator beam interruption on the surrounding reactor, since the remaining beams will still be supplying source neutrons. The proton beam will be assumed to have an energy of 1 GeV, and the target material will be natural lead, which will also be the coolant for the reactor assembly. Three proton beam arrangements will be considered, first a single beam (the traditional arrangement) with an entry at the assembly center, two more options will consist of three and six entry locations. The reactor fuel assembly parameters will be based on those of the S-PRISM fast reactor proposed by GE, and the fuel composition and type will be based on that proposed by Aker Solutions for use in their accelerator driven thorium reactor. The following table summarizes the parameters to be used in this study. The isotopic composition of the fertile material is 100% Th-232, and the plutonium isotopic distribution corresponds to that characteristic of the discharge from a typical LWR, following five years of decay. Thus, the isotopic distribution for the plutonium is; Pu-238 2.5%, Pu-239 53.3%, Pu-240 25.1%, Pu-241 11.8%, and Pu-242 7.3%.

Ludewig, H.; Aronson, A.



Experimental Study of Current-Driven Turbulence During Magnetic Reconnection  

SciTech Connect

CMPD Final Report Experimental Study of Current-Driven Turbulence During Magnetic Reconnection Miklos Porkolab, PI, Jan Egedal, co-PI, William Fox, graduate student. This is the final report for Grant DE-FC02-04ER54786, ├?┬ó├?┬?├?┬?MIT Participation in the Center for Multiscale Plasma Dynamics,├?┬ó├?┬?├?┬Ł which was active from 8/1/2004 to 7/31/2010. This Grant supported the thesis work of one MIT graduate student, William Fox, The thesis research consisted of an experimental study of the fluctuations arising during magnetic reconnection in plasmas on the Versatile Toroidal Facility (VTF) at MIT Plasma Science and Fusion Center (PSFC). The thesis was submitted and accepted by the MIT physics Department, ├?┬ó├?┬?├?┬?W. Fox, Experimental Study of Current-Driven Turbulence During Magnetic Reconnection, Ph.D. Thesis, MIT (2009)├?┬ó├?┬?├?┬Ł. In the VTF experiment reconnection and current-sheet formation is driven by quickly changing currents in a specially arranged set of internal conductors. Previous work on this device [Egedal, et al, PRL 98, 015003, (2007)] identified a ├?┬ó├?┬?├?┬?spontaneous├?┬ó├?┬?├?┬Ł reconnection regime. In this work fluctuations were studied using impedance-matched, high-bandwidth Langmuir probes. Strong, broadband fluctuations, with frequencies extending from near the lower-hybrid frequency [fLH = (fcefci)1/2] to the electron cyclotron frequency fce were found to arise during the reconnection events. Based on frequency and wavelength measurements, lower-hybrid waves and Trivelpiece-Gould waves were identified. The lower-hybrid waves are easiest to drive with strong perpendicular drifts or gradients which arise due to the reconnection events; an appealing possibility is strong temperature gradients. The Trivelpiece-Gould modes can result from kinetic, bump-on-tail instability of a runaway electron population energized by the reconnection events. We also observed that the turbulence is often spiky, consisting of discrete positive-potential spikes, which were identified as ├?┬ó├?┬?├?┬?electron phase-space holes,├?┬ó├?┬?├?┬Ł a class of nonlinear solitary wave known to evolve from a strong beam-on-tail instability. We established that fast electrons were produced by magnetic reconnection. Overall, these instabilities were found to be a consequence of reconnection, specifically the strong energization of electrons, leading to steep gradients in both coordinate- and velocity-space. Estimates (using quasi-linear theory) of the anomalous resistivity due to these modes did not appear large enough to substantially impact the reconnection process. Relevant publications: ├?┬ó├?┬?├?┬ó W. Fox, M. Porkolab, et al, Phys. Rev. Lett. 101, 255003 (2008). ├?┬ó├?┬?├?┬ó W. Fox, M. Porkolab, et al, Phys. Plasmas 17, 072303, (2010).

Miklos Porkolab; Jan Egedal-Pedersen; William Fox




Science Conference Proceedings (OSTI)

Non-ideal MHD effects play an important role in the gas dynamics in protoplanetary disks (PPDs). This paper addresses the influence of non-ideal MHD effects on the magnetorotational instability (MRI) and angular momentum transport in PPDs using the most up-to-date results from numerical simulations. We perform chemistry calculations using a complex reaction network with standard prescriptions for X-ray and cosmic-ray ionizations. We first show that whether or not grains are included, the recombination time is at least one order of magnitude less than the orbital time within five disk scale heights, justifying the validity of local ionization equilibrium and strong coupling limit in PPDs. The full conductivity tensor at different disk radii and heights is evaluated, with the MRI active region determined by requiring that (1) the Ohmic Elsasser number {Lambda} be greater than 1 and (2) the ratio of gas to magnetic pressure {beta} be greater than {beta}{sub min}(Am) as identified in the recent study by Bai and Stone, where Am is the Elsasser number for ambipolar diffusion. With full flexibility as to the magnetic field strength, we provide a general framework for estimating the MRI-driven accretion rate M-dot and the magnetic field strength in the MRI active layer. We find that the MRI active layer always exists at any disk radius as long as the magnetic field in PPDs is sufficiently weak. However, the optimistically predicted M-dot in the inner disk (r = 1-10 AU) appears insufficient to account for the observed range of accretion rates in PPDs (around 10{sup -8} M{sub sun} yr{sup -1}) even in the grain-free calculation, and the presence of solar abundance sub-micron grains further reduces M-dot by one to two orders of magnitude. Moreover, we find that the predicted M-dot increases with radius in the inner disk where accretion is layered, which would lead to runaway mass accumulation if disk accretion is solely driven by the MRI. Our results suggest that stronger sources of ionization and/or additional mechanisms such as magnetized wind are needed to explain the observed accretion rates in PPDs. In contrast, our predicted M-dot is on the order of 10{sup -9} M{sub sun} yr{sup -1} in the outer disk, consistent with the observed accretion rates in transitional disks.

Bai Xuening, E-mail: xbai@astro.princeton.edu [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 08544 (United States)



Evaluation of sight distance as a criterion for prioritizing rail-highway intersections in Texas  

E-Print Network (OSTI)

Priority or hazard indices are used by the states to rank their rail-highway intersections according to relative hazard to aid in locating crossings for treatment of conditions and/or improvements in warning devices. The Texas Priority Index has been effective over the years in identifying particularly hazardous rail-highway intersections based on high vehicle volumes, train volumes, and accident histories, and these crossings have been treated or improved. Many of the remaining crossings, however, are not well discriminated in terms of their need for improvement; many crossings have the same index number. The objective of this research was to evaluate sight distance as a criterion for prioritizing rail-highway intersections in Texas to help distinguish between the crossings with similar or identical priority index numbers. Accident and sight distance data were compiled and analyzed. A sight distance variable was incorporated into the current Texas Priority Index and evaluated for its effects on the overall ranking of the rail-highway intersections. A state hazard index was chosen from a state-of-the-practice review with which to compare the current and revised Texas Priority Indices. Finally, the effectiveness of each of the indices was predicted in terms of the distribution of priority index numbers and their ability to move the most potentially hazardous crossings up in the rankings. It was concluded from the accident analysis that sight distance contributed to more vehicle-train accidents than any other factor. Further, improvements to warning devices at passive crossings would effectively reduce the overall sight obstruction, reduce the number of train involved accidents, and thus, reduce the number of injuries and fatalities resulting from accidents at rail-highway intersections. It was concluded from the field data analysis that the Method 1 revised Texas Priority Index was the most effective index of the four priority indices evaluated in this thesis for ranking crossings in terms of exposure, accident history, sight distance, and protection type. The Method 1 revised index was effective at redistributing the individual index numbers in the rank and identifying crossings with restricted sight distance while conserving the significance of the exposure values.

Pecheux, Kelley Klaver



Direct match data flow memory for data driven computing  

DOE Patents (OSTI)

A data flow computer and method of computing is disclosed which utilizes a data driven processor node architecture. The apparatus in a preferred embodiment includes a plurality of First-In-First-Out (FIFO) registers, a plurality of related data flow memories, and a processor. The processor makes the necessary calculations and includes a control unit to generate signals to enable the appropriate FIFO register receiving the result. In a particular embodiment, there are three FIFO registers per node: an input FIFO register to receive input information form an outside source and provide it to the data flow memories; an output FIFO register to provide output information from the processor to an outside recipient; and an internal FIFO register to provide information from the processor back to the data flow memories. The data flow memories are comprised of four commonly addressed memories. A parameter memory holds the A and B parameters used in the calculations; an opcode memory holds the instruction; a target memory holds the output address; and a tag memory contains status bits for each parameter. One status bit indicates whether the corresponding parameter is in the parameter memory and one status bit to indicate whether the stored information in the corresponding data parameter is to be reused. The tag memory outputs a "fire" signal (signal R VALID) when all of the necessary information has been stored in the data flow memories, and thus when the instruction is ready to be fired to the processor.

Davidson, George S. (8516 San Francisco NE., Albuquerque, NM 87109); Grafe, Victor Gerald (1909 Saturn Ct. NE., Albuquerque, NM 87112)



Pulsed power driven Magneto-Rayleigh-Taylor experiments.  

SciTech Connect

Numerical simulations indicate that significant fusion yields (>100 kJ) may be obtained by pulsed-power-driven implosions of cylindrical metal liners onto magnetized and preheated deuterium-tritium fuel. The primary physics risk to this approach is the Magneto-Rayleigh-Taylor (MRT) instability, which operates during both the acceleration and deceleration phase of the liner implosion. We have designed and performed some experiments to study the MRT during the acceleration phase, where the light fluid is purely magnetic. Results from our first series of experiments and plans for future experiments will be presented. According to simulations, an initial axial magnetic field of 10 T is compressed to >100 MG within the liner during the implosion. The magnetic pressure becomes comparable to the plasma pressure during deceleration, which could significantly affect the growth of the MRT instability at the fuel/liner interface. The MRT instability is also important in some astronomical objects such as the Crab Nebula (NGC1962). In particular, the morphological structure of the observed filaments may be determined by the ratio of the magnetic to material pressure and alignment of the magnetic field with the direction of acceleration [Hester, ApJ, 456, 225 1996]. Potential experiments to study this MRT behavior using the Z facility will be presented.

Sefkow, Adam B.; Peterson, Kyle J.; Rovang, Dean Curtis; Slutz, Stephen A.; Cuneo, Michael Edward; Vesey, Roger Alan; Herrmann, Mark C.; Sinars, Daniel Brian



Electro-osmotically driven liquid delivery method and apparatus  

DOE Patents (OSTI)

Method and apparatus are disclosed for controlling precisely the composition and delivery of liquid at sub-{micro}L/min flow rate. One embodiment of such a delivery system is an electro-osmotically driven gradient flow delivery system that generates dynamic gradient flows with sub-{micro}L/min flow rates by merging a plurality of electro-osmotic flows. These flows are delivered by a plurality of delivery arms attached to a mixing connector, where they mix and then flow into a receiving means, preferably a column. Each inlet of the plurality of delivery arms is placed in a corresponding solution reservoir. A plurality of independent programmable high-voltage power supplies is used to apply a voltage program to each of the plurality of solution reservoirs to regulate the electro-osmotic flow in each delivery arm. The electro-osmotic flow rates in the delivery arms are changed with time according to each voltage program to deliver the required gradient profile to the column. 4 figs.

Rakestraw, D.J.; Anex, D.S.; Yan, C.; Dadoo, R.; Zare, R.N.



Thermophoresis of Brownian particles driven by coloured noise  

E-Print Network (OSTI)

The Brownian motion of microscopic particles is driven by the collisions with the molecules of the surrounding fluid. The noise associated with these collisions is not white, but coloured due, e.g., to the presence of hydrodynamic memory. The noise characteristic time scale is typically of the same order as the time over which the particle's kinetic energy is lost due to friction (inertial time scale). We demonstrate theoretically that, in the presence of a temperature gradient, the interplay between these two characteristic time scales can have measurable consequences on the particle long-time behaviour. Using homogenization theory, we analyse the infinitesimal generator of the stochastic differential equation describing the system in the limit where the two characteristic times are taken to zero; from this generator, we derive the thermophoretic transport coefficient, which, we find, can vary in both magnitude and sign, as observed in experiments. Furthermore, studying the long-term stationary particle distribution, we show that particles can accumulate towards the colder (positive thermophoresis) or the warmer (negative thermophoresis) regions depending on the dependence of their physical parameters and, in particular, their mobility on the temperature.

Scott Hottovy; Giovanni Volpe; Jan Wehr




SciTech Connect

We discuss the effect of chemical separation as matter freezes at the base of the ocean of an accreting neutron star, and argue that the retention of light elements in the liquid acts as a source of buoyancy that drives a slow but continual mixing of the ocean, enriching it substantially in light elements, and leading to a relatively uniform composition with depth. We first consider the timescales associated with different processes that can redistribute elements in the ocean, including convection, sedimentation, crystallization, and diffusion. We then calculate the steady-state structure of the ocean of a neutron star for an illustrative model in which the accreted hydrogen and helium burn to produce a mixture of O and Se. Even though the H/He burning produces only 2% oxygen by mass, the steady-state ocean has an oxygen abundance more than 10 times larger, almost 40% by mass. Furthermore, we show that the convective motions transport heat inward, with a flux of {approx}0.2 MeV nucleon{sup -1} for an O-Se ocean, heating the ocean and steepening the outward temperature gradient. The enrichment of light elements and heating of the ocean due to compositionally driven convection likely have important implications for carbon ignition models of superbursts.

Medin, Zach; Cumming, Andrew, E-mail: zmedin@physics.mcgill.ca, E-mail: cumming@physics.mcgill.ca [Department of Physics, McGill University, 3600 rue University, Montreal, QC H3A 2T8 (Canada)



Disposition of nuclear waste using subcritical accelerator-driven systems  

Science Conference Proceedings (OSTI)

Spent fuel from nuclear power plants contains large quantities of Pu, other actinides, and fission products (FP). This creates challenges for permanent disposal because of the long half-lives of some isotopes and the potential for diversion of the fissile material. Two issues of concern for the US repository concept are: (1) long-term radiological risk peaking tens-of-thousands of years in the future; and (2) short-term thermal loading (decay heat) that limits capacity. An accelerator-driven neutron source can destroy actinides through fission, and can convert long-lived fission products to shorter-lived or stable isotopes. Studies over the past decade have established that accelerator transmutation of waste (ATW) can have a major beneficial impact on the nuclear waste problem. Specifically, the ATW concept the authors are evaluating: (1) destroys over 99.9% of the actinides; (2) destroys over 99.9% of the Tc and I; (3) separates Sr-90 and Cs-137; (4) separates uranium from the spent fuel; (5) produces electric power.

Venneri, F.; Li, N.; Williamson, M.; Houts, M.; Lawrence, G.



Spike morphology in blast-wave-driven instability experiments  

Science Conference Proceedings (OSTI)

The laboratory experiments described in the present paper observe the blast-wave-driven Rayleigh-Taylor instability with three-dimensional (3D) initial conditions. About 5 kJ of energy from the Omega laser creates conditions similar to those of the He-H interface during the explosion phase of a supernova. The experimental target is a 150 {mu}m thick plastic disk followed by a low-density foam. The plastic piece has an embedded, 3D perturbation. The basic structure of the pattern is two orthogonal sine waves where each sine wave has an amplitude of 2.5 {mu}m and a wavelength of 71 {mu}m. In some experiments, an additional wavelength is added to explore the interaction of modes. In experiments with 3D initial conditions the spike morphology differs from what has been observed in other Rayleigh-Taylor experiments and simulations. Under certain conditions, experimental radiographs show some mass extending from the interface to the shock front. Current simulations show neither the spike morphology nor the spike penetration observed in the experiments. The amount of mass reaching the shock front is analyzed and potential causes for the spike morphology and the spikes reaching the shock are discussed. One such hypothesis is that these phenomena may be caused by magnetic pressure, generated by an azimuthal magnetic field produced by the plasma dynamics.

Kuranz, C. C.; Drake, R. P.; Grosskopf, M. J.; Fryxell, B.; Budde, A. [Department of Atmospheric, Oceanic and Space Science, Center for Radiative Shock Hydrodynamics, University of Michigan, 2455 Hayward Street, Ann Arbor, Michigan 48109 (United States); Hansen, J. F.; Miles, A. R. [Lawrence Livermore National Laboratory, P.O. Box 808, Livermore, California 94550 (United States); Plewa, T. [Department of Scientific Computing, Florida State University, 400 Dirac Science Library, Tallahassee, Florida 32306 (United States); Hearn, N. [Center for Astrophysical Thermonuclear Flashes, University of Chicago, 5640 South Ellis Avenue, Chicago, Illinois 60637 (United States); Knauer, J. [Laboratory for Laser Energetics, University of Rochester, 250 East River Road, Rochester, New York 14623 (United States)



Heat-driven acoustic cooling engine having no moving parts  

DOE Patents (OSTI)

A heat-driven acoustic cooling engine having no moving parts receives heat from a heat source. The acoustic cooling engine comprises an elongated resonant pressure vessel having first and second ends. A compressible fluid having a substantial thermal expansion coefficient and capable of supporting an acoustic standing wave is contained in the resonant pressure vessel. The heat source supplies heat to the first end of the vessel. A first heat exchanger in the vessel is spaced-apart from the first end and receives heat from the first end. A first thermodynamic element is adjacent to the first heat exchanger and converts some of the heat transmitted by the first heat exchanger into acoustic power. A second thermodynamic element has a first end located spaced-apart from the first thermodynamic element and a second end farther away from the first thermodynamic element than is its first end. The first end of the second thermodynamic element heats while its second end cools as a consequence of the acoustic power. A second heat exchanger is adjacent to and between the first and second thermodynamic elements. A heat sink outside of the vessel is thermally coupled to and receives heat from the second heat exchanger. The resonant pressure vessel can include a housing less than one-fourth wavelength in length coupled to a reservoir. The housing can include a reduced diameter portion communicating with the reservoir.

Wheatley, John C. (Los Alamos, NM); Swift, Gregory W. (Santa Fe, NM); Migliori, Albert (Santa Fe, NM); Hofler, Thomas J. (Los Alamos, NM)



Revel8or: Model Driven Capacity Planning Tool Suite  

SciTech Connect

Designing complex multi-tier applications that must meet strict performance requirements is a challenging software engineering problem. Ideally, the application architect could derive accurate performance predictions early in the project life-cycle, leveraging initial application design-level models and a description of the target software and hardware platforms. To this end, we have developed a capacity planning tool suite for component-based applications, called Revel8tor. The tool adheres to the model driven development paradigm and supports benchmarking and performance prediction for J2EE, .Net and Web services platforms. The suite is composed of three different tools: MDAPerf, MDABench and DSLBench. MDAPerf allows annotation of design diagrams and derives performance analysis models. MDABench allows a customized benchmark application to be modeled in the UML 2.0 Testing Profile and automatically generates a deployable application, with measurement automatically conducted. DSLBench allows the same benchmark modeling and generation to be conducted using a simple performance engineering Domain Specific Language (DSL) in Microsoft Visual Studio. DSLBench integrates with Visual Studio and reuses its load testing infrastructure. Together, the tool suite can assist capacity planning across platforms in an automated fashion.

Zhu, Liming; Liu, Yan; Bui, Ngoc B.; Gorton, Ian



Transmutation of nuclear waste in accelerator-driven systems  

E-Print Network (OSTI)

Today more than ever energy is not only a cornerstone of human development, but also a key to the environmental sustainability of economic activity. In this context, the role of nuclear power may be emphasized in the years to come. Nevertheless, the problems of nuclear waste, safety and proliferation still remain to be solved. It is believed that the use of accelerator-driven systems (ADSs) for nuclear waste transmutation and energy production would address these problems in a simple, clean and economically viable, and therefore sustainable, manner. This thesis covers the major nuclear physics aspects of ADSs, in particular the spallation process and the core neutronics specific to this type of systems. The need for accurate nuclear data is described, together with a detailed analysis of the specific isotopes and energy ranges in which this data needs to be improved and the impact of their uncertainty. Preliminary experimental results for some of these isotopes, produced by the Neutron Time-of-Flight (n_TOF) ...

Herrera-MartÝnez, A


Note: This page contains sample records for the topic "distance driven mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A transformation composition framework for model driven engineering  

E-Print Network (OSTI)

Model Driven Engineering is a promising approach where software development processes lead from abstract models to code generation. In order to support these software processes, it is important to provide means that are flexible and that can be tailored to match specific requirements of engineering domainsľlike health care, telecommunications, or embedded systems. In other word, to build the tool according to the needs and to the domain specificities. This report proposes to reach this goal thro