National Library of Energy BETA

Sample records for deviation diminishing gradually

  1. The law of demand versus diminishing marginal utility

    E-Print Network [OSTI]

    Bettie, Bruce R.; Lafrance, Jeffrey T.

    2006-01-01

    Diminishing marginal utility will provide a negative sloperegularity for u. Thus, this utility function (or a simpleDiminishing Marginal Utility Endnotes References Burt,

  2. Gradual Variation Analysis for Groundwater Flow

    E-Print Network [OSTI]

    Chen, Li

    2010-01-01

    Groundwater flow in Washington DC greatly influences the surface water quality in urban areas. The current methods of flow estimation, based on Darcy's Law and the groundwater flow equation, can be described by the diffusion equation (the transient flow) and the Laplace equation (the steady-state flow). The Laplace equation is a simplification of the diffusion equation under the condition that the aquifer has a recharging boundary. The practical way of calculation is to use numerical methods to solve these equations. The most popular system is called MODFLOW, which was developed by USGS. MODFLOW is based on the finite-difference method in rectangular Cartesian coordinates. MODFLOW can be viewed as a "quasi 3D" simulation since it only deals with the vertical average (no z-direction derivative). Flow calculations between the 2D horizontal layers use the concept of leakage. In this project, we have established a mathematical model based on gradually varied functions for groundwater data volume reconstruction. T...

  3. Deviation differential equations. Jacobi fields

    E-Print Network [OSTI]

    G. Sardanashvily

    2013-04-02

    Given a differential equation on a smooth fibre bundle Y, we consider its canonical vertical extension to that, called the deviation equation, on the vertical tangent bundle VY of Y. Its solutions are Jacobi fields treated in a very general setting. In particular, the deviation of Euler--Lagrange equations of a Lagrangian L on a fibre bundle Y are the Euler-Lagrange equations of the canonical vertical extension of L onto VY. Similarly, covariant Hamilton equations of a Hamiltonian form H are the Hamilton equations of the vertical extension VH of H onto VY.

  4. IMAGES OF GRADUAL MILLIMETER EMISSION AND MULTI--WAVELENGTH

    E-Print Network [OSTI]

    White, Stephen

    SOLAR FLARE Adriana V. R. Silva \\Lambda Solar Astronomy 264­33, Caltech, Pasadena, CA 91125 R. P. Lin--rays and at microwave frequencies, followed by a gradual decay phase. The gradual phase was also detected at 86 GHz: a footpoint and a loop top source. Nonthermal emissions at microwave and hard X--ray wavelengths are analyzed

  5. The Law of Demand versus Diminishing Marginal Utility

    E-Print Network [OSTI]

    Beattie, Bruce R.; LaFrance, Jeffrey T

    2006-01-01

    not guarantee DSD. This form of utility function generates aHausman). This type of utility model is commonplace amongversus Diminishing Marginal Utility References Burt, O.R.

  6. The Law of Demand Versus Diminishing Marginal Utility

    E-Print Network [OSTI]

    Beattie, Bruce R.; LaFrance, Jeffrey T.

    2006-01-01

    not guarantee DSD. This form of utility function generates aHausman). This type of utility model is commonplace amongversus Diminishing Marginal Utility References Burt, O.R.

  7. Fuzzy Rules in Data Mining: From Fuzzy Associations to Gradual

    E-Print Network [OSTI]

    Hüllermeier, Eyke

    Fuzzy Rules in Data Mining: From Fuzzy Associations to Gradual Dependencies Eyke H recently also in the field of data mining. In this chapter, we provide a synthesis of different approaches of knowledge discovery in databases (KDD) and its core methodological component, data mining, have attracted

  8. Proton aurora related to intervals of pulsations of diminishing periods

    E-Print Network [OSTI]

    California at Berkeley, University of

    Proton aurora related to intervals of pulsations of diminishing periods A. G. Yahnin,1 T. A are generated because of a cyclotron instability of the anisotropic distribution of ring current ions. Proton precipitation produced by the cyclotron instability can be responsible for proton aurora. Indeed

  9. Ion Density Deviations in Semipermeable Ionic Microcapsules

    E-Print Network [OSTI]

    Qiyun Tang; Alan R. Denton

    2015-07-07

    By implementing the nonlinear Poisson-Boltzmann theory in a cell model, we theoretically investigate the influence of polyelectrolye gel permeability on ion densities and pH deviations inside the cavities of ionic microcapsules. Our calculations show that variations in permeability of a charged capsule shell cause a redistribution of ion densities within the capsule, which ultimately affects the pH deviation and Donnan potential induced by the electric field of the shell. We find that semipermeable capsules can induce larger pH deviations inside their cavities that can permeable capsules. Furthermore, with increasing capsule charge, the influence of permeability on pH deviations progressively increases. Our theory, while providing a self-consistent method for modeling the influence of permeability on fundamental properties of ionic microgels, makes predictions of practical significance for the design of microcapsules loaded with fluorescent dyes, which can serve as biosensors for diagnostic purposes.

  10. POLICY FLASH 2015-22 - Federal Acquisition Regulation Class Deviation...

    Office of Environmental Management (EM)

    2 - Federal Acquisition Regulation Class Deviation POLICY FLASH 2015-22 - Federal Acquisition Regulation Class Deviation DATE: May 8, 2015 TO: Procurement DirectorsContracting...

  11. Policy Flash 2015-04 - Class Deviation: Min Wage | Department...

    Office of Environmental Management (EM)

    4 - Class Deviation: Min Wage Policy Flash 2015-04 - Class Deviation: Min Wage DATE: October 21, 2014 TO: Procurement Directors FROM: Director, Contract and Financial Assistance...

  12. Global temperature deviations as a random walk

    SciTech Connect (OSTI)

    Karner, O.

    1996-12-31

    Surface air temperature is the main parameter to represent the earth`s contemporary climate. Several historical temperature records on a global/monthly basis are available. Time-series analysis shows that they can be modelled via autoregressive moving average models closely connected to the classical random walk model. Fitted models emphasize a nonstationary character of the global/monthly temperature deviation from a certain level. The nonstationarity explains all trends and periods, found in the last century`s variability of global mean temperature. This means that the short-term temperature trends are inevitable and may have little in common with a currently increasing carbon dioxide amount. The calculations show that a reasonable understanding of the contemporary global mean climate is attainable, assuming random forcing to the climate system and treating temperature deviation as a response to it. The forcings occur due to volcanic eruptions, redistribution of cloudiness, variations in snow and ice covered areas, changes in solar output, etc. Their impact can not be directly estimated from changes of the earth`s radiation budget at the top of the atmosphere, because actual measurements represent mixture of the forcings and responses. Thus, it is impossible empirically to separate the impact of one particular forcing (e.g., that due to increase of CO{sub 2} amount) from the sequence of all existing forcings in the earth climate system. More accurate modelling involving main feedback loops is necessary to ease such a separation.

  13. STATIC ANALYSIS FOR RUBY IN THE PRESENCE OF GRADUAL TYPING MICHAEL JOSEPH EDGAR

    E-Print Network [OSTI]

    STATIC ANALYSIS FOR RUBY IN THE PRESENCE OF GRADUAL TYPING MICHAEL JOSEPH EDGAR Department Advisor i #12;STATIC ANALYSIS FOR RUBY IN THE PRESENCE OF GRADUAL TYPING by MICHAEL JOSEPH EDGAR THESIS challenges to traditional static analysis techniques, leaving most errors to be detected at runtime

  14. COSTS OF WATER TREATMENT DUE TO DIMINISHED WATER QUALITY: A CASE STUDY IN TEXAS

    E-Print Network [OSTI]

    McCarl, Bruce A.

    COSTS OF WATER TREATMENT DUE TO DIMINISHED WATER QUALITY: A CASE STUDY IN TEXAS David Dearmont and Resources Portland State University P O Box 751 Portland OR 97207-0751 October, 1997 Draft of paper in Water Resources Research, 34(4), 849-854, 1998. #12;2 CHEMICAL COSTS OF WATER TREATMENT DUE TO DIMINISHED WATER

  15. Primary Cementing of a Highly Deviated Oil Well

    E-Print Network [OSTI]

    Fournier, John J.F.

    in the construction of a well. The objective is to provide zonal isolation, i.e., a hydraulic seal between the wellPrimary Cementing of a Highly Deviated Oil Well by Mariana Carrasco-Teja B.Sc., Instituto Tecnol. The study comes from the primary cementing of highly deviated oil and gas wells. Highly deviated wells

  16. FocalSpace : enhancing users' focus on foreground through diminishing the background

    E-Print Network [OSTI]

    Yao, Lining

    2012-01-01

    In this document we introduce FocalSpace, a video conferencing system that helps users focus on the foreground by diminishing the background through synthetic blur effects. The system can dynamically recognize the relevant ...

  17. Diminishing sensitivity for other-regarding preferences for university undergraduate research fellows 

    E-Print Network [OSTI]

    Hill, Sarah Anne

    2013-02-22

    several proposed models and the equal-division equivalent. By placing restrictions on the models suggested by Fehr and Schmidt and by Charness and Rabin, inequity aversion and diminishing sensitivity can be guaranteed when the player is ahead and behind...

  18. Section 5 (cont.): Variance and Standard Deviation; Chebyshev's ...

    E-Print Network [OSTI]

    2014-09-25

    Section 5 (cont.): Variance and Standard. Deviation; Chebyshev's Inequality. October 2nd, 2014. Lesson 9. Page 2. In the previous lesson, we introduced an ...

  19. Predicting multiphase flow behavior in a deviated well

    SciTech Connect (OSTI)

    Hasan, A.R. (Univ. of North Dakota (US)); Kabir, C.S. (Schlumberger Well Services (US))

    1988-11-01

    In deviated wells of an offshore producing environment, flow of two- or three-phase mixtures is invariably encountered. While many investigators have studied vertical multiphase flow behavior, few studies, often entirely empirical, deal with deviated well systems. The main objective of this work is to present a model that predicts both flow regime and pressure gradient in a deviated wellbore. In the modeling of flow-pattern transition and void fraction, an approach similar to that for vertical flow is taken; i.e., four principal flow regimes are recognized: bubbly, slug, churn, and annular. The transition form bubbly to slug flow is found to be at a local void fraction of 0.25. This transition criterion in terms of gas and liquid superficial velocities is found to be significantly affected by the well deviation, particularly in highly deviated wells. The transitions from slug to churn flow and churn to annular flow occur at high fluid velocities and are unaffected by well deviation. The velocity-profile-distribution parameter for bubbly, slug, and churn flows is found to be unaffected by the well deviation angle. Similarly, the terminal rise velocity for small bubbles also appears to be insignificantly affected by the well deviation. In contrast, the ''Taylor'' bubble-rise velocity changes dramatically as deviation angle is increased. Thus, the characters of slug and churn flows in a deviated well differ from those in a vertical well. Data on gas void fraction were obtained both from a 5-in. (127-mm) circular pipe and from annular flow channels for deviation angles up to 32/sup 0/ from the vertical. The validity of the proposed model is demonstrated with these data and with laboratory data from other sources. Several field examples are presented to show the application of the model.

  20. Ion Density Deviations in Polyelectrolyte Microcapsules: Influence on Biosensors

    E-Print Network [OSTI]

    Qiyun Tang; Alan R. Denton

    2014-10-24

    Polyelectrolyte microcapsules loaded with fluorescent dyes have been proposed as biosensors to monitor local pH and ionic strength for diagnostic purposes. In the case of charged microcapsules, however, the local electric field can cause deviations of ion densities inside the cavities, potentially resulting in misdiagnosis of some diseases. Using nonlinear Poisson-Boltzmann theory, we systematically investigate these deviations induced by charged microcapsules. Our results show that the microcapsule charge density, as well as the capsule and salt concentrations, contribute to deviations of local ion concentrations and pH. Our findings are relevant for applications of polyelectrolyte microcapsules with encapsulated ion-sensitive dyes as biosensors.

  1. Quantum mechanics and geodesic deviation in the brane world

    E-Print Network [OSTI]

    S. M. M. Rasouli; A. F. Bahrehbakhsh; S. Jalalzadeh; M. Farhoudi

    2009-11-16

    We investigate the induced geodesic deviation equations in the brane world models, in which all the matter forces except gravity are confined on the 3-brane. Also, the Newtonian limit of induced geodesic deviation equation is studied. We show that in the first Randall-Sundrum model the Bohr-Sommerfeld quantization rule is as a result of consistency between the geodesic and geodesic deviation equations. This indicates that the path of test particle is made up of integral multiples of a fundamental Compton-type unit of length $h/mc$.

  2. Predicting multiphase flow behavior in a deviated well

    SciTech Connect (OSTI)

    Hasan, A.R.; Kabir, C.S.

    1986-01-01

    In deviated wells of an offshore producing environment, flow of two- or three - phase mixtures are invariably encountered. While large number of investigators have studied vertical multiphase flow behavior, there are few studies, often entirely empirical, that deal with deviated well systems. The main objective of this work is to present a model that predicts both flow regime and pressure gradient in a deviated wellbore. In modeling flow pattern transition and void fraction, an approach similar to that for vertical flow is taken; that is, four principal flow regimes are recognized - bubbly, slug, churn and annular.

  3. Recognizing deviations from normalcy for brain tumor segmentation

    E-Print Network [OSTI]

    Gering, David T. (David Thomas), 1971-

    2003-01-01

    A framework is proposed for the segmentation of brain tumors from MRI. Instead of training on pathology, the proposed method trains exclusively on healthy tissue. The algorithm attempts to recognize deviations from normalcy ...

  4. POLICY FLASH 2015-22- Federal Acquisition Regulation Class Deviation

    Broader source: Energy.gov [DOE]

    The Civilian Agency Acquisition Council (CAAC) issued CAAC Letter 2015-02, authorizing agencies to issue a Class Deviation to prohibit the use of funds appropriated or otherwise for a contract, grant, or cooperative agreement with an entity that requires employees or subcontractors seeking to report FWA to sign internal confidentiality agreements or statements prohibiting or otherwise restricting the lawful reporting of FWA to designated agents of the Government. This Policy Flash forwards the approved DOE class deviation with associated required provision and clause for incorporation into solicitations and contracts.

  5. Large deviations principles of Non-Freidlin-Wentzell type

    E-Print Network [OSTI]

    Jaykov Foukzon

    2014-10-22

    Generalized Large deviation principles was developed for Colombeau-Ito SDE with a random coefficients. We is significantly expand the classical theory of large deviations for randomly perturbed dynamical systems developed by Freidlin and Wentzell.Using SLDP approach, jumps phenomena, in financial markets, also is considered. Jumps phenomena, in financial markets is explained from the first principles, without any reference to Poisson jump process. In contrast with a phenomenological approach we explain such jumps phenomena from the first principles, without any reference to Poisson jump process.

  6. Simulations of the spatial and temporal invariance in the spectra of gradual solar energetic particle events

    E-Print Network [OSTI]

    Wang, Yang

    2015-01-01

    The spatial and temporal invariance in the spectra of energetic particles in the gradual solar events is reproduced in the simulations. Based on a numerical solution of the focused transport equation, we obtain the intensity time profiles of solar energetic particles (SEPs) accelerated by an interplanetary shock in the three-dimensional interplanetary space. The shock is treated as a moving source of energetic particles with a distribution function. The time profiles of particle flux with different energies are calculated in the ecliptic at $1$ AU. We find that the spatial and temporal invariance in SEP spectra are the results of the effects of perpendicular diffusion and adiabatic cooling in the interplanetary space in our model. Furthermore, a spectra invariant region, which agrees with observations but is different than the one suggested by Reames and co-workers, is proposed based on our simulations.

  7. Device and method for measuring fluid flow in a conduit having a gradual bend

    DOE Patents [OSTI]

    Ortiz, M.G.; Boucher, T.J.

    1998-11-10

    A system is described for measuring fluid flow in a conduit having a gradual bend or arc, and a straight section. The system includes pressure transducers, one or more disposed in the conduit on the outside of the arc, and one disposed in the conduit in a straight section thereof. The pressure transducers measure the pressure of fluid in the conduit at the locations of the pressure transducers and this information is used by a computational device to calculate fluid flow rate in the conduit. For multi-phase fluid, the density of the fluid is measured by another pair of pressure transducers, one of which is located in the conduit elevationally above the other. The computation device then uses the density measurement along with the fluid pressure measurements, to calculate fluid flow. 1 fig.

  8. Device and method for measuring fluid flow in a conduit having a gradual bend

    DOE Patents [OSTI]

    Ortiz, Marcos German (Idaho Falls, ID); Boucher, Timothy J (Helena, MT)

    1998-01-01

    A system for measuring fluid flow in a conduit having a gradual bend or arc, and a straight section. The system includes pressure transducers, one or more disposed in the conduit on the outside of the arc, and one disposed in the conduit in a straight section thereof. The pressure transducers measure the pressure of fluid in the conduit at the locations of the pressure transducers and this information is used by a computational device to calculate fluid flow rate in the conduit. For multi-phase fluid, the density of the fluid is measured by another pair of pressure transducers, one of which is located in the conduit elevationally above the other. The computation device then uses the density measurement along with the fluid pressure measurements, to calculate fluid flow.

  9. Geodesic Deviation Equation in $f(T)$ gravity

    E-Print Network [OSTI]

    F. Darabi; M. Mousavi; K. Atazadeh

    2015-04-14

    In this work, we show that it is possible to study the notion of geodesic deviation equation in $f(T)$ gravity, in spite of the fact that in teleparallel gravity there is no notion of geodesics, and the torsion is responsible for the appearance of gravitational interaction. In this regard, we obtain the GR equivalent equations for $f(T)$ gravity which are in the modified gravity form such as $f(R)$ gravity. Then, we obtain the GDE within the context of this modified gravity. In this way, the obtained geodesic deviation equation will correspond to the $f(T)$ gravity. Eventually, we extend the calculations to obtain the modification of Matting relation.

  10. Solar Radiation Pressure and Deviations from Keplerian Orbits

    E-Print Network [OSTI]

    Roman Ya. Kezerashvili; Justin F. Vazquez-Poritz

    2009-04-15

    Newtonian gravity and general relativity give exactly the same expression for the period of an object in circular orbit around a static central mass. However, when the effects of the curvature of spacetime and solar radiation pressure are considered simultaneously for a solar sail propelled satellite, there is a deviation from Kepler's third law. It is shown that solar radiation pressure affects the period of this satellite in two ways: by effectively decreasing the solar mass, thereby increasing the period, and by enhancing the effects of other phenomena, rendering some of them detectable. In particular, we consider deviations from Keplerian orbits due to spacetime curvature, frame dragging from the rotation of the sun, the oblateness of the sun, a possible net electric charge of the sun, and a very small positive cosmological constant.

  11. Policy Flash 2015-15 Class Deviation FAR Test Programs | Department...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    5 Class Deviation FAR Test Programs Policy Flash 2015-15 Class Deviation FAR Test Programs DATE: March 6, 2015 TO: Procurement DirectorsContracting Officers FROM: Director...

  12. Policy Flash 2013-64 Acquisition Letter 10 and Class Deviation...

    Energy Savers [EERE]

    64 Acquisition Letter 10 and Class Deviation for Nondisplacement of Qualified Workers Policy Flash 2013-64 Acquisition Letter 10 and Class Deviation for Nondisplacement of...

  13. Policy Flash 2014-09 Class Deviation from the Department of Energy...

    Energy Savers [EERE]

    Class Deviation from the Department of Energy Acquisition Regulation (DEAR) 952.204-2 Policy Flash 2014-09 Class Deviation from the Department of Energy Acquisition Regulation...

  14. Non-thermal Electrons at the Earth's Bow Shock: A `Gradual' Event

    E-Print Network [OSTI]

    M. Oka; T. Terasawa; M. Fujimoto; H. Matsui; Y. Kasaba; Y. Saito; H. Kojima; H. Matsumoto; T. Mukai

    2008-10-24

    Earth's bow shock is known to produce non-thermal electrons which are generally observed as a `spike' in their flux profile. Here, in this paper, we present an analysis of electron and whistler wave properties for a quasi-perpendicular shock crossing that is supercritical, but subcritical to the so-called whistler critical Mach number, M$^w_{\\rm crit}$, above which whistler waves cannot propagate upstream. We have found that the amplitudes of whistler waves increased exponentially as a function of time prior to the shock encounter, while the suprathermal ($>$ 2 keV) electron flux similarly increased with time, although with differing $e$-folding time scales. Comparison of the electron energy spectrum measured within the ramp with predictions from diffusive shock acceleration theory was poor, but the variation of pitch angle distribution showed scattering of non-thermal electrons in the upstream region. While not finding a specific mechanism to account for the electron diffusion, we suggest that the whistlers seen probably account for the differences observed between this `gradual' event and the `spike' events seen at shocks with no upstream whistlers.

  15. Temperature of the Source Plasma in Gradual Solar Energetic Particle Events

    E-Print Network [OSTI]

    Reames, Donald V

    2015-01-01

    Scattering, during interplanetary transport in large, "gradual" solar energetic-particle (SEP) events, can cause element abundance enhancements or suppressions that depend upon the mass-to-charge ratio A/Q of the ions as an increasing power law early in events and a decreasing power law of the residual ions later. Since the Q values for the ions depend upon the source plasma temperature T, best fits to the power-law dependence of enhancements vs. A/Q provide a fundamentally new method to determine the most probable value of T for these events. We find that fits to the times of increasing and decreasing powers give similar values of T, most commonly (69%) in the range of 0.8-1.6 MK, consistent with the acceleration of ambient coronal plasma by shock waves driven out from the Sun by coronal mass ejections (CMEs). However, 24% of the SEP events studied showed plasma of 2.5-3.2 MK, typical of that previously determined for the smaller impulsive SEP events; these particles may be reaccelerated preferentially by qu...

  16. Low-energy magnetic radiation: Deviations from GOE

    SciTech Connect (OSTI)

    Frauendorf, S.; Schwengner, R.; Wimmer, K.

    2014-10-15

    A pronounced spike at low energy in the strength function for magnetic radiation (LEMAR) is found by means of Shell Model calculations, which explains the experimentally observed enhancement of the dipole strength. LEMAR originates from statistical low-energy M1-transitions between many excited complex states. Re-coupling of the proton and neutron high-j orbitals generates the strong magnetic radiation. LEMAR is closely related to Magnetic Rotation. LEMAR is predicted for nuclides participating in the r-process of element synthesis and is expected to change the reaction rates. An exponential decrease of the strength function and a power law for the size distribution of the B(M1) values are found, which strongly deviate from the ones of the GOE of random matrices, which is commonly used to represent complex compound states.

  17. Constraints on deviations from ?CDM within Horndeski gravity

    E-Print Network [OSTI]

    Emilio Bellini; Antonio J. Cuesta; Raul Jimenez; Licia Verde

    2015-09-25

    Recent anomalies found in cosmological datasets such as the low multipoles of the Cosmic Microwave Background or the low redshift amplitude and growth of clustering measured by e.g., abundance of galaxy clusters and redshift space distortions in galaxy surveys, have motivated explorations of models beyond standard {\\Lambda}CDM. Of particular interest are models where general relativity (GR) is modified on large cosmological scales. Here we consider deviations from {\\Lambda}CDM+GR within the context of Horndeski gravity, which is the most general theory of gravity with second derivatives in the equations of motion. We adopt a parametrization in which the four additional Horndeski functions of time {\\alpha}_i(t) are proportional to the cosmological density of dark energy {\\Omega}_DE(t). Constraints on this extended parameter space using a suite of state-of-the art cosmological observations are presented for the first time. Although the theory is able to accommodate the low multipoles of the Cosmic Microwave Background and the low amplitude of fluctuations from redshift space distortions, we find no significant tension with {\\Lambda}CDM+GR when performing a global fit to recent cosmological data and thus there is no evidence against {\\Lambda}CDM+GR from an analysis of the value of the Bayesian evidence ratio of the modified gravity models with respect to {\\Lambda}CDM, despite introducing extra parameters. The posterior distribution of these extra parameters that we derive return strong constraints on any possible deviations from {\\Lambda}CDM+GR in the context of Horndeski gravity. We illustrate how our results can be applied to a more general frameworks of modified gravity models.

  18. POLICY FLASH 2013-59 Class Deviation (FAR) 19.15, Women-Owned...

    Energy Savers [EERE]

    POLICY FLASH 2013-59 Class Deviation (FAR) 19.15, Women-Owned Small Business (WOSB) Program POLICY FLASH 2013-59 Class Deviation (FAR) 19.15, Women-Owned Small Business (WOSB)...

  19. Large-deviation properties of resilience of power grids

    E-Print Network [OSTI]

    Dewenter, Timo

    2014-01-01

    We study the distributions of the resilience of power flow models against transmission line failures via a so-called backup capacity. We consider three ensembles of random networks and in addition, the topology of the British transmission power grid. The three ensembles are Erd\\H{o}s-R\\'enyi random graphs, Erd\\H{o}s-R\\'enyi random graphs with a fixed number of links, and spatial networks where the nodes are embedded in a two dimensional plane. We investigate numerically the probability density functions (pdfs) down to the tails to gain insight in very resilient and very vulnerable networks. This is achieved via large-deviation techniques which allow us to study very rare values which occur with probability densities below $10^{-160}$. We find that the right tail of the pdfs towards larger backup capacities follows an exponential with a strong curvature. This is confirmed by the rate function which approaches a limiting curve for increasing network sizes. Very resilient networks are basically characterized by ...

  20. Large deviations for quasi-periodic cocycles with singularities

    E-Print Network [OSTI]

    Pedro Duarte; Silvius Klein

    2015-07-10

    We derive large deviations type (LDT) estimates for linear cocycles over an ergodic multifrequency torus translation. These models are called quasi-periodic cocycles. We make the following assumptions on the model: the translation vector satisfies a generic Diophantine condition, and the fiber action is given by a matrix valued analytic function of several variables which is not identically singular. The LDT estimates obtained here depend on some uniform measurements on the cocycle. Our general results derived in [9] regarding the continuity properties of the Lyapunov exponents (LE) and of the Oseledets filtration and decompositions are then applicable, and we obtain local weak-Holder continuity of these quantities in the presence of gaps in the Lyapunov spectrum. The main new feature of this work is allowing a cocycle depending on several variables to have singularities, i.e. points of non invertibility. This requires a careful analysis of the set of zeros of certain analytic functions of several variables and of the singularities (i.e. negative infinity values) of pluri-subharmonic functions related to the iterates of the cocycle. A refinement of this method in the one variable case leads to a stronger LDT estimate and in turn to a stronger, nearly-Holder modulus of continuity of the LE, Oseledets filtration and Oseledets decomposition. This is a draft of a chapter in our forthcoming research monograph [9].

  1. Risk Analysis, Vol. , No. , DOI: Mean-Deviation Analysis in The Theory of Choice

    E-Print Network [OSTI]

    Banaji,. Murad

    Risk Analysis, Vol. , No. , DOI: Mean-Deviation Analysis in The Theory of Choice Bogdan Grechuk: mean-deviation analysis, theory of choice, deviation measures, coherent risk measures 1. INTRODUCTION for Risk Analysis #12;2 B. Grechuk, A. Molyboha, M. Zabarankin r.v. PC such that PC > PB with probability 1

  2. Microsoft Word - Flash2006-47DeviatedClauseII.doc

    Office of Environmental Management (EM)

    970.5227-3 Technology Transfer Mission (Deviation-July 2006) This clause has as its purpose implementation of the National Competitiveness Technology Transfer Act of 1989 (Sections...

  3. Deviations from piecewise linearity in the solid-state limit with approximate density functionals

    E-Print Network [OSTI]

    Baer, Roi

    Deviations from piecewise linearity in the solid-state limit with approximate density functionals (2015) Deviations from piecewise linearity in the solid-state limit with approximate density functionals functional methods J. Chem. Phys. 141, 124123 (2014); 10.1063/1.4896455 Thermally-assisted-occupation density

  4. Software Deviation Analysis: A ``Safeware'' Technique \\Lambda Jon Damon Reese and Nancy G. Leveson

    E-Print Network [OSTI]

    Leveson, Nancy

    Software Deviation Analysis: A ``Safeware'' Technique \\Lambda Jon Damon Reese and Nancy G. Leveson be a mixture of humans, hardware, and software. This paper describes one of the Safeware hazard analysis techniques, Software Deviation Analysis, that incorporates the beneficial fea­ tures of HAZOP (such

  5. Gradual crossover in molecular organization of stable liquid H{sub 2}O at moderately high pressure and temperature

    SciTech Connect (OSTI)

    Koga, Yoshikata; Westh, Peter; Yoshida, Koh; Inaba, Akira; Nakazawa, Yasuhiro

    2014-09-15

    Using the literature raw data of the speed of sound and the specific volume, the isothermal compressibility, ?{sub T}, a second derivative thermodynamic quantity of G, was evaluated for liquid H{sub 2}O in the pressure range up to 350 MPa and the temperature to 50 ºC. We then obtained its pressure derivative, d?{sub T}/dp, a third derivative numerically without using a fitting function to the ?{sub T} data. On taking yet another p-derivative at a fixed T graphically without resorting to any fitting function, the resulting d{sup 2}?{sub T}/dp{sup 2}, a fourth derivative, showed a weak but clear step anomaly, with the onset of the step named point X and its end point Y. In analogy with another third and fourth derivative pair in binary aqueous solutions of glycerol, d?{sub p}/dx{sub Gly} and d{sup 2}?{sub p}/dx{sub Gly}{sup 2}, at 0.1 MPa (?{sub p} is the thermal expansivity and x{sub Gly} the mole fraction of solute glycerol) in our recent publication [J. Solution Chem. 43, 663-674 (2014); DOI:10.1007/s10953-013-0122-7], we argue that there is a gradual crossover in the molecular organization of pure H{sub 2}O from a low to a high p-regions starting at point X and ending at Y at a fixed T. The crossover takes place gradually spanning for about 100 MPa at a fixed temperature. The extrapolated temperature to zero p seems to be about 70 – 80 °C for points X and 90 – 110 °C for Y. Furthermore, the mid-points of X and Y seem to extrapolate to the triple point of liquid, ice Ih and ice III. Recalling that the zero x{sub Gly} extrapolation of point X and Y for binary aqueous glycerol at 0.1 MPa gives about the same T values respectively, we suggest that at zero pressure the region below about 70 °C the hydrogen bond network is bond-percolated, while above about 90 ºC there is no hydrogen bond network. Implication of these findings is discussed.

  6. BoseEinstein Condensation in the Large Deviations Regime with Applications to Information

    E-Print Network [OSTI]

    Merhav, Neri

    Bose­Einstein Condensation in the Large Deviations Regime with Applications to Information System(U) = lim M " - 1 M log Pr ( X i ni MU )# may exhibit phase transitions ­ Bose­Einstein condensation (BEC

  7. Deviational simulation of phonon transport in graphene ribbons with ab initio scattering

    E-Print Network [OSTI]

    Landon, Colin D.

    We present a deviational Monte Carlo method for solving the Boltzmann-Peierls equation with ab initio 3-phonon scattering, for temporally and spatially dependent thermal transport problems in arbitrary geometries. Phonon ...

  8. FROM DYNAMIC TO STATIC LARGE DEVIATIONS IN BOUNDARY DRIVEN EXCLUSION PARTICLE SYSTEMS

    E-Print Network [OSTI]

    developments on the non­equilibrium stationary measures by Derrida, Lebowitz and Speer [4] and the more closely, Derrida, Lebowitz and Speer [4] obtained the explicit form of the rate function for the large deviation

  9. Sonic Logging in Deviated Boreholes in an Anisotropic Formation: Laboratory Study

    E-Print Network [OSTI]

    Zhu, Zhenya

    2006-01-01

    Deepwater field development requires drilling of deviated or horizontal wells. Most formations encountered can be highly anisotropic and P- and S-wave velocities vary with propagation directions. Sonic logs acquired in ...

  10. Policy Flash 2013-31 Class Deviation from the Federal Acquisition...

    Energy Savers [EERE]

    Federal Acquisition Regulation (FAR) 13.5, Test Program for Certain Commercial Items Policy Flash 2013-31 Class Deviation from the Federal Acquisition Regulation (FAR) 13.5, Test...

  11. Policy Flash 2014-09 Class Deviation from the Department of Energy...

    Broader source: Energy.gov (indexed) [DOE]

    Lawrence Butler, of the Contract and Financial Assistance Policy Division at (202) 287-1945 or at lawrence.butler@hq.doe.gov. Policy Flash 13 Class Deviation(2) (3).pdf Signed...

  12. Spatiotemporal study of the local thermodynamic equilibrium deviations in high-intensity discharge lamps

    SciTech Connect (OSTI)

    Helali, H.; Bchir, T.; Araoud, Z.; Charrada, K.

    2013-04-15

    The aim of this work is to study the local thermodynamic equilibrium (LTE) deviations in arc discharges plasma generated in high-intensity discharge lamps operating under an ac (50 Hz) power supply. To achieve this goal, we elaborate a two-temperature, two-dimensional, and time-depending model. We have found numerical results almost reproducing the experimental data, which allows us to validate this model. After validation, we have discussed different energy term effects on the LTE deviations.

  13. The use of petroleum for liquid-transportation fuels has strained the environment and caused the global crude oil reserves to diminish. Therefore, there exists a need to replace petroleum as the primary fuel

    E-Print Network [OSTI]

    the global crude oil reserves to diminish. Therefore, there exists a need to replace petroleum as the primary

  14. Limits on deviations from the inverse-square law on megaparsec scales

    E-Print Network [OSTI]

    Carolyn Sealfon; Licia Verde; Raul Jimenez

    2005-06-29

    We present an attempt to constrain deviations from the gravitational inverse-square law on large-scale structure scales. A perturbed law modifies the Poisson equation, which implies a scale-dependent growth of overdensities in the linear regime and thus modifies the power spectrum shape. We use two large-scale structure surveys (the Sloan Digital Sky survey and the Anglo-Australian Two-degree field galaxy redshift survey) to constrain the parameters of two simple modifications of the inverse-square law. We find no evidence for deviations from normal gravity on the scales probed by these surveys (~ 10^(23) m.)

  15. Zero Emission Vehicle Program Changes In 1990, California embarked on a plan to reduce vehicle emissions to zero through the gradual introduction of

    E-Print Network [OSTI]

    Gille, Sarah T.

    12/10/01 Zero Emission Vehicle Program Changes In 1990, California embarked on a plan to reduce vehicle emissions to zero through the gradual introduction of zero emission vehicles (ZEVs). Specifically, the Air Resources Board mandated that at least 2 percent, 5 percent and 10 percent of new car sales

  16. Policy Flash 2015-23- Class Deviation to DEAR 970.5204-3

    Broader source: Energy.gov [DOE]

    SUMMARY: The attached Class Deviation to the DEAR is issued to revise the Access to and Ownership of Records clause. Contracting Officers should begin utilizing the revised version of the clause in new solicitations and contracts immediately, and commence negotiations to modify any existing contracts that contain the clause accordingly.

  17. MUSiC - An Automated Scan for Deviations between Data and Monte Carlo Simulation

    SciTech Connect (OSTI)

    Meyer, Arnd

    2010-02-10

    A model independent analysis approach is presented, systematically scanning the data for deviations from the standard model Monte Carlo expectation. Such an analysis can contribute to the understanding of the CMS detector and the tuning of event generators. The approach is sensitive to a variety of models of new physics, including those not yet thought of.

  18. Two-scale large deviations for chemical reaction kinetics through second quantization path integral

    E-Print Network [OSTI]

    Tiejun Li; Feng Lin

    2015-08-26

    Motivated by the study of the rare event for a typical genetic switching model in systems biology, we aim to establish the general two-scale large deviations for chemical reaction kinetic systems in this paper. We build a formal approach to explicitly obtain the large deviation rate functionals of the considered two-scale processes based upon the second-quantization path integral technique. This approach is shown to be superior than the well-known WKB asymptotics in giving the correct large deviation rate functionals rather than a non-unique Hamilton-Jacobi equation for the quasi-potential. We get three important types of large deviation results when the underlying two times scales are in three different regimes. This is realized by singular perturbation analysis to the rate functionals obtained by path integral. We find that the three regimes correspond to the same mean-field deterministic limit but completely different chemical Langevin approximations. The obtained results are natural extensions of the classical large volume limit in chemical reaction kinetics. Our framework and results can be applied to understand general multi-scale systems including diffusion processes.

  19. MHC Class II Tetramers and the Pursuit of Antigen-specific T cells: Define, Deviate, Delete

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 MHC Class II Tetramers and the Pursuit of Antigen-specific T cells: Define, Deviate, Delete Class II tetramers Corresponding Author: Roberto Mallone, MD Benaroya Research Institute at Virginia secretion and proliferation. The advent of MHC Class II tetramers has added a pivotal tool to our research

  20. Deviational simulation of phonon transport in graphene ribbons with ab initio scattering

    SciTech Connect (OSTI)

    Landon, Colin D.; Hadjiconstantinou, Nicolas G. [Department of Mechanical Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

    2014-10-28

    We present a deviational Monte Carlo method for solving the Boltzmann-Peierls equation with ab initio 3-phonon scattering, for temporally and spatially dependent thermal transport problems in arbitrary geometries. Phonon dispersion relations and transition rates for graphene are obtained from density functional theory calculations. The ab initio scattering operator is simulated by an energy-conserving stochastic algorithm embedded within a deviational, low-variance Monte Carlo formulation. The deviational formulation ensures that simulations are computationally feasible for arbitrarily small temperature differences, while the stochastic treatment of the scattering operator is both efficient and exhibits no timestep error. The proposed method, in which geometry and phonon-boundary scattering are explicitly treated, is extensively validated by comparison to analytical results, previous numerical solutions and experiments. It is subsequently used to generate solutions for heat transport in graphene ribbons of various geometries and evaluate the validity of some common approximations found in the literature. Our results show that modeling transport in long ribbons of finite width using the homogeneous Boltzmann equation and approximating phonon-boundary scattering using an additional homogeneous scattering rate introduces an error on the order of 10% at room temperature, with the maximum deviation reaching 30% in the middle of the transition regime.

  1. Large deviation for diffusions and Hamilton-Jacobi equation in Hilbert spaces

    E-Print Network [OSTI]

    Feng, Jin

    2006-01-01

    . Then for each f ? Cb(S) (bounded continuous functions on S), if we define ?n(f ) = n?1 logE[exp{nf (Xn)}], lim n?+? ?n(f ) = lim n?+? 1 n logE [ enf (Xn) ] = sup x?S {f (x) ? I (x)} = ?(f ).(1.1) LARGE DEVIATIONS IN HILBERT SPACE 323 (b) Suppose that {Xn...} is exponentially tight (Definition 1.17) and that the limit (1.1) exists for each f ? Cb(S). Then {Xn} satisfies the large deviation with good rate function I (x) = sup f ?Cb(S) ( f (x) ? ?(f ) ) .(1.2) See Theorems 4.3.1 and 4.4.2 in [12]. The main result in [18...

  2. Large deviation generating function for energy transport in the Pauli-Fierz model

    E-Print Network [OSTI]

    Wojciech De Roeck

    2007-11-14

    We consider a finite quantum system coupled to quasifree thermal reservoirs at different temperatures. Under the assumptions of small coupling and exponential decay of the reservoir correlation function, the large deviation generating function of energy transport into the reservoirs is shown to be analytic on a bounded set. Our method is different from the spectral deformation technique which was employed recently in the study of spin-boson-like models. As a corollary, we derive the Gallavotti-Cohen fluctuation relation for the entropy production and a central limit theorem for energy transport.

  3. Rapid Mixing of Glauber Dynamics of Gibbs Ensembles via Aggregate Path Coupling and Large Deviations Methods

    E-Print Network [OSTI]

    Yevgeniy Kovchegov; Peter T. Otto

    2015-08-11

    In this paper, we present a novel extension to the classical path coupling method to statistical mechanical models which we refer to as aggregate path coupling. In conjunction with large deviations estimates, we use this aggregate path coupling method to prove rapid mixing of Glauber dynamics for a large class of statistical mechanical models, including models that exhibit discontinuous phase transitions which have traditionally been more difficult to analyze rigorously. The parameter region for rapid mixing for the generalized Curie-Weiss-Potts model is derived as a new application of the aggregate path coupling method.

  4. AL2005-04ClassDeviation.pdf | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s s iof1AGGIE SOLAL2005-04ClassDeviation.pdf More

  5. Design, drilling, and testing of a deviated HTHP exploration well in the North Sea

    SciTech Connect (OSTI)

    Seymour, K.P.; MacAndrew, R.

    1994-12-01

    Significant quantities of hydrocarbon reserves are contained in North Sea high-temperature, high-pressure (HTHP) reservoirs. Development of these reserves will require deviated wells. This paper outlines the planning, drilling, and testing of the first deviated HTHP well in the UK Sector of the North Sea. The high temperature requires mud systems, downhole equipment, and tools designed to work at elevated temperatures. The convergence of pore and fracture pressures leads to problems owing to the narrow band of mud weight between inducing losses and inducing a kick. This aspect of these wells probably causes the most trouble. The high mud weights required for well control leads to a situation where, owing to the large difference between formation-fluid and mud pressure gradients, mud overbalance becomes so high at the bottom of long permeable hole sections that differential sticking becomes likely. These problems are magnified when drilling small-diameter directional holes. The most important single factor in controlling these problems is the mud system design.

  6. Attacks exploiting deviation of mean photon number in quantum key distribution and coin tossing

    E-Print Network [OSTI]

    Shihan Sajeed; Igor Radchenko; Sarah Kaiser; Jean-Philippe Bourgoin; Anna Pappa; Laurent Monat; Matthieu Legre; Vadim Makarov

    2015-03-30

    The security of quantum communication using a weak coherent source requires an accurate knowledge of the source's mean photon number. Finite calibration precision or an active manipulation by an attacker may cause the actual emitted photon number to deviate from the known value. We model effects of this deviation on the security of three quantum communication protocols: the Bennett-Brassard 1984 (BB84) quantum key distribution (QKD) protocol without decoy states, Scarani-Acin-Ribordy-Gisin 2004 (SARG04) QKD protocol, and a coin-tossing protocol. For QKD, we model both a strong attack using technology possible in principle, and a realistic attack bounded by today's technology. To maintain the mean photon number in two-way systems, such as plug-and-play and relativistic quantum cryptography schemes, bright pulse energy incoming from the communication channel must be monitored. Implementation of a monitoring detector has largely been ignored so far, except for ID Quantique's commercial QKD system Clavis2. We scrutinize this implementation for security problems, and show that designing a hack-proof pulse-energy-measuring detector is far from trivial. Indeed the first implementation has three serious flaws confirmed experimentally, each of which may be exploited in a cleverly constructed Trojan-horse attack. We discuss requirements for a loophole-free implementation of the monitoring detector.

  7. Parametrization of lepton mixing matrix in terms of deviations from bi-maximal and tri-bimaximl mixing

    E-Print Network [OSTI]

    Chandan Duarah; K. Sashikanta Singh; N. Nimai Singh

    2015-03-26

    We parametrize lepton mixing matrix, known as PMNS matrix, in terms of three parameters which account deviations of three mixing angles from their bi-maximal or tri-bimaximal values. On the basis of this parametrization we can determine corresponding charged lepton mixing matrix in terms of those three parameters which can deviate bi-maximal or tri-bimaximal mixing. We find that the charged lepton mixing matrices which can deviate bi-maximal mixing matrix and tri-bimaximal mixing matrix exhibit similar structures. Numerical analysis shows that these charged lepton mixing matrices are close to CKM matrix of quark sector.

  8. Gradual Typestate Roger Wolff1

    E-Print Network [OSTI]

    Aldrich, Jonathan

    of Computer Science ­ Carnegie Mellon University first.last@cs.cmu.edu 2 PLEIAD Laboratory Computer Science the properties of an object. To address this shortcoming, Strom and Yemini [26] introduced the notion

  9. Computer simulator of coiled tubing wellbore cleanouts in deviated wells recommends optimum pump rate and fluid viscosity

    SciTech Connect (OSTI)

    Walton, I.C.

    1995-12-31

    Key factors in the efficient removal of sand fill from deviated wells are the proper selection of a fluid and the pump rates. The operation should be designed to (1) reduce or eliminate the formation of beds of particles in the annulus between the casing and tubing, (2) maintain the particles in suspension and (3) transport the fill to the surface. A new design tool for coiled tubing (CT) cleanouts in deviated wells has been developed. Based on a mechanistic model of particle transport in deviated wells, it predicts the conditions under which a particle bed is formed, calculates the depth of the bed and determines whether the bed slides upward, remains stationary or slides back down the well. Moreover, it calculates the minimum pump rate required to achieve complete suspension of the fill for different fluid viscosities, sand pick-up rates and deviation angles, thereby allowing a simple assessment of the optimum design parameters.

  10. Device and method for measuring multi-phase fluid flow and density of fluid in a conduit having a gradual bend

    DOE Patents [OSTI]

    Ortiz, Marcos German (Idaho Falls, ID); Boucher, Timothy J. (Helena, MT)

    1998-01-01

    A system for measuring fluid flow in a conduit having a gradual bend or arc, and a straight section. The system includes pressure transducers, one or more disposed in the conduit on the outside of the arc, and one disposed in the conduit in a straight section thereof. The pressure transducers measure the pressure of fluid in the conduit at the locations of the pressure transducers and this information is used by a computational device to calculate fluid flow rate in the conduit. For multi-phase fluid, the density of the fluid is measured by another pair of pressure transducers, one of which is located in the conduit elevationally above the other. The computation device then uses the density measurement along with the fluid pressure measurements, to calculate fluid flow.

  11. Device and method for measuring multi-phase fluid flow and density of fluid in a conduit having a gradual bend

    DOE Patents [OSTI]

    Ortiz, M.G.; Boucher, T.J.

    1998-10-27

    A system is described for measuring fluid flow in a conduit having a gradual bend or arc, and a straight section. The system includes pressure transducers, one or more disposed in the conduit on the outside of the arc, and one disposed in the conduit in a straight section thereof. The pressure transducers measure the pressure of fluid in the conduit at the locations of the pressure transducers and this information is used by a computational device to calculate fluid flow rate in the conduit. For multi-phase fluid, the density of the fluid is measured by another pair of pressure transducers, one of which is located in the conduit elevationally above the other. The computation device then uses the density measurement along with the fluid pressure measurements, to calculate fluid flow. 1 fig.

  12. Why not only electric discharge but even a minimum charge on the surface of highly sensitive explosives can catalyze their gradual exothermic decomposition and how a cloud of unipolar charged explosive particles turns into ball lightning

    E-Print Network [OSTI]

    Meshcheryakov, Oleg

    2014-01-01

    Even a single excess electron or ion migrating on the surface of sensitive explosives can catalyze their gradual exothermic decomposition. Mechanisms underlying such a charge-induced gradual thermal decomposition of highly sensitive explosives can be different. If sensitive explosive is a polar liquid, intense charge-dipole attraction between excess surface charges and surrounding explosive molecules can result in repetitive attempts of solvation of these charges by polar explosive molecules. Every attempt of such uncompleted nonequilibrium solvation causes local exothermic decomposition of thermolabile polar molecules accompanied by further thermal jumping unsolvated excess charges to new surface sites. Thus, ionized mobile hot spots emerge on charged explosive surface. Stochastic migration of ionized hot spots on explosive surface causes gradual exothermic decomposition of the whole mass of the polar explosive. The similar gradual charge-catalyzed exothermic decomposition of both polar and nonpolar highly s...

  13. Borehole deviation surveys are necessary for hydraulic fracture monitoring Leo Eisner, Schlumberger Cambridge Research, Petr Bulant, Charles University in Prague, Jol H. Le Calvez*,

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    Borehole deviation surveys are necessary for hydraulic fracture monitoring Leo Eisner, Schlumberger Not performing accurate borehole deviation surveys for hydraulic fracture monitoring (HFM) and neglecting fracture parameters. Introduction Recently a large number of hydraulic fracture treatments have been

  14. Several small Josephson junctions in a resonant cavity: Deviation from the Dicke model W. A. Al-Saidi* and D. Stroud

    E-Print Network [OSTI]

    Stroud, David

    Several small Josephson junctions in a resonant cavity: Deviation from the Dicke model W. A. Al-Saidi

  15. Fluctuation theorem and large deviation function for a solvable model of a molecular motor

    E-Print Network [OSTI]

    D. Lacoste; A. W. C. Lau; K. Mallick

    2008-07-01

    We study a discrete stochastic model of a molecular motor. This discrete model can be viewed as a \\emph{minimal} ratchet model. We extend our previous work on this model, by further investigating the constraints imposed by the Fluctuation Theorem on the operation of a molecular motor far from equilibrium. In this work, we show the connections between different formulations of the Fluctuation Theorem. One formulation concerns the generating function of the currents while another one concerns the corresponding large deviation function, which we have calculated exactly for this model. A third formulation of FT concerns the ratio of the probability of making one forward step to the probability of making one backward step. The predictions of this last formulation of the Fluctuation Theorem adapted to our model are in very good agreement with the data of Carter and Cross [Nature, {\\bf 435}, 308 (2005)] on single molecule measurements with kinesin. Finally, we show that all the formulations of FT can be understood from the notion of entropy production.

  16. Large deviations of the maximum of independent and identically distributed random variables

    E-Print Network [OSTI]

    Pierpaolo Vivo

    2015-07-20

    A pedagogical account of some aspects of Extreme Value Statistics (EVS) is presented from the somewhat non-standard viewpoint of Large Deviation Theory. We address the following problem: given a set of $N$ i.i.d. random variables $\\{X_1,\\ldots,X_N\\}$ drawn from a parent probability density function (pdf) $p(x)$, what is the probability that the maximum value of the set $X_{\\mathrm{max}}=\\max_i X_i$ is "atypically larger" than expected? The cases of exponential and Gaussian distributed variables are worked out in detail, and the right rate function for a general pdf in the Gumbel basin of attraction is derived. The Gaussian case convincingly demonstrates that the full rate function cannot be determined from the knowledge of the limiting distribution (Gumbel) alone, thus implying that it indeed carries additional information. Given the simplicity and richness of the result and its derivation, its absence from textbooks, tutorials and lecture notes on EVS for physicists appears inexplicable.

  17. Large-deviation principles, stochastic effective actions, path entropies, and the structure and meaning of thermodynamic descriptions

    E-Print Network [OSTI]

    Eric Smith

    2011-02-18

    The meaning of thermodynamic descriptions is found in large-deviations scaling of the fluctuations probabilities. The primary large-deviations rate function is the entropy, which is the basis for both fluctuation theorems and for characterizing the thermodynamic interactions of systems. Freidlin-Wentzell theory provides a general formulation of large-deviations scaling for non-equilibrium stochastic processes, through a representation in terms of a Hamiltonian dynamical system. A number of related methods now exist to construct the Freidlin-Wentzell Hamiltonian for many kinds of stochastic processes; one method due to Doi and Peliti, appropriate to integer counting statistics, is widely used in reaction-diffusion theory. Using these tools together with a path-entropy method due to Jaynes, we show how to construct entropy functions that both express large-deviations scaling of fluctuations, and describe system-environment interactions, for discrete stochastic processes either at or away from equilibrium. A collection of variational methods familiar within quantum field theory, but less commonly applied to the Doi-Peliti construction, is used to define a "stochastic effective action", which is the large-deviations rate function for arbitrary non-equilibrium paths. We show how common principles of entropy maximization, applied to different ensembles of states or of histories, lead to different entropy functions and different sets of thermodynamic state variables. Yet the relations of among all these levels of description may be constructed explicitly and understood in terms of information conditions. The example systems considered introduce methods that may be used to systematically construct descriptions with all the features familiar from equilibrium thermodynamics, for a much wider range of systems describable by stochastic processes.

  18. Improved blade profile loss and deviation angle models for advanced transonic compressor bladings. Part 1: A model for subsonic flow

    SciTech Connect (OSTI)

    Koenig, W.M.; Hennecke, D.K.; Fottner, L.

    1996-01-01

    New blading concepts as used in modern transonic axial-flow compressors require improved loss and deviation angle correlations. The new model presented in this paper incorporates several elements and treats blade-row flows having subsonic and supersonic inlet conditions separately. In the first part of this paper two proved and well-established profile loss correlations for subsonic flows are extended to quasi-two-dimensional conditions and to custom-tailored blade designs. Instead of a deviation angle correlation, a simple method based on singularities is utilized. The comparison between the new model and a recently published model demonstrates the improved accuracy in prediction of cascade performance achieved by the new model.

  19. Effects of the deviation characteristics of nuclear waste emplacement boreholes on borehole liner stresses; Yucca Mountain Project

    SciTech Connect (OSTI)

    Glowka, D.A.

    1990-09-01

    This report investigates the effects of borehole deviation on the useability of lined boreholes for the disposal of high-level nuclear waste at the proposed Yucca Mountain Repository in Nevada. Items that lead to constraints on borehole deviation include excessive stresses that could cause liner failure and possible binding of a waste container inside the liner during waste emplacement and retrieval operations. Liner stress models are developed for two general borehole configurations, one for boreholes drilled with a steerable bit and one for boreholes drilled with a non-steerable bit. Procedures are developed for calculating liner stresses that arise both during insertion of the liner into a borehole and during the thermal expansion process that follows waste emplacement. The effects of borehole curvature on the ability of the waste container to pass freely inside the liner without binding are also examined. Based on the results, specifications on borehole deviation allowances are developed for specific vertical and horizontal borehole configurations of current interest. 11 refs., 22 figs., 4 tabs.

  20. Why not only electric discharge but even a minimum charge on the surface of highly sensitive explosives can catalyze their gradual exothermic decomposition and how a cloud of unipolar charged explosive particles turns into ball lightning

    E-Print Network [OSTI]

    Oleg Meshcheryakov

    2013-07-17

    Even a single excess electron or ion migrating on the surface of sensitive explosives can catalyze their gradual exothermic decomposition. Mechanisms underlying such a charge-induced gradual thermal decomposition of highly sensitive explosives can be different. If sensitive explosive is a polar liquid, intense charge-dipole attraction between excess surface charges and surrounding explosive molecules can result in repetitive attempts of solvation of these charges by polar explosive molecules. Every attempt of such uncompleted nonequilibrium solvation causes local exothermic decomposition of thermolabile polar molecules accompanied by further thermal jumping unsolvated excess charges to new surface sites. Thus, ionized mobile hot spots emerge on charged explosive surface. Stochastic migration of ionized hot spots on explosive surface causes gradual exothermic decomposition of the whole mass of the polar explosive. The similar gradual charge-catalyzed exothermic decomposition of both polar and nonpolar highly sensitive explosives can be also caused by intense charge-dipole attacks of surrounding water vapor molecules electrostatically attracted from ambient humid air and strongly accelerated towards charged sites on explosive surfaces. Emission of electrons, photons and heat from ionized hot spots randomly migrating on charged surface of highly sensitive explosive aerosol nanoparticles converts such particles into the form of short-circuited thermionic nanobatteries.

  1. Geophysical Prospecting, 2007, 55, 891899 doi:10.1111/j.1365-2478.2007.00654.x Importance of borehole deviation surveys for monitoring of hydraulic

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    of borehole deviation surveys for monitoring of hydraulic fracturing treatments Petr Bulant1 , Leo Eisner2 accepted April 2007 ABSTRACT During seismic monitoring of hydraulic fracturing treatment, it is very common to ig- nore the deviations of the monitoring or treatment wells from their assumed positions

  2. How the “main condition” of phase stability can explain the effect of the velocity deviation of secondary electrons in DC-biased single-sided multipactors

    SciTech Connect (OSTI)

    Mostajeran, M.

    2014-11-15

    In this work, a “main condition” for phase stability has been employed to investigate the effects of the velocity deviation of the electrons in DC-biased single-sided multipactors (MPs). In a previous study [M. Mostajeran, Phys. Plasmas 21, 053108 (2014)], a stability equation was derived, where the secondary electron was assumed to have zero initial velocity and the phase deviation from the resonant phase was considered. In this work, both deviations in phase and velocity from the resonant condition are taken into account, assuming nonzero initial velocity for the secondary electrons. Using the main condition for stability, it is shown that MP discharge can rise in situations, where large velocity deviations from initial velocity and large phase deviations from resonant phase exist. This is contrary to what can be predicted on the basis of the “simple stability condition.” This result is further confirmed by numerical simulations.

  3. Testing AdS/CFT Deviations from pQCD Heavy Quark Energy Loss with Pb+Pb at LHC

    E-Print Network [OSTI]

    W. A. Horowitz; M. Gyulassy

    2007-06-15

    Heavy quark jet quenching in nuclear collisions at LHC is predicted and compared using the classical gravity AdS/CFT correspondence and Standard Model perturbative QCD. The momentum independence and inverse quark mass dependence of the drag coefficient in AdS/CFT differs substantially from the characteristic log(pT/M)/pT variation of the drag in QCD. We propose that the measurement of the momentum dependence of the double ratio of the nuclear modification factors of charm and bottom jets is a robust observable that can be used to search for strong coupling deviations from perturbative QCD predictions.

  4. Deviations from tribimaximal mixing due to the vacuum expectation value misalignment in A{sub 4} models

    SciTech Connect (OSTI)

    Barry, James; Rodejohann, Werner

    2010-05-01

    The addition of an A{sub 4} family symmetry and extended Higgs sector to the standard model can generate the tribimaximal mixing pattern for leptons, assuming the correct vacuum expectation value alignment of the Higgs scalars. Deviating this alignment affects the predictions for the neutrino oscillation and neutrino mass observables. An attempt is made to classify the plethora of models in the literature, with respect to the chosen A{sub 4} particle assignments. Of these models, two particularly popular examples have been analyzed for deviations from tribimaximal mixing by perturbing the vacuum expectation value alignments. The effect of perturbations on the mixing angle observables is studied. However, it is only investigation of the mass-related observables (the effective mass for neutrinoless double beta decay and the sum of masses from cosmology) that can lead to the exclusion of particular models by constraints from future data, which indicates the importance of neutrino mass in disentangling models. The models have also been tested for fine-tuning of the parameters. Furthermore, a well-known seesaw model is generalized to include additional scalars, which transform as representations of A{sub 4} not included in the original model.

  5. Imprints of deviations from the gravitational inverse-square law on the power spectrum of mass fluctuations

    E-Print Network [OSTI]

    M. Sereno; J. A. Peacock

    2006-05-19

    Deviations from the gravitational inverse-square law would imprint scale-dependent features on the power spectrum of mass density fluctuations. We model such deviations as a Yukawa-like contribution to the gravitational potential and discuss the growth function in a mixed dark matter model with adiabatic initial conditions. Evolution of perturbations is considered in general non-flat cosmological models with a cosmological constant, and an analytical approximation for the growth function is provided. The coupling between baryons and cold dark matter across recombination is negligibly affected by modified gravity physics if the proper cutoff length of the long-range Yukawa-like force is > 10 h^{-1} Mpc. Enhancement of gravity affects the subsequent evolution, boosting large-scale power in a way that resembles the effect of a lower matter density. This phenomenon is almost perfectly degenerate in power-spectrum shape with the effect of a background of massive neutrinos. Back-reaction on density growth from a modified cosmic expansion rate should however also affect the normalization of the power spectrum, with a shape distortion similar to the case of a non-modified background.

  6. Averaging and large deviation principles for fully-coupled piecewise deterministic Markov processes and applications to molecular motors

    E-Print Network [OSTI]

    A. Faggionato; D. Gabrielli; M. Ribezzi Crivellari

    2008-09-16

    We consider Piecewise Deterministic Markov Processes (PDMPs) with a finite set of discrete states. In the regime of fast jumps between discrete states, we prove a law of large number and a large deviation principle. In the regime of fast and slow jumps, we analyze a coarse-grained process associated to the original one and prove its convergence to a new PDMP with effective force fields and jump rates. In all the above cases, the continuous variables evolve slowly according to ODEs. Finally, we discuss some applications related to the mechanochemical cycle of macromolecules, including strained--dependent power--stroke molecular motors. Our analysis covers the case of fully--coupled slow and fast motions.

  7. Improved blade profile loss and deviation angle models for advanced transonic compressor bladings. Part 2: A model for supersonic flow

    SciTech Connect (OSTI)

    Koenig, W.M.; Hennecke, D.K.; Fottner, L.

    1996-01-01

    New blading concepts as used in modern transonic axial-flow compressors require improved loss and deviation angle correlations. The new model presented in this paper incorporates several elements and treats blade-row flows having subsonic and supersonic inlet conditions separately. The second part of the present report focuses on the extension of a well-known correlation for cascade losses at supersonic inlet flows. It was originally established for DCA bladings and is now modified to reflect the flow situation in blade rows having low-cambered, arbitrarily designed blades including precompression blades. Finally, the steady loss increase from subsonic to supersonic inlet-flow velocities demonstrates the matched performance of the different correlations of the new model.

  8. Standard deviation Chebychev's inequality

    E-Print Network [OSTI]

    Adler, Robert J.

    , is no more than 1/(-1.1333)2 = 0.779. · BUT, these are bounds and not approximations. In partic- ular, Chebychev's inequality is not good for k near 1, and useless for k

  9. Inequalities/Large Deviations

    E-Print Network [OSTI]

    2015-11-11

    8. Estimation theorems. Gameplan: Chapter 8.2 Markov inequality and Chebychev inequality Chapter 8.4. Jensens inequality and Chernov Bounds. Theorem ...

  10. Large deviations in stochastic heat-conduction processes provide a gradient-flow structure for heat conduction

    SciTech Connect (OSTI)

    Peletier, Mark A., E-mail: m.a.peletier@tue.nl [Department of Mathematics and Computer Science and Institute for Complex Molecular Systems, Technische Universiteit Eindhoven, Postbus 513, 5600 MB Eindhoven (Netherlands); Redig, Frank, E-mail: f.h.j.redig@tudelft.nl [Delft Institute of Applied Mathematics, Technische Universiteit Delft, Mekelweg 4, 2628 CD Delft (Netherlands); Vafayi, Kiamars, E-mail: k.vafayi@tue.nl [Department of Mathematics and Computer Science, Technische Universiteit Eindhoven, Postbus 513, 5600 MB Eindhoven (Netherlands)

    2014-09-01

    We consider three one-dimensional continuous-time Markov processes on a lattice, each of which models the conduction of heat: the family of Brownian Energy Processes with parameter m (BEP(m)), a Generalized Brownian Energy Process, and the Kipnis-Marchioro-Presutti (KMP) process. The hydrodynamic limit of each of these three processes is a parabolic equation, the linear heat equation in the case of the BEP(m) and the KMP, and a nonlinear heat equation for the Generalized Brownian Energy Process with parameter a (GBEP(a)). We prove the hydrodynamic limit rigorously for the BEP(m), and give a formal derivation for the GBEP(a). We then formally derive the pathwise large-deviation rate functional for the empirical measure of the three processes. These rate functionals imply gradient-flow structures for the limiting linear and nonlinear heat equations. We contrast these gradient-flow structures with those for processes describing the diffusion of mass, most importantly the class of Wasserstein gradient-flow systems. The linear and nonlinear heat-equation gradient-flow structures are each driven by entropy terms of the form -log ?; they involve dissipation or mobility terms of order ?² for the linear heat equation, and a nonlinear function of ? for the nonlinear heat equation.

  11. Do diminishing marginal returns apply to DSM?

    SciTech Connect (OSTI)

    Sioshansi, F.P.

    1994-05-01

    The U.S. electric power industry is currently spending approximately $2 billion annually on demand-side management (DSM) programs, a substantial increase over just a few years ago. The level of DSM spending is expected to continue to grow in the foreseeable future, according to various industry surveys. Environmental benefits are among the chief assumed - and expected - benefits of DSM. In fact, the answer to how much cost-effective and achievable DSM is available depends, to some extent, on whether the value of environmental benefits of DSM is considered explicitly or implicitly. Several states now specifically require the environmental effect of alternative supply or demand options to be considered in utility resource-planning decisions. On the surface, it seems plausible that, assuming the current level of DSM is `good` for the environment, an even more aggressive level of DSM would be even better. Carrying this line of argument a step further would suggest that a highly aggressive DSM strategy, coupled with a heavy dose of nonpolluting renewable energy technologies, would eliminate the need for all new supply-side resources and be the closest thing to achieving nirvana - low-cost, environmentally benign electricity service - in utility resource planning. Those advocating such a strategy argue that is is not only justified from an environmental point of view, but also from an economic perspective, because it is the cheapest course of action to follow.

  12. How to convert gradually to oil-refinery hydrocracking

    SciTech Connect (OSTI)

    Basta, N.

    1986-01-06

    Over the past ten years, demand for refined petroleum products has been relatively constant, primarily because of worldwide conservation efforts. In fact, the demand for residual fuels has actually declined, while the market for gasoline has risen just slightly. Only middle distillates, which have seen a moderate increase since 1975, will continue to rise slowly over the next several years, says UOP Inc., a Des Plaines, Illinois, division of Allied-Signal Inc. This rise, coupled with the decline in resid demand, dictates the need for conversion capacity that will be capable of selectively producing distillate products. Traditionally, this need has been filled by hydrocracking gas oils to distillates. However, full conversion to hydrocracking requires high capital investment, which may not be possible in today's competitive refining industry. As a solution to this problem, UOP has developed a staged approach to distillate production, which allows the refiner both to phase in capital costs and to increase production over a number of years, says Mark Reno, manager of hydrocracking process development. The staged approach involves (1) constructing a mild-hydrocracking (MHC) unit that would produce less distillate, but at a lower cost; (2) upgrading to full conversion at a later date. The aldready-installed MHC equipment would be used with only minor modifications. UOP offers its own mild/full hydrocracking technology, called unibon; the firm says it can also convert a customer's existing hydrotreating equipment.

  13. A Gradual Reawakening: Broadacre City and a New American Agrarianism

    E-Print Network [OSTI]

    Wise, Ella

    2013-01-01

    Green Development, and Renewable Energy. 2nd ed. AmericanCritical Agrarianism. ” Renewable Agriculture and Food

  14. A Gradual Reawakening: Broadacre City and a New American Agrarianism

    E-Print Network [OSTI]

    Wise, Ella

    2013-01-01

    Urban Agriculture from Detroit, Michigan. ” Urban Geographysites in the city of Detroit, Michigan alone (Colasanti,

  15. A Gradual Reawakening: Broadacre City and a New American Agrarianism

    E-Print Network [OSTI]

    Wise, Ella

    2013-01-01

    Urbanism, Green Development, and Renewable Energy. 2nd ed.forgets the ‘green,’ concentrating on energy efficiency and

  16. Site assessment standards emerge, evolve gradually from several sources

    SciTech Connect (OSTI)

    Bryant, M.E. (M T AGRA Inc., Anaheim, CA (United States))

    1993-03-01

    Since the early 1980s, potential environmental liability associated with hazardous materials and other regulated substances has been important to anyone involved in real estate transactions. Under CERCLA, commercial and industrial property owners are potentially responsible for contamination discovered on their property. If private parties fail to clean up contaminated property, EPA may recover remedial and other costs from those it designates as potentially responsible parties (PRPs). CERCLA effectively obligates buyers and certain lenders to conduct due diligence to ascertain whether a property is contaminated. Buyers of property who fail to conduct such inquiries can be held responsible for site cleanup. CERCLA releases property buyers from liability only if contamination occurred before the property was transferred, and if the buyer can establish a lack of knowledge or reason to know about the contamination at the time of purchase. Under CERCLA, a buyer must have undertaken, at the time of acquisition, all appropriate inquiry into the previous ownership and uses of the property consistent with good commercial or customary practice in an effort to minimize liability.

  17. Large Deviations for Stochastic Volterra Equations

    E-Print Network [OSTI]

    Nualart, David; Rovira, Carles

    2000-04-01

    with N â :? T 1ÿâ K 2 Z ? T áÿâ C Z and ø(x) ? exp(x 2 =4), x 2 R. Let B ? ? T 0 ? T 0 ø I(t)ÿ I(r) r(jt ÿ rj) #18; #19; dt dr: For ®xed r , t, we consider the continuous F u -martingale de®ned by M u ? ? u 0 g t,r (s) r(jt ÿ rj) dW s , with quadratic... variation hMi u < ? T 0 g 2 t,r (s) r 2 (jt ÿ rj) ds < T 1ÿâ kZk 2 1 ? T áÿâ î N â , for 0 < u < T. Set A ? fkZk 1 < K Z , î < C Z g. Note that on the set A we have hMi T < 1. Then E ø I(t)ÿ I(r) r(jt ÿ rj) #18; #19; 1 A #20; #21; ? E exp M 2 T 4 #18; #19; 1...

  18. High temperature thermal insulating composite

    DOE Patents [OSTI]

    Brassell, Gilbert W. (Golden, CO); Lewis, Jr., John (Oak Ridge, TN)

    1983-01-01

    A composite contains in one region graphite flakes and refractory fibers in arbonized polymeric resin and in an adjacent region a gradually diminishing weight proportion of graphite flakes, refractory fibers, and the same carbonized resin.

  19. 069 MCNITORINGTHE GROWTH OF SEODNDARYPRECIPITATES UPON METALSORPTICN CM CLAY MINERALS AND ALUMINUM OXIDES USING X-RAY ABSORPTICN FINE STRUCIURE (XAFS)

    E-Print Network [OSTI]

    Sparks, Donald L.

    069 MCNITORINGTHE GROWTH OF SEODNDARYPRECIPITATES UPON METALSORPTICN CM CLAY MINERALS AND ALUMINUM and oxide minerals is typically fast initially, then the rates gradually diminish. In the literature on surfaces of clay minerals and aluminum oxides. #12;

  20. Effect of Residence Time on Ni-Sorption Mechanisms on Clay and Oxide Minerals: An X-ray Absorption Fine Structure (XAFS) Study

    E-Print Network [OSTI]

    Sparks, Donald L.

    Effect of Residence Time on Ni-Sorption Mechanisms on Clay and Oxide Minerals: An X-ray Absorption minerals is typically fast initially, then the rates gradually diminish. In the literature the decline

  1. Growing the gas-giant planets by the gradual accumulation of pebbles

    E-Print Network [OSTI]

    Levison, Harold F; Duncan, Martin J

    2015-01-01

    It is widely held that the first step in forming the gas giant planets, such as Jupiter and Saturn, is to form solid `cores' of roughly 10 M$_\\oplus$. Getting the cores to form before the solar nebula dissipates ($\\sim\\!1-10\\,$Myr) has been a major challenge for planet formation models. Recently models have emerged in which `pebbles' (centimeter- to meter-size objects) are first concentrated by aerodynamic drag and then gravitationally collapse to form 100 --- 1000 km objects. These `planetesimals' can then efficiently accrete leftover pebbles and directly form the cores of giant planets. This model known as `pebble accretion', theoretically, can produce 10 M$_\\oplus$ cores in only a few thousand years. Unfortunately, full simulations of this process show that, rather than creating a few 10 M$_\\oplus$ cores, it produces a population of hundreds of Earth-mass objects that are inconsistent with the structure of the Solar System. Here we report that this difficulty can be overcome if pebbles form slowly enough t...

  2. Gradual time reversal in thermo-and photo-acoustic tomography within a resonant

    E-Print Network [OSTI]

    Kunyansky, Leonid

    , thermoacoustic tomography, time reversal, resonant cavity, reflecting walls, wave equation 1. Introduction Thermoacoustic tomography (TAT) [23, 44] and photoacoustic (or optoacoustic) tomography (PAT/OAT) [9, 22, 33] are based on the thermoacoustic effect: when a material is heated it expands. To perform measurements

  3. MOLECULAR SIEVING ACTION OF THE CELL MEMBRANE DURING GRADUAL OSMOTIC HEMOLYSIS

    E-Print Network [OSTI]

    MacGregor II, R.D.

    2010-01-01

    R.F. and N.R. Gillis, 1969. Osmotic hemolysis of chemicallyEffect of cytochalasin B on the osmotic fragility of humanJ. Gen. Physiol. 40: 79-94. Osmotic properties of Schachman,

  4. Computational Strategies for Non-convex Multistage MINLP Models with Decision-Dependent Uncertainty and Gradual

    E-Print Network [OSTI]

    Grossmann, Ignacio E.

    Pittsburgh, PA 15213 Vikas Goel ExxonMobil Upstream Research Company, Houston, TX 77098 Abstract In many that involve uncertainty in the data which are represented by probability distributions. There are two broad E

  5. Music as a Gradual Lostness: A Performer's Guide to the Phase Music of Steve Reich

    E-Print Network [OSTI]

    Flickinger, Kelly Lawrence

    2012-01-01

    Web. Reich, Steve. Clapping Music for two performers (1972).of Beat-Class Sets in Steve Reich’s Phase Shifting Music. ”Perspectives of New Music 30.2 (Summer 1992): 146-177. Web.

  6. Goals: Understand how evolution works through gradual changes over time. Correlate DNA sequence conservation with evolution.

    E-Print Network [OSTI]

    Campbell, A. Malcolm

    understanding of evolution of species? 5) Genomics and Human Genome Project What is a genome? What is the human genome project? Mystery Sequences 1 ­ 18 #1 GCTTACGACCATATCACGTTGAATGCACGCCATCCCGTCCGATCTGGCAAGTTAAGCAAC

  7. MOLECULAR SIEVING ACTION OF THE CELL MEMBRANE DURING GRADUAL OSMOTIC HEMOLYSIS

    E-Print Network [OSTI]

    MacGregor II, R.D.

    2010-01-01

    ra d' C , (X) JUS d *monomer dimer trimer tetramer monomerdimer *tetramer octamermonomer dimer *tetramer 20.6 f ) 23.6 f ) Hemoglobin

  8. Music as a Gradual Lostness: A Performer's Guide to the Phase Music of Steve Reich

    E-Print Network [OSTI]

    Flickinger, Kelly Lawrence

    2012-01-01

    7 (1993): 149-178. Web Schick, Steven. The Percussionist’sAs percussionist Steven Schick points out, “What separates [October 1999) 73. Steven Schick, The Percussionist’s Art

  9. Rapid and gradual modes of aerosol trace metal dissolution in seawater

    E-Print Network [OSTI]

    Mackey, KRM; Chien, CT; Post, AF; Saito, MA; Paytan, A

    2015-01-01

    Atlantic,” in Trace Metals in Seawater, NATO Conferencesolubility of trace metals from natural and anthropogenicresponses to atmospheric metal deposi- tion in the coastal

  10. Gradual Release of Strongly Bound Nitric Oxide from Fe2(NO)2...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    over the course of more than 10 days, suggesting it, and potential future iron(II)-based metal-organic frameworks, are good candidates for certain biomedical applications...

  11. SOFC Long Term Operation in Pure Methane by Gradual Internal Reforming S. Georgesa

    E-Print Network [OSTI]

    Boyer, Edmond

    , syngas) or renewable fuels (biogas, waste fuels, bioethanol), is a huge actual challenge whose success

  12. MOLECULAR SIEVING ACTION OF THE CELL MEMBRANE DURING GRADUAL OSMOTIC HEMOLYSIS

    E-Print Network [OSTI]

    MacGregor II, R.D.

    2010-01-01

    Res. Commun. 61: 30-37. Marinkovic, D.V. and L.F. Smith,Travnicek et al. , 1967; Marinkovic and Smith, 1970; Stein,

  13. Partisan Pathways to Racial Realignment: The Gradual Realignment of Race and Party in the Twentieth Century

    E-Print Network [OSTI]

    Butler, Sara Marie

    2015-01-01

    as the state was home to shipyards and industries criticalCorporation operated various shipyards in California and wasthat mandated that all shipyard workers join a union.

  14. Gradual Release of Strongly Bound Nitric Oxide from Fe2(NO)2(dobdc) |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid you not findGeoscience/EnvironmentGlobal Security GlobalGlossaryCenter

  15. Deviation from the Knudsen law on quantum gases

    SciTech Connect (OSTI)

    Babac, Gulru

    2014-12-09

    Gas flow in micro/nano scale systems has been generally studied for the Maxwell gases. In the limits of very low temperature and very confined domains, the Maxwellian approximation can break down and the quantum character of the gases becomes important. In these cases, Knudsen law, which is one of the important equations to analyze rarefied gas flows is invalid and should be reanalyzed for quantum gases. In this work, the availability of quantum gas conditions in the high Knudsen number cases is discussed and Knudsen law is analyzed for quantum gases.

  16. New Rotary Engine Designs by Deviation Function Method

    E-Print Network [OSTI]

    Warren, Sarah

    2012-01-01

    Kenichi Hayasaka. Noncircular Gears: Design and Generation.involved in noncircular gear design, most of the relevantDesign, analysis and realisation of a high-performance magnetic gear.

  17. New Twin Screw Compressor Design by Deviation Function Method

    E-Print Network [OSTI]

    Huang, Chih-Yung

    2015-01-01

    Gear Geometry," Transaction of ASME: Journal of Mechanical Design,Gear Pump," Trans. ASME Journal of Mechanisms, and Transmissions, and Automation in Design,design is an oil-free compressor and is driven by a pair of timing gears.

  18. Detecting Deviations from Usual Medical Care James Mezger1

    E-Print Network [OSTI]

    Hauskrecht, Milos

    administration models generated from the training data, 9 fell above the thresholds set for AUROC and HLS p-value a logistic regression model was constructed from the training set and applied to the test set to predict) and the p-value of the Hosmer-Lemeshow statistic (HLS) was computed for each medication model. Models

  19. 5 Thermodynamics 5.1 Deviations from Equilibrium

    E-Print Network [OSTI]

    Cambridge, University of

    to allotriomorphic ferrite, equivalent to about 0.04 in units of RTM, where R is the Gas Constant and TM the absolute of phase into parts which are attributed to the individual components. This leads to the concept

  20. New Twin Screw Compressor Design by Deviation Function Method

    E-Print Network [OSTI]

    Huang, Chih-Yung

    2015-01-01

    of ASME - Journal of Mechanical Design, vol. 121, no. 4, pp.of ASME - Journal of Mechanical Design, vol. 122, pp. 536- [of ASME - Journal of Mechanical Design, vol. 130, p. 092601–

  1. Deviation probability bounds for fractional martingales and related remarks

    E-Print Network [OSTI]

    Saussereau, Bruno

    2012-01-01

    In this paper we prove exponential inequalities (also called Bernstein's inequality) for fractional martingales. As an immediate corollary, we will discuss weak law of large numbers for fractional martingales under divergence assumption on the $\\beta-$variation of the fractional martingale. A non trivial example of application of this convergence result is proposed.

  2. Numerical Simulation of Mud-Filtrate Invasion in Deviated Wells

    E-Print Network [OSTI]

    Torres-Verdín, Carlos

    permeability, relative permeability, pore pressure, shale chem- istry, capillary pressure, and residual fluid, capillary pressure, permeability anisotropy, dipping layers, and degree of hydraulic communication between density and chemistry, mud circulation pressure, and time of fil- tration may all significantly affect

  3. New Rotary Engine Designs by Deviation Function Method

    E-Print Network [OSTI]

    Warren, Sarah

    2012-01-01

    Examples of rotary engine design . . . . . . . . . . . .Rotary Engine Design by Apex Seal7 Rotary Engine Profiles from Noncircular Pitch Curves

  4. New Rotary Engine Designs by Deviation Function Method

    E-Print Network [OSTI]

    Warren, Sarah

    2012-01-01

    of apex seals in a Wankel engine, R = 105 mm. . . . . . . .of 2 mm apex seals in a Wankel engine, R = 105 mm. . .9] D. E. Cole. The wankel engine. Scientific American, 227:

  5. New Rotary Engine Designs by Deviation Function Method

    E-Print Network [OSTI]

    Warren, Sarah

    2012-01-01

    of apex seals in a Wankel engine, R = 105 mm. . . . . . . .2 mm apex seals in a Wankel engine, R = 105 mm. . . Radius9] D. E. Cole. The wankel engine. Scientific American, 227:

  6. ACCESS TO AND OWNERSHIP OF RECORDS (OCT 2014) (DEVIATION

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram:Y-12 Beta-3 Racetracks25 AMOSystem forAAPGABENGOA

  7. Diminished Defenses In Children May Lead To Increased Susceptibility To Inflammatory Effects of Air Pollutants

    E-Print Network [OSTI]

    Lin, Erina May

    2012-01-01

    et al. , Outdoor air pollution and uncontrolled asthma in142-7. Schwartz, J. , Air pollution and children's health.OEHHA), O.o.E.H.H.A. Air Pollution and Children's Health.

  8. APPLICATION OF A SYMMETRIC TOTAL VARIATION DIMINISHING SCHEME TO AERODYNAMICS OF ROTORS

    E-Print Network [OSTI]

    and present members of CFD lab for their warm friendship and support during my years in the lab. I am thanks to the former and present members of our CFD Lab: Saeid Niazi, Alex Stein, Mehmet Sahin, Guanpeng Benjanirat, and Sujeet Phanse. I would also like to thank my friends and colleagues in the Combustion Lab

  9. An Analysis of Motor System Optimization Options- A Question of Diminishing Return on Investment 

    E-Print Network [OSTI]

    Wroblewski, R. G.; Herro, M.; Schiebel, S.; Waffenschmidt, D.

    1997-01-01

    This paper presents the verified results of a pump system optimization project at a major midwestern brewery. A 150-horsepower "sweet water" pump circulates a glycol/water solution to cool tanks of beer during fermentation. To keep the pump from...

  10. Inhibition of K+ permeability diminishes alpha 2-adrenoceptor mediated effects on norepinephrine release

    SciTech Connect (OSTI)

    Zimanyi, I.; Folly, G.; Vizi, E.S.

    1988-05-01

    The effect of two different potassium channel blockers, 4-aminopyridine (4-AP) and quinine, on the alpha 2-adrenoceptor mediated modulation of norepinephrine (NE) release was investigated. Pairs of mouse vasa deferentia were loaded with /sup 3/H-norepinephrine (/sup 3/H-NE), superfused continuously, and stimulated electrically. 4-AP (5.3 x 10(-4) M), and quinine (10(-5) M) enhanced the stimulation-evoked release of tritium significantly. The electrically induced release of radioactivity was reduced by alpha 2-adrenoceptor agonists (1-NE and xylazine) and enhanced by the alpha 2-adrenoceptor antagonist yohimbine. Both effects were affected markedly by 4-AP or quinine: the depressant action of 1-NA and xylazine was partially antagonized and the facilitatory effect of yohimbine was completely abolished during the blockade of the potassium channels. It is suggested that the blockade of the potassium permeability counteracts negative feedback modulation; therefore, it seems likely that the stimulation of alpha 2-adrenoceptors leads to an enhanced potassium permeability and hyperpolarization of varicose axon terminals.

  11. Diminished Hopes: The United States and the United Nations During the Truman Years

    E-Print Network [OSTI]

    LEBE, MELVIN STANTON

    2012-01-01

    Cold War and the National Security State. (Boston: HoughtonA Preponderance of Power: National Security, The TrumanNations. ” 77 A 1948 National Security Council (NSC) report

  12. Motor learning and its sensory effects: time course of perceptual change and its presence with gradual introduction of load

    E-Print Network [OSTI]

    Malfait, Nicole

    Motor learning and its sensory effects: time course of perceptual change and its presence 2012 Mattar AA, Darainy M, Ostry DJ. Motor learning and its sensory effects: time course of perceptual motor and sensory systems. We showed recently that motor learning leads to changes in the sensed

  13. Device and method for measuring multi-phase fluid flow in a conduit having an abrupt gradual bend

    DOE Patents [OSTI]

    Ortiz, M.G.

    1998-02-10

    A system is described for measuring fluid flow in a conduit having an abrupt bend. The system includes pressure transducers, one disposed in the conduit at the inside of the bend and one or more disposed in the conduit at the outside of the bend but spaced a distance therefrom. The pressure transducers measure the pressure of fluid in the conduit at the locations of the pressure transducers and this information is used by a computational device to calculate fluid flow rate in the conduit. For multi-phase fluid, the density of the fluid is measured by another pair of pressure transducers, one of which is located in the conduit elevationally above the other. The computation device then uses the density measurement along with the fluid pressure measurements, to calculate fluid flow. 1 fig.

  14. Device and method for measuring multi-phase fluid flow in a conduit having an abrupt gradual bend

    DOE Patents [OSTI]

    Ortiz, Marcos German (Idaho Falls, ID)

    1998-01-01

    A system for measuring fluid flow in a conduit having an abrupt bend. The system includes pressure transducers, one disposed in the conduit at the inside of the bend and one or more disposed in the conduit at the outside of the bend but spaced a distance therefrom. The pressure transducers measure the pressure of fluid in the conduit at the locations of the pressure transducers and this information is used by a computational device to calculate fluid flow rate in the conduit. For multi-phase fluid, the density of the fluid is measured by another pair of pressure transducers, one of which is located in the conduit elevationally above the other. The computation device then uses the density measurement along with the fluid pressure measurements, to calculate fluid flow.

  15. Hyaluronan suppresses prostate tumor cell proliferation through diminished expression of N-cadherin and aberrant growth factor receptor signaling

    SciTech Connect (OSTI)

    Bharadwaj, Alamelu G.; Goodrich, Nathaniel P.; McAtee, Caitlin O.; Haferbier, Katie [Department of Biochemistry, University of Nebraska, Lincoln, NE 68588 (United States)] [Department of Biochemistry, University of Nebraska, Lincoln, NE 68588 (United States); Oakley, Gregory G.; Wahl, James K. [Department of Oral Biology, University of Nebraska College of Dentistry, Lincoln, NE 68588 (United States)] [Department of Oral Biology, University of Nebraska College of Dentistry, Lincoln, NE 68588 (United States); Simpson, Melanie A., E-mail: msimpson2@unl.edu [Department of Biochemistry, University of Nebraska, Lincoln, NE 68588 (United States); Eppley Cancer Center, University of Nebraska Medical Center, Omaha, NE 68198 (United States)

    2011-05-01

    Hyaluronan (HA) production has been functionally implicated in prostate tumorigenesis and metastasis. We previously used prostate tumor cells overexpressing the HA synthesizing enzyme HAS3 or the clinically relevant hyaluronidase Hyal1 to show that excess HA production suppresses tumor growth, while HA turnover accelerates spontaneous metastasis from the prostate. Here, we examined pathways responsible for effects of HAS3 and Hyal1 on tumor cell phenotype. Detailed characterization of cell cycle progression revealed that expression of Hyal1 accelerated cell cycle re-entry following synchronization, whereas HAS3 alone delayed entry. Hyal1 expressing cells exhibited a significant reduction in their ability to sustain ERK phosphorylation upon stimulation by growth factors, and in their expression of the cyclin-dependent kinase inhibitor p21. In contrast, HAS3 expressing cells showed prolonged ERK phosphorylation and increased expression of both p21 and p27, in asynchronous and synchronized cultures. Changes in cell cycle regulatory proteins were accompanied by HA-induced suppression of N-cadherin, while E-cadherin expression and {beta}-catenin expression and distribution remained unchanged. Our results are consistent with a model in which excess HA synthesis suppresses cell proliferation by promoting homotypic E-cadherin mediated cell-cell adhesion, consequently signaling to elevate cell cycle inhibitor expression and suppress G1- to S-phase transition.

  16. Three-Dimensional Seismic Study of Pluton Emplacement, Offshore Northwestern New Zealand

    E-Print Network [OSTI]

    Seamons, Kent E.

    Taranaki Graben. Offset along these faults is on the order of 10s to over 100 meters. Strata on top 0.7 km of overlying strata. Fault offset gradually diminishes vertically away from the top Gerald Morton (former VP of Pogo Producing Company) and Plains Exploration and Production Company

  17. Available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/he

    E-Print Network [OSTI]

    Mench, Matthew M.

    of macro- and micro-porous layer interaction in polymer electrolyte fuel cells Ramaraja P. Ramasamya , Emin diffusion layer Flooding Micro-porous layer Two-phase transport Water management a b s t r a c t An array to be beneficial to alleviate flooding under wet conditions, but this beneficial effect gradually diminishes

  18. Large deviation bounds for matrix Brownian motion P. BIANE, M. CAPITAINE, and A. GUIONNET

    E-Print Network [OSTI]

    Guionnet, Alice

    * * *-algebra of the free group with generators (uit; t 2 [0, 1], i 2 {1 . .,.m}). In partic* *ular we shall prove the existence of a good rate function I on this space of stat* *es, given by a variational

  19. Gyroscope deviation from geodesic motion: quasiresonant oscillations on a circular orbit

    E-Print Network [OSTI]

    O. B. Karpov

    2003-01-17

    General relativistic spin-orbit interaction leads to the quasiresonant oscillation of the gyroscope mass center along the orbital normal. The beating amplitude does not include the speed of light and equals the ratio of the intrinsic momentum of the gyroscope to its orbital momentum. The modulation frequency equals the angular velocity of the geodetic precession that prevents the oscillation from resonance. The oscillation represents the precession of the gyroscope orbital momentum. Within an acceptable time the oscillation amplitude reaches the values that are amenable to being analyzed experimentally. Taking into account the source oblateness decreases the beating amplitude and increases the modulation frequency by the factor that is equal to the ratio of the quadrupole precession velocity to the geodetic precession velocity. The period of the quadrupole precession turns out to be a quite sufficient time to form a measurable amplitude of the oscillation.

  20. Policy Flash 2014-28 Updated Class Deviation for FAR 52.209-5...

    Broader source: Energy.gov (indexed) [DOE]

    Kevin M. Smith, of the Contract and Financial Assistance Policy Division, at Kevin.M.Smith@hq.doe.gov , or at (202) 287-1614. Flash Approps Class Dev 5 2 2014.pdf...

  1. Deviation from power law of the global earthquake seismic moment distribution

    E-Print Network [OSTI]

    Serra, Isabel

    2015-01-01

    The distribution of earthquake seismic moment is of capital importance to evaluate seismic hazard, in particular regarding the most extreme events. Likelihood-ratio tests let to compare the performance of the most suitable probabilistic models when ?tted to the global CMT catalog. The conclusion is that the truncated gamma model outperforms the power law and the tapered Gutenberg-Richter models, being able to explain the empirical data both before and after the great Sumatra-Andaman earthquake of 2004.

  2. Specification Risk Analysis: Avoiding Product Performance Deviations through an FMEA-Based Method

    E-Print Network [OSTI]

    Wagner, Claudia

    This thesis investigates the potential application of the Failure Mode and Effect Analysis (FMEA) as a method that facilitates risk management for product architectures. The process described by Pahl & Beitz and the Munich ...

  3. RAPID MIXING OF GLAUBER DYNAMICS OF GIBBS ENSEMBLES VIA AGGREGATE PATH COUPLING AND LARGE DEVIATIONS METHODS

    E-Print Network [OSTI]

    Kovchegov, Yevgeniy

    discontinuous phase transitions which have traditionally been more difficult to analyze rigorously is the relationship between the mixing times of the dynamics and the equilibrium phase transition structure, second-order, phase transition, was one of the first models studied to investigate this relation- ship

  4. Microsoft Word - Flash2006-47JulyDeviatedClause.doc

    Office of Environmental Management (EM)

    administration of this contract, such as financial, administrative, cost and pricing, or management information. (4) Limited rights data, as used in this clause, means data, other...

  5. Incident detection using the Standard Normal Deviate model and travel time information from probe vehicles 

    E-Print Network [OSTI]

    Mountain, Christopher Eugene

    1993-01-01

    One application of travel time information explored in this thesis is freeway incident detection. It is vital to develop reliable methods for automatically detecting incidents to facilitate the quick response and removal of incidents before...

  6. Automated identification of terminal area air traffic flows and weather related deviations

    E-Print Network [OSTI]

    Ng, Tony M. Eng. Massachusetts Institute of Technology

    2008-01-01

    Air traffic in terminal air space is very complex, making it very difficult to identify air traffic flows. Finding air traffic flows and flow boundaries are very helpful in analyzing how air traffic would react to weather. ...

  7. Policy Flash 2015-15 - Class Deviation FAR Test Programs | Department...

    Broader source: Energy.gov (indexed) [DOE]

    March 6, 2015 TO: Procurement DirectorsContracting Officers FROM: Director Contract and Financial Assistance Policy Division Office of Policy Office of Procurement and Assistance...

  8. Mid- and far-field deviations from causality in spontaneous light emission by atomic Hydrogen

    E-Print Network [OSTI]

    Vincent Debierre; Thomas Durt

    2015-09-04

    We investigate, in the case of the $2\\mathrm{p}-1\\mathrm{s}$ transition in atomic Hydrogen, the behaviour of the spontaneously emitted electromagnetic field in spacetime. We focus on Glauber's wave function for the emitted photon, a quantity which we find is nonzero outside the lightcone at all times after the start of the emission. We identify the uncertainty on the position of the decaying electron as a source of departure from causality in the naive sense of the term. We carry out a detailed study of the emitted electric field in the mid- and far-field regions, through analytical and numerical computations as well as asymptotic arguments.

  9. Model for crystallization kinetics: Deviations from KolmogorovJohnsonMehlAvrami kinetics

    E-Print Network [OSTI]

    Sánchez, Angel "Anxo"

    development of active matrix-addressed flat- panel displays1 and thin-film solar cells.2 In this context, nucleation develops in the Si/SiO2 interface due to inhomogeneities or impurities that catalyze

  10. Policy Flash 2014-28 Updated Class Deviation for FAR 52.209-5...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Matters Questions concerning this policy flash should be directed to Kevin M. Smith, of the Contract and Financial Assistance Policy Division, at Kevin.M.Smith@hq.doe.gov...

  11. Total Possible Points: 60.00 Standard Deviation: 8.01

    E-Print Network [OSTI]

    Shoubridge, Eric

    80.00 100.00 80.00 0.34B 15.00 80.00 5.00 0.00 0.00 DE2 Q2 75.00 100.00 40.00 0.23C 0.00 20.00 75.00 65.00 5.00 0.00 0.00 DE10 Q10 90.00 100.00 80.00 0.18C 0.00 10.00 90.00 0.00 0.00 ADE11 Q11 75.00 80.00 AB13 Q13 55.00 100.00 80.00 0.27D 0.00 0.00 5.00 55.00 40.00 AB14 Q14 70.00 80.00 60.00 0.05C 0.00 0

  12. about a teenage girl who is doing exactly that: deviating from the path she's sup-

    E-Print Network [OSTI]

    Sprott, Julien Clinton

    &AChristina Stoddard talks about poetry, Mormonism, feminism, gang violence, and revengewith the author To interview in Mormon culture, and have been dating back to pioneer times. The exact reason why is not known for sure

  13. Size-dependent standard deviation for growth rates: Empirical results and theoretical modeling Boris Podobnik*

    E-Print Network [OSTI]

    Podobnik, Boris

    , Croatia; Zagreb School of Economics and Management, Zagreb, Croatia; and Center for Polymer Studies of Physics, Faculty of Science, University of Zagreb, Zagreb, Croatia Fabio Pammolli Faculty of Economics

  14. POLICY FLASH 2013-59 Class Deviation (FAR) 19.15, Women-Owned Small

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAandSummary Areas of theConference on FuelWestern AreaBing Liu,Business

  15. Policy Flash 2013-64 Acquisition Letter 10 and Class Deviation for

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Financing Tool Fits theCommitteeCrystalline Silicon Cellresearch performanceNondisplacement of

  16. Policy Flash 2014-09 Class Deviation from the Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Financing Tool Fits theCommitteeCrystalline Siliconof Division F, Title I, Title II, andAcquisition

  17. Policy Flash 2013-31 Class Deviation from the Federal Acquisition

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergyPresidential PermitDAYS - WE NEED ADr.BelowRegulation (FAR) 13.5, Test

  18. Policy Flash 2014-09 Class Deviation from the Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergyPresidential PermitDAYS - WE NEEDImplications of31.205-33)Acquisition

  19. SCALING DEVIATIONS F O R NEUTRINO REACTIONS IN AYSMPTOTICALLY FREE FIELD THEORIES*

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust, High-Throughput Analysis of Protein1-0845* Storage Systems and ParallelHPX

  20. Recent HRIBF Research - Deviations from U(5) Symmetry in 116Cd

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts onReal-Time Chemical ImagingSelectedRecent Developments.

  1. CLASS DEVIATION FINDINGS AND DETERMINATION USE OF CLAUSE TO IMPLEMENT EXECUTIVE ORDER 13658,

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l DeInsulation at04-86)Contractors InternationalSubpartUSE OF CLAUSE

  2. Deviation from high-entropy configurations in the atomic distributions of a

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing BacteriaConnectlaser-solidSwitchgrass

  3. Policy Flash 2013-64 Acquisition Letter 10 and Class Deviation for

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuilding energy codesPhiladelhia GasDepartmentand How ItNondisplacement

  4. Policy Flash 2014-09 Class Deviation from the Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuilding energy codesPhiladelhia GasDepartmentand| Department

  5. Policy Flash 2014-10 Class Deviation DEAR 952.204-02 | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuilding energy codesPhiladelhia GasDepartmentand| Department10 Class

  6. Policy Flash 2014-28 Updated Class Deviation for FAR 52.209-5,

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuilding energy codesPhiladelhia GasDepartmentand|Division E, Title

  7. POLICY FLASH 2013-59 Class Deviation (FAR) 19.15, Women-Owned Small

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuilding energy codes have a more thanPNM ResourcesCERTIFIEDFINAL

  8. CLASS DEVIATION FINDINGS AND DETERMINATION TO IMPLEMENT AN APPROPRIATIONS PROVISION RELATED TO

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment|Marketing, LLCEfficiency |CBA.PDF&#0; MoreJuneREALTYCITSSTheTO

  9. ASEAN's Gradual Evolution: Challenges and Opportunities for Integrating Participatory Procedural Reforms for the Environment in an Evolving Rights-Based Framework

    E-Print Network [OSTI]

    Abdel-Monem, Tarik

    2012-01-01

    NGOs and Civil Society in Global Environmental Governance,in GLOBAL ENVIRONMENTAL GOVERNANCE: OPTIONS & OPPORTUNITIEsEnvironmental Governance: Examining the Association of Southeast Asian Nations (ASEAN) Model, in GLOBAL

  10. ASEAN's Gradual Evolution: Challenges and Opportunities for Integrating Participatory Procedural Reforms for the Environment in an Evolving Rights-Based Framework

    E-Print Network [OSTI]

    Abdel-Monem, Tarik

    2012-01-01

    and Development: Is There a Kuznets Curve for Air PollutionDevelopment: The Environmental Kuznets Curve Revisited, 62Corruption, Pollution, and the Kuznets Environment Curve, 40

  11. Solar spectral irradiance changes during cycle 24

    SciTech Connect (OSTI)

    Marchenko, S. V.; DeLand, M. T.

    2014-07-10

    We use solar spectra obtained by the Ozone Monitoring Instrument (OMI) on board the Aura satellite to detect and follow long-term (years) and short-term (weeks) changes in the solar spectral irradiance (SSI) in the 265-500 nm spectral range. During solar Cycle 24, in the relatively line-free regions the SSI changed by ?0.6% ± 0.2% around 265 nm. These changes gradually diminish to 0.15% ± 0.20% at 500 nm. All strong spectral lines and blends, with the notable exception of the upper Balmer lines, vary in unison with the solar 'continuum'. Besides the lines with strong chromospheric components, the most involved species include Fe I blends and all prominent CH, NH, and CN spectral bands. Following the general trend seen in the solar 'continuum', the variability of spectral lines also decreases toward longer wavelengths. The long-term solar cycle SSI changes are closely, to within the quoted 0.1%-0.2% uncertainties, matched by the appropriately adjusted short-term SSI variations derived from the 27 day rotational modulation cycles. This further strengthens and broadens the prevailing notion about the general scalability of the UV SSI variability to the emissivity changes in the Mg II 280 nm doublet on timescales from weeks to years. We also detect subtle deviations from this general rule: the prominent spectral lines and blends at ? ? 350 nm show slightly more pronounced 27 day SSI changes when compared to the long-term (years) trends. We merge the solar data from Cycle 21 with the current Cycle 24 OMI and GOME-2 observations and provide normalized SSI variations for the 170-795 nm spectral region.

  12. IEEE TRANSACTIONS ON ELECTRON DEVICES, VOL. 52, NO. 8, AUGUST 2005 1815 A New Poly-Si TG-TFT With Diminished

    E-Print Network [OSTI]

    Kumar, M. Jagadesh

    comparable to the poly-Si grain size, using modern metal-induced lateral crystal- lization or excimer laser was arranged by Editor C.-Y. Lu. A. A. Orouji is with Semnan University, Semnan, Iran. M. J. Kumar

  13. Strong carrier localization and diminished quantum-confined Stark effect in ultra-thin high-indium-content InGaN quantum wells with violet light emission

    SciTech Connect (OSTI)

    Ko, Suk-Min; Kwack, Ho-Sang; Park, Chunghyun; Yoo, Yang-Seok; Cho, Yong-Hoon, E-mail: yhc@kaist.ac.kr [Department of Physics and KI for the NanoCentury, Korea Advanced Institute of Science and Technology, Daejeon 305-701 (Korea, Republic of)] [Department of Physics and KI for the NanoCentury, Korea Advanced Institute of Science and Technology, Daejeon 305-701 (Korea, Republic of); Kwon, Soon-Yong [Department of Materials Science and Engineering, Seoul National University, Seoul 151-744 (Korea, Republic of) [Department of Materials Science and Engineering, Seoul National University, Seoul 151-744 (Korea, Republic of); School of Mechanical and Advanced Materials Engineering, Ulsan National Institute of Science and Technology, Ulsan 689-798 (Korea, Republic of); Jin Kim, Hee; Yoon, Euijoon, E-mail: eyoon@snu.ac.kr [Department of Materials Science and Engineering, Seoul National University, Seoul 151-744 (Korea, Republic of)] [Department of Materials Science and Engineering, Seoul National University, Seoul 151-744 (Korea, Republic of); Si Dang, Le [Nanophysics and Semiconductors, CEA-CNRS-UJF Group, Institut Néel, CNRS Grenoble, 25 rue des Martyrs, 38042 Grenoble Cedex 9 (France)] [Nanophysics and Semiconductors, CEA-CNRS-UJF Group, Institut Néel, CNRS Grenoble, 25 rue des Martyrs, 38042 Grenoble Cedex 9 (France)

    2013-11-25

    Here, we report on the optical and structural characteristics of violet-light-emitting, ultra-thin, high-Indium-content (UTHI) InGaN/GaN multiple quantum wells (MQWs), and of conventional low-In-content MQWs, which both emit at similar emission energies though having different well thicknesses and In compositions. The spatial inhomogeneity of In content, and the potential fluctuation in high-efficiency UTHI MQWs were compared to those in the conventional low-In-content MQWs. We conclude that the UTHI InGaN MQWs are a promising structure for achieving better quantum efficiency in the visible and near-ultraviolet spectral range, owing to their strong carrier localization and reduced quantum-confined Stark effect.

  14. A New Grounded Lamination Gate (GLG) SOI MOSFET for Diminished Fringe Capacitance Effects Nano Science and Technology Institute Home | Subscribe | Site Map

    E-Print Network [OSTI]

    Kumar, M. Jagadesh

    -- 15% off with Free Shipping Order: Mail/Fax Form Up 2007 Meetings Current Highlights q Cleantech 2007

  15. Pleuronectiform fishes (flatfishes) are a large and successful group of teleost fishes which have deviated from the general

    E-Print Network [OSTI]

    Gibb, Alice C.

    at least two direct consequences for the symmetry of the cephalic bones and muscles: (1) the neurocranium, asymmetrical anterior movement of the ventral portion of the maxilla does occur in X. liolepis during mouth

  16. Deviation Between ?13C and Leaf Intercellular Co2 in Salix Interior Cuttings Developing Under Low Light

    E-Print Network [OSTI]

    Le Roux-Swarthout, Debbie J.; Terwilliger, Valery J.; Martin, Craig E.

    2001-01-01

    these hypotheses by sprouting cuttings of Salix interior under wet and dry soil?moisture conditions in a controlled environmental chamber. Plants were defoliated after 56 d, and watering treatments were then reversed for half of the plants in each treatment. The ?...

  17. Rapid, Interactive Assessment of Petrophysical and Geometrical Effects on Density and Neutron Logs Acquired in Vertical and Deviated Wells

    E-Print Network [OSTI]

    Torres-Verdín, Carlos

    SPE 124879 Rapid, Interactive Assessment of Petrophysical and Geometrical Effects on Density and invasion with water- and oil-base muds. Our rapid simulation procedure enables the interactivel on field logs. It also permits efficient integration with induction resistivity measurements for assessment

  18. J. Phys. Chem. 1984, 88, 1463-1467 1463 The isotope effects appear as the deviation and unsymmetri-

    E-Print Network [OSTI]

    - zation of the potential profile along the IRC in the mass-weighted Cartesian coordinate system, whereas is greatest in the vicinity of the transition state extends to the considerably extended region along the IRC using the concept of the IRC will be profitable in applications to more complicated biochemical systems

  19. Abstract --The Robotic Gait Rehabilitation (RGR) Trainer, was designed and built to target secondary gait deviations in

    E-Print Network [OSTI]

    Mavroidis, Constantinos

    Abstract -- The Robotic Gait Rehabilitation (RGR) Trainer, was designed and built to target weakness or trouble moving one side of their body, and require rehabilitation [1]. Walking allows and Rehabilitation, Harvard Medical School and Spaulding Rehabilitation Hospital, Boston, MA, 02114, USA (phone: 617

  20. PFT: a Protocol For evaluating video Trackers The mean () and standard deviation () of AUC scores obtained for the trackers on

    E-Print Network [OSTI]

    Cavallaro, Andrea

    .483 (0.0794) 0.555 (0.0272) 0.686 (0.1061) 0.500 (0.0723) #12;Trial 2 (Size perturbation) Tracker Reference H1 µ() H2 µ() H3 µ() H4 µ() PF pdf 0.463 (0.0532) 0.698 (0.1311) 0.593 (0.0555) 0.814 (0.0716) MS.0781) 0.820 (0.0430) 0.770 (0.1232) 0.555 (0.0818) Hybrid pdf 0.506 (0.0759) 0.586 (0.0530) 0.741 (0

  1. Large deviations of the average shapes of vesicles from equilibrium: Effects of thermal fluctuations in the presence of constraints

    E-Print Network [OSTI]

    Heinrich, Volkmar

    suggests that the determination of the membrane bending modulus kc from observations of thermal vesicle. In this paper we develop a formal- ism to calculate this thermal shift, and we demonstrate that nonlinearities are governed by the elastic bending energy of the vesicle membrane, both its membrane area, as well

  2. Deviations of the Energy-Momentum Tensor from Equilibrium in the Initial State for Hydrodynamics from Transport Approaches

    E-Print Network [OSTI]

    Oliinychenko, Dmytro

    2015-01-01

    Many hybrid models of heavy ion collisions construct the initial state for hydrodynamics from transport models. Hydrodynamics requires that the energy-momentum tensor $T^{\\mu\

  3. Deviations of the Energy-Momentum Tensor from Equilibrium in the Initial State for Hydrodynamics from Transport Approaches

    E-Print Network [OSTI]

    Dmytro Oliinychenko; Hannah Petersen

    2015-08-18

    Many hybrid models of heavy ion collisions construct the initial state for hydrodynamics from transport models. Hydrodynamics requires that the energy-momentum tensor $T^{\\mu\

  4. Deviation from high-entropy configurations in the atomic distributions of a multi-principal-element alloy

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Santodonato, Louis J.; Zhang, Yang; Feygenson, Mikhail; Parish, Chad M.; Gao, Michael C.; Weber, Richard J. K.; Neuefeind, Joerg C.; Tang, Zhi; Liaw, Peter K.

    2015-01-20

    The alloy-design strategy of combining multiple elements in near-equimolar ratios has shown great potential for producing exceptional engineering materials, often known as “high-entropy alloys”. Understanding the elemental distribution, and, thus, the evolution of the configurational entropy during solidification, is undertaken in the present study using the Al1.3CoCrCuFeNi model alloy. Here we show that even when the material undergoes elemental segregation, precipitation, chemical ordering, and spinodal decomposition, a significant amount of disorder remains, due to the distributions of multiple elements in the major phases. In addition, the results suggest that the high-entropy-alloy-design strategy may be applied to a wide range ofmore »complex materials, and should not be limited to the goal of creating single-phase solid solutions.« less

  5. Current Biology 24, 23862392, October 20, 2014 2014 Elsevier Ltd All rights reserved http://dx.doi.org/10.1016/j.cub.2014.08.034 Gradual Assembly of Avian Body Plan

    E-Print Network [OSTI]

    Wang, Steve C.

    evolutionary transitions in the history of life [1­ 22]. The macroevolutionary tempo and mode of this transi to dissect a major morphological, behavioral, and paleobiological trans- formation in deep time articulated by George Gaylord Simpson in the 1940s [25] and has been the subject of intense debate ever since

  6. Inverse sensitivity analysis of SISO and MIMO systems using Maletinsky's spline-type modulation function method 

    E-Print Network [OSTI]

    Smith, Cherri Imelda

    1987-01-01

    of dynamic control systems. It allows direct, parametric observation of parameter deviations. In this aspect, inverse sensitivity theory is a powerful device in preventing the gradual deterioration of system performance. Normally large changes in system... systems. Another set of first-order inverse sensitivity functions were developed for the nonlinear-in-parameter systems. A method was offered for obtaining higher-order inverse sensitivity functions for nonlinear-in-parameter systems. The derived...

  7. Two-photon spectroscopy of excitons with entangled photons

    SciTech Connect (OSTI)

    Schlawin, Frank, E-mail: Frank.Schlawin@physik.uni-freiburg.de [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States) [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States); Physikalisches Institut, Albert-Ludwigs-Universität Freiburg, Hermann-Herder-Straße 3, 79108 Freiburg (Germany); Mukamel, Shaul, E-mail: smukamel@uci.edu [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States)] [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States)

    2013-12-28

    The utility of quantum light as a spectroscopic tool is demonstrated for frequency-dispersed pump-probe, integrated pump-probe, and two-photon fluorescence signals which show Ramsey fringes. Simulations of the frequency-dispersed transmission of a broadband pulse of entangled photons interacting with a three-level model of matter reveal how the non-classical time-bandwidth properties of entangled photons can be used to disentangle congested spectra, and reveal otherwise unresolved features. Quantum light effects are most pronounced at weak intensities when entangled photon pairs are well separated, and are gradually diminished at higher intensities when different photon pairs overlap.

  8. PHYSICAL REVIEW E 83, 021304 (2011) Response of a noncohesive packing of grains to a localized force: Deviation from continuum elasticity

    E-Print Network [OSTI]

    Clamond, Didier

    2011-01-01

    commonly used to model the behavior of cohesionless soils in civil engineering or in soil mechanics the mechanical behavior of grain piles, we investigate the response of a noncohesive two-dimensional packing between neighboring grains is generally larger than the number of equilibrium mechanical equations

  9. Appendix. Variable descriptions, code, unit of measure, and descriptive statistics, which include the mean, standard deviation (SD), and range of values in the data set.

    E-Print Network [OSTI]

    Poff, N. LeRoy

    .37­246.26 Median annual coefficient of variation of daily flows C.H.CV Unitless 1.66 0.7 0.77­4.63 Proportion­0.77 Proportion of fast-water habitat (riffles, runs, etc) within the reach R.H.Fast Proportion 0.51 0.28 0­1 Riparian (nonclimatic) Proportion of all vegetation types along of riparian zone of reach R

  10. Global optimization of data quality checks on 2-D and 3-D networks of GPR cross-well tomographic data for automatic correction of unknown well deviations

    E-Print Network [OSTI]

    Sassen, D. S.

    2010-01-01

    particle swarm optimization (PSO) to automatically correctsolution. We utilized the PSO FORTRAN code of Mishra (2006),as particle swarm optimization (PSO). The PSO algorithm of

  11. Stroke plane deviation for a microrobotic fly Benjamin M. Finio, Student Member, IEEE, John P. Whitney and Robert J. Wood, Member, IEEE

    E-Print Network [OSTI]

    Wood, Robert

    -dimensional mechanism or a spherical joint (such as the five-bar mechanism with auxiliary four-bar in [12]). While (MAVs) is restricted to a flat stroke plane in order to simplify analysis and mechanism design. An MAV components [5], [6], including the Harvard Microrobotic Fly (HMF) [7], [8], [9], and even hybrid mechanical

  12. Temperature dependence of magnetization and anisotropy in uniaxial NiFe?O? nanomagnets: Deviation from the Callen-Callen power law

    SciTech Connect (OSTI)

    Chatterjee, Biplab K.; Ghosh, C. K. [School of Materials Science and Nanotechnology, Jadavpur University, Jadavpur, Kolkata 700032 (India); Chattopadhyay, K. K., E-mail: kalyan-chattopadhyay@yahoo.com [School of Materials Science and Nanotechnology, Jadavpur University, Jadavpur, Kolkata 700032 (India); Thin Film and Nanoscience Laboratory, Department of Physics, Jadavpur University, Jadavpur, Kolkata 700032 (India)

    2014-10-21

    The thermal variation of magnetic anisotropy (K) and saturation magnetization (M{sub S}) for uniaxial nickel ferrite (NiFe?O?) nanomagnets are investigated. Major magnetic hysteresis loops are measured for the sample at temperatures over the range 5–280?K using a vibrating sample magnetometer. The high-field regimes of the hysteresis loops are modeled using the law of approach to saturation, based on the assumption that at sufficiently high field only direct rotation of spin-moment take place, with an additional forced magnetization term that is linear with applied field. The uniaxial anisotropy constant K is calculated from the fitting of the data to the theoretical equation. As temperature increases from 5?K to 280?K, a 49% reduction of K, accompanied by an 85% diminution of M{sub S} is observed. Remarkably, K is linearly proportional to M{sub S}?.? in the whole temperature range violating the existing theoretical model by Callen and Callen. The unusual power-law behavior for the NiFe?O? uniaxial nanomagnets is ascribed to the non-negligible contributions from inter-sublattice pair interactions, Neel surface anisotropy, and higher order anisotropies. A complete realization of the unusual anisotropy-magnetization scaling behavior for nanoscale two-sublattice magnetic materials require a major modification of the existing theory by considering the exact mechanism of each contributions to the effective anisotropy.

  13. The Experience of Disability Compensation for OEF/OIF Veterans

    E-Print Network [OSTI]

    MacGregor, Casey

    2015-01-01

    Affirmation Affirmation Diminishment Diminishment MoldingMolding Diagnoses References Amdur, D. , Batres, A. ,a role in affirming, molding or diminishing those symptoms.

  14. On Statistical Analysis of the Pattern of Evolution of Perceived Emotions Induced by Hindustani Music- A Study Based on Listener Responses

    E-Print Network [OSTI]

    Midya, Vishal; Manna, Srijita; Sengupta, Ranjan

    2015-01-01

    The objective of this study is to find the underlying pattern of how perception of emotions has evolved in India. Here Hindustani Music has been used as a reference frame for tracking the changing perception of emotions. It has been found that different emotions perceived from Hindustani Music form a particular sequential pattern when their corresponding pitch periods are analyzed using the standard deviations and mean successive squared differences.This sequential pattern of emotions coincides with their corresponding sequential pattern of tempos or average number of steady states. On the basis of this result we further found that the range of perception of emotions has diminished significantly these days compared to what it was before. The proportion of responses for the perceived emotions like Anger, Serenity, Romantic and Sorrow has also decreased to a great extent than what it was previously. The proportion of responses for the perceived emotion Anxiety has increased phenomenally. Both standard deviation...

  15. The Importance of Wildlife Harvest to Human Health and Livelihoods in Northeastern Madagascar

    E-Print Network [OSTI]

    Golden, Christopher DeWeir

    2011-01-01

    effects of damaged ecosystems and diminished access to natural resourceseffects of damaged ecosystems and diminished access to natural resources

  16. Efficiency of feedback process in cavity quantum electrodynamics

    E-Print Network [OSTI]

    H. T. Fung; P. T. Leung

    2007-08-02

    Utilizing the continuous frequency mode quantization scheme, we study from first principle the efficiency of a feedback scheme that can generate maximally entangled states of two atoms in an optical cavity through their interactions with a single input photon. The spectral function of the photon emitted from the cavity, which will be used as the input of the next round in the feedback process, is obtained analytically. We find that the spectral function of the photon is modified in each round and deviates from the original one. The efficiency of the feedback scheme consequently deteriorates gradually after several rounds of operation.

  17. Experimental investigation on the slip between oil and water in horizontal pipes

    SciTech Connect (OSTI)

    Xu, Jing-yu; Wu, Ying-xiang; Feng, Fei-fei; Chang, Ying; Li, Dong-hui [Division of Engineering Sciences, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100190 (China)

    2008-10-15

    This work is devoted to study of the slip phenomenon between phases in water-oil two-phase flow in horizontal pipes. The emphasis is placed on the effects of input fluids flow rates, pipe diameter and viscosities of oil phase on the slip. Experiments were conducted to measure the holdup in two horizontal pipes with 0.05 m diameter and 0.025 m diameter, respectively, using two different viscosities of white oil and tap water as liquid phases. Results showed that the ratios of in situ oil to water velocity at the pipe of small diameter are higher than those at the pipe of big diameter when having same input flow rates. At low input water flow rate, there is a large deviation on the holdup between two flow systems with different oil viscosities and the deviation becomes gradually smaller with further increased input water flow rate. (author)

  18. Crossover transition in the Fluctuation of Internet

    E-Print Network [OSTI]

    Qian, Jiang-Hai; Han, Ding-Ding; Ma, Yu-Gang

    2015-01-01

    Gibrat's law predicts that the standard deviation of the growth rate of a node's degree is constant. On the other hand, the preferential attachment(PA) indicates that such standard deviation decreases with initial degree as a power law of exponent $-0.5$. While both models have been applied to Internet modeling, this inconsistency requires the verification of their validation. Therefore we empirically study the fluctuation of Internet of three different time intervals(daily, monthly and yearly). We find a crossover transition from PA model to Gibrat's law, which has never been reported. Specifically Gibrat-law starts from small degree region and extends gradually with the increase of the observed period. We determine the validated periods for both models and find that the correlation between internal links has large contribution to the emergence of Gibrat law. These findings indicate neither PA nor Gibrat law is applicable to the actual Internet, which requires a more complete model theory.

  19. Staged venting of fuel cell system during rapid shutdown

    DOE Patents [OSTI]

    Keskula, Donald H.; Doan, Tien M.; Clingerman, Bruce J.

    2004-09-14

    A venting methodology and system for rapid shutdown of a fuel cell apparatus of the type used in a vehicle propulsion system. H.sub.2 and air flows to the fuel cell stack are slowly bypassed to the combustor upon receipt of a rapid shutdown command. The bypass occurs over a period of time (for example one to five seconds) using conveniently-sized bypass valves. Upon receipt of the rapid shutdown command, the anode inlet of the fuel cell stack is instantaneously vented to a remote vent to remove all H.sub.2 from the stack. Airflow to the cathode inlet of the fuel cell stack gradually diminishes over the bypass period, and when the airflow bypass is complete the cathode inlet is also instantaneously vented to a remote vent to eliminate pressure differentials across the stack.

  20. Staged venting of fuel cell system during rapid shutdown

    DOE Patents [OSTI]

    Clingerman, Bruce J. (Palmyra, NY); Doan, Tien M. (Columbia, MD); Keskula, Donald H. (Webster, NY)

    2002-01-01

    A venting methodology and system for rapid shutdown of a fuel cell apparatus of the type used in a vehicle propulsion system. H.sub.2 and air flows to the fuel cell stack are slowly bypassed to the combustor upon receipt of a rapid shutdown command. The bypass occurs over a period of time (for example one to five seconds) using conveniently-sized bypass valves. Upon receipt of the rapid shutdown command, the anode inlet of the fuel cell stack is instantaneously vented to a remote vent to remove all H.sub.2 from the stack. Airflow to the cathode inlet of the fuel cell stack gradually diminishes over the bypass period, and when the airflow bypass is complete the cathode inlet is also instantaneously vented to a remote vent to eliminate pressure differentials across the stack.

  1. On the classical description of the recombination of dark matter particles with a Coulomb-like interaction

    E-Print Network [OSTI]

    Belotsky, K M; Kirillov, A A

    2015-01-01

    Cold dark matter (DM) scenario may be cured of several problems by involving self-interaction of dark matter. Viability of the models of long-range interacting DM crucially depends on the effectiveness of recombination of the DM particles, making thereby their interaction short-range. Usually in numeric calculations, recombination is described by cross section obtained on a feasible quantum level. However in a wide range of parameter values, a classical treatment, where the particles are bound due to dipole radiation, is applicable. The cross sections, obtained in both approaches, are very different and lead to diverse consequences. Classical cross section has a steeper dependence on relative velocity, what leads to the fact that, after decoupling of DM particles from thermal background of "dark photons" (carriers of DM long-range interaction), recombination process does not "freeze out", diminishing gradually density of unbound DM particles. Our simplified estimates show, that at the taken parameter values (...

  2. Essays on Financial Information Analysis

    E-Print Network [OSTI]

    Schuett, Harm Henning

    2013-01-01

    signals such as abnormal capex growth diminishes.signals such as abnormal capex growth diminishes.that, first, such abnormal capex growth me- chanically leads

  3. Optimization of quantum interferometric metrological sensors in the presence of photon loss

    E-Print Network [OSTI]

    Tae-Woo Lee; Sean D. Huver; Hwang Lee; Lev Kaplan; Steven B. McCracken; Changjun Min; Dmitry B. Uskov; Christoph F. Wildfeuer; Georgios Veronis; Jonathan P. Dowling

    2009-08-20

    We optimize two-mode, entangled, number states of light in the presence of loss in order to maximize the extraction of the available phase information in an interferometer. Our approach optimizes over the entire available input Hilbert space with no constraints, other than fixed total initial photon number. We optimize to maximize the Fisher information, which is equivalent to minimizing the phase uncertainty. We find that in the limit of zero loss the optimal state is the so-called N00N state, for small loss, the optimal state gradually deviates from the N00N state, and in the limit of large loss the optimal state converges to a generalized two-mode coherent state, with a finite total number of photons. The results provide a general protocol for optimizing the performance of a quantum optical interferometer in the presence of photon loss, with applications to quantum imaging, metrology, sensing, and information processing.

  4. Substitution of Ni for Fe in superconducting Fe?.??Te?.?Se?.? depresses the normal-state conductivity but not the magnetic spectral weight

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Wang, Jinghui; Tranquada, J. M.; Zhong, Ruidan; Li, Shichao; Gan, Yuan; Xu, Zhijun; Zhang, Cheng; Ozaki, T.; Matsuda, M.; Zhao, Yang; et al

    2015-01-05

    We have performed systematic resistivity and inelastic neutron scattering measurements on Fe?.???zNizTe?.?Se?.? samples to study the impact of Ni substitution on the transport properties and the low-energy (? 12 meV) magnetic excitations. It is found that, with increasing Ni doping, both the conductivity and superconductivity are gradually suppressed; in contrast, the low-energy magnetic spectral weight changes little. Comparing with the impact of Co and Cu substitution, we find that the effects on conductivity and superconductivity for the same degree of substitution grow systematically as the atomic number of the substituent deviates from that of Fe. The impact of the substituentsmore »as scattering centers appears to be greater than any contribution to carrier concentration. The fact that low-energy magnetic spectral weight is not reduced by increased electron scattering indicates that the existence of antiferromagnetic correlations does not depend on electronic states close to the Fermi energy.« less

  5. Substitution of Ni for Fe in superconducting Fe?.??Te?.?Se?.? depresses the normal-state conductivity but not the magnetic spectral weight

    SciTech Connect (OSTI)

    Wang, Jinghui [Nanjing Univ., Nanjing (China); Tranquada, J. M. [Brookhaven National Lab. (BNL), Upton, NY (United States); Zhong, Ruidan [Brookhaven National Lab. (BNL), Upton, NY (United States); Stony Brook Univ., Stony Brook, NY (United States); Li, Shichao [Nanjing Univ., Nanjing (China); Gan, Yuan [Nanjing Univ., Nanjing (China); Xu, Zhijun [Univ. of California, Berkeley, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Zhang, Cheng [Brookhaven National Lab. (BNL), Upton, NY (United States); Stony Brook Univ., Stony Brook, NY (United States); Ozaki, T. [Brookhaven National Lab. (BNL), Upton, NY (United States); Matsuda, M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Zhao, Yang [National Inst. of Standards and Technology (NIST), Gaithersburg, MD (United States); Univ. of Maryland, College Park, MD (United States); Li, Qiang [Brookhaven National Lab. (BNL), Upton, NY (United States); Xu, G. [Brookhaven National Lab. (BNL), Upton, NY (United States); Gu, Genda [Brookhaven National Lab. (BNL), Upton, NY (United States); Birgeneau, R. J. [Univ. of California, Berkeley, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Wen, Jinsheng [Nanjing Univ., Nanjing (China)

    2015-01-01

    We have performed systematic resistivity and inelastic neutron scattering measurements on Fe?.???zNizTe?.?Se?.? samples to study the impact of Ni substitution on the transport properties and the low-energy (? 12 meV) magnetic excitations. It is found that, with increasing Ni doping, both the conductivity and superconductivity are gradually suppressed; in contrast, the low-energy magnetic spectral weight changes little. Comparing with the impact of Co and Cu substitution, we find that the effects on conductivity and superconductivity for the same degree of substitution grow systematically as the atomic number of the substituent deviates from that of Fe. The impact of the substituents as scattering centers appears to be greater than any contribution to carrier concentration. The fact that low-energy magnetic spectral weight is not reduced by increased electron scattering indicates that the existence of antiferromagnetic correlations does not depend on electronic states close to the Fermi energy.

  6. Substitution of Ni for Fe in superconducting Fe?.??Te?.?Se?.? depresses the normal-state conductivity but not the magnetic spectral weight

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Wang, Jinghui [Nanjing Univ., Nanjing (China); Tranquada, J. M. [Brookhaven National Lab. (BNL), Upton, NY (United States); Zhong, Ruidan [Brookhaven National Lab. (BNL), Upton, NY (United States); Stony Brook Univ., Stony Brook, NY (United States); Li, Shichao [Nanjing Univ., Nanjing (China); Gan, Yuan [Nanjing Univ., Nanjing (China); Xu, Zhijun [Univ. of California, Berkeley, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Zhang, Cheng [Brookhaven National Lab. (BNL), Upton, NY (United States); Stony Brook Univ., Stony Brook, NY (United States); Ozaki, T. [Brookhaven National Lab. (BNL), Upton, NY (United States); Matsuda, M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Zhao, Yang [National Inst. of Standards and Technology (NIST), Gaithersburg, MD (United States); Univ. of Maryland, College Park, MD (United States); Li, Qiang [Brookhaven National Lab. (BNL), Upton, NY (United States); Xu, G. [Brookhaven National Lab. (BNL), Upton, NY (United States); Gu, Genda [Brookhaven National Lab. (BNL), Upton, NY (United States); Birgeneau, R. J. [Univ. of California, Berkeley, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Wen, Jinsheng [Nanjing Univ., Nanjing (China)

    2015-01-01

    We have performed systematic resistivity and inelastic neutron scattering measurements on Fe?.???zNizTe?.?Se?.? samples to study the impact of Ni substitution on the transport properties and the low-energy (? 12 meV) magnetic excitations. It is found that, with increasing Ni doping, both the conductivity and superconductivity are gradually suppressed; in contrast, the low-energy magnetic spectral weight changes little. Comparing with the impact of Co and Cu substitution, we find that the effects on conductivity and superconductivity for the same degree of substitution grow systematically as the atomic number of the substituent deviates from that of Fe. The impact of the substituents as scattering centers appears to be greater than any contribution to carrier concentration. The fact that low-energy magnetic spectral weight is not reduced by increased electron scattering indicates that the existence of antiferromagnetic correlations does not depend on electronic states close to the Fermi energy.

  7. Substitution of Ni for Fe in superconducting Fe0.98Te0.5Se0.5 depresses the normal-state conductivity but not the magnetic spectral weight

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Wang, Jinghui; Zhong, Ruidan; Li, Shichao; Gan, Yuan; Xu, Zhijun; Zhang, Cheng; Ozaki, T.; Matsuda, M.; Zhao, Yang; Li, Qiang; et al

    2015-01-05

    We have performed systematic resistivity and inelastic neutron scattering measurements on Fe?.???zNizTe?.?Se?.? samples to study the impact of Ni substitution on the transport properties and the low-energy (? 12 meV) magnetic excitations. It is found that, with increasing Ni doping, both the conductivity and superconductivity are gradually suppressed; in contrast, the low-energy magnetic spectral weight changes little. Comparing with the impact of Co and Cu substitution, we find that the effects on conductivity and superconductivity for the same degree of substitution grow systematically as the atomic number of the substituent deviates from that of Fe. The impact of the substituentsmore »as scattering centers appears to be greater than any contribution to carrier concentration. The fact that low-energy magnetic spectral weight is not reduced by increased electron scattering indicates that the existence of antiferromagnetic correlations does not depend on electronic states close to the Fermi energy.« less

  8. Merger vs. Accretion and the Structure of Dark Matter Halos

    E-Print Network [OSTI]

    E. Salvador-Sole; A. Manrique; J. M. Solanes

    1997-12-05

    High-resolution N-body simulations of hierarchical clustering in a wide variety of cosmogonies show that the density profiles of dark matter halos are universal, with low mass halos being denser than their more massive counterparts. This mass-density correlation is interpreted as reflecting the earlier typical formation time of less massive objects. We investigate this hypothesis in the light of formation times defined as the epoch at which halos experience their last major merger. Such halo formation times are calculated by means of a modification of the extended Press & Schechter formalism which includes a phenomenological frontier, Delta_m, between tiny and notable relative mass captures leading to the distinction between merger and accretion. For Delta_m=0.6, we confirm that the characteristic density of halos is essentially proportional to the mean density of the universe at their time of formation. Yet, proportionality with respect to the critical density yields slightly better results for open universes. In addition, we find that the scale radius of halos is also essentially proportional to their virial radius at the time of formation. We show that these two relations are consistent with the following simple scenario. Violent relaxation caused by mergers rearranges the structure of halos leading to the same density profile with universal values of the dimensionless characteristic density and scale radius. Between mergers, halos grow gradually through the accretion of surrounding layers by keeping their central parts steady and expanding their virial radius as the critical density of the universe diminishes.

  9. Lyapunov instability of rough hard-disk fluids

    E-Print Network [OSTI]

    Jacobus A. van Meel; Harald A. Posch

    2009-04-02

    The dynamical instability of rough hard-disk fluids in two dimensions is characterized through the Lyapunov spectrum and the Kolmogorov-Sinai entropy, $h_{KS}$, for a wide range of densities and moments of inertia $I$. For small $I$ the spectrum separates into translation-dominated and rotation-dominated parts. With increasing $I$ the rotation-dominated part is gradually filled in at the expense of translation, until such a separation becomes meaningless. At any density, the rate of phase-space mixing, given by $h_{KS}$, becomes less and less effective the more the rotation affects the dynamics. However, the degree of dynamical chaos, measured by the maximum Lyapunov exponent, is only enhanced by the rotational degrees of freedom for high-density gases, but is diminished for lower densities. Surprisingly, no traces of Lyapunov modes were found in the spectrum for larger moments of inertia. The spatial localization of the perturbation vector associated with the maximum exponent however persists for any $I$.

  10. 1 ISO 14001 requires that operational control be maintained over significant environmental aspects such that lack of control would lead to deviation from environmental policy and targets. 2 Targets are as described and scheduled in the Recovery and Resource Loaded schedule and are dependent on funding of Recovery Plan .

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopmentataboutScalable FrameworkFireproofing10-03) SECTION

  11. American Institute of Aeronautics and Astronautics A Modular State-Vector based Modeling Architecture for

    E-Print Network [OSTI]

    de Weck, Olivier L.

    and technologies are gradually added to the exhaust aftertreatment system such as oxidation catalysts, particulate

  12. ENERGY AND ENVIRONMENT DIVISION ANNUAL REPORT 1978

    E-Print Network [OSTI]

    Cairns, E.L.

    2011-01-01

    transition to the condensed phase is gradual. Further increase of surface coverage results in a rapid

  13. The Future of Shrinking Cities: Problems, Patterns and Strategies of Urban Transformation in a Global Context

    E-Print Network [OSTI]

    Karina Pallagst; et al

    2009-01-01

    accessible deposits diminishing, but environmental legal restrictions, health concerns, and conflicts with other industries (such as tourism)

  14. Ab Initio Calculation of Nuclear Magnetic Resonance Chemical Shift Anisotropy Tensors 1. Influence of Basis Set on the Calculation of 31P Chemical Shifts

    SciTech Connect (OSTI)

    Alam, T.M.

    1998-09-01

    The influence of changes in the contracted Gaussian basis set used for ab initio calculations of nuclear magnetic resonance (NMR) phosphorous chemical shift anisotropy (CSA) tensors was investigated. The isotropic chemical shitl and chemical shift anisotropy were found to converge with increasing complexity of the basis set at the Hartree-Fock @IF) level. The addition of d polarization function on the phosphorous nucIei was found to have a major impact of the calculated chemical shi~ but diminished with increasing number of polarization fimctions. At least 2 d polarization fimctions are required for accurate calculations of the isotropic phosphorous chemical shift. The introduction of density fictional theory (DFT) techniques through tie use of hybrid B3LYP methods for the calculation of the phosphorous chemical shift tensor resulted in a poorer estimation of the NMR values, even though DFT techniques result in improved energy and force constant calculations. The convergence of the W parametem with increasing basis set complexity was also observed for the DFT calculations, but produced results with consistent large deviations from experiment. The use of a HF 6-31 l++G(242p) basis set represents a good compromise between accuracy of the simulation and the complexity of the calculation for future ab initio calculations of 31P NMR parameters in larger complexes.

  15. N-(N-[2-(3,5-Difluorophenyl)acetyl]-(S)-alanyl)-(S)-phenylglycine tert-butyl ester (DAPT): an inhibitor of ?-secretase, revealing fine electronic and hydrogen-bonding features

    SciTech Connect (OSTI)

    Czerwinski, Andrzej; Valenzuela, Francisco; Afonine, Pavel; Dauter, Miroslawa; Dauter, Zbigniew

    2010-12-01

    The title compound, C{sub 23}H{sub 26}F{sub 2}N{sub 2}O{sub 4}, is a dipeptidic inhibitor of ?-secretase, one of the enzymes involved in Alzheimer’s dis@@ease. The mol@@ecule adopts a compact conformation, without intra@@molecular hydrogen bonds. In the crystal structure, one of the amide N atoms forms the only inter@@molecular N—H?O hydrogen bond; the second amide N atom does not form hydrogen bonds. High-resolution synchrotron diffraction data permitted the unequivocal location and refinement without restraints of all H atoms, and the identification of the characteristic shift of the amide H atom engaged in the hydrogen bond from its ideal position, resulting in a more linear hydrogen bond. Significant residual densities for bonding electrons were revealed after the usual SHELXL refinement, and modeling of these features as additional inter@@atomic scatterers (IAS) using the program PHENIX led to a significant decrease in the R factor from 0.0411 to 0.0325 and diminished the r.m.s. deviation level of noise in the final difference Fourier map from 0.063 to 0.037 e Å{sup ?3}.

  16. Energy consumption and economic development in West Africa

    SciTech Connect (OSTI)

    Chima, C.M.

    1987-01-01

    This study evaluates the commercial energy sector of the Economic Community of West African States (ECOWAS). Presently, an economic union exists between the 16 countries of West Africa that are members of ECOWAS. Although the ECOWAS region has plentiful resources of commercial energy, it faces problems in this sector for two reasons. First is the problem resulting from the diminishing traditional energy resources such as wood fuel and charcoal. Second, most ECOWAS members, except Nigeria, are net importers of commercial energy, and hence face a high import burden for oil. Liquid petroleum is the dominant form of commercial energy used in the ECOWAS despite the availability of other resources. This author basically argues that the best policy and strategy solution for dealing with energy problems is through a combination of regional cooperative effort, and a more-intensive country level. The intensity-of-use hypothesis is tested with case studies of Ghana, the Ivory Coast, and Nigeria. The results indicate that newly developing countries can deviate from the expectations of the hypothesis.

  17. Beam energy scan using a viscous hydro+cascade model

    E-Print Network [OSTI]

    Karpenko, Iu A; Huovinen, P; Petersen, H

    2013-01-01

    Following the experimental program at BNL RHIC, we perform a similar "energy scan" using 3+1D viscous hydrodynamics coupled to the UrQMD hadron cascade, and study the collision energy dependence of pion and kaon rapidity distributions and $m_T$-spectra, as well as charged hadron elliptic flow. To this aim the equation of state for finite baryon density from a Chiral model coupled to the Polyakov loop is employed for hydrodynamic stage. 3D initial conditions from UrQMD are used to study gradual deviation from boost-invariant scaling flow. We find that the inclusion of shear viscosity in the hydrodynamic stage of evolution consistently improves the description of the data for Pb-Pb collisions at CERN SPS, as well as of the elliptic flow measurements for Au-Au collisions in the Beam Energy Scan (BES) program at BNL RHIC. The suggested value of shear viscosity is $\\eta/s\\ge0.2$ for $\\sqrt{s_{NN}}=6.3\\dots39$ GeV.

  18. Dark matter vs. modifications of the gravitational inverse-square law. Results from planetary motion in the solar system

    E-Print Network [OSTI]

    M. Sereno; Ph. Jetzer

    2006-06-08

    Dark matter or modifications of the Newtonian inverse-square law in the solar-system are studied with accurate planetary astrometric data. From extra-perihelion precession and possible changes in the third Kepler's law, we get an upper limit on the local dark matter density, rho_{DM} gravitational acceleration are really small. We examined the MOND interpolating function mu in the regime of strong gravity. Gradually varying mu suggested by fits of rotation curves are excluded, whereas the standard form mu(x)= x/(1+x^2)^{1/2} is still compatible with data. In combination with constraints from galactic rotation curves and theoretical considerations on the external field effect, the absence of any significant deviation from inverse square attraction in the solar system makes the range of acceptable interpolating functions significantly narrow. Future radio ranging observations of outer planets with an accuracy of few tenths of a meter could either give positive evidence of dark matter or disprove modifications of gravity.

  19. The transition mechanism from a symmetric single period discharge to a period-doubling discharge in atmospheric helium dielectric-barrier discharge

    SciTech Connect (OSTI)

    Zhang, Dingzong; Wang, Yanhui; Wang, Dezhen [School of Physics and Optoelectronic Technology, Dalian University of Technology, Dalian 116024 (China)] [School of Physics and Optoelectronic Technology, Dalian University of Technology, Dalian 116024 (China)

    2013-06-15

    Period-doubling and chaos phenomenon have been frequently observed in atmospheric-pressure dielectric-barrier discharges. However, how a normal single period discharge bifurcates into period-doubling state is still unclear. In this paper, by changing the driving frequency, we study numerically the transition mechanisms from a normal single period discharge to a period-doubling state using a one-dimensional self-consistent fluid model. The results show that before a discharge bifurcates into a period-doubling state, it first deviates from its normal operation and transforms into an asymmetric single period discharge mode. Then the weaker discharge in this asymmetric discharge will be enhanced gradually with increasing of the frequency until it makes the subsequent discharge weaken and results in the discharge entering a period-doubling state. In the whole transition process, the spatial distribution of the charged particle density and the electric field plays a definitive role. The conclusions are further confirmed by changing the gap width and the amplitude of the applied voltage.

  20. Comparative study of polar and semipolar (112?2) InGaN layers grown by metalorganic vapour phase epitaxy

    SciTech Connect (OSTI)

    Dinh, Duc V. E-mail: peter.parbrook@tyndall.ie; Zubialevich, V. Z.; Oehler, F.; Kappers, M. J.; Humphreys, C. J.; Alam, S. N.; Parbrook, P. J. E-mail: peter.parbrook@tyndall.ie; Caliebe, M.; Scholtz, F.

    2014-10-21

    InGaN layers were grown simultaneously on (112?2) GaN and (0001) GaN templates by metalorganic vapour phase epitaxy. At higher growth temperature (?750°C), the indium content (<15%) of the (112?2) and (0001) InGaN layers was similar. However, for temperatures less than 750°C, the indium content of the (112?2) InGaN layers (15%–26%) were generally lower than those with (0001) orientation (15%–32%). The compositional deviation was attributed to the different strain relaxations between the (112?2) and (0001) InGaN layers. Room temperature photoluminescence measurements of the (112?2) InGaN layers showed an emission wavelength that shifts gradually from 380 nm to 580 nm with decreasing growth temperature (or increasing indium composition). The peak emission wavelength of the (112?2) InGaN layers with an indium content of more than 10% blue-shifted a constant value of ?(50–60) nm when using higher excitation power densities. This blue-shift was attributed to band filling effects in the layers.

  1. Seismic Performance, Modeling, and Failure Assessment of Reinforced Concrete Shear Wall Buildings

    E-Print Network [OSTI]

    Tuna, Zeynep

    2012-01-01

    standard deviation with respect to the original data With ACIstandard deviation with respect to the original data With ACIand standard deviation (shown in brackets) of the shear stress values calculated as v n , ACI ?

  2. Design and Analysis of Robust Variability-Aware SRAM to Predict Optimum Access-Time to Achieve Yield Enhancement in Future Nano-Scaled CMOS.

    E-Print Network [OSTI]

    Samandari-Rad, Jeren

    2012-01-01

    Mean and standard deviation of Ideal Access-Time (ACI) forMean and standard deviation of Ideal Access-Time (ACI) forof the standard deviation, and therefore variability, of ACI

  3. Interview of Michael Mann

    E-Print Network [OSTI]

    Mann, Michael

    2005-08-24

    on Roman Empire, one on feudalism and one contemporary; gradually turned into 'The Sources of Social Power'; took the further step of separating the military from the political; gradually case studies became bigger with linking historical passages; got too...

  4. GEOTHERMAL SUBSIDENCE RESEARCH PROGRAM PLAN

    E-Print Network [OSTI]

    Lippmann, Marcello J.

    2010-01-01

    in piezometric levels and pore pressure considered in thedue to (1) a gradual decrease in pore pressure (2) a suddenstep decrease in pore pressure, and (3) a gradual increase

  5. Y-12 Site Experience with Deposition Velocity Issues

    Office of Environmental Management (EM)

    ( ) * elevation angle standard deviation sigma-phi ( ) * vertical wind speed standard deviation sigma-omega ( ), * wind-speed ratio method (u R ) *...

  6. --No Title--

    Energy Savers [EERE]

    Awardee Performance and Integrity Information System (FAPIIS) - FAR Clause 52.209-8 Class Deviation SUMMARY: Attached is a class deviation executed by the Senior Procurement...

  7. Z .Marine Chemistry 73 2001 273290 www.elsevier.nlrlocatermarchem

    E-Print Network [OSTI]

    Mahadevan, Amala

    amount. The gradual infusion and spread of this 14 C through the oceans since the 1950s has provided

  8. Another Viewpoint (AVP)

    E-Print Network [OSTI]

    Tuma, Elias H

    2011-01-01

    safe alternative energy sources, gradual demilitarization of the Middle East, establishment of the region as a nuclear and

  9. Hurts So Good: Representations of Sadomasochism in Spanish Novels (1883-2012)

    E-Print Network [OSTI]

    Powell, Eilene Jamie

    2015-01-01

    s diminished grip on Spanish government allowed for the 1931occuring in the Spanish government with the establishment ofruined houses that the Spanish Government sends [the British

  10. Geothermal Exploration in Eastern California Using Aster Thermal...

    Open Energy Info (EERE)

    Nighttime scenes are most useful, because of the significantly diminished effect of solar irradiation compared with daytime. However, daytime scenes are also used for...

  11. DOE/IG-0058

    Office of Environmental Management (EM)

    energy savings, increasing consumer risk, and diminishing the value of the recent infusion of 300 million for ENERGY STAR rebates under the Recovery Act. Management generally...

  12. Unraveling Internet identities : accountability & anonymity at the application layer

    E-Print Network [OSTI]

    Wolff, Josephine Charlotte Paulina

    2012-01-01

    Both anonymity and accountability play crucial roles in sustaining the Internet's functionality, however there is a common misconception that increasing the anonymity of Internet identities necessitates diminishing their ...

  13. PDF file

    E-Print Network [OSTI]

    2008-03-08

    too large, the computational resource is wasted; if it is too small, the ... procedure which, while preserving the normalization and energy diminishing, does not ...

  14. Demographic Approaches to Assessing Climate Change Impact

    E-Print Network [OSTI]

    Funk, W. Chris

    of realized and potential effects. Second, freshwater species have a diminished capacity to respond change, such as building more "clean energy" hydropower facilities or increasing irrigation demands

  15. Trends in the cost of efficiency for appliances and consumer electronics

    E-Print Network [OSTI]

    Desroches, Louis-Benoit

    2013-01-01

    appliances and consumer electronics Louis-Benoit Desroches,appliances and consumer electronics have decreased in realappliances and consumer electronics are likely to diminish

  16. Memristor-based ternary content addressable memory for data-intensive applications

    E-Print Network [OSTI]

    Zheng, Le

    2015-01-01

    one is the so-called ‘power wall’ [10]. As more transistorsto diminish when the ‘power wall’ is hit. Hardware and

  17. PublicationsmailagreementNo.40014024 ThAT nEPTUnE

    E-Print Network [OSTI]

    Victoria, University of

    , ethics in politics, supporting families? Maybe even funding for post-secondary education?To add your diminished in Japan, but amidst unstable nuclear reactorsandtherubbleofastarklyredefinedland- scape

  18. Screenable Pressure-Sensitive Adhesives

    Broader source: Energy.gov [DOE]

    Pressure-sensitive adhesives (PSAs) in recycled paper create a number of problems for the recycling process, including lost production and diminished product quality. Unlike conventional PSAs, a...

  19. A Conceptual Model of Sedimentation in the Sacramento–San Joaquin Delta

    E-Print Network [OSTI]

    Schoellhamer, David H.; Wright, Scott A.; Drexler, Judy

    2012-01-01

    Dams have also been constructed for other purposes, such as trapping hydraulicdams, deposition in flood bypasses, protection of river banks, and diminishment of the hydraulic

  20. 7339 U-007-307.63 RADIOLOGICAL ASSESSMENTS CORPORATION, THE FERNALD

    E-Print Network [OSTI]

    ) Geometric Standard Deviations (GSD) Industrial Hygiene and Radiation (lH&R) International Commission

  1. July 10th (Sunday) 6:00pm -9:00pm

    E-Print Network [OSTI]

    Zhou, Yuanyuan

    - Reliability and security (Chair: Gernot Heiser) Security Breaches as PMU Deviation: Detecting and Identifying

  2. Structural phase transition, narrow band gap, and room-temperature ferromagnetism in [KNbO{sub 3}]{sub 1?x}[BaNi{sub 1/2}Nb{sub 1/2}O{sub 3??}]{sub x} ferroelectrics

    SciTech Connect (OSTI)

    Zhou, Wenliang; Yang, Pingxiong Chu, Junhao; Deng, Hongmei

    2014-09-15

    Structural phase transition, narrow band gap (E{sub g}), and room-temperature ferromagnetism (RTFM) have been observed in the [KNbO{sub 3}]{sub 1?x}[BaNi{sub 1/2}Nb{sub 1/2}O{sub 3??}]{sub x} (KBNNO) ceramics. All the samples have single phase perovskite structure, but exhibit a gradual transition behaviour from the orthorhombic to a cubic structure with the increase of x. Raman spectroscopy analysis not only corroborates this doping-induced change in normal structure but also shows the local crystal symmetry for x ? 0.1 compositions to deviate from the idealized cubic perovskite structure. A possible mechanism for the observed specific changes in lattice structure is discussed. Moreover, it is noted that KBNNO with compositions x?=?0.1–0.3 have quite narrow E{sub g} of below 1.5?eV, much smaller than the 3.2?eV band gap of parent KNbO{sub 3} (KNO), which is due to the increasing Ni 3d electronic states within the gap of KNO. Furthermore, the KBNNO materials present RTFM near a tetragonal to cubic phase boundary. With increasing x from 0 to 0.3, the magnetism of the samples develops from diamagnetism to ferromagnetism and paramagnetism, originating from the ferromagnetic–antiferromagnetic competition. These results are helpful in the deeper understanding of phase transitions, band gap tunability, and magnetism variations in perovskite oxides and show the potential role, such materials can play, in perovskite solar cells and multiferroic applications.

  3. Building of multilevel stakeholder consensus in radioactive waste repository siting

    SciTech Connect (OSTI)

    Dreimanis, A. [Radiation Safety Centre, Riga LV (Latvia)

    2007-07-01

    This report considers the problem of multilevel consensus building for siting and construction of shared multinational/regional repositories for radioactive waste (RW) deep disposal. In the siting of a multinational repository there appears an essential innovative component of stakeholder consensus building, namely: to reach consent - political, social, economic, ecological - among international partners, in addition to solving the whole set of intra-national consensus building items. An entire partnering country is considered as a higher-level stakeholder - the national stakeholder, represented by the national government, being faced to simultaneous seeking an upward (international) and a downward (intra-national) consensus in a psychologically stressed environment, possibly being characterized by diverse political, economic and social interests. The following theses as a possible interdisciplinary approach towards building of shared understanding and stakeholder consensus on the international scale of RW disposal are forwarded and developed: a) building of international stakeholder consensus would be promoted by activating and diversifying on the international scale multilateral interactions between intra- and international stakeholders, including web-based networks of the RW disposal site investigations and decision-making, as well as networks for international cooperation among government authorities in nuclear safety, b) gradual progress in intergovernmental consensus and reaching multilateral agreements on shared deep repositories will be the result of democratic dialogue, via observing the whole set of various interests and common resolving of emerged controversies by using advanced synergetic approaches of conflict resolution, c) cross-cultural thinking and world perception, mental flexibility, creativity and knowledge are considered as basic prerogatives for gaining a higher level of mutual understanding and consensus for seeking further consensus, for advancing the preparedness to act together, and ultimately - for achieving desired shared goals. It is proposed that self-organized social learning will make it possible to promote adequate perception of risk and prevent, by diminishing uncertainties and unknown factors, social amplification of an imagined risk, as well as to increase the trust level and facilitate more adequate equity perception. The proposed approach to the multilevel stakeholder consensus building on international scale is extrapolated to the present-day activities of siting of such near-surface RW disposal facilities which supposedly could have non-negligible trans-boundary impact. A multilevel stakeholder interaction process is considered for the case of resolving of emerged problems in site selection for the planned near-surface RW repository in vicinity of the Lithuanian-Latvian border foreseen for disposal of short lived low- and intermediate level waste arising from the decommissioning of the Ignalina Nuclear Power Plant. (authors)

  4. Comparative study of two- and three-dimensional modeling on arc discharge phenomena inside a thermal plasma torch with hollow electrodes

    SciTech Connect (OSTI)

    Kim, Keun Su; Park, Jin Myung; Choi, Sooseok; Kim, Jongin; Hong, Sang Hee

    2008-02-15

    A comparative study between two- and three-dimensional (2D and 3D) modeling is carried out on arc discharge phenomena inside a thermal plasma torch with hollow electrodes, in order to evaluate the effects of arc root configuration characterized by either 2D annular or 3D highly localized attachment on the electrode surface. For this purpose, a more precise 3D transient model has been developed by taking account of 3D arc current distribution and arc root rotation. The 3D simulation results apparently reveal that the 3D arc root attachment brings about the inherent 3D and turbulence nature of plasma fields inside the torch. It is also found that the constricted arc column near the vortex chamber plays an important role in heating and acceleration of injected arc gases by concentrating arc currents on the axis of the hollow electrodes. The inherent 3D nature of arc discharge is well preserved inside the cathode region, while these 3D features slowly diminish behind the vortex chamber where the turbulent flow begins to be developed in the anode region. Based on the present simulation results, it is noted that the mixing effects of the strong turbulent flow on the heat and mass transfer are mainly responsible for the gradual relaxation of the 3D structures of plasma fields into the 2D axisymmetric ones that eventually appear in the anode region near the torch exit. From a detailed comparison of the 3D results with the 2D ones, the arc root configuration seems to have a significant effect on the heat transfer to the electrode surfaces interacting with the turbulent plasma flow. That is, in the 2D simulation based on an axisymmetric stationary model, the turbulence phenomena are fairly underestimated and the amount of heat transferred to the cold anode wall is calculated to be smaller than that obtained in the 3D simulation. For the validation of the numerical simulations, calculated plasma temperatures and axial velocities are compared with experimentally measured ones, and the 3D simulation turns out to be more accurate than the 2D simulation as a result of a relatively precise description of the turbulent phenomena inside the torch using a more realistic model of arc root attachment. Finally, it is suggested that the 3D transient formulation is indeed required for describing the real arc discharge phenomena inside the torch, while the 2D stationary approach is sometimes useful for getting practical information about the time-averaged plasma characteristics outside the torch because of its simplicity and rapidness in computation.

  5. ARE DECAYING MAGNETIC FIELDS ABOVE ACTIVE REGIONS RELATED TO CORONAL MASS EJECTION ONSET?

    SciTech Connect (OSTI)

    Suzuki, J. [Department of Astronomy, University of California, Berkeley, CA 94720-7450 (United States); Welsch, B. T.; Li, Y. [Space Sciences Laboratory, University of California, Berkeley, CA 94720-7450 (United States)

    2012-10-10

    Coronal mass ejections (CMEs) are powered by magnetic energy stored in non-potential (current-carrying) coronal magnetic fields, with the pre-CME field in balance between outward magnetic pressure of the proto-ejecta and inward magnetic tension from overlying fields that confine the proto-ejecta. In studies of global potential (current-free) models of coronal magnetic fields-Potential Field Source Surface (PFSS) models-it has been reported that model field strengths above flare sites tend to be weaker when CMEs occur than when eruptions fail to occur. This suggests that potential field models might be useful to quantify magnetic confinement. One straightforward implication of this idea is that a decrease in model field strength overlying a possible eruption site should correspond to diminished confinement, implying an eruption is more likely. We have searched for such an effect by post facto investigation of the time evolution of model field strengths above a sample of 10 eruption sites. To check if the strengths of overlying fields were relevant only in relatively slow CMEs, we included both slow and fast CMEs in our sample. In most events we study, we find no statistically significant evolution in either (1) the rate of magnetic field decay with height, (2) the strength of overlying magnetic fields near 50 Mm, or (3) the ratio of fluxes at low and high altitudes (below 1.1 R{sub Sun }, and between 1.1 and 1.5 R{sub Sun }, respectively). We did observe a tendency for overlying field strengths and overlying flux to increase slightly, and their rates of decay with height to become slightly more gradual, consistent with increased confinement. The fact that CMEs occur regardless of whether the parameters we use to quantify confinement are increasing or decreasing suggests that either (1) the parameters that we derive from PFSS models do not accurately characterize the actual large-scale field in CME source regions, (2) systematic evolution in the large-scale magnetic environment of CME source regions is not, by itself, a necessary condition for CMEs to occur, or both.

  6. 1. A Prospectus on Agent Autonomy 1 A Prospectus on Agent Autonomy

    E-Print Network [OSTI]

    Hexmoor, Henry

    focused on architectures and this gradually shifted to address autonomy more directly (AAAI 1991- 1995 - National Research Council, Rome, Italy Key words: interaction, dependence, mixed initiative, adjustable

  7. 3D MEMS via (post-) buckling of micromachined structures and integration of bulk nanoporous elements in microfluidic devices

    E-Print Network [OSTI]

    Fachin, Fabio

    2011-01-01

    The last two decades have seen a proliferation of fields and applications where microtechnologies have gradually replaced, and often outperformed, their macroscopic counterparts. From engineering to basic sciences, ...

  8. Supplemental material for "Probing decoherence through Fano resonances"

    E-Print Network [OSTI]

    Rotter, Stefan

    in the ensemble average of the total transmission |t|2 will be gradually suppressed for increasing, we took advantage of the knowledge that the mini

  9. Vozes dos Porões: A literatura periférica do Brasil

    E-Print Network [OSTI]

    Reyes Arias, Alejandro

    2011-01-01

    democratização”, neoliberalismo, tráfico de drogas, crimedo Menor. Democratização e neoliberalismo A gradual aberturaMarcos, em uma análise do neoliberalismo global intitulado “

  10. A Computational Model of Lakatos-style Reasoning 

    E-Print Network [OSTI]

    Pease, Alison

    2007-06-26

    Lakatos outlined a theory of mathematical discovery and justification, which suggests ways in which concepts, conjectures and proofs gradually evolve via interaction between mathematicians. Different mathematicians may ...

  11. Acknowledgments Many people skip over the acknowledgments when they read a book. Not me. Every book

    E-Print Network [OSTI]

    Turbak, Franklyn

    repair to solar system dynamics. His unbounded energy, infectious enthusiasm, diverse interests, and good has nourished me. Lisa gradually assumed all household duties while her husband mutated

  12. From Motherhood Penalties to Husband Premia: The New Challenge for Gender Equality and Family Policy, Lessons from Norway

    E-Print Network [OSTI]

    Petersen, Trond; Penner, Andrew; Høgnes, Geir

    2012-01-01

    2001. “Cohabitation in Norway: An Accepted and GraduallyWage Gap, The Case of Norway. ” European Sociological ReviewA Comparison of Finland, Norway and Swe- den. ” European

  13. National Clean Energy Business Plan Competition | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    has developed materials that will fundamentally change the economics of gas storage in natural gas vehicles - supporting the gradual displacement of foreign oil. Learn More Mesdi...

  14. National Clean Energy Business Plan Competition | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    has developed materials that will fundamentally change the economics of gas storage in natural gas vehicles - supporting the gradual displacement of foreign oil. Learn More...

  15. Current Status and Future Scenarios of Residential Building Energy Consumption in China

    E-Print Network [OSTI]

    Zhou, Nan

    2010-01-01

    coal boilers and district heating will gradually shift torespectively, followed by district heating of 22%, while ingas boiler boiler stove district heating heat pump air

  16. Energy for 500 Million Homes: Drivers and Outlook for Residential Energy Consumption in China

    E-Print Network [OSTI]

    Zhou, Nan

    2010-01-01

    coal boilers and district heating will gradually shift togas boiler boiler stove district heating heat pump airrespectively, followed by district heating of 22%, while in

  17. High-throughput Synthesis and Metrology of Graphene Materials

    E-Print Network [OSTI]

    Ghazinejad, Maziar Ghazinejad

    2012-01-01

    exfoliated graphene oxide layers along with CVD grown CNTsto create a barrier oxide layer on copper foil. Fe catalystcopper oxide foil, the oxide layer would be gradually flow,

  18. 1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    energy source. Implementing a capture, utilization, and storage might enable a gradual transition to energy sources that emit less CO 2 per unit of energy while continuing to...

  19. GeoArabia, Vol. 13, No. 2, 2008 Gulf PetroLink, Bahrain

    E-Print Network [OSTI]

    Ali, Mohammed

    regime took place in the Late Eocene-Miocene but gradually shifted to become N-S to NE-SW. This shift

  20. FACTORS RELATING TO MULTICULTURAL COMPETENCE IN BEGINNING PSYCHOLOGY INTERNS

    E-Print Network [OSTI]

    Vargas, Christian

    2010-07-21

    , Adjusting for Social Desirability……………...114 Table 5. Means and Standard Deviations of High, Medium, and Low Infusion Groups on the Multicultural Competence Inventory……………………………………………....115 Table 6. Means and Standard Deviations of Internship Sites...

  1. Reliability based assessment of FRP rehabilitation of reinforced concrete girders

    E-Print Network [OSTI]

    Wilcox, Patrick Carlo

    2008-01-01

    3-4. Average values, standard deviations, and ACI 440 [2002]3-4. Average values, standard deviations, and ACI 440 [2002]ACI 440 [2002], where the mean modulus was used as a characteristic value and standard

  2. Field observations of soil moisture variability across scales

    E-Print Network [OSTI]

    Famiglietti, James S; Ryu, Dongryeol; Berg, Aaron A; Rodell, Matthew; Jackson, Thomas J

    2008-01-01

    extent scales and wet- ness conditions. The more than 36,000deviation, CV, and skew- ness versus mean moisture contentstandard deviation and skew- ness versus mean soil moisture,

  3. California community colleges : a study of administrators' support of classified staff during organizational change

    E-Print Network [OSTI]

    Jensen, Christine M.

    2011-01-01

    their associated themes, mean, and standard deviation datatheir associated theme(s), mean, and standard deviation dataTheme Communication Mean SD Trust Trust & Support Communication & Trust Communication & Trust Trust Trust Trust & Support Support The means and standard

  4. Nuclear astrophysical plasmas: ion distribution functions and fusion rates

    E-Print Network [OSTI]

    Marcello Lissia; Piero Quarati

    2005-11-15

    This article illustrates how very small deviations from the Maxwellian exponential tail, while leaving unchanged bulk quantities, can yield dramatic effects on fusion reaction rates and discuss several mechanisms that can cause such deviations.

  5. The Effect of Roll Waves on the Hydrodynamics of Falling Films Observed in Vertical Column Absorbers

    SciTech Connect (OSTI)

    Miller, W.A.

    2001-06-28

    A thin falling film is well suited to simultaneous heat and mass transfer because of the small thermal resistance through the film and because of the large contact surface achievable at low flow rates. The film enters as a smooth laminar flow and quickly transitions into small-amplitude wavy flow. The waves grown in length and amplitude and are identified as roll waves. This flow regime is termed wavy-laminar flow, and modern heat and mass transfer equipment operate in this complicated transition regime. Research published in open literature has shown the mass flow rate in the rollwaves to be about 10 to 20 times greater than that in the laminar substrate. As the film fully develops, the waves grow in mass and the film substrate thins because fluid is swept from the substrate by the secondary flows of the roll wave. Many studies have been conducted to measure and correlate the film thickness of wavy-laminar flows. Literature data show that Nusselt's theory for smooth laminar flow can over predict the film thickness by as much as 20% for certain wavy-laminar flow conditions. The hydrodynamics of falling films were therefore studied to measure the film thickness of a free-surface falling film and to better understand the parameters that affect the variations of the film thickness. A flow loop was set up for measuring the thickness, wave amplitude,and frequency of a film during hydrodynamic flow. Decreasing the pipe diameter caused the amplitude of the wavy flow to diminish. Measurements monitored from stations along the falling film showed a thinning of film thickness. Fully developed flow required large starting lengths of about 0.5 m. The film thickness increases as the Reynolds number (Re) increases. Increasing the Kapitza number (Ka) causes a decrease in the film thickness. Regression analysis showed that the Re and Ka numbers described the data trends in wavy-laminar flow. Rather than correlating the Re number in discrete ranges of the Ka number as earlier researchers have done, this research made the Ka number an independent regression variable along with the Re number. The correlation explains 96% of the total variation in the data and predicts the experimental data within an absolute average deviation of {+-} 4.0%. The correlation supports the calculation of a fully developed film thickness for wavy-laminar falling films.

  6. Sexual Functioning Among Endometrial Cancer Patients Treated With Adjuvant High-Dose-Rate Intra-Vaginal Radiation Therapy

    SciTech Connect (OSTI)

    Damast, Shari; Alektiar, Kaled M.; Goldfarb, Shari; Eaton, Anne; Patil, Sujata; Mosenkis, Jeffrey; Bennett, Antonia; Atkinson, Thomas; Jewell, Elizabeth; Leitao, Mario; Barakat, Richard; Carter, Jeanne; Basch, Ethan

    2012-10-01

    Purpose: We used the Female Sexual Function Index (FSFI) to investigate the prevalence of sexual dysfunction (SD) and factors associated with diminished sexual functioning in early stage endometrial cancer (EC) patients treated with simple hysterectomy and adjuvant brachytherapy. Methods and Materials: A cohort of 104 patients followed in a radiation oncology clinic completed questionnaires to quantify current levels of sexual functioning. The time interval between hysterectomy and questionnaire completion ranged from <6 months to >5 years. Multivariate regression was performed using the FSFI as a continuous variable (score range, 1.2-35.4). SD was defined as an FSFI score of <26, based on the published validation study. Results: SD was reported by 81% of respondents. The mean ({+-} standard deviation) domain scores in order of highest-to-lowest functioning were: satisfaction, 2.9 ({+-}2.0); orgasm, 2.5 ({+-}2.4); desire, 2.4 ({+-}1.3); arousal, 2.2 ({+-}2.0); dryness, 2.1 ({+-}2.1); and pain, 1.9 ({+-}2.3). Compared to the index population in which the FSFI cut-score was validated (healthy women ages 18-74), all scores were low. Compared to published scores of a postmenopausal population, scores were not statistically different. Multivariate analysis isolated factors associated with lower FSFI scores, including having laparotomy as opposed to minimally invasive surgery (effect size, -7.1 points; 95% CI, -11.2 to -3.1; P<.001), lack of vaginal lubricant use (effect size, -4.4 points; 95% CI, -8.7 to -0.2, P=.040), and short time interval (<6 months) from hysterectomy to questionnaire completion (effect size, -4.6 points; 95% CI, -9.3-0.2; P=.059). Conclusions: The rate of SD, as defined by an FSFI score <26, was prevalent. The postmenopausal status of EC patients alone is a known risk factor for SD. Additional factors associated with poor sexual functioning following treatment for EC included receipt of laparotomy and lack of vaginal lubricant use.

  7. Theoretical foundation for measuring the groundwater age distribution.

    SciTech Connect (OSTI)

    Gardner, William Payton; Arnold, Bill Walter

    2014-01-01

    In this study, we use PFLOTRAN, a highly scalable, parallel, flow and reactive transport code to simulate the concentrations of 3H, 3He, CFC-11, CFC-12, CFC-113, SF6, 39Ar, 81Kr, 4He and themean groundwater age in heterogeneous fields on grids with an excess of 10 million nodes. We utilize this computational platform to simulate the concentration of multiple tracers in high-resolution, heterogeneous 2-D and 3-D domains, and calculate tracer-derived ages. Tracer-derived ages show systematic biases toward younger ages when the groundwater age distribution contains water older than the maximum tracer age. The deviation of the tracer-derived age distribution from the true groundwater age distribution increases with increasing heterogeneity of the system. However, the effect of heterogeneity is diminished as the mean travel time gets closer the tracer age limit. Age distributions in 3-D domains differ significantly from 2-D domains. 3D simulations show decreased mean age, and less variance in age distribution for identical heterogeneity statistics. High-performance computing allows for investigation of tracer and groundwater age systematics in high-resolution domains, providing a platform for understanding and utilizing environmental tracer and groundwater age information in heterogeneous 3-D systems. Groundwater environmental tracers can provide important constraints for the calibration of groundwater flow models. Direct simulation of environmental tracer concentrations in models has the additional advantage of avoiding assumptions associated with using calculated groundwater age values. This study quantifies model uncertainty reduction resulting from the addition of environmental tracer concentration data. The analysis uses a synthetic heterogeneous aquifer and the calibration of a flow and transport model using the pilot point method. Results indicate a significant reduction in the uncertainty in permeability with the addition of environmental tracer data, relative to the use of hydraulic measurements alone. Anthropogenic tracers and their decay products, such as CFC11, 3H, and 3He, provide significant constraint oninput permeability values in the model. Tracer data for 39Ar provide even more complete information on the heterogeneity of permeability and variability in the flow system than the anthropogenic tracers, leading to greater parameter uncertainty reduction.

  8. www.sciencemag.org/cgi/content/full/1157707/DC1 Supporting Online Material for

    E-Print Network [OSTI]

    Fischer, Hubertus

    data sequences and changes within of the prescribed standard deviation values. An exception stratigraphy Chronostratigraphical terms Dansgaard-Oeschge

  9. Detection and quantification system for monitoring instruments

    DOE Patents [OSTI]

    Dzenitis, John M. (Danville, CA); Hertzog, Claudia K. (Houston, TX); Makarewicz, Anthony J. (Livermore, CA); Henderer, Bruce D. (Livermore, CA); Riot, Vincent J. (Oakland, CA)

    2008-08-12

    A method of detecting real events by obtaining a set of recent signal results, calculating measures of the noise or variation based on the set of recent signal results, calculating an expected baseline value based on the set of recent signal results, determining sample deviation, calculating an allowable deviation by multiplying the sample deviation by a threshold factor, setting an alarm threshold from the baseline value plus or minus the allowable deviation, and determining whether the signal results exceed the alarm threshold.

  10. Thesis Presentation

    E-Print Network [OSTI]

    Jonathon Peterson

    2008-07-23

    Jul 24, 2008 ... Thesis Presentation. Limiting Distributions and Large Deviations for. Random Walks in Random Environments. Jonathon Peterson. School of ...

  11. Constraining the propagation of bomb-radiocarbon through the dissolved organic carbon (DOC) pool in the northeast Pacific Ocean

    E-Print Network [OSTI]

    Beaupré, Steven R; Druffel, Ellen R.M.

    2009-01-01

    the deviations in D 14 C measurements of UV oxidized 14 CM) for concentration measurements via UV-oxidation (Beaupre´

  12. Shoreface Morphodynamics, Back Beach Variability, and Implications of Future Sea-Level Rise for California's Sandy Shorelines

    E-Print Network [OSTI]

    Harden, Erika Lynne

    2012-01-01

    index.html> NOAA National Data Buoy Center Online. buoy sources wave heights from NDBC buoy 46042 with standard deviations;

  13. PIERS ONLINE, VOL. 4, NO. 5, 2008 551 A Parallel, Fourier Finite-Element Formulation with an Iterative

    E-Print Network [OSTI]

    Torres-Verdín, Carlos

    with an Iterative Solver for the Simulation of 3D LWD Measurements Acquired in Deviated Wells D. Pardo1 , M. J. Nam1-while-drilling (LWD) instrument operating at 1.75 MHz in a 55-degree deviated well. Numerical results confirm the high. The method is applied to the simulation of LWD measurements in a 55-degree deviated well. 2. MODEL PROBLEM

  14. Automatically Grading Learners’ English Using a Gaussian Process

    E-Print Network [OSTI]

    van Dalen, Rogier C.; Knill, Kate M.; Gales, Mark J. F.

    2015-08-04

    deviation Disfluencies number Words number, number per second, mean duration Phones mean, standard deviation, median, mean absolute deviation as a pie chart or bar chart. The prompt for the last section asks the candidate to imagine they are in a specific...

  15. Assessing Reservoir Depositional Environments to Develop and Quantify Improvements in CO2 Storage Efficiency. A Reservoir Simulation Approach

    SciTech Connect (OSTI)

    Okwen, Roland; Frailey, Scott; Leetaru, Hannes; Moulton, Sandy

    2014-09-30

    The storage potential and fluid movement within formations are dependent on the unique hydraulic characteristics of their respective depositional environments. Storage efficiency (E) quantifies the potential for storage in a geologic depositional environment and is used to assess basinal or regional CO2 storage resources. Current estimates of storage resources are calculated using common E ranges by lithology and not by depositional environment. The objectives of this project are to quantify E ranges and identify E enhancement strategies for different depositional environments via reservoir simulation studies. The depositional environments considered include deltaic, shelf clastic, shelf carbonate, fluvial deltaic, strandplain, reef, fluvial and alluvial, and turbidite. Strategies considered for enhancing E include CO2 injection via vertical, horizontal, and deviated wells, selective completions, water production, and multi-well injection. Conceptual geologic and geocellular models of the depositional environments were developed based on data from Illinois Basin oil fields and gas storage sites. The geologic and geocellular models were generalized for use in other US sedimentary basins. An important aspect of this work is the development of conceptual geologic and geocellular models that reflect the uniqueness of each depositional environment. Different injection well completions methods were simulated to investigate methods of enhancing E in the presence of geologic heterogeneity specific to a depositional environment. Modeling scenarios included horizontal wells (length, orientation, and inclination), selective and dynamic completions, water production, and multiwell injection. A Geologic Storage Efficiency Calculator (GSECalc) was developed to calculate E from reservoir simulation output. Estimated E values were normalized to diminish their dependency on fluid relative permeability. Classifying depositional environments according to normalized baseline E ranges ranks fluvial deltaic and turbidite highest and shelf carbonate lowest. The estimated average normalized baseline E of turbidite, and shelf carbonate depositional environments are 42.5% and 13.1%, with corresponding standard deviations of 11.3%, and 3.10%, respectively. Simulations of different plume management techniques suggest that the horizontal well, multi-well injection with brine production from blanket vertical producers are the most efficient E enhancement strategies in seven of eight depositional environments; for the fluvial deltaic depositional environment, vertical well with blanket completions is the most efficient. This study estimates normalized baseline E ranges for eight depositional environments, which can be used to assess the CO2 storage resource of candidate formations. This study also improves the general understanding of depositional environment’s influence on E. The lessons learned and results obtained from this study can be extrapolated to formations in other US basins with formations of similar depositional environments, which should be used to further refine regional and national storage resource estimates in future editions of the Carbon Utilization and Storage Atlas of the United States. Further study could consider the economic feasibility of the E enhancement strategies identified here.

  16. USING THE EPQ WITH PARTIAL BACKORDERING FOR COORDINATED PLANNING OF A PRODUCT AND ITS COMPONENTS

    E-Print Network [OSTI]

    Toews, Carl

    little work on systems recognizing the WIP effects when there is gradual, rather than batch, conversion planning of a final product and its components that recognized the gradual conversion of input to output that there is one unit of each component in the final product as in Banerjee et al. (1990) by redefining a component

  17. Customer research, customer-driven design, and business strategy in Massively Multiplayer Online Games

    E-Print Network [OSTI]

    Andrivet, Sébastien

    2007-01-01

    This thesis is a part of an exploration of how the relationships between the customers of Massively Multiplayer Online Games (MMOGs) shape customer experience, and can be used to diminish customer churn and improve customer ...

  18. letters to nature 364 NATURE |VOL 407 |21 SEPTEMBER 2000 |www.nature.com

    E-Print Network [OSTI]

    Morel, François M. M.

    generates a continuous rain of calcium carbonate to the deep ocean and underlying sediments1 proportion of malformed coccoliths and incomplete coccospheres. Diminished calci®ca- tion led to a reduction

  19. SNL Memohead (black tbird w/o macro)

    Office of Environmental Management (EM)

    of the passing air even as the convection coefficient was diminished by reduced flow velocity. The magnitude of the P7R7 air temperature increase and the increase in...

  20. Salmon fishing boats of the North American Pacific Coast in the era of oar and sail 

    E-Print Network [OSTI]

    Moore, Charles David

    1993-01-01

    for small craft identification by archaeologists working on the Pacific Coast. The information gained from studying various salmon fishing boats and their distribution reflects changing hull shape due to local sea conditions, competition amid diminishing...

  1. ORGANIZATIONAL, INTERFACE AND FINANCIAL BARRIERS TO THE COMMERCIAL DEVELOPMENT OF COMMUNITY ENERGY SYSTEMS

    E-Print Network [OSTI]

    Schladale, R.

    2010-01-01

    that fossil fuel supplies will diminish, and rise in price.fossil fuels, questions are likely to arise during contract negotiations regard- ing the availability of fuel supply and price,fuel prices. Conventional power plants running on fossil

  2. ANALYSIS OF THE CALIFORNIA ENERGY INDUSTRY

    E-Print Network [OSTI]

    Authors, Various

    2010-01-01

    I! ~J q 5B OFFSHORE Oil PRODUCTION-lOWER ~8 (~ MB/Dl lCW-G""to diminished expenditures for offshore oil production sinceoffshore oil production is expected to peak by 1990, and in

  3. Advancement of Erosion Testing, Modeling, and Design of Concrete Pavement Subbase Layers 

    E-Print Network [OSTI]

    Jung, Youn Su

    2010-10-12

    Concrete pavement systems have great capacity to provide long service lives; however, if the subbase layer is improperly designed or mismanaged, service life would be diminished significantly since the subbase layer performs ...

  4. DOI: 10.1007/s00339-004-3170-4 Appl. Phys. A 80, 13851389 (2005)

    E-Print Network [OSTI]

    Yoo, S. J. Ben

    2005-01-01

    are shrinking to diminishing dimensions, the devices and interconnects in a microprocessor or memory array for negative index materials, photonic crystals, molds for nano-imprinting and surface enhanced Raman

  5. Int. J. Product Lifecycle Management, Vol. X, No. Y, xxxx 1 Copyright 200x Inderscience Enterprises Ltd.

    E-Print Network [OSTI]

    Sandborn, Peter

    technology roadmap requirements, obsolescence management realities, logistics limitations, budget limitations and management policy. Keywords: component obsolescence; product lifecycle management; diminishing manufacturing) and is caused by the unavailability of technologies or components that are needed to manufacture or sustain

  6. Quantum ghost imaging through turbulence

    E-Print Network [OSTI]

    Dixon, P. Ben

    We investigate the effect of turbulence on quantum ghost imaging. We use entangled photons and demonstrate that for a specific experimental configuration the effect of turbulence can be greatly diminished. By decoupling ...

  7. Cost, Precision, and Task Structure in Aggression-based Arbitration for Minimalist Robot Cooperation 

    E-Print Network [OSTI]

    Mitra, Tanushree

    2012-10-19

    Multi-robot systems have the potential to improve performance through parallelism. Unfortunately, interference often diminishes those returns. Starting from the earliest multi-robot research, a variety of arbitration mechanisms have been proposed...

  8. Efficient Sensor Placement Optimization for Securing Large Water Distribution Networks

    E-Print Network [OSTI]

    Pratt, Vaughan

    Efficient Sensor Placement Optimization for Securing Large Water Distribution Networks Andreas Abstract: The problem of deploying sensors in a large water distribution network is considered, in order water--exhibits an important diminishing returns effect called submodularity. The submodularity

  9. Wednesday, October 12th Bourns A265 1:40-2:30pm The development of catalytic chemical conversion processes that are environmentally friendly and

    E-Print Network [OSTI]

    resources to desired products is necessary to mitigate diminishing fossil resources and growing concerns instead of oil) requires the design of new classes of catalytic materials that can perform complex

  10. Supplement article Two-phase partitioning bioreactors: the use of polymers for

    E-Print Network [OSTI]

    Daugulis, Andrew J.

    on the cells, diminished this positive performance. © 2012 Curtin University of Technology and John Wiley demonstrated.[4­6] Amorphous (`soft') plastics, which can be consid- ered to be large molecular weight organic

  11. Late Cenomanian – Early Turonian Reconstruction of Intermediate and Deep-Water Circulation in the Proto-Indian Ocean 

    E-Print Network [OSTI]

    Tilghman, David S

    2013-09-24

    with widespread burial of organic carbon (Oceanic Anoxic Event 2 - OAE2). Several factors likely promoted organic carbon burial including increased nutrient input, diminished seafloor oxygen levels, density stratification, enhanced upwelling, and sluggish deep-water...

  12. Changing Places: How Communities Will Improve the Health of Boys of Color

    E-Print Network [OSTI]

    Edley, Christopher; Ruiz de Velasco, Jorge

    2010-01-01

    bearing on student and school performance (Noguera 2003). Weis whether or not school performance is aligned with statec h o o l s / 1 6 5 school performance that in turn diminish

  13. An adaptive unstructured solver for shallow granular , M. Schafer1

    E-Print Network [OSTI]

    Gray, Nico

    . These features include traveling or steady-state jumps in the depth (analogous to hydraulic jumps or shock waves), depth diminishing waves (expansion waves), and formation of zero depth regions (vacuum), Gray and Tai

  14. Getting Serious About Safety and Loss Prevention Emergency Power and Standby Generators 

    E-Print Network [OSTI]

    Fisher, D.; Fenter, T.; McClure, J. D.

    2004-01-01

    Power failures can occur for a variety of reasons. The consequences of such outages range from mere inconveniences to damaged equipment, ruined goods, lost revenue, and diminished safety. In all buildings lighting is among the greatest safety...

  15. Role of SUMO modification in hepatocyte differentiation 

    E-Print Network [OSTI]

    Hannoun, Zara

    2011-11-25

    Primary human hepatocytes are a scarce resource with variable function, which diminishes with time in culture. As a consequence their use in tissue modelling and therapy is restricted. Human embryonic stem cells (hESCs) ...

  16. A Three-Level Problem-Centric Strategy for Selecting NMR Precusors & Analytes.

    E-Print Network [OSTI]

    Grossmann, Ignacio E.

    determining whether the analytes provide unique flux values or multiple flux solutions. Finally, the economics has indicated that attenuating the activity of pyruvate kinase will diminish acetate formation from

  17. The potential role of arteriolar vasodilator responsiveness in orthostatic intolerance 

    E-Print Network [OSTI]

    McCurdy, Matthew R

    2013-02-22

    Astronauts returning to earth experience hypotension from hours to days. The subsequent inability to maintain the upright (orthostatic) position diminishes work capacity. Orthostatic hypotension appears to result from weightlessness...

  18. Colorado Water Resources Research Institute Annual Technical Report

    E-Print Network [OSTI]

    -economic impacts, and consequences to cities, rural communities, agriculture and industry. Drought response Lab Created -- As Colorado's drought worsens, the state's water supplies diminish, and communities at the university's Agricultural Experiment Station research centers located in communities throughout Colorado. Co

  19. Bio-Artificial Synergies for Grasp Posture Control of Supernumerary Robotic Fingers

    E-Print Network [OSTI]

    Wu, Faye Y.

    A new type of wrist-mounted robot, the Supernumerary Robotic (SR) Fingers, is proposed to work closely with the human hand and aid the human in performing a variety of prehensile tasks. For people with diminished functionality ...

  20. China's food production under water and land limitations

    E-Print Network [OSTI]

    Hoisungwan, Piyatida

    2010-01-01

    The future availability of the natural resources (water and land) needed for food production is highly uncertain. Evidence shows diminishing natural resources and growing food demand throughout many parts of the world. ...

  1. Evaluation of consumer demand for selected end-use markets for cotton 

    E-Print Network [OSTI]

    Viator, Catherine Longman

    2000-01-01

    The U.S. cotton industry is facing a rapidly diminishing share of the domestic and foreign textile markets. To become more competitive in these markets, the textile industry should know where consumer demand is being directed. The objectives...

  2. The rheological complexity of waxy crude oils : yielding, thixotropy and shear heterogeneities

    E-Print Network [OSTI]

    Dimitriou, Christopher (Christopher J.)

    2013-01-01

    Precipitate-containing crude oils are of increasing economic importance, due to diminishing oil reserves and the increased need to extract hydrate and wax-containing crude oil from ultra deep-water resources. Despite this ...

  3. Developing the small, mixed-use urban project : contribution to neighborhood revitalization

    E-Print Network [OSTI]

    Olivier, Jacqueline Morrissette

    1988-01-01

    Through out many cities in America, urban neighborhoods are characterized by the diminished vitality and extensive deterioration of their overall landscape. The consequences of modem city planning, architectural design and ...

  4. ESTIMATION OF SAFETY EFFECTIVENESS OF COMPOSITE SHOULDERS ON RURAL TWO-LANE HIGHWAYS

    E-Print Network [OSTI]

    Zeng, Huanghui

    2012-05-31

    A paved shoulder has been regarded as an effective safety improvement to reduce crashes. There is belief that there is a diminishing safety benefit for each additional increment of paved shoulder width. Thus there may be opportunities for greater...

  5. Synthesis of controlled release drug device with supercritical CO2 and co-solvent 

    E-Print Network [OSTI]

    Bush, Joshua R.

    2007-04-25

    for prolonged periods. Made from biodegradable and bioerodable polymers, unwanted side effects and the need of return trips for treatment diminish. However, a usable device must be free of organic solvents normally used to dissolve large drug molecules. Many...

  6. Future CO2 Emissions and Climate Change from Existing Energy Infrastructure

    E-Print Network [OSTI]

    Davis, SJ; Caldeira, K; Matthews, HD

    2010-01-01

    Future CO 2 Emissions and Climate Change from Existing Energynon-energy emissions could diminish in the future. In viewfuture CO 2 emissions is much greater in China, because China’s energy

  7. Exploring change in preservice teachers' beliefs about English language learning and teaching 

    E-Print Network [OSTI]

    Clark-Goff, Kylah Lynn

    2009-05-15

    Increasing numbers of English language learners (ELLs) and diminishing services for those students is resulting in mainstream teachers across the United States taking on the responsibility of teaching ELLs. This demands the preparation of all...

  8. Funcitonal importance of Belize coral reefs, Wulff52 FUNCTIONAL IMPORTANCE OF BIODIVERSITY FOR CORAL REEFS OF BELIZE1

    E-Print Network [OSTI]

    Ronquist, Fredrik

    , and other animals shelter and find food, while sponges glue living corals onto the reef frame and protect manufactured or released from inside the earth), too many species may be diminished or deleted simultaneously

  9. Nanoscale antigen organization regulates binding to specific B-cells and B-cell activation

    E-Print Network [OSTI]

    Ke, Chyan Ying

    2015-01-01

    The successes of vaccines in modern medicine diminished the morbidity and mortality of many pathogenic infections. Yet, difficulties remain in improving the immunogenicity of modern subunit vaccines. In addition, isolation ...

  10. Tiled microprocessors

    E-Print Network [OSTI]

    Taylor, Michael Bedford, 1975-

    2007-01-01

    Current-day microprocessors have reached the point of diminishing returns due to inherent scalability limitations. This thesis examines the tiled microprocessor, a class of microprocessor which is physically scalable but ...

  11. The first bilateral investment treaties : U.S. friendship, commerce and navigation treaties in the Truman administration

    E-Print Network [OSTI]

    Vandevelde, Kenneth J.

    2012-01-01

    no way diminished the administration’s commitment to the NewForeign Policy in the Truman Administration The FCN treatyprogram in the Truman administration not only reflected New

  12. Design of a bead holder for thermal atherosclerosis sensor

    E-Print Network [OSTI]

    Savage, Christopher (Christopher R.)

    2007-01-01

    Atherosclerosis is a systemic disease that causes plaque accumulation in arteries and diminished endothelial function. Because it is rarely identified until serious symptoms appear, there is value in a noninvasive technique ...

  13. HIS: an instruction issue mechanism for hyperscalar processors 

    E-Print Network [OSTI]

    Kuttanna, Belliappa

    1993-01-01

    by providing multiple functional units and by improving resource utilization by supporting multiple instruction threads. Pipeline stalls are decreased by diminishing the effect of control instructions and hardware resource sharing is provided. A dual...

  14. MICROBIOLOGY OF AQUATIC SYSTEMS Species Composition of Bacterial Communities Influences

    E-Print Network [OSTI]

    of Mosquitoes to Experimental Plant Infusions Loganathan Ponnusamy & Dawn M. Wesson & Consuelo Arellano & Coby use oviposition traps containing plant infusions for monitoring populations of these mosquito species significantly diminished responses to experimental infusions made with sterilized white oak leaves, showing

  15. Direct Refrigeration from Heat Recovery Using 2-Stage Absorption Chillers 

    E-Print Network [OSTI]

    Hufford, P. E.

    1983-01-01

    Although the cost of some fossil fuels has moderated, the importance of energy conservation by heat recovery has not diminished. The application of waste heat generated steam to produce chilled water is not new. However, there is a newly developed...

  16. Ecology 2003 17, 766777

    E-Print Network [OSTI]

    Koerner, Christian

    availability. Nutrient losses associated with desertification will thus diminish potential gains in biomass due scarce availability of water might further decrease in many areas as a consequence of desertification

  17. USF System USF USFSP USFSM Number: 10-051

    E-Print Network [OSTI]

    Meyers, Steven D.

    of clean energy, increasing energy efficiency, and diminishing life-cycle impacts and our consumption environments (including water management), transportation, energy, and consumption (waste and recycling to: materials reuse and building renovation, retrofitting, green building, smart masonry, materials

  18. Public market development strategy : making the improbable possible

    E-Print Network [OSTI]

    Zade, Joshua Charles

    2009-01-01

    Public markets were once central components of the urban food system in American cities, but declined in number and importance by the middle of the 20th century. Despite a diminished role in feeding the city, public markets ...

  19. RealReal--Time AdvancedTime Advanced Process Control forProcess Control for

    E-Print Network [OSTI]

    Rubloff, Gary W.

    enables prediction of crystal quality Significance GaN HEMT technology requires precise control of Al to 35% AlN) High: breakdown suffers Low: 2DEG diminished Thickness (~20 to 25 nm) Thick: pinch

  20. Assessment of the urban public's knowledge of white-tailed deer management in two Texas communities 

    E-Print Network [OSTI]

    Alderson, Jessica Lynn

    2009-05-15

    Urbanization throughout much of Texas has resulted in diminished wildlife habitat, resulting from fragmented landscapes. Several previous studies addressed the public’s attitudes concerning the most acceptable white-tailed ...

  1. Is social-emotional development a predictor of school success in Head Start children? A field study 

    E-Print Network [OSTI]

    Team, Rachel Marie

    2009-06-02

    Social-emotional development in preschoolers often functions as a gateway into more advanced social and academic behaviors; social-emotional experiences during the preschool years may enhance or diminish a child’s later adjustment and academic...

  2. Hybrid solar thermoelectric systems utilizing thermosyphons for bottoming cycles

    E-Print Network [OSTI]

    Miljkovic, Nenad

    2011-01-01

    Efficient renewable energy sources are in significant demand to replace diminishing and environmentally harmful fossil fuels. The combination of commercial and residential buildings as well as the industrial sector currently ...

  3. Application of a radiophotoluminescent glass dosimeter to nonreference condition dosimetry in the postal dose audit system

    SciTech Connect (OSTI)

    Mizuno, Hideyuki, E-mail: h-mizuno@nirs.go.jp; Fukumura, Akifumi; Fukahori, Mai [National Institute of Radiological Sciences, 4-9-1, Anagawa, Inage-ku, Chiba-shi 263-8555 (Japan); Sakata, Suoh; Yamashita, Wataru; Takase, Nobuhiro [Association for Nuclear Technology in Medicine, 7-16, Nihonbashikodenmacho, Chuou-ku, Tokyo 103-0001 (Japan); Yajima, Kaori [Toho University Omori Medical Center, 6-11-1 Omori-Nishi, Ota-ku, Tokyo 143-8541 (Japan); Katayose, Tetsurou [Chiba Cancer Center, 666-2 Nitona-Cho, Chuoh-ku, Chiba-shi, Chiba 260-8717 (Japan); Abe-Sakama, Kyoko; Kanai, Tatsuaki [Gunma University, Heavy Ion Medical Research Center, 4-2, Aramaki-machi, Maebashi City, Gunma 371-8510 (Japan); Kusano, Yohsuke [Kanagawa Cancer Center, 1-1-2 Nakao, Asahi-ku, Yokohama-shi, Kanagawa 241-8515 (Japan); Shimbo, Munefumi [Saitama Medical Center, 1981, Kamoda, Kawagoe-shi, Saitama 350-8550 (Japan)

    2014-11-01

    Purpose: The purpose of this study was to obtain a set of correction factors of the radiophotoluminescent glass dosimeter (RGD) output for field size changes and wedge insertions. Methods: Several linear accelerators were used for irradiation of the RGDs. The field sizes were changed from 5 × 5 cm to 25 × 25 cm for 4, 6, 10, and 15 MV x-ray beams. The wedge angles were 15°, 30°, 45°, and 60°. In addition to physical wedge irradiation, nonphysical (dynamic/virtual) wedge irradiations were performed. Results: The obtained data were fitted with a single line for each energy, and correction factors were determined. Compared with ionization chamber outputs, the RGD outputs gradually increased with increasing field size, because of the higher RGD response to scattered low-energy photons. The output increase was about 1% per 10 cm increase in field size, with a slight difference dependent on the beam energy. For both physical and nonphysical wedged beam irradiation, there were no systematic trends in the RGD outputs, such as monotonic increase or decrease depending on the wedge angle change if the authors consider the uncertainty, which is approximately 0.6% for each set of measured points. Therefore, no correction factor was needed for all inserted wedges. Based on this work, postal dose audits using RGDs for the nonreference condition were initiated in 2010. The postal dose audit results between 2010 and 2012 were analyzed. The mean difference between the measured and stated doses was within 0.5% for all fields with field sizes between 5 × 5 cm and 25 × 25 cm and with wedge angles from 15° to 60°. The standard deviations (SDs) of the difference distribution were within the estimated uncertainty (1SD) except for the 25 × 25 cm field size data, which were not reliable because of poor statistics (n = 16). Conclusions: A set of RGD output correction factors was determined for field size changes and wedge insertions. The results obtained from recent postal dose audits were analyzed, and the mean differences between the measured and stated doses were within 0.5% for every field size and wedge angle. The SDs of the distribution were within the estimated uncertainty, except for one condition that was not reliable because of poor statistics.

  4. Erice: its past and present roles

    SciTech Connect (OSTI)

    Canavan, Gregory H [Los Alamos National Laboratory

    2009-01-01

    In the depths of the cold war there were few places where it was possible, let alone acceptable, to discuss global problems and their solution. Erice provided such a venue. Prof. Zichichi built it by inviting friends of international statue to visit Erice to discuss fundamental problems in science, technology, and society. Gradually the discussions were broadened to the more sensitive issues of global war and its consequences, which ranged from strategic forces and their stability to missile defenses and their impacts. Erice was one of the few places that these problems and their possible solutions could be discussed in a dispassionate and productive manner. Much of the reason these discussions remained objective and productive was Prof. Zichichi's 'gentle' prodding of participants towards a useful solution that all could accept. All was not deadly serious. I often accompanied Dr. Teller to the meetings, which he enjoyed enormously because they recalled the free-wheeling discussions he participated in when quantum physics was in its infancy. It was also pleasant to see him interact with Prof. Lee, who still gave Dr. Teller the deference due his old professor, and Dr. Garwin, who had worked with Dr. Teller in Los Alamos. By the end of the cold war Erice was recognized as a valuable site for such discussions. Perhaps for that reason, when the transfer of power in the Soviet Union evolved into an attempted coup, President Yeltsin sent a large contingent of scientists in his own plane to participate in the Erice seminar. It soon appeared that this contingent was not chosen randomly, but might contain many of the scientists who knew their missile launch codes. Despite their senior status, they quickly proved themselves to be competent scientists and enthusiastic participants. A by product to that interaction developed the following year when the Russian economy faltered and its science needed external support lest nuclear scientists leave Russia. U.S. scientific contingents formed by State and Commerce for extended fact finding tours to Russia were hosted by many the same people who had come to Erice during the attempted coup. We found that they were the heads of critical design bureaus, but they freely discussed proposed military and civil projects. The teams negotiated projects for cooperation in science and technology that could have been of great benefit to both countries had they been accepted by U.S. administrations. By that time there were a number of venues for discussion and a large number of groups visiting Russia, so one might think the possibility for contributions by Erice might be diminished. But most of the groups that visited Russia left little behind, particularly in the critical area of energy. That left Erice an important role for the interchange of information on the development of an energy infrastructure that respected the environment. In those discussions western scientists collaborated with Russian scientists like Academicians Velikhov and Fortov, who had often been on opposite the side of earlier debates, in developing the architecture of Russia's energy infrastructure. Discussions have turned cold again. One can say that the chill is due to geopolitical factors or military actions, but much appears to be due to lack of communication. Discussions of strategic missiles revive the arguments of the 1960s, and discussions of missile defense ignore the insights developed in Erice in the 1980s and 1990s. Discussion has sunk to levels not seen since the depths of the cold war. In the areas of science, energy, and military much could be gained by resuming those earlier dialogues. While there are now other venues for holding such discussions, none has the scope and record Erice achieved under Prof. Zichichi in its prime. It may be time for Erice to resume the unique service it performed in previous decades. It could be important for it to do so.

  5. An analysis of the accuracy of relative permeability 

    E-Print Network [OSTI]

    Tao, Teh-Ming

    1982-01-01

    Properties Used in Sample Study. . . 2. Summary of Cases Run 34 3. Summary of Sample Properties. 36 4. Comparison of the Relative Error 51 5. Error in Water Infection Rate. 57 6. Influence of Different Magnitude of Measurement Error. 75 LIST QF FIGURES.... Pressure Variation. 27 8. Simulated Measurement Errors. 31 Estimation Deviation Distribution of k for Cases 1, 5, 6, 7. 41 10 Estimation Deviation Distribution of k for Cases 1, 5, 6, 7. 42 Standard Deviation Distribution of Oil Relative Permeability...

  6. The role of transfer-appropriate processing in the effectiveness of decision-support graphics 

    E-Print Network [OSTI]

    Stiso, Michael E.

    2004-11-15

    of Training .......................................................................58 Table 9 Means and Standard Deviations for NumExits, PlnCon, and NavCon by Type of Testing...........................................................................62... and Score6 ................................91 Table 17 Means and Standard Deviations for PlnCon5 and PlnCon6 ..........................91 Table 18 Means and Standard Deviations for NumExits5 and NumExits6..................92 Table 19 Means...

  7. EUROGRAPHICS 2014/ M. Paulin and C. Dachsbacher Poster A Nonobscuring Eye Tracking Solution for

    E-Print Network [OSTI]

    Magnor, Marcus

    of immersion. All basic parts of the body can be printed using a 3d printer at low costs. The screen can ei around VR has been gradually pro- voked in gaming industry. Advances in mobile hardware al- lowed

  8. A study of carbon-14 of paleoatmospheric methane for the last glacial termination from ancient glacial ice

    E-Print Network [OSTI]

    Petrenko, Vasilii Victorovich

    2008-01-01

    than that expected from outgassing of dissolved air from thealuminum surface with a low-outgassing epoxy appeared to befrom leaks and gradual outgassing of CO 2 from the CH 4 line

  9. Rationalized structural systems for diverse applications

    E-Print Network [OSTI]

    Panayides, Floris

    1988-01-01

    Industrialized building emerged as a consequence of the need for the economical and rapid provision of healthy and safe living environments. In both Europe and developing countries, concrete panel systems were gradually ...

  10. Ergonomic product and process design

    E-Print Network [OSTI]

    Mortenson Schiveley, Sara Beth, 1975-

    2004-01-01

    Ergonomic injuries are not the result of acute events. An ergonomic injury develops gradually from continued actions combining force, motion repetition, posture, and duration. Because these injuries accrue over time, it ...

  11. Comparison of Several Eco-Friendly Refrigeration Technologies 

    E-Print Network [OSTI]

    Tang, C.; Luo, Q.; Li, X.; Zhu, X.

    2006-01-01

    will be liquefied. Heat discharged by liquefaction passes through condenser 2 and exchanges heat with refrigerant (such as air or water). When stop heating, adsorbent becomes cool, its adsorbing capacity gradually enhances again. At this moment, it adsorb...

  12. The Effect of Hyperosmotic Stress on the Network Morphology and Transport Function of the Endoplasmic Reticulum in Tobacco 

    E-Print Network [OSTI]

    Adeniji, Opeyemi 1989-

    2011-05-04

    To study the effect of hyperosmolarity on the dynamic morphology of the endoplasmic reticulum (ER) form change, Nicotiana benthamiana seedlings with ER-labeled GFP-HDEL were put in a culture chamber and gradually infused with high D...

  13. The Technical and Economical Analysis of a Centralized Air-Conditioning System with Cold Storage Refrigeration in High-Rise Residential Buildings 

    E-Print Network [OSTI]

    Xiang, C.; Xie, G.

    2006-01-01

    In recent years, the application of a centralized air-conditioning system (CACS) with cold storage refrigeration in high-rise residential buildings has gradually increased. Due to the large difference between civil residential buildings...

  14. Moving towards climate-smart flood management in Bangkok and Tokyo

    E-Print Network [OSTI]

    Takemoto, Shoko, M.C.P. Massachusetts Institute of Technology

    2011-01-01

    Managing the impacts of climate change is no longer a concern of the future, but a significant reality of the present. Preparing for, and mitigating extreme weather events and adapting to the gradual shift in climatic ...

  15. Rolling contact fatigue in martensitic 100Cr6: Subsurface hardening and crack formation

    E-Print Network [OSTI]

    Kang, Jee-Hyun; Vegter, R. H.; Rivera-Díaz-del-Castillo, Pedro E. J.

    2014-04-13

    Rolling contact fatigue tests on 100Cr6 steel were carried out with a ball-on-rod tester. Microstructural damage was manifested by gradual hardness changes under the subsurface, and microcracks formed adjacent to inclusions; both being evidence...

  16. Institutional Arrangements for Effective Groundwater Management to Halt Land Subsidence 

    E-Print Network [OSTI]

    Brah, W. L.; Jones, L. L.

    1978-01-01

    low cost freshwater supplies has contributed to the building of a strong and dynamic economic base. However use of these common water supplies in excess of natural replenishment has resulted in a gradual but accelerated and irreversible subsidence...

  17. Succession of microbial consortia in the developing infant gut microbiome

    E-Print Network [OSTI]

    Angenent, Lars T.

    gradually over time and that changes in community composition conformed to a smooth temporal gradient involved in plant polysaccharide metabolism were present before the introduction of solid food, priming

  18. The Hampering Active Wellbore Kit (HAWK) for rapidly controlling a free flowing oil well

    E-Print Network [OSTI]

    Rojas, Folkers Eduardo

    2014-01-01

    To mitigate the impact of a Blowout Preventer (BOP) failure, this work proposes a method and machine that can create a gradual flow reduction to zero in an offshore well by introducing a mechanical plug inside the BOP. The ...

  19. Characterization of a Fe/Y[subscript 2]O[subscript 3] metal/oxide interface using neutron and x-ray scattering

    E-Print Network [OSTI]

    Watkins, E. B.

    The structure of metal/oxide interfaces is important to the radiation resistance of oxide dispersion-strengthened steels. We find evidence of gradual variations in stoichiometry and magnetization across a Fe/Y[subscript ...

  20. Blame for all 

    E-Print Network [OSTI]

    Ahmed, Amal; Findler, Robert Bruce; Matthews, Jacob; Wadler, Philip

    2009-01-01

    We present a language that integrates statically and dynamically typed components, similar to the gradual types of Siek and Taha (2006), and extend it to incorporate parametric polymorphism. Our system permits a dynamically ...

  1. Climate Change Impacts on Fish and Wildlife

    Broader source: Energy.gov [DOE]

    The Earth’s climate is changing. In some places such as the Arctic, the change is rapid and profound, while in other areas change has been less dramatic and more gradual. But virtually everywhere,...

  2. Study of the evolution of legislation on offences relating to religion in British India and their implications in contemporary Pakistan 

    E-Print Network [OSTI]

    Nazir, Farhana Anthony

    2014-07-04

    The offence of blasphemy and its implications is one of the critical issues in Pakistan today. This research examines the historical setting and gradual amendment of blasphemy laws and their impact on religious communities ...

  3. Studies on the ion-droplet mixed regime in colloid thrusters

    E-Print Network [OSTI]

    Lozano-Tovar, Paulo César, 1970-

    2003-01-01

    Colloid thrusters working with mixtures of ions and droplets are gradually becoming an alternative technology for space micro-propulsion needs in missions requiring high position controllability, compactness and low power ...

  4. Introduction Hangzhou, China, is a world-famous tourist city. With

    E-Print Network [OSTI]

    Jiao, Jiu Jimmy

    and dams were built, the encroach- ment of seawater was kept within limit. The drainage river and ditch and the fresh lake water was discharged into the rivers, which resulted in gradual desalination

  5. Application of direct-fitting, mass-integral, and multi-rate methods to analysis of flowing fluid electric conductivity logs from Horonobe, Japan

    E-Print Network [OSTI]

    Doughty, C.; Tsang, C.-F.; Hatanaka, K.; Yabuuchi, S.; Kurikami, H.

    2008-01-01

    decline in the well, and effects of drilling mud. To analyzeof residual mud used in drilling the well a gradual boreholeobtained during the drilling of Well HDB-11 with the FEC i

  6. Relations between the ultrasonic elastic moduli of compact bone and tissue microstructure 

    E-Print Network [OSTI]

    Ahern, John Charles

    1994-01-01

    for Haversian compact bone as homogeneous solid. This study observed that mild changes in the microstructure can predict variations in the mechanical properties. All the tested material properties exhibit gradual increases for small positive changes in ash...

  7. Development of a novel orthopedic microfastener 

    E-Print Network [OSTI]

    Agnihotri, Mukul Mukund

    2007-04-25

    Over the last decade, biodegradable screws and plates have received wide acceptance over metallic fasteners for orthopedic fracture fixation. A biodegradable fastener would gradually "disappear" during healing of a fractured bone or tissues...

  8. Primary and Secondary Three Dimensional Microbatteries

    E-Print Network [OSTI]

    Cirigliano, Nicolas

    2013-01-01

    new electrode architecture and micropackaging design," Advanced Energy Materials,new high capacity materials or by engineering new battery designs that decouple power and energy.new materials and chemistries is an essential and gradual part of improving the energy

  9. The New York Times headquarters daylighting mockup: Monitored performance of the daylighting control system

    E-Print Network [OSTI]

    Lee, Eleanor S.; Selkowitz, Stephen E.

    2006-01-01

    sun down. The average work plane illuminance at 100% powersun down. However, the average work plane illuminance at 100% powersun in the afternoon. The fluorescent lights dimmed down gradually to minimum power (

  10. Writing the life of the self: constructions of identity in autobiographical discourse by six eighteenth-century American Indians 

    E-Print Network [OSTI]

    Pruett, David Alan

    2004-09-30

    The invasion of the Western Hemisphere by empire-building Europeans brought European forms of rhetoric to the Americas. American Indians who were exposed to European-style education gradually adopted some of the cultural ways of the invaders...

  11. Coordination of Voltage and Frequency Feedback in Load-Frequency Control Capability of Wind Turbine

    E-Print Network [OSTI]

    Silva, Filipe Faria Da

    Coordination of Voltage and Frequency Feedback in Load-Frequency Control Capability of Wind Turbine-Frequency Control (LFC) is gradually shifted to Variable Speed Wind Turbines (VSWTs). In order to equip VSWT

  12. Integrating Zooarchaeology and Modeling: Trans-Holocene Fishing in Monterey Bay, California

    E-Print Network [OSTI]

    Boone, Cristie

    2012-01-01

    6050 BC, it was a high-energy tidal inlet at its mouth,described the high energy tidal environment as graduallyElkhorn Slough was a high-energy tidal inlet for thousands

  13. Graphene-based Material Systems for Nanoelectronics and Energy Storage Devices

    E-Print Network [OSTI]

    Guo, Shirui

    2012-01-01

    exfoliated graphene oxide layers along with CVD grown CNTsto create a barrier oxide layer on copper foil. Fe catalystcopper-copper oxide foil, the oxide layer would be gradually

  14. Pressure Transient Analysis and Production Analysis for New Albany Shale Gas Wells 

    E-Print Network [OSTI]

    Song, Bo

    2010-10-12

    Shale gas has become increasingly important to United States energy supply. During recent decades, the mechanisms of shale gas storage and transport were gradually recognized. Gas desorption was also realized and quantitatively ...

  15. Immunopaleontology reveals how affinity enhancement is achieved during affinity maturation of antibodies to influenza virus

    E-Print Network [OSTI]

    Eisen, Herman N.

    The Abs made by B lymphocytes on first encountering an antigen bind it with low intrinsic affinity, and, over time, the average affinity of the Abs made against that antigen gradually increases. These changes, known as ...

  16. Janet and Grant Brians: Brians Ranch

    E-Print Network [OSTI]

    Farmer, Ellen

    2010-01-01

    Brians: Well, putting on compost and gypsum have been two ofback in the soil, and compost and things. But we didn’tthen putting gypsum and compost in, gradually it’s getting

  17. Our Ocean Backyard Santa Cruz Sentinel columns by Gary Griggs, Director, Institute of Marine Sciences, UC Santa Cruz.

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    gallon, if we took all of the salt out of the world oceans it would be enough to cover the entire planet of water that helped cool the Earth's surface and gradually collected to help form the oceans

  18. Contrib Mineral Petrol (2015) 169:35 DOI 10.1007/s00410-015-1129-4

    E-Print Network [OSTI]

    Tommasi, Andrea

    2015-01-01

    1 3 Contrib Mineral Petrol (2015) 169:35 DOI 10.1007/s00410-015-1129-4 ORIGINAL PAPER On topotaxy in the natural samples include: (1) smooth bending of the former foliation, (2) gradual crystallographic

  19. Schema and memory consolidation 

    E-Print Network [OSTI]

    Tse, Dorothy

    2011-06-27

    The traditional view of systems memory consolidation is that it is a gradual process that takes place over days or weeks. Within this approach, the hippocampus (HPC) is thought to be involved in the rapid encoding of ...

  20. Earth & Space Science News Eos.org // 27 RESEARCH SPOTLIGHT

    E-Print Network [OSTI]

    Houze Jr., Robert A.

    . In a new study, Barnes and Houze catalog different types of "hydrometeors"--parti- cles of water and ice inflows travel laterally and gradually descend. This study shows how the formation of the liquid and ice

  1. Early word learning through communicative inference

    E-Print Network [OSTI]

    Frank, Michael C., Ph. D. Massachusetts Institute of Technology

    2010-01-01

    How do children learn their first words? Do they do it by gradually accumulating information about the co-occurrence of words and their referents over time, or are words learned via quick social inferences linking what ...

  2. Professor Paul O'Shea from Nottingham's Cell Biophysics Group is one of a new generation of scientists with skills in both life sciences

    E-Print Network [OSTI]

    O'Shea, Paul

    a runaway railway carriage running along a two-dimensional railway track and gradually rolling to a halt. With their expertise in optical engineering, the team is instigating different ways of coating microscope coverslips

  3. An experimental and numerical study of wind turbine seismic behavior

    E-Print Network [OSTI]

    Prowell, I.

    2011-01-01

    studied were vertical axis wind turbines, which are nottesting of vertical axis wind turbines (VAWT). For example,vertical axis turbines (VAWTs). Gradually, as the industry matured, most design concepts standardized on horizontal axis wind turbines (

  4. Online Marketplace for Residential Measures 

    E-Print Network [OSTI]

    Ashe,J.; MBA; BEP

    2014-01-01

    boundaries that have been delineated by topography. Plant species richness and diversity gradually decreased with increasing lateral distances from the stream bank. Herbaceous richness and diversity declined with increasing Ashe juniper cover in the riparian...

  5. Condition assessment methodologies for maintenance and repair decisions 

    E-Print Network [OSTI]

    Bouvier, Charles

    1997-01-01

    Structures like embankment dams gradually deteriorate with time. For safety reasons, among others, those structures have to be maintained. However, the institutions responsible for those structures, like the Corps of Engineers, or Hydro-Quebec, have...

  6. A Study to Verify the Material Surface Concept of Water Table by Examining Analytical and Numerical Models. 

    E-Print Network [OSTI]

    Dadi, Sireesh Kumar

    2011-10-21

    : the Neuman model, which assumes instantaneous drainage from the unsaturated zone; the Moench model, which considered gradual drainage from the unsaturated zone using a series of exponential terms in the water table boundary condition; and the Mathias...

  7. An ultra low power implantable neural recording system for brain-machine interfaces

    E-Print Network [OSTI]

    Wattanapanitch, Woradorn

    2011-01-01

    In the past few decades, direct recordings from different areas of the brain have enabled scientists to gradually understand and unlock the secrets of neural coding. This scientific advancement has shown great promise for ...

  8. The origins and abundances of the chemical elements before 1957: from Prout's hypothesis to Pasadena

    E-Print Network [OSTI]

    Trimble, V

    2010-01-01

    2 × 10 7 K). Stars living on hydrogen fusion in their coresat least) fusion reactions. And the life of a star is afusion beyond helium was Sterne (1933), who had in mind a gradually contracting star,

  9. Flexible Hardware Abstraction for Wireless Sensor Networks

    E-Print Network [OSTI]

    California at Berkeley, University of

    Flexible Hardware Abstraction for Wireless Sensor Networks Vlado Handziski, Joseph Polastre, Jan; Computer Science Department Berkeley, CA 94720 US Abstract-- We present a flexible Hardware Abstraction gradually adapts the capabilities of the underlying hardware plat- forms to the selected platform

  10. Dissecting design : exploring the role of rules in the design process

    E-Print Network [OSTI]

    Pantazi, Magdalini Eleni

    2008-01-01

    Since the first application of computer programs to problem solving in the 1960s, computers and computational processes have been gradually introduced in the field of architecture to the point where today they are an ...

  11. Use of fiber reinforced polymer composite in bridge structures

    E-Print Network [OSTI]

    Tuakta, Chakrapan, 1980-

    2005-01-01

    Fiber reinforced polymer composite (FRP) is a new construction material, gradually gaining acceptance from civil engineers. Bridge engineering is among the fields in civil engineering benefiting from the introduction of ...

  12. Modeling metropolis : clean energy guidelines for neighborhood design in rapidly urbanizing China

    E-Print Network [OSTI]

    Wheeler, Alexis M. (Alexis Marie)

    2013-01-01

    In China's current landscape the paradigm for urban development is the rapid creation of whole neighborhoods instead of the conventional piecemeal approach of creating individual buildings that gradually aggregate over ...

  13. DESIGN OF DUPLEX LOW CARBON STEELS FOR IMPROVED STRENGTH: WEIGHT APPLICATIONS

    E-Print Network [OSTI]

    Koo, J.

    2010-01-01

    of all the Cr steels is about Upon annealing of the initialCr bearing steels to attain similar initial of the annealingsteel) and martensite lath boundaries, coupled with the gradual evo- lution of austenite particles with annealing

  14. A cycling network for the cities of Boston and Cambridge

    E-Print Network [OSTI]

    Tian, Ruifeng

    2009-01-01

    In recent years, many cities have been looking for alternative urban transportation tools due to the high cost of energy and the global climate change. As one of the clean transportation types, cycling has become gradually ...

  15. Effect of Vascular Heterogeneity, Aging, and Exercise Training on eNOS – Associated Protein:Protein Interactions 

    E-Print Network [OSTI]

    Luttrell, Meredith Joy

    2014-04-14

    Endothelial dysfunction is a major risk factor for the development of cardiovascular diseases, and aging is associated with a gradual decline in endothelial function. Furthermore, endothelial dysfunction in arteries and ...

  16. Fact #647: November 1, 2010 Sales Shifting from Light Trucks to Cars

    Broader source: Energy.gov [DOE]

    From 2005 to 2009 light vehicle sales have gradually shifted toward cars over light trucks. The graph below shows this trend broken down by the major manufacturers. This trend is more evident among...

  17. Impact of 3D printing on global supply chains by 2020

    E-Print Network [OSTI]

    Bhasin, Varun

    2014-01-01

    This thesis aims to quantitatively estimate the potential impact of 3D Printing on global supply chains. Industrial adoption of 3D Printing has been increasing gradually from prototyping to manufacturing of low volume ...

  18. MEMORANDUM FOR JAMES R. COOPER DEPUTY MANAGER FROM: SUBJECT:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MonthlyQuarterly Progress Reviews. Finally, the process of reviewing and dispositioning COs, Performance Baseline (PB) deviations, and PB changes must be fully integrated with the...

  19. Curriculum Vitae Education Employment Research Interests Grants

    E-Print Network [OSTI]

    2015-09-02

    9.2 (2012), pp. 531–569. 7. Jonathon Peterson. “Large deviations and slowdown asymptotics for one-dimensional excited random walks”. In: Electron. J. Probab.

  20. The New York Times headquarters daylighting mockup: Monitored performance of the daylighting control system

    E-Print Network [OSTI]

    Lee, Eleanor S.; Selkowitz, Stephen E.

    2006-01-01

    W, respectively. Lighting power density at full power levelssavings and average lighting power density savings for astandard deviation Lighting power density at full power:

  1. OPTI-502 Syllabus Optical Design and Instrumentation I --3 Credit Hours (29 Lectures)

    E-Print Network [OSTI]

    Arizona, University of

    . 19. Image erection and relay systems; microscopes. 20. Telecentric systems; imaging properties; minimum deviation; index measurement; glass properties; Abbe number; other optical materials. 27. Prism

  2. --No Title--

    Energy Savers [EERE]

    Division Office of Policy Office of Procurement and Assistance Management SUBJECT: Class Deviation from the Department of Energy Acquisition Regulation (DEAR) 952.204-2,...

  3. Flash2011-18 OPAM | Department of Energy

    Energy Savers [EERE]

    Awardee Performance and Integrity Information System (FAPIIS) - FAR Clause 52.209-8 Class Deviation 2011-18 Attachment Public Access to Federal Awardee Performance and...

  4. DATE: TO: FROM:

    Office of Environmental Management (EM)

    and Assistance Policy, MA-61 Office of Procurement and Assistance Management SUBJECT: Class Deviation by General Services Administration (GSA) to Federal Acquisition Regulation...

  5. --No Title--

    Office of Environmental Management (EM)

    Policy Division Office of Policy Office of Acquisition and Project Management SUBJECT: Class Deviation from the Federal Acquisition Regulation (FAR) 13.5, Test Program for Certain...

  6. Policy Flash 2015-04 | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Policy Division Office of Policy Office of Acquisition and Project Management SUBJECT: Class Deviation for Use of Clause 52.222-99, Establishing a Minimum Wage for Contractors...

  7. TO: Procurement Directors FROM: Director, Contract and Financial...

    Energy Savers [EERE]

    Policy Division Office of Policy Office of Acquisition and Project Management SUBJECT: Class Deviation for Use of Clause 52.222-99, Establishing a Minimum Wage for Contractors...

  8. GreenLectureWeinstein

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    that the use of standard deviations is not a mechanical application of a statistical formula, but demands knowledge, craft, and judgment. Questions have also been raised...

  9. F.E. S.D. Gender

    Energy Savers [EERE]

    OF PERSONS AFFECTED UGESP Q-21 EXCEPTION WFR Impact Analysis SELECTION RATE % OF POOL SELECTED POOL FLAG STANDARD DEVIATION FISHER'S EXACT 80% RULE EXPECTED OF PERSONS...

  10. Plume Rise and Dispersion of Emissions from Low Level Buoyant Sources in Urban Areas

    E-Print Network [OSTI]

    Pournazeri, Sam

    2012-01-01

    in the vertical and crosswind directions, respectively,the standard deviation of crosswind and vertical velocityplume spread in the u 2 crosswind direction at distance x

  11. Part V: Section H - Special Contract Requirements

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    shall not affect the application of otherwise applicable laws and regulations of the United States, including regulations of the Department of Energy. (c) Deviation Processes...

  12. Traffic-related air pollution exposures and changes in heart rate variability in Mexico City: A panel study

    E-Print Network [OSTI]

    2013-01-01

    Participating Investigators of ICD-HRV Italian Study Group.heart rate variability (HRV) in a population of researchersthe association between HRV parameters (standard deviation

  13. PDF file

    E-Print Network [OSTI]

    2000-05-03

    Jul 24, 1997 ... gation of nonlinear dispersive waves in a water channel. ... the variable h (x, t) is the dimensionless deviation of the water surface (scaled.

  14. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    of the impact of their choices on the Earth by studying the ecological footprint concept. They also learn how to calculate the mean, median, mode, and standard deviation...

  15. Policy Flash 2011-98.pdf

    Energy Savers [EERE]

    managementprocurement-and-acquisitionpolicy-flashes. Questions regarding this Class Deviation may be directed to Kevin M. Smith at (202) 287-1614 or Kevin.M.Smith@hq...

  16. Changes in the Economic Value of Variable Generation at High Penetration Levels: A Pilot Case Study of California

    E-Print Network [OSTI]

    Mills, Andrew

    2013-01-01

    RT deviations impose (i.e. wind forecast errors on averagerelative magnitude of wind forecast errors decreases betweenwith managing DA wind forecast errors steadily increases.

  17. Dark Energy in the Dark Ages

    E-Print Network [OSTI]

    Linder, Eric V.

    2009-01-01

    fraction of dark energy density today and at the CMB lastenergy density at high redshifts causes strong deviations in the total linear growth achieved by today,

  18. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    also learn how to calculate the mean, median, mode, and standard deviation of a set of data. http:energy.goveereeducationdownloadshow-big-your-footprint Download Energy...

  19. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    also learn how to calculate the mean, median, mode, and standard deviation of a set of data. http:energy.goveereeducationdownloadshow-big-your-footprint Download Watt Does...

  20. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    also learn how to calculate the mean, median, mode, and standard deviation of a set of data. http:energy.goveereeducationdownloadshow-big-your-footprint Download Summer...

  1. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    also learn how to calculate the mean, median, mode, and standard deviation of a set of data. http:energy.goveereeducationdownloadshow-big-your-footprint Download Life With...

  2. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    also learn how to calculate the mean, median, mode, and standard deviation of a set of data. http:energy.goveereeducationdownloadshow-big-your-footprint Current search...

  3. In the OSTI Collections: Keeping Power Grids Stable | OSTI, US...

    Office of Scientific and Technical Information (OSTI)

    methods help gauge their influence on the grid's stability to power fluctuations. (b) The green plane represents deviations from the forecast of power output from two...

  4. Credible Research Designs for Minimum Wage Studies

    E-Print Network [OSTI]

    Allegretto, Sylvia; Dube, Arindrajit; Reich, Michael; Zipperer, Ben

    2013-01-01

    the Routine Task Intensity (RTI) index of occupations fella standard deviation in the RTI index across states (resultssignificant. As a result, the RTI gap was more than fully

  5. The Dancing History Collection: Cultural Dances, Part 1. Chapter 4: Nigeria, Olokun

    E-Print Network [OSTI]

    Beck, Jill

    2001-01-01

    of Dance. Owerri, Nigeria: AP Publications, cl993. Okwori,of the Idoma. Zaria, Nigeria: Instances Communicationsp. 355, ex. 53 lb. Nigeria 139 Deviation from the path. See

  6. Improvements in Energy Decomposition Analysis for Single Determinant Methods

    E-Print Network [OSTI]

    Horn, Paul Richard

    2015-01-01

    of Hydrogen Bonds: a Density-based Energy Decompositionhydrogen bond distances. (b) Frozen energy component deviations from that of the frozen orbital density

  7. Aspects of earthquake triggering and seismicity clustering /

    E-Print Network [OSTI]

    Chen, Xiaowei

    2013-01-01

    important for earthquake prediction and hazard mitigation.of great impor- tance for earthquake prediction and hazardearthquake triggering tends to deviate from ETAS modeling predictions.

  8. MEASURING THE READING ABILITY OF INCOMING FRESHMEN: A PATH ANALYSIS INVESTIGATION INTO READING COMPREHENSION

    E-Print Network [OSTI]

    Schuster, Jonathan

    2012-05-31

    on the entire word (Ferguson, 1986; Studdert-Kennedy, 1986; Suomi, 1993; Walley, 1993) and gradually begin to segment words into syllables and 14 phonemes (Ehri, 1999; Goswami & Bryant, 1990; Juel, Griffith, & Gough, 1986). This typically occurs when oral... on the entire word (Ferguson, 1986; Studdert-Kennedy, 1986; Suomi, 1993; Walley, 1993) and gradually begin to segment words into syllables and 14 phonemes (Ehri, 1999; Goswami & Bryant, 1990; Juel, Griffith, & Gough, 1986). This typically occurs when oral...

  9. Community Characteristics and Demographic Development: Three Württemberg Communities, 1558 - 1914

    E-Print Network [OSTI]

    Ogilvie, Sheilagh; Küpker, M; Maegraith, J

    that all the land in the village was taken over from alien overlords. In other institutional respects, however, from 1263 Auingen was gradually subjected to the intensifying territorial administration of the ruling house of Württemberg... that all the land in the village was taken over from alien overlords. In other institutional respects, however, from 1263 Auingen was gradually subjected to the intensifying territorial administration of the ruling house of Württemberg...

  10. Bose Einstein Condensation as Dark Energy and Dark Matter

    E-Print Network [OSTI]

    Masako Nishiyama; Masa-aki Morita; Masahiro Morikawa

    2004-03-24

    We study a cosmological model in which the boson dark matter gradually condensates into dark energy. Negative pressure associated with the condensate yields the accelerated expansion of the Universe and the rapid collapse of the smallest scale fluctuations into many black holes, which become the seeds of the first galaxies. The cycle of gradual sedimentation and rapid collapse of condensate repeats many times and self-regularizes the ratio of dark energy and dark matter to be order one.

  11. In aqua vivo EPID dosimetry

    SciTech Connect (OSTI)

    Wendling, Markus; McDermott, Leah N.; Mans, Anton; Olaciregui-Ruiz, Igor; Pecharroman-Gallego, Raul; Sonke, Jan-Jakob; Stroom, Joep; Herk, Marcel J.; Mijnheer, Ben van [Department of Radiation Oncology, Netherlands Cancer Institute-Antoni van Leeuwenhoek Hospital, Plesmanlaan 121, 1066 CX Amsterdam (Netherlands)

    2012-01-15

    Purpose: At the Netherlands Cancer Institute-Antoni van Leeuwenhoek Hospital in vivo dosimetry using an electronic portal imaging device (EPID) has been implemented for almost all high-energy photon treatments of cancer with curative intent. Lung cancer treatments were initially excluded, because the original back-projection dose-reconstruction algorithm uses water-based scatter-correction kernels and therefore does not account for tissue inhomogeneities accurately. The aim of this study was to test a new method, in aqua vivo EPID dosimetry, for fast dose verification of lung cancer irradiations during actual patient treatment. Methods: The key feature of our method is the dose reconstruction in the patient from EPID images, obtained during the actual treatment, whereby the images have been converted to a situation as if the patient consisted entirely of water; hence, the method is termed in aqua vivo. This is done by multiplying the measured in vivo EPID image with the ratio of two digitally reconstructed transmission images for the unit-density and inhomogeneous tissue situation. For dose verification, a comparison is made with the calculated dose distribution with the inhomogeneity correction switched off. IMRT treatment verification is performed for each beam in 2D using a 2D {gamma} evaluation, while for the verification of volumetric-modulated arc therapy (VMAT) treatments in 3D a 3D {gamma} evaluation is applied using the same parameters (3%, 3 mm). The method was tested using two inhomogeneous phantoms simulating a tumor in lung and measuring its sensitivity for patient positioning errors. Subsequently five IMRT and five VMAT clinical lung cancer treatments were investigated, using both the conventional back-projection algorithm and the in aqua vivo method. The verification results of the in aqua vivo method were statistically analyzed for 751 lung cancer patients treated with IMRT and 50 lung cancer patients treated with VMAT. Results: The improvements by applying the in aqua vivo approach are considerable. The percentage of {gamma} values {<=}1 increased on average from 66.2% to 93.1% and from 43.6% to 97.5% for the IMRT and VMAT cases, respectively. The corresponding mean {gamma} value decreased from 0.99 to 0.43 for the IMRT cases and from 1.71 to 0.40 for the VMAT cases, which is similar to the accepted clinical values for the verification of IMRT treatments of prostate, rectum, and head-and-neck cancers. The deviation between the reconstructed and planned dose at the isocenter diminished on average from 5.3% to 0.5% for the VMAT patients and was almost the same, within 1%, for the IMRT cases. The in aqua vivo verification results for IMRT and VMAT treatments of a large group of patients had a mean {gamma} of approximately 0.5, a percentage of {gamma} values {<=}1 larger than 89%, and a difference of the isocenter dose value less than 1%. Conclusions: With the in aqua vivo approach for the verification of lung cancer treatments (IMRT and VMAT), we can achieve results with the same accuracy as obtained during in vivo EPID dosimetry of sites without large inhomogeneities.

  12. 1. c) For all five types, the distribution is quite symmetric. Hearthlog typically burns the longest, with a mean of about 2:40. Wax Logs and Duraflame have a mean about 10 minutes lower. Hot

    E-Print Network [OSTI]

    Preston, Scott

    the longest, with a mean of about 2:40. Wax Logs and Duraflame have a mean about 10 minutes lower. Hot Logs:15. For all but Wax Logs, the distributions have similar variability ­ each has a standard deviation around 9 minutes. Wax Logs burn more consistently near the mean time ­ the standard deviation is just over 5

  13. Hanford Personnel Dosimeter supporting studies FY-1980. [Lead abstract

    SciTech Connect (OSTI)

    Endres, G.W.R.; Cummings, F.M.; Aldrich, J.M.; Thorson, M.R.; Kathren, R.L.

    1981-02-01

    Separate abstracts were prepared for the 10 sections of this report which describe fundamental characteristics of the Hanford multipurpose personnel dosimeter (HMPD). Abstracts were not prepared for Appendix A and Appendix B which deal with calculated standard deviations for 100 mrem mixed field exposures and detailed calculations of standard deviations, respectively. (KRM)

  14. 978-1-5090-0172-9/15/$31.00 2015 IEEE Minimizing the Effects of Data Centers on Microgrid

    E-Print Network [OSTI]

    Simunic, Tajana

    978-1-5090-0172-9/15/$31.00 ©2015 IEEE Minimizing the Effects of Data Centers on Microgrid dynamics. They pose might severe problems especially for smaller circuits, such as microgrids, that might voltage deviations. The grid1 (microgrid in our case) has to address these voltage deviations, which may

  15. Toward Quasiregular Sensor Networks: Topology Control Algorithms for

    E-Print Network [OSTI]

    Haenggi, Martin

    as sentries and relays that are approximately evenly spaced, thereby emulating a regular grid topology on a Gaussian deviation about an ideal grid point (type A), and the ones that consist of a subset of nodes taken of the Poisson point process and, in particular, that in both cases the deviation from the ideal regular grid

  16. RICE UNIVERSITY Transport in Single Molecule Transistors

    E-Print Network [OSTI]

    Natelson, Douglas

    As the size of a physical system decreases toward the nanoscale, quantum me- chanical effects characteristics that deviate from the simplest model of Kondo physics in single electron devices. We suggest explain the observed deviation. #12;Acknowledgments To begin, I would like to thank my advisor, Professor

  17. Supplemental Information Pay-off structure of the gambling task

    E-Print Network [OSTI]

    Nieuwenhuis, Sander

    by slot machine i on trial t ranged from 1 to 100, drawn from a Gaussian distribution (standard deviation in a decaying Gaussian random walk: µµ +-+=+ )1(,1, titi The decay parameter was 0.9836, the decay center was 50, and the diffusion noise was zero- mean Gaussian (standard deviation d = 2.8). We used one

  18. Higher order QED in high mass e+ e- pairs production at RHIC

    E-Print Network [OSTI]

    Anthony J. Baltz; Joakim Nystrand

    2010-03-19

    Lowest order and higher order QED calculations have been carried out for the RHIC high mass e+ e- pairs observed by PHENIX with single ZDC triggers. The lowest order QED results for the experimental acceptance are about two standard deviations larger than the PHENIX data. Corresponding higher order QED calculations are within one standard deviation of the data.

  19. Trans Inst Br Geogr NS 30 151172 2005 ISSN 0020-2754 Royal Geographical Society (with The Institute of British Geographers) 2005

    E-Print Network [OSTI]

    of the nineteenth century. While grounded in normative and cognitive claims, its transformation from local self, and finance markets are ready to slap them on the wrist if they deviate. Countries deviating from free trade- tion in Geneva, to which nation-states accede the power (after due deliberation and an appeals process

  20. Going With the Flow: Pedestrian Efficiency in Crowded Scenes

    E-Print Network [OSTI]

    Nishino, Ko

    Going With the Flow: Pedestrian Efficiency in Crowded Scenes Louis Kratz and Ko Nishino Department. The collective motion of pedestrians form a crowd flow, but individuals often largely deviate from it as they anticipate and react to each other. Deviations from the crowd decreases the pedestrian's efficiency

  1. Surface control bent sub for directional drilling of petroleum wells

    DOE Patents [OSTI]

    Russell, Larry R. (6025 Edgemoor, Suite C, Houston, TX 77081)

    1986-01-01

    Directional drilling apparatus for incorporation in a drill string, wherein a lower apparatus section is angularly deviated from vertical by cam action and wherein rotational displacement of the angularly deviated apparatus section is overcome by additional cam action, the apparatus being operated by successive increases and decreases of internal drill string pressure.

  2. VOLUME 86, NUMBER 13 P H Y S I C A L R E V I E W L E T T E R S 26 MARCH 2001 Photon Statistics of a Laser with Slow Inversion

    E-Print Network [OSTI]

    Exter, Martin van

    . Dramatic deviations from "standard" photon statistics have been predicted for the case Lb * 1, where L GC, for semiconductor lasers, this deviation from standard photon statistics is a highly relevant issue; it is in fact the theme of our Letter. We report experimental observation of highly nonstan- dard photon statistics

  3. arXiv:astro-ph/0610865v130Oct2006 Power Laws and the Cosmic Ray Energy

    E-Print Network [OSTI]

    arXiv:astro-ph/0610865v130Oct2006 Power Laws and the Cosmic Ray Energy Spectrum J. D. Hague a,1 B and preliminary Auger Cosmic Ray Energy spectra in an attempt to find deviation from a pure power-law. The first spectrum suggests deviation from a power-law. However, potentially large systematics on the relative energy

  4. Addressing an Uncertain Future Using Scenario Analysis

    SciTech Connect (OSTI)

    Siddiqui, Afzal S.; Marnay, Chris

    2006-12-15

    The Office of Energy Efficiency and Renewable Energy (EERE) has had a longstanding goal of introducing uncertainty into the analysis it routinely conducts in compliance with the Government Performance and Results Act (GPRA) and for strategic management purposes. The need to introduce some treatment of uncertainty arises both because it would be good general management practice, and because intuitively many of the technologies under development by EERE have a considerable advantage in an uncertain world. For example, an expected kWh output from a wind generator in a future year, which is not exposed to volatile and unpredictable fuel prices, should be truly worth more than an equivalent kWh from an alternative fossil fuel fired technology. Indeed, analysts have attempted to measure this value by comparing the prices observed in fixed-price natural gas contracts compared to ones in which buyers are exposed to market prices (see Bolinger, Wiser, and Golove and (2004)). In addition to the routine reasons for exploring uncertainty given above, the history of energy markets appears to have exhibited infrequent, but troubling, regime shifts, i.e., historic turning points at which the center of gravity or fundamental nature of the system appears to have abruptly shifted. Figure 1 below shows an estimate of how the history of natural gas fired generating costs has evolved over the last three decades. The costs shown incorporate both the well-head gas price and an estimate of how improving generation technology has gradually tended to lower costs. The purpose of this paper is to explore scenario analysis as a method for introducing uncertainty into EERE's forecasting in a manner consistent with the preceding observation. The two questions are how could it be done, and what is its academic basis, if any. Despite the interest in uncertainty methods, applying them poses some major hurdles because of the heavy reliance of EERE on forecasting tools that are deterministic in nature, such as the Energy Information Administration's (EIA's) National Energy Modeling System (NEMS). NEMS is the source of the influential Annual Energy Outlook whose business-as-usual (BAU) case, the Reference Case, forms the baseline for most of the U.S. energy policy discussion. NEMS is an optimizing model because: 1. it iterates to an equilibrium among modules representing the supply, demand, and energy conversion subsectors; and 2. several subsectoral models are individually solved using linear programs (LP). Consequently, it is deeply rooted in the recent past and any effort to simulate the consequences of a major regime shift as depicted in Figure 1 must come by applying an exogenously specified scenario. And, more generally, simulating futures that lie outside of our recent historic experience, even if they do not include regime switches suggest some form of scenario approach. At the same time, the statistical validity of scenarios that deviate significantly outside the ranges of historic inputs should be questioned.

  5. A voxel-based finite element model for the prediction of bladder deformation

    SciTech Connect (OSTI)

    Chai Xiangfei; Herk, Marcel van; Hulshof, Maarten C. C. M.; Bel, Arjan [Radiation Oncology Department, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam (Netherlands); Radiation Oncology Department, Netherlands Cancer Institute, 1066 CX Amsterdam (Netherlands); Radiation Oncology Department, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam (Netherlands)

    2012-01-15

    Purpose: A finite element (FE) bladder model was previously developed to predict bladder deformation caused by bladder filling change. However, two factors prevent a wide application of FE models: (1) the labor required to construct a FE model with high quality mesh and (2) long computation time needed to construct the FE model and solve the FE equations. In this work, we address these issues by constructing a low-resolution voxel-based FE bladder model directly from the binary segmentation images and compare the accuracy and computational efficiency of the voxel-based model used to simulate bladder deformation with those of a classical FE model with a tetrahedral mesh. Methods: For ten healthy volunteers, a series of MRI scans of the pelvic region was recorded at regular intervals of 10 min over 1 h. For this series of scans, the bladder volume gradually increased while rectal volume remained constant. All pelvic structures were defined from a reference image for each volunteer, including bladder wall, small bowel, prostate (male), uterus (female), rectum, pelvic bone, spine, and the rest of the body. Four separate FE models were constructed from these structures: one with a tetrahedral mesh (used in previous study), one with a uniform hexahedral mesh, one with a nonuniform hexahedral mesh, and one with a low-resolution nonuniform hexahedral mesh. Appropriate material properties were assigned to all structures and uniform pressure was applied to the inner bladder wall to simulate bladder deformation from urine inflow. Performance of the hexahedral meshes was evaluated against the performance of the standard tetrahedral mesh by comparing the accuracy of bladder shape prediction and computational efficiency. Results: FE model with a hexahedral mesh can be quickly and automatically constructed. No substantial differences were observed between the simulation results of the tetrahedral mesh and hexahedral meshes (<1% difference in mean dice similarity coefficient to manual contours and <0.02 cm difference in mean standard deviation of residual errors). The average equation solving time (without manual intervention) for the first two types of hexahedral meshes increased to 2.3 h and 2.6 h compared to the 1.1 h needed for the tetrahedral mesh, however, the low-resolution nonuniform hexahedral mesh dramatically decreased the equation solving time to 3 min without reducing accuracy. Conclusions: Voxel-based mesh generation allows fast, automatic, and robust creation of finite element bladder models directly from binary segmentation images without user intervention. Even the low-resolution voxel-based hexahedral mesh yields comparable accuracy in bladder shape prediction and more than 20 times faster in computational speed compared to the tetrahedral mesh. This approach makes it more feasible and accessible to apply FE method to model bladder deformation in adaptive radiotherapy.

  6. Statistical model based iterative reconstruction (MBIR) in clinical CT systems: Experimental assessment of noise performance

    SciTech Connect (OSTI)

    Li, Ke; Tang, Jie; Chen, Guang-Hong

    2014-04-15

    Purpose: To reduce radiation dose in CT imaging, the statistical model based iterative reconstruction (MBIR) method has been introduced for clinical use. Based on the principle of MBIR and its nonlinear nature, the noise performance of MBIR is expected to be different from that of the well-understood filtered backprojection (FBP) reconstruction method. The purpose of this work is to experimentally assess the unique noise characteristics of MBIR using a state-of-the-art clinical CT system. Methods: Three physical phantoms, including a water cylinder and two pediatric head phantoms, were scanned in axial scanning mode using a 64-slice CT scanner (Discovery CT750 HD, GE Healthcare, Waukesha, WI) at seven different mAs levels (5, 12.5, 25, 50, 100, 200, 300). At each mAs level, each phantom was repeatedly scanned 50 times to generate an image ensemble for noise analysis. Both the FBP method with a standard kernel and the MBIR method (Veo{sup ®}, GE Healthcare, Waukesha, WI) were used for CT image reconstruction. Three-dimensional (3D) noise power spectrum (NPS), two-dimensional (2D) NPS, and zero-dimensional NPS (noise variance) were assessed both globally and locally. Noise magnitude, noise spatial correlation, noise spatial uniformity and their dose dependence were examined for the two reconstruction methods. Results: (1) At each dose level and at each frequency, the magnitude of the NPS of MBIR was smaller than that of FBP. (2) While the shape of the NPS of FBP was dose-independent, the shape of the NPS of MBIR was strongly dose-dependent; lower dose lead to a “redder” NPS with a lower mean frequency value. (3) The noise standard deviation (?) of MBIR and dose were found to be related through a power law of ????(dose){sup ??} with the component ? ? 0.25, which violated the classical ????(dose){sup ?0.5} power law in FBP. (4) With MBIR, noise reduction was most prominent for thin image slices. (5) MBIR lead to better noise spatial uniformity when compared with FBP. (6) A composite image generated from two MBIR images acquired at two different dose levels (D1 and D2) demonstrated lower noise than that of an image acquired at a dose level of D1+D2. Conclusions: The noise characteristics of the MBIR method are significantly different from those of the FBP method. The well known tradeoff relationship between CT image noise and radiation dose has been modified by MBIR to establish a more gradual dependence of noise on dose. Additionally, some other CT noise properties that had been well understood based on the linear system theory have also been altered by MBIR. Clinical CT scan protocols that had been optimized based on the classical CT noise properties need to be carefully re-evaluated for systems equipped with MBIR in order to maximize the method's potential clinical benefits in dose reduction and/or in CT image quality improvement.

  7. Communication Electric polarization in carbon fiber-reinforced cement

    E-Print Network [OSTI]

    Chung, Deborah D.L.

    Communication Electric polarization in carbon fiber-reinforced cement Sihai Wen, D.D.L. Chung-reinforced cement paste during resistivity measurement. The effect was diminished by increasing the conductivity of the cement paste through the use of carbon fibers that were more crystalline, the increase of the fiber

  8. JOURNAL DE PHYSIQUE IV Colloque C9, supplement au Journal de Physique 111,Volume 3, decembre 1993

    E-Print Network [OSTI]

    Boyer, Edmond

    is receiving renewed analysis. The role of convoluted metalloxide interfaces in promoting or diminishing. Adhesion relates to interfacial energy, Ti, through Wad = Ti - -%x (*) Keynote lecture. Article published online by EDP Sciences and available at http://dx.doi.org/10.1051/jp4:1993904 #12;66 JOURNAL DE PHYSIQUE

  9. ORIGINAL ARTICLE Interactive visual supports for children with autism

    E-Print Network [OSTI]

    Hayes, Gillian R.

    ORIGINAL ARTICLE Interactive visual supports for children with autism Gillian R. Hayes · Sen Hirano access at Springerlink.com Abstract Interventions to support children with autism often include the use visual supports are effective in helping to diminish many of the challenges of autism, they are difficult

  10. Noise-Enhanced Balance Control in Patients with Diabetes and Patients with Stroke

    E-Print Network [OSTI]

    Collins, James J.

    Noise-Enhanced Balance Control in Patients with Diabetes and Patients with Stroke Attila A with stroke, resulting in diminished motor performance. Recently, it has been shown that input noise can mechanical noise applied to the soles of the feet via vibrating insoles can be used to improve quiet

  11. Introduction to Special Edition on University Nonproliferation Education and Training

    E-Print Network [OSTI]

    in tensions across the globe. Nuclear weapons would lose their salience as markers of elite status among but has become more dangerous. The drive to acquire nuclear weapons has not diminished, and the threat acquire nuclear weapons, weapons states on the outside fail to join, and nations that want to acquire them

  12. Intheprocessedfoodsindustry,manufacturersdelight in releasing recipes that require their product. The

    E-Print Network [OSTI]

    Zyda, Michael

    quite adequately for most household tasks (word processing and tax preparation), so manufacturers need. The companies making the greatest investment, both through in-house development and funding of external research a point of diminishing returns for this line of inquiry. Now is pre- cisely the time to think about

  13. American Institute of Aeronautics and Astronautics Performance Analysis of a Medium-Power Helicon Thruster

    E-Print Network [OSTI]

    Walker, Mitchell

    .1 x 10-5 Torr-Ar. Ion number density, electron temperature, and electron energy distribution function = electron temperature Vp = plasma floating potential ic = ion cyclotron frequency ec = electron cyclotron power because the solar energy available diminishes as the vehicles moves away from the sun. Therefore

  14. Masters Project Report A Distributed Annotation System

    E-Print Network [OSTI]

    Eddy, Sean

    , a valuable source of information is severely diminished. In this report I outline the design is the elucidation of the primary sequence of DNA contained within a given species. While the availability of the primary sequence itself is valuable, it does not reach its full potential until it has been annotated

  15. May 2005 O-1 The Interaction between Power Planning and Fish

    E-Print Network [OSTI]

    BACKGROUND The Columbia River Basin hydroelectric system is a limited resource that is unable to completely and wildlife survival often diminish the generating capability of the hydroelectric system. Conversely implementing the NOAA Fisheries' 2000 Biological Opinion (BiOp) mainstem hydroelectric operations in 2001

  16. Atmos. Chem. Phys., 11, 85158541, 2011 www.atmos-chem-phys.net/11/8515/2011/

    E-Print Network [OSTI]

    Jackman, Charles H.

    effect. Sensitivity tests illustrate that due to the strong chemical interaction between methane the reduction in the ozone chemical loss rates, and (2) ac- celerating the Brewer-Dobson circulation (BDC) which diminish, CO2, N2O, and CH4 loading will all have significant impacts on global to- tal ozone based

  17. Economic Potential of Biomass Based Fuels for Greenhouse Gas Emission Mitigation

    E-Print Network [OSTI]

    McCarl, Bruce A.

    Words): Use of biofuels diminishes fossil fuel combustion thereby also reducing net greenhouse gasEconomic Potential of Biomass Based Fuels for Greenhouse Gas Emission Mitigation Uwe A. Schneider policies or markets are simulated via hypothetical carbon prices. At each carbon price level

  18. 13-th IEEE International Conference on Peer-to-Peer Computing Have a Snack, Pay with Bitcoins

    E-Print Network [OSTI]

    Tobias Bamert, Christian Decker, Lennart Elsen, Roger Wattenhofer, Samuel Welten ETH Zurich, Switzerland double-spending attacks and show that, employing our concept, the success of such attacks diminishes between transaction speed and confirmation reliability in the Bitcoin network. In addition to our double

  19. Air Emissions and Oil Displacement Benefits

    E-Print Network [OSTI]

    McGaughey, Alan

    and the U.S. costs of oil consumption, including supply disruption risks, increases in world oil prices dueAir Emissions and Oil Displacement Benefits from Plug-in Vehicles The electrification of passenger; and (3) reduce gasoline consumption, helping to diminish dependency on imported oil. Current policy

  20. Neuroscience Letters 583 (2014) 2631 Contents lists available at ScienceDirect

    E-Print Network [OSTI]

    Wade, Juli

    2014-01-01

    tend not to be sexually dimorphic ([6], but see [13]). In seasonally breeding songbirds, volumes Accepted 4 September 2014 Available online 16 September 2014 Keywords: Song system Sexual differentiation of a bird's ability to practice and/or to hear its own typically developing song specifically diminishes

  1. The Whale Pump: Marine Mammals Enhance Primary Productivity in a Coastal Basin

    E-Print Network [OSTI]

    Vermont, University of

    diminished this region's role as a reservoir for carbon [8]. Several lines of evidence indicate that most mammals provide an important ecosystem service by sustaining productivity in regions where they occur Research (ONR) grant N00014-08-1-0630, National Oceanographic Partnership Program (NOPP) grant N00014

  2. High efficiency photovoltaic power conditioning system Hosam Sharabash, DVMM Krishna, Norbert Frhleke and Joachim Bcker

    E-Print Network [OSTI]

    Noé, Reinhold

    .1. Introduction Nowadays, the potential threat of global climate enforced, increasing energy demand and diminishing nonrenewable energy has resulted into the usage of renewable energy as alter- native source of energy. Among renewable energy sources, the solar energy is a clean, efficient and readily available

  3. 2004 Geological Society of America. For permission to copy, contact Copyright Permissions, GSA, or editing@geosociety.org. Geology; August 2004; v. 32; no. 8; p. 709712; doi: 10.1130/G20491.1; 4 figures; 1 table; Data Repository item 2004116. 709

    E-Print Network [OSTI]

    Sinclair, Hugh D.

    boreholes and extent of cross section illustrated in B. Bold curve marks Alpine thrust front. B: Cross in the southwest (Geneva), diminishing to 0.3 km in the northeast (Zu¨rich), while mid- dle to late Miocene paleo­geothermal

  4. ON-ROAD MOTOR VEHICLE EMISSIONS FROM AROUND THE WORLD Donald H. Stedman and Gary A. Bishop

    E-Print Network [OSTI]

    Denver, University of

    consists of a non-dispersive infrared (IR) component for detecting carbon monoxide, carbon dioxide (CO2 successful in the past have reached a level of diminishing returns combined with escalating costs. The remote, the remote sensor only directly measures ratios of CO, HC or NO to CO2. The ratios of CO, HC, or NO to CO2

  5. Int. J. Mol. Sci. 2011, 12, 1908-1920; doi:10.3390/ijms12031908 International Journal of

    E-Print Network [OSTI]

    North Texas, University of

    , with the objective to diminish the use of synthetic petroleum-based raw materials. Natural polymers have diverse, Queretaro, Mexico; E-Mail: analaura@fata.unam.mx 4 Laboratory of Advanced Polymers & Optimized Materials (LAPOM), Department of Materials Science & Engineering and Center for Advanced Research and Technology

  6. Reprocessing & Storage Daniel VanBriesen

    E-Print Network [OSTI]

    Bowen, James D.

    Pros Reduces the level of nuclear waste Extracts more energy per volume of fuel Potentially cheaper #12;Waste Storage Nuclear power is the only energy-producing technology which takes full. The radioactivity of all nuclear wastes diminishes with time. #12;Waste Storage Pros: Safe & Reliable. Helps

  7. 8 1663 May 2015 1663 May 2015

    E-Print Network [OSTI]

    such hardware and installation costs have diminished over time, the standard silicon solar cells they rely upon changed somewhat. Costs for silicon solar cells have dropped to the point where, in particularly sunny regions, solar energy can compete with higher-cost energy sources in the existing power mix

  8. Current Biology 19, 442447, March 10, 2009 2009 Elsevier Ltd All rights reserved DOI 10.1016/j.cub.2009.01.058 The Processivity of Kinesin-2 Motors

    E-Print Network [OSTI]

    Hancock, William O.

    .cub.2009.01.058 Report The Processivity of Kinesin-2 Motors Suggests Diminished Front-Head Gating Gayatri The Pennsylvania State University 205 Hallowell Building University Park, PA 16802 USA Summary Kinesin-2 motors, differ from motors in the canonical kinesin-1 family by having a heterodimeric rather than homodimeric

  9. Synovial fluid homeostasis : bulk flow, lubricant transport, and biophysical restoration

    E-Print Network [OSTI]

    McCarty, William Joseph

    2012-01-01

    biosynthesis with cycloheximide (CX) diminishes both theC) and cellular biosynthesis (±CX) on matrix depletion (sGAG3) 28d (n=5) at 37ºC without CX, for (4) 28d (n=4) at 4ºC

  10. Statistical and dynamical assessment of vegetation feedbacks on climate over the boreal forest

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    in the hydrological cycle include diminished transpiration and moisture recycling, supporting a reduction, the surface albedo was substantially increased. The albedo feedback produced peak cooling in April and weaker cooling in summer. While the cooling due to boreal deforestation was greatest in winter

  11. SUBMITTED TO THE INTERNATIONAL JOURNAL OF FLOW CONTROL, REVISED VERSION 1 Fluid Flow Control: a Vision-Based Approach

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    SUBMITTED TO THE INTERNATIONAL JOURNAL OF FLOW CONTROL, REVISED VERSION 1 Fluid Flow Control, by visualizing a fluid flow, dense flow velocity maps can be computed via optical flow techniques by diminishing the fuel consumption of their aircrafts through drag reduction [1]. In contrast, in other

  12. Coyotes, Jazz, and Creative Teams: Facing and Seeking Variance Russ Derickson

    E-Print Network [OSTI]

    Gordon, Scott

    various domains. Recent reports of over reduction of variance through misuse of Six Sigma quality for their innovation entered into misapplication of Six-Sigma quality practices that severely diminished idea the apparent overuse of Six Sigma variance reduction in various enterprises, we present a systems model

  13. Multifilamentation transmission through fog G. Mjean, J. Kasparian,* J. Yu, E. Salmon, S. Frey, and J.-P. Wolf

    E-Print Network [OSTI]

    Skupin, Stefan

    Multifilamentation transmission through fog G. Méjean, J. Kasparian,* J. Yu, E. Salmon, S. Frey, it is shown that dense fogs dissipate quasi-linearly the energy in the beam envelope and diminish the number of view, numerical computations confirm that a dense fog composed of micrometric droplets acts like

  14. Sub millimeter analysis of Specificity of SE, GE, and ASE BOLD responses in the Human Visual Cortex , A. Shmuel2

    E-Print Network [OSTI]

    , spin echo BOLD, and asymmetric echo BOLD in human visual cortex at 7 Tesla. Background: Vasculature generated with 0.5mm in plane spatial resolutions. Contrast to noise (CNR) is clearly better in the GRE at 7 Tesla. ASE with more weighting towards T2 changes may diminish very large vessel signals

  15. UNIVERSITY OF SASKATCHEWAN FINANCE SYSTEMS DATA USE

    E-Print Network [OSTI]

    Peak, Derek

    for use by the Financial Services Division based on the "Data Management, Data Access and Data Use PolicyUNIVERSITY OF SASKATCHEWAN FINANCE SYSTEMS DATA USE STATEMENT OF UNDERSTANDING Recognizing that data is a valuable resource to the institution, and that the value can be diminished through misuse

  16. Sonochemistry and sonoluminescence in microfluidics , Siew-Wan Ohla

    E-Print Network [OSTI]

    Ohl, Claus-Dieter

    Sonochemistry and sonoluminescence in microfluidics Tandionoa , Siew-Wan Ohla , Dave S. W. Owb within a narrow channel of polydimethylsiloxane-based microfluidic devices. In the microfluidics channels to boundaries (for example, in microfluidics), in- stabilities develop into liquid jets that diminish the energy

  17. An ab Initio Study on the Oxidative Coupling of Methane over a Lithium-Doped MgO Catalyst: Surface Defects and Mechanism

    E-Print Network [OSTI]

    Truong, Thanh N.

    utilization of methane, the primary component of natural gas, is becoming an immediate goal as we face issues of diminishing natural resources. Unfortunately, the remote locations of most natural gas reserves make transportation of this fuel economically unreasonable.1 One means to exploit the remote gas sources is to first

  18. Relic gravitational waves and the generalized second law

    E-Print Network [OSTI]

    German Izquierdo; Diego Pavon

    2005-01-12

    The generalized second law of gravitational thermodynamics is applied to the present era of accelerated expansion of the Universe. In spite of the fact that the entropy of matter and relic gravitational waves inside the event horizon diminish, the mentioned law is fulfilled provided that the expression for the entropy density of the gravitational waves satisfies a certain condition.

  19. FTIR spectroscopy can predict organic matter quality in2 regenerating cutover peatlands3

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    emissions51 Soil Biology and Biochemistry #12;3 show a return to net carbon sequestration (Tuittila et al sequestration potential. Increased losses of dissolved organic carbon (DOC)55 have been observed from many area. Peat46 extraction for fuel and horticultural use has steadily diminished this carbon stock,47

  20. Biomass Chronosequences of United States Forests: Implications for Carbon Storage

    E-Print Network [OSTI]

    Lichstein, Jeremy W.

    Management and Carbon Sequestration Forests account for a large fraction of the carbon stored in global soils for forest management aimed at carbon sequestration is controversial. On the one hand, logging diminishes of succession (Peet 1981, 1992; Shugart 1984). In the context of forest management aimed at carbon sequestration

  1. ing depends not only on initial porosity but also on the relative time scales for soil defor-

    E-Print Network [OSTI]

    Hendry, Andrew

    - mation and pore pressure diffusion (18). If fluid pressure can diffuse into or away from contracting and the effects of po- rosity change diminish. However, the time scale for pore pressure diffusion is h2 /D, where for diffusive pore pressure equilibration in deforming soil masses with h 1 m typically surpasses 10 s

  2. Academic Integrity at the University of California, Riverside DEFINITIONS

    E-Print Network [OSTI]

    1 Academic Integrity at the University of California, Riverside DEFINITIONS At the University of California, Riverside (UCR) honesty and integrity are fundamental values that guide and inform us an educated person, undermines the efforts of the entire academic community, and diminishes the value

  3. Autophagic response of higher plant cells to a prolonged period of sucrose deprivation

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    , sudden temperature drop, water stress or the decrease of the circadian light period diminishes the rates in 3! P nuclear magnetic resonance (NMR) experi- ments. Cells harvested from the culture medium were acid (PCA) extraction (Roby et aL, 1987), sucrose and starch determi- nations (Journet et al., 1986

  4. Journal of The Electrochemical Society, 162 (2) A3145-A3153 (2015) A3145 FOCUS ISSUE OF SELECTED PRESENTATIONS FROM IMLB 2014

    E-Print Network [OSTI]

    Gupta, Amit

    2015-01-01

    -Commercial No Derivatives 4.0 License (CC BY-NC-ND, http://creativecommons.org/licenses/by-nc-nd/4.0/), which permits non from IMLB 2014. Diminishing fossil fuel reserves have made it imperative to develop alternative energy in terms of energy and power density. In this regard, various combinations of electrode

  5. BATTERY STORAGE CONTROL FOR STEADYING RENEWABLE POWER GENERATION

    E-Print Network [OSTI]

    by storing excess power to a battery during excess generation, and then releasing the energy when power generation diminishes. Among other considera- tions, we would like to release and store energy at a bounded States have adopted renewable portfolio standards, which require a certain percentage of electric energy

  6. Microplasma Ball Reactor for Liquid Hydrocarbon Conversion 

    E-Print Network [OSTI]

    Slavens, Stephen M

    2014-04-24

    As the world’s light oil reserves diminish, the use of alternative fuels is becoming more of a necessity. In order to make use of alternative fuels, alternative processes must be developed. The goal of this research is to convert long, complex chain...

  7. Geothermal Power/Oil & Gas Coproduction Opportunity

    SciTech Connect (OSTI)

    DOE

    2012-02-01

    Coproduced geothermal resources can deliver near-term energy savings, diminish greenhouse gas emissions, extend the economic life of oil and gas fields, and profitably utilize oil and gas field infrastructure. This two-pager provides an overview of geothermal coproduced resources.

  8. Climatic variations of the work done by the wind on the ocean's general circulation

    E-Print Network [OSTI]

    Naveira Garabato, Alberto

    Climatic variations of the work done by the wind on the ocean's general circulation J. M for the deep overturning circulation. In a coarse-resolution ocean model, northward-shifted winds increase Circumpolar Current (ACC). Alternatively, energy supply is diminished by southward-shifted winds, primarily

  9. BUILDING A CO2 STORAGE HUB IN

    E-Print Network [OSTI]

    Painter, Kevin

    , once at the forefront of this innovative technology that can give us clean energy from abundant fossil technology we have in the battle to reduce CO2 emissions from power and industrial sources. Without it we and global reliance on low-cost energy from coal and gas shows no sign of diminishing, the time has come

  10. Airborne Volcanic Ash--A Global Threat to Aviation U.S. Department of the Interior

    E-Print Network [OSTI]

    Airborne Volcanic Ash--A Global Threat to Aviation U.S. Department of the Interior U.S. Geological on the aviation industry. Airborne volcanic ash can be a serious hazard to aviation even hundreds of miles from an eruption. Encounters with high-concentration ash clouds can diminish visibility, damage flight control

  11. PREDICTING VOLTAGE DROOPS USING RECURRING PROGRAM

    E-Print Network [OSTI]

    Brooks, David

    ($200 mV for a nominal volt- age of 1.1 V).1 Such conservative operating voltage margins guarantee VOLTAGE DROOPS USING RECURRING PROGRAM AND MICROARCHITECTURAL EVENT ACTIVITY .......................................................................................................................................................................................................................... SHRINKING FEATURE SIZE AND DIMINISHING SUPPLY VOLTAGE ARE MAKING CIRCUITS MORE SENSITIVE TO SUPPLY VOLTAGE

  12. An increasingly large portion of scheduler latency is derived from the monolithic content addressable memory

    E-Print Network [OSTI]

    Ernst, Daniel J.

    operand. By com- bining these two tag-reduction schemes, we are able to construct dynamic schedulers with approximately one quarter of the tag comparators found in conventional designs. Conservative circuit-per- formance microprocessors. Increasing clock speeds and diminishing voltage margins have combined to produce

  13. WORLD OF BUSINESS MEETS THE WORLD

    E-Print Network [OSTI]

    Dennett, Daniel

    their solar lanterns in Burkina Faso, West Africa. #12;ONTEX #12;WHAT A DIFFERENCE THREE YEARS MAKE When we political agenda; innovations for populations aspiring to join the global consuming class; rising demand with diminishing supplies of natural resources; operating risks of markets with missing institutions

  14. Temporal Features and Kernel Methods for Predicting Sepsis in Postoperative Patients

    E-Print Network [OSTI]

    Scott, Clayton

    ]. In the United States, 0.8 to 2 million patients become septic every year, 30% of which are surgical patients, and are based on four physiological variables: body temperature, heart rate, breathing rate, and white blood positive rate), which diminishes their utility in clinical settings. This paper presents new features

  15. Fundamental Challenges in Mobile Computing M. Satyanarayanan

    E-Print Network [OSTI]

    the official policies or need to be sensitive to power consumption argues for self­ endorsements, either­inclined computers scientists. over time, the need to be sensitive to power consumption will not diminish. Concern for power 1.1. Constraints of Mobility consumption must span many levels of hardware Mobile computing

  16. MuMHR: Multi-path, Multi-hop Hierarchical Mohammad Hammoudeh, Alexander Kurz, and Elena Gaura

    E-Print Network [OSTI]

    Kurz, Alexander

    Leicester, LE1 7RH, UK. Email: kurz@mcs.le.ac.uk Abstract-- This paper proposes a self-organizing, cluster the energy consumption in the network. The dynamic cluster- ing brings extra overhead, such as head changes, which may diminish savings in energy consumption. A possible solution which is examined in this paper

  17. XRDS SUMMER 2011 VOL .17 NO.414 Sustainable

    E-Print Network [OSTI]

    Dutta, Prabal

    as well: the effect of scaling on energy storage and harvesting. As sensors scale to smaller and smaller dimensions, energy storage capacity diminishes cubically with the prin- cipal node dimension since storage of length L is devoted to energy storage and that volume is occupied by a non-rechargeable Lithium pri- mary

  18. An Integrated Circuit/Architecture Approach to Reducing Leakage in Deep-Submicron High-Performance I-Caches

    E-Print Network [OSTI]

    Vijaykumar, T. N.

    battery life and diminishes the utility of por- table systems. Historically, the primary source of energy] estimates a factor of 7.5 increase in leakage current and a five-fold increase in total leakage energy- ing speeds by scaling down the supply voltage and proportionately reducing the transistor threshold

  19. Mitigation and Adaptation Strategies for Global Change

    E-Print Network [OSTI]

    concerns about rising energy demand and cost, diminishing oil reserves, and climate change, Central a critical analysis of this experience focusing on non-technical barriers to investment. Survey results America . Caribbean basin initiative . Trade and investment . Energy security Mitig Adapt Strateg Glob

  20. Two-Level Free-Form Deformation for High-Fidelity Aerodynamic Shape Optimization

    E-Print Network [OSTI]

    Zingg, David W.

    awakened global awareness.1 Its disastrous impacts on the environ- ment have long been linked to oil, whose diminishing world reserves have led to a substantial rise in fuel prices. As far as the aviation industry of incorporating an high-fidelity finite-element structural solver in the near future. Historically, shape control

  1. Multifamily Ventilation Retrofit Strategies

    SciTech Connect (OSTI)

    Ueno, K.; Lstiburek, J.; Bergey, D.

    2012-12-01

    In multifamily buildings, central ventilation systems often have poor performance, overventilating some portions of the building (causing excess energy use), while simultaneously underventilating other portions (causing diminished indoor air quality). BSC and Innova Services Corporation performed a series of field tests at a mid-rise test building undergoing a major energy audit and retrofit, which included ventilation system upgrades.

  2. XRDS SUMMER 2011 VOL .17 NO.414 Sustainable

    E-Print Network [OSTI]

    Cafarella, Michael J.

    requires volume. Solar cell power, in contrast, diminishes quadratically with the principal node dimension eco-physiology. Today, many believe that similar sensor technologies will play a key role in creating, and guide building controls with unprecedented fidelity and scale--ultimately allowing us to better allocate

  3. Protecting Your Precious Recuperators in High Temperature Processes 

    E-Print Network [OSTI]

    Reed, R. J.

    1983-01-01

    -water-with a high latent heat, making it very forgiving. The flow of air coolant through a recuperator diminishes as the burner input is turned down to lower firing rates. But, the furnace temperature, and therefore the flue gas temperature, stays at about...

  4. Kendrick et al. 1 THE IMPACT OF BICYCLE LANE CHARACTERISTICS ON BICYCLISTS'1

    E-Print Network [OSTI]

    Kendrick et al. 1 THE IMPACT OF BICYCLE LANE CHARACTERISTICS ON BICYCLISTS'1 EXPOSURE TO TRAFFIC Bicycling as a mode of transportation is increasingly seen as a healthy alternative to2 motorized transportation modes. However, in congested urban areas the health benefits of3 bicycling can be diminished

  5. 47TH ANNUAL CONFERENCE ON INFORMATION SCIENCES AND SYSTEMS, MARCH 2013 1 A Modified Bethe Free Energy Approximation for

    E-Print Network [OSTI]

    Regalia, Phillip A.

    to a modified Bethe free energy function. Applications to distributed coding in sensor networks are also of the side information diminishes. Index Terms--belief propagation, Bethe free energy, codeword quantization connection with a modified Bethe free energy approximation. We likewise illustrate its performance

  6. The rapid economic and industrial growth of China, exemplified by a 10-fold increase in its gross domestic

    E-Print Network [OSTI]

    Zhang, Minghua

    compounds. In addition, soil quality is degraded by erosion, desertification, and nutrient runoff. Air. Desertification and diminishing water resources threaten future food security. In recent years, China's government., 2010). Due to the rising population in China, soil erosion, desertification, nutri- ent runoff

  7. DESIGNING EFFICIENT MEMORY FOR FUTURE COMPUTING SYSTEMS

    E-Print Network [OSTI]

    Balasubramonian, Rajeev

    , limited pin counts, increasing heterogeneity and complexity, and the diminished importance of cost main memory system with the following innovative features: (i) overfetch-aware re-organized chips, (ii) low-cost silicon photonic memory channels, (iii) largely autonomous memory modules with a packet

  8. Introduction to Multicore architecture

    E-Print Network [OSTI]

    costs, GHz clock rates researchers can't build believable prototypes Old CW: Innovate via compiler high soft & hard error rates Old CW: Demonstrate new ideas by building chips New CW: Mask costs, ECAD compilers, innovation (Out-of-order, speculation, VLIW, ...) New CW: "ILP wall" diminishing returns on more

  9. Speech masking and cancelling and voice obscuration

    DOE Patents [OSTI]

    Holzrichter, John F.

    2013-09-10

    A non-acoustic sensor is used to measure a user's speech and then broadcasts an obscuring acoustic signal diminishing the user's vocal acoustic output intensity and/or distorting the voice sounds making them unintelligible to persons nearby. The non-acoustic sensor is positioned proximate or contacting a user's neck or head skin tissue for sensing speech production information.

  10. Photo: Gerard Kuster "Transboundary Environmental Problems: Facts and

    E-Print Network [OSTI]

    ISSUES IN EUROPE THE STORY OF A NET IMPORTER: NETHERLANDS! 3 Hazardous waste Source: worldmapper.org CO2 emissions in 2000 #12;·Distance are `shrinking', borders are diminishing, national economies integrate Internet map of the world Airline map of the world #12;IS OUR CLIMATE CHANGING? 6 The inconvenient truth

  11. U.S. Senate Commerce, Science, and Transportation Committee working group discussion, "Maximizing the Impact of Basic Research."

    E-Print Network [OSTI]

    Resler, Lynn M.

    sector be encouraged to perform in driving the U.S. "innovation ecosystem" and how can they strengthen their partnership to ensure the U.S. position as a global innovation leader? · Basic research is the feedstock for our innovation ecosystem ­ We are not close to a point of diminishing returns in the U.S. Greater

  12. AIAA Paper 2002-5977 Aeroacoustics of Single and Multiple Supersonic Impinging Jets

    E-Print Network [OSTI]

    2 AIAA Paper 2002-5977 Aeroacoustics of Single and Multiple Supersonic Impinging Jets A impinging jets, such as those occurring in the next generation of STOVL aircraft. We conclusively loop - both for single and dual impinging jets - and diminishing the flow unsteadiness and ultimately

  13. Spring Movements of Paddlefish in a Prairie Reservoir System Craig P. Paukert3

    E-Print Network [OSTI]

    Paddlefish (Polyodon spathula) movements and habitat use were monitored in the Keystone Reservoir System. Paddlefish in the Keystone Reservoir system appear to have adapted to the high spring water temperatures combine to make Keystone Reservoir in northcentral Oklahoma. Paddlefish populations have diminished

  14. Study questions: Energy & Environment: Humans & Nature 18 May 2012 Two `Laws' of human nature

    E-Print Network [OSTI]

    Study questions: Energy & Environment: Humans & Nature 18 May 2012 Two `Laws' of human nature 1. Jevons' Law, or the law of diminishing marginal utility One of the class (sorry, can't remember who) posted an interesting note on `Jevons' Law'. This would seem to be a danger signal for the hopeful

  15. A Green Technology for the Production of Biofuels . The past several decades have been demarcated by growing concerns about

    E-Print Network [OSTI]

    Appanna, Vasu

    A Green Technology for the Production of Biofuels Dan Whalen #12;Abstract . The past several of green technologies and alternative fuel sources in an effort to diminish GHG production. One of hemicellulose, a major component of woody materials, in the production of alternative fuels remains elusive

  16. The effect of time-since-treatment and other factors on the perceived scenic beauty of southern pine-oak forest plots 

    E-Print Network [OSTI]

    Gritter, Molly Kay

    1997-01-01

    year 2 was-3.01 while the mean from year 6 was 40.3 1. This finding is consistent with research that has found larger d diminished evidence of human manipulation to trees, increased natural complexity, an promote higher scenic-beauty values. Treatment...

  17. GRADUATE STUDY IN BIOENGINEERING The Bioengineering (BioE) Graduate Program

    E-Print Network [OSTI]

    GRADUATE STUDY IN BIOENGINEERING The Bioengineering (BioE) Graduate Program prepares students. Multidisciplinary Approach Because of the breadth of bioengineer- ing, along with the diminishing barriers between disciplines, the bioengineering graduate program emphasizes an inter- disciplinary approach to our education

  18. Karina Espinoza Biochemistry 118Q

    E-Print Network [OSTI]

    Brutlag, Doug

    underdevelopment and diminished infertility #12;+Diagnosis Definite: all cardinal signs present + 2 others;+Treatment No specific treatment to cure disease -Treatment addresses symptoms: Aggressive treatment the same basis Treatment is very limited (2011) Aging is accompanied by a decrease in WRN gene expression

  19. Cosmological Evidence for Modified Gravity (MOG)

    E-Print Network [OSTI]

    Moffat, J W

    2015-01-01

    Deviations from the standard $\\Lambda$CDM model motivate an interpretation of early universe cosmology using the Scalar-Tensor-Vector-Gravity (STVG) theory. A constraint analysis carried out by Valentino, Melchiorri and Silk, revealed deviations from the growth of structure predicted by General Relativity, and a lensing anomaly in the angular CMB power spectrum data with a $95\\%$ c.l. The modified gravity (MOG) theory resolves the lensing deviation from the standard model and provides an explanation of the CMB and structure growth data.

  20. Design of a robust parameter estimator for nominally Laplacian noise 

    E-Print Network [OSTI]

    Bhagawat, Pankaj

    2004-09-30

    of standard deviation. 5 CHAPTER II MAXIMUM LIKELIHOOD ESTIMATOR(ML)FOR LAPLACIAN DATA The probability distribution function for Laplacian noise is given by f(x) = de jxj a c (2.1) where c = 2 and d = 12 (2.2) where is the standard deviation. In this work...jxj; jxj < +k p2k; x < k (3.21) Also notice that the parameter to be estimated for Laplacian data is its standard deviation ; thus, should be replaced by . The speci c integral parts for the Laplace distribution of the equation (3.20) can now...