Powered by Deep Web Technologies
Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Detroit Public Lighting Department - Commercial and Industrial...  

Open Energy Info (EERE)

with form History Share this page on Facebook icon Twitter icon Detroit Public Lighting Department - Commercial and Industrial Energy Wise Program This is the approved...


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and… (more)

Yun, Michael



Detroit Public Lighting Department - Residential Energy Wise Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Public Lighting Department - Residential Energy Wise Detroit Public Lighting Department - Residential Energy Wise Program Detroit Public Lighting Department - Residential Energy Wise Program < Back Eligibility Low-Income Residential Multi-Family Residential Residential Savings Category Heating & Cooling Cooling Appliances & Electronics Commercial Lighting Lighting Program Info State Michigan Program Type Utility Rebate Program Rebate Amount CFLs: $2-$10 LED Task Light: $10.00 LED Night light: $1.25 Energy Star Ceiling Fan: $10 Provider Detroit Public Lighting Department The Detroit Public Lighting Department (PLD) offers residential customers rebates for energy efficient lights. In addition, low-income residential customers may qualify for free compact fluorescent lights (CFLs). Specific rebate amounts, equipment requirements, and applications are available on


Detroit Public Lighting Department - Commercial and Industrial Energy Wise  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Public Lighting Department - Commercial and Industrial Detroit Public Lighting Department - Commercial and Industrial Energy Wise Program Detroit Public Lighting Department - Commercial and Industrial Energy Wise Program < Back Eligibility Commercial Industrial Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Cooling Other Sealing Your Home Design & Remodeling Windows, Doors, & Skylights Manufacturing Heat Pumps Appliances & Electronics Commercial Lighting Lighting Insulation Maximum Rebate $50,000 per customer/facility, or 100% of the project cost Program Info State Michigan Program Type Utility Rebate Program Rebate Amount Light Fixtures: $2-$200 Lighting Controls: $0.10-$65 HVAC Equipment: $10-$30/ton Programmable Thermostat: $80 Window Glazing: $0.30/square foot



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


Clean Cities: Detroit Clean Cities coalition  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Detroit Clean Cities Coalition Detroit Clean Cities Coalition The Detroit Clean Cities coalition works with vehicle fleets, fuel providers, community leaders, and other stakeholders to reduce petroleum use in transportation. Detroit Clean Cities coalition Contact Information Aaron Champion 734-585-5720 x23 aaron@cec-mi.org Coalition Website Clean Cities Coordinator Aaron Champion Photo of Aaron Champion Aaron Champion is the Coordinator for Detroit Area Clean Cities and a Project Manager with Clean Energy Coalition, where he works on sustainable transportation solutions. Previously, he served as Programs Representative between the U.S. Department of Energy and the Oklahoma Department of Commerce, where he implemented and monitored more than 70 energy efficiency and alternative fuel vehicle projects. Additionally, Champion provided


Detroit blues women.  

E-Print Network (OSTI)

??ABSTRACT DETROIT BLUES WOMEN by Michael Duggan Murphy August 2011 Advisor: Dr. John J. Bukowczyk Major: History Degree: Doctor of Philosophy "Detroit Blues Women" explores… (more)

Murphy, Michael Duggan



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Detroit: Mapping a New Narrative.  

E-Print Network (OSTI)

??This thesis identifies the attractors of Detroit’s growth and divulges into the cultural, federal, socio-economic and urban deterrents that have afflicted Detroit for the past… (more)

Bedard, Joshua



Detroit as linear city.  

E-Print Network (OSTI)

??Detroit is a city in decline. Through strategic withdrawal into a linear city its main artery -Woodward Avenue- becomes an assembly line that holds different… (more)

Kuys, J.I.



Detroit : open city.  

E-Print Network (OSTI)

??Detroit is often regarded as America's largest city in decline, a metropolis that has failed to recover from an insidious cycle of deindustrialization, racism, suburban… (more)

Berry, Daniel (Daniel Kevin)



Sustaining development in Detroit  

E-Print Network (OSTI)

The intent of this thesis is to propose a strategy for stabilizing and increasing the disparate pieces of development that form the traces of the once great industrial city of Detroit. It focuses primarily on Fordism as a ...

Resnick, Noah Samuel, 1977-



Detroit : open city  

E-Print Network (OSTI)

Detroit is often regarded as America's largest city in decline, a metropolis that has failed to recover from an insidious cycle of deindustrialization, racism, suburban flight and laggard politics. This image of the city ...

Berry, Daniel (Daniel Kevin)



Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Identifying Detroit: Representing Tension, Conflict, and Hope in Detroit Architecture.  

E-Print Network (OSTI)

??Since the 1950s, Detroit's businesses and residents have been steadily migrating to the suburbs, taking with them much of the cultural, social, and economic diversity… (more)



Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


Reclaiming the Ruin: Detroit's Second Coming?  

E-Print Network (OSTI)

13. 22. Ibid. 23. Solnit, “Detroit Arcadia,” p. 70. Above:2/3 (1977), pp. 3-23. 7. “Detroit. Demolition. Disneyland. :Lot! ” ”12. Rebecca Solnit, “Detroit Arcadia: Exploring the

Moon, Whitney



Detroit: Return of the cityzen.  

E-Print Network (OSTI)

??Detroit has steadily declined as a city since the height of its greatness in the 1950s. Deindustrialization, suburbanization, divisive racism, and disenfranchisement have taken a… (more)

Ratkowski, Eric



PP-221 Detroit Edison Company  

Energy.gov (U.S. Department of Energy (DOE))

Presidential Permit authorizing Detroit Edison Company to construct, operate and maintain electric transmission facilities at the U.S. - Canada border.


Detroit Commuter Hydrogen Project  

Science Conference Proceedings (OSTI)

This project was undertaken to demonstrate the viability of using hydrogen as a fuel in an internal combustion engine vehicle for use as a part of a mass transit system. The advantages of hydrogen as a fuel include renew-ability, minimal environmental impact on air quality and the environment, and potential to reduce dependence on foreign energy sources for the transportation sector. Recognizing the potential for the hydrogen fuel concept, the Southeast Michigan Congress of Governments (SEMCOG) determined to consider it in the study of a proposed regional mass transit rail system for southeast Michigan. SEMCOG wanted to evaluate the feasibility of using hydrogen fueled internal combustion engine (H2ICE) vehicles in shuttle buses to connect the Detroit Metro Airport to a proposed, nearby rail station. Shuttle buses are in current use on the airport for passenger parking and inter-terminal transport. This duty cycle is well suited to the application of hydrogen fuel at this time because of the ability to re-fuel vehicles at a single nearby facility, overcoming the challenge of restricted fuel availability in the undeveloped hydrogen fuel infrastructure. A cooperative agreement between SEMCOG and the DOE was initiated and two H2ICE buses were placed in regular passenger service on March 29, 2009 and operated for six months in regular passenger service. The buses were developed and built by the Ford Motor Company. Wayne County Airport Authority provided the location for the demonstration with the airport transportation contractor, Metro Cars Inc. operating the buses. The buses were built on Ford E450 chassis and incorporated a modified a 6.8L V-10 engine with specially designed supercharger, fuel rails and injectors among other sophisticated control systems. Up to 30 kg of on-board gaseous hydrogen were stored in a modular six tank, 350 bar (5000 psi) system to provide a 150 mile driving range. The bus chassis and body were configured to carry nine passengers with luggage. By collecting fuel use data for the two H2ICE buses, with both written driver logs and onboard telemetry devices, and for two conventional propane-gasoline powered buses in the same service, comparisons of operating efficiency and maintenance requirements were completed. Public opinion about the concept of hydrogen fuel was sampled with a rider survey throughout the demonstration. The demonstration was very effective in adding to the understanding of the application of hydrogen as a transportation fuel. The two 9 passenger H2ICE buses accumulated nearly 50,000 miles and carried 14,285 passengers. Data indicated the H2ICE bus fuel economy to be 9.4 miles/ gallon of gasoline equivalent (m/GGE) compared to the 10 passenger propane-gasoline bus average of 9.8 m/GGE over 32,400 miles. The 23- passenger bus averaged 7.4 m/GGE over 40,700 miles. Rider feedback from 1050 on-board survey cards was overwhelmingly positive with 99.6% indicating they would ride again on a hydrogen powered vehicle. Minimal maintenance was required for theses buses during the demonstration project, but a longer duration demonstration would be required to more adequately assess this aspect of the concept.

Brooks, Jerry; Prebo, Brendan



The Heidelberg Project - Detroit, Michigan [EDRA / Places Awards, 2004 -- Design  

E-Print Network (OSTI)

The Heidelberg Project — Detroit, Michigan Tyree Guytona kid in a broken family, Detroit artist Tyree Guyton woreWhen Guyton was a child, Detroit burned; he still remembers

Nasar, Jack; Moffat, David



Detroit, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Michigan: Energy Resources Michigan: Energy Resources (Redirected from Detroit, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.331427°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.331427,"lon":-83.0457538,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Detroit Edison Comments on NRC Guidance for Operability Determinations  

E-Print Network (OSTI)

with the Nuclear Energy Institute (NEI) in the preparation of industry comments on the draft revision to NRC Manual Chapter 9900. Detroit Edison appreciates the efforts by NRC staff to update and clarify the guidance for operability determinations and the opportunity to provide comments prior to final issuance. Detroit Edison concurs with the specific comments on the referenced Federal Register notice provided by NEI and the associated recommendation that the NRC continue public dialogue on this topic. Should you have any questions or require additional information, please contact me at (734) 586-4258. Sincerely, Norman K. Peterson

Detroit Edison; Washington D C; Detroit Edison; Has Participated



City of Detroit - SmartBuildings Detroit Grant Program | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Detroit - SmartBuildings Detroit Grant Program City of Detroit - SmartBuildings Detroit Grant Program City of Detroit - SmartBuildings Detroit Grant Program < Back Eligibility Commercial Institutional Local Government Multi-Family Residential State Government Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Sealing Your Home Cooling Other Design & Remodeling Windows, Doors, & Skylights Heat Pumps Appliances & Electronics Commercial Lighting Lighting Insulation Water Buying & Making Electricity Solar Water Heating Wind Maximum Rebate 25% of eligible costs Program Info Expiration Date 06/02/2013 State Michigan Program Type Local Grant Program Provider City of Detroit '''''Note: This program is no longer accepting applications. Check the


Transit-Oriented Development in Detroit.  

E-Print Network (OSTI)

??Working with the Detroit Department of Transportation, this project outlines a Transit?Oriented Development (TOD) plan in conjunction with the impending Woodward Avenue Light Rail Train… (more)

De Silva, Lauren; Krueger, Allison; Lee, Angela; Mansoor, Paul



Converging Identities: Islamic Architecture in Detroit.  

E-Print Network (OSTI)

??The development of identity and place within the Detroit Muslim community is explored in this thesis through the creation of an Islamic Center and research… (more)

Chinchilla, Najahyia Luna



Detroit Neighbourhood Stabilization: Burdens Become Assets.  

E-Print Network (OSTI)

??Detroit is just one example of a post-industrial city that has been struggling with the decline of the American industrial economy. In the past 100… (more)

Rutherford, Michael



Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Where the Heart Is? A Geographic Analysis of Working-class Cultures in Detroit Neighborhoods, 1953  

E-Print Network (OSTI)

Peterson 1954. City of Detroit Election Commission. 1952.Precinct Level. Microfilm. Detroit City Hall. Clawson, Dan.You!" Footnotes 24:1,4. Detroit Metropolitan Area Traffic

Stepan-Norris, Judith; Southworth, Caleb



City of Detroit - SmartBuildings Detroit Green Fund Loan | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Detroit - SmartBuildings Detroit Green Fund Loan City of Detroit - SmartBuildings Detroit Green Fund Loan City of Detroit - SmartBuildings Detroit Green Fund Loan < Back Eligibility Commercial Institutional Local Government Multi-Family Residential State Government Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Sealing Your Home Cooling Other Heat Pumps Appliances & Electronics Commercial Lighting Lighting Insulation Design & Remodeling Windows, Doors, & Skylights Water Buying & Making Electricity Energy Sources Solar Water Heating Wind Maximum Rebate 40% of eligible costs, up to $100,000 Program Info Funding Source The American Reinvestment and Recovery Act (ARRA) of 2009; State Energy Program State Michigan Program Type Local Loan Program


Detroit Public Lighting Department - Commercial and Industrial...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

HVAC Equipment: 10-30ton Programmable Thermostat: 80 Window Glazing: 0.30square foot Window Film: 0.20 Chillers: 7 - 40ton Variable Frequency Drives: 70-180...


Detroit Public Lighting Department - Residential Energy Wise...  

Open Energy Info (EERE)

Multi-Family Residential, Residential Eligible Technologies Ceiling Fan, Lighting, LED Lighting Active Incentive Yes Implementing Sector Utility Energy Category Energy...


“Straight Up Detroit Shit”: Genre, Authenticity, and Appropriation in Detroit Ghettotech.  

E-Print Network (OSTI)

??This thesis is an analysis of the genre of Detroit dance music known as ghettotech based primarily on ethnographic data collected from music producers and… (more)

Mueller, Gavin C.



Detroit politics in a global perspective: a Marxist analysis of the 2009 Detroit mayoral primary.  

E-Print Network (OSTI)

??The 2009 Detroit mayoral primary ballot listed a candidate named D'Artagnon Collier. Collier is a member of the Socialist Equality Party. This thesis analyzes the… (more)

Stephens, Christopher Cody



Detroit Edison Co | Open Energy Information  

Open Energy Info (EERE)

Detroit Edison Co Detroit Edison Co Place Detroit, Michigan Utility Id 5109 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Retail Marketing Yes Activity Bundled Services Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] SGIC[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Detroit Edison Company Smart Grid Project was awarded $83,828,878 Recovery Act Funding with a total project value of $167,657,756.


Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

What&039;s your energypledge? What's your EnergyPledge? 1. Secretary Chu at the Detroit Auto Show Snapshots of the Year in Energy: 12 Awesome Photos from 2012 Day 12: Drive...


Southern California: The Detroit of Electric Cars?  

E-Print Network (OSTI)

University o f An early alternative to an electric car.CALIFORNIA: THE DETROIT O F ELECTRIC CARS? BY A L L E N J .center for producing electric cars? It's a mistake to assume

Scott, Allen J.



Detroit -- Focus: HOPE Center for Advanced Technologies [The Place of Work  

E-Print Network (OSTI)

troubled economic times. In Detroit, an abandoned, 50-year-by Focus: MOPE, a Detroit civil rights organization. CAT's

Bressi, Todd W; Marcus, Galith S



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Auto Show 2012 Detroit Auto Show 2012 Detroit Auto Show 2012 Addthis 1 of 10 Energy Secretary Steven Chu with Chrysler Chief Executive Sergio Marchionne. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 2 of 10 Energy Secretary Steven Chu examines the Dodge Dart's four cylinder, 2.4-liter, 184 horsepower engine block. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 3 of 10 Energy Secretary Steven Chu gets behind the wheel of the new 2013 Dodge Dart. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 4 of 10 Energy Secretary Steven Chu examines the interior of the new 2013 Dodge Dart. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 5 of 10 Energy Secretary Steven Chu discusses the latest auto innovations with a


Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Economic Club -- As Prepared for Detroit Economic Club -- As Prepared for Delivery Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for Delivery January 11, 2012 - 9:30am Addthis Thank you, President Simon, for the introduction. I also want to thank the Detroit Economic Club for hosting me. For more than 75 years, the Detroit Economic Club has promoted thoughtful conversation on the important issues facing Michigan and our country, and I am pleased to be a part of that tradition. Finally, I want to recognize Michigan's congressional delegation for its tireless work on behalf of the state's families and industries. It's an exciting time to be in Detroit, the heart of America's auto industry. Yesterday, I toured the auto show and saw the amazing products that will hit the roads soon. What began more than a century ago as a


Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chu's Remarks at Detroit Economic Club -- As Prepared for Chu's Remarks at Detroit Economic Club -- As Prepared for Delivery Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for Delivery January 11, 2012 - 9:30am Addthis Thank you, President Simon, for the introduction. I also want to thank the Detroit Economic Club for hosting me. For more than 75 years, the Detroit Economic Club has promoted thoughtful conversation on the important issues facing Michigan and our country, and I am pleased to be a part of that tradition. Finally, I want to recognize Michigan's congressional delegation for its tireless work on behalf of the state's families and industries. It's an exciting time to be in Detroit, the heart of America's auto industry. Yesterday, I toured the auto show and saw the amazing products that will hit the roads soon. What began more than a century ago as a


Like the Last 30 Years Never Happened: Understanding Detroit Rock Music Through Oral History.  

E-Print Network (OSTI)

??This study was conducted to better understand Detroit’s unusual amount of rock music success. From the 1960s on, Detroit has continuously produced some of the… (more)

Schmitt, Jason M.



Detroit to Durban: Black Workers' Common Struggle; Southern Africa/Black America: Same Struggles, Same Fight  

E-Print Network (OSTI)

DETROIT TO DURBAN: BlACK \\\\OOKERS CCM1>N STRUGGLE by Blackearliest parrphlet is Detroit to Durban . Although publishedstrikes of early 1973 and the Detroit riots of 1967 is a bit

Philips, John



The Social Coalition Character of the Democratic and Republican Precinct Cadres in Detroit, 1956-1984  

E-Print Network (OSTI)

Jones, Bryan D. et al. 1986 Detroit, an American city. TheThe Party Coalitions in Detroit in 1956: The Socio-Economicof Party Cadres in Detroit, 1956. Social Characteristics

Eldersveld, Samuel J.



The mechanics of race : the discursive production of Detroit's landscape of difference  

E-Print Network (OSTI)

Development, and Immigrants in Detroit, 1880-1920. Chicago:a Finer City in Postwar Detroit. Baltimore and London: TheRoss. 1985. “The Crisis of Detroit and the Emergence of

Kinney, Rebecca J.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



An Ethnographic Study of The Moth Detroit StorySLAM.  

E-Print Network (OSTI)

??The Moth Detroit StorySLAM is one of many storytelling events staged in urban bar environments. Unlike the increasingly aged audiences attending the National Storytelling Festival… (more)

Janssen, Catherine Jo


Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Environmental Justice and Fish Consumption Advisories on the Detroit River.  

E-Print Network (OSTI)

??The Detroit River serves as a source of recreation, food, transportation and is an international demarcation. Decades of industrial and municipal pollution have threatened this… (more)

Kalkirtz, Victoria; Martinez, Michelle



Wastewater Treatment Comes To Detroit: Law, Politics, Technology And Funding.  

E-Print Network (OSTI)

??Detroit was one of the cities identified by the International Joint Commission as polluting the Great Lakes in contravention of the Boundary Waters Treaty of… (more)

Johnson, Barry Neal



Connecting Culture and Nature in Detroit's Downtown Core: The Design of a Technical College Campus.  

E-Print Network (OSTI)

??This thesis addresses the City of Detroit`s transformation from a thriving center of trade and commerce to its present abandoned state. Due to the decentralization… (more)

Braithwaite, Peter



The mechanics of race : the discursive production of Detroit's landscape of difference.  

E-Print Network (OSTI)

??Positioning Detroit's "post-industrial" landscape as anything but "natural", this work seeks to understand and engage the racialized production of Detroit in the urban spatial imaginary… (more)

Kinney, Rebecca J.



Detroit Edison Company Smart Grid Project | Open Energy Information  

Open Energy Info (EERE)

Detroit Edison Company Detroit Edison Company Country United States Headquarters Location Detroit, Michigan Recovery Act Funding $83,828,878.00 Total Project Value $167,657,756.00 Coverage Area Coverage Map: Detroit Edison Company Smart Grid Project Coordinates 42.331427°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NO. DE-FC05-00OR22805; DOE WAIVER DOCKET W(A)-01-012 ORO-764 Petitioner, Detroit Diesel Corporation, has made a timely request for an advance waiver to worldwide rights in...


Section 2: Landscapes of Capital - On Big Beaver Road: Detroit and the Diversity of American Metropolitan Landscapes  

E-Print Network (OSTI)

Center near Ann Arbor, Detroit News, April 12, 2005, p. 8.on Southern Plant,” Detroit News, October 28, 2006, p. 3.Pro?le: Michigan 2005 (Detroit: Southeast Michigan Council

Fishman, Robert



The Detroit Edison Company Smart Grid Demonstration Project | Open Energy  

Open Energy Info (EERE)

The Detroit Edison Company The Detroit Edison Company Country United States Headquarters Location Detroit, Michigan Recovery Act Funding $4,995,271.00 Total Project Value $10,877,258.00 Coordinates 42.331427°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Revving up the Motor City : targeted neighborhood redevelopment in Detroit  

E-Print Network (OSTI)

This thesis is an analysis of an ambitious redevelopment plan for a two square mile area in the city of Detroit, Michigan. This area is dominated by city-owned vacant lots, which make up half of the neighborhood. The plan, ...

Pauls, Edward, 1977-




NLE Websites -- All DOE Office Websites (Extended Search)

François Rémi Carrié [Clear All Filters] François Rémi Carrié [Clear All Filters] 2013 Wargocki, Pawel, Max H. Sherman, Willem de Gids, Peter Wouters, Francis Allard, François Rémi Carrié, Paolo Carrer, and Stylianos Kephalopolous. Proposed Research Agenda for Achieving Indoor Air Quality Supporting Health and Comfort in Highly Energy Efficient Buildings., 2013. 2002 Carrié, François Rémi, Ronnen M. Levinson, Tengfang T. Xu, Darryl J. Dickerhoff, William J. Fisk, Jennifer A. McWilliams, Mark P. Modera, and Duo Wang. "Laboratory and field testing of an aerosol-based duct-sealing technology for large commercial buildings." ASHRAE Transactions (2002). Xu, Tengfang T., François Rémi Carrié, Darryl J. Dickerhoff, William J. Fisk, Jennifer A. McWilliams, Duo Wang, and Mark P. Modera. "Performance of


Sub[urban] Detroit: Mediating the Expression.  

E-Print Network (OSTI)

??In an era commodified by images and sounds throughout the global public landscape, architecture is not only being transformed by new technology, but by the… (more)

Karalambo, Paul N.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

BY DETROIT DIESEL CORPORATION (DDC) BY DETROIT DIESEL CORPORATION (DDC) FOR ADVANCE WAIVER OF U.S. AND FOREIGN RIGHTS TO INVENTIONS MADE UNDER MODIFICATION 17 TO CONTRACT DEN-3-329 [W(A)93-043] The Petitioner is asking for U.S. and foreign patent rights to all subject inventions made under DOE Contract DEN-3-329, Modification 17, entitled "Adiabetic Diesel Engine Component Development". This entire contract is being funded by DOE, but is being administered by the NASA Lewis Research Center. The entire contract has as its object the successful design, fabrication, and demonstration of five stationary and moving structural monolithic ceramic components in an extremely hostile Low Heat Rejection (LHR) environment. DDC was formed in January 1988 to design, manufacture, and sell diesel engines. It is a joint-venture company 80% owned by



Office of Legacy Management (LM)

* .t-* * .t-* . * * - -. _ _ ,.. .I AIT. 4 NOTES AND COMMENTS REVERE COPPER AR! BRASS DETROIT, MICHIGAN A preliminary (screening) survey was conducted in several areas of the Revere Copper and Brass Facility, 5851 W. Jefferson Street, Detroit, Michigan. The survey was conducted by the ANL Radiological Survey Group on April 22, 1981. The Survey Group, consisting of W. Smith, R. Mundis, K. Flynn (all of ANI), and E. Jascewsky (DOE-CH) met on site with J. Evans (Safety Engineer), D. Tratt (Asst. Engineer), -- M~37~se'Zanak~(Aeth6ds~De!@iFXi%itXiupe~isox$ and E. Betancourt (Personnel Manager) to discuss what information was available concerning the operations that transpired at the facility during the Manhattan Engineering District Atomic Energy Commission (MED/AEC) era. MrYWtisffaliab indicated that


A Look Inside the Detroit Auto Show | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show January 12, 2011 - 1:15pm Addthis Kerry Duggan Waking up at 4:30AM is not my idea of fun. But after I witnessed the 6:30AM unveiling of the shiny new Porsche 918 RSR Hybrid at the North American International Auto Show, I got over it. To those who know cars, its lineage is in the #22 Porsche 917 race car, winner of the LeMans in 1971. With a top speed of 140 mph, the new 918 RSR combines the power of a 563-horsepower V-8 engine and a dual inertial flywheel system to produce a total 767-horsepower. On the efficiency side, a Kinetic Energy Recovery System (KERS) allows the two 75-kW flywheels to capture wasted energy when the brakes are applied. The Porsche president said that their goal is to achieve high fuel efficiency in extreme driving


City of Detroit, Michigan (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Detroit Detroit Place Michigan Utility Id 5107 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Operates Generating Plant Yes Activity Generation Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1050/kWh Commercial: $0.0994/kWh Transportation: $0.1060/kWh The following table contains monthly sales and revenue data for City of Detroit (Michigan). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS


A Look Inside the Detroit Auto Show | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show January 12, 2011 - 1:15pm Addthis Kerry Duggan Waking up at 4:30AM is not my idea of fun. But after I witnessed the 6:30AM unveiling of the shiny new Porsche 918 RSR Hybrid at the North American International Auto Show, I got over it. To those who know cars, its lineage is in the #22 Porsche 917 race car, winner of the LeMans in 1971. With a top speed of 140 mph, the new 918 RSR combines the power of a 563-horsepower V-8 engine and a dual inertial flywheel system to produce a total 767-horsepower. On the efficiency side, a Kinetic Energy Recovery System (KERS) allows the two 75-kW flywheels to capture wasted energy when the brakes are applied. The Porsche president said that their goal is to achieve high fuel efficiency in extreme driving


Conference Program "Detroit, Global City: The Motor City in the World"  

E-Print Network (OSTI)

, Nativism and Citizenship in 1920s Detroit" 12:10-2:00: Lunch Break 3. 2:10-3:40 Getting Beyond "Ruin Porn

Cinabro, David


The struggle for vibrancy : a study of local government intervention in Detroit's inner suburbs  

E-Print Network (OSTI)

Today, many communities located on the periphery of central cities confront traditionally "urban" problems. Detroit's inner suburbs struggle with aging infrastructure, limited governmental capacity, commercial disinvestment, ...

Kohn, Amy J. (Amy Jennifer)



Urban agriculture as a tool for neighborhood fabric repair in post-industrial Detroit.  

E-Print Network (OSTI)

??This thesis focuses on Detroit as a post-industrial city that suffers from abandonment, vacancy, and food security issues. I address this problem through the lens… (more)

Fairbank, Sandra Trubow



African-American and Arab American Muslim communities in the Detroit Ummah.  

E-Print Network (OSTI)

?? This paper provides overview of the two larger Muslim communities in Detroit (African-American and Arab American), their differing views on theology, racism, and women's… (more)

Omanson, Lisa Gail


Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Spatial Injustice of Crisis-Driven Neoliberal Urban Restructuring in Detroit.  

E-Print Network (OSTI)

??Struggling to provide basic services due to a dwindling tax base and confronted with significant pockets of vacant land, Detroit has proposed a radical urban… (more)

Clement, Daniel



"Ruin Porn" or the Reality of Ruin?: A Rhetorical Analysis of Andrew Moore's Detroit Disassembled.  

E-Print Network (OSTI)

??Ruin photography, widely called "ruin porn" by critics, is an artistic trend that has entered the conscience of artists and consumers alike. Andrew Moore's Detroit… (more)

Nemeth, Katharine



Spatial And Temporal Relationships Between Blood Lead And Soil Lead Concentrations In Detroit, Michigan.  

E-Print Network (OSTI)

??This study explored variations in child blood lead levels (BLLs) relative to street-side soil lead in Detroit, Michigan. Findings showed that average BLLs steadily decreased… (more)

Bickel, Michael Jonathan



Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Children’s homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard




NLE Websites -- All DOE Office Websites (Extended Search)

1 results: 1 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Mark P. Modera [Clear All Filters] 2002 Carrié, François Rémi, Ronnen M. Levinson, Tengfang T. Xu, Darryl J. Dickerhoff, William J. Fisk, Jennifer A. McWilliams, Mark P. Modera, and Duo Wang. "Laboratory and field testing of an aerosol-based duct-sealing technology for large commercial buildings." ASHRAE Transactions (2002). Xu, Tengfang T., François Rémi Carrié, Darryl J. Dickerhoff, William J. Fisk, Jennifer A. McWilliams, Duo Wang, and Mark P. Modera. "Performance of thermal distribution systems in large commercial buildings." Energy and Buildings 34 (2002): 215-226. 2001 Carrié, François Rémi, and Mark P. Modera. "Experimental investigation


Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CORPORATION, FOR AN ADVANCE WAIVER OF CORPORATION, FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS IN SUBJECT INVENTIONS MADE IN THE COURSE OF OR UNDER DEPARTMENT OF ENERGY COOPERATIVE AGREEMENT NO. DE-FC05-00OR22805; DOE WAIVER DOCKET W(A)-01-012 [ORO-764] Petitioner, Detroit Diesel Corporation, has made a timely request for an advance waiver to worldwide rights in Subject Inventions made in the course of or under Department of Energy (DOE) Cooperative Agreement No. DE-FC05-00OR22805. The scope of this work is to develop a commercially viable heavy-duty diesel technology package for truck applications targeted at achieving 50% thermal efficiency and meeting 2007 EPA mandated emissions. This work is sponsored by the Office of Transportation Technologies, Office of Heavy Vehicle Technologies.


City of Detroit Lakes, Minnesota (Utility Company) | Open Energy  

Open Energy Info (EERE)

Minnesota (Utility Company) Minnesota (Utility Company) Jump to: navigation, search Name City of Detroit Lakes Place Minnesota Utility Id 5111 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes ISO MISO Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Lights - 100 Watt HPS (Unmetered) Lighting Area Lights - 100 Watt HPS (metered) Lighting Area Lights - 250 Watt HPS (Unmetered) Lighting Area Lights - 250 Watt HPS (metered) Lighting Area Lights - 400 Watt HPS (Unmetered) Lighting Area Lights - 400 Watt HPS (metered) Lighting


Simulation and Visualization of Airside Operations at Detroit Metropolitan Airport  

E-Print Network (OSTI)

In recent years, airline flight delays have been among the most troublesome problems in the national transportation system. Although bad weather has historically been the main cause of delays, a growing reason has been the inability of the nation’s air transport system to efficiently absorb all of the aircraft trying to use limited airspace or trying to take off or land at busy airports. Simulation modeling and visualization can be of substantial help in the efficient design of airport operations, which in turn can mitigate some of the abovementioned capacity problems. This study presents the simulation model and 3D animation of the airside airport operations at Detroit Metro Airport, Romulus, Michigan. The simulation model is developed in STROBOSCOPE (Martinez 1996) and the 3D animation is created using

Copyright Hiam; M. Khoury; Vineet R. Kamat; Vineet R. Kamat; Photios G. Ioannou; Photios G. Ioannou; Hiam M. Khoury; Hiam M. Khoury



City of Detroit (Michigan) EIA Revenue and Sales - May 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit (Michigan) EIA Revenue and Sales - May 2008 City of Detroit (Michigan) EIA Revenue and Sales - May 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for May 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-05 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-05-01 End Date 2008-06-01 Residential Revenue(Thousand $) 1.4 Residential Sales (MWh) 15.6 Residential Consumers 82 Commercial Revenue(Thousand $) 3889 Commercial Sales (MWh) 38146 Commercial Consumers 121 Other Revenue (Thousand $) 49 Other Sales (MWh) 376 Other Consumers 1 Total Revenue (Thousand $) 3939.4 Total Sales (MWh) 38537.6 Total Consumers 204 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1]


City of Detroit (Michigan) EIA Revenue and Sales - February 2009 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for February 2009. Monthly Electric Utility Sales and Revenue Data Short Name 2009-02 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2009-02-01 End Date 2009-03-01 Residential Revenue(Thousand $) 2.1 Residential Sales (MWh) 22.5 Residential Consumers 78 Commercial Revenue(Thousand $) 4175 Commercial Sales (MWh) 41864 Commercial Consumers 117 Other Revenue (Thousand $) 76.9 Other Sales (MWh) 786 Other Consumers 1 Total Revenue (Thousand $) 4254 Total Sales (MWh) 42672.5 Total Consumers 196 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_February_2009&oldid=12572


City of Detroit (Michigan) EIA Revenue and Sales - December 2008 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for December 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-12 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-12-01 End Date 2009-01-01 Residential Revenue(Thousand $) 1.8 Residential Sales (MWh) 18.3 Residential Consumers 80 Commercial Revenue(Thousand $) 3407 Commercial Sales (MWh) 34836 Commercial Consumers 118 Other Revenue (Thousand $) 38.9 Other Sales (MWh) 376 Other Consumers 1 Total Revenue (Thousand $) 3447.7 Total Sales (MWh) 35230.3 Total Consumers 199 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_December_2008&oldid=19459


City of Detroit (Michigan) EIA Revenue and Sales - August 2008 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for August 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-08 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-08-01 End Date 2008-09-01 Residential Revenue(Thousand $) 1.75 Residential Sales (MWh) 18.6 Residential Consumers 77 Commercial Revenue(Thousand $) 4689 Commercial Sales (MWh) 45432 Commercial Consumers 124 Other Revenue (Thousand $) 51 Other Sales (MWh) 403 Other Consumers 1 Total Revenue (Thousand $) 4741.75 Total Sales (MWh) 45853.6 Total Consumers 202 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_August_2008&oldid=17335


City of Detroit (Michigan) EIA Revenue and Sales - January 2009 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for January 2009. Monthly Electric Utility Sales and Revenue Data Short Name 2009-01 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2009-01-01 End Date 2009-02-01 Residential Revenue(Thousand $) 2.5 Residential Sales (MWh) 27 Residential Consumers 81 Commercial Revenue(Thousand $) 4964 Commercial Sales (MWh) 48160 Commercial Consumers 120 Other Revenue (Thousand $) 63.5 Other Sales (MWh) 513 Other Consumers 1 Total Revenue (Thousand $) 5030 Total Sales (MWh) 48700 Total Consumers 202 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_January_2009&oldid=12026


City of Detroit (Michigan) EIA Revenue and Sales - June 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit for City of Detroit for June 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-06 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-06-01 End Date 2008-07-01 Residential Revenue(Thousand $) 1.6 Residential Sales (MWh) 17.7 Residential Consumers 77 Commercial Revenue(Thousand $) 4376 Commercial Sales (MWh) 44180 Commercial Consumers 123 Other Revenue (Thousand $) 49 Other Sales (MWh) 386 Other Consumers 1 Total Revenue (Thousand $) 4426.6 Total Sales (MWh) 44583.7 Total Consumers 201 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_June_2008&oldid=16285


City of Detroit (Michigan) EIA Revenue and Sales - July 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit for City of Detroit for July 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-07 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-07-01 End Date 2008-08-01 Residential Revenue(Thousand $) 1.7 Residential Sales (MWh) 18.1 Residential Consumers 77 Commercial Revenue(Thousand $) 4597 Commercial Sales (MWh) 44891 Commercial Consumers 123 Other Revenue (Thousand $) 52 Other Sales (MWh) 408 Other Consumers 1 Total Revenue (Thousand $) 4650.7 Total Sales (MWh) 45317.1 Total Consumers 201 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_July_2008&oldid=16810"


City of Detroit (Michigan) EIA Revenue and Sales - November 2008 | Open  

Open Energy Info (EERE)

City of Detroit (Michigan) EIA Revenue and Sales - November 2008 City of Detroit (Michigan) EIA Revenue and Sales - November 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for November 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-11 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-11-01 End Date 2008-12-01 Residential Revenue(Thousand $) 1.709 Residential Sales (MWh) 17.18 Residential Consumers 79 Commercial Revenue(Thousand $) 4219 Commercial Sales (MWh) 41796 Commercial Consumers 126 Other Revenue (Thousand $) 38.9 Other Sales (MWh) 376.3 Other Consumers 1 Total Revenue (Thousand $) 4259.609 Total Sales (MWh) 42189.48 Total Consumers 206 Source: Energy Information Administration. Form EIA-826 Database Monthly


City of Detroit (Michigan) EIA Revenue and Sales - March 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit (Michigan) EIA Revenue and Sales - March 2008 City of Detroit (Michigan) EIA Revenue and Sales - March 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for March 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-03 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-03-01 End Date 2008-04-01 Residential Revenue(Thousand $) 1.4 Residential Sales (MWh) 16 Residential Consumers 81 Commercial Revenue(Thousand $) 3467 Commercial Sales (MWh) 38666 Commercial Consumers 117 Other Revenue (Thousand $) 50 Other Sales (MWh) 455 Other Consumers 1 Total Revenue (Thousand $) 3518.4 Total Sales (MWh) 39137 Total Consumers 199 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1]


Anticipating Detroit : a collection of instruments as a catalyst for recovery  

E-Print Network (OSTI)

The social, political and economic history of Detroit has been inextricably linked to the development of its most dominant industry: automotive manufacturing. This thesis suggests a strategy to overcome the disadvantages ...

Bouwman, Laura Marcella, 1976-



Woodward Avenue, Detroit : a pedestrian zone for a changing downtown retail street  

E-Print Network (OSTI)

The thesis studies the changing direction of Detroit's central downtown shopping street, Woodward Avenue. During the last two decades, Woodward Avenue has lost most of its retail market to suburban shopping centers. The ...

Lewis, Philip Strickland


Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Urban agriculture as a tool for neighborhood fabric repair in post-industrial Detroit  

E-Print Network (OSTI)

This thesis focuses on Detroit as a post-industrial city that suffers from abandonment, vacancy, and food security issues. I address this problem through the lens of agriculture, asking how urban farming can be used to ...

Fairbank, Sandra Trubow




NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Publications Most publications by Environmental Energy Technologies Division authors are searchable from this page, including peer-reviewed publications, book chapters, conference proceedings and LBNL reports. Filter Advanced Search Publications list This publications database is an ongoing project, and not all Division publications are represented here yet. For additional help see the bottom of this page. Show only items where Author Type Term Year Keyword is Abadie, Marc O Abbey, Chad Abdolrazaghi, Mohamad Aberg, Annika Abhyankar, Nikit Abraham, Marvin M Abshire, James B Abushakra, Bass Acevedo-Ruiz, Manuel Aceves, Salvador Ache, Hans J Ackerly, David D Ackerman, Andrew S Adamkiewicz, Gary Adams, Carl Adams, J W Adamson, Bo Addy, Susan E Addy, Nathan Aden, Nathaniel T Adesola, Bunmi Adhikari, Sarina Adilov, Nodir



Energy.gov (U.S. Department of Energy (DOE))

The EERE Publication and Product Library will allow you to find publications and products provided by the DOE's Office of Energy Efficiency and Renewable Energy specifically for our constituents....


Subsidized Housing and Neighborhood Change  

E-Print Network (OSTI)

97 Figure 3-6a Detroit, MI PMSA Neighborhood Quintile98 Figure 3-6b Detroit, MI PMSA Neighborhood Quintileinterviewing from the Detroit Area Study. Neighborhood

Wilson, Florence Louise



Comparative Analysis of Urban Decay and Renewal in the Cities of Detroit and Pittsburgh, Postwar to Present: An Introductory Survey .  

E-Print Network (OSTI)

??The thesis represents the results of comparing and analyzing the social and economic circumstances of Detroit and Pittsburgh over the last seventy years in the… (more)

Tolksdorf, Alexander



Women and the high school principalship: metropolitan detroit principals' and superintendents' perceptions regarding barriers and facilitators for job attainment.  

E-Print Network (OSTI)


Schnabel Kattula, Heidi




NLE Websites -- All DOE Office Websites (Extended Search)

some of the publications, presentations, posters and other output of the Computational Science and Engineering Petascale Iniative's post-doctoral researchers. Sort by: Default |...



Science Conference Proceedings (OSTI)

... Baldrige Stock Studies Performance of the Baldrige Index, a fictitious stock fund including the stock of publicly traded US companies that have ...




NLE Websites -- All DOE Office Websites (Extended Search)

Division authors are searchable from this page, including peer-reviewed publications, book chapters, conference proceedings and LBNL reports. NOTICE Due to the current lapse of...


Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by… (more)

Marotta, Stephen J.



Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available



US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.



NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Analysis Publications Thermal Analysis Publications Items are listed below in chronological order with the most recent reports first. The Source column lists the journals or conference proceeding where many reports can be found. Please check your local technical or engineering libraries to find these reports. Reports that have links are available on this server in PDF format. Download a free copy of Adobe Acrobat Reader. If you would like to receive a report on this list, please contact our publications coordinator at the address below: Pat Ross Windows and Daylighting Group Lawrence Berkeley National Laboratory Mail Stop 90/3111 Berkeley, CA 94720 (510) 486-6845 Fax: (510) 486-4089 email: plross@lbl.gov Please limit your request to no more than 5 publications. Note: Use the Find function of your browser to search this page if you are


City of Detroit (Michigan) EIA Revenue and Sales - February 2008 | Open  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » City of Detroit (Michigan) EIA Revenue and Sales - February 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for February 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-02 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-02-01 End Date 2008-03-01 Residential Revenue(Thousand $) 1.5 Residential Sales (MWh) 17 Residential Consumers 76 Commercial Revenue(Thousand $) 4083 Commercial Sales (MWh) 43432 Commercial Consumers 123 Other Revenue (Thousand $) 55 Other Sales (MWh) 494



NLE Websites -- All DOE Office Websites (Extended Search)

Recent Publications Recent Publications Ying Xu, Dong Xu, Dongsup Kim, Victor Olman, Jane Razumovskaya, and Tao Jiang Automated Assignment of Backbone NMR Peaks Using Constrained Bipartite Matching. Computing in Science and Engineering. In press. Ying Xu, Victor Olman, and Dong Xu. Clustering Gene Expression Data Using a Graph-Theoretic Approach: An Application of Minimum Spanning Trees. Bioinformatics. In press. Ying Xu, Victor Olman, and Dong Xu. Minimum Spanning Trees for Gene Expression Data Clustering. In Proceedings of the 12th International Conference on Genome Informatics (GIW), edited by S. Miyano, R. Shamir and T. Takagi. Accepted. Dong Xu and Ying Xu. Computational Studies of Protein Structure and Function Using Threading Program PROSPECT. In Protein Structure Prediction: Bioinformatic Approach, edited by Igor Tsigelny. International University Line publishers (IUL), La Jolla, CA. Invited publication.



NLE Websites -- All DOE Office Websites (Extended Search)

Lee » Publications Lee » Publications Publications Sort by: Date | Author | Type 2013 Daya Bay Collaboration: F.P. An, A.B. Balantekin, H.R. Band, W. Beriguete, et. al, "Spectral measurement of electron antineutrino oscillation amplitude and frequency at Daya Bay", Phys. Rev. Letter, October 24, 2013, A measurement of the energy dependence of antineutrino disappearance at the Daya Bay Reactor Neutrino Experiment is reported. Electron antineutrinos from six GW reactors were detected with six detectors deployed in two near (effective baselines 512 m and 561 m) and one far (1579 m) underground experimental halls. Using 217 days of data, 41589 (203809 and 92912) antineutrino candidates were detected in the far hall (near halls). An improved measurement of the oscillation amplitude and the first direct


Detroit Lakes energy systems study: Phase I feasibility. Final report, February 1, 1978--July 31, 1978  

DOE Green Energy (OSTI)

The objective of the Detroit Lakes Energy Systems Study is to determine the economic feasibility of alternative renewable energy system configurations in the northern latitudes. A forecast through both 1990 and the year 2000 is made of the demand for electrical energy in the Detroit Lakes area. An assessment of renewable energy resources including biomass, wind, and insolation is provided. A detailed analysis is made of system costs including biomass, wind, solar thermal, solar photovoltaic, selected hybrids, and conventional fuel systems. Lessons learned and recommendations for prototype fabrication are highlighted. (MHR)




Field Demonstration of a 24-kV Superconducting Cable at Detroit Edison: Final Report  

Science Conference Proceedings (OSTI)

Following up the successful testing of a complete 50 m, 115 kV high temperature superconducting (HTS) power cable system prototype, EPRI, Pirelli Power Cables and Systems, the Department of Energy, Detroit Edison, and American Superconductor Corporation undertook a project to design, install, and operate a 24 kV HTS power cable at Detroit Edison's Frisbie substation to serve customer load. The demonstration cable circuit ran approximately 120 m between the 24 kV bus distribution bus and a 120 kV-24 kV tr...


Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

7 results: 7 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Laura Van Wie McGrory [Clear All Filters] 2006 McGrory, Laura Van Wie, Philip Coleman, David Fridley, Jeffrey P. Harris, and Edgar Villasenor Franco. "Two Paths to Transforming Markets through Public Sector Energy Efficiency: Bottom Up versus Top Down." In 2006 ACEEE Summer Study on Energy Efficiency in Buildings. Pacific Grove, CA, 2006. McGrory, Laura Van Wie, Philip Coleman, David Fridley, Jeffrey P. Harris, and Edgar Villasenor Franco. Two Paths to Transforming Markets through Public Sector Energy Efficiency: Bottom Up versus Top Down In 2006 ACEEE Summer Study on Energy Efficiency in Buildings . Vol. 6., 2006. 2004 Wiel, Stephen, Laura Van Wie McGrory, and Lloyd Harrington. Energy



NLE Websites -- All DOE Office Websites (Extended Search)

PUBLICATIONS PUBLICATIONS A. Refereed International Journal Papers V. Radmilovic, C. Ophus, E.A. Marquis, A. Tolley, M.D. Rossell, A. Gautam, M. Asta and U. Dahmen, "Highly monodisperse core-shell particles created by solid-state reactions", Nature Materials, 2011, in press. Ki-Joon Jeon, Zonghoon Lee, Elad Pollak, Luca Moreschini, Aaron Bostwick, Cheol-Min Park, Rueben Mendelsberg, Velimir Radmilovic, Robert Kostecki, Thomas Richardson, Eli Rotenberg, "Fluorographane: a wide band gap semiconductor with ultraviolet luminescence", ACS Nano, 5 (2011) 1042-1046. J.T. McKewon, V.R. Radmilovic, R. Gronsky, and A.M. Gleaser, "Silicide characterization at alumina-niobium interfaces", Journal of Materials Science, 46 (2011) 3969-3981. B. Jokic, M. Mitric, V. Radmilovic, S. Drmanic, R. Petrovic, and D.



NLE Websites -- All DOE Office Websites (Extended Search)

35 results: 35 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Arthur H. Rosenfeld [Clear All Filters] 2009 Akbari, Hashem, and Arthur H. Rosenfeld. Cool roofs could save money, save planet In KGO-TV (abc7news)., 2009. Akbari, Hashem, Surabi Menon, and Arthur H. Rosenfeld. "Global cooling: increasing world-wide urban albedos to offset CO2." Climatic Change 94 (2009): 275-286. Rosenfeld, Arthur H.. Painting the town white: California Energy Commissioner, Art Rosenfeld, explains the benefits of cool roofs In National Public Radio., 2009. 2008 Akbari, Hashem, Surabi Menon, and Arthur H. Rosenfeld. Equivalent CO2 avoided by reflective roofs and pavements in California In Memo to California Air Resources Board., 2008. Akbari, Hashem, and Arthur H. Rosenfeld. White roofs cool the world,



NLE Websites -- All DOE Office Websites (Extended Search)

3 results: 3 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Kayje Booker [Clear All Filters] 2012 Booker, Kayje, Ashok J. Gadgil, and David Winickoff. "Engineering for the Global Poor: The Role of Intellectual Property." Science and Public Policy 39, no. 6 (2012): 775-786. 2011 Booker, Kayje, Tae Won Han, Jessica Granderson, Jennifer L. Jones, Kathleen M. Lask, Nina Yang, and Ashok J. Gadgil. Performance of Charcoal Cookstoves for Haiti, Part 1: Results from the Water Boiling Test. Berkeley: Lawrence Berkeley National Laboratory, 2011. Lask, Kathleen M., Jennifer L. Jones, Kayje Booker, Cristina Ceballos, Nina Yang, and Ashok J. Gadgil. Performance of Charcoal Cookstoves for Haiti, Part 2: Results from the Controlled Cooking



NLE Websites -- All DOE Office Websites (Extended Search)

19 results: 19 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Maithili Iyer [Clear All Filters] 2012 Iyer, Maithili, and Jayant A. Sathaye. Market Assessment of Public Sector Energy Efficiency Potential in India. LBNL, 2012. 2011 Sathaye, Jayant A., Stephane Rue de la du Can, Maithili Iyer, Michael A. McNeil, Klaas Jan Kramer, Joyashree Roy, Moumita Roy, and Shreya Roy Chowdhury. Strategies for Low Carbon Growth In India: Industry and Non Residential Sectors. LBNL, 2011. 2010 Harris, Jeffrey P., Richard C. Diamond, Carl Blumstein, Chris Calwell, Maithili Iyer, Christopher T. Payne, and Hans-Paul Siderius. "Towards a Policy of Progressive Efficiency." In People-Centered Initiatives for Increasing Energy Saving. Washington, D.C. : ACEEE, 2010.



NLE Websites -- All DOE Office Websites (Extended Search)

3 results: 3 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Tiefeng Yu [Clear All Filters] 2012 Bauman, Fred S., Thomas L. Webster, Stefano Schiavon, Hui Zhang, Edward A. Arens, Kwang Ho Lee, Tyler Hoyt, Darryl J. Dickerhoff, Timothy Moore, Wilmer Pasut et al. Advanced Design and Commissioning Tools for Energy-Efficient Building Technologies In Final report to California Energy Commission (CEC) Public Interest Energy Research (PIER) Program. Berkeley: Center for the Built Environment, University of California, 2012. 2011 Bauman, Fred S., Thomas L. Webster, David Lehrer, Edward A. Arens, Hui Zhang, John Goins, Darryl J. Dickerhoff, Stefano Schiavon, Sabine Hoffmann, Tiefeng Yu et al. Advanced Integrated Systems Tools Development and


Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...


Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...


Field Demonstration of a 24-kV Warm Dielectric Cable at Detroit Edison: FY2002 Annual Progress Report for the Detroit Edison HTS Cab le Field Demonstration Project  

Science Conference Proceedings (OSTI)

A project sponsored by EPRI, Pirelli Power Cables and Systems, the Department of Energy, Detroit Edison, and American Superconductor Corporation was initiated in 1998 to install and operate a 24 kV high temperature superconductor (HTS) power cable in a Detroit Edison substation to serve customer load. The previous years of activity have focused on design, testing, manufacturing, and installation of the cable system as described in the FY2000 and FY2001 status reports. The successful implementation of thi...



"Arab Americans and Segmented Assimilation: Looking Beyond the Theory to the Reality in the Detroit Metro Area".  

E-Print Network (OSTI)

??This thesis aims to apply Segmented Assimilation Theory to the Arab-American community in Metropolitan Detroit. Segmented assimilation theory relates to second-generation immigrants, and proposes three… (more)

Weaver, Kristin



Black and white do not make grey| Narratives of women's friendship across a racial divide in metro Detroit.  

E-Print Network (OSTI)

?? Interracial friendship between African Americans and whites in metro Detroit requires bridge-building across a socially constructed divide. This ethnographically-inflected, interview-based case study of the… (more)

Van't Hof, Marcia



DTE Energy Technologies With Detroit Edison Co. and Kinectrics Inc.: Distributed Resources Aggregation Modeling and Field Configuration Testing  

Science Conference Proceedings (OSTI)

Summarizes the work of DTE Energy Technologies, Detroit Edison, and Kinectrics, under contract to DOE's Distribution and Interconnection R&D, to develop distributed resources aggregation modeling and field configuration testing.

Not Available



Field Demonstration of a 24-KV Warm Dielectric Cable at Detroit Edison: FY2001 Annual Progress Report  

Science Conference Proceedings (OSTI)

A project sponsored by EPRI, Pirelli Power Cables and Systems, the U.S. Department of Energy, Detroit Edison, and American Superconductor Corporation was initiated in 1998 to install and operate a 24 kV high-temperature superconducting (HTS) power cable in a Detroit Edison substation to serve customer load. The scope of this demonstration will result in the world's first underground installation of an HTS cable system using an existing duct network. Furthermore, the project involves installing the necess...



City of Detroit (Michigan) EIA Revenue and Sales - January 2008 | Open  

Open Energy Info (EERE)

January 2008 January 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for January 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-01 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-01-01 End Date 2008-02-01 Residential Revenue(Thousand $) 1.7 Residential Sales (MWh) 19 Residential Consumers 76 Commercial Revenue(Thousand $) 4458 Commercial Sales (MWh) 47480 Commercial Consumers 123 Other Revenue (Thousand $) 63.3 Other Sales (MWh) 537 Other Consumers 1 Total Revenue (Thousand $) 4523 Total Sales (MWh) 48036 Total Consumers 200 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from


City of Detroit (Michigan) EIA Revenue and Sales - April 2008 | Open Energy  

Open Energy Info (EERE)

April 2008 April 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for April 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-04 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-04-01 End Date 2008-05-01 Residential Revenue(Thousand $) 1.2 Residential Sales (MWh) 13 Residential Consumers 81 Commercial Revenue(Thousand $) 4537 Commercial Sales (MWh) 41373 Commercial Consumers 121 Other Revenue (Thousand $) 55 Other Sales (MWh) 400 Other Consumers 1 Total Revenue (Thousand $) 4593.2 Total Sales (MWh) 41786 Total Consumers 203 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from


City of Detroit (Michigan) EIA Revenue and Sales - March 2009 | Open Energy  

Open Energy Info (EERE)

9 9 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for March 2009. Monthly Electric Utility Sales and Revenue Data Short Name 2009-03 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2009-03-01 End Date 2009-04-01 Residential Revenue(Thousand $) 2.1 Residential Sales (MWh) 20.7 Residential Consumers 79 Commercial Revenue(Thousand $) 3720 Commercial Sales (MWh) 36330 Commercial Consumers 112 Other Revenue (Thousand $) 60.4 Other Sales (MWh) 560 Other Consumers 1 Total Revenue (Thousand $) 3782.5 Total Sales (MWh) 36910.7 Total Consumers 192 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from


Detroit Lakes Energy Systems Study. Quarterly technical progress report, February 1, 1978--April 30, 1978  

DOE Green Energy (OSTI)

The initial phase of the Detroit Lakes Energy Systems Study was designed to assemble and analyze sufficient data from which to recommend specific classes of alternative energy supplies. Most of the information on meteorological conditions and biomass materials have been obtained. This is being compiled into a useful form for future evaluation. Research into legal and economic areas are underway. Analysis of this data is being conducted and results will be used in assessing the impact of alternative energy systems. Current technical information on solar thermal, solar photovoltaic, wind and hybrid power systems is being evaluated. Potential systems are being considered in light of their impact on the Detroit Lakes region and the northern latitudes in general. Final evaluation of the data is expected well within schedule.

DeVillers, K.E.



“I Can’t Walk!” Acute Thrombosis of Descending Aorta Causing Paraplegia  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, Michigan Supervising SectionWest Grand Boulevard, CFP-258, Detroit, MI 48202. Email:

Mitchell, Matthew Lee; Yucebey, Elif; Weaver, Mitchell R; Jaehne, A Kathrin; Rivers, Emanuel P



miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Higher than those of their race of less fortunate advantages:Race, ethnicity, and West Indian political leadership in Detroit's African American community, 1885-1940.  

E-Print Network (OSTI)

??This dissertation explores West Indian immigrants in the city of Detroit and their leadership of key institutions in the African American community from 1885 to… (more)

Beard, Kathryn Lorraine


Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Girls Will Be Boys: Cross-Dressed Women and the Legitimation of American Silent Cinema  

E-Print Network (OSTI)

in American Film. Detroit: Wayne State University Press,159. “Washington--The Prince and the Pauper. ” Detroit News.Detroit, MI, December 6, 1915. Waters, Sarah. “‘A Girton

Horak, Laura



The Rise Of Public Sector Unionism In Detroit, 1947-1967.  

E-Print Network (OSTI)

??In 1947, the Michigan Legislature passed into law the Hutchinson Act banning strikes of state and local workers. The law provided for the termination of… (more)

Jones, Louis Eugene



Advanced Communication and Control of Distributed Energy Resources at Detroit Edison  

DOE Green Energy (OSTI)

The project objective was to create the communication and control system, the process and the economic procedures that will allow owners (e.g., residential, commercial, industrial, manufacturing, etc.) of Distributed Energy Resources (DER) connected in parallel to the electric distribution to have their resources operated in a manner that protects the electric utility distribution network and personnel that may be working on the network. The Distribution Engineering Workstation (DEW) (a power flow and short circuit modeling tool) was modified to calculate the real-time characteristics of the distribution network based on the real-time electric distribution network information and provide DER operating suggestions to the Detroit Edison system operators so that regional electric stability is maintained. Part of the suggestion algorithm takes into account the operational availability of DER’s, which is known by the Energy Aggregator, DTE Energy Technologies. The availability information will be exchanged from DTE Energy Technologies to Detroit Edison. For the calculated suggestions to be used by the Detroit Edison operators, procedures were developed to allow an operator to operate a DER by requesting operation of the DER through DTE Energy Technologies. Prior to issuing control of a DER, the safety of the distribution network and personnel needs to be taken into account. This information will be exchanged from Detroit Edison to DTE Energy Technologies. Once it is safe to control the DER, DTE Energy Technologies will issue the control signal. The real-time monitoring of the DECo system will reflect the DER control. Multi-vendor DER technologies’ representing approximately 4 MW of capacity was monitored and controlled using a web-based communication path. The DER technologies included are a photovoltaic system, energy storage, fuel cells and natural gas/diesel internal combustion engine generators. This report documents Phase I result for the Detroit Edison (Utility) led team, which also includes: DTE Energy Technology (DER provider & Aggregator), Electrical Distribution Design (Virginia Tech company supporting DEW); Systems Integration Specialists Company (real-time protocol integrator); and OSIsoft (software system for managing real-time information). This work was performed in anticipation of being selected for Phase II of the Advanced Communication and Control of Distributed Energy Resources project.

Haukur Asgeirsson; Richard Seguin




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Applications in the Nuclear Industry for Thermal Spray Amorphous Metal and Ceramic Coatings  

E-Print Network (OSTI)

Science & Technology 2007, Detroit, MI, Sept. 16– 20, 2007,2007, Sept. 16–20, 2007, Detroit, MI, American CeramicExhib. , Sept. 16–20, 2007, Detroit, MI, American Ceramic

Blink, J.; Farmer, J.; Choi, J.; Saw, C.



Field Demonstration of a 24-kV Warm Dielectric Superconducting Cable at Detroit Edison: FY2003 Annual Progress Report  

Science Conference Proceedings (OSTI)

A project sponsored by EPRI, Pirelli Power Cables and Systems, the Department of Energy, Detroit Edison, and American Superconductor Corporation was initiated in 1998 to install and operate a 24 kV HTS power cable in a Detroit Edison substation to serve customer load. The previous years of activity have focused on design, testing, manufacturing, and installation of the cable system as described in the FY2000 and FY2001 status reports. The FY2002 status report focused on leak detection. The cornerstone of...



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve



P3s Public-Private Partnerships? Or Peripatetic Pain in the Pants  

E-Print Network (OSTI)

--new Detroit River crossing #12;Types of projects (3): new and aging Interstates New routes (tolled): ! Las Crunch ! Miami port tunnel ! Midway ! Problem is debt, not equity ! Infrastructure investment funds. Alternatives: ! Public utility commission ! Concession agreement terms The latter is more flexible. #12;One

Minnesota, University of


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


NREL: Water Power Research - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Access NREL publications on water power research. 1st Advanced Marine Renewable Energy Instrumentation Experts Workshop Report. Driscoll, R.; NREL Report No. MP-5000-51584. 2011 Marine and Hydrokinetic Device Modeling Workshop: Final Report. Li, Y.; NREL Report No. TP-5000-51421; DOE/GO-102011-3374. "Commercialization Path and Challenges for Marine Hydrokinetic Renewable Energy." 2011 IEEE PES (Power and Energy Society) General Meeting: The Electrification of Transportation and the Grid of the Future, 24-28 July 2011, Detroit, Michigan. Piscataway, NJ: Institute of Electrical and Electronics Engineers (IEEE) 8 pp.; NREL Report No. CP-5000-49959. Conventional Hydropower Technologies (Fact Sheet). Wind and Water Power Program (WWPP). (2011). 2 pp.; NREL Report No. FS-5000-52168;



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CORPORATION FOR AN CORPORATION FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS IN SUBJECT INVENTIONS MADE IN THE COURSE OF OR UNDER DEPARTMENT OF ENERGY CONTRACT NO. DE- FC05-970R22581; DOE WAIVER DOCKET W(A)-97-009 [ORO-653] Detroit Diesel Corporation (DDC) has made a timely request for an advance waiver to worldwide rights in Subject Inventions made in the course of or under Department of Energy (DOE) Contract No. DE-FC05-970R22581. The scope of the work calls for the development of advanced materials for low emissions, high efficiency diesel engine components. The work is sponsored by the Office of Transportation Technologies. The dollar amount of the contract is $6,811,639 with DDC cost sharing $3,405,819, or 50% of the contract. DDC is a world leader in the design, development, and production of diesel engines. It has a


Field Demonstration of a 24-kV Superconducting Cable at Detroit Edison  

SciTech Connect

Customer acceptance of high temperature superconducting (HTS) cable technology requires a substantial field demonstration illustrating both the system's technical capabilities and its suitability for installation and operation within the utility environment. In this project, the world's first underground installation of an HTS cable using existing ductwork, a 120 meter demonstration cable circuit was designed and installed between the 24 kV bus distribution bus and a 120 kV-24 kV transformer at Detroit Edison's Frisbie substation. The system incorporated cables, accessories, a refrigeration system, and control instrumentation. Although the system was never put in operation because of problems with leaks in the cryostat, the project significantly advanced the state-of-the-art in the design and implementation of Warm Dielectric cable systems in substation applications. Lessons learned in this project are already being incorporated in several ongoing demonstration projects.

Kelley, Nathan; Corsaro, Pietro



Evaluation of Fish Passage Conditions for Juvenile Salmonids Using Sensor Fish at Detroit Dam, Oregon  

DOE Green Energy (OSTI)

Fish passage conditions through two spillways at Detroit Dam on the North Santiam River in Oregon were evaluated by Pacific Northwest National Laboratory for the U.S. Army Corps of Engineers (USACE), Portland District, using Sensor Fish devices. The objective of the study was to describe and compare passage exposure conditions through Spillbay 3 and Spillbay 6 at 1.5- and 3.5-ft gate openings, identifying potential fish injury regions of the routes. The study was performed in July 2009, concurrent with HI-Z balloon-tag studies by Normandeau Associates, Inc. Sensor Fish and live fish were deployed at elevations approximately 3 ft above structure at depths determined using a computational fluid dynamics model. Data collected were analyzed to estimate 1) exposure conditions, particularly exposure to severe collision and shear events by passage route sub-regions; 2) differences in passage conditions between passage routes; and 3) relationships to live-fish injury and mortality data estimates.

Duncan, Joanne P.



Microsoft Word - Sandalow Detroit National Summit Speech 6-17.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

REMARKS PREPARED FOR DELIVERY REMARKS PREPARED FOR DELIVERY REMARKS OF DAVID SANDALOW ASSISTANT SECRETARY FOR POLICY & INTERNATIONAL AFFAIRS U.S. DEPARTMENT OF ENERGY DETROIT ECONOMIC CLUB NATIONAL SUMMIT JUNE 17, 2009 [Acknowledgements.] It's good to be home in Michigan. I grew up a mile from the Michigan Football Stadium - close enough to hear the roar of the crowd from the front yard when the Wolverines scored. My first job after graduation was at the Michigan Department of Commerce. That was many years ago. In the past several months, my new position with the U.S. Department of Energy has taken me far away - to six countries on three continents. Those trips - often exhausting - have taught me a lot. One constant lesson, which I saw especially clearly last week in Beijing, is


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Air traffic control communication at Detroit Metro Wayne County Airport August 17, 1987  

E-Print Network (OSTI)

This report contains a transcript of radio communications between air traffic controllers and pilots. The transcript was prepared as part of the ATC Interaction Research Project (AIR Project) at the Oregon Graduate Institute, which has been investigating computational representations of air traffic control (ATC) communication. The transcript was made from a tape prepared and narrated by Lawrence L. Porter, a consultant in the field of air traffic control and aircraft accidents. It follows Northwest Airlines Flight 255 as it landed and took off from Detroit Metro Wayne County Airport on August 17, 1987, showing the pilot's interaction with each of the controller positions (Arrival Radar, Local Control, Ground Control, and Clearance Delivery). A copy of this recording on cassette may be obtained by writing to the Department of Computer Science and Engineering of the Oregon Graduate Institute. The authors thank Mr. Porter for providing the recording and narration. The transcript is in two parts. The section entitled "Full Transcript" depicts all exchanges chronologically as they occurred. However, air traffic control dialogue can be viewed as many interleaved yet fairly independent conversations, so in the "Separated Transcripts" section utterances are grouped by aircraft to show the course of each individual conversation. The utterance numbers from the full transcript are preserved in the separated transcripts so that the utterance context may be located easily. The notation and transcription conventions used in these transcripts are described in Appendix A. Appendix B contains charts describing the airspace around Detroit Metro Wayne County Airport.. The utterances in this transcript contain specialized terms and usages specific to the Air Traffic Control (ATC) domain. B...

Karen Ward; David Novick; Carolyn Sousa




E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Detroit Lakes Energy Systems Study: Phase I extension. Final report, August 1, 1978-January 15, 1979. [Biomass for power plant  

DOE Green Energy (OSTI)

An assessment of the resource availability of biomass and the potential of utilization of renewable energy systems in Detroit Lakes, Minnesota is presented. The feasibility of retrofitting the existing power plant to house a biomass energy system is discussed. Survey and evaluation of current off-the-shelf farm implement equipment which can be adapted to the handling of selected biomass materials is presented. Density studies on sunflower stalks, grain straw, and forest residues are included. (DC)

Not Available



"1. Monroe","Coal","Detroit Edison Co",2944 "2. Donald C Cook","Nuclear","Indiana Michigan Power Co",2069  

U.S. Energy Information Administration (EIA) Indexed Site

Michigan" Michigan" "1. Monroe","Coal","Detroit Edison Co",2944 "2. Donald C Cook","Nuclear","Indiana Michigan Power Co",2069 "3. Ludington","Pumped Storage","Consumers Energy Co",1872 "4. Midland Cogeneration Venture","Gas","Midland Cogeneration Venture",1849 "5. Dan E Karn","Coal","Consumers Energy Co",1791 "6. Belle River","Coal","Detroit Edison Co",1518 "7. J H Campbell","Coal","Consumers Energy Co",1451 "8. St Clair","Coal","Detroit Edison Co",1397 "9. Fermi","Nuclear","Detroit Edison Co",1133


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


The Detroit Diesel DELTA Engine for Light Trucks and SUVs - Year 2000 Update  

DOE Green Energy (OSTI)

Detroit Diesel Corporation (DDC) is developing the DELTA 4.0L V6 engine, specifically for the North American light truck market. This market poses unique requirements for a diesel engine, necessitating a clean sheet engine design. DELTA was developed from a clean sheet of paper, with the first engine firing just 228 days later. The process began with a Quality Function Deployment (QFD) analysis, which prioritized the development criteria. The development process integrated a co-located, fully cross-functional team. Suppliers were fully integrated and maintained on-site representation. The first demonstration vehicle moved under its own power 12 weeks after the first engine fired. It was demonstrated to the automotive press 18 days later. DELTA has repeatedly demonstrated its ability to disprove historical North American diesel perceptions and compete directly with gasoline engines. This paper outlines the Generation 0.0 development process and briefly defines the engine. A brief indication of the Generation 0.5 development status is given.

Nabil S. Hakim; Charles E. Freese; Stanley P. Miller



Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mäkinen; Jorma Tarhio



Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Transfac 2009: Home Page  

Science Conference Proceedings (OSTI)

TRANSFAC 2009 • OCT. 31 - NOV. 3, 2009 • DETROIT, MI • USA ... and Materials (KIM), Metsoc Metallurgical Society of CIM, ASM International Detroit Chaper ...


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...


Wildlife and Wildlife Habitat Loss Assessment at Detroit Big Cliff Dam and Reservoir Project, North Santiam River, Oregon, 1985 Final Report.  

DOE Green Energy (OSTI)

A habitat based assessment was conducted of the US Army Corps of Engineers' Detroit/Big Cliff Dam and Reservoir Project (Detroit Project) on the North Santiam River, Oregon, to determine losses or gains resulting from the development and operation of the hydroelectric-related components of the project. Preconstruction, postconstruction, and recent vegetation cover types at the project site were mapped based on aerial photographs from 1939, 1956, and 1979, respectively. Vegetation cover types were identified within the affected area and acreages of each type at each time period were determined. Ten wildlife target species were selected to represent a cross-section of species groups affected by the project. An interagency team evaluated the suitability of the habitat to support the target species at each time period. An evaluation procedure which accounted for both the quantity and quality of habitat was used to aid in assessing impacts resulting from the project. The Detroit Project extensively altered or affected 6324 acres of land and river in the North Santiam River drainage. Impacts to wildlife centered around the loss of 1,608 acres of conifer forest and 620 acres of riparian habitat. Impacts resulting from the Detroit Project included the loss of winter range for black-tailed deer and Roosevelt elk, and the loss of year-round habitat for deer, river otter, beaver, ruffed grouse, pileated woodpecker, spotted owl, and many other wildlife species. Bald eagle and osprey were benefited by an increase in foraging habitat. The potential of the affected area to support wildlife was greatly altered as a result of the Detroit Project. Losses or gains in the potential of the habitat to support wildlife will exist over the life of the project.

Noyes, J.H.



Hydroacoustic Evaluation of Juvenile Salmonid Passage and Distribution at Detroit Dam, 2011  

Science Conference Proceedings (OSTI)

Pacific Northwest National Laboratory evaluated juvenile salmonid passage and distribution at Detroit Dam (DET) on the North Santiam River, Oregon for the U.S. Army Corps of Engineers (USACE) to provide data to support decisions on long-term measures to enhance downstream passage at DET and others dams in USACE’s Willamette Valley Project. This study was conducted in response to regulatory requirements necessitated by the listing of Upper Willamette River Spring Chinook salmon (Oncorhynchus tshawytscha) and Upper Willamette River steelhead (O. mykiss) as threatened under the Endangered Species Act. The goal of the study was to provide information of juvenile salmonid passage and distribution at DET from February 2011 through February 2012. The results of the hydroacoustic study provide new and, in some cases, first-ever data on passage estimates, run timing, distributions, and relationships between fish passage and environmental variables at the dam. This information will inform management decisions on the design and development of surface passage and collection devices to help restore Chinook salmon populations in the North Santiam River watershed above DET. During the entire study period, an estimated total of 182,526 smolt-size fish (±4,660 fish, 95% CI) passed through turbine penstock intakes. Run timing peaked in winter and early spring months. Passage rates were highest during late fall, winter and early spring months and low during summer. Horizontal distribution for hours when both turbine units were operated simultaneously indicated Unit 2 passed almost twice as much fish as Unit 1. Diel distribution for smolt-size fish during the study period was fairly uniform, indicating fish were passing the turbines at all times of the day. A total of 5,083 smolt-size fish (± 312 fish, 95% CI) were estimated passed via the spillway when it was open between June 23 and September 27, 2011. Daily passage was low at the spillway during the June-August period, and increased somewhat in September 2011. When the spillway was operated simultaneously with the turbines, spillway efficiency (efficiency is estimated as spillway passage divided by total project passage) was 0.72 and effectiveness (fish:flow ratio—proportion fish passage at a route (e.g., spillway) divided by proportion water through that route out of the total project) was 2.69. That is, when the spillway was open, 72% of the fish passing the dam used the spillway and 28% passed into the turbine penstocks. Diel distribution for smolt-size fish at the spillway shows a distinct peak in passage between mid-morning and mid-afternoon and low passage at night. We estimated that 23,339 smolt-size fish (± 572 fish, 95% CI) passed via the Regulating Outlet (RO) when it was open from October 29 through November 12, 2011, January 2-6, and January 20 through February 3, 2012. During the October–November period, RO passage peaked at 1,086 fish on November 5, with a second peak on November 7 (1,075 fish). When the RO was operated simultaneously with the turbines, RO efficiency was 0.33 and effectiveness was 0.89. In multiple regression analyses, a relatively parsimonious model was selected that predicted the observed fish passage data well. The best model included forebay temperature at depth, forebay elevation, total discharge, hours of daylight, and the operation period. The vertical distribution of fish in the forebay near the face of the dam where the transducers sampled showed fish were generally distributed throughout the water column during all four operational periods. During the refill and full pool periods, vertical distribution was bi-modal with surface-layer and mid-water modes. Patterns for day and night distributions were variable. Fish were distributed above and below the thermocline when it was present (full pool and drawdown periods).

Khan, Fenton; Royer, Ida M.; Johnson, Gary E.; Ham, Kenneth D.



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Reducing the Environmental Footprint and Economic Costs of Automotive Manufacturing through an Alternative Energy Supply  

E-Print Network (OSTI)

in urban areas like the Detroit region. In such a situation,energy supply based on in Detroit, MI, region in the Unitedsupply figures for the Detroit region where much of the U.S.

Yuan, Chris; Dornfeld, David




E-Print Network (OSTI)

explored the theme of "ruin porn" as it is applied to declining cities, such as Detroit. This idea argued

Young, Paul Thomas

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Deputy Secretary Poneman Tours Minority-Owned Small Business Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in Detroit Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in Detroit May 22, 2012 - 10:37am Addthis Deputy Secretary of Energy Daniel Poneman meets with owners and workers at Diversified Chemical Technologies, a small business in Detroit, MI. | Energy Department photo Deputy Secretary of Energy Daniel Poneman meets with owners and workers at Diversified Chemical Technologies, a small business in Detroit, MI. | Energy Department photo Bill Gibbons Deputy Press Secretary, Office of Public Affairs What does this mean for me? During National Small Business Week, Energy Department leaders are visiting small businesses across the country as a renewed promise to help their businesses grow, hire and succeed.


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Determining the Appropriate Package and Transportation Methodology for the Detroit Edison, Fermi II Msrs and Associated Components  

SciTech Connect

During the spring of 2005, Detroit Edison, Enrico Fermi II Nuclear Power Station (Fermi) decided to disposition two MSRs and associated components scheduled for replacement in the spring of 2006 during the MSR Replacement Outage. Of concern to Fermi was the proper packaging and transportation methodology when dis-positioning a component measuring approximately 110' in length and 13' in diameter and weighing over 300 tons. Upon removal from the Turbine Deck the retired MSRs and associated components were turned over to the Rad Waste Group for packaging and final disposition. Fermi requested quotations from vendors to package, transport, and disposition the MSRs and associated components. However, multiple Vendors informed Fermi that the size and weight of the MSRs were questionable in passing permitting requirements and would require segmentation and volume reduction on site or at a waste processor. Fermi contracted with MHF Logistical Solutions (MHF-LS) based on their ability to receive clearances for shipping the MSRs in one piece via two heavy haul rail conveyances acting as a bolstered load with professionally engineered blocking and bracing configured to support the retired MSRs. (authors)

Weber, B. [Detroit Edison Company/Enrico Fermi II Nuclear Power Station, Newport, MI (United States); Dempsey, S. [MHF Logistical Solutions, Oak Ridge, TN (United States)



DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


Preserving the U.S. Underground and Alternative Press of the 1960s and '70s: History, Prospects, and Microform Sources  

E-Print Network (OSTI)

Reporter, Washington, DC, 1985- , UMI Navajo Times, WindowWashington, DC Native Sun, Detroit, MI Navajo Times, Window

Tsang, Daniel C



REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



CDF/PUB/EXOTIC/PUBLIC/8887, FERMILAB-PUB-07-567-E, SCIPP 07/15 Search for Standard Model Higgs Bosons Produced in  

E-Print Network (OSTI)

Wayne State University, Detroit, Michigan 48201 58 University of Wisconsin, Madison, Wisconsin 53706 59

California at Santa Cruz, University of


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Characterization of Fish Passage Conditions through a Francis Turbine, Spillway, and Regulating Outlet at Detroit Dam, Oregon, Using Sensor Fish, 2009  

Science Conference Proceedings (OSTI)

Fish passage conditions through two spillways, a Francis turbine, and a regulating outlet (RO) at Detroit Dam on the North Santiam River in Oregon were evaluated by Pacific Northwest National Laboratory for the U.S. Army Corps of Engineers (USACE), Portland District, using Sensor Fish devices. The objective of the study was to describe and compare passage exposure conditions, identifying potential fish injury regions within the routes. The study was performed in July, October, and December 2009 concurrent with HI-Z balloon-tag studies by Normandeau Associates, Inc. Sensor Fish data were analyzed to estimate 1) exposure conditions, particularly exposure to severe strike, collision, and shear events by passage route sub-regions; 2) differences in passage conditions between passage routes; and 3) relationships to live-fish injury and mortality data estimates. Comparison of the three passage routes evaluated at Detroit Dam indicates that the RO passage route through the 5-ft gate opening was relatively the safest route for fish passage under the operating conditions tested; turbine passage was the most deleterious. These observations were supported also by the survival and malady estimates obtained from live-fish testing. Injury rates were highest for turbine and spillway passage. However, none of the passage routes tested is safe for juvenile salmonid passage.

Duncan, Joanne P.; Carlson, Thomas J.



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Publications Portal  

Science Conference Proceedings (OSTI)

Publications Portal. ... a mention of the concept of electronic books, or ebooks. ... http://www.nist.gov/manuscript-publication-search.cfm?pub_id=151477 ...


Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Darshan » Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications June 18th, 2013 Publications from the Darshan team: Argonne Leadership Computing Facility, "ALCF IO Data Repository", Technical Memorandum ANLALCFTM-131, Argonne...


NETL: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Technology Reference Shelves Oil & Natural Gas Supply Coal & Power Systems Carbon Storage Hydrogen & Clean Fuels Accomplishment Reports Brochures All...


History Publications  

Energy.gov (U.S. Department of Energy (DOE))

List of historical publications available through the Department's History Office, including free PDF versions.


The potential impacts of a competitive wholesale market in the midwest: A preliminary examination of centralized dispatch  

E-Print Network (OSTI)

City WL&P-Springfield Detroit Edison Company Duke EnergyIndiana Public Service Co. Detroit Edison Company debtIndiana Public Service Co. Detroit Edison Company OPF System

Lesieutre, Bernard C.; Bartholomew, Emily; Eto, Joseph H.; Hale, Douglas; Luong, Thanh



The potential impacts of a competitive wholesale market in the midwest: A preliminary examination of centralized dispatch  

E-Print Network (OSTI)

WL&P-Springfield Detroit Edison Company Duke Energy FirstPublic Service Co. Detroit Edison Company debt service) thatPublic Service Co. Detroit Edison Company OPF System Cost (

Lesieutre, Bernard C.; Bartholomew, Emily; Eto, Joseph H.; Hale, Douglas; Luong, Thanh



Analysis of operational, institutional and international limitations for alternative fuel vehicles and technologies: Means/methods for implementing changes. [Public fleet groups--information needs  

DOE Green Energy (OSTI)

This project focused upon the development of an approach to assist public fleet managers in evaluating the characteristics and availability of alternative fuels (AF's) and alternative fuel vehicles (AFV's) that will serve as possible replacements for vehicles currently serving the needs of various public entities. Also of concern were the institutional/international limitations for alternative fuels and alternative fuel vehicles. The City of Detroit and other public agencies in the Detroit area were the particular focus for the activities. As the development and initial stages of use of alternative fuels and alternative fuel vehicles proceeds, there will be an increasing need to provide information and guidance to decision-makers regarding differences in requirements and features of these fuels and vehicles. There wig be true differences in requirements for servicing, managing, and regulating. There will also be misunderstanding and misperception. There have been volumes of data collected on AFV'S, and as technology is improved, new data is constantly added. There are not, however, condensed and effective sources of information for public vehicle fleet managers on vehicle and equipment sources, characteristics, performance, costs, and environmental benefits. While theoretical modeling of public fleet requirements has been done, there do not seem to be readily available practical''. There is a need to provide the best possible information and means to minimize the problems for introducing the effective use of alternative fuels and alternative fuel vehicles.

Not Available



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Publications Portal  

Science Conference Proceedings (OSTI)

... Many proposed computational platforms are dri ... http://www.nist.gov/ manuscript-publication-search.cfm?pub_id=901100 413. ...



2012 Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

2Publications 2Publications Sign In Launch the Developer Dashboard SLAC National Accelerator Laboratory DOE | Stanford | SLAC | SSRL | LCLS | AD | PPA | Photon Science | PULSE | SIMES LCLS : Linac Coherent Light Source An Office of Science User Facility Search this site... Search Help (new window) Top Link Bar LCLS Lasers Expand Lasers LCLS Quick Launch Home About LCLS Expand About LCLS LCLS News Expand LCLS News User Resources Expand User Resources Instruments Expand Instruments Proposals Publications Expand Publications Schedules Machine Status Machine FAQs Safety Organization Expand Organization Directories Expand Directories Staff Resources Contact Us All Site Content Department of Energy Page Content 2012 Publications 2013 | 2012 | 2011 | 2010 | 2009 | Archive | Citations | Statistics


2010 Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

0Publications 0Publications Sign In Launch the Developer Dashboard SLAC National Accelerator Laboratory DOE | Stanford | SLAC | SSRL | LCLS | AD | PPA | Photon Science | PULSE | SIMES LCLS : Linac Coherent Light Source An Office of Science User Facility Search this site... Search Help (new window) Top Link Bar LCLS Lasers Expand Lasers LCLS Quick Launch Home About LCLS Expand About LCLS LCLS News Expand LCLS News User Resources Expand User Resources Instruments Expand Instruments Proposals Publications Expand Publications Schedules Machine Status Machine FAQs Safety Organization Expand Organization Directories Expand Directories Staff Resources Contact Us All Site Content Department of Energy Page Content 2010 Publications 2013 | 2012 | 2011 | 2010 | 2009 | Archive | Citations | Statistics


Archived Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

ArchivedPublications ArchivedPublications Sign In Launch the Developer Dashboard SLAC National Accelerator Laboratory DOE | Stanford | SLAC | SSRL | LCLS | AD | PPA | Photon Science | PULSE | SIMES LCLS : Linac Coherent Light Source An Office of Science User Facility Search this site... Search Help (new window) Top Link Bar LCLS Lasers Expand Lasers LCLS Quick Launch Home About LCLS Expand About LCLS LCLS News Expand LCLS News User Resources Expand User Resources Instruments Expand Instruments Proposals Publications Expand Publications Schedules Machine Status Machine FAQs Safety Organization Expand Organization Directories Expand Directories Staff Resources Contact Us All Site Content Department of Energy Page Content Archived Publications 2013 | 2012 | 2011 | 2010 | 2009 | Archive | Citations | Statistics


Publications Alphabetically  

NLE Websites -- All DOE Office Websites (Extended Search)

Alphabetically Alphabetically Recently Posted Overview Report: Project to date through September 2013 Nissan Leaf Vehicle Summary Report: July - September 2013 Chevrolet Volt Vehicle Summary Report: July - September 2013 Electric Vehicle Charging Infrastructure Summary Report: July - September 2013 Blink Charging Units Map - Project to date through September 2013 Nissan Leafs and Chevrolet Volts Map - Project to date through September 2013 DOE U.S. Drive All Tech Teams Meeting (SLIDES) Troy, MI - December 2013 IWC - Testing Results: PLUGLESS Wireless Charging System by Evatran Group Inc. (SLIDES) Franklin, TN - December 2013 2011 Honda CRZ (2982) Fleet Testing Results to Date 2011 Honda CRZ (4466) Fleet Testing Results to Date 2011 Honda CRZ (2982) Fact Sheet 2011 Honda CRZ (4466) Fact Sheet


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Publications Portal  

Science Conference Proceedings (OSTI)

... Growing public concern over air quality has led ... Distillation Curve Analysis of Biodiesel Fuels: Assessment ... Method Part 4: Alcohols, Aldehydes, and ...



WBM Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

CMS Web Based Monitoring Publications CHEP 2012 Presenter: Irakli Chakaberia Title: New Developments in Web Based Monitoring at the CMS Experiment Authors: William Badgett, Irakli...


Publications Portal  

Science Conference Proceedings (OSTI)

... http://www.nist.gov/manuscript-publication-search.cfm?pub_id=912942 72. Fire Tests of Amtrak Passenger Rail Vehicle Interiors. Final Report. ...



MSID Publications  

Science Conference Proceedings (OSTI)

... Publication date: June 1993. Citation: Don Libes: "A Debugger for Tcl Applications," Proceedings of the 1993 Tcl/Tk Conference, June, 1993. ...


Publications Portal  

Science Conference Proceedings (OSTI)

... GLUT/Tk: Open GL with Tcl/Tk Series: Special Publication (NIST SP) Report Number: 500-253 Published: 5/1/2003 Author: Joseph Konczal Abstract ...


Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Publications Portal  

Science Conference Proceedings (OSTI)

... GLUT/Tk: Open GL with Tcl/Tk Series: Special Publication (NIST SP) Report Number: 500-253 Topic: Information Technology Published: 5/1/2002 ...



Publications Portal  

Science Conference Proceedings (OSTI)

... Answering Track Series: Special Publication (NIST SP) Topic: Information Delivery Systems Published: 11/5/2008 Authors: Hoa Trang Dang, Jimmy ...



Publications Portal  

Science Conference Proceedings (OSTI)

... Olthoff Abstract: This volume deals with the basic knowledge and ... manuscript- publication-search.cfm?pub_id=31439 2. Electricity Division Programs ...



Publications Portal  

Science Conference Proceedings (OSTI)

... publication-search.cfm?pub_id=10539 3. 10 Volt Programmable Josephson voltage standard circuits using NbSi-barrier junctions Topic: Quantum ...



Publications Portal  

Science Conference Proceedings (OSTI)

... www.nist.gov/manuscript-publication-search.cfm?pub_id=100199 4. Statistical Correlation of Spectroscopic Analysis of Poplar Samples Published ...



Geothermal: Publications  

Office of Scientific and Technical Information (OSTI)

GEOTHERMAL TECHNOLOGIES LEGACY COLLECTION - Publications Geothermal Technologies Legacy Collection HelpFAQ | Site Map | Contact Us | Admin Log On HomeBasic Search About...


Publications Portal  

Science Conference Proceedings (OSTI)

... http://www.nist.gov/manuscript-publication-search.cfm?pub_id=911090 2. Early LNG Program and LN2 Cryogenic Flow Measurement Facility at ...



MSID Publications  

Science Conference Proceedings (OSTI)

... Publication summary. Author(s): G. Thomas, G. Thompson, C. Chung, Edward Barkmeyer, F. Carter, M. Templeton, S. Fox and B. Hartman. ...


Publications Portal  

Science Conference Proceedings (OSTI)

... gov/manuscript-publication-search.cfm?pub_id=831316 6. Distribution and Retention of ^u137^Cs in Sediments at the Hanford Site, Washington ...



ARM - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Lidar Technologies, Techniques, and Measurements for Atmospheric Remote Sensing VIII, : SPIE - The International Society for Optical Engineering. Read more Publication Notice: 3...


Publications Portal  

Science Conference Proceedings (OSTI)

... The MOSS project sought to reduce transi ... ... nist.gov/manuscript-publication- search.cfm?pub_id=911880 6. AP210 Edition 2 Concept of Operations ...



Public Outreach  

NLE Websites -- All DOE Office Websites (Extended Search)

58 9 Executive Summary This manual represents a distillation of best practices for public outreach and education to support carbon dioxide (CO 2...


Public Process  

NLE Websites -- All DOE Office Websites (Extended Search)

AGENCY: Department of Energy. 10 CFR Part 903 Procedures for Public Participation in Power and Transmission Rate Adjustments and Extensions 50 FR 37835 September 18, 1985...


Publications Portal  

Science Conference Proceedings (OSTI)

... The method is based on iter ... http://www.nist.gov/manuscript-publication-search. cfm?pub_id=901466 89. ... The method is based on iter ... ...



Publications Portal  

Science Conference Proceedings (OSTI)

... publication-search.cfm?pub_id=901284 6. Certification of Selected Polynuclear Aromatic Hydrocarbons in SRM l580, "Organics in Shale Oil" Topic ...



Category:SecondarySchool | Open Energy Information  

Open Energy Info (EERE)

IA MidAmerican Energy Co (Iowa).png SVSecondarySchool Des ... 68 KB SVSecondarySchool Detroit MI Detroit Edison Co.png SVSecondarySchool Detr... 66 KB SVSecondarySchool El Paso TX...


Residential segregation and health behavior among Black adults  

E-Print Network (OSTI)

of supermarkets in metropolitan Detroit. Am J Public Health,determinants of health in Detroit. The Millbank Quarterly,86.7% of the Blacks in Detroit, 83.6% of the Blacks in

Corral, Irma



PNNL: Publication Details  

NLE Websites -- All DOE Office Websites (Extended Search)

we cannot locate that Publication. Please try the Publications Database for other PNNL Publications. Powered By ERICA, PNNL's publication metadatabase Publications Search...


USGCRP Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

USGCRP Publications Print E-mail USGCRP Publications Print E-mail The U.S. Global Change Research Program (USGCRP) delivers a variety of publications that highlight scientific advances pertaining to global change. In addition to detailing scientific progress, USGCRP products illustrate the impacts of global change and highlight the Nation's response to these changes. As mandated by Congress, the USGCRP produces regular assessments of global change and annual reports showcasing the Program's progress in achieving its annual goals. Below are some descriptions of recent USGCRP publications. Scientific Assessments According to the scientific assessments are evaluation and consensus building processes for establishing an integrated view of recent scientific breakthroughs and providing policy-relevant information to decision makers.


Public Activities  

NLE Websites -- All DOE Office Websites (Extended Search)

publicactivities_header.jpg publicactivities_header.jpg Public Activities Citizens are encouraged to learn about the Department of Energy's programs through a variety of activities that are open to the public. Our goal is to educate citizens and seek their meaningful involvement. If you are visiting the area, the American Museum of Science and Energy in Oak Ridge is the best starting point for exhibits and information about DOE programs in science, environmental management, nuclear fuel supply, and national security. Tours are conducted of the Oak Ridge National Laboratory, Y-12 National Security Complex and East Tennessee Technology Park during the summer months departing from the Museum. For those with more specific interests in our programs, each month we publish a calendar of public involvement activities, which identifies announcements, comment periods and public meetings of potential interest. Our Environmental Management Program has a Site Specific Advisory Board composed of area citizens who meet the second Wednesday of each month.

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


TAO: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Referencing TAO Impact Who We Are Acknowledgements License Contact Us Papers TAO 2.0 Users Manual, T. Munson, J. Sarich, Stefan M. Wild, S. Benson, and L....


Publications Search  

NLE Websites -- All DOE Office Websites (Extended Search)

Search Search for publications of the Windows and Daylighting Group by title, author, journal, or keywords: Search for: Start Search Clear If the search doesn't produce the desired...


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Old Publication Portal  

Science Conference Proceedings (OSTI)

Publications Portal. This publications database includes many of the most recent publications of the National Institute of ...



Select Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Dosanjh » Select Dosanjh » Select Publications Select Publications Sort by: Date | Author | Type 2013 Richard A. Barrett, Shekhar Borkar, Sudip S. Dosanjh, Simon D. Hammond, Michael A. Heroux, X. Sharon Hu, Justin Luitjens, Steven G. Parker, John Shalf, Li Tang, "On the Role of Co-design in High Performance Computing", Transition of HPC Towards Exascale Computing, E.H. D'Hollander et. al (Eds.), IOS Press, 2013, ( November 1, 2013) Download File: Codesign-Paper.pdf (pdf: 867 KB) Rolf Riesen, Sudip Dosanjh, Larry Kaplan, "The ExaChallenge Symposium", IBM Research Paper, August 26, 2013, Download File: ExaChallenge2012.pdf (pdf: 1.4 MB) S. Dosanjh, R. Barrett, D. Doerfler, S. Hammond, K. Hemmert, M. Heroux, P. Lin, K. Pedretti, A. Rodrigues, T. Trucano, J.Juitjens, "Exascale Design


Public Meeting  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Summary Minutes of the U.S. Department of Energy (DOE) Secretary of Energy Advisory Board (SEAB) Public Meeting November 14, 2011 Committee Members: William Perry, Chair; Norm Augustine; Ralph Cicerone; John Deutch, Nick Donofrio; Chad Holliday; Michael McQuade; Matt Rogers; Art Rosenfeld; Steven Westly Date and Time: 2:00PM - 2:45PM, November 14, 2011 Location: Teleconference Purpose: Meeting of the Secretary of Energy Advisory Board SEAB Staff: Alyssa Morrissey, Designated Federal Officer for the SEAB Committee Renee Stone, Designated Federal Officer for the Shale Gas Subcommittee Meeting Summary SEAB Members convened by teleconference to discuss the Second 90-Day Report of the Shale Gas Subcommittee. John Deutch gave an overview of the report, which was followed by a public comment


Publications - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Alternative Power & Energy Conversion Emissions & Emission Controls Engine Combustion & Efficiency Fuels Technology Vehicle Research Miscellaneous Alternative Power & Energy Conversion Z. Gao, The Impact of TXV Heating on the Performance of Air-Source Heat Pumps in Heating Mode, submitted to Energy Conversion and Management (Journal). Emissions & Emission Controls T.J. Toops, N.A. Ottinger, C. Liang, J.A. Pihl, A. Payzant, "Impact of lattice substitution in Ba-based NOx storage reduction catalysts on sulfation, desulfation and NOx reduction performance", Catalysis Today 160:1 (2011) 131. T.J. Toops, M.P. Brady, P.F. Tortorelli, J.A. Pihl, F. Estevez, D. Connors, F. Garzon, T. Rockward, D. Gervasio, W. Mylan and S.H. Kosaraju, "Pre-Oxidized and Nitrided Stainless Steel Alloy Foil for Proton Exchange Membrane Fuel Cell Bipolar Plates: Part 2- Single-Cell Fuel Cell Evaluation of Stamped Plates", Journal of Power Sources 195:17 (2010) 5619.


NDB Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Papers from the NDB Project supported in total or in part by the NDB grants (in reverse chronological order) S. Neidle, B. Schneider, H. M. Berman. (2009). Chapter 3 Fundamentals of DNA and RNA structure. In Structural Bioinformatics, Second Edition (P. E. Bourne & J. Gu, eds.). John Wiley & Sons, Inc., Hoboken, NJ. B. Schneider, J. D. L. Cruz, Z. Feng, L. Chen, S. Dutta, I. Persikova, J. D. Westbrook, H. Yang, J. Young, C. Zardecki, H. M. Berman. (2009). Chapter 12 The Nucleic Acid Database. In Structural Bioinformatics, Second Edition (J. Gu & P. E. Bourne, eds.), pp. 305-319. John Wiley & Sons, Inc., Hoboken, NJ. B. Schneider, H. M. Berman. (2006). Basics of Nucleic Acid Structure. Concepts, Tools, and Archives. In Computational approaches to


1 Introduction  

E-Print Network (OSTI)

1Department of Mathematics, Wayne State University, Detroit, MI 48202 (boris@ math.wayne.edu). Research of this author was partly supported by the National ...


1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202, USA; email: boris@math.wayne.edu. Research of this author was also partly supported  ...


Approximate Maximum Principle for Discrete Approximations of ...  

E-Print Network (OSTI)

Detroit, MI 48202. Email: boris@math.wayne.edu. ILYA SHVARTSMAN. Department of Mathematics and Computer Science. Penn State University - Harrisburg.


Hölder Metric Subregularity with Applications to Proximal Point Method  

E-Print Network (OSTI)

Feb 2, 2012 ... ‡Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. Email: boris@math.wayne.edu. Research of this author was also ...


1 Introduction  

E-Print Network (OSTI)

Strategic Reference Framework under grant PTDC/MAT/111809/2009. 3Doctoral Student, Department of Mathematics, Wayne State University, Detroit, MI 48202 ...



U.S. Energy Information Administration (EIA)

... , "Detroit, MI",, ,Coking,Steam 2000,61542,1142280 2005,177414,8456023 2010,160896,6187802 Jan-Aug 2011,9323,1227071 ,, "Mobile, AL", ...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DTE Energy PMCPVT FY2012Appx. 11 months Rondle Harp Detroit, MI GM Battery Pack Assembly Plant - Electric Substation Upgrade General business actions to support the EDV battery...


1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202, USA; email: boris@math.wayne.edu. Research of this author was also partially ...



Science Conference Proceedings (OSTI)

Room: 330A. Session Chairperson: J.E. Benci, Wayne State University, Dept. of Materials Science and Engineering, Detroit, MI 48202 ...



U.S. Energy Information Administration (EIA)

... is through August, the latest data available",,,,, ,"Norfolk, VA","Baltimore, MD","Mobile, AL","New Orleans, LA","Detroit, MI","Seattle, ...

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202 (boris@ math.wayne.edu). Re- search of this author was also partly supported by the ...


New Fractional Error Bounds for Nonconvex Polynomial Systems ...  

E-Print Network (OSTI)

Jan 7, 2013 ... †Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. Email: boris@math.wayne.edu. Re- search of this author was ...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- Clean Energy Coalition Michigan Green Fleets Improvements andor upgrades to existing CNG refueling station in Detroit, MI. This CX form is for one location in this project...


Individual Particle-Analysis of Ambient PM2.5 Using Advanced...  

NLE Websites -- All DOE Office Websites (Extended Search)

communities near southwestern Detroit, MI (close to multiple combustion sources including motor vehiclediesel, incinerators, and oil and coal combustion sources) and Steubenville,...


Materials for Transportation Applications: Selected Proceedings ...  

Science Conference Proceedings (OSTI)

Sep 16, 2007 ... A collection of papers from MS&T'07 held in Detroit, MI, September 16-20, 2007, covering topics related to Materials for Transportation ...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PVTD 2009 S. Richardson 102009 - 122013 Detroit, MI Installation of Retail Biofuel Infrastructure Supporting I-75 Green Corridor Project Install retail biofuel fueling...


NETL: Mercury Emissions Control Technologies - Pilot Testing...  

NLE Websites -- All DOE Office Websites (Extended Search)

Utilities, ND; Detroit Edison, MI; and SaskPower, Canada. Contacts: For further information on this project, contact NETL Project Manager, Barbara Carney or Alan Bland from WRI...


1 Introduction  

E-Print Network (OSTI)

cal/bilevel structures, stochastic programming with applications to electricity spot market. 1Department of Mathematics, Wayne State University, Detroit, MI 48202 ...



U.S. Energy Information Administration (EIA)

SEPT02MI 1. Monroe Coal Detroit Edison Co 2. Donald C Cook Nuclear Indiana Michigan Power Co 3. Ludington Pumped Storage Consumers Energy Co 4. ...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Upgrade Compressed Natural Gas Facility at existing station located in Detroit, MI. This CX form is for one location in this project selected under Clean Cities FOA...


Public Safety Communications  

Science Conference Proceedings (OSTI)

Public Safety Communication. Summary: ... the development of quantitative requirements for public safety communications. ...



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Reactor & Nuclear Systems Publications | ORNL  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications and Reports NSED Monthly Reports Reactor and Nuclear Systems Publications 2013 Publications 2012 Publications 2011 Publications 2010 and Older Publications Nuclear...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6.html[2/3/2012 12:44:00 PM] 6.html[2/3/2012 12:44:00 PM] PUBLIC SUBMISSION As of: February 03, 2012 Received: January 19, 2012 Status: Pending_Post Tracking No. 80f9b24f Comments Due: January 20, 2012 Submission Type: Web Docket: DOE-HQ-2012-0004 U.S. Department of Energy Audit Guidance: For-Profit Recipients Comment On: DOE-HQ-2012-0004-0001 Audit Guidance: For-Profit Recipients Document: DOE-HQ-2012-0004-DRAFT-0006 Comment on FR Doc # 2011-32622 Submitter Information Name: Eric Russell Address: 836 Thurber Drive West Apt 1 Columbus, Ohio, 43215 Email: ejrussell02@yahoo.com Phone: 615-972-9984 General Comment See attached file(s) Attachments Response to DOE For Profit Audit Federal Register Notice Response to U.S. Department of Energy Request for Information Federal Register Notice 2011-32622


Public Meeting  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Summary Minutes of the Summary Minutes of the U.S. Department of Energy (DOE) Secretary of Energy Advisory Board (SEAB) Public Meeting July 19, 2012 Committee Members: William Perry, Chair; Norm Augustine; Ralph Cicerone; Nick Donofrio; Michael McQuade; Matt Rogers; Art Rosenfeld; Sue Tierney; Steven Westly; Daniel Yergin Date and Time: 3:00PM - 4:30PM, July 19, 2012 Location: Teleconference Purpose: Meeting of the Secretary of Energy Advisory Board SEAB Staff: Amy Bodette, Designated Federal Officer Alyssa Morrissey, Deputy Designated Federal Officer Meeting Summary SEAB Members convened by teleconference to hear updates from the Building Efficiency and Small Modular Reactor (SMR) Subcommittees. After the Subcommittee reports and questions from the full


City of Detroit - SmartBuildings Detroit Grant Program | Open...  

Open Energy Info (EERE)

insulation, glazing treatments, windows, doors, weatherstripping, insulated roofs, solar panels, geothermal installations, wind, hydroelectric, thermal load reduction, HVAC,...


ARM - Publications: Science Team Meeting Documents: Publication...  

NLE Websites -- All DOE Office Websites (Extended Search)

Publication Trends of ARM Research Troyan, David Brookhaven National Laboratory This study summarizes the publication record of ARM research. Items of all types listed in the ARM...


Find LANL Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Communication Alerts Bibliographic Management Copyright Open Access How to Find LANL Publications Find LANL Publications1354608000000Find LANL PublicationsSome of these...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2-2012%2010-10-11-600/Document%20List%2003-02-2012%2010-10-11-600_docs/Martin%20WeblerCover_DRAFT-0004.html[2/3/2012 12:40:30 PM] 2-2012%2010-10-11-600/Document%20List%2003-02-2012%2010-10-11-600_docs/Martin%20WeblerCover_DRAFT-0004.html[2/3/2012 12:40:30 PM] PUBLIC SUBMISSION As of: February 03, 2012 Received: January 05, 2012 Status: Pending_Post Tracking No. 80f8e384 Comments Due: January 20, 2012 Submission Type: Web Docket: DOE-HQ-2012-0004 U.S. Department of Energy Audit Guidance: For-Profit Recipients Comment On: DOE-HQ-2012-0004-0001 Audit Guidance: For-Profit Recipients Document: DOE-HQ-2012-0004-DRAFT-0004 Comment on FR Doc # 2011-32622 Submitter Information Name: Martin Webler Address: 866 Macarthur Dr 866 Macarthur Dr Pittsburgh, PA, 15228 General Comment In working with the "316 Audits" over the past year, I noted some general improvements in the guidance that would help clarify things for the auditor, the recipients and DOE personnel. I hope you


TMS Publications Home  

Science Conference Proceedings (OSTI)

TMS Publications Home. TMS publishes numerous journals, conference proceedings volumes, textbooks, and other print and electronic publications designed ...

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


NIST Publications Policy  

Science Conference Proceedings (OSTI)

... NIST Technical Publication Policy. All technical ... authors. NIST requires all scientific publications to be of high technical quality. In ...


Michigan Public Service Commission | Open Energy Information  

Open Energy Info (EERE)

Commission Commission Jump to: navigation, search State Michigan Name Michigan Public Service Commission Address 6545 Mercantile Way, Suite 7 City, State Lansing, MI Zip 48911 Website http://www.michigan.gov/mpsc/ Coordinates 42.663692°, -84.535225° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.663692,"lon":-84.535225,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



ARM - Public Information Materials  

NLE Websites -- All DOE Office Websites (Extended Search)

govPublicationsPublic Information Materials govPublicationsPublic Information Materials Publications Journal Articles Conference Documents Program Documents Technical Reports Publications Database Public Information Materials Image Library Videos Publication Resources Submit a Publication Publishing Procedures ARM Style Guide (PDF, 448KB) Acronyms Glossary Logos Contacts RSS for Publications Public Information Materials The ARM Climate Research Facility develops public information materials to communicate the purpose and objectives of the program to general audiences. These materials are designed to increase awareness of ARM Climate Research Facility goals and to document its scientific results to a lay audience. Public information materials include fact sheets, brochures, CDs, videos, press releases, and information packets. Approved materials are made


Geothermal: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Sorted By: Relevance, Descending Results: 1-25 of exactly 18776 matches. Sort Results By: Relevance Publication Date System Entry Date Document Type Title Research Org Sponsoring Org OSTI Identifier Report Number DOE Contract Number Ascending Descending Go Show: Make a Selection OSTI ID Report Number DOE Contract No Other Identifier No Document Type Research Org Sponsoring Org Subject Publisher Country Language Availability Entry Date Keywords Go Page 1 of 400 Next » Go to Page: 1 of 400 2 of 400 3 of 400 4 of 400 5 of 400 6 of 400 7 of 400 8 of 400 9 of 400 10 of 400 11 of 400 12 of 400 13 of 400 14 of 400 15 of 400 16 of 400 17 of 400 18 of 400 19 of 400 20 of 400 21 of 400 22 of 400 23 of 400 24 of 400 25 of 400 26 of 400 27 of 400 28 of 400 29 of 400 30 of 400 31 of 400 32 of 400 33 of 400 34 of 400 35 of 400 36 of 400 37 of 400 38 of 400 39 of 400 40 of 400 41 of 400 42 of 400 43 of 400 44 of 400 45 of 400 46 of 400 47 of 400 48 of 400 49 of 400 50 of 400 51 of 400 52 of 400 53 of 400 54 of 400 55 of 400 56 of 400 57 of 400 58 of 400 59 of 400 60 of 400 61 of 400 62 of 400 63 of 400 64 of 400 65 of 400 66 of 400 67 of 400 68 of 400 69 of 400 70 of 400 71 of 400 72 of 400 73 of 400 74 of 400 75 of 400 76 of 400 77 of 400 78 of 400 79 of 400 80 of 400 81 of 400 82 of 400 83 of 400 84 of 400 85 of 400 86 of 400 87 of 400 88 of 400 89 of 400 90 of 400 91 of 400 92 of 400 93 of 400 94 of 400 95 of 400 96 of 400 97 of 400 98 of 400 99 of 400 100 of 400 101 of 400 102 of 400 103 of 400 104 of 400 105 of 400 106 of 400 107 of 400 108 of 400 109 of 400 110 of 400 111 of 400 112 of 400 113 of 400 114 of 400 115 of 400 116 of 400 117 of 400 118 of 400 119 of 400 120 of 400 121 of 400 122 of 400 123 of 400 124 of 400 125 of 400 126 of 400 127 of 400 128 of 400 129 of 400 130 of 400 131 of 400 132 of 400 133 of 400 134 of 400 135 of 400 136 of 400 137 of 400 138 of 400 139 of 400 140 of 400 141 of 400 142 of 400 143 of 400 144 of 400 145 of 400 146 of 400 147 of 400 148 of 400 149 of 400 150 of 400 151 of 400 152 of 400 153 of 400 154 of 400 155 of 400 156 of 400 157 of 400 158 of 400 159 of 400 160 of 400 161 of 400 162 of 400 163 of 400 164 of 400 165 of 400 166 of 400 167 of 400 168 of 400 169 of 400 170 of 400 171 of 400 172 of 400 173 of 400 174 of 400 175 of 400 176 of 400 177 of 400 178 of 400 179 of 400 180 of 400 181 of 400 182 of 400 183 of 400 184 of 400 185 of 400 186 of 400 187 of 400 188 of 400 189 of 400 190 of 400 191 of 400 192 of 400 193 of 400 194 of 400 195 of 400 196 of 400 197 of 400 198 of 400 199 of 400 200 of 400 201 of 400 202 of 400 203 of 400 204 of 400 205 of 400 206 of 400 207 of 400 208 of 400 209 of 400 210 of 400 211 of 400 212 of 400 213 of 400 214 of 400 215 of 400 216 of 400 217 of 400 218 of 400 219 of 400 220 of 400 221 of 400 222 of 400 223 of 400 224 of 400 225 of 400 226 of 400 227 of 400 228 of 400 229 of 400 230 of 400 231 of 400 232 of 400 233 of 400 234 of 400 235 of 400 236 of 400 237 of 400 238 of 400 239 of 400 240 of 400 241 of 400 242 of 400 243 of 400 244 of 400 245 of 400 246 of 400 247 of 400 248 of 400 249 of 400 250 of 400 251 of 400 252 of 400 253 of 400 254 of 400 255 of 400 256 of 400 257 of 400 258 of 400 259 of 400 260 of 400 261 of 400 262 of 400 263 of 400 264 of 400 265 of 400 266 of 400 267 of 400 268 of 400 269 of 400 270 of 400 271 of 400 272 of 400 273 of 400 274 of 400 275 of 400 276 of 400 277 of 400 278 of 400 279 of 400 280 of 400 281 of 400 282 of 400 283 of 400 284 of 400 285 of 400 286 of 400 287 of 400 288 of 400 289 of 400 290 of 400 291 of 400 292 of 400 293 of 400 294 of 400 295 of 400 296 of 400 297 of 400 298 of 400 299 of 400 300 of 400 301 of 400 302 of 400 303 of 400 304 of 400 305 of 400 306 of 400 307 of 400 308 of 400 309 of 400 310 of 400 311 of 400 312 of 400 313 of 400 314 of 400 315 of 400 316 of 400 317 of 400 318 of 400 319 of 400 320 of 400 321 of 400 322 of 400 323 of 400 324 of 400 325 of 400 326 of 400 327 of 400 328 of 400 329 of 400 330 of 400 331 of 400 332 of 400 333 of 400 334 of 400 335 of 400 336 of 400 337 of 400 338 of 400 339 of 400 340 of 400 341 of 400 342 of 400 343 of 400 344 of 400 345 of 400 346 of 400 347 of 400 348 of 400 349 of 400 350 of 400 351 of 400 352 of 400 353 of 400 354 of 400 355 of 400 356 of 400 357 of 400 358 of 400 359 of 400 360 of 400 361 of 400 362 of 400 363 of 400 364 of 400 365 of 400 366 of 400 367 of 400 368 of 400 369 of 400 370 of 400 371 of 400 372 of 400 373 of 400 374 of 400 375 of 400 376 of 400 377 of 400 378 of 400 379 of 400 380 of 400 381 of 400 382 of 400 383 of 400 384 of 400 385 of 400 386 of 400 387 of 400 388 of 400 389 of 400 390 of 400 391 of 400 392 of 400 393 of 400 394 of 400 395 of 400 396 of 400 397 of 400 398 of 400 399 of 400 400 of 400 Go


NETL: Publication Standards Manual  

NLE Websites -- All DOE Office Websites (Extended Search)

Standards Manual Publications Publication Standards Manual Click on the logo to access the NETL Publication Standards Manual 2003 APEX Logo Click on the logo or on the link below...


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



LANSCE | Lujan Center | Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publication acknowledgement Lujan Center monitors the number of papers published as a result of the use of our facilities. The Lujan Center's sponsoring agency, US...


NREL: Publications Home Page  

NLE Websites -- All DOE Office Websites (Extended Search)

the database for publications from 1977 to the present on subjects related to renewable energy and energy-efficient technologies. Many publications are available electronically...


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Building and Fire Publications  

Science Conference Proceedings (OSTI)

... economic analysis; energy conservation; energy economics; life cycle cost analysis; public buildings; renewable energy; water conservation ...


Petroleum Institute Scholarly Publications  

E-Print Network (OSTI)

Abu Dhabi The Petroleum Institute Scholarly Publications January 1st ­ December 31st 2007 #12;The Petroleum Institute Scholarly Publications January 1st ­ December 31st 2007 v #12;- 2 - Scholarly Publications 2007 | The Petroleum Institute #12;- 3 - Scholarly Publications 2007 | The Petroleum Institute


NIST Manuscript Publication Search  

Science Conference Proceedings (OSTI)

... Publication Citation: Radioanalytical Emergency Response Exercise. NIST Authors in Bold. ... Title: Radioanalytical Emergency Response Exercise. ...




E-Print Network (OSTI)

PUBLICATIONS, CONFERENCE PRESENTATIONS AND REPORTS Refereed Publications 29. M.H. Alkhaldi, H. 46, 19-25. 22. Dholkawala, Z. F., Sarma, H.K., and Kam, S.I.: Application of Fractional Flow Theory Pressure When CO2 Is Diluted With Other Gases, SPE Reservoir Evaluation & Engineering, Volume 9, Number 4

Williams, John M.


Public Assembly Buildings  

U.S. Energy Information Administration (EIA) Indexed Site

Assembly Assembly Characteristics by Activity... Public Assembly Public assembly buildings are those in which people gather for social or recreational activities, whether in private or non-private meeting halls. Basic Characteristics [ See also: Equipment | Activity Subcategories | Energy Use ] Public Assembly Buildings... Most public assembly buildings were not large convention centers or entertainment arenas; about two-fifths fell into the smallest size category. About one-fifth of public assembly buildings were government-owned, mostly by local governments; examples of these types of public assembly buildings are libraries and community recreational facilities. Tables: Buildings and Size Data by Basic Characteristics Establishment, Employment, and Age Data by Characteristics


NREL: Buildings Research - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications NREL publishes a variety of documents related to its research, including technical reports, brochures, and presentations. Read the information below to find out how to find a publication about buildings research at NREL. Accessing Research Papers Buildings Technical Highlights Research Papers - Commercial Research Papers - Residential Accessing Buildings Research Documents Documents produced by NREL related to buildings technologies may be accessed online in several different ways. National Renewable Energy Laboratory Publications Database The NREL Publications Database covers building technology documents written or edited by NREL staff and subcontractors from 1977 to the present. The database includes technical reports as well as outreach publications such

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



NREL: Wind Research - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications The NREL wind research program develops publications about its R&D activities in wind energy technologies. Below you'll find links to recently published publications, links to the NREL Avian Literature and Publications Databases, and information about the Technical Library at the National Wind Technology Center (NWTC). The NWTC's quarterly newsletter, @NWTC, contains articles on current wind energy research projects and highlights the latest reports, papers, articles, and events published or sponsored by NREL. Subscribe to @NWTC. Selected Publications Featured Publication Large-scale Offshore Wind Power in the United States: Assessment of Opportunities and Barriers Here are some selected NWTC publications: 2011 Cost of Wind Energy Review Built-Environment Wind Turbine Roadmap


NETL: Major Demonstrations Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Reference Shelf > Publications Reference Shelf Publications Inventory of Power Plants in the U.S. as of January 1, 1997 PDF-31MB (Dec 1997) Sustainable Development with Clean...


NETL Publication Standards Manual  

NLE Websites -- All DOE Office Websites (Extended Search)

Standards NETL Publication Standards Manual Publication Standards Manual Click on topic below to view Click "Contents" in the bookmarks panel at the left of your screen to return to this page Introduction * Overview * About This Manual - Point of Contact - Download Files - Permission - Signage - Special Applications Publication Standards * Design Elements * Fact Sheets * Font (Typeface) * Full-Size Brochures * Logo * Presentations * Report Covers NETL Publication Standards Manual Overview For over 60 years, we have been at the forefront


Conference Proceedings Publication Proposal  

Science Conference Proceedings (OSTI)

AVAILABILITY. ? Concurrent with conference ? Non-concurrent (publication recommended within 3 months of meeting). Date papers are due to editors: ...


Building and Fire Publications  

Science Conference Proceedings (OSTI)

... Ramsey prices. Optimal Pricing of Publicly Supplied Private Goods: A Case Study of NIST Standard Reference Materials. ...


NIST Manuscript Publication Search  

Science Conference Proceedings (OSTI)

... Publication Citation: ITL Updates Glossary of Key Information Security Terms. ... Title: ITL Updates Glossary of Key Information Security Terms. ...



NIST Manuscript Publication Search  

Science Conference Proceedings (OSTI)

... Publication Citation: Glossary of Key Information Security Terms. NIST Authors in Bold. ... Title: Glossary of Key Information Security Terms. ...



EIA publications directory, 1992  

DOE Green Energy (OSTI)

This directory contains abstracts and ordering information for EIA publications. The abstracts are arranged by broad subject category such as coal, petroleum, natural gas, and electric power. A comprehensive subject index, a title index, and a report number index are included. Each entry gives the title, report number, publication frequency, date, number of pages, and ordering information. Publication began with the 1979 edition.

Not Available



Publications | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Publications Publications Publications November 1, 2013 - 11:40am Addthis Thumbnail image of the cover for the Combined Heat and Power (CHP): A Decade of Progress, A Vision for the Future, October 2009 Numerous publications are available to help educate end users, product developers, project managers, and policymakers on the many potential benefits of distributed generation (DG) and combined heat and power (CHP) and the barriers to widespread deployment of these technologies. Among these resources are market analyses, databases, fact sheets, guidebooks, technical reports, technical white papers, technology reviews, webcasts, and vision and roadmap documents. Recent Publications Market Analyses Commercial District Energy/Institutional Federal Industrial Multifamily Housing


Publications | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Publications Publications Publications November 1, 2013 - 11:40am Addthis Thumbnail image of the cover for the Combined Heat and Power (CHP): A Decade of Progress, A Vision for the Future, October 2009 Numerous publications are available to help educate end users, product developers, project managers, and policymakers on the many potential benefits of distributed generation (DG) and combined heat and power (CHP) and the barriers to widespread deployment of these technologies. Among these resources are market analyses, databases, fact sheets, guidebooks, technical reports, technical white papers, technology reviews, webcasts, and vision and roadmap documents. Recent Publications Market Analyses Commercial District Energy/Institutional Federal Industrial Multifamily Housing


Emergency Information for the Public  

NLE Websites -- All DOE Office Websites (Extended Search)

the Public Emergency Information for the Public Ensuring release of accurate information to the public. Contact Communications Office (505) 667-7000 Email LANL Update (505)...


LCLS Publications: Statistics  

NLE Websites -- All DOE Office Websites (Extended Search)

LCLS Publications: Statistics LCLS Publications: Statistics Sign In Launch the Developer Dashboard SLAC National Accelerator Laboratory DOE | Stanford | SLAC | SSRL | LCLS | AD | PPA | Photon Science | PULSE | SIMES LCLS : LCLS Publications: Statistics Linac Coherent Light Source An Office of Science User Facility Search this site... Search Help (new window) Top Link Bar LCLS Lasers Expand Lasers LCLS Quick Launch Home About LCLS Expand About LCLS LCLS News Expand LCLS News User Resources Expand User Resources Instruments Expand Instruments Proposals Publications Expand Publications Schedules Machine Status Machine FAQs Safety Organization Expand Organization Directories Expand Directories Staff Resources Contact Us All Site Content Department of Energy Page Content LCLS Publications: Statistics 2013 | 2012 | 2011 | 2010 | 2009 | Archive | Citations | Statistics


Publications 2000 - Nuclear Data Program - Nuclear Engineering...  

NLE Websites -- All DOE Office Websites (Extended Search)

0 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications Publications 2011 Publications 2010 Publications 2009...


130517 - Public Meeting - Notepad  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



NREL: Geothermal Technologies - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications NREL's geothermal team develops publications, including technical reports and conference papers, about geothermal resource assessments, market and policy analysis, and geothermal research and development (R&D) activities. In addition to the selected documents available below, you can find resources on the U.S. Department of Energy (DOE) Geothermal Technologies Program Web site or search the NREL Publications Database. For additional geothermal documents, including those published since 1970, please visit the Office of Science and Technology Information Geothermal Legacy Collection. Policymakers' Guidebooks Five steps to effective policy. Geothermal Applications Market and Policy Analysis Program Activities R&D Activities Geothermal Applications


Public Reading Room  

Office of Legacy Management (LM)

has established a Public Reading Room at 955 has established a Public Reading Room at 955 Mound Road, Miamisburg, Ohio, which contains documents and information related to Mound as required under Section 117(d) of SARA. Copies of key Mound records, including the CERCLA Administrative Record and Information Repository, are kept in the Public Reading Room. The Administrative Record and Information Repository for Mound are updated as new documents are created and an index of documents in the complete collections accompanies each update. The Public Reading Room also contains reference items consisting of technical documents, news clippings, videotapes, journal articles, annual reports, and environmental restoration and decontamination and decommissioning decisional documents. Stakeholders are


ORISE: Public Health Communication  

NLE Websites -- All DOE Office Websites (Extended Search)

Communication Communication Public Health Communication The Oak Ridge Institute for Science and Education (ORISE) assists government agencies and organizations in addressing public health challenges by developing evidence-based communication programs and social marketing initiatives that resonate with target populations. Because approximately half of American adults do not understand basic health information, ORISE develops the types of messages that will attract attention and motivate people to address their personal and family health. ORISE also develops and executes evidence-based and culturally-competent public health communication programs that help change behaviors and result in healthier lifestyles. Communication Planning and Products Public health organizations are faced with increasing demands for


Sririam Recent Publication  

Science Conference Proceedings (OSTI)

... 4, 2009, pp. 25-38. Presentation slides: http://www.cyber.st.dhs.gov/ public/CATCH/Sriram.pdf. Kotikalapudi Sriram, Doug ...



Advanced Energy Storage Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Advanced Energy Storage Publications Reports: Advanced Technology Development Program For Lithium-Ion Batteries: Gen 2 Performance Evaluation Final Report Advanced Technology...

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


NIST Manuscript Publication Search  

Science Conference Proceedings (OSTI)

NIST Home > NIST Manuscript Publication Search. ... In general, comb generators apply high power to a non-linear element (NLE) such as a step ...



About - Glass Publications Portal  

Office of Scientific and Technical Information (OSTI)

from the repository at OSTI. The Glass Publications Portal is sponsored by the DOE Energy Efficiency and Renewable Energy (EERE) Industrial Technologies Program. In...


Public Assembly Buildings  

U.S. Energy Information Administration (EIA) Indexed Site

buildings. Since they comprised 7 percent of commercial floorspace, this means that their energy intensity was just slightly below the commercial average. Public assembly buildings...


Building and Fire Publications  

Science Conference Proceedings (OSTI)

... to cover costs, prices therefore need to deviate from marginal cost. A public-sector pricing model in the Boiteux tradition computes price and output ...


Building and Fire Publications  

Science Conference Proceedings (OSTI)

... A public-sector pricing model in the Boiteux tradition computes price and output combinations that minimize the loss from charging prices that do ...


Making waste public.  

E-Print Network (OSTI)

??This thesis questions the boundaries that define waste as a public or private dilemma, investigating these boundaries as productive sites for the imagination of social… (more)

Gambetta, Curt



Making Waste Public.  

E-Print Network (OSTI)

??This thesis questions the boundaries that define waste as a public or private dilemma, investigating these boundaries as productive sites for the imagination of social… (more)

Gambetta, Curt



ORNL Neutron Sciences Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

at other facilties by Neutron Sciences Directorate staff. We strongly encourage SNS and HFIR users to submit citation information, including URLs, for all publications regarding...


Nathalie Prevost - Publications - CECM  

E-Print Network (OSTI)

Publications. Ph.D. Thesis The Physics of Language: Towards a Phase Transition of Language Change. Canadian Artificial Intelligence(CAI) magazine


Montgomery County Public Schools  

Science Conference Proceedings (OSTI)

... Montgomery County Public Schools (MCPS) is the largest school district in the state of Maryland and the 16th-largest school district in the nation. ...



NIST Manuscript Publication Search  

Science Conference Proceedings (OSTI)

NIST Home > NIST Manuscript Publication Search. Author(s): Kristen L. Wood; RJ B. Stone; DRJ Mcadams; J Hirtz; Simon Szykman; ...



NERSC Publications and Reports  

NLE Websites -- All DOE Office Websites (Extended Search)

Reports Publications & Reports Download the NERSC Strategic Plan (PDF | 3.2 MB) NERSC Annual Reports NERSC's annual reports highlight the scientific accomplishments of its users...


Public Safety Network Requirements  

Science Conference Proceedings (OSTI)

... Usage scenario. ... imposed by public safety applications and usage scenarios is key in ... requirements as shown in Figure 2. This analysis was used as ...



Electric Vehicle Public Charging -  

NLE Websites -- All DOE Office Websites (Extended Search)

Electric Vehicle Public Charging - Time vs. Energy March, 2013 A critical factor for successful PEV adoption is the deployment and use of charging infrastructure in non-...


Alternative Fuels Data Center: Publications  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Publications Publications Printable Version Share this resource Send a link to Alternative Fuels Data Center: Publications to someone by E-mail Share Alternative Fuels Data Center: Publications on Facebook Tweet about Alternative Fuels Data Center: Publications on Twitter Bookmark Alternative Fuels Data Center: Publications on Google Bookmark Alternative Fuels Data Center: Publications on Delicious Rank Alternative Fuels Data Center: Publications on Digg Find More places to share Alternative Fuels Data Center: Publications on AddThis.com... Publications Find publications about alternative transportation, including alternative fuels, advanced vehicles, and regulated fleets. Keyword Category Search more search options close × Filter by Document Category Books & Chapters Brochures & Fact Sheets Conference Papers & Proceedings


Alternative Fuels Data Center: Publications  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Publications Publications Printable Version Share this resource Send a link to Alternative Fuels Data Center: Publications to someone by E-mail Share Alternative Fuels Data Center: Publications on Facebook Tweet about Alternative Fuels Data Center: Publications on Twitter Bookmark Alternative Fuels Data Center: Publications on Google Bookmark Alternative Fuels Data Center: Publications on Delicious Rank Alternative Fuels Data Center: Publications on Digg Find More places to share Alternative Fuels Data Center: Publications on AddThis.com... Publications Find publications about alternative transportation, including alternative fuels, advanced vehicles, and regulated fleets. Keyword Category alternative fuel price report Search more search options close × Filter by Document Category


T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


2007 NSLS Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

07 NSLS Publications 07 NSLS Publications Brookhaven National Laboratory * National Synchrotron Light Source * P.O. Box 5000, Upton, NY 11973 * http://www.nsls.bnl.gov/ VUV-IR Beamlines ................................................................................................................................................................................................. 2 X-Ray Beamlines .................................................................................................................................................................................................. 8 NSLS Users NSLS Staff ............................................................................................................................................................................................................


EIA Publications Directory 1993  

SciTech Connect

This directory contains abstracts and ordering information for EIA publications released in the above time period. The abstracts are arranged by broad subject category such as coal, petroleum, natural gas, and electric power. A comprehensive subject index, a title index, and a report number index are included. Each entry gives the title, report number, publication frequency, date, number of pages, and ordering information.

Not Available



Public affairs plan  

SciTech Connect

The purpose of the Uranium Mill Tailings Remedial Action (UMTRA) Project Public Affairs Plan is to establish goals for the Fiscal Year 1995 UMTRA public affairs program and identify specific activities to be conducted during the year. It also describes the roles of various agencies involved in the conduct of the public affairs program and defines the functions of the Technical Assistance Contractor (TAC) Public Affairs Department. It integrates and replaces the Public Participation Plan (DOE/AL/62350-47D) and Public Information Plan (DOE/AL/623590-71). The plan describes the US Department of Energy`s (DOE) plans to keep stakeholders and other members of the public informed about project policies, plans, and activities, and provide opportunities for stakeholders and interested segments of the public to participate in project decision-making processes. The plan applies to the UMTRA Project Office; the DOE Albuquerque Operations Office, Office of Intergovernmental and External Affairs (OIEA); the UMTRA TAC; the UMTRA Remedial Action Contractor (RAC); and other cooperating agencies.

Not Available



Environmental Public Health at  

E-Print Network (OSTI)

requiring special laboratory expertise · The Division of Emergency and Environmental Health Services, which, environmental sanitation, and laboratory sciences----to protect public health · Responding and sharing solutions to environmental public health problems worldwide "We" are---- · The Division of Laboratory Sciences, which


Publications and Presentations  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications and Presentations Publications and Presentations News & Publications ESnet in the News ESnet News Publications and Presentations Galleries ESnet Awards and Honors Contact Us Technical Assistance: 1 800-33-ESnet (Inside the US) 1 800-333-7638 (Inside the US) 1 510-486-7600 (Globally) 1 510-486-7607 (Globally) Report Network Problems: trouble@es.net Provide Web Site Feedback: info@es.net Publications and Presentations Sort by: Date | Author | Type 2013 Dart E., Rotman L., Tierney B., Hester M., and Zurawski J., "The Science DMZ: A Network Design Pattern for Data-Intensive Science", IEEE/ACM Annual SuperComputing Conference (SC13), Denver CO, USA, November 19, 2013, LBNL LBNL-6366E Download File: sc13sciDMZ-final.pdf (pdf: 952 KB) Ezra Kissel, Martin Swany, Brian Tierney and Eric Pouyoul, "Efficient


Public Scoping Meeting Materials  

NLE Websites -- All DOE Office Websites (Extended Search)

Public Scoping Meeting Materials Public Scoping Meeting Materials Public Scoping Meeting Materials Fact sheets, presentations, and other information from the Conversion EIS Public Scoping Meetings. The following materials were made available during the DUF6 Conversion EIS public scoping meetings held near Portsmouth, Ohio, Oak Ridge, Tennessee, and Paducah, Kentucky, November - December, 2001. Notice of Intent PDF Icon Notice of Intent to Prepare an Environmental Impact Statement for Depleted Uranium Hexafluoride Conversion Facilities 60 KB details Presentation PDF Icon Overview: Depleted Uranium Hexafluoride (DUF6) Management Program 5.97 MB details DUF6 Fact Sheets PDF Icon Overview of Depleted Uranium Hexafluoride Management Program 174 KB details PDF Icon NEPA Activities for the Depleted Uranium Hexafluoride Management Program


WIPP - Public Reading Facilities  

NLE Websites -- All DOE Office Websites (Extended Search)

Public Reading Facilities/Electronic Reading Facilities The Freedom of Information Act (FOIA) and Electronic FOIA (E-FOIA) require that various specific types of records, as well as various other records, be maintained in public reading facilities. Before you submit a FOIA request, we recommend you contact or visit the appropriate public reading facility to determine if the records you are seeking have already been released. The U.S. Department of Energy (DOE), as well as other related DOE sites, have established home pages on the Internet with links to other web sites. If you determine a specific facility might have records in which you are interested, requests for those records can be made directly to the public reading rooms identified below. Copying of records located in the public reading rooms must be made by the staff of those facilities.


Publication Submission Form  

NLE Websites -- All DOE Office Websites (Extended Search)

Pages Pages publicationsubmission Sign In Launch the Developer Dashboard SLAC National Accelerator Laboratory DOE | Stanford | SLAC | SSRL | LCLS | AD | PPA | Photon Science | PULSE | SIMES LCLS : Linac Coherent Light Source An Office of Science User Facility Search this site... Search Help (new window) Top Link Bar LCLS Lasers Expand Lasers LCLS Quick Launch Home About LCLS Expand About LCLS LCLS News Expand LCLS News User Resources Expand User Resources Instruments Expand Instruments Proposals Publications Expand Publications Schedules Machine Status Machine FAQs Safety Organization Expand Organization Directories Expand Directories Staff Resources Contact Us All Site Content Department of Energy Page Content Publication Submission Form Th Tell LCLS about new publications Please submit this form to notify LCLS about new publications relating to


Department of Energy - Public Participation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Public Sector Energy Efficiency  

NLE Websites -- All DOE Office Websites (Extended Search)

Capitol dome Capitol dome Public Sector Energy Efficiency Research on sustainable federal operations supports the implementation of sustainable policies and practices in the public sector. This work serves as a bridge between the technology development of Department of Energy's National Laboratories and the operational needs of public sector. Research activities involve many aspects of integrating sustainability into buildings and government practices, including technical assistance for sustainable building design, operations, and maintenance; project financing for sustainable facilities; institutional change in support of sustainability policy goals; and procurement of sustainable products. All of those activities are supported by our work on program and project evaluation, which analyzes overall program effectiveness while ensuring


DOE Emergency Public Affairs Plan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Headquarters Headquarters Office of Public Affairs Emergency Public Affairs Plan The DOE HQ Office of Public Affairs Emergency Public Affairs Plan has been approved for implementation by: __________________________________________________________ Dan Leistikow, Director, HQ Office of Public Affairs Date: ______________ __________________________________________________________ Joseph Krol, Director, HQ Office of Emergency Management Date: ______________ DOE Office of Public Affairs Emergency Public Affairs Plan 1 Purpose The Department of Energy (DOE) HQ Office of Public Affairs (PA) is committed to communicating information about the Department's work in a timely, accurate and accessible way to the news media, general public and employees.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'EXEC-2009-002897 'EXEC-2009-002897 PUBLIC SERV COM 1 2/25/2009 5:00 PM February 25,2009 The Honorable Steven Chu Secretary, U. S. Department of Energy 1000 Independence Avenue, S .W. Washingon, D.C. 20585 Re: State Energy Program Assurances Dear Secretary Chu: As a condition of receiving our State's share o f the $3.1, billion funding for the S t a t e Energy Program (SEP) under the American Recovery and Renewal Act of 2009 (H.R. l)(ARRA), I am providing the following assurances. I have written to our public u t i l i t y commission and requested that it consider additional actions to promote energy efficiency, consistent with the Federal statutory language contained in H.R. 1 and its obligations to maintain just and reasonable rates, while protecting the public. As set forth in the attached letter, the Chairperson of the Public Service


PNNL: EDO - Useful Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Useful Publications Useful Publications EDO produces an assortment of publications designed to inform, support and educate local technology businesses and service providers as well as communicate about our own efforts. We invite you to make use of these publications in supporting your efforts to start or grow a tech business or to help one succeed. Report - Hanford and the Tri-Cities Economy: Historical Trends 1970-2008 Tri-Cities Tech Business Update - Monthly news and events of interest to tech businesses in the Mid-Columbia area of Southeastern Washington State Companies with Roots in PNNL - Color flyer listing companies that received foundational technology and/or executives from PNNL since 1965. SBIR Alerting Service Targeted Support Program Technology Assistance Program


Publications | Argonne National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Documents Publications Publication Type - Any - Book Book Chapter Conference Paper Conference Proceedings Journal Journal Article Miscellaneous Report Year - Any - 1985 1988 1990 1992 1993 1994 1995 1996 1997 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 Author - Any - Abarzhi, S. I. Abate, J. Abdel-khalik, H. S. Abeysuriya, R. Abhishek, K. Abhyankar, Shrirang Abla, G. Abraham, J. A. Adams, B. Adams, M. L. Addis, B. Adhikari, A. N. Adve, S. V. Afsahi, A. Ahmadia, A. Ahsant, M. Aiken, R. J. Aithal, Shashi M. Akella, S. Akerley, J. Aksenova, A. E. Aktulga, H. M. Al-Ali, R. Alam, S. Albee, P. B. Albrecht, A. Alderman, I. Aldermhini, I. Alessandri, A. Alexe, M. Alexeev, Y. Ali, N. Alimohideen, J. Allain, J. P. Allan, Benjamin A. Allcock, William E. Allen, B. Allen, G.


CBECS - public use data  

U.S. Energy Information Administration (EIA) Indexed Site

Public Use Microdata Files Public Use Microdata Files CBECS Public Use Microdata Files Released: November 2008 Next CBECS will cover calendar year 2007 The 2003 CBECS Public Use Files are comma separated value (.csv) files that each contain 5,215 records. They represent commercial buildings from the 50 States and the District of Columbia. Each record corresponds to a single responding, in-scope sampled building. These files contain data for all buildings, including malls. There are 395 mall building records. For the mall buildings, a limited amount of information was collected, so there are many blank fields in the data for these cases. For all buildings, these files contain information such as the building size, year constructed, types of energy used, energy consumption and expenditures. For non-mall buildings, additional data items such as types of energy-using equipment and conservation features are also included in the files.


Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



BNL Biology Department - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

2003 2002 2001 File Format .pdf 2011 2010 2009 2008 2007 2006 2005 2004 2003 2002 2001 Biology Department 2012 Publications Agarwal R., Burley S.K., and Swaminathan S. Structural...

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EMSL: Publications Search  

NLE Websites -- All DOE Office Websites (Extended Search)

Search for publications related to an EMSL user proposal by author, title, keyword, Science Theme, and more. Full text is available in PDF for download as copyright allows. You may...


Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



Risks to the public  

Science Conference Proceedings (OSTI)

Edited by Peter G. Neumann (Risks Forum Moderator and Chairman of the ACM Committee on Computers and Public Policy), plus personal contributions by others, as indicated. Opinions expressed are individual rather than organizational, and all of the usual ...

Peter G. Neumann



BNL | Public Events  

NLE Websites -- All DOE Office Websites (Extended Search)

Public Events Public Events Public event photos > About Visiting Brookhaven National Laboratory hosts concerts, lectures, and other events throughout the year which are free and open to the public. U.S. citizens age 16 and over must bring government-issued photo-identification for admission. Lectures JAN 17 Friday East Coast Conference for Undergraduate Women in Physics - Lecture "The Nation's Nuclear Physics Program and the Role of the Government" Presented by Dr. Jehanne Gillo, U.S. Department of Energy, Nuclear Physics 9:30 am, Berkner Hall Auditorium Friday, January 17, 2014, 9:30 am Hosted by: Director's Office JAN 22 Wednesday Brookhaven Lecture "491st Brookhaven Lecture: Juergen Thieme of Photon Sciences Directorate" Presented by Juergen Thieme, Brookhaven Lab's Photon Sciences Directorate


ZeptoOS // Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications K. Yoshii, H. Naik, C. Yu, and P. Beckman, Extending and Benchmarking the Big Memory Implementation on Blue GeneP Linux, In "Proceedings of the 1st Int. Workshop on...



E-Print Network (OSTI)

This Public Health Statement is the summary chapter from the Toxicological Profile for Mercury. It is one in a series of Public Health Statements about hazardous substances and their health effects. A shorter version, the ToxFAQs™, is also available. This information is important because this substance may harm you. The effects of exposure to any hazardous substance depend on the dose, the duration, how you are exposed, personal traits and habits, and whether other chemicals are

unknown authors



Publication Number: Special Publication 800-56A Revision 2 ...  

Science Conference Proceedings (OSTI)

... Final Publication: http://nvlpubs.nist.gov/nistpubs/SpecialPublications/NIST. SP.800- 56Ar2.pdf • Related Information on CSRC: ...



Can Public Research Universities Compete?  

E-Print Network (OSTI)

shifted to a 60-40 public- private split by 1960, shiftedagain to a 75-25 public-private split by 1970, andto an 80-20 public-private split by 1980, before moving back

Brint, Steven



Public Works Transportation Infrastructure Study  

E-Print Network (OSTI)

Public Works Transportation Infrastructure Study Minneapolis City of Lakes Minneapolis Public Works Transportation Infrastructure Study #12;Public Works Transportation Infrastructure Study Minneapolis City Works Transportation Infrastructure Study Minneapolis City of Lakes Background: · Currently, funding

Minnesota, University of


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



EERE Publication and Product Library  

NLE Websites -- All DOE Office Websites (Extended Search)

& Energy at Home Details Bookmark & Share View Related Request by Mail Welcome to the EERE Publication and Product Library. This library will allow you to find publications and...


Sandia National Laboratories: News: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Research Magazine Search Sandia Publications News Publications Reports authored by Sandia National Laboratories can be obtained through the following sources: Office of Scientific...


Search Publications | Superconducting Magnet Division  

NLE Websites -- All DOE Office Websites (Extended Search)

Rapid Cycling Magnets Helical Magnets HERA upgrade LHC IR Dipoles RHIC Publications Search Publications Selected Cryogenic Data Notebook Proceedings of the 1968 Summer Study on...


NREL: Transmission Grid Integration - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Want updates about future transmission grid integration webinars and publications? Join our mailing list. NREL has an extensive collection of publications related to transmission integration research. Explore the resources below to learn more. Selected Project Publications Read selected publications related to these transmission integration projects: Western Wind and Solar Integration Study Eastern Renewable Generation Integration Study Oahu Wind Integration and Transmission Study Flexible Energy Scheduling Tool for Integration of Variable generation (FESTIV) Active power controls Forecasting Grid Simulation. NREL Publications Database NREL's publications database offers a variety of documents related to transmission integration that were written by NREL staff and


U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI : 140 : 2011-2013: Marysville, MI: 176 : 1,080: 14 : 2011-2013: St. Clair, MI: 1,562: 1,422: 2 : 26 : 2011-2013: Noyes, MN: 13,380: 14,460: 20,624: 33,889 ...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 3.80 : 4.50 : 2011-2013: Marysville, MI: 3.63: 3.65 : 4.57: 4.70 : 2011-2013: St. Clair, MI: 3.75: 3.67: 4.09: 4.41 : 4.35: 2011-2013: Noyes, MN: 3.74: 3 ...


U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 22,904: 27,220: 43,980: 44,275: 43,690: 50,347: 1996-2011: Marysville, MI: 9,158: 8,756: 14,925: 22,198: 41,964: 42,866: 1996-2011: Sault Ste. Marie, MI ...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 8.28: 6.58: 4.53: 8.37: 5.17 : 1996-2011: Marysville, MI: 7.59: 8.59: 3.80: 4.44: 4.42: 2.99: 1996-2012: St. Clair, MI: 6.97: 10.03: 5.10: 4.97: 4.29: 2 ...


U.S. Price of Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 6.88: 8.37: 4.01: 4.69: 4.26: 3.10: 1996-2012: Marysville, MI: 7.77: 7.48: 4.85: 4.87: 4.48: 3.18: 1996-2012: Sault Ste. Marie, MI: 7.13: 8.75: 5.04: 5 ...

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Solid-State Lighting: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications to someone by Publications to someone by E-mail Share Solid-State Lighting: Publications on Facebook Tweet about Solid-State Lighting: Publications on Twitter Bookmark Solid-State Lighting: Publications on Google Bookmark Solid-State Lighting: Publications on Delicious Rank Solid-State Lighting: Publications on Digg Find More places to share Solid-State Lighting: Publications on AddThis.com... Conferences & Meetings Presentations Publications Postings Articles Program Fact Sheets Technology Fact Sheets CALiPER Reports GATEWAY Reports LED Lighting Facts Reports Project Reports Studies and Reports Technology Roadmaps Product Performance Guides Webcasts Videos Tools Publications The Solid-State Lighting (SSL) program produces a comprehensive portfolio of publications, ranging from overviews of the program's research


ARM News &#187; Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publication Notice: Publication Notice: New Journal Reference Available Mon, 25 Nov 2013 15:51:51 +0000 Publication Notice: New Journal Reference Available Wed, 20 Nov 2013 22:43:20 +0000 Publication Notice: 2 New References Available Thu, 14 Nov 2013 23:20:39 +0000 Publication Notice: New Journal Reference Available Wed, 13 Nov 2013 17:18:42 +0000 Publication Notice: 2 New References Available Mon, 11 Nov 2013 19:48:04 +0000 Publication Notice: New Journal Reference Available Mon, 04 Nov 2013 14:40:22 +0000 Publication Notice: New Journal Reference Available Thu, 31 Oct 2013 21:00:57 +0000 Publication Notice: 3 New References Available Wed, 30 Oct 2013 22:13:53 +0000 Publication Notice: 2 New References Available Mon, 28 Oct 2013 21:39:05 +0000 Publication Notice: New Journal Reference Available Wed, 23 Oct 2013 23:24:48 +0000


Notice of Public Meeting  

NLE Websites -- All DOE Office Websites (Extended Search)

[6450-01-P] [6450-01-P] DEPARTMENT OF ENERGY 10 CFR Parts 429 and 430 (Docket No. EERE-2012-BT-TP-00xx) Test Procedure Guidance for Room Air Conditioners, Residential Dishwashers, and Residential Clothes Washers: Public Meeting AGENCY: Office of Energy Efficiency and Renewable Energy, Department of Energy. ACTION: Notice of public meeting. SUMMARY: The U.S. Department of Energy (DOE) is holding a public meeting to provide a forum for manufacturers and test laboratories to discuss their respective interpretations of existing DOE test procedures, where they believe that the test procedures lack clarity, and to provide information for DOE to consider prior to publishing any proposed guidance to clarify the current test procedures for room air conditioners, residential dishwashers, and residential clothes


Green Power Network: Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

News News TVA Seeks 126 MW of Renewables in 2014 December 2013 More News More News Subscribe to E-Mail Update Subscribe to e-mail update Events EPA Webinar - The Power of Aggregated Purchasing: How to Green Your Electricity Supply & Save Money January 15, 2014 1:00-2:00 p.m. ET Previous Webinars More News Features Green Power Market Status Report (2011 Data) Featured Green Power Reports Publications Alphabetical Listing Categorical Listing Chronological Listing Featured Reports The Green Power Network library contains articles and reports on green power, green pricing, and related topics. Whenever possible, we provide a link to publications available online. The publications are grouped by the following topics to help you in your search. If you are aware of other documents that should be added to this list, please notify our Webmaster.


Theory and Software Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Coming up A probability-conserving dissipative Schrodinger equation M. van Veenendaal, J. Chang, and A. J. Fedro preprint Publications 2011 Electronic structure and orbital polarization of LaNiO3 with a reduced coordination and under strain: A first-principles study M. J. Han and M. van Veenendaal Phys. Rev. B 84, 125137 (2011). Stability of ferromagnetic ground state against large compressive stress in magnetodielectric oxide La2MnNiO6 D. Haskel, G. Fabbris, N. M. Souza-Neto, M. van Veenendaal, G. Shen, A. E. Smith, and M. A. Subramanian Phys. Rev. B 84, 100403(R) (2011). Addressing the amorphous content issue in quantitative phase analysis: the certification of NIST standard reference material 676a J. P. Cline, R. B. Von Dreele, R. Winburn, P. W. Stephens, and J. J.


Argonne CNM: Publications 2004  

NLE Websites -- All DOE Office Websites (Extended Search)

4 Publications 4 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z Publications for 2004 B Barber R., Ghantasala M., Divan R., Mancini D. and Harvey E., "An Investigation of SU-8 Resist Layer Adhesion in Deep X-Ray Lithography of High-Aspect-Ratio Structures," Proc. SPIE, 5276, pp85-91, 2004 Barnard A., "Shape and energetics of TiN nanoparticles," Journal of Computational and Theoretical Nanoscience, 1, pp334-339, 2004 Bhattacharjee S., Booske J., Kory C., Van Der Weide D., Limbach S., Gallagher S., Welter J., Lopez M., Gilgenbach R., Ives R., Read M., Divan R. and Mancini D., "Folded Waveguide Traveling Wave Tube Sources for THz Radiation," IEEE Transaction of Plasma Science, Special Issue on High Power Microwaves, 32, pp1002-1014, 2004


American Public Power Association  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Public Power Association Public Power Association 2301 M SJ Issue Brief 2301M ! NWV Issue aie I I*Wasnimgon. D., 2. 0037-I48-a 202/467-2900 FAX 202/45-7-2910 www. APPAnet.org National Energy Policy Legislation - A Comprehensive Approach to Ensuring Energy Security March 2001 Summary: A confluence of even s involving rising prices and supply shortages in several energy sectors has focused public and political attention on the need to update the nation's energy policy and to provide for increased production of domestic energy sources. President George W. Bush made this central point in his campaign platform on energy issues and has designated an Administration team under the leadership of Vice President Cheney to develop specific recommendations in this regard. House and Senate leaders have similarly indicated


Publications | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Publications Publications Publications Energy Savers Guide This guide shows you how easy it is to cut your energy use at home and also on the road. The easy, practical solutions for saving energy include tips you can use today -- from your roof and landscaping to appliances and lights. They are good for your wallet and for the environment -- and actions that you take help reduce our national needs to produce or import more energy, thereby improving our energy security. Ahorre Energía Esta guía le muestra lo fácil que es reducir el uso de energía en su casa, y también en los caminos. Estas soluciones fáciles y prácticas para ahorrar energía incluyen consejos que usted puede usar hoy mismo, en el techo, en el paisaje que rodea su casa, en sus electrodomésticos y en


LEAF List of Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

LEAF Logo LEAF Logo Laser-Electron Accelerator Facility Publications Concerning LEAF and Work Done at LEAF The Brookhaven Laser-Electron Accelerator Facility (LEAF) J. F. Wishart Houshasenkagaku (Biannual Journal of the Japanese Society of Radiation Chemistry) 66, 63-64 (1998) Electron Attachment to CO2 in Supercritical Ethane M. Nishikawa, K. Itoh, and R. Holroyd J. Phys. Chem. A 103, 550-556 (1999) Abstract [Find paper at ACS Publications] Thermodynamics of Electron Attachment to Pyrimidine and Styrene in Supercritical Ethane R. A. Holroyd, M. Nishikawa, and K. Itoh J. Phys. Chem. B 103, 9205-9210 (1999) Abstract [Find paper at ACS Publications] Solvent Clustering around Pyrazine Ions in the High-Compressibility Region of Supercritical Ethane R. A. Holroyd, M. Nishikawa, and K. Itoh


EIA publications directory, 1991  

SciTech Connect

Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department`s independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, and resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the EIA from January through December 1991. This edition supplements EIA Publications Directory 1977--1989 and EIA Publications Directory 1990. The body of the Directory contains citations and abstracts arranged by broad subject categories, such as coal, petroleum, and natural gas and subcategories such as reserves, produces and byproducts, and marketing and economics. All reports are indexed alphabetically by subject and title and numerically by report number.

Not Available



EIA publications directory, 1991  

SciTech Connect

Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department's independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, and resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the EIA from January through December 1991. This edition supplements EIA Publications Directory 1977--1989 and EIA Publications Directory 1990. The body of the Directory contains citations and abstracts arranged by broad subject categories, such as coal, petroleum, and natural gas and subcategories such as reserves, produces and byproducts, and marketing and economics. All reports are indexed alphabetically by subject and title and numerically by report number.

Not Available



Annual Energy Outlook 2013 Early Release Reference Case  

U.S. Energy Information Administration (EIA) Indexed Site

Vehicle Choice Modeling and Vehicle Choice Modeling and Projections for the Annual Energy Outlook John Maples Office of Energy Analysis, Energy Efficiency and End Use January 25, 2013 | Detroit, MI Outline John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 2 * Overview of model structure and inputs * Battery electric vehicles and current state of the market * Projections of battery electric vehicles in the Annual Energy Outlook 2013 * High Battery Technology case in the Annual Energy Outlook 2012 Overview of model structure and inputs 3 John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 Light duty vehicle technology market penetration John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 4 * Technologies affecting light-duty vehicle fuel economy are


Level schedule implementation in unstable manufacturing environments  

E-Print Network (OSTI)

American Axle & Manufacturing Inc. (AAM), headquartered in Detroit (MI) is one of the major Tier 1 suppliers in the automotive industry. The main challenge in AAM plant 2 is production rate unstability due to downtime, ...

López de Haro, Santiago




E-Print Network (OSTI)

?Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. ( boris@math.wayne.edu) ...... alent to the fundamental metric regularity property of the inverse F?1. The latter ...... Handbook of Semidefinite Program- ming: Theory  ...


Argonne Transportation - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Transportation Publications All downloadable documents on this site are in PDF format. You will need Adobe Reader to view these files (download Adobe Reader). Please note that some of these files are very large and may take some time to download. transforum TransForum The Center's quarterly newsletter featuring articles and photographs about current transportation research and breakthroughs. A 2011 STC Excellence Award winner. Subscribe to TransForum » factsheet icon Fact Sheets One sheet summaries on transportation topics and research argonne logo Recent Papers & Presentations Search for Papers, Presentations & More Find publications highlighting researcher work presented at conferences and other venues. Search by WORD or PHRASE Enter word or phrase


Carbon Sequestration - Public Meeting  

NLE Websites -- All DOE Office Websites (Extended Search)

Public Meeting Programmatic Environmental Impact Statement Public Meeting May 18, 2004 National Energy Technology Laboratory Office of Fossil Energy Scott Klara Carbon Sequestration Technology Manager Carbon Sequestration Program Overview * What is Carbon Sequestration * The Fossil Energy Situation * Greenhouse Gas Implications * Pathways to Greenhouse Gas Stabilization * Sequestration Program Overview * Program Requirements & Structure * Regional Partnerships * FutureGen * Sources of Information What is Carbon Sequestration? Capture can occur: * at the point of emission * when absorbed from air Storage locations include: * underground reservoirs * dissolved in deep oceans * converted to solid materials * trees, grasses, soils, or algae Capture and storage of CO 2 and other Greenhouse Gases that


NERSC Staff Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Staff Staff Publications & Presentations NERSC Staff Publications & Presentations Sort by: Date | Author | Type 2013 Massimo Di Pierro, James Hetrick, Shreyas Cholia, James Simone, and Carleton DeTar., "The new "Gauge Connection" at NERSC", 21st International Lattice Data Grid Workshop, December 2013, Richard Gerber (Berkeley Lab), Ken Bloom (U. Nebraska-Lincoln), "Report of the Snowmass 2013 Computing Frontier Working Group on Distributed Computing and Facility Infrastructures", to be included in proceedings of Community Summer Study ("Snowmass") 2013, November 11, 2013, Download File: 1311.2208v1.pdf (pdf: 551 KB) Richard Gerber and Harvey Wasserman, eds., "Large Scale Computing and Storage Requirements for High Energy Physics - Target 2017", November 8,


Terrestrial Trading Recent Publications  

E-Print Network (OSTI)

In t ro du ct i o n This Newsletter is created by the National Energy Technology Laboratory and represents a summary of carbon sequestration news covering the past month. Readers are referred to the actual article(s) for complete information. It is produced by the National Energy Technology Laboratory to provide information on recent activities and publications related to carbon sequestration. It covers domestic, international, public sector, and private sector news. Hi g h l i g h t s Wh at ’s In s i d e? Sequestration in the News

unknown authors



BFRL: HVAC&R - Publications  

Science Conference Proceedings (OSTI)

HVAC&R Equipment Performance Group. Publications. Repeatability of Energy Consumption Test Results for Compact Refrigerators ...


Detroit, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

27°, -83.0457538° 27°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.331427,"lon":-83.0457538,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Detroit Edison Co | Open Energy Information  

Open Energy Info (EERE)



Southern California: The Detroit of Electric Cars?  

E-Print Network (OSTI)

electric cars as a potential solution. and susceptible to rapid change; (c) con- ulations governing vehicle safety

Scott, Allen J.



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Clean Fleets Announcement 1 of 14 Clean Fleets Announcement Untitled Secretary Chu Visits Dublin, Ireland 110410-110510 Keep Your Home Office Efficient with ENERGY STAR. Home...


The Regeneration of Urban Empty Space / Detroit.  

E-Print Network (OSTI)

??The depopulation of once-major central cities is no longer an uncommon occurrence. Between the years 1950 and 2010, over 350 large cities worldwide lost a… (more)

Hall, Philip A.



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A New Energy-Efficient Home in the D.C. Community Solar Decathlon at Home in the D.C. Community Record-Breaking Solar Game-Changing Advancements in Solar Energy Energy Pumpkin...


Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Supercomputers' Pictorial Superpowers How the Smart Grid Helps Homeowners Reduce Their Energy Use EcoCAR Challenge Finish Line Event 1 of 8 Students Earn Street Cred With the...


Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Management Trade Show Supercomputers' Pictorial Superpowers How the Smart Grid Helps Homeowners Reduce Their Energy Use EcoCAR Challenge Finish Line Event 1 of 8 Students Earn...


Southern California: The Detroit of Electric Cars?  

E-Print Network (OSTI)

by building a new electric-vehicle industry in Southerntime being, the electric vehicle industry electric-vehicleindustry into the electric-vehicle industry. • Inclusion of

Scott, Allen J.



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Saving Energy and Resources Revolutionizing Manufacturing INFOGRAPHIC: Wind Energy in America National Wind Technology Center - Colorado America's Wind Testing Facilities Beyond...


Publications Salmonid Broodstock, Black  

E-Print Network (OSTI)

Publications Salmonid Broodstock, Black Cod, and Successful Fishing Piers "Salmon Broodstock Avenue. N.E.. Seattle, WA 98105. "Black Cod, Boom or Bust?", also published by Washington Sea Grant- page paper- bound booklet addresses the location and status of black cod stocks. harvest methods


Science and Public Policy  

SciTech Connect

The United States faces many issues that involve science. Issues ranging from climate change to nano-technology, from human genomics to modified food crops. What is the role that science plays in determining what the public policy for these issues should be? How as scientists should we respond to requests for advice?

Handler, Thomas [University of Tennessee



Clean Cities: Clean Cities Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Information Resources Information Resources Printable Version Share this resource Send a link to Clean Cities: Clean Cities Publications to someone by E-mail Share Clean Cities: Clean Cities Publications on Facebook Tweet about Clean Cities: Clean Cities Publications on Twitter Bookmark Clean Cities: Clean Cities Publications on Google Bookmark Clean Cities: Clean Cities Publications on Delicious Rank Clean Cities: Clean Cities Publications on Digg Find More places to share Clean Cities: Clean Cities Publications on AddThis.com... Publications Technical Assistance Clean Cities Publications Learn about alternative fuels and vehicles, infrastructure development, emissions, idle reduction, and more in the following Clean Cities-branded publications. Program Clean Cities Overview Clean Cities Now - Fall 2013 issue


Argonne CNM: Publications 2006  

NLE Websites -- All DOE Office Websites (Extended Search)

6 Publications 6 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A Alvine K., Pontoni D., Shpyrko O., Pershan P., Cookson D., Shin K., Russell T., Brunnbauer M., Stellacci F. and Gang O., "Solvent Mediated Assembly of Nanoparticles Confined in Mesoporous Alumina," Phys. Rev. B, 73, p 125412, 2006 Alvine K., Shpyrko O., Pershan P., Shin K. and Russell T., "Capillary Filing of Anodized Alumina Nanopore Arrays," Phys. Rev. Lett., 97, p 175503, 2006 Angadi M., Watanabe T., Bodapati A., Xiao X., Auciello O., Carlisle J., Eastman J., Schelling P. and Phillpot S., "Thermal Transport and Grain Boundary Conductance in Ultrananocry Stalline Diamond Thin Films," J. Appl. Phys., 99, p 114301, 2006


JGI - Notable Scientific Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Notable Scientific Publications Notable Scientific Publications May 5, 2013 Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. (Nature Methods.) We present a hierarchical genome-assembly process (HGAP) for high-quality de novo microbial genome assemblies using only a single, long-insert shotgun DNA library in conjunction with Single Molecule, Real-Time (SMRT) DNA sequencing. Our method uses the longest reads as seeds to recruit all other reads for construction of highly accurate preassembled reads through a directed acyclic graph–based consensus procedure, which we follow with assembly using off-the-shelf long-read assemblers. March 24, 2013 The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, domestication and genome evolution. (Nature


Argonne CNM: Publications 2009  

NLE Websites -- All DOE Office Websites (Extended Search)

9 Publications 9 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A Adiga S. P., Jin C., Curtiss L. A., Monteiro-riviere N. A. and Narayan R. J., "Nanoporous Membranes for Medical and Biological Applications," Wiley Interdisciplinary Reviews: Nanomedicine and Nanobiotechnology, 1, pp568-581, 2009 ( Link) Adiga V. P., Sumant A. V., Suresh S., Gudeman C., Auciello O., Carlisle J. A. and Carpick R. W."Temperature dependence of mechanical stiffness and dissipation in ultrananocrystalline diamond," Micro- and Nanotechnology Sensors, Systems, and Applications, [7318], (SPIE - The International Society for Optical Engineering, USA), 2009 ( Link) Adiga V. P., Sumant A. V., Suresh S., Gudeman C., Auciello O., Carlisle J. A. and Carpick R. W., "Mechanical Stiffness and Dissipation in Ultrananocrystalline Diamond Microresonators," Phys. Rev. B, 79, p 245403, 2009 ( Link)


BNL | Biosciences Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Past Publications 2013 2012 2011 2010 File Format .pdf 2013 2012 2011 2010 Biosciences Department 2013 Publications Andre C., Kim S.-W., Yu X.-H., and Shanklin J. Fusing catalase to an alkane-producing enzyme maintains enzymatic activity by converting the inhibitory byproduct H2O2 to the cosubstrate O2. Proceedings of the National Academy of Sciences USA, 110(8):3191-3196 (February, 2013). PubMed Babst B., Karve A., and Tatjana J. Radio-metabolite analysis of carbon-11 biochemical partitioning to nonstructural carbohydrates for integrated metabolism and transport studies. Plant & Cell Physiology, 54(6):1016-1025 (June 2013). PubMed Baniecki M.L., McGrath W.J., and Mangel W.F. Regulation of a viral proteinase by a peptide and DNA in one-dimensional space. III. Atomic resolution structure of a nascent form of the adenovirus


Argonne CNM: Publications 2013  

NLE Websites -- All DOE Office Websites (Extended Search)

3 Publications 3 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A An C., Wang J., Liu J., Wang S. and Sun Y., "Hollow AgI:Ag Nanoframes as Solar Photocatalysts for Hydrogen Generation from Water Reduction," Chem Sus Chem, 6, 1931-1937 (2013) (Link) (Back to top B Bairu S. G., Mghanga E., Hasan J., Kola S., Rao V. J., Bhanuprakash K., Giribabu L., Wiederrecht G. P., Da Silva R., Rego L. G. and Ramakrishna G., "Ultrafast Interfacial Charge-Transfer Dynamics in a Donor-?-Acceptor Chromophore Sensitized TiO2 Nanocomposite," J. Phys. Chem. C, 117, 4824-4835 (2013) (Link) Balasubramanian S., Wang P., Schaller R. D., Rajh T. and Rozhkova E. A., "High-Performance Bioassisted Nanophotocatalyst for Hydrogen Production," Nano Letters, 13, 3365-3371 (2013) (Link)


Argonne CNM: Publications 2005  

NLE Websites -- All DOE Office Websites (Extended Search)

5 Publications 5 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z B Barber R., Ghantasala M., Divan R., Vora K., Harvey E. and Mancini D., "Optimisation of SU-8 Processing Parameters for Deep X-Ray Lithography," Microsystem Technologies, 11, pp303-310, 2005 Barnard A., Lin X. and Curtiss L., "Equilibrium Morphology of FCC Gold Nanoparticles >3nm and Shape Changes Induced by Temperature," J. Phys. Chem. B, 109, pp24465-24472, 2005 Barnard A., Russo S. and Snook I., "Visualization of Hybridization in Nanocarbon Systems," Journal of Computer Theory and Nanoscience, 2, pp68-74, 2005 Barnard A., Saponjic Z., Tiede D., Rajh T. and Curtiss L., "Multiscale modeling of titanium dioxide: Controlling shape with surface chemistry," Review of Advanced Materials Science, 10, pp21-27, 2005


Argonne CNM: Publications 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

2 Publications 2 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A Ade P., Datesman A. M., Novosad V. and Yefremenko V. G."Performance and on-sky optical characterization of the SPTpol instrument," Proc. SPIE: Millimeter, Submillimeter, and Far-Infrared Detectors and Instrumentation for Astronomy VI, 8452 (84521F-1) (2012) (Link) Ade P., Datesman A. M., Novosad V. and Yefremenko V. G., "An Overview of the SPTpol Experiment," J. Low Temp. Phys., 167, 859-864 (2012) (Link) Ade P., Novosad V. and Yefremenko V. G."Detectors for the South Pole Telescope," Proc. 2nd Int. Conf. Technology and Instrumentation in Particle Physics,37 (1381-1388) (2012) (Link) Antonio D., Zanette D. and Lopez O., "Frequency Stabilization in Nonlinear Micromechanical Oscillators," Nature, 3, 806 (2012) (Link)


ARM - Publications Article  

NLE Websites -- All DOE Office Websites (Extended Search)

September 27, 2013 [Publications] September 27, 2013 [Publications] New Radar Brochure Available Bookmark and Share A new brochure describing ARM's global network of 32 research radars is now available. ARM radars are divided into three main groups: Scanning ARM Cloud Radars; Scanning ARM Precipitation Radars; and ARM Cloud Profiling Radars. A map is included, showing where specific radars are located throughout the ARM sites: North Slope of Alaska, Southern Great Plains, Tropical Western Pacific, and Eastern North Atlantic. It also indicates which type of radars are available with each of ARM's three mobile facilities. In addition, the brochure includes a high-level flowchart detailing how ARM radar data is stored, processed, and output into advanced data products and tools. All ARM data can be found using the ARM Data

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Sector 6 Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 2009 2008 2007 2006 2005 2004 2003 2002 2001 APS Pubs. Database Sector 6 Publications Publications 2013:(45) "Classical and quantum phase transitions revealed using transport and x-ray measurements," Arnab Banerjee, Ph.D.-Thesis, University of Chicago, 2013. "Charge transfer and multiple density waves in the rare earth tellurides," A. Banerjee, Yejun Feng, D.M. Silevitch, Jiyang Wang, J.C. Lang, H.-H. Kuo, I.R. Fisher, T.F. Rosenbaum, Phys. Rev. B 87, 155131 (2013). "Controlling Size-Induced Phase Transformations Using Chemically Designed Nanolaminates," Matt Beekman, Sabrina Disch, Sergei Rouvimov, Deepa Kasinathan, Klaus Koepernik, Helge Rosner, Paul Zschack, Wolfgang S. Neumann, David C. Johnson, Angew. Chem. Int. Ed. 52, 13211 (2013).


Modeling & Simulation publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Modeling & Simulation » Modeling & Simulation » Modeling & Simulation Publications Modeling & Simulation publications Research into alternative forms of energy, especially energy security, is one of the major national security imperatives of this century. Get Expertise David Harradine Physical Chemistry and Applied Spectroscopy Email Josh Smith Chemistry Email The inherent knowledge of transformation has beguiled sorcerers and scientists alike. D.A. Horner, F. Lambert, J.D. Kress, and L.A. Collins, "Transport properties of lithium hydride from quantum molecular dynamics and orbital-free molecular dynamics," Physical Review B - Condensed Matter and Materials Physics 80(2) (2009). J.D. Kress, D.A. Horner, and L.A. Collins, "Mixing rules for optical and transport properties of warm, dense matter," AIP Conference Proceedings 1195, 931-934 (2009).


EIA publications directory, 1990  

Science Conference Proceedings (OSTI)

Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department's independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, and resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the EIA from January through December 1990. This edition supplements EIA Publications Directory 1977--1989. The body of the Directory contains citations and abstracts arranged by broad subject categories, such as coal, petroleum, and natural gas and subcategories such as reserves, products and byproducts, and marketing and economics. All reports are indexed alphabetically by subject and title and numerically by report number.

Not Available



Fuel Cells publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Materials Science » Materials Science » Fuel Cells » Fuel Cells Publications Fuel Cells publications Research into alternative forms of energy, especially energy security, is one of the major national security imperatives of this century. Get Expertise Melissa Fox Applied Energy Email Catherine Padro Sensors & Electorchemical Devices Email Fernando Garzon Sensors & Electorchemical Devices Email Piotr Zelenay Sensors & Electorchemical Devices Email Rod Borup Sensors & Electorchemical Devices Email Karen E. Kippen Chemistry Communications Email Like a battery, a fuel cell consists of two electrodes separated by an electrolyte-in polymer electrolyte fuel cells, the separator is made of a thin polymeric membrane. Unlike a battery, a fuel cell does not need recharging-it continues to produce electricity as long as fuel flows


Public Facilities Guidebook  

Science Conference Proceedings (OSTI)

This "Guidebook" provides a basic guide to electric solutions for typical problems encountered in public facilities. The "Guidebook" introduces technologies that can improve energy service quality, reduce energy costs, improve building occupant satisfaction, increase building occupant productivity, and enhance environmental protection. The "Guidebook" suggests practical measures for applying state-of-the-art electric technology to existing buildings as well as to modern and new buildings. The document al...



EIA publications directory 1997  

SciTech Connect

This edition of the EIA Publications Directory contains 68 titles and abstracts of periodicals and one time reports produced by EIA from January through December 1997. The body of the Directory contains citations and abstracts arranged by broad subject categories; (1) MetaData, (2) Coal, (3) Oil (4) Natural gas, (5) Nuclear, (6) Electricity, (7) Renewable energy and Alternative fuels, (8) Multifuel, (9) End use consumption, (10) Models, and (11) Forecasts.




EIA publications directory 1996  

DOE Green Energy (OSTI)

This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the Energy Information Administration (EIA) from January through December 1996. The body of the Directory contains citations and abstracts arranged by broad subject categories; metadata, coal, oil and gas, nuclear, electricity, renewable and energy/alternative fuels, multifuel, end-use consumption, models, and forecasts.




Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



LBA Data and Publication Policy  

NLE Websites -- All DOE Office Websites (Extended Search)

LBA Data and Publication Policy The LBA Data and Publication Policy was amended by the Science Steering Committee in May 2006: For LBA data archived at the Oak Ridge National...


The FIFE Data Publication Experiment  

Science Conference Proceedings (OSTI)

The First ISLSCP Field Experiment (FIFE) provided an opportunity to test the concept of data publication for long-term access to valuable scientific data. In analogy with the procedures used in research publication, the FIFE Information System ...

Donald E. Strebel; David R. Landis; K. Fred Huemmrich; Jeffrey A. Newcomer; Blanche W. Meeson



EERE Publication and Product Library  

NLE Websites -- All DOE Office Websites (Extended Search)

Mail Requests You have not requested any products. You can request that products and publications be mailed to you by clicking on the "Request by Mail" link in the publication...


Publications inventory control and distribution  

Science Conference Proceedings (OSTI)

Most publications stocked by STSC, Inc. are produced at headquarters. A small number of other publications, however, are ordered from outside vendors and then stocked at headquarters for distribution. Past procedures for inventory control and distribution ...

Deborah R. Richardson



BFRL: HVAC&R - Publications  

Science Conference Proceedings (OSTI)

HVAC&R Equipment Performance Group. Publications. Fundamental Aspects of the Application of Carbon Dioxide in Comfort Cooling. ...



Science Conference Proceedings (OSTI)

Page 1. NBS SPECIAL PUBLICATION 445- 1 Page 2. NATJONAL BUREAU OF STANDARDS The National Bureau of Standards ...



EIA publications directory 1994  

Science Conference Proceedings (OSTI)

Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department`s independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by EIA from January through December 1994. The body of the Directory contains citations and abstracts arranged by broad subject categories: metadata, coal, oil and gas, nuclear, electricity, renewable energy/alternative fuels, multifuel, end-use consumption, models, and forecasts.




Argonne CNM: Publications 2011  

NLE Websites -- All DOE Office Websites (Extended Search)

1 Publications 1 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A Antonio D. and Lopez O."Micromechanical Magnetometers Based on Clamped-clamped High-Q Nonlinear Resonators ,"IEEE Conf. Proc. Solid-State Sensors, Actuators and Microsystems (2011) (Link) Aschauer U. J. and Selloni A., "Structure of the Rutile TiO2(011) Surface in Aqueous Environment," Phys. Rev. Lett., 106, 166102-166105 (2011) (Link) Awuah S. G., Polreis J., Biradar V. and You Y., "Singlet Oxygen Generation by Novel NIR BODIPY Dyes," Org. Lett., 13, 3884-3887 (2011) (Link) Aytug T., Chen Z., Maroni V. A., Miller D. J., Cantoni C., Specht E. D., Kropf A. J., Zaluzec N., Zhang Y., Zuev Y. and Paranthaman M., "Nano-engineered Defect Structures in Ce- and Ho-doped Metal-organic Chemical Vapor Deposited YBa2Cu3O6+x Films: Correlation of Structure and Chemistry with Flux Pinning Performance," J. Appl. Phys., 109, 113923-113934 (2011) (Link)


AP Group Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

List of Publications since 2006 List of Publications since 2006 E. Fujita, C. Creutz, D. C. Grills, J. T. Muckerman, D. E. Polyansky D. Cabelli, P. Khalifah, J. A. Rodriguez, and K. Sasaki 2013 Matsubara, Y.; Hightower, S. H.; Chen, J.; Grills, D. C.; Polyansky, D. E.; Muckerman, J. T.; Tanaka, K.; Fujita, E. Reactivity of a fac-ReCl(α-diimine)(CO)3 complex with an NAD+ model ligand toward CO2 reduction, Chem. Commun. ASAP, DOI:10.1039/C3CC47699E. Manaka, Y.; Wang, W.-H.; Suna, Y.; Kambayashi, H.; Muckerman, J. T.; Fujita. E.; Himeda, Y. Efficient H2 generation from formic acid using azole complexes in water, Catal. Sci. Technol. ASAP, DOI: 10.1039/c3cy00830d. Lewandowska-Andralojc, A.; Polyansky, D. E. "Mechanism of the Quenching of the Tris(bipyridine)ruthenium(II) Emission by Persulfate: Implications for Photo-Induced Oxidation Reactions" J. Phys Chem. A, 2013, 117, 10311-10319, DOI: 10.1021/jp407573d.


Argonne CNM: Publications 2008  

NLE Websites -- All DOE Office Websites (Extended Search)

8 Publications 8 Publications A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A Adiga S. P., Curtiss L., Elam J. W., Pellin M. J., Shih C. C., Shih C. M., Lin S. J., Su Y. Y., Gittard S. A., Zhang J. and Narayan R., "Nanoporous Materials for Biomedical Devices," JOM, 60, pp26-32, 2008 ( Link) B Baca A. J., Ahn J., Sun Y., Meitl M. A., Menard E., Kim H., Choi W., Kim D., Huang Y. and Rogers J. A., "Semiconductor wires and ribbons for high-performance flexible electronics," Angew. Chem. Int. Ed., 47, pp5524-5542, 2008 ( Link) Barnard A. and Sternberg M. G., "Vacancy Induced Structural Changes in Diamond Nanoparticles," J. Comput. Theor. Nanosci., 5, pp2089-2095, 2008 ( Link) Belkin A. V., Novosad V., Iavarone M., Pearson J. and Karapetrov G., "Superconductor/Ferromagnet Bilayers: Influence of Magnetic Domain Structure on Vortex Dynamics," Phys. Rev. B, 77, pp180506-180509, 2008 ( Link)


Sector 9 | Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Acknowledgement: Work at the CMC Beamlines is supported in part by the Office of Basic Energy Sciences of the U.S. Dept. of Energy and by the National Science Foundation Division of Materials Research. Use of the Advanced Photon Source is supported by the Office of Basic Energy Sciences of the U.S. Department of Energy under Contract No. W-31-109-Eng-38. 2007: T. Gog, D.M. Casa, I. Kuzmenko, R.J. Krakora, T.B. Bolin, "Windowless transition between atmospheric pressure and high vacuum via differential pumping for synchrotron radiation applications," J. Synchrotron Rad. 14 (4), July, 339-344 (2007). DOI: 10.1107/S0909049507016317 J.P. Hill, D.S. Coburn, Y.-J. Kim, T. Gog, D.M. Casa, C.N. Kodituwakku, H. Sinn, "A 2m inelastic X-ray scattering spectrometer at CMC-XOR, Advanced Photon Source," J. Synchrotron Rad. 14 (4), July, 361-365 (2007). DOI: 10.1107/S0909049507018006


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 – 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.


Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


From networked publics to issue publics: reconsidering the public/private distinction in web science  

Science Conference Proceedings (OSTI)

As an increasing part of everyday life becomes connected with the web in many areas of the globe, the question of how the web mediates political processes becomes still more urgent. Several scholars have started to address this question by thinking about ... Keywords: Dewey, Facebook, democracy, issue publics, networked publics, public/private, social media

Andreas Birkbak



Public Order and Safety Buildings  

U.S. Energy Information Administration (EIA) Indexed Site

Order and Safety Order and Safety Characteristics by Activity... Public Order and Safety Public order buildings are those used for the preservation of law and order or public safety. Basic Characteristics [ See also: Equipment | Activity Subcategories | Energy Use ] Public Order and Safety Buildings... Volunteer fire stations tend not to be government owned, which probably explains why 33 percent of public order and safety buildings were not owned by Federal, state, or local governments. Only 7 percent of all public order and safety buildings were constructed in the 1990's. The Northeast Census region had a high concentration of public order and safety buildings—43 percent of these buildings are in the Northeast (while the Northeast region contained only 9 percent of all commercial buildings).


PSERC Public Webinar  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Transmission Design at the National Level: Transmission Design at the National Level: Benefits, Risks and Possible Paths Forward James D. McCalley Professor, Electrical and Computer Engineering Iowa State University PSERC Public Webinar Tuesday, January 24, 2012 2:00-3:00 p.m. Eastern Time (11:00-12:00 p.m. Pacific) [Note: a poster on this work is available on the PSERC website: Dec. 7 Workshop Poster, PDF 583KB. The white paper associated with this webinar will be available on the PSERC website in advance of the webinar.] Description Today, the ability to move electric energy interregionally is limited to the capacity of the existing transmission system, a system designed largely to serve intraregional needs from fossil- and nuclear- based generation for which production costs are relatively flat from one region to another. In contrast, the


Energy Analysis Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Analysis > Product List Analysis > Product List HeaderLine Energy Analysis Publications Products BRIEFS: Showing Results 1 to 5 of 23 Role of Alternative Energy Sources: Nuclear Technology Assessment Brief (Aug 2012) Role of Alternative Energy Sources: Hydropower Technology Assessment Brief (Aug 2012) Role of Alternative Energy Sources: Geothermal Technology Assessment Brief (Aug 2012) Role of Alternative Energy Sources: Solar Thermal Technology Assessment Brief (Aug 2012) Role of Alternative Energy Sources: Wind Technology Assessment Brief (Aug 2012) View All MODELS/TOOLS: Showing Results 1 to 5 of 23 Power Plant Flexible Model (Nov 2013) NETL Upstream Dashboard Tool (Aug 2012) Power Systems Life Cycle Analysis Tool (Power LCAT) (Jun 2012) Life Cycle Greenhouse Gas Analysis of Advanced Jet Propulsion Fuels: Fischer-Tropsch Based SPK-1 Case Study - Model (Dec 2011)


Marshall D. Newton Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Marshall D. Newton Marshall D. Newton Recent Publications 138. Modeling Donor/Acceptor Interactions: Combined Roles of Theory and Computation M. D. Newton Int. J. Quant. Chem. 77, 255-263 (2000) 139. Estimation of Electron Transfer Distances from AM1 Calculations S. F. Nelson and M. D. Newton J. Phys. Chem. A104, 10023-31 (2000) 140. An Informative Subtlety of Temperature-Jump or Coulostatic Responses for Surface-Attached Species J. F. Smalley, M. D. Newton and S. W. Fledberg Electrochem. Commun. 2, 832-38 (2000) 141. Electron Transfer: Theoretical Models and Computational Implementation M. D. Newton In Electron Transfer in Chemistry, Vol I, Ed., V. Balzani .; Wiley-VCH Verlag GmbH: Weinhein, Germany, 2001, p3 142. Adiabatic Interfacial Electron Transfer over 26 Ã… through


Energy Analysis Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Analysis Analysis Life Cycle Analysis Energy Analysis Publications NEW RELEASES Perspective on the U.S. Coal Industry Perspective on the U.S. Coal Industry [PPSX - 3.09MB] (Dec 2013) Novel CO2 Utilization Concepts: Working Paper Novel CO2 Utilization Concepts: Working Paper [ZIP - 4MB] (Nov 2013) Contact: Gavin Pickenpaugh Contact: Robert James This presentation provides an overview of the coal industry, focusing on the United States, but within a global context.... Read More Working Report on CO2 Utilization Concepts, detailing screening and detailed studies of concepts using CO2 for product g... Read More Power Plant Flexible Model Power Plant Flexible Model [2.04 - PDF] (Nov 2013) LCA XIII: The Carbon Footprint of Carbon Dioxide LCA XIII: The Carbon Footprint of Carbon Dioxide


NETL Publications: Conference Proceedings  

NLE Websites -- All DOE Office Websites (Extended Search)

Conference Proceedings Conference Proceedings Publications Conference Proceedings 2013 Aug 20-22 Carbon Storage R&D Project Review Meeting Aug 6-7 2013 NETL Workshop on Multiphase Flow Science July 23 14th Annual SECA Workshop July 8-11 NETL CO2 Capture Technology Meeting June 11-13 University Coal Research/Historically Black Colleges and Universities and other Minority Institutions Contractors Review Meeting 2012 Oct 2-4 2012 University Turbine Systems Research Workshop Aug 21-23 Carbon Storage R&D Project Review Meeting July 24-27 13th Annual SECA Workshop July 9-12 2012 NETL CO2 Capture Technology Meeting May 30-31 2012 University Coal Research/ Historically Black Colleges and Universities and Other Minority Institutions Contractors Review Conference April 17-19 The 26th Annual Conference on Fossil Energy Materials


PSERC Public Webinar  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Cyber-Physical Systems Security for the Smart Grid Cyber-Physical Systems Security for the Smart Grid Manimaran Govindarasu Professor, Electrical and Computer Engineering Iowa State University PSERC Public Webinar Tuesday, February 7, 2012 2:00-3:00 p.m. Eastern Time (11:00-12:00 p.m. Pacific) [Note: a poster on this work is available on the PSERC website: Dec. 7 Workshop Poster, PDF 763KB. The white paper associated with this webinar will be available on the PSERC website in advance of the webinar.] Description One thing that virtually all of the information hierarchy components must deal with is cyber and physical security. This webinar (and the associated white paper) focuses on identifying a comprehensive set of cyber security challenges and the need for security at multiple levels of the cyber-physical power system,


EIS-0431: Extension of public comment period; Notice of public...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Notice of public hearing; Correction Hydrogen Energy California's Integrated Gasification Combined Cycle and Carbon Capture and Sequestration Project, CA On Monday, August 26,...


Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: © 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Recent Publications | Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

Entries in the APS Publications Database for the week ending 12.29.2013 Entries in the APS Publications Database for the week ending 12.29.2013 This list of entries in the APS Publications Database includes Journal Articles (9,007), Conference Proceedings (7), Books (4), and Book Chapters (76), and Dissertations (0). This list of entries in the APS Publications Database does not include abstracts, invited talks, awards, magazine articles, or patents. For the complete list, search the APS Publications Database. Inquiries about or submissions to the publications database should be directed to apspubs@aps.anl.gov. Journal Article Z. Aabdin, N. Peranio, O. Eibl, Tö W. llner, K. Nielsch, D. Bessas, R.P. Hermann, M. Winkler, Kö J. nig, Bö H. ttner, V. Pacheco, J. Schmidt, A. Hashibon, Elsä C. sser, Nanostructure, Excitations, and Thermoelectric


Publications - Center for Transportation Analysis  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Publications are by year in alphabetical order by lead author. If you need additional assistance, please contact Debbie Bain. Note: Many publications prior to 1999 are not available electronically and can be obtained by contacting the author. CTA Publications are listed by Year [2013] [2012] [2011] [2010] [2009] [2008] [2007] [2006] [2005] [2004] [2003] [2002] [2001] [2000] [1999] [1998] [1997] [1996] [1995] 2013 Publications Malikopoulos, A.A., "Impact of Component Sizing in Plug-In Hybrid Electric Vehicles for Energy Resource and Greenhouse Emissions Reduction,"ASME Journal of Energy Resources Technology, Vol. 135, No. 4, 2013, pp. 041201-041209. Malikopoulos, A.A. and Aguilar, J.P., "An Optimization Framework for Driver Feedback Systems,"IEEE Transactions on Intelligent Transportation Systems, Vol. 14, No. 2, 2013, pp. 955-964.


Recent Publications | Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

Entries in the APS Publications Database for the week ending 01.05.2014 Entries in the APS Publications Database for the week ending 01.05.2014 This list of entries in the APS Publications Database includes Journal Articles (9,003), Conference Proceedings (7), Books (4), and Book Chapters (76), and Dissertations (0). This list of entries in the APS Publications Database does not include abstracts, invited talks, awards, magazine articles, or patents. For the complete list, search the APS Publications Database. Inquiries about or submissions to the publications database should be directed to apspubs@aps.anl.gov. Journal Article Z. Aabdin, N. Peranio, O. Eibl, Tö W. llner, K. Nielsch, D. Bessas, R.P. Hermann, M. Winkler, Kö J. nig, Bö H. ttner, V. Pacheco, J. Schmidt, A. Hashibon, Elsä C. sser, Nanostructure, Excitations, and Thermoelectric


Public Involvment Plan - Rifle, Colorado  

Office of Legacy Management (LM)

4-TAR 4-TAR MAC-GWRIF 7.1 UMTRA Ground Water Project Public Involvement Plan for the Environmental Assessment of Ground Water Compliance at the New and Old Rifle, Colorado, Uranium Mill Tailings Sites May 1999 Prepared by U.S. Department of Energy Grand Junction Office Grand Junction, Colorado Work performed under DOE Contract No. DE-AC13-96GJ87335 Public Involvement Plan for the Rifle UMTRA Sites Page 2 Introduction This Public Involvement Plan is tiered to the Uranium Mill Tailings Remedial Action (UMTRA) Ground Water Project Public Participation Plan dated October 1997. This Public Involvement Plan applies to both the Old and New Rifle, Colorado, UMTRA Project sites and details the activities that have been or will be carried out to meet the public participation requirements of the


Microsoft Word - Final AVTA_V2G_Power_Flow_Report 09-15-12.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

near its generation site, thereby reducing lost energy through transmission. APS Arizona Public Service ConEd Con Edison DG distributed generation DTE Detroit Edison EV...


DUF6 EIS Public Comment Form  

NLE Websites -- All DOE Office Websites (Extended Search)

Public Comment Form Public Comment Form The public comment period for the Depleted UF6 Supplemental Analysis is closed. The public comment form is no longer available. Sorry The...


Synthetic and Mechanistic Chemistry publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Synthetic and Mechanistic Synthetic and Mechanistic publications Research into alternative forms of energy, especially energy security, is one of the major national...


2007 Solar Decathlon Technical Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

2007 Solar Decathlon Citations from Select Technical Publications Changing Behaviors: Market Transformation Web Sites as Online Narrative Hicks, D. Panel 6 - Market Transformation:...


Fuel Cell Technologies Office: Educational Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Educational Educational Publications to someone by E-mail Share Fuel Cell Technologies Office: Educational Publications on Facebook Tweet about Fuel Cell Technologies Office: Educational Publications on Twitter Bookmark Fuel Cell Technologies Office: Educational Publications on Google Bookmark Fuel Cell Technologies Office: Educational Publications on Delicious Rank Fuel Cell Technologies Office: Educational Publications on Digg Find More places to share Fuel Cell Technologies Office: Educational Publications on AddThis.com... Publications Program Publications Technical Publications Educational Publications Newsletter Program Presentations Multimedia Conferences & Meetings Webinars Data Records Databases Glossary Quick Links Hydrogen Production Hydrogen Delivery Hydrogen Storage

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


City of Detroit - SmartBuildings Detroit Green Fund Loan | Open...  

Open Energy Info (EERE)

insulation, glazing treatments, windows, doors, weatherstripping, insulated roofs, solar panels, geothermal installations, wind, hydroelectric, thermal load reduction, HVAC,...


Prior NIST Work in Public Safety Communications  

Science Conference Proceedings (OSTI)

... Prior NIST Work in Public Safety Communications. ... Distributed Testbed for First Responders; Guide to Public Safety Communication Technologies.



American Municipal Power (Public Electric Utilities) - Residential...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

American Municipal Power (Public Electric Utilities) - Residential Efficiency Smart Program (Ohio) American Municipal Power (Public Electric Utilities) - Residential Efficiency...


Developer American Public Transportation Association | Open Energy...  

Open Energy Info (EERE)

value "American Public Transportation Association" 2011 APTA Public Transportation Fact Book + Quantifying Greenhouse Gas Emissions from Transit + Property: Developer Value:...


Environmental Justice and Public Participation Through Technology...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Environmental Justice and Public Participation Through Technology- Building Community Capacity Environmental Justice and Public Participation Through Technology- Building Community...


Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Public Scoping Meeting Public Scoping Meeting David Levenstein  

Office of Legacy Management (LM)

Public Scoping Public Scoping Meeting Public Scoping Meeting David Levenstein EIS Document Manager David Levenstein EIS Document Manager 2 About Tonight's Scoping Meeting * Scoping is a required step in the National Environmental Policy Act (NEPA) process for preparing an environmental impact statement (EIS). * Scoping is the process of determining the subjects that will be considered and evaluated in an EIS. * Public comments - both oral and written - received during the scoping period are taken into account when decisions are made about the issues and alternatives to be analyzed in an EIS. * The scoping period for the Mercury Storage EIS began with publication in the Federal Register of DOE's Notice of Intent to prepare the Mercury Storage EIS on July 2, 2009; ends on August 17, 2009.


Publications on maglev technologies  

Science Conference Proceedings (OSTI)

Magnetically levitated passenger-transportation vehicles, using attractive and repulsive magnetic forces, are currently in the development or prototype-revenue stages in Japan and Germany. The basic principles of these technologies have been understood for several decades, but their practical applications awaited advances in high-power electronic devices, modern controls, superconducting magnets, and improvements in our transportation infrastructures. A considerable amount of work was devoted to magnetic-levitation (maglev) transportation system in the late 1960s and the 1970s. Detailed development was sustained primarily in Germany and Japan. This listing of publications was begun as the initial phase of a design study for a maglev development facility sponsored by the State of Illinois. The listing has been continually updated under programs sponsored by the Federal Railroad Administration and the US Army Corps of Engineers. In 1991, the National Maglev Initiative issued 27 contracts for the study of technical issues related to maglev and four contracts for the definition of maglev systems. In December 1991, the Intermodal Surface Transportation Efficiency Act was enacted, mandating the development of a US-designed maglev system in a six-year period. This listing is offered as an aid to those working on these projects, to help them locate technical papers on relevant technologies. The design and installation of a maglev transportation system will require the efforts of workers in many disciplines, from electronics to economics to safety. Accordingly, the references have been grouped in 14 different sections to expedite review of the listing. In many case, the references are annotated to indicate the general content of the papers. Abstracts are not available. A list of information services from which the listed documents might be obtained and an author index are provided.

He, J.L.; Coffey, H.T.; Rote, D.M.; Wang, Z.



Appendix V Public Involvement Plan  

NLE Websites -- All DOE Office Websites (Extended Search)

V V Public Involvement Plan Revision No.: 6 February 2008 Federal Facility Agreement and Consent Order (FFACO) FFACO, Appendix V February 2008 i FFACO Public Involvement Plan U.S. Department of Energy National Nuclear Security Administration Nevada Site Office Las Vegas, Nevada U.S. Department of Defense Defense Threat Reduction Agency Detachment 1, Nevada Operations Mercury, Nevada U.S. Department of Energy Office of Legacy Management Grand Junction, Colorado FFACO, Appendix V February 2008 ii Preface The Public Involvement Plan serves two purposes: it provides a broad public involvement strategy, and fulfills requirements contained in the Federal Facility Agreement and Consent Order (FFACO) relating to public awareness and participation. Under the FFACO, agreed to by


Publications of LASL research, 1978  

DOE Green Energy (OSTI)

This bibliography is a compilation of unclassified publications of work done at the Los Alamos Scientific Laboratory for 1978. Papers published in 1978 are included regardless of when they were actually written. Publications received too late for inclusion in earlier compilations are also listed. Declassification of previously classified reports is considered to constitute publication. All classified issuances are omitted. If a paper was published more than once, all places of publication are included. The bibliography includes Los Alamos Scientific Laboratory reports, papers released as non-LASL reports, journal articles, books, chapters of books, conference papers (whether published separately or as part of conference proceedings issued as books or reports), papers published in congressional hearings, theses, and US patents. Publications by LASL authors that are not records of Laboratory-sponsored work are also included.

Willis, J.K.; Salazar, C.A. (comps.)



NREL: Concentrating Solar Power Research - Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications NREL develops publications, including technical reports and papers, about its R&D activities in concentrating solar power, as well as related information. Below you'll find a list of selected NREL publications concerning these activities. Also see TroughNet's publications on parabolic trough technology, and market and economic assessment. For other NREL concentrating solar power publications, you can search NREL's Publications Database. Selected Publications These publications are available as Adobe Acrobat PDFs. Utility-Scale Power Tower Solar Systems: Performance Acceptance Test Guidelines NREL Subcontract Report Author: David Kearney - Kearney & Associates Publication Date: March 2013 Simulating the Value of Concentrating Solar Power with Thermal Energy


Public Affairs | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

The National Nuclear Security Administration The National Nuclear Security Administration Public Affairs Home > Field Offices > Welcome to the Sandia Field Office > Public Affairs Public Affairs The SFO Public Affairs Director is responsible for all public affairs matters connected with the functions of SFO. In this capacity the Public Affairs Director is responsible for the development and management of the SFO public affairs programs including media relations, community relations, tribal relations, public participation, government/congressional relations, protocol, emergency public information, and internal employee communications and contractor oversight of these same programs. For public affairs assistance, please call (505) 845-5264. Printer-friendly version Printer-friendly version


Fuel Cell Technologies Office: Hydrogen Technical Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Information Resources Information Resources Printable Version Share this resource Send a link to Fuel Cell Technologies Office: Hydrogen Technical Publications to someone by E-mail Share Fuel Cell Technologies Office: Hydrogen Technical Publications on Facebook Tweet about Fuel Cell Technologies Office: Hydrogen Technical Publications on Twitter Bookmark Fuel Cell Technologies Office: Hydrogen Technical Publications on Google Bookmark Fuel Cell Technologies Office: Hydrogen Technical Publications on Delicious Rank Fuel Cell Technologies Office: Hydrogen Technical Publications on Digg Find More places to share Fuel Cell Technologies Office: Hydrogen Technical Publications on AddThis.com... Publications Program Publications Technical Publications Hydrogen Fuel Cells Safety, Codes & Standards


Index of Publications by the Nuclear Data Program - Nuclear Engineering  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications Bookmark and Share The ND staff has contributed to a number of scientific journals, conference



E-Print Network (OSTI)

Public-private partnerships (PPPs) cannot be justified because they free public funds. When PPPs are justified on efficiency grounds, the contract that optimally balances demand risk, user-fee distortions and the opportunity cost of public funds, features a minimum revenue guarantee and a revenue cap. However, observed revenue guarantees and revenue sharing arrangements differ from those suggested by the optimal contract. Also, this contract can be implemented via a competitive auction with realistic informational requirements. Finally, the allocation of risk under the optimal contract suggests that PPPs

Eduardo Engel; Ronald Fischer; Alexander Galetovic



U.S. Natural Gas Pipeline Exports by Point of Exit  

Annual Energy Outlook 2012 (EIA)

Eastport, ID 0 252 113 12 10 1998-2011 Calais, ME 0 0 2,131 452 1,028 6,952 2007-2011 Detroit, MI 22,904 27,220 43,980 44,275 43,690 50,347 1996-2011 Marysville, MI 9,158 8,756...


U.S. Natural Gas Pipeline Exports by Point of Exit  

Annual Energy Outlook 2012 (EIA)

1973-2013 Eastport, ID 2011-2011 Calais, ME 1,824 1,853 2,021 1,528 433 652 2011-2011 Detroit, MI 4,331 4,801 3,571 4,430 3,769 3,933 2011-2011 Marysville, MI 4,807 5,273 2,983...


Argonne National Laboratory 1985 publications  

Science Conference Proceedings (OSTI)

This report is a bibliography of scientific and technical 1985 publications of Argonne National Laboratory. Some are ANL contributions to outside organizations' reports published in 1985. This compilation, prepared by the Technical Information Services Technical Publications Section (TPB), lists all nonrestricted 1985 publications submitted to TPS by Laboratory's Divisions. The report is divided into seven parts: Journal Articles - Listed by first author, ANL Reports - Listed by report number, ANL and non-ANL Unnumbered Reports - Listed by report number, Non-ANL Numbered Reports - Listed by report number, Books and Book Chapters - Listed by first author, Conference Papers - Listed by first author, Complete Author Index.

Kopta, J.A. (ED.); Hale, M.R. (comp.)



Publications 2010 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 2010 References Bookmark and Share 1. Refereed Publications in Peer-reviewed Scientific Journals

Note: This page contains sample records for the topic "detroit mi public" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Publications 2006 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

6 6 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 2006 References Bookmark and Share Refereed Publications in Peer-reviewed Scientific Journals


Publications 2007 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 2007 References Bookmark and Share Refereed Publications in Peer-reviewed Scientific Journals


Mississippi Public Utility Act | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mississippi Public Utility Act Mississippi Public Utility Act Mississippi Public Utility Act < Back Eligibility Commercial Construction Developer General Public/Consumer Industrial Investor-Owned Utility Municipal/Public Utility Rural Electric Cooperative Utility Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State Mississippi Program Type Industry Recruitment/Support Siting and Permitting Provider Public Service Commission The Mississippi Public Utility Act is relevant to any project that plans to generate energy. It requires that a utility must first obtain a Certificate of Public Convenience and Necessity (CPCN) from the Mississippi Public Service Commission (PSC) before commencing construction of a new electric


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Recent Publications | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Recent Publications Recent Publications Recent Publications November 1, 2013 - 11:40am Addthis Learn more about DOE's Combined Heat and Power (CHP) Program and CHP's potential benefits to the nation by downloading these recent publications. Guide to Using Combined Heat and Power for Enhancing Reliability and Resiliency in Buildings, 20 pp*, September 2013 Capturing Waste Gas: Saves Energy, Lowers Costs - Case Study, 2 pp*, July 2013 Combined Heat and Power System Achieves Millions in Cost Savings at Large University - Case Study, 4 pp*, May 2013 Tapping Landfill Gas to Provide Significant Energy Savings and Greenhouse Gas Reductions - Case Study, 4 pp*, Apr. 2013 Combined Heat and Power System Enables 100% Reliability at Leading Medical Campus - Case Study, 4 pp*, Mar. 2013 CHP: Enabling Resilient Energy Infrastructure for Critical


Recent Publications | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Recent Publications Recent Publications Recent Publications November 1, 2013 - 11:40am Addthis Learn more about DOE's Combined Heat and Power (CHP) Program and CHP's potential benefits to the nation by downloading these recent publications. Guide to Using Combined Heat and Power for Enhancing Reliability and Resiliency in Buildings, 20 pp*, September 2013 Capturing Waste Gas: Saves Energy, Lowers Costs - Case Study, 2 pp*, July 2013 Combined Heat and Power System Achieves Millions in Cost Savings at Large University - Case Study, 4 pp*, May 2013 Tapping Landfill Gas to Provide Significant Energy Savings and Greenhouse Gas Reductions - Case Study, 4 pp*, Apr. 2013 Combined Heat and Power System Enables 100% Reliability at Leading Medical Campus - Case Study, 4 pp*, Mar. 2013 CHP: Enabling Resilient Energy Infrastructure for Critical


Federal Energy Management Program: Publications  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Advanced Search Browse by Topic Mail Requests Help Software FAQs Feature featured product thumbnail Federal Energy Management Program Overview - Facilitating Sound, Cost-Effective Energy Management Details Bookmark & Share View Related Welcome to the Federal Energy Management Program's (FEMP) publication and product library. Use this database to: Search for FEMP publications and products View or download publications Request hard copies of select publications and products. Search the Library Search (Searches Title, Description, Filename and Keywords) Advanced Search Browse by Topic Most Popular Energy Savings Performance Contract (ESPC) ENABLE Program The Energy Savings Performance Contract (ESPC) ENABLE program, a new project funding approach, allows small Federal facilities to realize energy and water savings in six months or less. ESPC ENABLE pr Details Bookmark & Share


Publications | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Center » [all items] Center » [all items] Site Map Printable Version Development Adoption Compliance Regulations Resource Center FAQs Publications Resource Guides eLearning Model Policies Glossary Related Links ACE Learning Series Utility Savings Estimators Publications To receive updates about BECP publications subscribe to the BECP Mailing List. Additional resources are also available from the Building America Solution Center. 189.1 Progress Indicator Report Energy Use Comparison between 189.1-2009 and 90.1-2010 Document type: Presentation Publication Date: June 2011 Focus: Code Development, Green and Advanced Codes Presentation given at the ASHRAE Annual Meeting, ASHRAE Standard 189.1 Committee; June 29, 2011; Montreal Canada.Main topics included: Progress Indicator and Prototype Models developed by Pacific


Publications 1997 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 1997 References Bookmark and Share Donald L. Smith and Andreas Fessler


Publications 2002 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 2002 References Bookmark and Share M. Danchev, D.J. Hartley, F.G. Kondev, M.P. Carpenter, R.V.F.


Publications 2008 - Nuclear Data Program - Nuclear Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 Nuclear Data Program Overview Current Projects & Recent Activities Collaborating Organizations Publications [Publications 2011] [Publications 2010] [Publications 2009] [Publications 2008] [Publications 2007] [Publications 2006] [Publications 2005] [Publications 2004] [Publications 2003] [Publications 2002] [Publications 2001] [Publications 2000] [Publications 1999] [Publications 1998] [Publications 1997] [Other Publications] Nuclear Data Measurements (NDM) Reports Experimental Nuclear Data Resources Contact ND Program Related Resources Other Major Programs Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE Division on Flickr Nuclear Data Program Publications: 2008 References Bookmark and Share F.G. Kondev Nuclear Data Sheets for A=206



Annual Energy Outlook 2012 (EIA)

1983(3) is- sue of the PMM). Therefore, there may be some mi- nor discontinuity in price estimates between August 1988 and September 1988 and between December 1983 and...


Publications on Energy Policy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Publications on Energy Policy Publications on Energy Policy Get information on clean energy policy in publications produced by the U.S. Department of Energy (DOE) and the National...


Public School Transportation National and Regional  

E-Print Network (OSTI)

..............................................................................1 II. West Virginia's Public School Transportation Funding SystemPublic School Transportation National and Regional Perspectives: An Update Presented to Education Subcommittee C ­ Public School Finance January 2009 Amy Higginbotham Jared Pincin Dr. Tami Gurley-Calvez Dr

Mohaghegh, Shahab


Clean Cities: Tips for Public Outreach  

NLE Websites -- All DOE Office Websites (Extended Search)

Tips for Public Outreach to someone by E-mail Share Clean Cities: Tips for Public Outreach on Facebook Tweet about Clean Cities: Tips for Public Outreach on Twitter Bookmark Clean...


Butler Public Power District | Open Energy Information  

Open Energy Info (EERE)

Public Power District (Redirected from Butler County Rural P P D) Jump to: navigation, search Name Butler Public Power District Place Nebraska Utility Id 2643 Utility Location Yes...


DUF6 Draft EIS Public Hearing Transcripts  

NLE Websites -- All DOE Office Websites (Extended Search)

Depleted UF6 Draft EIS Public Hearing Transcripts Transcripts from the DUF6 Conversion Draft EIS Public Hearings The following transcripts are from the DUF6 Conversion...


Coldwater Board of Public Utilities - Commercial & Industrial...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

here Home Savings Coldwater Board of Public Utilities - Commercial & Industrial Lighting Rebate Program Coldwater Board of Public Utilities - Commercial & Industrial Lighting...


Building Technologies Office: Reports and Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

on Twitter Bookmark Building Technologies Office: Reports and Publications on Google Bookmark Building Technologies Office: Reports and Publications on Delicious Rank...


Nuclear Science | Publications and Reports | ORNL  

NLE Websites -- All DOE Office Websites (Extended Search)

NSED Monthly Reports Reactor and Nuclear Systems Publications News and Awards Nuclear Science Home | Science & Discovery | Nuclear Science | Publications and Reports SHARE...