Powered by Deep Web Technologies
Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and… (more)

Yun, Michael



Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


Connecting Culture and Nature in Detroit's Downtown Core: The Design of a Technical College Campus.  

E-Print Network (OSTI)

??This thesis addresses the City of Detroit`s transformation from a thriving center of trade and commerce to its present abandoned state. Due to the decentralization… (more)

Braithwaite, Peter




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The mechanics of race : the discursive production of Detroit's landscape of difference.  

E-Print Network (OSTI)

??Positioning Detroit's "post-industrial" landscape as anything but "natural", this work seeks to understand and engage the racialized production of Detroit in the urban spatial imaginary… (more)

Kinney, Rebecca J.



Clean Cities: Detroit Clean Cities coalition  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Detroit Clean Cities Coalition Detroit Clean Cities Coalition The Detroit Clean Cities coalition works with vehicle fleets, fuel providers, community leaders, and other stakeholders to reduce petroleum use in transportation. Detroit Clean Cities coalition Contact Information Aaron Champion 734-585-5720 x23 aaron@cec-mi.org Coalition Website Clean Cities Coordinator Aaron Champion Photo of Aaron Champion Aaron Champion is the Coordinator for Detroit Area Clean Cities and a Project Manager with Clean Energy Coalition, where he works on sustainable transportation solutions. Previously, he served as Programs Representative between the U.S. Department of Energy and the Oklahoma Department of Commerce, where he implemented and monitored more than 70 energy efficiency and alternative fuel vehicle projects. Additionally, Champion provided


Detroit blues women.  

E-Print Network (OSTI)

??ABSTRACT DETROIT BLUES WOMEN by Michael Duggan Murphy August 2011 Advisor: Dr. John J. Bukowczyk Major: History Degree: Doctor of Philosophy "Detroit Blues Women" explores… (more)

Murphy, Michael Duggan



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Detroit: Mapping a New Narrative.  

E-Print Network (OSTI)

??This thesis identifies the attractors of Detroit’s growth and divulges into the cultural, federal, socio-economic and urban deterrents that have afflicted Detroit for the past… (more)

Bedard, Joshua



Detroit as linear city.  

E-Print Network (OSTI)

??Detroit is a city in decline. Through strategic withdrawal into a linear city its main artery -Woodward Avenue- becomes an assembly line that holds different… (more)

Kuys, J.I.



Detroit : open city.  

E-Print Network (OSTI)

??Detroit is often regarded as America's largest city in decline, a metropolis that has failed to recover from an insidious cycle of deindustrialization, racism, suburban… (more)

Berry, Daniel (Daniel Kevin)



Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Sustaining development in Detroit  

E-Print Network (OSTI)

The intent of this thesis is to propose a strategy for stabilizing and increasing the disparate pieces of development that form the traces of the once great industrial city of Detroit. It focuses primarily on Fordism as a ...

Resnick, Noah Samuel, 1977-



Detroit : open city  

E-Print Network (OSTI)

Detroit is often regarded as America's largest city in decline, a metropolis that has failed to recover from an insidious cycle of deindustrialization, racism, suburban flight and laggard politics. This image of the city ...

Berry, Daniel (Daniel Kevin)



Identifying Detroit: Representing Tension, Conflict, and Hope in Detroit Architecture.  

E-Print Network (OSTI)

??Since the 1950s, Detroit's businesses and residents have been steadily migrating to the suburbs, taking with them much of the cultural, social, and economic diversity… (more)




DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


Reclaiming the Ruin: Detroit's Second Coming?  

E-Print Network (OSTI)

13. 22. Ibid. 23. Solnit, “Detroit Arcadia,” p. 70. Above:2/3 (1977), pp. 3-23. 7. “Detroit. Demolition. Disneyland. :Lot! ” ”12. Rebecca Solnit, “Detroit Arcadia: Exploring the

Moon, Whitney



Detroit: Return of the cityzen.  

E-Print Network (OSTI)

??Detroit has steadily declined as a city since the height of its greatness in the 1950s. Deindustrialization, suburbanization, divisive racism, and disenfranchisement have taken a… (more)

Ratkowski, Eric



PP-221 Detroit Edison Company  

Energy.gov (U.S. Department of Energy (DOE))

Presidential Permit authorizing Detroit Edison Company to construct, operate and maintain electric transmission facilities at the U.S. - Canada border.


The Heidelberg Project - Detroit, Michigan [EDRA / Places Awards, 2004 -- Design  

E-Print Network (OSTI)

The Heidelberg Project — Detroit, Michigan Tyree Guytona kid in a broken family, Detroit artist Tyree Guyton woreWhen Guyton was a child, Detroit burned; he still remembers

Nasar, Jack; Moffat, David



Detroit, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Michigan: Energy Resources Michigan: Energy Resources (Redirected from Detroit, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.331427°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.331427,"lon":-83.0457538,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


City of Detroit - SmartBuildings Detroit Grant Program | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Detroit - SmartBuildings Detroit Grant Program City of Detroit - SmartBuildings Detroit Grant Program City of Detroit - SmartBuildings Detroit Grant Program < Back Eligibility Commercial Institutional Local Government Multi-Family Residential State Government Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Sealing Your Home Cooling Other Design & Remodeling Windows, Doors, & Skylights Heat Pumps Appliances & Electronics Commercial Lighting Lighting Insulation Water Buying & Making Electricity Solar Water Heating Wind Maximum Rebate 25% of eligible costs Program Info Expiration Date 06/02/2013 State Michigan Program Type Local Grant Program Provider City of Detroit '''''Note: This program is no longer accepting applications. Check the


Detroit Commuter Hydrogen Project  

Science Conference Proceedings (OSTI)

This project was undertaken to demonstrate the viability of using hydrogen as a fuel in an internal combustion engine vehicle for use as a part of a mass transit system. The advantages of hydrogen as a fuel include renew-ability, minimal environmental impact on air quality and the environment, and potential to reduce dependence on foreign energy sources for the transportation sector. Recognizing the potential for the hydrogen fuel concept, the Southeast Michigan Congress of Governments (SEMCOG) determined to consider it in the study of a proposed regional mass transit rail system for southeast Michigan. SEMCOG wanted to evaluate the feasibility of using hydrogen fueled internal combustion engine (H2ICE) vehicles in shuttle buses to connect the Detroit Metro Airport to a proposed, nearby rail station. Shuttle buses are in current use on the airport for passenger parking and inter-terminal transport. This duty cycle is well suited to the application of hydrogen fuel at this time because of the ability to re-fuel vehicles at a single nearby facility, overcoming the challenge of restricted fuel availability in the undeveloped hydrogen fuel infrastructure. A cooperative agreement between SEMCOG and the DOE was initiated and two H2ICE buses were placed in regular passenger service on March 29, 2009 and operated for six months in regular passenger service. The buses were developed and built by the Ford Motor Company. Wayne County Airport Authority provided the location for the demonstration with the airport transportation contractor, Metro Cars Inc. operating the buses. The buses were built on Ford E450 chassis and incorporated a modified a 6.8L V-10 engine with specially designed supercharger, fuel rails and injectors among other sophisticated control systems. Up to 30 kg of on-board gaseous hydrogen were stored in a modular six tank, 350 bar (5000 psi) system to provide a 150 mile driving range. The bus chassis and body were configured to carry nine passengers with luggage. By collecting fuel use data for the two H2ICE buses, with both written driver logs and onboard telemetry devices, and for two conventional propane-gasoline powered buses in the same service, comparisons of operating efficiency and maintenance requirements were completed. Public opinion about the concept of hydrogen fuel was sampled with a rider survey throughout the demonstration. The demonstration was very effective in adding to the understanding of the application of hydrogen as a transportation fuel. The two 9 passenger H2ICE buses accumulated nearly 50,000 miles and carried 14,285 passengers. Data indicated the H2ICE bus fuel economy to be 9.4 miles/ gallon of gasoline equivalent (m/GGE) compared to the 10 passenger propane-gasoline bus average of 9.8 m/GGE over 32,400 miles. The 23- passenger bus averaged 7.4 m/GGE over 40,700 miles. Rider feedback from 1050 on-board survey cards was overwhelmingly positive with 99.6% indicating they would ride again on a hydrogen powered vehicle. Minimal maintenance was required for theses buses during the demonstration project, but a longer duration demonstration would be required to more adequately assess this aspect of the concept.

Brooks, Jerry; Prebo, Brendan



Transit-Oriented Development in Detroit.  

E-Print Network (OSTI)

??Working with the Detroit Department of Transportation, this project outlines a Transit?Oriented Development (TOD) plan in conjunction with the impending Woodward Avenue Light Rail Train… (more)

De Silva, Lauren; Krueger, Allison; Lee, Angela; Mansoor, Paul


Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Converging Identities: Islamic Architecture in Detroit.  

E-Print Network (OSTI)

??The development of identity and place within the Detroit Muslim community is explored in this thesis through the creation of an Islamic Center and research… (more)

Chinchilla, Najahyia Luna



Detroit Neighbourhood Stabilization: Burdens Become Assets.  

E-Print Network (OSTI)

??Detroit is just one example of a post-industrial city that has been struggling with the decline of the American industrial economy. In the past 100… (more)

Rutherford, Michael



Detroit Public Lighting Department - Commercial and Industrial...  

Open Energy Info (EERE)

with form History Share this page on Facebook icon Twitter icon Detroit Public Lighting Department - Commercial and Industrial Energy Wise Program This is the approved...


DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Where the Heart Is? A Geographic Analysis of Working-class Cultures in Detroit Neighborhoods, 1953  

E-Print Network (OSTI)

Peterson 1954. City of Detroit Election Commission. 1952.Precinct Level. Microfilm. Detroit City Hall. Clawson, Dan.You!" Footnotes 24:1,4. Detroit Metropolitan Area Traffic

Stepan-Norris, Judith; Southworth, Caleb



City of Detroit - SmartBuildings Detroit Green Fund Loan | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Detroit - SmartBuildings Detroit Green Fund Loan City of Detroit - SmartBuildings Detroit Green Fund Loan City of Detroit - SmartBuildings Detroit Green Fund Loan < Back Eligibility Commercial Institutional Local Government Multi-Family Residential State Government Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Sealing Your Home Cooling Other Heat Pumps Appliances & Electronics Commercial Lighting Lighting Insulation Design & Remodeling Windows, Doors, & Skylights Water Buying & Making Electricity Energy Sources Solar Water Heating Wind Maximum Rebate 40% of eligible costs, up to $100,000 Program Info Funding Source The American Reinvestment and Recovery Act (ARRA) of 2009; State Energy Program State Michigan Program Type Local Loan Program


“Straight Up Detroit Shit”: Genre, Authenticity, and Appropriation in Detroit Ghettotech.  

E-Print Network (OSTI)

??This thesis is an analysis of the genre of Detroit dance music known as ghettotech based primarily on ethnographic data collected from music producers and… (more)

Mueller, Gavin C.



Detroit politics in a global perspective: a Marxist analysis of the 2009 Detroit mayoral primary.  

E-Print Network (OSTI)

??The 2009 Detroit mayoral primary ballot listed a candidate named D'Artagnon Collier. Collier is a member of the Socialist Equality Party. This thesis analyzes the… (more)

Stephens, Christopher Cody



Detroit Edison Co | Open Energy Information  

Open Energy Info (EERE)

Detroit Edison Co Detroit Edison Co Place Detroit, Michigan Utility Id 5109 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Retail Marketing Yes Activity Bundled Services Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] SGIC[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Detroit Edison Company Smart Grid Project was awarded $83,828,878 Recovery Act Funding with a total project value of $167,657,756.


Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

What&039;s your energypledge? What's your EnergyPledge? 1. Secretary Chu at the Detroit Auto Show Snapshots of the Year in Energy: 12 Awesome Photos from 2012 Day 12: Drive...


Southern California: The Detroit of Electric Cars?  

E-Print Network (OSTI)

University o f An early alternative to an electric car.CALIFORNIA: THE DETROIT O F ELECTRIC CARS? BY A L L E N J .center for producing electric cars? It's a mistake to assume

Scott, Allen J.



Detroit -- Focus: HOPE Center for Advanced Technologies [The Place of Work  

E-Print Network (OSTI)

troubled economic times. In Detroit, an abandoned, 50-year-by Focus: MOPE, a Detroit civil rights organization. CAT's

Bressi, Todd W; Marcus, Galith S



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Auto Show 2012 Detroit Auto Show 2012 Detroit Auto Show 2012 Addthis 1 of 10 Energy Secretary Steven Chu with Chrysler Chief Executive Sergio Marchionne. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 2 of 10 Energy Secretary Steven Chu examines the Dodge Dart's four cylinder, 2.4-liter, 184 horsepower engine block. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 3 of 10 Energy Secretary Steven Chu gets behind the wheel of the new 2013 Dodge Dart. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 4 of 10 Energy Secretary Steven Chu examines the interior of the new 2013 Dodge Dart. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 5 of 10 Energy Secretary Steven Chu discusses the latest auto innovations with a


Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Economic Club -- As Prepared for Detroit Economic Club -- As Prepared for Delivery Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for Delivery January 11, 2012 - 9:30am Addthis Thank you, President Simon, for the introduction. I also want to thank the Detroit Economic Club for hosting me. For more than 75 years, the Detroit Economic Club has promoted thoughtful conversation on the important issues facing Michigan and our country, and I am pleased to be a part of that tradition. Finally, I want to recognize Michigan's congressional delegation for its tireless work on behalf of the state's families and industries. It's an exciting time to be in Detroit, the heart of America's auto industry. Yesterday, I toured the auto show and saw the amazing products that will hit the roads soon. What began more than a century ago as a


Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chu's Remarks at Detroit Economic Club -- As Prepared for Chu's Remarks at Detroit Economic Club -- As Prepared for Delivery Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for Delivery January 11, 2012 - 9:30am Addthis Thank you, President Simon, for the introduction. I also want to thank the Detroit Economic Club for hosting me. For more than 75 years, the Detroit Economic Club has promoted thoughtful conversation on the important issues facing Michigan and our country, and I am pleased to be a part of that tradition. Finally, I want to recognize Michigan's congressional delegation for its tireless work on behalf of the state's families and industries. It's an exciting time to be in Detroit, the heart of America's auto industry. Yesterday, I toured the auto show and saw the amazing products that will hit the roads soon. What began more than a century ago as a


Like the Last 30 Years Never Happened: Understanding Detroit Rock Music Through Oral History.  

E-Print Network (OSTI)

??This study was conducted to better understand Detroit’s unusual amount of rock music success. From the 1960s on, Detroit has continuously produced some of the… (more)

Schmitt, Jason M.



Detroit to Durban: Black Workers' Common Struggle; Southern Africa/Black America: Same Struggles, Same Fight  

E-Print Network (OSTI)

DETROIT TO DURBAN: BlACK \\\\OOKERS CCM1>N STRUGGLE by Blackearliest parrphlet is Detroit to Durban . Although publishedstrikes of early 1973 and the Detroit riots of 1967 is a bit

Philips, John



The Social Coalition Character of the Democratic and Republican Precinct Cadres in Detroit, 1956-1984  

E-Print Network (OSTI)

Jones, Bryan D. et al. 1986 Detroit, an American city. TheThe Party Coalitions in Detroit in 1956: The Socio-Economicof Party Cadres in Detroit, 1956. Social Characteristics

Eldersveld, Samuel J.



The mechanics of race : the discursive production of Detroit's landscape of difference  

E-Print Network (OSTI)

Development, and Immigrants in Detroit, 1880-1920. Chicago:a Finer City in Postwar Detroit. Baltimore and London: TheRoss. 1985. “The Crisis of Detroit and the Emergence of

Kinney, Rebecca J.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site


Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


An Ethnographic Study of The Moth Detroit StorySLAM.  

E-Print Network (OSTI)

??The Moth Detroit StorySLAM is one of many storytelling events staged in urban bar environments. Unlike the increasingly aged audiences attending the National Storytelling Festival… (more)

Janssen, Catherine Jo



Environmental Justice and Fish Consumption Advisories on the Detroit River.  

E-Print Network (OSTI)

??The Detroit River serves as a source of recreation, food, transportation and is an international demarcation. Decades of industrial and municipal pollution have threatened this… (more)

Kalkirtz, Victoria; Martinez, Michelle



Wastewater Treatment Comes To Detroit: Law, Politics, Technology And Funding.  

E-Print Network (OSTI)

??Detroit was one of the cities identified by the International Joint Commission as polluting the Great Lakes in contravention of the Boundary Waters Treaty of… (more)

Johnson, Barry Neal



U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI : 140 : 2011-2013: Marysville, MI: 176 : 1,080: 14 : 2011-2013: St. Clair, MI: 1,562: 1,422: 2 : 26 : 2011-2013: Noyes, MN: 13,380: 14,460: 20,624: 33,889 ...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 3.80 : 4.50 : 2011-2013: Marysville, MI: 3.63: 3.65 : 4.57: 4.70 : 2011-2013: St. Clair, MI: 3.75: 3.67: 4.09: 4.41 : 4.35: 2011-2013: Noyes, MN: 3.74: 3 ...


U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 22,904: 27,220: 43,980: 44,275: 43,690: 50,347: 1996-2011: Marysville, MI: 9,158: 8,756: 14,925: 22,198: 41,964: 42,866: 1996-2011: Sault Ste. Marie, MI ...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 8.28: 6.58: 4.53: 8.37: 5.17 : 1996-2011: Marysville, MI: 7.59: 8.59: 3.80: 4.44: 4.42: 2.99: 1996-2012: St. Clair, MI: 6.97: 10.03: 5.10: 4.97: 4.29: 2 ...


U.S. Price of Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 6.88: 8.37: 4.01: 4.69: 4.26: 3.10: 1996-2012: Marysville, MI: 7.77: 7.48: 4.85: 4.87: 4.48: 3.18: 1996-2012: Sault Ste. Marie, MI: 7.13: 8.75: 5.04: 5 ...


Detroit Public Lighting Department - Residential Energy Wise Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Public Lighting Department - Residential Energy Wise Detroit Public Lighting Department - Residential Energy Wise Program Detroit Public Lighting Department - Residential Energy Wise Program < Back Eligibility Low-Income Residential Multi-Family Residential Residential Savings Category Heating & Cooling Cooling Appliances & Electronics Commercial Lighting Lighting Program Info State Michigan Program Type Utility Rebate Program Rebate Amount CFLs: $2-$10 LED Task Light: $10.00 LED Night light: $1.25 Energy Star Ceiling Fan: $10 Provider Detroit Public Lighting Department The Detroit Public Lighting Department (PLD) offers residential customers rebates for energy efficient lights. In addition, low-income residential customers may qualify for free compact fluorescent lights (CFLs). Specific rebate amounts, equipment requirements, and applications are available on


Detroit Edison Company Smart Grid Project | Open Energy Information  

Open Energy Info (EERE)

Detroit Edison Company Detroit Edison Company Country United States Headquarters Location Detroit, Michigan Recovery Act Funding $83,828,878.00 Total Project Value $167,657,756.00 Coverage Area Coverage Map: Detroit Edison Company Smart Grid Project Coordinates 42.331427°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NO. DE-FC05-00OR22805; DOE WAIVER DOCKET W(A)-01-012 ORO-764 Petitioner, Detroit Diesel Corporation, has made a timely request for an advance waiver to worldwide rights in...


Section 2: Landscapes of Capital - On Big Beaver Road: Detroit and the Diversity of American Metropolitan Landscapes  

E-Print Network (OSTI)

Center near Ann Arbor, Detroit News, April 12, 2005, p. 8.on Southern Plant,” Detroit News, October 28, 2006, p. 3.Pro?le: Michigan 2005 (Detroit: Southeast Michigan Council

Fishman, Robert



Energy Information Administration / Natural Gas Annual 2010 27  

Gasoline and Diesel Fuel Update (EIA)

7 7 Table 11. Summary of U.S. Natural Gas Exports By Point of Exit, 2006-2010 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Pipeline (Canada) Calais, ME .......................... 0 -- 0 -- 0 -- 2,131 5.62 452 4.53 Detroit, MI ........................... 22,156 7.61 22,904 6.88 27,220 8.37 43,980 4.01 44,275 4.69 Eastport, ID......................... 0 -- 0 -- 252 7.43 113 4.49 12 5.85 Marysville, MI...................... 3,483 7.36 9,158 7.77 8,756 7.48 14,925 4.85 22,198 4.87 Sault Ste. Marie, MI ............ 5,070 8.11 4,389 7.13 3,122 8.75 2,044 5.04 4,011 5.27 St. Clair, MI ......................... 286,582 7.39 418,765 7.24 492,235 8.96 612,369 4.62 650,590 4.86 Havre, MT ........................... 21,245 6.05 20,420 6.16 16,399 8.14 12,504 3.63 9,437


,"Michigan Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050MI3","N3010MI3","N3020MI3","N3035MI3","N3045MI3" "Date","Natural Gas Citygate Price in Michigan (Dollars per Thousand Cubic Feet)","Michigan Price of...


Advanced Communication and Control of Distributed Energy Resources at Detroit Edison  

DOE Green Energy (OSTI)

The project objective was to create the communication and control system, the process and the economic procedures that will allow owners (e.g., residential, commercial, industrial, manufacturing, etc.) of Distributed Energy Resources (DER) connected in parallel to the electric distribution to have their resources operated in a manner that protects the electric utility distribution network and personnel that may be working on the network. The Distribution Engineering Workstation (DEW) (a power flow and short circuit modeling tool) was modified to calculate the real-time characteristics of the distribution network based on the real-time electric distribution network information and provide DER operating suggestions to the Detroit Edison system operators so that regional electric stability is maintained. Part of the suggestion algorithm takes into account the operational availability of DER’s, which is known by the Energy Aggregator, DTE Energy Technologies. The availability information will be exchanged from DTE Energy Technologies to Detroit Edison. For the calculated suggestions to be used by the Detroit Edison operators, procedures were developed to allow an operator to operate a DER by requesting operation of the DER through DTE Energy Technologies. Prior to issuing control of a DER, the safety of the distribution network and personnel needs to be taken into account. This information will be exchanged from Detroit Edison to DTE Energy Technologies. Once it is safe to control the DER, DTE Energy Technologies will issue the control signal. The real-time monitoring of the DECo system will reflect the DER control. Multi-vendor DER technologies’ representing approximately 4 MW of capacity was monitored and controlled using a web-based communication path. The DER technologies included are a photovoltaic system, energy storage, fuel cells and natural gas/diesel internal combustion engine generators. This report documents Phase I result for the Detroit Edison (Utility) led team, which also includes: DTE Energy Technology (DER provider & Aggregator), Electrical Distribution Design (Virginia Tech company supporting DEW); Systems Integration Specialists Company (real-time protocol integrator); and OSIsoft (software system for managing real-time information). This work was performed in anticipation of being selected for Phase II of the Advanced Communication and Control of Distributed Energy Resources project.

Haukur Asgeirsson; Richard Seguin



U.S. Natural Gas Pipeline Exports by Point of Exit  

Annual Energy Outlook 2012 (EIA)

Eastport, ID 0 252 113 12 10 1998-2011 Calais, ME 0 0 2,131 452 1,028 6,952 2007-2011 Detroit, MI 22,904 27,220 43,980 44,275 43,690 50,347 1996-2011 Marysville, MI 9,158 8,756...


U.S. Natural Gas Pipeline Exports by Point of Exit  

Annual Energy Outlook 2012 (EIA)

1973-2013 Eastport, ID 2011-2011 Calais, ME 1,824 1,853 2,021 1,528 433 652 2011-2011 Detroit, MI 4,331 4,801 3,571 4,430 3,769 3,933 2011-2011 Marysville, MI 4,807 5,273 2,983...


The Detroit Edison Company Smart Grid Demonstration Project | Open Energy  

Open Energy Info (EERE)

The Detroit Edison Company The Detroit Edison Company Country United States Headquarters Location Detroit, Michigan Recovery Act Funding $4,995,271.00 Total Project Value $10,877,258.00 Coordinates 42.331427°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Detroit Public Lighting Department - Commercial and Industrial Energy Wise  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Public Lighting Department - Commercial and Industrial Detroit Public Lighting Department - Commercial and Industrial Energy Wise Program Detroit Public Lighting Department - Commercial and Industrial Energy Wise Program < Back Eligibility Commercial Industrial Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Cooling Other Sealing Your Home Design & Remodeling Windows, Doors, & Skylights Manufacturing Heat Pumps Appliances & Electronics Commercial Lighting Lighting Insulation Maximum Rebate $50,000 per customer/facility, or 100% of the project cost Program Info State Michigan Program Type Utility Rebate Program Rebate Amount Light Fixtures: $2-$200 Lighting Controls: $0.10-$65 HVAC Equipment: $10-$30/ton Programmable Thermostat: $80 Window Glazing: $0.30/square foot


Detroit Edison Comments on NRC Guidance for Operability Determinations  

E-Print Network (OSTI)

with the Nuclear Energy Institute (NEI) in the preparation of industry comments on the draft revision to NRC Manual Chapter 9900. Detroit Edison appreciates the efforts by NRC staff to update and clarify the guidance for operability determinations and the opportunity to provide comments prior to final issuance. Detroit Edison concurs with the specific comments on the referenced Federal Register notice provided by NEI and the associated recommendation that the NRC continue public dialogue on this topic. Should you have any questions or require additional information, please contact me at (734) 586-4258. Sincerely, Norman K. Peterson

Detroit Edison; Washington D C; Detroit Edison; Has Participated


Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Revving up the Motor City : targeted neighborhood redevelopment in Detroit  

E-Print Network (OSTI)

This thesis is an analysis of an ambitious redevelopment plan for a two square mile area in the city of Detroit, Michigan. This area is dominated by city-owned vacant lots, which make up half of the neighborhood. The plan, ...

Pauls, Edward, 1977-



Energy Information Administration / Natural Gas Annual 2007 22  

Gasoline and Diesel Fuel Update (EIA)

2 2 Table 10. Summary of U.S. Natural Gas Imports By Point of Entry, 2003-2007 (Volumes in Million Cubic Feet, Prices in Nominal Dollars per Thousand Cubic Feet) Pipeline (Canada) Eastport, ID......................... 623,652 4.72 707,885 5.30 624,468 7.13 690,781 6.22 704,429 6.31 Calais, ME .......................... 115,301 5.85 102,292 6.44 135,162 9.40 105,650 7.73 106,643 7.57 Detroit, MI ........................... 2,514 5.96 1,117 6.27 0 -- 0 -- 81 8.28 Marysville, MI...................... 0 -- 303 7.80 0 -- 24 7.07 876 7.59 St. Clair, MI ......................... 5,202 5.84 22,853 6.50 18,281 9.93 10,410 7.44 9,633 6.97 International Falls, MN ........ 0 -- 0 -- 22 11.20 0 -- 0 -- Noyes, MN .......................... 359,801 5.04 399,298 5.77 467,595 8.01 419,284 6.82 499,863


Energy Information Administration / Natural Gas Annual 2006 20  

Gasoline and Diesel Fuel Update (EIA)

0 0 Table 10. Summary of U.S. Natural Gas Imports By Point of Entry, 2002-2006 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Pipeline (Canada) Eastport, ID......................... 759,647 2.83 623,652 4.72 707,885 5.30 624,468 7.13 690,781 6.22 Calais, ME .......................... 124,991 3.49 115,301 5.85 102,292 6.44 135,162 9.40 105,650 7.73 Detroit, MI ........................... 1,948 3.56 2,514 5.96 1,117 6.27 0 -- 0 -- Marysville, MI...................... 74 3.95 0 -- 303 7.80 0 -- 24 7.07 St. Clair, MI ......................... 28,441 3.19 5,202 5.84 22,853 6.50 18,281 9.93 10,410 7.44 International Falls, MN ........ 602 3.01 0 -- 0 -- 22 11.20 0 -- Noyes, MN .......................... 402,621 3.09 359,801 5.04 399,298 5.77 467,595 8.01 419,284


Energy Information Administration / Natural Gas Annual 2005 20  

Gasoline and Diesel Fuel Update (EIA)

0 0 Table 10. Summary of U.S. Natural Gas Imports By Point of Entry, 2001-2005 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Pipeline (Canada) Eastport, ID......................... 802,182 4.71 759,647 2.83 623,652 4.72 707,885 5.30 624,468 7.13 Calais, ME .......................... 152,486 4.47 124,991 3.49 115,301 5.85 102,292 6.44 135,162 9.40 Detroit, MI ........................... 405 9.34 1,948 3.56 2,514 5.96 1,117 6.27 0 -- Marysville, MI...................... 0 -- 74 3.95 0 -- 303 7.80 0 -- St. Clair, MI ......................... 21,747 4.54 28,441 3.19 5,202 5.84 22,853 6.50 18,281 9.93 International Falls, MN ........ 617 4.85 602 3.01 0 -- 0 -- 22 11.20 Noyes, MN .......................... 448,898 4.19 402,621 3.09 359,801 5.04 399,298


Energy Information Administration / Natural Gas Annual 2010 23  

Gasoline and Diesel Fuel Update (EIA)

3 3 Table 10. Summary of U.S. Natural Gas Imports By Point of Entry, 2006-2010 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Pipeline (Canada) Eastport, ID......................... 690,781 6.22 704,429 6.31 688,782 7.88 693,892 3.86 708,806 4.19 Calais, ME .......................... 105,650 7.73 106,643 7.57 121,295 9.77 114,081 4.48 131,035 4.94 Detroit, MI ........................... 0 -- 81 8.28 753 6.58 21 4.53 79 8.37 Marysville, MI...................... 24 7.07 876 7.59 2,252 8.59 5,651 3.80 5,694 4.44 St. Clair, MI ......................... 10,410 7.44 9,633 6.97 9,104 10.03 6,544 5.10 5,591 4.97 Noyes, MN .......................... 419,284 6.82 499,863 6.72 476,948 8.48 478,368 4.21 447,079 4.49 Warroad, MN ......................


Table 11. Summary of U.S. natural gas exports by point of exit, 2008-2012  

U.S. Energy Information Administration (EIA) Indexed Site

1 1 Table 11. Summary of U.S. natural gas exports by point of exit, 2008-2012 (volumes in million cubic feet, prices in dollars per thousand cubic feet) See footnotes at end of table. Pipeline (Canada) Eastport, ID 252 7.43 113 4.49 12 5.85 10 4.74 0 -- Calais, ME 0 -- 2,131 5.62 452 4.53 1,028 4.46 6,952 4.30 Detroit, MI 27,220 8.37 43,980 4.01 44,275 4.69 43,690 4.26 50,347 3.10 Marysville, MI 8,756 7.48 14,925 4.85 22,198 4.87 41,964 4.48 42,866 3.18 Sault Ste. Marie, MI 3,122 8.75 2,044 5.04 4,011 5.27 9,555 4.23 24,913 3.20 St. Clair, MI 492,235 8.96 612,369 4.62 650,590 4.86 781,058 4.45 754,494 3.11 Noyes, MN 0 -- 0 -- 0 -- 3,975 3.90 11,768 3.46 Babb, MT 0 -- 0



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

BY DETROIT DIESEL CORPORATION (DDC) BY DETROIT DIESEL CORPORATION (DDC) FOR ADVANCE WAIVER OF U.S. AND FOREIGN RIGHTS TO INVENTIONS MADE UNDER MODIFICATION 17 TO CONTRACT DEN-3-329 [W(A)93-043] The Petitioner is asking for U.S. and foreign patent rights to all subject inventions made under DOE Contract DEN-3-329, Modification 17, entitled "Adiabetic Diesel Engine Component Development". This entire contract is being funded by DOE, but is being administered by the NASA Lewis Research Center. The entire contract has as its object the successful design, fabrication, and demonstration of five stationary and moving structural monolithic ceramic components in an extremely hostile Low Heat Rejection (LHR) environment. DDC was formed in January 1988 to design, manufacture, and sell diesel engines. It is a joint-venture company 80% owned by



Office of Legacy Management (LM)

* .t-* * .t-* . * * - -. _ _ ,.. .I AIT. 4 NOTES AND COMMENTS REVERE COPPER AR! BRASS DETROIT, MICHIGAN A preliminary (screening) survey was conducted in several areas of the Revere Copper and Brass Facility, 5851 W. Jefferson Street, Detroit, Michigan. The survey was conducted by the ANL Radiological Survey Group on April 22, 1981. The Survey Group, consisting of W. Smith, R. Mundis, K. Flynn (all of ANI), and E. Jascewsky (DOE-CH) met on site with J. Evans (Safety Engineer), D. Tratt (Asst. Engineer), -- M~37~se'Zanak~(Aeth6ds~De!@iFXi%itXiupe~isox$ and E. Betancourt (Personnel Manager) to discuss what information was available concerning the operations that transpired at the facility during the Manhattan Engineering District Atomic Energy Commission (MED/AEC) era. MrYWtisffaliab indicated that


Energy Information Administration / Natural Gas Annual 2009 22  

Gasoline and Diesel Fuel Update (EIA)

... 135,162 9.40 105,650 7.73 106,643 7.57 121,295 9.77 114,081 4.48 Detroit, MI ... 0 -- 0 -- 81 8.28 753 6.58 21 4.53 Marysville,...


Energy Information Administration / Natural Gas Annual 2008 22  

Gasoline and Diesel Fuel Update (EIA)

... 102,292 6.44 135,162 9.40 105,650 7.73 106,643 7.57 121,295 9.77 Detroit, MI ... 1,117 6.27 0 -- 0 -- 81 8.28 753 6.58 Marysville,...


A Look Inside the Detroit Auto Show | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show January 12, 2011 - 1:15pm Addthis Kerry Duggan Waking up at 4:30AM is not my idea of fun. But after I witnessed the 6:30AM unveiling of the shiny new Porsche 918 RSR Hybrid at the North American International Auto Show, I got over it. To those who know cars, its lineage is in the #22 Porsche 917 race car, winner of the LeMans in 1971. With a top speed of 140 mph, the new 918 RSR combines the power of a 563-horsepower V-8 engine and a dual inertial flywheel system to produce a total 767-horsepower. On the efficiency side, a Kinetic Energy Recovery System (KERS) allows the two 75-kW flywheels to capture wasted energy when the brakes are applied. The Porsche president said that their goal is to achieve high fuel efficiency in extreme driving


City of Detroit, Michigan (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Detroit Detroit Place Michigan Utility Id 5107 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Operates Generating Plant Yes Activity Generation Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1050/kWh Commercial: $0.0994/kWh Transportation: $0.1060/kWh The following table contains monthly sales and revenue data for City of Detroit (Michigan). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS


A Look Inside the Detroit Auto Show | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show January 12, 2011 - 1:15pm Addthis Kerry Duggan Waking up at 4:30AM is not my idea of fun. But after I witnessed the 6:30AM unveiling of the shiny new Porsche 918 RSR Hybrid at the North American International Auto Show, I got over it. To those who know cars, its lineage is in the #22 Porsche 917 race car, winner of the LeMans in 1971. With a top speed of 140 mph, the new 918 RSR combines the power of a 563-horsepower V-8 engine and a dual inertial flywheel system to produce a total 767-horsepower. On the efficiency side, a Kinetic Energy Recovery System (KERS) allows the two 75-kW flywheels to capture wasted energy when the brakes are applied. The Porsche president said that their goal is to achieve high fuel efficiency in extreme driving


Conference Program "Detroit, Global City: The Motor City in the World"  

E-Print Network (OSTI)

, Nativism and Citizenship in 1920s Detroit" 12:10-2:00: Lunch Break 3. 2:10-3:40 Getting Beyond "Ruin Porn

Cinabro, David


The struggle for vibrancy : a study of local government intervention in Detroit's inner suburbs  

E-Print Network (OSTI)

Today, many communities located on the periphery of central cities confront traditionally "urban" problems. Detroit's inner suburbs struggle with aging infrastructure, limited governmental capacity, commercial disinvestment, ...

Kohn, Amy J. (Amy Jennifer)



Urban agriculture as a tool for neighborhood fabric repair in post-industrial Detroit.  

E-Print Network (OSTI)

??This thesis focuses on Detroit as a post-industrial city that suffers from abandonment, vacancy, and food security issues. I address this problem through the lens… (more)

Fairbank, Sandra Trubow



African-American and Arab American Muslim communities in the Detroit Ummah.  

E-Print Network (OSTI)

?? This paper provides overview of the two larger Muslim communities in Detroit (African-American and Arab American), their differing views on theology, racism, and women's… (more)

Omanson, Lisa Gail



The Spatial Injustice of Crisis-Driven Neoliberal Urban Restructuring in Detroit.  

E-Print Network (OSTI)

??Struggling to provide basic services due to a dwindling tax base and confronted with significant pockets of vacant land, Detroit has proposed a radical urban… (more)

Clement, Daniel



"Ruin Porn" or the Reality of Ruin?: A Rhetorical Analysis of Andrew Moore's Detroit Disassembled.  

E-Print Network (OSTI)

??Ruin photography, widely called "ruin porn" by critics, is an artistic trend that has entered the conscience of artists and consumers alike. Andrew Moore's Detroit… (more)

Nemeth, Katharine



Spatial And Temporal Relationships Between Blood Lead And Soil Lead Concentrations In Detroit, Michigan.  

E-Print Network (OSTI)

??This study explored variations in child blood lead levels (BLLs) relative to street-side soil lead in Detroit, Michigan. Findings showed that average BLLs steadily decreased… (more)

Bickel, Michael Jonathan


Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Children’s homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard



U.S. Price of Natural Gas Pipeline Exports by Point of Exit  

Gasoline and Diesel Fuel Update (EIA)

1989-2013 Eastport, ID 2011-2011 Calais, ME 17.83 6.97 5.75 4.33 3.72 4.21 2011-2011 Detroit, MI 3.67 3.96 4.42 4.42 4.26 4.02 2011-2011 Marysville, MI 3.62 3.91 4.48 4.58 4.35...


U.S. Price of Natural Gas Pipeline Exports by Point of Exit  

Gasoline and Diesel Fuel Update (EIA)

ID -- 7.43 4.49 5.85 4.74 1998-2011 Calais, ME -- -- 5.62 4.53 4.46 4.30 2007-2011 Detroit, MI 6.88 8.37 4.01 4.69 4.26 3.10 1996-2011 Marysville, MI 7.77 7.48 4.85 4.87 4.48...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

Annual Energy Outlook 2012 (EIA)

7.88 3.86 4.19 3.90 2.59 1996-2012 Calais, ME 7.57 9.77 4.48 4.94 4.40 3.44 1998-2012 Detroit, MI 8.28 6.58 4.53 8.37 5.17 1996-2011 Marysville, MI 7.59 8.59 3.80 4.44 4.42 2.99...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Upgrade Compressed Natural Gas Facility at existing station located in Detroit, MI. This CX form is for one location in this project selected under Clean Cities FOA...


Table 10. Summary of U.S. natural gas imports by point of entry, 2007-2011  

Gasoline and Diesel Fuel Update (EIA)

7 7 Table 10. Summary of U.S. natural gas imports by point of entry, 2007-2011 (volumes in million cubic feet, prices in dollars per thousand cubic feet) See footnotes at end of table. Pipeline (Canada) Eastport, ID 704,429 6.31 688,782 7.88 693,892 3.86 708,806 4.19 606,099 3.90 Calais, ME 106,643 7.57 121,295 9.77 114,081 4.48 131,035 4.94 149,736 4.40 Detroit, MI 81 8.28 753 6.58 21 4.53 79 8.37 19 5.17 Marysville, MI 876 7.59 2,252 8.59 5,651 3.80 5,694 4.44 9,946 4.42 St. Clair, MI 9,633 6.97 9,104 10.03 6,544 5.10 5,591 4.97 5,228 4.29 Noyes, MN 499,863 6.72 476,948 8.48 478,368 4.21 447,079 4.49 544,135 4.15 Warroad, MN 4,813 6.75 4,800 8.50 4,380 4.24 4,325 4.69 4,551 4.17


Table 9. Summary of U.S. natural gas imports by point of entry, 2008-2012  

U.S. Energy Information Administration (EIA) Indexed Site

6 6 Table 9. Summary of U.S. natural gas imports by point of entry, 2008-2012 (volumes in million cubic feet, prices in dollars per thousand cubic feet) See footnotes at end of table. Pipeline (Canada) Eastport, ID 688,782 7.88 693,892 3.86 708,806 4.19 606,099 3.90 634,194 2.59 Calais, ME 121,295 9.77 114,081 4.48 131,035 4.94 149,736 4.40 76,540 3.44 Detroit, MI 753 6.58 21 4.53 79 8.37 19 5.17 0 -- Marysville, MI 2,252 8.59 5,651 3.80 5,694 4.44 9,946 4.42 8,099 2.99 St. Clair, MI 9,104 10.03 6,544 5.10 5,591 4.97 5,228 4.29 3,531 2.64 Noyes, MN 476,948 8.48 478,368 4.21 447,079 4.49 544,135 4.15 401,717 2.86 Warroad, MN 4,800 8.50 4,380 4.24 4,325 4.69 4,551 4.17 4,610 3.06


Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CORPORATION, FOR AN ADVANCE WAIVER OF CORPORATION, FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS IN SUBJECT INVENTIONS MADE IN THE COURSE OF OR UNDER DEPARTMENT OF ENERGY COOPERATIVE AGREEMENT NO. DE-FC05-00OR22805; DOE WAIVER DOCKET W(A)-01-012 [ORO-764] Petitioner, Detroit Diesel Corporation, has made a timely request for an advance waiver to worldwide rights in Subject Inventions made in the course of or under Department of Energy (DOE) Cooperative Agreement No. DE-FC05-00OR22805. The scope of this work is to develop a commercially viable heavy-duty diesel technology package for truck applications targeted at achieving 50% thermal efficiency and meeting 2007 EPA mandated emissions. This work is sponsored by the Office of Transportation Technologies, Office of Heavy Vehicle Technologies.


City of Detroit Lakes, Minnesota (Utility Company) | Open Energy  

Open Energy Info (EERE)

Minnesota (Utility Company) Minnesota (Utility Company) Jump to: navigation, search Name City of Detroit Lakes Place Minnesota Utility Id 5111 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes ISO MISO Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Lights - 100 Watt HPS (Unmetered) Lighting Area Lights - 100 Watt HPS (metered) Lighting Area Lights - 250 Watt HPS (Unmetered) Lighting Area Lights - 250 Watt HPS (metered) Lighting Area Lights - 400 Watt HPS (Unmetered) Lighting Area Lights - 400 Watt HPS (metered) Lighting


Simulation and Visualization of Airside Operations at Detroit Metropolitan Airport  

E-Print Network (OSTI)

In recent years, airline flight delays have been among the most troublesome problems in the national transportation system. Although bad weather has historically been the main cause of delays, a growing reason has been the inability of the nation’s air transport system to efficiently absorb all of the aircraft trying to use limited airspace or trying to take off or land at busy airports. Simulation modeling and visualization can be of substantial help in the efficient design of airport operations, which in turn can mitigate some of the abovementioned capacity problems. This study presents the simulation model and 3D animation of the airside airport operations at Detroit Metro Airport, Romulus, Michigan. The simulation model is developed in STROBOSCOPE (Martinez 1996) and the 3D animation is created using

Copyright Hiam; M. Khoury; Vineet R. Kamat; Vineet R. Kamat; Photios G. Ioannou; Photios G. Ioannou; Hiam M. Khoury; Hiam M. Khoury



City of Detroit (Michigan) EIA Revenue and Sales - May 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit (Michigan) EIA Revenue and Sales - May 2008 City of Detroit (Michigan) EIA Revenue and Sales - May 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for May 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-05 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-05-01 End Date 2008-06-01 Residential Revenue(Thousand $) 1.4 Residential Sales (MWh) 15.6 Residential Consumers 82 Commercial Revenue(Thousand $) 3889 Commercial Sales (MWh) 38146 Commercial Consumers 121 Other Revenue (Thousand $) 49 Other Sales (MWh) 376 Other Consumers 1 Total Revenue (Thousand $) 3939.4 Total Sales (MWh) 38537.6 Total Consumers 204 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1]


City of Detroit (Michigan) EIA Revenue and Sales - February 2009 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for February 2009. Monthly Electric Utility Sales and Revenue Data Short Name 2009-02 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2009-02-01 End Date 2009-03-01 Residential Revenue(Thousand $) 2.1 Residential Sales (MWh) 22.5 Residential Consumers 78 Commercial Revenue(Thousand $) 4175 Commercial Sales (MWh) 41864 Commercial Consumers 117 Other Revenue (Thousand $) 76.9 Other Sales (MWh) 786 Other Consumers 1 Total Revenue (Thousand $) 4254 Total Sales (MWh) 42672.5 Total Consumers 196 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_February_2009&oldid=12572


City of Detroit (Michigan) EIA Revenue and Sales - December 2008 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for December 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-12 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-12-01 End Date 2009-01-01 Residential Revenue(Thousand $) 1.8 Residential Sales (MWh) 18.3 Residential Consumers 80 Commercial Revenue(Thousand $) 3407 Commercial Sales (MWh) 34836 Commercial Consumers 118 Other Revenue (Thousand $) 38.9 Other Sales (MWh) 376 Other Consumers 1 Total Revenue (Thousand $) 3447.7 Total Sales (MWh) 35230.3 Total Consumers 199 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_December_2008&oldid=19459


City of Detroit (Michigan) EIA Revenue and Sales - August 2008 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for August 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-08 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-08-01 End Date 2008-09-01 Residential Revenue(Thousand $) 1.75 Residential Sales (MWh) 18.6 Residential Consumers 77 Commercial Revenue(Thousand $) 4689 Commercial Sales (MWh) 45432 Commercial Consumers 124 Other Revenue (Thousand $) 51 Other Sales (MWh) 403 Other Consumers 1 Total Revenue (Thousand $) 4741.75 Total Sales (MWh) 45853.6 Total Consumers 202 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_August_2008&oldid=17335


City of Detroit (Michigan) EIA Revenue and Sales - January 2009 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for January 2009. Monthly Electric Utility Sales and Revenue Data Short Name 2009-01 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2009-01-01 End Date 2009-02-01 Residential Revenue(Thousand $) 2.5 Residential Sales (MWh) 27 Residential Consumers 81 Commercial Revenue(Thousand $) 4964 Commercial Sales (MWh) 48160 Commercial Consumers 120 Other Revenue (Thousand $) 63.5 Other Sales (MWh) 513 Other Consumers 1 Total Revenue (Thousand $) 5030 Total Sales (MWh) 48700 Total Consumers 202 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_January_2009&oldid=12026


City of Detroit (Michigan) EIA Revenue and Sales - June 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit for City of Detroit for June 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-06 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-06-01 End Date 2008-07-01 Residential Revenue(Thousand $) 1.6 Residential Sales (MWh) 17.7 Residential Consumers 77 Commercial Revenue(Thousand $) 4376 Commercial Sales (MWh) 44180 Commercial Consumers 123 Other Revenue (Thousand $) 49 Other Sales (MWh) 386 Other Consumers 1 Total Revenue (Thousand $) 4426.6 Total Sales (MWh) 44583.7 Total Consumers 201 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_June_2008&oldid=16285


City of Detroit (Michigan) EIA Revenue and Sales - July 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit for City of Detroit for July 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-07 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-07-01 End Date 2008-08-01 Residential Revenue(Thousand $) 1.7 Residential Sales (MWh) 18.1 Residential Consumers 77 Commercial Revenue(Thousand $) 4597 Commercial Sales (MWh) 44891 Commercial Consumers 123 Other Revenue (Thousand $) 52 Other Sales (MWh) 408 Other Consumers 1 Total Revenue (Thousand $) 4650.7 Total Sales (MWh) 45317.1 Total Consumers 201 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_July_2008&oldid=16810"


City of Detroit (Michigan) EIA Revenue and Sales - November 2008 | Open  

Open Energy Info (EERE)

City of Detroit (Michigan) EIA Revenue and Sales - November 2008 City of Detroit (Michigan) EIA Revenue and Sales - November 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for November 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-11 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-11-01 End Date 2008-12-01 Residential Revenue(Thousand $) 1.709 Residential Sales (MWh) 17.18 Residential Consumers 79 Commercial Revenue(Thousand $) 4219 Commercial Sales (MWh) 41796 Commercial Consumers 126 Other Revenue (Thousand $) 38.9 Other Sales (MWh) 376.3 Other Consumers 1 Total Revenue (Thousand $) 4259.609 Total Sales (MWh) 42189.48 Total Consumers 206 Source: Energy Information Administration. Form EIA-826 Database Monthly


City of Detroit (Michigan) EIA Revenue and Sales - March 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit (Michigan) EIA Revenue and Sales - March 2008 City of Detroit (Michigan) EIA Revenue and Sales - March 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for March 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-03 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-03-01 End Date 2008-04-01 Residential Revenue(Thousand $) 1.4 Residential Sales (MWh) 16 Residential Consumers 81 Commercial Revenue(Thousand $) 3467 Commercial Sales (MWh) 38666 Commercial Consumers 117 Other Revenue (Thousand $) 50 Other Sales (MWh) 455 Other Consumers 1 Total Revenue (Thousand $) 3518.4 Total Sales (MWh) 39137 Total Consumers 199 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1]

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Anticipating Detroit : a collection of instruments as a catalyst for recovery  

E-Print Network (OSTI)

The social, political and economic history of Detroit has been inextricably linked to the development of its most dominant industry: automotive manufacturing. This thesis suggests a strategy to overcome the disadvantages ...

Bouwman, Laura Marcella, 1976-



Woodward Avenue, Detroit : a pedestrian zone for a changing downtown retail street  

E-Print Network (OSTI)

The thesis studies the changing direction of Detroit's central downtown shopping street, Woodward Avenue. During the last two decades, Woodward Avenue has lost most of its retail market to suburban shopping centers. The ...

Lewis, Philip Strickland



Urban agriculture as a tool for neighborhood fabric repair in post-industrial Detroit  

E-Print Network (OSTI)

This thesis focuses on Detroit as a post-industrial city that suffers from abandonment, vacancy, and food security issues. I address this problem through the lens of agriculture, asking how urban farming can be used to ...

Fairbank, Sandra Trubow



Subsidized Housing and Neighborhood Change  

E-Print Network (OSTI)

97 Figure 3-6a Detroit, MI PMSA Neighborhood Quintile98 Figure 3-6b Detroit, MI PMSA Neighborhood Quintileinterviewing from the Detroit Area Study. Neighborhood

Wilson, Florence Louise



Comparative Analysis of Urban Decay and Renewal in the Cities of Detroit and Pittsburgh, Postwar to Present: An Introductory Survey .  

E-Print Network (OSTI)

??The thesis represents the results of comparing and analyzing the social and economic circumstances of Detroit and Pittsburgh over the last seventy years in the… (more)

Tolksdorf, Alexander



Women and the high school principalship: metropolitan detroit principals' and superintendents' perceptions regarding barriers and facilitators for job attainment.  

E-Print Network (OSTI)


Schnabel Kattula, Heidi



Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by… (more)

Marotta, Stephen J.



Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available



US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


City of Detroit (Michigan) EIA Revenue and Sales - February 2008 | Open  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » City of Detroit (Michigan) EIA Revenue and Sales - February 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for February 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-02 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-02-01 End Date 2008-03-01 Residential Revenue(Thousand $) 1.5 Residential Sales (MWh) 17 Residential Consumers 76 Commercial Revenue(Thousand $) 4083 Commercial Sales (MWh) 43432 Commercial Consumers 123 Other Revenue (Thousand $) 55 Other Sales (MWh) 494


Detroit Lakes energy systems study: Phase I feasibility. Final report, February 1, 1978--July 31, 1978  

DOE Green Energy (OSTI)

The objective of the Detroit Lakes Energy Systems Study is to determine the economic feasibility of alternative renewable energy system configurations in the northern latitudes. A forecast through both 1990 and the year 2000 is made of the demand for electrical energy in the Detroit Lakes area. An assessment of renewable energy resources including biomass, wind, and insolation is provided. A detailed analysis is made of system costs including biomass, wind, solar thermal, solar photovoltaic, selected hybrids, and conventional fuel systems. Lessons learned and recommendations for prototype fabrication are highlighted. (MHR)




Field Demonstration of a 24-kV Superconducting Cable at Detroit Edison: Final Report  

Science Conference Proceedings (OSTI)

Following up the successful testing of a complete 50 m, 115 kV high temperature superconducting (HTS) power cable system prototype, EPRI, Pirelli Power Cables and Systems, the Department of Energy, Detroit Edison, and American Superconductor Corporation undertook a project to design, install, and operate a 24 kV HTS power cable at Detroit Edison's Frisbie substation to serve customer load. The demonstration cable circuit ran approximately 120 m between the 24 kV bus distribution bus and a 120 kV-24 kV tr...



Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...


Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...


Field Demonstration of a 24-kV Warm Dielectric Cable at Detroit Edison: FY2002 Annual Progress Report for the Detroit Edison HTS Cab le Field Demonstration Project  

Science Conference Proceedings (OSTI)

A project sponsored by EPRI, Pirelli Power Cables and Systems, the Department of Energy, Detroit Edison, and American Superconductor Corporation was initiated in 1998 to install and operate a 24 kV high temperature superconductor (HTS) power cable in a Detroit Edison substation to serve customer load. The previous years of activity have focused on design, testing, manufacturing, and installation of the cable system as described in the FY2000 and FY2001 status reports. The successful implementation of thi...



"Arab Americans and Segmented Assimilation: Looking Beyond the Theory to the Reality in the Detroit Metro Area".  

E-Print Network (OSTI)

??This thesis aims to apply Segmented Assimilation Theory to the Arab-American community in Metropolitan Detroit. Segmented assimilation theory relates to second-generation immigrants, and proposes three… (more)

Weaver, Kristin


Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Black and white do not make grey| Narratives of women's friendship across a racial divide in metro Detroit.  

E-Print Network (OSTI)

?? Interracial friendship between African Americans and whites in metro Detroit requires bridge-building across a socially constructed divide. This ethnographically-inflected, interview-based case study of the… (more)

Van't Hof, Marcia



DTE Energy Technologies With Detroit Edison Co. and Kinectrics Inc.: Distributed Resources Aggregation Modeling and Field Configuration Testing  

Science Conference Proceedings (OSTI)

Summarizes the work of DTE Energy Technologies, Detroit Edison, and Kinectrics, under contract to DOE's Distribution and Interconnection R&D, to develop distributed resources aggregation modeling and field configuration testing.

Not Available



Field Demonstration of a 24-KV Warm Dielectric Cable at Detroit Edison: FY2001 Annual Progress Report  

Science Conference Proceedings (OSTI)

A project sponsored by EPRI, Pirelli Power Cables and Systems, the U.S. Department of Energy, Detroit Edison, and American Superconductor Corporation was initiated in 1998 to install and operate a 24 kV high-temperature superconducting (HTS) power cable in a Detroit Edison substation to serve customer load. The scope of this demonstration will result in the world's first underground installation of an HTS cable system using an existing duct network. Furthermore, the project involves installing the necess...



City of Detroit (Michigan) EIA Revenue and Sales - January 2008 | Open  

Open Energy Info (EERE)

January 2008 January 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for January 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-01 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-01-01 End Date 2008-02-01 Residential Revenue(Thousand $) 1.7 Residential Sales (MWh) 19 Residential Consumers 76 Commercial Revenue(Thousand $) 4458 Commercial Sales (MWh) 47480 Commercial Consumers 123 Other Revenue (Thousand $) 63.3 Other Sales (MWh) 537 Other Consumers 1 Total Revenue (Thousand $) 4523 Total Sales (MWh) 48036 Total Consumers 200 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from


City of Detroit (Michigan) EIA Revenue and Sales - April 2008 | Open Energy  

Open Energy Info (EERE)

April 2008 April 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for April 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-04 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-04-01 End Date 2008-05-01 Residential Revenue(Thousand $) 1.2 Residential Sales (MWh) 13 Residential Consumers 81 Commercial Revenue(Thousand $) 4537 Commercial Sales (MWh) 41373 Commercial Consumers 121 Other Revenue (Thousand $) 55 Other Sales (MWh) 400 Other Consumers 1 Total Revenue (Thousand $) 4593.2 Total Sales (MWh) 41786 Total Consumers 203 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from


City of Detroit (Michigan) EIA Revenue and Sales - March 2009 | Open Energy  

Open Energy Info (EERE)

9 9 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for March 2009. Monthly Electric Utility Sales and Revenue Data Short Name 2009-03 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2009-03-01 End Date 2009-04-01 Residential Revenue(Thousand $) 2.1 Residential Sales (MWh) 20.7 Residential Consumers 79 Commercial Revenue(Thousand $) 3720 Commercial Sales (MWh) 36330 Commercial Consumers 112 Other Revenue (Thousand $) 60.4 Other Sales (MWh) 560 Other Consumers 1 Total Revenue (Thousand $) 3782.5 Total Sales (MWh) 36910.7 Total Consumers 192 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from


Detroit Lakes Energy Systems Study. Quarterly technical progress report, February 1, 1978--April 30, 1978  

DOE Green Energy (OSTI)

The initial phase of the Detroit Lakes Energy Systems Study was designed to assemble and analyze sufficient data from which to recommend specific classes of alternative energy supplies. Most of the information on meteorological conditions and biomass materials have been obtained. This is being compiled into a useful form for future evaluation. Research into legal and economic areas are underway. Analysis of this data is being conducted and results will be used in assessing the impact of alternative energy systems. Current technical information on solar thermal, solar photovoltaic, wind and hybrid power systems is being evaluated. Potential systems are being considered in light of their impact on the Detroit Lakes region and the northern latitudes in general. Final evaluation of the data is expected well within schedule.

DeVillers, K.E.



“I Can’t Walk!” Acute Thrombosis of Descending Aorta Causing Paraplegia  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, Michigan Supervising SectionWest Grand Boulevard, CFP-258, Detroit, MI 48202. Email:

Mitchell, Matthew Lee; Yucebey, Elif; Weaver, Mitchell R; Jaehne, A Kathrin; Rivers, Emanuel P



miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Higher than those of their race of less fortunate advantages:Race, ethnicity, and West Indian political leadership in Detroit's African American community, 1885-1940.  

E-Print Network (OSTI)

??This dissertation explores West Indian immigrants in the city of Detroit and their leadership of key institutions in the African American community from 1885 to… (more)

Beard, Kathryn Lorraine



Girls Will Be Boys: Cross-Dressed Women and the Legitimation of American Silent Cinema  

E-Print Network (OSTI)

in American Film. Detroit: Wayne State University Press,159. “Washington--The Prince and the Pauper. ” Detroit News.Detroit, MI, December 6, 1915. Waters, Sarah. “‘A Girton

Horak, Laura




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Applications in the Nuclear Industry for Thermal Spray Amorphous Metal and Ceramic Coatings  

E-Print Network (OSTI)

Science & Technology 2007, Detroit, MI, Sept. 16– 20, 2007,2007, Sept. 16–20, 2007, Detroit, MI, American CeramicExhib. , Sept. 16–20, 2007, Detroit, MI, American Ceramic

Blink, J.; Farmer, J.; Choi, J.; Saw, C.



Field Demonstration of a 24-kV Warm Dielectric Superconducting Cable at Detroit Edison: FY2003 Annual Progress Report  

Science Conference Proceedings (OSTI)

A project sponsored by EPRI, Pirelli Power Cables and Systems, the Department of Energy, Detroit Edison, and American Superconductor Corporation was initiated in 1998 to install and operate a 24 kV HTS power cable in a Detroit Edison substation to serve customer load. The previous years of activity have focused on design, testing, manufacturing, and installation of the cable system as described in the FY2000 and FY2001 status reports. The FY2002 status report focused on leak detection. The cornerstone of...



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

Summary of U.S. Natural Gas Imports and Exports, 1992-1996 Table 1992 1993 1994 1995 1996 Imports Volume (million cubic feet) Pipeline Canada............................. 2,094,387 2,266,751 2,566,049 2,816,408 2,883,277 Mexico .............................. 0 1,678 7,013 6,722 13,862 Total Pipeline Imports....... 2,094,387 2,268,429 2,573,061 2,823,130 2,897,138 LNG Algeria .............................. 43,116 81,685 50,778 17,918 35,325 United Arab Emirates ....... 0 0 0 0 4,949 Total LNG Imports............. 43,116 81,685 50,778 17,918 40,274 Total Imports......................... 2,137,504 2,350,115 2,623,839 2,841,048 2,937,413 Average Price (dollars per thousand cubic feet) Pipeline Canada............................. 1.84 2.02 1.86 1.48 1.96 Mexico .............................. - 1.94 1.99 1.53 2.25 Total Pipeline Imports.......



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CORPORATION FOR AN CORPORATION FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS IN SUBJECT INVENTIONS MADE IN THE COURSE OF OR UNDER DEPARTMENT OF ENERGY CONTRACT NO. DE- FC05-970R22581; DOE WAIVER DOCKET W(A)-97-009 [ORO-653] Detroit Diesel Corporation (DDC) has made a timely request for an advance waiver to worldwide rights in Subject Inventions made in the course of or under Department of Energy (DOE) Contract No. DE-FC05-970R22581. The scope of the work calls for the development of advanced materials for low emissions, high efficiency diesel engine components. The work is sponsored by the Office of Transportation Technologies. The dollar amount of the contract is $6,811,639 with DDC cost sharing $3,405,819, or 50% of the contract. DDC is a world leader in the design, development, and production of diesel engines. It has a


Field Demonstration of a 24-kV Superconducting Cable at Detroit Edison  

SciTech Connect

Customer acceptance of high temperature superconducting (HTS) cable technology requires a substantial field demonstration illustrating both the system's technical capabilities and its suitability for installation and operation within the utility environment. In this project, the world's first underground installation of an HTS cable using existing ductwork, a 120 meter demonstration cable circuit was designed and installed between the 24 kV bus distribution bus and a 120 kV-24 kV transformer at Detroit Edison's Frisbie substation. The system incorporated cables, accessories, a refrigeration system, and control instrumentation. Although the system was never put in operation because of problems with leaks in the cryostat, the project significantly advanced the state-of-the-art in the design and implementation of Warm Dielectric cable systems in substation applications. Lessons learned in this project are already being incorporated in several ongoing demonstration projects.

Kelley, Nathan; Corsaro, Pietro



Evaluation of Fish Passage Conditions for Juvenile Salmonids Using Sensor Fish at Detroit Dam, Oregon  

DOE Green Energy (OSTI)

Fish passage conditions through two spillways at Detroit Dam on the North Santiam River in Oregon were evaluated by Pacific Northwest National Laboratory for the U.S. Army Corps of Engineers (USACE), Portland District, using Sensor Fish devices. The objective of the study was to describe and compare passage exposure conditions through Spillbay 3 and Spillbay 6 at 1.5- and 3.5-ft gate openings, identifying potential fish injury regions of the routes. The study was performed in July 2009, concurrent with HI-Z balloon-tag studies by Normandeau Associates, Inc. Sensor Fish and live fish were deployed at elevations approximately 3 ft above structure at depths determined using a computational fluid dynamics model. Data collected were analyzed to estimate 1) exposure conditions, particularly exposure to severe collision and shear events by passage route sub-regions; 2) differences in passage conditions between passage routes; and 3) relationships to live-fish injury and mortality data estimates.

Duncan, Joanne P.



Microsoft Word - Sandalow Detroit National Summit Speech 6-17.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

REMARKS PREPARED FOR DELIVERY REMARKS PREPARED FOR DELIVERY REMARKS OF DAVID SANDALOW ASSISTANT SECRETARY FOR POLICY & INTERNATIONAL AFFAIRS U.S. DEPARTMENT OF ENERGY DETROIT ECONOMIC CLUB NATIONAL SUMMIT JUNE 17, 2009 [Acknowledgements.] It's good to be home in Michigan. I grew up a mile from the Michigan Football Stadium - close enough to hear the roar of the crowd from the front yard when the Wolverines scored. My first job after graduation was at the Michigan Department of Commerce. That was many years ago. In the past several months, my new position with the U.S. Department of Energy has taken me far away - to six countries on three continents. Those trips - often exhausting - have taught me a lot. One constant lesson, which I saw especially clearly last week in Beijing, is


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Air traffic control communication at Detroit Metro Wayne County Airport August 17, 1987  

E-Print Network (OSTI)

This report contains a transcript of radio communications between air traffic controllers and pilots. The transcript was prepared as part of the ATC Interaction Research Project (AIR Project) at the Oregon Graduate Institute, which has been investigating computational representations of air traffic control (ATC) communication. The transcript was made from a tape prepared and narrated by Lawrence L. Porter, a consultant in the field of air traffic control and aircraft accidents. It follows Northwest Airlines Flight 255 as it landed and took off from Detroit Metro Wayne County Airport on August 17, 1987, showing the pilot's interaction with each of the controller positions (Arrival Radar, Local Control, Ground Control, and Clearance Delivery). A copy of this recording on cassette may be obtained by writing to the Department of Computer Science and Engineering of the Oregon Graduate Institute. The authors thank Mr. Porter for providing the recording and narration. The transcript is in two parts. The section entitled "Full Transcript" depicts all exchanges chronologically as they occurred. However, air traffic control dialogue can be viewed as many interleaved yet fairly independent conversations, so in the "Separated Transcripts" section utterances are grouped by aircraft to show the course of each individual conversation. The utterance numbers from the full transcript are preserved in the separated transcripts so that the utterance context may be located easily. The notation and transcription conventions used in these transcripts are described in Appendix A. Appendix B contains charts describing the airspace around Detroit Metro Wayne County Airport.. The utterances in this transcript contain specialized terms and usages specific to the Air Traffic Control (ATC) domain. B...

Karen Ward; David Novick; Carolyn Sousa



MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Detroit Lakes Energy Systems Study: Phase I extension. Final report, August 1, 1978-January 15, 1979. [Biomass for power plant  

DOE Green Energy (OSTI)

An assessment of the resource availability of biomass and the potential of utilization of renewable energy systems in Detroit Lakes, Minnesota is presented. The feasibility of retrofitting the existing power plant to house a biomass energy system is discussed. Survey and evaluation of current off-the-shelf farm implement equipment which can be adapted to the handling of selected biomass materials is presented. Density studies on sunflower stalks, grain straw, and forest residues are included. (DC)

Not Available



"1. Monroe","Coal","Detroit Edison Co",2944 "2. Donald C Cook","Nuclear","Indiana Michigan Power Co",2069  

U.S. Energy Information Administration (EIA) Indexed Site

Michigan" Michigan" "1. Monroe","Coal","Detroit Edison Co",2944 "2. Donald C Cook","Nuclear","Indiana Michigan Power Co",2069 "3. Ludington","Pumped Storage","Consumers Energy Co",1872 "4. Midland Cogeneration Venture","Gas","Midland Cogeneration Venture",1849 "5. Dan E Karn","Coal","Consumers Energy Co",1791 "6. Belle River","Coal","Detroit Edison Co",1518 "7. J H Campbell","Coal","Consumers Energy Co",1451 "8. St Clair","Coal","Detroit Edison Co",1397 "9. Fermi","Nuclear","Detroit Edison Co",1133


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


The Detroit Diesel DELTA Engine for Light Trucks and SUVs - Year 2000 Update  

DOE Green Energy (OSTI)

Detroit Diesel Corporation (DDC) is developing the DELTA 4.0L V6 engine, specifically for the North American light truck market. This market poses unique requirements for a diesel engine, necessitating a clean sheet engine design. DELTA was developed from a clean sheet of paper, with the first engine firing just 228 days later. The process began with a Quality Function Deployment (QFD) analysis, which prioritized the development criteria. The development process integrated a co-located, fully cross-functional team. Suppliers were fully integrated and maintained on-site representation. The first demonstration vehicle moved under its own power 12 weeks after the first engine fired. It was demonstrated to the automotive press 18 days later. DELTA has repeatedly demonstrated its ability to disprove historical North American diesel perceptions and compete directly with gasoline engines. This paper outlines the Generation 0.0 development process and briefly defines the engine. A brief indication of the Generation 0.5 development status is given.

Nabil S. Hakim; Charles E. Freese; Stanley P. Miller



Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mäkinen; Jorma Tarhio



Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Transfac 2009: Home Page  

Science Conference Proceedings (OSTI)

TRANSFAC 2009 • OCT. 31 - NOV. 3, 2009 • DETROIT, MI • USA ... and Materials (KIM), Metsoc Metallurgical Society of CIM, ASM International Detroit Chaper ...


Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...


Wildlife and Wildlife Habitat Loss Assessment at Detroit Big Cliff Dam and Reservoir Project, North Santiam River, Oregon, 1985 Final Report.  

DOE Green Energy (OSTI)

A habitat based assessment was conducted of the US Army Corps of Engineers' Detroit/Big Cliff Dam and Reservoir Project (Detroit Project) on the North Santiam River, Oregon, to determine losses or gains resulting from the development and operation of the hydroelectric-related components of the project. Preconstruction, postconstruction, and recent vegetation cover types at the project site were mapped based on aerial photographs from 1939, 1956, and 1979, respectively. Vegetation cover types were identified within the affected area and acreages of each type at each time period were determined. Ten wildlife target species were selected to represent a cross-section of species groups affected by the project. An interagency team evaluated the suitability of the habitat to support the target species at each time period. An evaluation procedure which accounted for both the quantity and quality of habitat was used to aid in assessing impacts resulting from the project. The Detroit Project extensively altered or affected 6324 acres of land and river in the North Santiam River drainage. Impacts to wildlife centered around the loss of 1,608 acres of conifer forest and 620 acres of riparian habitat. Impacts resulting from the Detroit Project included the loss of winter range for black-tailed deer and Roosevelt elk, and the loss of year-round habitat for deer, river otter, beaver, ruffed grouse, pileated woodpecker, spotted owl, and many other wildlife species. Bald eagle and osprey were benefited by an increase in foraging habitat. The potential of the affected area to support wildlife was greatly altered as a result of the Detroit Project. Losses or gains in the potential of the habitat to support wildlife will exist over the life of the project.

Noyes, J.H.



U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA) Indexed Site

25,575 142,032 133,749 128,589 130,297 122,391 1997-2013 25,575 142,032 133,749 128,589 130,297 122,391 1997-2013 To Canada 70,735 81,695 75,846 66,473 68,325 69,733 1973-2013 Eastport, ID 6 2011-2013 Calais, ME 2,021 1,528 433 652 122 185 2011-2013 Detroit, MI 3,571 4,430 3,769 3,933 4,131 3,885 2011-2013 Marysville, MI 2,983 1,470 995 1,856 1,521 1,400 2011-2013 Sault Ste. Marie, MI 1,531 1,171 935 1,231 849 911 2011-2013 St. Clair, MI 43,917 56,075 54,114 42,609 45,524 47,795 2011-2013 Noyes, MN 76 171 316 1,331 447 445 2011-2013 Babb, MT 2011-2011 Havre, MT 184 188 174 177 183 166 2011-2013 Pittsburg, NH 2011-2013 Grand Island, NY 47 20 10 10 11 2011-2013 Massena, NY 2012-2012 Niagara Falls, NY 13,738 13,789 13,174 13,904 13,939 13,022 2011-2013 Waddington, NY


Hydroacoustic Evaluation of Juvenile Salmonid Passage and Distribution at Detroit Dam, 2011  

Science Conference Proceedings (OSTI)

Pacific Northwest National Laboratory evaluated juvenile salmonid passage and distribution at Detroit Dam (DET) on the North Santiam River, Oregon for the U.S. Army Corps of Engineers (USACE) to provide data to support decisions on long-term measures to enhance downstream passage at DET and others dams in USACE’s Willamette Valley Project. This study was conducted in response to regulatory requirements necessitated by the listing of Upper Willamette River Spring Chinook salmon (Oncorhynchus tshawytscha) and Upper Willamette River steelhead (O. mykiss) as threatened under the Endangered Species Act. The goal of the study was to provide information of juvenile salmonid passage and distribution at DET from February 2011 through February 2012. The results of the hydroacoustic study provide new and, in some cases, first-ever data on passage estimates, run timing, distributions, and relationships between fish passage and environmental variables at the dam. This information will inform management decisions on the design and development of surface passage and collection devices to help restore Chinook salmon populations in the North Santiam River watershed above DET. During the entire study period, an estimated total of 182,526 smolt-size fish (±4,660 fish, 95% CI) passed through turbine penstock intakes. Run timing peaked in winter and early spring months. Passage rates were highest during late fall, winter and early spring months and low during summer. Horizontal distribution for hours when both turbine units were operated simultaneously indicated Unit 2 passed almost twice as much fish as Unit 1. Diel distribution for smolt-size fish during the study period was fairly uniform, indicating fish were passing the turbines at all times of the day. A total of 5,083 smolt-size fish (± 312 fish, 95% CI) were estimated passed via the spillway when it was open between June 23 and September 27, 2011. Daily passage was low at the spillway during the June-August period, and increased somewhat in September 2011. When the spillway was operated simultaneously with the turbines, spillway efficiency (efficiency is estimated as spillway passage divided by total project passage) was 0.72 and effectiveness (fish:flow ratio—proportion fish passage at a route (e.g., spillway) divided by proportion water through that route out of the total project) was 2.69. That is, when the spillway was open, 72% of the fish passing the dam used the spillway and 28% passed into the turbine penstocks. Diel distribution for smolt-size fish at the spillway shows a distinct peak in passage between mid-morning and mid-afternoon and low passage at night. We estimated that 23,339 smolt-size fish (± 572 fish, 95% CI) passed via the Regulating Outlet (RO) when it was open from October 29 through November 12, 2011, January 2-6, and January 20 through February 3, 2012. During the October–November period, RO passage peaked at 1,086 fish on November 5, with a second peak on November 7 (1,075 fish). When the RO was operated simultaneously with the turbines, RO efficiency was 0.33 and effectiveness was 0.89. In multiple regression analyses, a relatively parsimonious model was selected that predicted the observed fish passage data well. The best model included forebay temperature at depth, forebay elevation, total discharge, hours of daylight, and the operation period. The vertical distribution of fish in the forebay near the face of the dam where the transducers sampled showed fish were generally distributed throughout the water column during all four operational periods. During the refill and full pool periods, vertical distribution was bi-modal with surface-layer and mid-water modes. Patterns for day and night distributions were variable. Fish were distributed above and below the thermocline when it was present (full pool and drawdown periods).

Khan, Fenton; Royer, Ida M.; Johnson, Gary E.; Ham, Kenneth D.



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Reducing the Environmental Footprint and Economic Costs of Automotive Manufacturing through an Alternative Energy Supply  

E-Print Network (OSTI)

in urban areas like the Detroit region. In such a situation,energy supply based on in Detroit, MI, region in the Unitedsupply figures for the Detroit region where much of the U.S.

Yuan, Chris; Dornfeld, David



The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Determining the Appropriate Package and Transportation Methodology for the Detroit Edison, Fermi II Msrs and Associated Components  

SciTech Connect

During the spring of 2005, Detroit Edison, Enrico Fermi II Nuclear Power Station (Fermi) decided to disposition two MSRs and associated components scheduled for replacement in the spring of 2006 during the MSR Replacement Outage. Of concern to Fermi was the proper packaging and transportation methodology when dis-positioning a component measuring approximately 110' in length and 13' in diameter and weighing over 300 tons. Upon removal from the Turbine Deck the retired MSRs and associated components were turned over to the Rad Waste Group for packaging and final disposition. Fermi requested quotations from vendors to package, transport, and disposition the MSRs and associated components. However, multiple Vendors informed Fermi that the size and weight of the MSRs were questionable in passing permitting requirements and would require segmentation and volume reduction on site or at a waste processor. Fermi contracted with MHF Logistical Solutions (MHF-LS) based on their ability to receive clearances for shipping the MSRs in one piece via two heavy haul rail conveyances acting as a bolstered load with professionally engineered blocking and bracing configured to support the retired MSRs. (authors)

Weber, B. [Detroit Edison Company/Enrico Fermi II Nuclear Power Station, Newport, MI (United States); Dempsey, S. [MHF Logistical Solutions, Oak Ridge, TN (United States)


Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA) Indexed Site

215,438 228,558 228,644 228,087 227,437 228,043 1997-2013 215,438 228,558 228,644 228,087 227,437 228,043 1997-2013 From Canada 215,418 228,544 228,616 227,905 227,273 227,895 1973-2013 Eastport, ID 56,795 55,526 58,195 60,900 58,601 56,407 2011-2013 Calais, ME 1,846 1,368 1,910 1,831 1,356 3,925 2011-2013 Detroit, MI 140 2011-2013 Marysville, MI 1,080 14 21 194 2011-2013 St. Clair, MI 2 26 151 211 2011-2013 Noyes, MN 20,624 33,889 31,352 11,189 13,943 20,155 2011-2013 Warroad, MN 452 328 308 292 271 290 2011-2013 Babb, MT 1,028 931 1,946 2,200 2,103 2,386 2011-2013 Port of Del Bonita, MT 20 22 18 20 21 21 2011-2013 Port of Morgan, MT 55,965 58,896 59,252 59,822 61,514 57,958 2011-2013 Sweetgrass, MT 25 991 2011-2013 Whitlash, MT


U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA) Indexed Site

2007 2008 2009 2010 2011 2012 View 2007 2008 2009 2010 2011 2012 View History U.S. Total 3,836,770 3,632,403 3,299,402 3,309,747 3,119,753 2,963,140 1985-2012 From Canada 3,782,708 3,589,089 3,271,107 3,279,752 3,117,081 2,962,827 1973-2012 Eastport, ID 704,429 688,782 693,892 708,806 606,099 634,194 1996-2012 Calais, ME 106,643 121,295 114,081 131,035 149,736 76,540 1998-2012 Detroit, MI 81 753 21 79 19 0 1996-2012 Marysville, MI 876 2,252 5,651 5,694 9,946 8,099 1996-2012 St. Clair, MI 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 International Falls, MN 1996-2006 Noyes, MN 499,863 476,948 478,368 447,079 544,135 401,717 1996-2012 Warroad, MN 4,813 4,800 4,380 4,325 4,551 4,610 1996-2012 Babb, MT 4,580 4,057 6,702 6,671 12,807 15,525 1996-2012


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


Preserving the U.S. Underground and Alternative Press of the 1960s and '70s: History, Prospects, and Microform Sources  

E-Print Network (OSTI)

Reporter, Washington, DC, 1985- , UMI Navajo Times, WindowWashington, DC Native Sun, Detroit, MI Navajo Times, Window

Tsang, Daniel C



REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Characterization of Fish Passage Conditions through a Francis Turbine, Spillway, and Regulating Outlet at Detroit Dam, Oregon, Using Sensor Fish, 2009  

Science Conference Proceedings (OSTI)

Fish passage conditions through two spillways, a Francis turbine, and a regulating outlet (RO) at Detroit Dam on the North Santiam River in Oregon were evaluated by Pacific Northwest National Laboratory for the U.S. Army Corps of Engineers (USACE), Portland District, using Sensor Fish devices. The objective of the study was to describe and compare passage exposure conditions, identifying potential fish injury regions within the routes. The study was performed in July, October, and December 2009 concurrent with HI-Z balloon-tag studies by Normandeau Associates, Inc. Sensor Fish data were analyzed to estimate 1) exposure conditions, particularly exposure to severe strike, collision, and shear events by passage route sub-regions; 2) differences in passage conditions between passage routes; and 3) relationships to live-fish injury and mortality data estimates. Comparison of the three passage routes evaluated at Detroit Dam indicates that the RO passage route through the 5-ft gate opening was relatively the safest route for fish passage under the operating conditions tested; turbine passage was the most deleterious. These observations were supported also by the survival and malady estimates obtained from live-fish testing. Injury rates were highest for turbine and spillway passage. However, none of the passage routes tested is safe for juvenile salmonid passage.

Duncan, Joanne P.; Carlson, Thomas J.



U.S. Price of Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA) Indexed Site

2007 2008 2009 2010 2011 2012 View 2007 2008 2009 2010 2011 2012 View History U.S. Total 6.96 8.62 4.34 4.75 4.35 3.08 1985-2012 To Canada 7.17 8.86 4.59 4.84 4.45 3.17 1985-2012 Eastport, ID -- 7.43 4.49 5.85 4.74 -- 1998-2012 Calais, ME -- -- 5.62 4.53 4.46 4.30 2007-2012 Detroit, MI 6.88 8.37 4.01 4.69 4.26 3.10 1996-2012 Marysville, MI 7.77 7.48 4.85 4.87 4.48 3.18 1996-2012 Sault Ste. Marie, MI 7.13 8.75 5.04 5.27 4.23 3.20 1999-2012 St. Clair, MI 7.24 8.96 4.62 4.86 4.45 3.11 1996-2012 Noyes, MN -- -- -- -- 3.90 3.46 1998-2012 Warroad, MN 1999-2002 Babb, MT -- -- -- -- 3.39 -- 1996-2012 Havre, MT 6.16 8.14 3.63 4.05 3.82 2.40 1998-2012 Port of Morgan, MT 1998-2006 Sherwood, ND 1999-2006 Pittsburg, NH -- 7.61 -- -- 7.54 2.62 2007-2012


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



PII S0016-7037(00)00610-X Transport of U-and Th-series nuclides in a Baltic Shield watershed and the Baltic Sea  

E-Print Network (OSTI)

, Pasadena, CA 91125 USA 2 Swedish Museum of Natural History, Laboratory for Isotope Geology, Box 50007, 104 of the Charles Arms Laboratory, Division of Geological and Planetary Sciences, California Institute of Technology 05 Stockholm, Sweden 3 Department of Geology, Wayne State University, Detroit, MI 48202 USA (Received

Baskaran, Mark


Hafnium isotopes in Arctic Ocean water Bettina Zimmermann a  

E-Print Network (OSTI)

-GEOMAR, 24148 Kiel, Germany d Laboratory for Isotope Geology, Swedish Museum of Natural History, Box 50007, SEHafnium isotopes in Arctic Ocean water Bettina Zimmermann a , Don Porcelli b,*, Martin Frank c-104 05 Stockholm, Sweden e Department of Geology, Wayne State University, Detroit, MI 48202, USA f

Baskaran, Mark


Natural Gas | OpenEI  

Open Energy Info (EERE)

Gas Gas Dataset Summary Description This is a non-proprietary subset of DOE's Buildings Performance Database. Buildings from the cities of Dayton, OH and Gainesville, FL areas are provided as an example of the data in full database. Sample data here is formatted as CSV Source Department of Energy's Buildings Performance Database Date Released July 09th, 2012 (2 years ago) Date Updated Unknown Keywords Buildings Performance Database Dayton Electricity Gainesville Natural Gas open data Residential Data application/zip icon BPD Dayton and Gainesville Residential csv files in a zip file (zip, 2.8 MiB) text/csv icon BPD Dayton and Gainesville Residential Building Characteristics data (csv, 1.4 MiB) text/csv icon BPD Dayton and Gainesville Residential data headers (csv, 5.8 KiB)


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA) Indexed Site

Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History U.S. Total 3.96 3.93 3.73 3.37 3.01 3.01 1997-2013 From Canada 3.96 3.93 3.73 3.37 3.01 3.01 1989-2013 Eastport, ID 3.71 3.74 3.54 3.16 2.78 2.73 2011-2013 Calais, ME 4.09 4.58 4.41 4.29 3.75 3.70 2011-2013 Detroit, MI 4.50 2011-2013 Marysville, MI 4.57 4.70 4.22 4.17 2011-2013 St. Clair, MI 4.41 4.35 3.96 4.06 2011-2013 Noyes, MN 4.12 4.08 3.84 3.79 3.44 3.54 2011-2013 Warroad, MN 4.25 4.35 4.14 3.91 3.68 3.77 2011-2013 Babb, MT 3.66 3.74 3.45 2.94 2.65 2.44 2011-2013 Port of Del Bonita, MT 3.93 3.85 3.43 2.97 2.73 2.50 2011-2013 Port of Morgan, MT 3.62 3.69 3.50 3.06 2.72 2.58 2011-2013 Sweetgrass, MT 3.69 3.73 2011-2013


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown


Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Category:SecondarySchool | Open Energy Information  

Open Energy Info (EERE)

IA MidAmerican Energy Co (Iowa).png SVSecondarySchool Des ... 68 KB SVSecondarySchool Detroit MI Detroit Edison Co.png SVSecondarySchool Detr... 66 KB SVSecondarySchool El Paso TX...


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


1 Introduction  

E-Print Network (OSTI)

1Department of Mathematics, Wayne State University, Detroit, MI 48202 (boris@ math.wayne.edu). Research of this author was partly supported by the National ...


1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202, USA; email: boris@math.wayne.edu. Research of this author was also partly supported  ...


Approximate Maximum Principle for Discrete Approximations of ...  

E-Print Network (OSTI)

Detroit, MI 48202. Email: boris@math.wayne.edu. ILYA SHVARTSMAN. Department of Mathematics and Computer Science. Penn State University - Harrisburg.


Hölder Metric Subregularity with Applications to Proximal Point Method  

E-Print Network (OSTI)

Feb 2, 2012 ... ‡Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. Email: boris@math.wayne.edu. Research of this author was also ...


1 Introduction  

E-Print Network (OSTI)

Strategic Reference Framework under grant PTDC/MAT/111809/2009. 3Doctoral Student, Department of Mathematics, Wayne State University, Detroit, MI 48202 ...



U.S. Energy Information Administration (EIA)

... , "Detroit, MI",, ,Coking,Steam 2000,61542,1142280 2005,177414,8456023 2010,160896,6187802 Jan-Aug 2011,9323,1227071 ,, "Mobile, AL", ...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DTE Energy PMCPVT FY2012Appx. 11 months Rondle Harp Detroit, MI GM Battery Pack Assembly Plant - Electric Substation Upgrade General business actions to support the EDV battery...


1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202, USA; email: boris@math.wayne.edu. Research of this author was also partially ...



Science Conference Proceedings (OSTI)

Room: 330A. Session Chairperson: J.E. Benci, Wayne State University, Dept. of Materials Science and Engineering, Detroit, MI 48202 ...



U.S. Energy Information Administration (EIA)

... is through August, the latest data available",,,,, ,"Norfolk, VA","Baltimore, MD","Mobile, AL","New Orleans, LA","Detroit, MI","Seattle, ...


1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202 (boris@ math.wayne.edu). Re- search of this author was also partly supported by the ...


New Fractional Error Bounds for Nonconvex Polynomial Systems ...  

E-Print Network (OSTI)

Jan 7, 2013 ... †Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. Email: boris@math.wayne.edu. Re- search of this author was ...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- Clean Energy Coalition Michigan Green Fleets Improvements andor upgrades to existing CNG refueling station in Detroit, MI. This CX form is for one location in this project...


Individual Particle-Analysis of Ambient PM2.5 Using Advanced...  

NLE Websites -- All DOE Office Websites (Extended Search)

communities near southwestern Detroit, MI (close to multiple combustion sources including motor vehiclediesel, incinerators, and oil and coal combustion sources) and Steubenville,...

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Materials for Transportation Applications: Selected Proceedings ...  

Science Conference Proceedings (OSTI)

Sep 16, 2007 ... A collection of papers from MS&T'07 held in Detroit, MI, September 16-20, 2007, covering topics related to Materials for Transportation ...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PVTD 2009 S. Richardson 102009 - 122013 Detroit, MI Installation of Retail Biofuel Infrastructure Supporting I-75 Green Corridor Project Install retail biofuel fueling...


NETL: Mercury Emissions Control Technologies - Pilot Testing...  

NLE Websites -- All DOE Office Websites (Extended Search)

Utilities, ND; Detroit Edison, MI; and SaskPower, Canada. Contacts: For further information on this project, contact NETL Project Manager, Barbara Carney or Alan Bland from WRI...


1 Introduction  

E-Print Network (OSTI)

cal/bilevel structures, stochastic programming with applications to electricity spot market. 1Department of Mathematics, Wayne State University, Detroit, MI 48202 ...



U.S. Energy Information Administration (EIA)

SEPT02MI 1. Monroe Coal Detroit Edison Co 2. Donald C Cook Nuclear Indiana Michigan Power Co 3. Ludington Pumped Storage Consumers Energy Co 4. ...


Searching, naturally  

Science Conference Proceedings (OSTI)

Keywords: artificial intelligence, computational linguistics, information retrieval, knowledge representation, natural language processing, text processing

Eileen E. Allen



liquefied natural gas LNG | OpenEI  

Open Energy Info (EERE)

liquefied natural gas LNG liquefied natural gas LNG Dataset Summary Description Alternative fueling stations are located throughout the United States and their availability continues to grow. The Alternative Fuels Data Center (AFDC) maintains a website where you can find alternative fuels stations near you or on a route, obtain counts of alternative fuels stations by state, Source Alternative Fuels Data Center Date Released December 13th, 2010 (4 years ago) Date Updated December 13th, 2010 (4 years ago) Keywords alt fuel alternative fuels alternative fuels stations biodiesel CNG compressed natural gas E85 Electricity ethanol hydrogen liquefied natural gas LNG liquefied petroleum gas LPG propane station locations Data text/csv icon alt_fuel_stations_apr_4_2012.csv (csv, 2.3 MiB) Quality Metrics


compressed natural gas | OpenEI  

Open Energy Info (EERE)

compressed natural gas compressed natural gas Dataset Summary Description Alternative fueling stations are located throughout the United States and their availability continues to grow. The Alternative Fuels Data Center (AFDC) maintains a website where you can find alternative fuels stations near you or on a route, obtain counts of alternative fuels stations by state, Source Alternative Fuels Data Center Date Released December 13th, 2010 (3 years ago) Date Updated December 13th, 2010 (3 years ago) Keywords alt fuel alternative fuels alternative fuels stations biodiesel CNG compressed natural gas E85 Electricity ethanol hydrogen liquefied natural gas LNG liquefied petroleum gas LPG propane station locations Data text/csv icon alt_fuel_stations_apr_4_2012.csv (csv, 2.3 MiB) Quality Metrics


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



,"Michigan Natural Gas Underground Storage Capacity (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Annual",2012 Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","n5290mi2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n5290mi2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/12/2013 5:30:15 PM" "Back to Contents","Data 1: Michigan Natural Gas Underground Storage Capacity (MMcf)" "Sourcekey","N5290MI2" "Date","Michigan Natural Gas Underground Storage Capacity (MMcf)" 32324,982362 32689,982362 33054,994542 33419,995181 33785,994281


,"Michigan Natural Gas Underground Storage Capacity (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Monthly","9/2013" Monthly","9/2013" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","n5290mi2m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n5290mi2m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/12/2013 5:30:15 PM" "Back to Contents","Data 1: Michigan Natural Gas Underground Storage Capacity (MMcf)" "Sourcekey","N5290MI2" "Date","Michigan Natural Gas Underground Storage Capacity (MMcf)" 37271,1070717 37302,1070717 37330,1070717 37361,1070717


City of Detroit - SmartBuildings Detroit Grant Program | Open...  

Open Energy Info (EERE)

insulation, glazing treatments, windows, doors, weatherstripping, insulated roofs, solar panels, geothermal installations, wind, hydroelectric, thermal load reduction, HVAC,...


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



Natural Gas  

Energy.gov (U.S. Department of Energy (DOE))

The Energy Department supports research and policy options to ensure environmentally sustainable domestic and global supplies of oil and natural gas.


,"Michigan Natural Gas Underground Storage Volume (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Volume (MMcf)" Volume (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Michigan Natural Gas Underground Storage Volume (MMcf)",1,"Monthly","9/2013" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","n5030mi2m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n5030mi2m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/12/2013 5:28:05 PM"


Natural gas  

E-Print Network (OSTI)

www.eia.gov Over time the electricity mix gradually shifts to lower-carbon options, led by growth in natural gas and renewable generation U.S. electricity net generation trillion kilowatthours 6

Adam Sieminski Administrator; Adam Sieminski Usnic; Adam Sieminski Usnic



Natural Gas  

U.S. Energy Information Administration (EIA)

Natural Gas. Under the baseline winter weather scenario, EIA expects end-of-October working gas inventories will total 3,830 billion cubic feet (Bcf) and end March ...


Natural Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

originate? I need to give the intitial natural source of this energy. Replies: The energy source for most known organisms is the sun. Some organisms, such as deep-sea vent fauna...

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A Long Term Field Emissions Study of Natural Gas Fueled Refuse Haulers in New York City  

DOE Green Energy (OSTI)

New York City Department of Sanitation has operated natural gas fueled refuse haulers in a pilot study: a major goal of this study was to compare the emissions from these natural gas vehicles with their diesel counterparts. The vehicles were tandem axle trucks with GVW (gross vehicle weight) rating of 69,897 pounds. The primary use of these was for street collection and transporting the refuse to a landfill. West Virginia University Transportable Heavy Duty Emissions Testing Laboratories have been engaged in monitoring the tailpipe emissions from these trucks for seven-years. In the later years of testing the hydrocarbons were speciated for non-methane and methane components. Six of these vehicles employed the older technology (mechanical mixer) Cummins L-10 lean burn natural gas engines. Five trucks were equipped with electronically controlled Detroit Diesel Series 50 lean burn engines, while another five were powered by Caterpillar stoichiometric burn 3306 natural gas engines, The Ca terpillar engines employed an exhaust oxygen sensor feedback and three way catalysts. Since the refuse haulers had automatic Allison transmissions, and since they were employed in stop-and-go city service, initial emissions measurements were made using the Central Business Cycle (SAE Jl376) for buses at 42,000 pound test weight. Some additional measurements were made using an ad hoc cycle that has been designed to be more representative of the real refuse hauler use that included several compaction cycles. The Cummins powered natural gas vehicles showed oxides of nitrogen and carbon monoxide emission variations typically associated with variable fuel mixer performance. In the first Year of testing, the stoichiometric Caterpillar engines yielded low emission levels, but in later years two of these refuse haulers had high carbon monoxide attributed to failure of the feedback system. For example, carbon monoxide on these two vehicles rose from 1.4 g/mile and 10 g/mile in 1995 to 144.9 g/mile and 57.8 g/mile in 1996. These stoichiometric engines were also less fuel efficient than their lean burn counterparts. The Detroit Diesel Series 50 powered refuse haulers produced high levels of oxides of nitrogen. However, it was found that changing the shifting patterns of the transmission lowered the oxides of nitrogen. All three engine types showed the potential for low emissions operation and the particulate matter reduction advantage offered by natural gas was evident from the results.

Nigel N. Clark; Byron l. Rapp; Mridul Gautam; Wenguang Wang; Donald W. Lyons



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Natural System  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Natural System Natural System Evaluation and Tool Development - FY11 Progress Report Prepared for U.S. Department of Energy Used Fuel Disposition Program Yifeng Wang (SNL) Michael Simpson (INL) Scott Painter (LANL) Hui-Hai Liu (LBNL) Annie B. Kersting (LLNL) July 15, 2011 FCRD-USED-2011-000223 UFD Natural System Evaluation - FY11 Year-End Report July 15, 2011 2 DISCLAIMER This information was prepared as an account of work sponsored by an agency of the U.S. Government. Neither the U.S. Government nor any agency thereof, nor any of their employees, makes any warranty, expressed or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness, of any information, apparatus, product, or process disclosed, or represents that its use would not infringe


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

134,294 32,451 0.37 0 0.00 32 1.09 43,764 0.83 10,456 0.38 39,786 1.26 126,488 0.63 C o n n e c t i c u t Connecticut 54. Summary Statistics for Natural Gas Connecticut, 1992-1996...


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

0 0.00 53 1.81 147,893 2.82 7,303 0.27 93,816 2.97 398,581 1.99 W i s c o n s i n Wisconsin 97. Summary Statistics for Natural Gas Wisconsin, 1992-1996 Table 1992 1993 1994...


Natural games  

E-Print Network (OSTI)

Behavior in the context of game theory is described as a natural process that follows the 2nd law of thermodynamics. The rate of entropy increase as the payoff function is derived from statistical physics of open systems. The thermodynamic formalism relates everything in terms of energy and describes various ways to consume free energy. This allows us to associate game theoretical models of behavior to physical reality. Ultimately behavior is viewed as a physical process where flows of energy naturally select ways to consume free energy as soon as possible. This natural process is, according to the profound thermodynamic principle, equivalent to entropy increase in the least time. However, the physical portrayal of behavior does not imply determinism. On the contrary, evolutionary equation for open systems reveals that when there are three or more degrees of freedom for behavior, the course of a game is inherently unpredictable in detail because each move affects motives of moves in the future. Eventually, when no moves are found to consume more free energy, the extensive-form game has arrived at a solution concept that satisfies the minimax theorem. The equilibrium is Lyapunov-stable against variation in behavior within strategies but will be perturbed by a new strategy that will draw even more surrounding resources to the game. Entropy as the payoff function also clarifies motives of collaboration and subjective nature of decision making.

Jani Anttila; Arto Annila



Natural Gas  

Annual Energy Outlook 2012 (EIA)

3.91 119,251 0.60 229 7.81 374,824 7.15 2,867 0.10 189,966 6.01 915,035 4.57 O h i o Ohio 83. Summary Statistics for Natural Gas Ohio, 1992-1996 Table 1992 1993 1994 1995 1996...


Natural Gas  

Annual Energy Outlook 2012 (EIA)

10,799 1,953 0.02 0 0.00 0 0.00 2,523 0.05 24 0.00 2,825 0.09 7,325 0.04 V e r m o n t Vermont 93. Summary Statistics for Natural Gas Vermont, 1992-1996 Table 1992 1993 1994 1995...


Natural Gas  

Annual Energy Outlook 2012 (EIA)

845,998 243,499 2.75 135,000 0.68 35 1.19 278,606 5.32 7,239 0.26 154,642 4.90 684,022 3.42 P e n n s y l v a n i a Pennsylvania 86. Summary Statistics for Natural Gas...


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

,366 ,366 95,493 1.08 0 0.00 1 0.03 29,406 0.56 1,206 0.04 20,328 0.64 146,434 0.73 - Natural Gas 1996 Million Percent of Million Percent of Cu. Feet National Total Cu. Feet National Total Net Interstate Movements: Industrial: Marketed Production: Vehicle Fuel: Deliveries to Consumers: Electric Residential: Utilities: Commercial: Total: South Carolina South Carolina 88. Summary Statistics for Natural Gas South Carolina, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 0 0 0 0 0 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ...........................................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

0,216 0,216 50,022 0.56 135 0.00 49 1.67 85,533 1.63 8,455 0.31 45,842 1.45 189,901 0.95 - Natural Gas 1996 Million Percent of Million Percent of Cu. Feet National Total Cu. Feet National Total Net Interstate Movements: Industrial: Marketed Production: Vehicle Fuel: Deliveries to Consumers: Electric Residential: Utilities: Commercial: Total: M a r y l a n d Maryland 68. Summary Statistics for Natural Gas Maryland, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... NA NA NA NA NA Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 9 7 7 7 8 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 33 28 26 22 135 From Oil Wells ...........................................


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Natural networks  

E-Print Network (OSTI)

Scale-free and non-computable characteristics of natural networks are found to result from the least-time dispersal of energy. To consider a network as a thermodynamic system is motivated since ultimately everything that exists can be expressed in terms of energy. According to the variational principle, the network will grow and restructure when flows of energy diminish energy differences between nodes as well as relative to nodes in surrounding systems. The natural process will yield scale-free characteristics because the nodes that contribute to the least-time consumption of free energy preferably attach to each other. Network evolution is a path-dependent and non-deterministic process when there are two or more paths to consume a common source of energy. Although evolutionary courses of these non-Hamiltonian systems cannot be predicted, many mathematical functions, models and measures that characterize networks can be recognized as appropriate approximations of the thermodynamic equation of motion that has been derived from statistical physics of open systems.

Tuomo Hartonen; Arto Annila



Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

68,747 68,747 34,577 0.39 0 0.00 34 1.16 14,941 0.29 0 0.00 11,506 0.36 61,058 0.31 I d a h o Idaho 60. Summary Statistics for Natural Gas Idaho, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 0 0 0 0 0 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 0 0 0 0 0 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ............... 0 0 0 0 0 Wet After Lease Separation.......................... 0 0 0 0 0 Vented


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

0 0 0 0.00 0 0.00 0 0.00 540 0.01 0 0.00 2,132 0.07 2,672 0.01 H a w a i i Hawaii 59. Summary Statistics for Natural Gas Hawaii, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 0 0 0 0 0 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 0 0 0 0 0 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ............... 0 0 0 0 0 Wet After Lease Separation.......................... 0 0 0 0 0 Vented and Flared


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

483,052 483,052 136,722 1.54 6,006 0.03 88 3.00 16,293 0.31 283,557 10.38 41,810 1.32 478,471 2.39 F l o r i d a Florida 57. Summary Statistics for Natural Gas Florida, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 47 50 98 92 96 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ........................................... 7,584 8,011 8,468 7,133 6,706 Total.............................................................. 7,584 8,011 8,468 7,133 6,706 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ...............

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

291,898 291,898 113,995 1.29 0 0.00 4 0.14 88,078 1.68 3,491 0.13 54,571 1.73 260,140 1.30 I o w a Iowa 63. Summary Statistics for Natural Gas Iowa, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 0 0 0 0 0 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 0 0 0 0 0 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ............... 0 0 0 0 0 Wet After Lease Separation.......................... 0 0 0


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

Vehicle Fuel: Vehicle Fuel: Deliveries to Consumers: Electric Residential: Utilities: Commercial: Total: New England New England 36. Summary Statistics for Natural Gas New England, 1992-1996 Table 691,089 167,354 1.89 0 0.00 40 1.36 187,469 3.58 80,592 2.95 160,761 5.09 596,215 2.98 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 0 0 0 0 0 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 0 0 0 0 0 Repressuring ................................................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

42,980 42,980 14,164 0.16 0 0.00 1 0.03 9,791 0.19 23,370 0.86 6,694 0.21 54,020 0.27 D e l a w a r e Delaware 55. Summary Statistics for Natural Gas Delaware, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 0 0 0 0 0 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 0 0 0 0 0 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ............... 0 0 0 0 0 Wet After Lease Separation..........................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

-49,536 -49,536 7,911 0.09 49,674 0.25 15 0.51 12,591 0.24 3 0.00 12,150 0.38 32,670 0.16 North Dakota North Dakota 82. Summary Statistics for Natural Gas North Dakota, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 496 525 507 463 462 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 104 101 104 99 108 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 12,461 18,892 19,592 16,914 16,810 From Oil Wells ........................................... 47,518 46,059 43,640 39,760 38,906 Total.............................................................. 59,979 64,951 63,232 56,674 55,716 Repressuring ................................................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

21,547 21,547 4,916 0.06 0 0.00 0 0.00 7,012 0.13 3 0.00 7,099 0.22 19,031 0.10 N e w H a m p s h i r e New Hampshire 77. Summary Statistics for Natural Gas New Hampshire, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 0 0 0 0 0 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 0 0 0 0 0 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ............... 0 0 0 0 0 Wet After Lease Separation..........................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

139,881 139,881 26,979 0.30 463 0.00 115 3.92 27,709 0.53 19,248 0.70 28,987 0.92 103,037 0.52 A r i z o n a Arizona 50. Summary Statistics for Natural Gas Arizona, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... NA NA NA NA NA Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 6 6 6 7 7 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 721 508 711 470 417 From Oil Wells ........................................... 72 110 48 88 47 Total.............................................................. 794 618 759 558 464 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ............... 0 0 0 0 0 Wet After Lease


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

Middle Middle Atlantic Middle Atlantic 37. Summary Statistics for Natural Gas Middle Atlantic, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 1,857 1,981 2,042 1,679 1,928 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 36,906 36,857 26,180 37,159 38,000 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 161,372 152,717 140,444 128,677 152,494 From Oil Wells ........................................... 824 610 539 723 641 Total.............................................................. 162,196 153,327 140,982 129,400 153,134 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

386,690 386,690 102,471 1.16 0 0.00 43 1.47 142,319 2.72 5,301 0.19 98,537 3.12 348,671 1.74 M i n n e s o t a Minnesota 71. Summary Statistics for Natural Gas Minnesota, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 0 0 0 0 0 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 0 0 0 0 0 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ............... 0 0 0 0 0 Wet After Lease Separation..........................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

1,108,583 1,108,583 322,275 3.63 298 0.00 32 1.09 538,749 10.28 25,863 0.95 218,054 6.90 1,104,972 5.52 I l l i n o i s Illinois 61. Summary Statistics for Natural Gas Illinois, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... NA NA NA NA NA Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 382 385 390 372 370 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 337 330 323 325 289 From Oil Wells ........................................... 10 10 10 10 9 Total.............................................................. 347 340 333 335 298 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ...............


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

286,485 286,485 71,533 0.81 25 0.00 31 1.06 137,225 2.62 5,223 0.19 72,802 2.31 286,814 1.43 M i s s o u r i Missouri 73. Summary Statistics for Natural Gas Missouri, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... NA NA NA NA NA Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 5 8 12 15 24 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 27 14 8 16 25 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 27 14 8 16 25 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ............... 0 0 0 0 0 Wet After Lease Separation..........................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

411,951 411,951 100,015 1.13 0 0.00 5 0.17 114,365 2.18 45,037 1.65 96,187 3.05 355,609 1.78 Massachusetts Massachusetts 69. Summary Statistics for Natural Gas Massachusetts, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 0 0 0 0 0 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 0 0 0 0 0 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ............... 0 0 0 0 0 Wet After Lease Separation..........................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

226,798 226,798 104,124 1.17 0 0.00 0 0.00 58,812 1.12 2,381 0.09 40,467 1.28 205,783 1.03 North Carolina North Carolina 81. Summary Statistics for Natural Gas North Carolina, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 0 0 0 0 0 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 0 0 0 0 0 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ............... 0 0 0 0 0 Wet After Lease Separation..........................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

29,693 29,693 0 0.00 0 0.00 6 0.20 17,290 0.33 0 0.00 16,347 0.52 33,644 0.17 District of Columbia District of Columbia 56. Summary Statistics for Natural Gas District of Columbia, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 0 0 0 0 0 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 0 0 0 0 0 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 0 0 0 0 0 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 0 0 0 0 0 Repressuring ................................................ 0 0 0 0 0 Nonhydrocarbon Gases Removed ............... 0 0 0 0 0 Wet After Lease Separation..........................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

73,669 73,669 141,300 1.59 221,822 1.12 3 0.10 46,289 0.88 33,988 1.24 31,006 0.98 252,585 1.26 A r k a n s a s Arkansas 51. Summary Statistics for Natural Gas Arkansas, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 1,750 1,552 1,607 1,563 1,470 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 3,500 3,500 3,500 3,988 4,020 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 171,543 166,273 161,967 161,390 182,895 From Oil Wells ........................................... 39,364 38,279 33,446 33,979 41,551 Total.............................................................. 210,906 204,552 195,413 195,369 224,446 Repressuring ................................................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

-1,080,240 -1,080,240 201,024 2.27 1,734,887 8.78 133 4.54 76,629 1.46 136,436 4.99 46,152 1.46 460,373 2.30 O k l a h o m a Oklahoma 84. Summary Statistics for Natural Gas Oklahoma, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 13,926 13,289 13,487 13,438 13,074 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 28,902 29,118 29,121 29,733 29,733 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 1,674,405 1,732,997 1,626,858 1,521,857 1,467,695 From Oil Wells ........................................... 342,950 316,945 308,006 289,877 267,192 Total.............................................................. 2,017,356 2,049,942 1,934,864


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

7,038,115 7,038,115 3,528,911 39.78 13,646,477 69.09 183 6.24 408,861 7.80 1,461,718 53.49 281,452 8.91 5,681,125 28.40 West South Central West South Central 42. Summary Statistics for Natural Gas West South Central, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 87,198 84,777 88,034 88,734 62,357 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 92,212 95,288 94,233 102,525 102,864 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 11,599,913 11,749,649 11,959,444 11,824,788 12,116,665 From Oil Wells ........................................... 2,313,831 2,368,395 2,308,634 2,217,752 2,151,247 Total..............................................................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

77,379 77,379 94,481 1.07 81,435 0.41 8 0.27 70,232 1.34 1,836 0.07 40,972 1.30 207,529 1.04 K e n t u c k y Kentucky 65. Summary Statistics for Natural Gas Kentucky, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 1,084 1,003 969 1,044 983 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 12,483 12,836 13,036 13,311 13,501 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 79,690 86,966 73,081 74,754 81,435 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. 79,690 86,966 73,081 74,754 81,435 Repressuring ................................................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

-67,648 -67,648 75,616 0.85 480,828 2.43 0 0.00 16,720 0.32 31,767 1.16 29,447 0.93 153,549 0.77 Pacific Noncontiguous Pacific Noncontiguous 45. Summary Statistics for Natural Gas Pacific Noncontiguous, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 9,638 9,907 9,733 9,497 9,294 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 112 113 104 100 102 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 198,603 190,139 180,639 179,470 183,747 From Oil Wells ........................................... 2,427,110 2,588,202 2,905,261 3,190,433 3,189,837 Total.............................................................. 2,625,713 2,778,341


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

-310,913 -310,913 110,294 1.24 712,796 3.61 2 0.07 85,376 1.63 22,607 0.83 57,229 1.81 275,508 1.38 K a n s a s Kansas 64. Summary Statistics for Natural Gas Kansas, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 9,681 9,348 9,156 8,571 7,694 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 18,400 19,472 19,365 22,020 21,388 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 580,572 605,578 628,900 636,582 629,755 From Oil Wells ........................................... 79,169 82,579 85,759 86,807 85,876 Total.............................................................. 659,741 688,157 714,659 723,389 715,631 Repressuring ................................................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

819,046 819,046 347,043 3.91 245,740 1.24 40 1.36 399,522 7.62 32,559 1.19 201,390 6.38 980,555 4.90 M i c h i g a n Michigan 70. Summary Statistics for Natural Gas Michigan, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 1,223 1,160 1,323 1,294 2,061 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 3,257 5,500 6,000 5,258 5,826 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 120,287 126,179 136,989 146,320 201,123 From Oil Wells ........................................... 80,192 84,119 91,332 97,547 50,281 Total.............................................................. 200,479 210,299 228,321 243,867 251,404 Repressuring ................................................

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

W W y o m i n g -775,410 50,253 0.57 666,036 3.37 14 0.48 13,534 0.26 87 0.00 9,721 0.31 73,609 0.37 Wyoming 98. Summary Statistics for Natural Gas Wyoming, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 10,826 10,933 10,879 12,166 12,320 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 3,111 3,615 3,942 4,196 4,510 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 751,693 880,596 949,343 988,671 981,115 From Oil Wells ........................................... 285,125 142,006 121,519 111,442 109,434 Total.............................................................. 1,036,817 1,022,602 1,070,862 1,100,113 1,090,549 Repressuring


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

-67,648 -67,648 75,616 0.85 480,828 2.43 0 0.00 16,179 0.31 31,767 1.16 27,315 0.86 150,877 0.75 A l a s k a Alaska 49. Summary Statistics for Natural Gas Alaska, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 9,638 9,907 9,733 9,497 9,294 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 112 113 104 100 102 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 198,603 190,139 180,639 179,470 183,747 From Oil Wells ........................................... 2,427,110 2,588,202 2,905,261 3,190,433 3,189,837 Total.............................................................. 2,625,713 2,778,341 3,085,900 3,369,904 3,373,584 Repressuring


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

628,189 628,189 449,511 5.07 765,699 3.88 100 3.41 528,662 10.09 39,700 1.45 347,721 11.01 1,365,694 6.83 West North Central West North Central 39. Summary Statistics for Natural Gas West North Central, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 10,177 9,873 9,663 9,034 8,156 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 18,569 19,687 19,623 22,277 21,669 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 594,551 626,728 651,594 655,917 648,822 From Oil Wells ........................................... 133,335 135,565 136,468 134,776 133,390 Total.............................................................. 727,886 762,293


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

1,048,760 1,048,760 322,661 3.64 18,131 0.09 54 1.84 403,264 7.69 142,688 5.22 253,075 8.01 1,121,742 5.61 N e w Y o r k New York 80. Summary Statistics for Natural Gas New York, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 329 264 242 197 232 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 5,906 5,757 5,884 6,134 6,208 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 22,697 20,587 19,937 17,677 17,494 From Oil Wells ........................................... 824 610 539 723 641 Total.............................................................. 23,521 21,197 20,476 18,400 18,134 Repressuring ................................................


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

1,554,530 1,554,530 311,229 3.51 3,094,431 15.67 442 15.08 299,923 5.72 105,479 3.86 210,381 6.66 927,454 4.64 Mountain Mountain 43. Summary Statistics for Natural Gas Mountain, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 38,711 38,987 37,366 39,275 38,944 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 30,965 34,975 38,539 38,775 41,236 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 2,352,729 2,723,393 3,046,159 3,131,205 3,166,689 From Oil Wells ........................................... 677,771 535,884 472,397 503,986 505,903 Total.............................................................. 3,030,499 3,259,277 3,518,556


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

1,592,465 1,592,465 716,648 8.08 239,415 1.21 182 6.21 457,792 8.73 334,123 12.23 320,153 10.14 1,828,898 9.14 South Atlantic South Atlantic 40. Summary Statistics for Natural Gas South Atlantic, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 3,307 3,811 4,496 4,427 4,729 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 39,412 35,149 41,307 37,822 36,827 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 206,766 208,892 234,058 236,072 233,409 From Oil Wells ........................................... 7,584 8,011 8,468 7,133 6,706 Total.............................................................. 214,349 216,903 242,526 243,204 240,115


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

1,999,161 1,999,161 895,529 10.10 287,933 1.46 1,402 47.82 569,235 10.86 338,640 12.39 308,804 9.78 2,113,610 10.57 Pacific Contiguous Pacific Contiguous 44. Summary Statistics for Natural Gas Pacific Contiguous, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 3,896 3,781 3,572 3,508 2,082 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 1,142 1,110 1,280 1,014 996 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... 156,635 124,207 117,725 96,329 88,173 From Oil Wells ........................................... 294,800 285,162 282,227 289,430 313,581 Total.............................................................. 451,435 409,370


Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

-122,394 -122,394 49,997 0.56 178,984 0.91 5 0.17 37,390 0.71 205 0.01 28,025 0.89 115,622 0.58 West Virginia West Virginia 96. Summary Statistics for Natural Gas West Virginia, 1992-1996 Table 1992 1993 1994 1995 1996 Reserves (billion cubic feet) Estimated Proved Reserves (dry) as of December 31 ....................................... 2,356 2,439 2,565 2,499 2,703 Number of Gas and Gas Condensate Wells Producing at End of Year.............................. 38,250 33,716 39,830 36,144 35,148 Production (million cubic feet) Gross Withdrawals From Gas Wells ......................................... E 182,000 171,024 183,773 186,231 178,984 From Oil Wells ........................................... 0 0 0 0 0 Total.............................................................. E 182,000 171,024 183,773 186,231 178,984 Repressuring ................................................


Unconventional Natural Gas  

NLE Websites -- All DOE Office Websites (Extended Search)

Natural Gas Unconventional Natural Gas Los Alamos scientists are committed to the efficient and environmentally-safe development of major U.S. natural gas and oil resources....


,"Texas Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Wellhead Price (Dollars per Thousand Cubic Feet)","Texas Natural Gas Imports Price (Dollars per Thousand Cubic Feet)","Price of Texas Natural Gas Exports...


,"Mississippi Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Wellhead Price (Dollars per Thousand Cubic Feet)","Mississippi Natural Gas Imports Price All Countries (Dollars per Thousand Cubic Feet)","Mississippi Natural Gas...


,"Montana Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Wellhead Price (Dollars per Thousand Cubic Feet)","Montana Natural Gas Imports Price (Dollars per Thousand Cubic Feet)","Price of Montana Natural Gas Exports...


,"Michigan Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Wellhead Price (Dollars per Thousand Cubic Feet)","Michigan Natural Gas Imports Price (Dollars per Thousand Cubic Feet)","Price of Michigan Natural Gas Exports...


SRNL - Natural Attenuation Monitor  

NLE Websites -- All DOE Office Websites (Extended Search)

Natural Attenuation Monitor covers Natural Attenuation Monitor Published by the US DOE Monitored Natural Attenuation and Enhanced Attenuation for Chlorinated Solvents Technology...


T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Natural Gas Vehicles  

Energy.gov (U.S. Department of Energy (DOE))

Natural gas vehicles (NGVs) are either fueled exclusively with compressed natural gas or liquefied natural gas (dedicated NGVs) or are capable of natural gas and gasoline fueling (bi-fuel NGVs).


100,000 quads of natural gas  

DOE Green Energy (OSTI)

Of the various possible unconventional natural gas resources that have been examined, the most recent, and by far the largest, is that which is dissolved in the hot salt water within the geopressurized zones of the Gulf Coast. Recent assessments have estimated that the amount of gas contained in these waters, underlying about 150,000 sq. mi. of Texas and Louisiana--both onshore and offshore--is between 60,000 and 100,000 quads. In addition to the natural gas, there is a huge potential for producing electric power from the heat content of the fluid, as well as other potential uses for hot water. The net value of this geothermal heat may be about half that of the natural gas. The major problems associated with commercial production of the fluids from these zones and the extraction of energy from the heat and pressure of the fluid are discussed and the long-term potential is estimated. It appears likely that commercial production will depend upon the existence of uncontrolled prices for natural gas and the satisfactory resolution of various legal, environmental, and institutional problems, all of which are likely to require considerable effort. Although the production potential from the Gulf Coast zones might be accurately estimated after a decade or so of active research and development, at present the long-term potential appears to be between 4 percent and 50 percent of the fluid within the reservoirs that are eventually developed. Although the costs of production of gas and electric power from this resource may not be cheap, the principal reservoirs should be relatively easy to locate in the onshore Gulf region because of the existing data available from the vast number of wells that have already been drilled.

Brown, W.M.


Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Regulation of natural monopolies  

E-Print Network (OSTI)

This chapter provides a comprehensive overview of the theoretical and empirical literature on the regulation of natural monopolies. It covers alternative definitions of natural monopoly, regulatory goals, alternative ...

Joskow, Paul L.



Natural Gas Annual Archives  

U.S. Energy Information Administration (EIA)

Petroleum & Other Liquids. Crude oil, gasoline, heating oil, diesel, propane, and other liquids including biofuels and natural gas liquids. Natural Gas


Liquefied Natural Gas  

U.S. Energy Information Administration (EIA)

Petroleum & Other Liquids. Crude oil, gasoline, heating oil, diesel, propane, and other liquids including biofuels and natural gas liquids. Natural Gas


Natural Gas Weekly Update  

Annual Energy Outlook 2012 (EIA)

natural gas prices, successful application of horizontal drilling, and hydraulic fracturing, as well as significant investments made by natural gas companies in production...


Natural Gas Production  

U.S. Energy Information Administration (EIA)

Natural Gas Production. Measured By. Disseminated Through. Survey of Producing States and Mineral Management Service “Evolving Estimate” in Natural Gas Monthly.


EIA - Natural Gas Publications  

Annual Energy Outlook 2012 (EIA)

and a weather snapshot. Monthly Natural Gas Monthly Natural and supplemental gas production, supply, consumption, disposition, storage, imports, exports, and prices in the...


Natural Gas Exports (Summary)  

U.S. Energy Information Administration (EIA)

Estimates for Canadian pipeline volumes are derived from the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates of dry natural gas imports.


Natural Gas Weekly Update  

Annual Energy Outlook 2012 (EIA)

Release: Thursday, August 26, 2010 Overview Prices Storage Other Market Trends Natural Gas Transportation Update Overview (For the Week Ending Wednesday, August 18, 2010) Natural...


Natural Gas Weekly Update  

Annual Energy Outlook 2012 (EIA)

7, 2009 Next Release: May 14, 2009 Overview Prices Storage Other Market Trends Natural Gas Transportation Update Overview (For the Week Ending Wednesday, May 6, 2009) Natural gas...


Historical Natural Gas Annual  

Annual Energy Outlook 2012 (EIA)

8 The Historical Natural Gas Annual contains historical information on supply and disposition of natural gas at the national, regional, and State level as well as prices at...


Historical Natural Gas Annual  

Gasoline and Diesel Fuel Update (EIA)

7 The Historical Natural Gas Annual contains historical information on supply and disposition of natural gas at the national, regional, and State level as well as prices at...


Historical Natural Gas Annual  

Annual Energy Outlook 2012 (EIA)

6 The Historical Natural Gas Annual contains historical information on supply and disposition of natural gas at the national, regional, and State level as well as prices at...


Natural Gas Rules (Louisiana)  

Energy.gov (U.S. Department of Energy (DOE))

The Louisiana Department of Natural Resources administers the rules that govern natural gas exploration and extraction in the state. DNR works with the Louisiana Department of Environmental...


Annual Energy Outlook 2013 Early Release Reference Case  

U.S. Energy Information Administration (EIA) Indexed Site

Vehicle Choice Modeling and Vehicle Choice Modeling and Projections for the Annual Energy Outlook John Maples Office of Energy Analysis, Energy Efficiency and End Use January 25, 2013 | Detroit, MI Outline John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 2 * Overview of model structure and inputs * Battery electric vehicles and current state of the market * Projections of battery electric vehicles in the Annual Energy Outlook 2013 * High Battery Technology case in the Annual Energy Outlook 2012 Overview of model structure and inputs 3 John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 Light duty vehicle technology market penetration John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 4 * Technologies affecting light-duty vehicle fuel economy are


Level schedule implementation in unstable manufacturing environments  

E-Print Network (OSTI)

American Axle & Manufacturing Inc. (AAM), headquartered in Detroit (MI) is one of the major Tier 1 suppliers in the automotive industry. The main challenge in AAM plant 2 is production rate unstability due to downtime, ...

López de Haro, Santiago




E-Print Network (OSTI)

?Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. ( boris@math.wayne.edu) ...... alent to the fundamental metric regularity property of the inverse F?1. The latter ...... Handbook of Semidefinite Program- ming: Theory  ...


Detroit, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

27°, -83.0457538° 27°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.331427,"lon":-83.0457538,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Detroit Public Lighting Department - Commercial and Industrial...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

HVAC Equipment: 10-30ton Programmable Thermostat: 80 Window Glazing: 0.30square foot Window Film: 0.20 Chillers: 7 - 40ton Variable Frequency Drives: 70-180...


Detroit Public Lighting Department - Residential Energy Wise...  

Open Energy Info (EERE)

Multi-Family Residential, Residential Eligible Technologies Ceiling Fan, Lighting, LED Lighting Active Incentive Yes Implementing Sector Utility Energy Category Energy...

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Detroit Edison Co | Open Energy Information  

Open Energy Info (EERE)



Southern California: The Detroit of Electric Cars?  

E-Print Network (OSTI)

electric cars as a potential solution. and susceptible to rapid change; (c) con- ulations governing vehicle safety

Scott, Allen J.



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Clean Fleets Announcement 1 of 14 Clean Fleets Announcement Untitled Secretary Chu Visits Dublin, Ireland 110410-110510 Keep Your Home Office Efficient with ENERGY STAR. Home...


The Regeneration of Urban Empty Space / Detroit.  

E-Print Network (OSTI)

??The depopulation of once-major central cities is no longer an uncommon occurrence. Between the years 1950 and 2010, over 350 large cities worldwide lost a… (more)

Hall, Philip A.



Sub[urban] Detroit: Mediating the Expression.  

E-Print Network (OSTI)

??In an era commodified by images and sounds throughout the global public landscape, architecture is not only being transformed by new technology, but by the… (more)

Karalambo, Paul N.



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A New Energy-Efficient Home in the D.C. Community Solar Decathlon at Home in the D.C. Community Record-Breaking Solar Game-Changing Advancements in Solar Energy Energy Pumpkin...


Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Supercomputers' Pictorial Superpowers How the Smart Grid Helps Homeowners Reduce Their Energy Use EcoCAR Challenge Finish Line Event 1 of 8 Students Earn Street Cred With the...


Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Management Trade Show Supercomputers' Pictorial Superpowers How the Smart Grid Helps Homeowners Reduce Their Energy Use EcoCAR Challenge Finish Line Event 1 of 8 Students Earn...


Southern California: The Detroit of Electric Cars?  

E-Print Network (OSTI)

by building a new electric-vehicle industry in Southerntime being, the electric vehicle industry electric-vehicleindustry into the electric-vehicle industry. • Inclusion of

Scott, Allen J.



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Saving Energy and Resources Revolutionizing Manufacturing INFOGRAPHIC: Wind Energy in America National Wind Technology Center - Colorado America's Wind Testing Facilities Beyond...


EIA - Natural Gas Pipeline Network - Natural Gas Transmission...  

Annual Energy Outlook 2012 (EIA)

Transmission Path Diagram About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 20072008 with selected updates Natural Gas Transmission Path Natural...


Savine Pass, LA Natural Gas Liquefied Natural Gas Imports from...  

U.S. Energy Information Administration (EIA) Indexed Site

Savine Pass, LA Natural Gas Liquefied Natural Gas Imports from Egypt (Million Cubic Feet) Savine Pass, LA Natural Gas Liquefied Natural Gas Imports from Egypt (Million Cubic Feet)...


Highgate Springs, VT Natural Gas Liquefied Natural Gas Imports...  

U.S. Energy Information Administration (EIA) Indexed Site

Highgate Springs, VT Natural Gas Liquefied Natural Gas Imports from Canada (Million Cubic Feet) Highgate Springs, VT Natural Gas Liquefied Natural Gas Imports from Canada (Million...


Northeast Gateway, LA Natural Gas Liquefied Natural Gas Imports...  

U.S. Energy Information Administration (EIA) Indexed Site

Gateway, LA Natural Gas Liquefied Natural Gas Imports from Egypt (Million Cubic Feet) Northeast Gateway, LA Natural Gas Liquefied Natural Gas Imports from Egypt (Million Cubic...


Lake Charles, LA Natural Gas Liquefied Natural Gas Imports from...  

Gasoline and Diesel Fuel Update (EIA)

Lake Charles, LA Natural Gas Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Lake Charles, LA Natural Gas Liquefied Natural Gas Imports from Trinidad...


Cameron, LA Natural Gas Liquefied Natural Gas Imports from Trinidad...  

Gasoline and Diesel Fuel Update (EIA)

Natural Gas Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Cameron, LA Natural Gas Liquefied Natural Gas Imports from Trinidad and Tobago (Million...


Savine Pass, LA Natural Gas Liquefied Natural Gas Imports from...  

Annual Energy Outlook 2012 (EIA)

Savine Pass, LA Natural Gas Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Savine Pass, LA Natural Gas Liquefied Natural Gas Imports from Trinidad and...


Golden Pass, TX Natural Gas Liquefied Natural Gas Imports (price...  

Gasoline and Diesel Fuel Update (EIA)

Golden Pass, TX Natural Gas Liquefied Natural Gas Imports (price) (Dollars per Thousand Cubic Feet) Golden Pass, TX Natural Gas Liquefied Natural Gas Imports (price) (Dollars per...


South Dakota Natural Gas Removed from Natural Gas (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

View History: Monthly Annual Download Data (XLS File) South Dakota Natural Gas Removed from Natural Gas (Million Cubic Feet) South Dakota Natural Gas Removed from Natural Gas...


International Energy Outlook - Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

Natural Gas International Energy Outlook 2004 Natural Gas Natural gas is the fastest growing primary energy source in the IEO2004 forecast. Consumption of natural gas is projected...

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



EIA - Natural Gas Pipeline Network - Natural Gas Pipeline Mileage...  

U.S. Energy Information Administration (EIA) Indexed Site

Home > Natural Gas > About U.S. Natural Gas Pipelines > Natural Gas Pipeline Mileage by State About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through...


Natural Gas Annual, 2001  

Gasoline and Diesel Fuel Update (EIA)

1 1 EIA Home > Natural Gas > Natural Gas Data Publications Natural Gas Annual, 2001 The Natural Gas Annual, 2001 provides information on the supply and disposition of natural gas in the United States. Production, transmission, storage, deliveries, and price data are published by State for 2001. Summary data are presented for each State for 1997 to 2001. The data that appear in the tables of the Natural Gas Annual, 2001 are available as self-extracting executable files in ASCII TXT or CSV file format. This volume emphasizes information for 2001, although some tables show a five-year history. Please read the file entitled README.V1 for a description and documentation of information included in this file. Also available are files containing the following data: Summary Statistics - Natural Gas in the United States, 1997-2001 (Table 1) ASCII TXT, and Natural Gas Supply and Disposition by State, 2001 (Table 2) ASCII TXT.


Perceptions of the natural  

E-Print Network (OSTI)

This thesis takes on the difficulty of defining a clear line that connects and separates natural and artificial in a contemporary landscape. It is a proposal for a park that addresses the image and understanding of nature. ...

Filipovic, Renata, 1973-



Natural Gas Weekly Update  

Annual Energy Outlook 2012 (EIA)

natural gas futures also reversed gains made in the previous week. Wellhead Prices Annual Energy Review More Price Data Storage Working natural gas in storage increased by 63 Bcf...


Natural gas annual 1996  

Science Conference Proceedings (OSTI)

This document provides information on the supply and disposition of natural gas to a wide audience. The 1996 data are presented in a sequence that follows natural gas from it`s production to it`s end use.




Focused natural deduction  

Science Conference Proceedings (OSTI)

Natural deduction for intuitionistic linear logic is known to be full of non-deterministic choices. In order to control these choices, we combine ideas from intercalation and focusing to arrive at the calculus of focused natural deduction. The calculus ...

Taus Brock-Nannestad; Carsten Schürmann



Natural Gas Weekly Update  

Annual Energy Outlook 2012 (EIA)

with active programs. More information is available at: http:www.eia.doe.govcneafelectricitypagerestructuringrestructureelect.html. Information about natural gas...


Natural gas annual 1994  

SciTech Connect

The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. The 1994 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production to its end use. This is followed by tables summarizing natural gas supply and disposition from 1990 to 1994 for each Census Division and each State. Annual historical data are shown at the national level.




Natural gas annual 1995  

Science Conference Proceedings (OSTI)

The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. The 1995 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production to its end use. This is followed by tables summarizing natural gas supply and disposition from 1991 to 1995 for each Census Division and each State. Annual historical data are shown at the national level.




Natural gas monthly  

Science Conference Proceedings (OSTI)

Monthly highlights of activities, events, and analyses of interest to public and private sector organizations associated with the natural gas industry are presented. Feature articles for this issue are: Natural Gas Overview for Winter 1983-1984 by Karen A. Kelley; and an Analysis of Natural Gas Sales by John H. Herbert. (PSB)

Not Available



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


Natural Gas Annual 2006  

Gasoline and Diesel Fuel Update (EIA)

6 6 Released: October 31, 2007 The Natural Gas Annual 2006 Summary Highlights provides an overview of the supply and disposition of natural gas in 2006 and is intended as a supplement to the Natural Gas Annual 2006. The Natural Gas Annual 2006 Summary Highlights provides an overview of the supply and disposition of natural gas in 2006 and is intended as a supplement to the Natural Gas Annual 2006. Natural Gas Annual --- Full report in PDF (5 MB) Special Files --- All CSV files contained in a self-extracting executable file. Respondent/Company Level Natural Gas Data Files Annual Natural and Supplemental Gas Supply and Disposition Company level data (1996 to 2007) as reported on Form EIA-176 are provided in the EIA-176 Query System and selected data files. EIA-191A Field Level Underground Natural Gas Storage Data: Detailed annual data (2006 and 2007) of storage field capacity, field type, and maximum deliverability as of December 31st of the report year, as reported by operators of all U.S. underground natural gas storage fields.


Natural gas sdtrategic plan  

SciTech Connect

The US Department of Energy`s natural gas program is aimed at meeting simultaneously our national energy needs, reducing oil imports, protecting our environment, and improving our economy The Natural Gas Strategic Plan for 1995 represents a Department-wide effort to articulate the key issues related to the expanded development and utilization of natural gas, and defines the roles of the federal government and US industry in partnering to accomplish the strategic goals defined. The four overarching goals of the Natural Gas Strategic Plan are to: foster the development of advanced natural gas technologies; encourage the adoption of advanced natural gas technologies in new and existing markets; support the removal of policy impediments to natural gas use in new and existing markets; and foster technologies and policies to maximize the environmental benefits of natural gas use. DOE`s proposed fiscal year (FY) 1996 budget represents a commitment to natural gas research, development, and demonstration (RD&D) from reservoir to end use. DOE has redirected and increased funding for its natural gas exploration, production, delivery and storage, processing, and utilization RD&D programs, shifting funds from other energy programs to programs that will enhance efficiency and advance the role of natural gas in our domestic energy resources portfolio.



Natural Gas Annual, 2004  

Gasoline and Diesel Fuel Update (EIA)

4 4 EIA Home > Natural Gas > Natural Gas Data Publications Natural Gas Annual, 2004 Natural Gas Annual 2004 Release date: December 19, 2005 Next release date: January 2007 The Natural Gas Annual, 2004 provides information on the supply and disposition of natural gas in the United States. Production, transmission, storage, deliveries, and price data are published by State for 2004. Summary data are presented for each State for 2000 to 2004. The data that appear in the tables of the Natural Gas Annual, 2004 is available as self-extracting executable file or CSV file format. This volume emphasizes information for 2004, although some tables show a five-year history. Please read the file entitled README.V1 for a description and documentation of information included in this file.


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 – 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



EIA - Natural Gas Pipeline Network - Natural Gas Import/Export ...  

U.S. Energy Information Administration (EIA)

Home > Natural Gas > About U.S. Natural Gas Pipelines > Natural ... The EIA has determined that the informational map displays here do not raise security ...


EIA - Natural Gas Pipeline Network - Natural Gas Transportation...  

Gasoline and Diesel Fuel Update (EIA)

Corridors > Major U.S. Natural Gas Transportation Corridors Map About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 20072008 with selected updates...


Natural Gas Annual 2007  

Gasoline and Diesel Fuel Update (EIA)

7 7 Released: January 28, 2009 The Natural Gas Annual 2007 provides information on the supply and disposition of natural gas in the United States. Production, transmission, storage, deliveries, and price data are published by State for 2007. Summary data are presented for each State for 2003 to 2007. The Natural Gas Annual 2007 Summary Highlights provides an overview of the supply and disposition of natural gas in 2007 and is intended as a supplement to the Natural Gas Annual 2007. Natural Gas Annual --- Full report in PDF (5 MB) Special Files --- All CSV files contained in a self-extracting executable file. Respondent/Company Level Natural Gas Data Files Annual Natural and Supplemental Gas Supply and Disposition Company level data (1996 to 2007) as reported on Form EIA-176 are provided in the EIA-176 Query System and selected data files. EIA-191A Field Level Underground Natural Gas Storage Data: Detailed annual data (2005 to 2007) of storage field capacity, field type, and maximum deliverability as of December 31st of the report year, as reported by operators of all U.S. underground natural gas storage fields.

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Natural Gas Annual, 2002  

Gasoline and Diesel Fuel Update (EIA)

2 2 EIA Home > Natural Gas > Natural Gas Data Publications Natural Gas Annual, 2002 Natural Gas Annual 2002 Release date: January 29, 2004 Next release date: January 2005 The Natural Gas Annual, 2002 provides information on the supply and disposition of natural gas in the United States. Production, transmission, storage, deliveries, and price data are published by State for 2002. Summary data are presented for each State for 1998 to 2002. “The Natural Gas Industry and Markets in 2002” is a special report that provides an overview of the supply and disposition of natural gas in 2002 and is intended as a supplement to the Natural Gas Annual 2002. Changes to data sources for this Natural Gas Annual, as a result of ongoing data quality efforts, have resulted in revisions to several data series. Production volumes have been revised for the Federal offshore and several States. Several data series based on the Form EIA-176, including deliveries to end-users in several States, were also revised. Additionally, revisions have been made to include updates to the electric power and vehicle fuel end-use sectors.


Natural Gas Annual 2009  

Gasoline and Diesel Fuel Update (EIA)

9 9 Released: December 28, 2010 The Natural Gas Annual 2009 provides information on the supply and disposition of natural gas in the United States. Production, transmission, storage, deliveries, and price data are published by State for 2009. Summary data are presented for each State for 2005 to 2009. The Natural Gas Annual 2009 Summary Highlights provides an overview of the supply and disposition of natural gas in 2009 and is intended as a supplement to the Natural Gas Annual 2009. Natural Gas Annual --- Full report in PDF (5 MB) Special Files --- All CSV files contained in a self-extracting executable file. Respondent/Company Level Natural Gas Data Files Annual Natural and Supplemental Gas Supply and Disposition Company level data (1996 to 2009) as reported on Form EIA-176 are provided in the EIA-176 Query System and selected data files. EIA-191A Field Level Underground Natural Gas Storage Data: Detailed annual data (2005 to 2009) of storage field capacity, field type, and maximum deliverability as of December 31st of the report year, as reported by operators of all U.S. underground natural gas storage fields.


Natural Gas Annual 2008  

Gasoline and Diesel Fuel Update (EIA)

8 8 Released: March 2, 2010 The Natural Gas Annual 2008 provides information on the supply and disposition of natural gas in the United States. Production, transmission, storage, deliveries, and price data are published by State for 2008. Summary data are presented for each State for 2004 to 2008. The Natural Gas Annual 2008 Summary Highlights provides an overview of the supply and disposition of natural gas in 2008 and is intended as a supplement to the Natural Gas Annual 2008. Natural Gas Annual --- Full report in PDF (5 MB) Special Files --- All CSV files contained in a self-extracting executable file. Respondent/Company Level Natural Gas Data Files Annual Natural and Supplemental Gas Supply and Disposition Company level data (1996 to 2008) as reported on Form EIA-176 are provided in the EIA-176 Query System and selected data files. EIA-191A Field Level Underground Natural Gas Storage Data: Detailed annual data (2005 to 2008) of storage field capacity, field type, and maximum deliverability as of December 31st of the report year, as reported by operators of all U.S. underground natural gas storage fields.


Natural-gas liquids  

SciTech Connect

Casinghead gasoline or natural gasoline, now more suitably known as natural-gas liquids (NGL), was a nuisance when first found, but was developed into a major and profitable commodity. This part of the petroleum industry began at about the turn of the century, and more than 60 yr later the petroleum industry recovers approx. one million bbl of natural-gas liquids a day from 30 billion cu ft of natural gas processed in more than 600 gasoline plants. Although casinghead gasoline first was used for automobile fuel, natural-gas liquids now are used for fuel, industrial solvents, aviation blending stock, synthetic rubber, and many other petrochemical uses. Production from the individual plants is shipped by tank car, tank truck, pipeline, and tankers all over the world. Most of the natural-gas liquids come from wet natural gas which contains a considerable quantity of vapor, ranging from 0.5 to 6 gal/Mcf, and some particularly rich gases contain even more which can be liquefied. Nonassociated gas is generally clean, with a comparatively small quantity of gasoline, 0.1 to 0.5 gas/Mcf. The natural-gas liquids branch of the industry is build around the condensation of vapors in natural gas. Natural-gas liquids are processed either by the compression method or by adsorption processes.

Blackstock, W.B.; McCullough, G.W.; McCutchan, R.C.



Natural Gas Annual, 2003  

Gasoline and Diesel Fuel Update (EIA)

3 3 EIA Home > Natural Gas > Natural Gas Data Publications Natural Gas Annual, 2003 Natural Gas Annual 2003 Release date: December 22, 2004 Next release date: January 2006 The Natural Gas Annual, 2003 provides information on the supply and disposition of natural gas in the United States. Production, transmission, storage, deliveries, and price data are published by State for 2003. Summary data are presented for each State for 1999 to 2003. “The Natural Gas Industry and Markets in 2003” is a special report that provides an overview of the supply and disposition of natural gas in 2003 and is intended as a supplement to the Natural Gas Annual 2003. The data that appear in the tables of the Natural Gas Annual, 2003 is available as self-extracting executable file or CSV file format. This volume emphasizes information for 2003, although some tables show a five-year history. Please read the file entitled README.V1 for a description and documentation of information included in this file.


Natural Gas Weekly Update  

Gasoline and Diesel Fuel Update (EIA)

2, 2011 at 2:00 P.M. 2, 2011 at 2:00 P.M. Next Release: Thursday, May 19, 2011 Overview Prices Storage Other Market Trends Natural Gas Transportation Update Overview (For the Week Ending Wednesday, May 11, 2011) Natural gas prices fell across the board as oil prices dropped steeply along with most other major commodities. At the Henry Hub, the natural gas spot price fell 36 cents from $4.59 per million Btu (MMBtu) on Wednesday, May 4, to $4.23 per MMBtu on Wednesday, May 11. At the New York Mercantile Exchange, the price of the near-month natural gas contract (June 2011) dropped almost 9 percent, falling from $4.577 per MMBtu last Wednesday to $4.181 yesterday. Working natural gas in storage rose by 70 billion cubic feet (Bcf) to 1,827 Bcf, according to EIAÂ’s Weekly Natural Gas Storage Report.


Natural Gas Weekly Update  

Gasoline and Diesel Fuel Update (EIA)

2, 2010 at 2:00 P.M. 2, 2010 at 2:00 P.M. Next Release: Thursday, July 29, 2010 Overview Prices Storage Other Market Trends Natural Gas Transportation Update Overview (For the Week Ending Wednesday, July 21, 2010) Natural gas prices rose across market locations in the lower 48 States during the report week. The Henry Hub natural gas spot price rose 31 cents, or 7 percent, during the week, averaging $4.70 per million Btu (MMBtu) yesterday, July 21. At the New York Mercantile Exchange (NYMEX), the price of the August 2010 natural gas futures contract for delivery at the Henry Hub rose about 21 cents, or 5 percent, ending the report week at $4.513 per MMBtu. Working natural gas in storage increased to 2,891 billion cubic feet (Bcf) as of Friday, July 16, according to EIAÂ’s Weekly Natural Gas Storage


5. Natural Gas Liquids Statistics  

U.S. Energy Information Administration (EIA)

5. Natural Gas Liquids Statistics Natural Gas Liquids Proved Reserves U.S. natural gas liquids proved reserves decreased 7 percent to 7,459 million ...


,"North Dakota Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Wellhead Price (Dollars per Thousand Cubic Feet)","North Dakota Natural Gas Imports Price (Dollars per Thousand Cubic Feet)","North Dakota Natural Gas Exports...


Natural Disasters: Some Empirical  

Science Conference Proceedings (OSTI)

Page 1. j N8SIR 74-473 Natural Disasters: Some Empirical and Economic Considerations G. Thomas Sav Buildine Economies ...



Natural Gas Weekly Update  

Annual Energy Outlook 2012 (EIA)

each of the consumption sectors, excluding the industrial sector, according to BENTEK Energy Services, LLC. Moderating temperatures likely contributed to lower natural gas...


4. Natural Gas Statistics  

U.S. Energy Information Administration (EIA)

hydraulic fracturing, including shales and low permeability (tight) formations. Total U.S. dry natural gas reserves additions replaced 237 percent of 2007 dry


,"Wisconsin Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Wisconsin Natural Gas Prices",8,"Monthly","72013","1151989" ,"Release Date:","9302013"...


,"Texas Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Texas Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


Natural Gas Weekly Update  

Annual Energy Outlook 2012 (EIA)

increased to 3,683 billion cubic feet (Bcf) as of Friday, October 15, according to the Energy Information Administrations (EIA) Weekly Natural Gas Storage Report. The West...


Natural Gas Weekly Update  

Gasoline and Diesel Fuel Update (EIA)

storage facilities. Other Market Trends: EIA Releases Report on Underground Natural Gas Storage Developments: The Energy Information Administration (EIA) released a special...


Natural Gas Weekly Update  

Gasoline and Diesel Fuel Update (EIA)

that have helped reshape the natural gas market, with particular emphasis on policy directives during the past 26 years. The linked files provided on the web site provide...


Natural Gas Wellhead Prices  

U.S. Energy Information Administration (EIA)

Slide 19 of 27. Price: Wellhead. Natural gas wellhead prices are projected to move up 5 percent this winter, averaging about $2.28 per Mcf during this ...


Natural Gas Weekly Update  

Gasoline and Diesel Fuel Update (EIA)

of about 50 percent of natural gas production from the Gulf. (See "Other Market Trends" below for details.) Ivan's major impact on prices occurred on Monday, September 13,...


Natural Gas Weekly Update  

Gasoline and Diesel Fuel Update (EIA)

Report," and the Historical Weekly Storage Estimates Database. Other Market Trends: FERC Investigates Natural Gas Wash-Trading: The Federal Energy Regulatory Commission (FERC)...

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Natural Gas Annual 2005  

U.S. Energy Information Administration (EIA)

Oil and Gas Field Code Master List ... Hawaii, 2001-2005 ... Energy Information Administration/Natural Gas Annual 2005 vii 54.


Natural Gas Monthly  

U.S. Energy Information Administration (EIA)

sector organizations associated with the natural gas industry. Volume and price data are presented each month for ... Tables 1 and 2 ...


Natural Gas Outlook  

U.S. Energy Information Administration (EIA)

Natural Gas Outlook National Association of State Energy Officials State Heating Oil and Propane Conference August 30, 2004 William Trapmann Energy Information ...


Underground Natural Gas Storage  

U.S. Energy Information Administration (EIA)

Underground Natural Gas Storage. Measured By. Disseminated Through. Monthly Survey of Storage Field Operators -- asking injections, withdrawals, base gas, working gas.


Natural Gas Storage Valuation .  

E-Print Network (OSTI)

??In this thesis, one methodology for natural gas storage valuation is developed and two methodologies are improved. Then all of the three methodologies are applied… (more)

Li, Yun



Natural Gas Weekly Update  

Annual Energy Outlook 2012 (EIA)

since July 27, 2004. Prices: Moderate temperatures and a favorable supply situation led to widespread declines in natural gas spot prices in the Lower 48 States since last...


Natural Gas Weekly Update  

Gasoline and Diesel Fuel Update (EIA)

Release: Thursday, November 4, 2010 Overview Prices Storage Other Market Trends Natural Gas Transportation Update Overview (For the Week Ending Wednesday, October 27, 2010) As the...


Natural Gas Weekly Update  

Annual Energy Outlook 2012 (EIA)

Next Release: Thursday, May 13, 2010 Overview Prices Storage Other Market Trends Natural Gas Transportation Update Overview (For the Week Ending Wednesday, May 5, 2010) Since...


,"Connecticut Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1967" ,"Data 2","Underground Storage",3,"Annual",1996,"6301973" ,"Data 3","Liquefied Natural Gas Storage",3,"Annual",2011,"6301980" ,"Data 4","Consumption",8,"Annual",2012,"...


,"Wisconsin Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1967" ,"Data 2","Underground Storage",3,"Annual",1975,"6301973" ,"Data 3","Liquefied Natural Gas Storage",3,"Annual",2011,"6301980" ,"Data 4","Consumption",8,"Annual",2012,"...


,"Delaware Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1967" ,"Data 2","Underground Storage",3,"Annual",1975,"6301967" ,"Data 3","Liquefied Natural Gas Storage",3,"Annual",2011,"6301980" ,"Data 4","Consumption",9,"Annual",2012,"...


Biomimetics: Lessons from Nature  

Science Conference Proceedings (OSTI)

... structural coloration, thermal insulation, self-healing, and sensory aid mechanisms are some of the examples found in nature which are of commercial interest.


,"Minnesota Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 3","Underground Storage",4,"Annual",2012,"6301973" ,"Data 4","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 5","Consumption",8,"Annual",2012,"6...


,"Idaho Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 3","Underground Storage",2,"Annual",1975,"6301974" ,"Data 4","Liquefied Natural Gas Storage",3,"Annual",2012,"6301981" ,"Data 5","Consumption",9,"Annual",2012,"6...


,"California Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 5","Underground Storage",4,"Annual",2012,"6301967" ,"Data 6","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 7","Consumption",11,"Annual",2012,"6...


,"Alaska Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 5","Underground Storage",2,"Annual",1975,"6301973" ,"Data 6","Liquefied Natural Gas Storage",3,"Annual",2012,"6301969" ,"Data 7","Consumption",11,"Annual",2012,"6...


,"Georgia Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 3","Underground Storage",3,"Annual",1975,"6301974" ,"Data 4","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 5","Consumption",8,"Annual",2012,"6...


,"Louisiana Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 5","Underground Storage",4,"Annual",2012,"6301967" ,"Data 6","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 7","Consumption",11,"Annual",2012,"6...


,"Washington Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 3","Underground Storage",4,"Annual",2012,"6301967" ,"Data 4","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 5","Consumption",9,"Annual",2012,"6...


,"Maryland Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 4","Underground Storage",4,"Annual",2012,"6301967" ,"Data 5","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 6","Consumption",10,"Annual",2012,"6...

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


,"Massachusetts Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 3","Underground Storage",3,"Annual",1975,"6301967" ,"Data 4","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 5","Consumption",8,"Annual",2012,"6...


,"Wyoming Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

ame","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Wyoming Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Iowa Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Iowa Natural Gas Prices",10,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Nebraska Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Nebraska Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Vermont Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

ame","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Vermont Natural Gas Prices",10,"Annual",2012,"6301980" ,"Release Date:","10312013" ,"Next Release...


,"Ohio Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Ohio Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"California Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","California Natural Gas Prices",13,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Wisconsin Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Wisconsin Natural Gas Prices",10,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Maryland Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Maryland Natural Gas Prices",12,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Michigan Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Michigan Natural Gas Prices",13,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Illinois Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Illinois Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Kansas Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Kansas Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Arkansas Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Arkansas Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Texas Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Texas Natural Gas Prices",13,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Arizona Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

ame","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Arizona Natural Gas Prices",12,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Minnesota Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Minnesota Natural Gas Prices",12,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Florida Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

ame","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Florida Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Tennessee Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Tennessee Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Colorado Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Colorado Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Virginia Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Virginia Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


,"Oklahoma Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Oklahoma Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Washington Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Washington Natural Gas Prices",12,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Maine Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Maine Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Louisiana Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Louisiana Natural Gas Prices",13,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Utah Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Utah Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Oregon Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Oregon Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Mississippi Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Mississippi Natural Gas Prices",12,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Massachusetts Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Massachusetts Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Nevada Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Nevada Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Delaware Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Delaware Natural Gas Prices",10,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Pennsylvania Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Pennsylvania Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Kentucky Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Kentucky Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Montana Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

ame","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Montana Natural Gas Prices",13,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Idaho Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Idaho Natural Gas Prices",12,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Missouri Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Missouri Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Georgia Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

ame","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Georgia Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Indiana Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

ame","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Indiana Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Alabama Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

ame","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Alabama Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Connecticut Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Connecticut Natural Gas Prices",10,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...


,"Alaska Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Alaska Natural Gas Prices",11,"Annual",2012,"6301967" ,"Release Date:","10312013" ,"Next Release...

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


,"Hawaii Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Hawaii Natural Gas Prices",8,"Annual",2012,"6301980" ,"Release Date:","10312013" ,"Next Release...


Natural gas annual 1997  

Science Conference Proceedings (OSTI)

The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. The 1997 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production to its end use. This is followed by tables summarizing natural gas supply and disposition from 1993 to 1997 for each Census Division and each State. Annual historical data are shown at the national level. 27 figs., 109 tabs.




,"Alabama Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1967" ,"Data 4","Underground Storage",4,"Annual",2012,"6301968" ,"Data 5","Liquefied Natural Gas Storage",3,"Annual",2011,"6301980" ,"Data 6","Consumption",11,"Annual",2012,...


,"Missouri Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 3","Underground Storage",4,"Annual",2012,"6301967" ,"Data 4","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 5","Consumption",10,"Annual",2012,"6...


,"Nebraska Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 3","Underground Storage",4,"Annual",2012,"6301967" ,"Data 4","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 5","Consumption",11,"Annual",2012,"6...


,"Arkansas Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 4","Underground Storage",4,"Annual",2012,"6301967" ,"Data 5","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 6","Consumption",11,"Annual",2012,"6...


,"Oregon Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 3","Underground Storage",4,"Annual",2012,"6301973" ,"Data 4","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 5","Consumption",10,"Annual",2012,"6...


,"Alabama Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 4","Underground Storage",4,"Annual",2012,"6301968" ,"Data 5","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 6","Consumption",11,"Annual",2012,"6...


,"Illinois Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 3","Underground Storage",4,"Annual",2012,"6301967" ,"Data 4","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 5","Consumption",11,"Annual",2012,"6...


,"Tennessee Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 3","Underground Storage",4,"Annual",2012,"6301968" ,"Data 4","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 5","Consumption",11,"Annual",2012,"6...


,"Nevada Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

301967" ,"Data 2","Production",11,"Annual",2012,"6301991" ,"Data 3","Liquefied Natural Gas Storage",3,"Annual",2012,"6301982" ,"Data 4","Consumption",10,"Annual",2012,"6...


,"Colorado Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 4","Underground Storage",4,"Annual",2012,"6301967" ,"Data 5","Liquefied Natural Gas Storage",2,"Annual",2012,"6301980" ,"Data 6","Consumption",11,"Annual",2012,"6...


,"Virginia Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 4","Underground Storage",4,"Annual",2012,"6301967" ,"Data 5","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 6","Consumption",10,"Annual",2012,"6...


,"Pennsylvania Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 4","Underground Storage",4,"Annual",2012,"6301967" ,"Data 5","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 6","Consumption",11,"Annual",2012,"6...


,"Indiana Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Data 3","Underground Storage",4,"Annual",2012,"6301967" ,"Data 4","Liquefied Natural Gas Storage",3,"Annual",2012,"6301980" ,"Data 5","Consumption",10,"Annual",2012,"6...


,"Pennsylvania Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Pennsylvania Natural Gas Prices",8,"Monthly","72013","1151989" ,"Release Date:","9302013" ,"Next Release...


,"Idaho Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Idaho Natural Gas Prices",8,"Monthly","102013","1151989" ,"Release Date:","172014"...


Natural Gas Weekly Update  

Gasoline and Diesel Fuel Update (EIA)

2009 Next Release: January 23, 2009 Overview Prices Storage Other Market Trends Natural Gas Transportation Update Overview (For the Week Ending Wednesday, January 14, 2009) In the...


,"Iowa Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Iowa Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for" ,"Data...


,"Alabama Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Alabama Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...

Note: This page contains sample records for the topic "detroit mi natural" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


,"Georgia Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Georgia Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


,"Connecticut Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Connecticut Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


,"Colorado Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Colorado Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


,"California Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"California Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


,"Florida Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Florida Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


,"Arkansas Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Arkansas Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


,"Arizona Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Arizona Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


,"Alaska Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Alaska Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


,"Delaware Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Delaware Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


,"Hawaii Natural Gas Prices"  

U.S. Energy Information Administration (EIA) Indexed Site

,"Workbook Contents" ,"Hawaii Natural Gas Prices" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for"...


Natural Gas Weekly Update  

Annual Energy Outlook 2012 (EIA)

ends up in Clarington was delivered upstream. El Paso Natural Gas Pipeline issued an Emergency Critical Operating Condition Declaration for February 2 until further notice....


International Natural Gas Workshop  

U.S. Energy Information Administration (EIA)

International Natural Gas Workshop U.S. Energy Information Administration 1000 Independence Ave. SW, Room 2E-069 Washington, DC 20585 and a member of ...


Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: © 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



EIA - Natural Gas Pipeline Network - Natural Gas Supply Basins ...  

U.S. Energy Information Administration (EIA)

About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 2007/2008 with selected updates


Natural Gas Weekly Update  

Gasoline and Diesel Fuel Update (EIA)

Impact of Interruptible Natural Gas Service A Snapshot of California Natural Gas Market: Status and Outlook EIA's Testimony on Natural Gas Supply and Demand Residential Natural Gas Price Brochure Status of Natural Gas Pipeline System Capacity Previous Issues of Natural Gas Weekly Update Natural Gas Homepage Overview Net additions to storage during the fourth week of April were estimated to have been over 100 Bcf-a record high level for the first month of the refill season. Compared to last year when only 36 Bcf or 1.2 Bcf per day were added to stocks in April, this year the industry appears to be taking advantage of the reduction in demand that typically occurs in April, the first shoulder month of the year, and the recent price declines. After beginning the week down, spot prices at the Henry Hub trended down most days last week to end trading on Friday at $4.49 per MMBtu-the lowest price since early November. On the NYMEX futures market, the near-month (June) contract also moved down most days and ended last week at $4.490-down $0.377 from the previous Friday. Some-early summer high temperatures last week in the Northeast and winter-like weather in the Rockies (See Temperature Map) (See Deviation from Normal Temperatures Map) appear to have had little impact on the natural gas markets as prices declined most days at most major locations.


Natural Cooling Retrofit  

E-Print Network (OSTI)

Substantial numbers of existing plants and buildings are found to depend solely upon Mechanical Cooling even though Natural Cooling techniques could be employed utilizing ambient air. Most of these facilities were constructed without Natural Cooling capability due to 'first cost' budget constraints when the cost and availability of energy were of little concern.

Fenster, L. C.; Grantier, A. J.



,"Arizona Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"N3050AZ3","N3010AZ3","N3020AZ3","N3035AZ3","NA1570SAZ3","N3045AZ3" "Date","Arizona Natural Gas Wellhead Price (Dollars per Thousand Cubic Feet)","Price of Arizona Natural Gas...


,"Vermont Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

80SVT3","N3050VT3","N3010VT3","N3020VT3","N3035VT3","N3045VT3" "Date","Vermont Natural Gas Imports Price (Dollars per Thousand Cubic Feet)","Vermont Natural Gas Pipeline and...


,"Ohio Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050OH3","N3010OH3","N3020OH3","N3035OH3","N3045OH3" "Date","Natural Gas Citygate Price in Ohio (Dollars per Thousand Cubic Feet)","Ohio Price of Natural...