Powered by Deep Web Technologies
Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

Rats Rats Nature Bulletin No. 81 August 31, 1946 Forest Preserve District of Cook County Clayton F. Smith, President Roberts Mann, Superintendent of Conservation RATS Rats and men have been at war since the dawn of history. The "cradle of mankind" Central Asia, apparently was also the place of origin of the rat. From there, living and traveling with man, it has spread over the globe. In the United States today there are about as many rats as there are people. Cur common rat is the Norway or brown rat which arrived here from Europe before the Revolutionary War. Fiercer and more cunning, it soon exterminated the black rat and the roof rat which had migrated here with the early colonists and thrived. The black rat -- which is glossy black above, smaller and more slender -- and the roof rat, a close relative, are found now only rarely in some of the southern states, although still common in tropical America.


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Index of /images/rat/rat.seq  

NLE Websites -- All DOE Office Websites (Extended Search)

rat/rat.seq rat/rat.seq Parent Directory rat.seq.1.tif rat.seq.10.tif rat.seq.100.tif rat.seq.101.tif rat.seq.102.tif rat.seq.103.tif rat.seq.104.tif rat.seq.105.tif rat.seq.106.tif rat.seq.107.tif rat.seq.108.tif rat.seq.109.tif rat.seq.11.tif rat.seq.110.tif rat.seq.111.tif rat.seq.112.tif rat.seq.113.tif rat.seq.114.tif rat.seq.115.tif rat.seq.116.tif rat.seq.117.tif rat.seq.118.tif rat.seq.119.tif rat.seq.12.tif rat.seq.120.tif rat.seq.121.tif rat.seq.122.tif rat.seq.123.tif rat.seq.124.tif rat.seq.125.tif rat.seq.126.tif rat.seq.127.tif rat.seq.128.tif rat.seq.129.tif rat.seq.13.tif rat.seq.130.tif rat.seq.131.tif rat.seq.132.tif rat.seq.133.tif rat.seq.134.tif rat.seq.135.tif rat.seq.136.tif rat.seq.137.tif rat.seq.138.tif rat.seq.139.tif rat.seq.14.tif rat.seq.140.tif rat.seq.141.tif rat.seq.142.tif


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Rat Deterrent  

NLE Websites -- All DOE Office Websites (Extended Search)

Rat Deterrent Rat Deterrent Name: mike Location: N/A Country: N/A Date: N/A Question: my friends have a house with a basement, they have seen rats coming from cider blocks that are open at the top ,and on inspection with a mirror seem to go all the down to the foundation, i suggested maybe putting moth balls down the blocks to help out if they are coming from the botton up, they have a new baby in the house, will this hurt anyone or cause harm? thanks Replies: Moth balls are not going to hurt anyone, but they are not going to solve the problem either. Rats are serious pests that will not be deterred by moth balls and a permanent solution, sealing up access points after removing the rats, will be needed. J. Elliott Stuff the holes with steel wool. It's not poisonous, it's cheap, and rats can't chew through it.


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



The Metabolism of Americium in the Rat  

E-Print Network (OSTI)

A. J. Barber, J. G Hamilton, Metabolism of Plutonium inRats, Plutonium Project Record of the National Nuclearin the Rat (CH 3606) Plutonium Project Record of the

Scott, K.G.



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Gene therapy in alcoholic rats  

NLE Websites -- All DOE Office Websites (Extended Search)

70 70 Sept. 9, 2001 Gene Therapy Reduces Drinking in "Alcoholic" Rats UPTON, NY - Scientists at the U.S. Department of Energy's Brookhaven National Laboratory have shown that increasing the level of a brain protein important for transmitting pleasure signals can turn rats that prefer alcohol into light drinkers, and those with no preference into near teetotalers. The findings, published in the first September 2001 issue of the Journal of Neurochemistry (Vol. 78, No. 5), may have implications for the prevention and treatment of alcoholism in humans. "This is a preliminary study, but when you see a rat that chooses to drink 80 to 90 percent of its daily fluid as alcohol, and then three days later it's down to 20 percent, that's a dramatic drop in alcohol intake - a very clear change in behavior," said Panayotis Thanos, the lead researcher. "This gives us great hope that we can refine this treatment for future clinical use."


Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



National Aeronautics and Space Administration Desert RATS  

E-Print Network (OSTI)

. This helps the D-RATS team determine the system requirements necessary for exploring distant locations while exploration methods, equipment and tools developed in laboratory settings in a real world environment developing the technical skills required of the next generation of explorers. Desert RATS is one of a suite


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Sub-threshold spinal cord stimulation facilitates spontaneous motor activity in spinal rats  

E-Print Network (OSTI)

facilitates spontaneous motor activity in spinal rats.facilitates spontaneous motor activity in spinal rats Paragtreadmill (electrical enabling motor control, eEmc) after a


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


What Connects Rat Tails to Cancer and Heart Disease?  

NLE Websites -- All DOE Office Websites (Extended Search)

What Connects Rat Tails to Cancer and Heart Disease? Collagen is the main (and most abundant) protein in all mammalian connective tissues, including those of the heart, lungs,...


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Modification of radiation damage in rat spinal cord by mitotane  

SciTech Connect

Modification of the paralytic response in rats after 6-MV photon irradiation of the spinal cord with either single or split exposures (two equal fractions given in a 24-hour period) by mitotane was investigated. Mitotane was administered as a suspension in physiologic saline (300 mg/kg/day) for either 5 days prior to or 5 days after irradiation. For rats receiving split doses of 6-MV photons, either the last two doses of mitotane were given 2 hours prior to each radiation fraction or mitotane was begun 2 hours after the second fraction and continued for 5 days. The data to 6 months after irradiation indicate that, in rats given mitotane for 5 days prior to single-dose photon irradiation, the paralytic response (as defined by the dose needed to produce paralysis in 50% of the irradiated groups of rats) was enhanced by a dose-enhancement factor (DEF) of 1.40. The DEF in the group of rats given mitotane after single doses of 6-MV photons was 1.15. In the split-dose irradiation experiments, the DEF for the groups of rats given mitotane prior to each radiation fraction was 1.36; while the DEF for the group of rats receiving mitotane beginning after the second fraction was 1.18. These data indicate that mitotane can potentiate the effects of 6-MV photon irradiation to the central nervous system, with mitotane administered prior to irradiation being the most effective sequence.

Glicksman, A.S.; Bliven, S.F.; Leith, J.T.



Quantitation of products from riboflavin in rat urine  

SciTech Connect

When (2-/sup 14/C) riboflavin is injected i.p. into rats, the excreted vitamin in urine and feces has been shown to be the intact vitamin with trace amounts of lumichrome and lumiflavin. Recent findings with /sup 14/C-riboflavin fed to rats indicated higher levels of riboflavin catabolites in urine, e.g., 7- and 8-carboxylumichromes. The authors have determined catabolites in urine from male rats fed 0, 2, and 6 ..mu..g riboflavin/g diet/day for six weeks. Two rats from each group were placed weekly in metabolic cages, and urine was collected for 24 hours. On the fourth week, a third animal from each group received an i.p. injection of /sup 14/C-riboflavin and the urine was collected for 48 hours. Urine samples were extracted with phenol for flavin components and with chloroform for derivatives of lumichrome and lumiflavin. Riboflavin was the predominant flavin excreted by all diet groups with trace amounts of coenzymes and 7- and 8-hydroxymethylriboflavin. Riboflavin accounted for 85% of all the radioactivity recovered from the deficient and sufficient rats and 90% in rats fed excess. Lumichrome-type compounds including carboxylumichromes accounted for only a few % of recovered radioactivity. Thus, these components are primarily a product of intestinal microfloral degradation rather than significant tissue catabolites of riboflavin.

Chastain, J.L.; McCormick, D.B.



The effect of dietary Cu and diabetes on indices of Cu nutriture in the rat  

SciTech Connect

The uptake-retention of 67Cu is affected by dietary Cu and diabetes. Consequently, the functional activities of select enzymes and tissue Cu status were assessed. STZ-diabetic and control rats were fed Cu suppl. or def. diets. Rats were gavaged with 28 {mu}Ci 67Cu, and killed 8, 16, 24, 32, 64, or 128 h later. Diabetic rats were hyperphagic, hyperglycemic and hypoinsulinemic; with no effect of diet. Plasma ceruloplasmin activity (Cp) was lower in Cu def. rats; diabetic rats tended to have higher Cp than controls. Cu def. rats had low Cu levels in liver, kidney and plasma. Cu suppl. diabetic rats had higher liver and kidney Cu compared to Cu def. diabetic rats. Gel chromatography of liver showed that with time, there was a transfer of 67Cu from low to higher MW ligands. In nondiabetic rats, more 67Cu was associated with the higher MW ligands. The converse was observed for diabetic rats. There was no effect of diabetes on liver 67Cu localization. Diabetic rats had higher metallothionein (MT) concentrations in liver and kidney compared to controls Cu deficiency lowered MT values in both diabetic and control rats. CuZn SOD Cu activity was lowered with Cu def. and diabetes, while Mn SOD activity was similar among groups. Plasma lipid peroxide levels were lower in diabetic rats than controls. The results show that Cu metabolism is affected in diabetes, and the changes are functionally significant.

Rucker, R.B.; Uriu-Hare, J.Y.; Tinker, D.; Keen, C.L. (Univ. of California, Davis (United States))



Antidotal effectiveness of activated charcoal in rats  

SciTech Connect

This study was designed to investigate the relative adsorption of radiolabeled /sup 14/C-sodium pentobarbital by three types of activated charcoal. Factors affection adsorption of the drug by SuperChar, United States Pharmacopeia (USP), and Darco G-60 activated charcoals with surface areas of 2800-3500 m2/g, 1000 m/sup 2//g, and 650 m/sup 2//g, respectively, were studied both in vitro and in vivo. For in vitro experiments, the drug was dissolved in water of 70% sorbitol (w/v), and the maximum binding capacity and dissociation constants for each of the charcoals were calculated. Rank order of maximum binding capacity was directly proportional to charcoal surface area in both water and sorbitol, while the dissociation constants for the charcoals in water were not different. For in vivo experiments, absorption of orally administered sodium pentobarbital (40 mg/kg) was studied in rats with and without activated charcoal administration. The results of this research suggest that: (1) SuperChar given in water possesses the greatest antidotal efficacy, (2) sorbitol induced catharsis does not reduce oral absorption of sodium pentobarbital, and (3) sorbitol enhances the antidotal efficacy of USP charcoal.

Curd-Sneed, C.D.



Atrial natriuretic polypeptide-like material in rat lung  

SciTech Connect

Atrial natriuretic polypeptide-like immunoreactive material (ANP-IR) was found in rat lung by radioimmunoassay, with the concentration ranging from 0.6-1.2 pmol/g of tissue in each lobe. PAP-immunohistochemical study demonstrated that specific staining of granules for ..cap alpha..-human ANP are mainly located in the muscular layer of the pulmonary vein. Fractionation of lung extract by gel filtration and reserve phase HPLC revealed the presence of multiple forms of ANP-IR, which possibly possessed molecular structure partially different from rat ANP, atriopeptin I and III. Intravenous injection of lung extract induced potent diuresis and natriuresis in rats. These responses could be abolished when the lung extract was preincubated with antiserum for ..cap alpha..-human ANP. Specific binding sites for /sup 125/I-labeled rat ANP were also found in lung membrane preparation by radioreceptor assay. Incubation of synthetic atriopeptin III (10/sup -9/ to 10/sup -6/M) with lung tissue induced 1-28 fold increase in lung cGMP content. The results suggest that ANP-IR and its receptors existing in rat lung may be involved in the regulation of pulmonary function and have a synergic effect with ANP of cardiac origin in the control of water-electrolytes balance.

Chang, J.K.; Chang, D.; Xie, C.W.; Song, D.L.; Li, X.R.; Zhang, S.X.; Wang, T.L.; Tang, J.



Regulation of atrial natriuretic peptide receptors in the rat brain  

SciTech Connect

We have studied the localization, kinetics, and regulation of receptors for the circulating form of the atrial natriuretic peptide (ANP; 99-126) in the rat brain. Quantitative autoradiographic techniques and a /sup 125/I-labeled ligand, /sup 125/I-ANP (99-126), were employed. After in vitro autoradiography, quantification was achieved by computerized microdensitometry followed by comparison with /sup 125/I-standards. ANP receptors were discretely localized in the rat brain, with the highest concentrations in circumventricular organs, the choroid plexus, and selected hypothalamic nuclei involved in the production of the antidiuretic hormone vasopressin and in blood-pressure control. Spontaneously (genetic) hypertensive rats showed much lower numbers of ANP receptors than normotensive controls in the subfornical organ, the area postrema, the nucleus of the solitary tract, and the choroid plexus. These changes are in contrast to those observed for receptors of angiotensin II, another circulating peptide with actions opposite to those of ANP. Under conditions of acute dehydration after water deprivation, as well as under conditions of chronic dehydration such as those present in homozygous Brattleboro rats, there was an up-regulation of ANP receptors in the subfornical organ. Our results indicate that in the brain, circumventricular organs contain ANP receptors which could respond to variations in the concentration of circulating ANP. In addition, brain areas inside the blood-brain barrier contain ANP receptors probably related to the endogenous, central ANP system. The localization of ANP receptors and the alterations in their regulation present in genetically hypertensive rats and after dehydration indicate that brain ANP receptors are probably related to fluid regulation, including the secretion of vasopressin, and to cardiovascular function.

Saavedra, J.M.



The influence of dietary Cu and diabetes on tissue sup 67 Cu retention kinetics in rats  

SciTech Connect

Compared to controls, diabetes results in higher plasma, liver and kidney Cu concentrations. Since alterations in Cu metabolism may be associated with diabetic pathology, the authors investigated how Cu metabolism is affected by diabetes and dietary Cu intake. Nondiabetic and STZ diabetic rats were fed Cu suppl. or Cu def. diets for 5 wks. Rats were intubated with 28 {mu}Ci {sup 67}Cu and killed after 8, 16, 24, 32, 64, or 128 h. There were marked effects of both diet and diabetes on {sup 67}Cu metabolism. Independent of diabetes, deficient rats had a higher % of retained {sup 67}Cu, in liver, plasma, RBC, muscle, spleen, brain, lung, uterus, and intestine than adequate Cu rats. Independent of dietary Cu, diabetic rats had a lower % of retained {sup 67}Cu in liver, plasma, RBC, muscle, spleen, lung, bone, pancreas, skin, uterus and heart than controls. Differential effects were noted for kidney; adequate Cu diabetic rats had a higher % of retained {sup 67}Cu than all other groups. Marked effects of both diet and diabetes were evident when tissue Cu turnover was examined. Compared to Cu suppl. rats, Cu def. rats had a slower turnover of {sup 67}Cu, in liver, plasma, intestine, pancreas, eye, brain, muscle, spleen, lung and heart. Diabetic rats had a slower turnover of {sup 67}Cu than nondiabetic rats in liver, plasma, intestine, pancreas, eye, kidney, RBC and uterus. The data imply that a focus on Cu metabolism with regard to cellular Cu trafficking and pathology may be warranted.

Uriu-Hare, J.Y.; Rucker, R.B.; Keen, C.L. (Univ. of California, Davis (United States))



Sequence analysis of the rat Brca1 homolog and its promoter region  

Science Conference Proceedings (OSTI)

dog, and human to help identify the important functional domains ... regions among the rat, mouse, and human genes. .... resulted in Taq polymerase errors.


Effect of Low Dose Radiation on Antioxidant Levels in Rat Brain  

NLE Websites -- All DOE Office Websites (Extended Search)

Low Dose Radiation on Antioxidant Levels in Rat Brain Mohan Doss Fox Chase Cancer Center Abstract Background: Parkinsons disease (PD) is characterized by progressive...


PyRAT - python radiography analysis tool (u)  

SciTech Connect

PyRAT is a radiography analysis tool used to reconstruction images of unknown 1-0 objects. The tool is written in Python and developed for use on LINUX and Windows platforms. The tool is capable of performing nonlinear inversions of the images with minimal manual interaction in the optimization process. The tool utilizes the NOMAD mixed variable optimization tool to perform the optimization.

Temple, Brian A [Los Alamos National Laboratory; Buescher, Kevin L [Los Alamos National Laboratory; Armstrong, Jerawan C [Los Alamos National Laboratory



Extraction of erythropoietin from normal kidneys. [Rats, dogs  

SciTech Connect

Significant amounts of active erythropoietin were extracted from the kidneys of normal rats, cattle, dogs, and rabbits by homogenization of the organs in 0.1 M phosphate buffer. The mean erythropoietin activities of the extracts, as determined by the starved-rat assay, were 0.26 U/g beef kidney, 0.41 U/g dog kidney, and 0.11 U/g rat kidney. The dog kidney extracts had a mean activity of 0.35 U/g, as measured by stimulation of hemoglobin synthesis in cultured bone marrow cells (in vitro assay) and produced a dose-dependent stimulation of /sup 59/Fe incorporation into circulating red cells when assayed in polycythemic mice. Extracts of rabbit kidney cortices had a mean activity of 2.12 U/g, as measured by stimulation of hemoglobin synthesis in cultured bone marrow cells. When the dog kidney homogenate was fractionated on DEAE-cellulose, all of the erythropoietin activity was adsorbed to the exchanger in the presence of 0.01 M acetate buffer, pH 4.5, and was completely eluted by 0.1 M Na/sub 2/HPO/sub 4/-0.5 M NaCl, pH 8. An antibody made aganist human urinary erythropoietin completely inactivated the erythropoietic factor in the dog kidney extract. Serum from a donor dog had no erythropoietin activity when assayed in the starved rat, suggesting that the factor in the extracts is intracellular erythropoietin rather than that contained in plasma trapped in the renal vasculature. The complete inactivation of the erythropoietic factor in these kidney homogenates by antierythropoietin and its behavior on DEAE-cellulose indicate that this factor is structurally similar to native plasma erythropoietin. The extracts are completely active without being incubated in the presence of serum.

Sherwood, J.B.; Goldwasser, E.



Relaxation Time Constants and Apparent Diffusion Coefficients of Rat Retina at 7 Tesla  

E-Print Network (OSTI)

Relaxation Time Constants and Apparent Diffusion Coefficients of Rat Retina at 7 Tesla Govind Nair* and ADC of the rat eyes were measured at 50 3 50 3 800 lm at 7 Tesla. Profiles of T1, T2, T2* and ADC

Duong, Timothy Q.



E-Print Network (OSTI)

Summary.-Urine of normal rats, pregnant animals and animals bearing chemically induced hepatoma was tested with antisera to foetoproteins by the double immunodiffusion technique. Antigens were not detected in the urine of normal rats. Alpha-foetoprotein was demonstrated in the urine of pregnant rats and hepatomabearing animals. THREE specific embryonic proteins have been described in the rat. One antigen, the lipoprotein esterase, is present in the serum of the adult animal in minute amounts. The other two constituents, alpha-foetoprotein and alpha-M-foetoprotein, formerly termed LA antigen and alpha-2-glycoprotein, normally occur in the serum of the foetus, neonate and pregnant rat (Stanislawski-Birencwajg, 1967). Alpha-M-foetoprotein also appears in the serum of rats with acute toxic liver injury and following a variety of experimental procedures (van Gool and Ladiges, 1969; Heim and Lane, 1964). On the other hand, both foetoproteins are detected in the serum of rats with chemically induced hepatoma (Stanislawski-Birencwajg, Uriel and Grabar,. 1967). Since the alpha-foetoprotein (AFP) is present in the amniotic fluid, to which foetal urine contributes substantially (Pitkin, Reynolds and Burchell, 1968; Vernier and Smith, 1968), it is surprising that urinary excretion in the adult has received little attention (Masseyeff, 1972). In the rat, urinary excretion of non-plasma proteins, i.e. tissue antigens emanating from the accessory sex glands, kidneys, liver and testes, has been reported from

E. Okon; E. Rosenmann; T. Dishont; J. H. Boss



Norepinephrine uptake by rat jejunum: Modulation by angiotensin II  

SciTech Connect

Angiotensin II (ANG II) is believed to stimulate sodium and water absorption from the small intestine by enhancing sympathetic nerve transmission. This study is designed to determine whether ANG II can enhance sympathetic neurotransmission within the small intestine by inhibition norepinephrine (NE) uptake. Intracellular NE accumulation by rat jejunum was concentration dependent and resolved into high- and low-affinity components. The high-affinity component (uptake 1) exhibited a Michaelis constant (K{sub m}) of 1.72 {mu}M and a maximum velocity (V{sub max}) of 1.19 nmol {center dot} g{sup {minus}1} {center dot} 10 min{sup {minus}1}. The low-affinity component (uptake 2) exhibited a K{sub m} of 111.1 {mu}M and a V{sub max} of 37.1 nmol {center dot} g{sup {minus}1} {center dot} 10 min{sup {minus}1}. Cocaine, an inhibitor of neuronal uptake, inhibited the intracellular accumulation of label by 80%. Treatment of animals with 6-hydroxydopamine, which depletes norepinephrine from sympathetic terminals, also attenuated NE uptake by 60%. Thus accumulation within sympathetic nerves constitutes the major form of ({sup 3}H)NE uptake into rat jejunum. ANG II inhibited intracellular ({sup 3}H)NE uptake in a concentration-dependent manner. At a dose of 1 mM, ANG II inhibited intracellular ({sup 3}H)NE accumulation by 60%. Cocaine failed to potentiate the inhibition of ({sup 3}H)NE uptake produced by ANG II. Thus ANG II appears to prevent ({sup 3}H)NE accumulation within rat jejunum by inhibiting neuronal uptake.

Suvannapura, A.; Levens, N.R. (CIBA-GEIGY Corp., Summit, NJ (USA))



Effect of co-exposure and cadmium in rats  

Science Conference Proceedings (OSTI)

Metabolism and toxicity of heavy metals may be influenced by certain factors such as protein malnutrition, essential element deficiency or alcoholism. Ethanol has been found to enhance the absorption of lead in body and alcoholics have been reported to be more susceptible to lead intoxication. As alcoholism may be common among industry workers and a significant section of population, who may be exposed to cadmium, it was considered of interest to investigate the influence of ethanol-cadmium co-exposure on cadmium sensitive hepatic, renal and serum enzymes, tissue accumulation of cadmium, essential trace element status and cadmium induced hepatic metallothione in synthesis in rats.

Tandon, S.K.; Tewari, P.C.



A highly sensitive radioreceptor assay for atrial natriuretic peptide in rat plasma  

SciTech Connect

To enable serial measurements of plasma atrial natriuretic peptide (ANP) concentrations in the rat, a microradioreceptor assay (RRA) for this hormone was developed. Glomerular microsomes bearing ANP receptors were used to bind ANP. The smallest quantity of ANP detectable by this method was 0.2 fmol/sample. By contrast, a radioimmunoassay for ANP was sensitive to 2.4 fmol/sample. The intra- and interassay coefficients of variation for the RRA were 4.1 and 11.6%, respectively. Recovery of 10, 20, 50, and 100 pM synthetic ANP added to unextracted rat plasma was essentially 100%. Biologically inactive, synthetic amino- and carboxy-terminal ANP fragments added to rat plasma were not detected. Plasma ANP was stable when measured four consecutive times at 90-min intervals in 10 fasting rats. In a separate group of rats, fasting plasma ANP levels averaged 34 {plus minus} 3 and rose to 57 {plus minus} 5 pM in the postprandial state, whereas levels in fasting time controls remained constant. It is concluded that the RRA for ANP described here detects ANP in microliter quantities of unextracted rat plasma. Thus serial measurements of ANP concentrations can be undertaken in rats without inducing major changes in the volume status.

Ballermann, B.J. (Brigham and Women's Hospital, Boston, MA (USA) Harvard Medical School, Boston, MA (USA))



A mode of action for induction of thyroid gland tumors by Pyrethrins in the rat  

Science Conference Proceedings (OSTI)

Prolonged treatment with high doses of Pyrethrins results in thyroid gland tumors in the rat. To elucidate the mode of action for tumor formation, the effect of Pyrethrins on rat thyroid gland, thyroid hormone levels and hepatic thyroxine UDPglucuronosyltransferase activity was investigated. Male Sprague-Dawley CD rats were fed diets containing 0 (control) and 8000 ppm Pyrethrins and female rats diets containing 0, 100, 3000 and 8000 ppm Pyrethrins for periods of 7, 14 and 42 days and for 42 days followed by 42 days of reversal. As a positive control, rats were also fed diets containing 1200-1558 ppm sodium Phenobarbital (NaPB) for 7 and 14 days. The treatment of male rats with 8000 ppm Pyrethrins, female rats with 3000 and 8000 ppm Pyrethrins and both sexes with NaPB resulted in increased thyroid gland weights, which were associated with follicular cell hypertrophy. Thyroid follicular cell replicative DNA synthesis was increased by treatment with Pyrethrins and NaPB for 7 and/or 14 days. Treatment with Pyrethrins and NaPB increased hepatic microsomal thyroxine UDPglucuronosyltransferase activity and serum thyroid stimulating hormone levels (TSH), but reduced serum levels of either thyroxine (T{sub 4}) and/or triiodothyronine (T{sub 3}). The effects of Pyrethrins in female rats were dose-dependent, with 100 ppm being a no-effect level, and on cessation of treatment were essentially reversible in both sexes. The concordance between the effects of Pyrethrins and NaPB suggests that the mode of action for Pyrethrins-induced rat thyroid gland tumors is similar to that of some other non-genotoxic inducers of hepatic xenobiotic metabolism.

Finch, John M. [Inveresk Research, Tranent EH33 2NE, Scotland (United Kingdom); Osimitz, Thomas G. [Science Strategies LLC, Charlottesville, VA 22902 (United States)]. E-mail: perseus1@worldnet.att.net; Gabriel, Karl L. [ConTox Ltd, Fort Washington, PA 19034-0368 (United States); Martin, Tom [Inveresk Research, Tranent EH33 2NE, Scotland (United Kingdom); Henderson, Wendy J. [Inveresk Research, Tranent EH33 2NE, Scotland (United Kingdom); Capen, Charles C. [The Ohio State University, Columbus, OH 43082 (United States); Butler, William H. [Glebe Cottage, Big Common Lane, Bletchingley, Surrey RH14QE, England (United Kingdom); Lake, Brian G. [BIBRA International Ltd, Woodmansterne Road, Carshalton, Surrey SM5 4DS, England (United Kingdom); Centre for Toxicology, School of Biomedical and Molecular Sciences, University of Surrey, Guildford, Surrey GU2 7XH, England (United Kingdom)



Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Exercise training modulates apoptotic signaling in the aging rat heart  

E-Print Network (OSTI)

Aging is characterized by a progressive decline in cardiac function. A critical contributor to the age-related impairment in heart function is the loss of cardiac myocytes through ??apoptosis??, or programmed cell death. A dramatic increase in the rate of apoptosis has been reported with aging in the rat left ventricle. In contrast, exercise training not only improves cardiac function, but also reduces the risk of heart disease. However, the ability of exercise training to modulate apoptotic signaling and apoptosis in the aging heart remains unknown. Therefore, the purpose of this study was to determine the effects of exercise training on apoptotic signaling and apoptosis in the aging heart. We hypothesized that (1) aging would increase pro-apoptotic signaling and apoptosis in the rat left ventricle, and (2) exercise training would ameliorate upregulation of Bcl-2 family-driven apoptosis in the heart. Four and 25 month old Fischer-344 rats were assigned to four groups: young control (YC), young trained (YT), old control (OC), and old trained (OT). Exercise training groups ran on a treadmill for 60 min/day at 15 m/min (15? incline), 5 d/wk for 12 wk. Protein expression of Bax, Bcl-2, caspase-9, and cleaved caspase-3 was measured using Western immunoblot analysis. Apoptosis (DNA fragmentation) was assessed using a cell death detection ELISA. Bax levels in OC were dramatically higher (+176.0%) compared to YC. In contrast, exercise training resulted in a significant decrease (-53.4%) in Bax in OT compared to OC. Bcl-2 levels in OC were lower (-26.3%) compared to YC. Conversely, exercise training significantly increased Bcl-2 levels by 117.8% in OT compared to OC. Caspase-9 levels were higher (+98.7%) in OC than YC, while exercise training significantly reduced caspase-9 levels in YT (-52.6%) and OT (-76.9%), respectively. Aging resulted in a dramatic increase (+122.8%) in cleaved caspase-3 levels and a significant decrease (-32.9%) with exercise training. Finally, apoptosis (DNA fragmentation) significantly increased (+163.8%) with aging and decreased (-43.9%) with exercise training. These novel data indicate that aging increases pro-apoptotic signaling and apoptosis in the left ventricle, while exercise training is effective in diminishing pro-apoptotic signaling and apoptosis in the aging heart.

Kwak, Hyo Bum



Advances in Conjugated Linoleic Acid Research, Vol 2Chapter 13 CLA and Bone Modeling in Rats  

Science Conference Proceedings (OSTI)

Advances in Conjugated Linoleic Acid Research, Vol 2 Chapter 13 CLA and Bone Modeling in Rats Health Nutrition Biochemistry eChapters Health - Nutrition - Biochemistry AOCS Press Downloadable pdf of Chapter 13 C


Cocaine hypophagia and hyperlocomotion in rats before and after exposure to a high-fat diet  

E-Print Network (OSTI)

Relatively few studies have examined the effects of psychostimulants in obese subjects. Using the dietary obese rat model, the present experiments determined the reductions in food intake (hypophagia) and increases in locomotion (hyperlocomotion) induced by cocaine in diet-induced obese prone (DIO-prone) rats and diet resistant prone (DR-prone) rats as well as diet-induced obese (DIO) rats and diet resistant (DR) rats. In Experiment 1, thirty-six male Sprague-Dawley rats were given intra-peritoneal (i.p.) injections of cocaine (0, 10, 20, and 30 mg/kg) immediately prior to placement into locomotor chambers outfitted with a food source and a water source for a 60-minute test period. In Experiment 2, the same rats were exposed to a high-fat diet, and were subsequently divided into groups according to the extent of the weight gain (high weight gainers ? DIO group, low weight gainers ? DR group, and residual weight gainers ? MIX group). The rats were retested for reactivity to cocaine using conditions similar to those in Experiment 1. Rats injected with cocaine prior to high-fat exposure (Experiment 1) showed a dose dependent suppression of food intake, as well as a dose dependent increase in locomotor activity, with DR-prone rats exhibiting an enhanced degree of cocaine-induced hypophagia, as well as cocaine-induced hyperlocomotion as compared to the other groups. In Experiment 2, DIO rats exhibited a suppression of food intake after injection of 10 mg/kg cocaine, as well as an increase in locomotor activity that was significantly greater than noted in the other groups. When the results of Experiment 1 were analyzed as a function of prospective body weight gain (as opposed to placement into distinct groups), reactivity to cocaine decreased as body weight gain increased. In contrast, after high-fat exposure and weight gain, increased body weight gain was associated with an increased magnitude of suppression in food intake after cocaine administration. Similar patterns of differential cocaine sensitivity were observed for cocaine hyperlocomotion in Experiment 2. These studies indicate that although the propensity to develop obesity is associated with a diminished cocaine response, cocaine reactivity is enhanced after the induction of obesity.

Ho, Dao Hong



Particulate oil shale inhalation and pulmonary inflammatory response in rats  

SciTech Connect

This experiment detrimetal that long-term inhalation of shale dusts by rats elicits a limited inflammatory response in the lung less profound than that observed in animals exposed to equivalent levels of quartz alone. This observation suggests that organic and inorganic constituents of shale may provide a protective effect. The implications for fibrogenic disease are two-fold: (1) inhalation of oil shale dusts appeared to be less detriemtal than the inhalation of quartz along, and (2) there was no apparent synergistic action of quartz and the complex of organic materials present in shale. Animals exposed to shale dusts failed to develop any significant lung lesions, while all of the animals exposed to quartz developed granulomas and some frank fibrosis.

Wilson, J.S.; Holland, L.M.; Halleck, M.S.; Martinez, E.; Saunders, G.



Ultrastructural changes in rat hepatocytes following acute methyl mercury intoxication  

SciTech Connect

Male rats were given daily subcutaneous injections of methylmercuric chloride (CH/sub 3/HgCl) at a dosage of 10 mg/kg body weight for 4 days. The earliest ultrastructural changes consisted of dilatation of the rough endoplasmic reticulum, wavy transformation of the mitochondrial membranes and occasional accumulation of liposomes. Focal areas of cytoplasmic degradation were observed 1 day after the initial administration of mercury. An increased number of lysosomes as well as swelling and floccular degeneration of the mitochondria were frequently observed at 2 days. Sequestration of cytoplasmic organelles within the hepatocytes, extrusion of degenerated hepatic organelles and cytoplasmic debris into the sinusoid could be observed 24 hours after the initial mercury administration and became a frequent finding after 4 days of intoxication. (auth)

Desnoyers, P.A.; Chang, L.W.



Endotoxin suppresses surfactant synthesis in cultured rat lung cells  

Science Conference Proceedings (OSTI)

Pulmonary complications secondary to postburn sepsis are a major cause of death in burned patients. Using an in vitro organotypic culture system, we examined the effect of E. coli endotoxin (LPS) on lung cell surfactant synthesis. Our results showed that E. coli endotoxin (1.0, 2.5, 10 micrograms LPS/ml) was capable of suppressing the incorporation of /sup 3/H-choline into de novo synthesized surfactant, lamellar bodies (LB), and common myelin figures (CMF) at 50%, 68%, and 64%, respectively. In a similar study, we were able to show that LPS also inhibited /sup 3/H-palmitate incorporation by cultured lung cells. LPS-induced suppression of surfactant synthesis was reversed by hydrocortisone. Our results suggest that LPS may play a significant role in reducing surfactant synthesis by rat lung cells, and thus contribute to the pathogenesis of sepsis-related respiratory distress syndrome (RDS) in burn injury.

Li, J.J.; Sanders, R.L.; McAdam, K.P.; Gelfand, J.A.; Burke, J.F.



Biomethylation of inorganic arsenic by the rat and some laboratory animals  

SciTech Connect

This article concerns the distribution (in the liver, kidney and blood) and excretion (in the urine, feces and bile) of arsenic metabolites such as dimethylated, monomethylated and inorganic arsenic in rats following a single oral and intravenous (iv) administration of arsenic acid. This paper also describes studies on the species difference in the arsenic methylation between the rats and some other laboratory animals as mice, hamsters, rabbits and cats.

Odanaka, Y.; Matano, O.; Goto, S.



Automated whole-genome multiple alignment of rat, mouse, and human  

SciTech Connect

We have built a whole genome multiple alignment of the three currently available mammalian genomes using a fully automated pipeline which combines the local/global approach of the Berkeley Genome Pipeline and the LAGAN program. The strategy is based on progressive alignment, and consists of two main steps: (1) alignment of the mouse and rat genomes; and (2) alignment of human to either the mouse-rat alignments from step 1, or the remaining unaligned mouse and rat sequences. The resulting alignments demonstrate high sensitivity, with 87% of all human gene-coding areas aligned in both mouse and rat. The specificity is also high: <7% of the rat contigs are aligned to multiple places in human and 97% of all alignments with human sequence > 100kb agree with a three-way synteny map built independently using predicted exons in the three genomes. At the nucleotide level <1% of the rat nucleotides are mapped to multiple places in the human sequence in the alignment; and 96.5% of human nucleotides within all alignments agree with the synteny map. The alignments are publicly available online, with visualization through the novel Multi-VISTA browser that we also present.

Brudno, Michael; Poliakov, Alexander; Salamov, Asaf; Cooper, Gregory M.; Sidow, Arend; Rubin, Edward M.; Solovyev, Victor; Batzoglou, Serafim; Dubchak, Inna



Autoradiographic localization and characterization of angiotensin II binding sites in the spleen of rats and mice  

SciTech Connect

Specific binding sites for angiotensin II (Ang II) were localized in the red pulp of the spleen of rats and mice by quantitative autoradiography using /sup 125/I-Sar1-Ang II as a ligand. In the rat, the binding was saturable and specific, and the rank order for Ang II derivatives as competitors of /sup 125/I-Sar1-Ang II binding correlates well with their affinity for Ang II receptors in other tissues. Kinetic analysis in the rat spleen revealed a single class of binding sites with a KD of 1.11 nM and a Bmax value of 81.6 fmol/mg protein. Ang II binding sites were also localized on isolated rat spleen cells with similar affinity but with much lower Bmax, 9.75 fmol/mg protein. Ang II receptors were not detected in thymus sections from rats or mice, or on isolated rat thymocytes. The binding sites described here might represent a functional Ang II receptor with a role in the regulation of splenic volume and blood flow and in the modulation of the lymphocyte function.

Castren, E.; Kurihara, M.; Saavedra, J.M.



Age-related changes in receptor-mediated phosphoinositide hydrolysis in various regions of rat brain  

SciTech Connect

The effects of age on cholinergic markers and receptor-stimulated phosphoinositide hydrolysis was examined in the frontal cortex and striatum of male Fischer-344 rats. Choline acetyltransferase activity was decreased 27% in the striatum of aged rats compared to young controls. Muscarinic receptor density as measured by ({sup 3}H)-quinuclidinyl benzilate binding showed a similar 26% decrease in the striatum of aged rats. Phosphoinositide hydrolysis was measured by the release of inositol phosphate (IP) from tissue slices prelabeled with ({sup 3}H)myoinositol in response to carbachol, norepinephrine, and quisqualate. In the cortex, stimulated IP release was significantly greater in slices from aged rats compared to young rats for all three agonists. In contrast, stimulated IP release was significantly decreased in striatal slices from aged rats compared to young for all three agonists. These data indicate a differential effect of age on agonist-stimulated phosphoinositide hydrolysis in the cortex and striatum. The decreased responsiveness in the latter area may result from the age-related loss of postsynaptic receptors.

Mundy, W.; Tandon, P.; Tilson, H. (Research Triangle Park, NC (United States)); Ali, S. (National Center for Toxicological Research, Jefferson, AR (United States))



Establishing a rodent (Fischer 344 rat) model of mild cognitive impairment in aging  

E-Print Network (OSTI)

Mild Cognitive Impairment is characterized by age-related decline in a variety of cognitive domains, including reference and working memory and olfactory function. Importantly, declining age-related mnemonic abilities is not inevitable; learning and memory deficits emerge in some people by middle-age while others remain largely cognitively-intact even at advanced chronological ages. The goal of this thesis is to establish a Fischer 344 (F344) rat model with some features of human cognitive aging which can then be utilized to undercover the neurobiological underpinnings of age-related cognitive deficits. Young (6 mo), middle-aged (11 mo), and aged (22 mo) F344 rats were behaviorally characterized in a well-established reference memory version of the Morris water maze task. Indeed, age-related impairments did occur across the lifespan. Moreover, the reference memory protocol used here was sufficiently sensitive to detect a difference in individual abilities among aged F344 rats such that approximately half of the rats performed on par with young while the other half performed outside this range, demonstrating impairment. These data mimic individual differences in declarative memory among aged humans. Subsequently, subsets of rats initially characterized on the reference memory version of the water maze were tested on either a spatial working memory water maze task or an olfactory discrimination task. Despite detecting an age-related delay-dependent decline in spatial working memory, this impairment was not correlated with spatial reference memory. In contrast, a strong and significant relationship was observed among aged rats in the odor discrimination task such that aged rats with the worst spatial reference memory were also the most impaired in their ability to discriminate odors for a food reward. Importantly, this subset of cognitively-impaired rats was not impaired on digging media discrimination problems with identical task demands, nor were they anosmic. These data are among the first to demonstrate a cross-domain cognitive deficit in a rodent model of human aging. Together, the current study both confirms the use of the naturalistic F344 rat model for the study of cognitive deficits within the context of aging and provides the most comprehensive cognitive profile of this rat population to date.

LaSarge, Candi Lynn



In vitro dermal absorption of pyrethroid pesticides in human and rat skin  

SciTech Connect

Dermal exposure to pyrethroid pesticides can occur during manufacture and application. This study examined the in vitro dermal absorption of pyrethroids using rat and human skin. Dermatomed skin from adult male Long Evans rats or human cadavers was mounted in flow-through diffusion cells, and radiolabeled bifenthrin, deltamethrin or cis-permethrin was applied in acetone to the skin. Fractions of receptor fluid were collected every 4 h. At 24 h, the skins were washed with soap and water to remove unabsorbed chemical. The skin was then solubilized. Two additional experiments were performed after washing the skin; the first was tape-stripping the skin and the second was the collection of receptor fluid for an additional 24 h. Receptor fluid, skin washes, tape strips and skin were analyzed for radioactivity. For rat skin, the wash removed 53-71% of the dose and 26-43% remained in the skin. The cumulative percentage of the dose at 24 h in the receptor fluid ranged from 1 to 5%. For human skin, the wash removed 71-83% of the dose and 14-25% remained in the skin. The cumulative percentage of the dose at 24 h in the receptor fluid was 1-2%. Tape-stripping removed 50-56% and 79-95% of the dose in rat and human skin, respectively, after the wash. From 24-48 h, 1-3% and about 1% of the dose diffused into the receptor fluid of rat and human skin, respectively. The pyrethroids bifenthrin, deltamethrin and cis-permethrin penetrated rat and human skin following dermal application in vitro. However, a skin wash removed 50% or more of the dose from rat and human skin. Rat skin was more permeable to the pyrethroids than human skin. Of the dose in skin, 50% or more was removed by tape-stripping, suggesting that permeation of pyrethroids into viable tissue could be impeded. The percentage of the dose absorbed into the receptor fluid was considerably less than the dose in rat and human skin. Therefore, consideration of the skin type used and fractions analyzed are important when using in vitro dermal absorption data for risk assessment.

Hughes, Michael F., E-mail: hughes.michaelf@epa.go [Integrated Systems Toxicology Division, National Health and Environmental Effects Research Laboratory, Office of Research and Development, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Edwards, Brenda C. [Integrated Systems Toxicology Division, National Health and Environmental Effects Research Laboratory, Office of Research and Development, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)



Extracellular calcium sensing in rat aortic vascular smooth muscle cells  

Science Conference Proceedings (OSTI)

Extracellular calcium (Ca2+o) can act as a first messenger in many cell types through a G protein-coupled receptor, calcium-sensing receptor (CaR). It is still debated whether the CaR is expressed in vascular smooth muscle cells (VSMCs). Here, we report the expression of CaR mRNA and protein in rat aortic VSMCs and show that Ca2+o stimulates proliferation of the cells. The effects of Ca2+o were attenuated by pre-treatment with MAPK kinase 1 (MEK1) inhibitor, as well as an allosteric modulator, NPS 2390. Furthermore, stimulation of the VSMCs with Ca2+o-induced phosphorylation of ERK1/2, but surprisingly did not cause inositol phosphate accumulation. We were not able to conclusively state that the CaR mediates Ca2+o-induced cell proliferation. Rather, an additional calcium-sensing mechanism may exist. Our findings may be of importance with regard to atherosclerosis, an inflammatory disease characterized by abnormal proliferation of VSMCs and high local levels of calcium.

Smajilovic, Sanela [Laboratory of Molecular Cardiology, Department of Cardiology, Copenhagen University Hospital, Rigshospitalet (Denmark); Danish National Research Foundation Centre for Cardiac Arrhythmia (DARC), Copenhagen (Denmark); Hansen, Jakob Lerche [Laboratory of Molecular and Cellular Cardiology, Department of Cardiology, Copenhagen University Hospital, Rigshospitalet (Denmark); Danish National Research Foundation Centre for Cardiac Arrhythmia (DARC), Copenhagen (Denmark); Christoffersen, Tue E.H. [Laboratory of Molecular Cardiology, Department of Cardiology, Copenhagen University Hospital, Rigshospitalet (Denmark); Danish National Research Foundation Centre for Cardiac Arrhythmia (DARC), Copenhagen (Denmark)] (and others)



Automated whole-genome multiple alignment of rat, mouse, and human  

Science Conference Proceedings (OSTI)

We have built a whole genome multiple alignment of the three currently available mammalian genomes using a fully automated pipeline which combines the local/global approach of the Berkeley Genome Pipeline and the LAGAN program. The strategy is based on progressive alignment, and consists of two main steps: (1) alignment of the mouse and rat genomes; and (2) alignment of human to either the mouse-rat alignments from step 1, or the remaining unaligned mouse and rat sequences. The resulting alignments demonstrate high sensitivity, with 87% of all human gene-coding areas aligned in both mouse and rat. The specificity is also high: 100kb agree with a three-way synteny map built independently using predicted exons in the three genomes. At the nucleotide level <1% of the rat nucleotides are mapped to multiple places in the human sequence in the alignment; and 96.5% of human nucleotides within all alignments agree with the synteny map. The alignments are publicly available online, with visualization through the novel Multi-VISTA browser that we also present.

Brudno, Michael; Poliakov, Alexander; Salamov, Asaf; Cooper, Gregory M.; Sidow, Arend; Rubin, Edward M.; Solovyev, Victor; Batzoglou, Serafim; Dubchak, Inna


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Endogenous N-nitroso compounds, and their precursors, present in bacon, do not initiate or promote aberrant crypt foci in the colon of rats  

E-Print Network (OSTI)

groups of 10 rats, whose diets contained 7, 14 or 28 fat. Tested meats were bacon, pork, chicken and beef by the number of aberrant crypt foci (ACF) in the colon of rats, 45 days after the start of a high-fat bacon similar. Rats fed a diet based on beef, pork or chicken meat had less fecal NOC than controls (most p

Paris-Sud XI, Université de


Genome sequence of the brown Norway rat yields insights into mammalian evolution  

SciTech Connect

The laboratory rat (Rattus norvegicus) is an indispensable tool in experimental medicine and drug development, having made inestimable contributions to human health. We report here the genome sequence of the Brown Norway (BN) rat strain. The sequence represents a high-quality 'draft' covering over 90 percent of the genome. The BN rat sequence is the third complete mammalian genome to be deciphered, and three-way comparisons with the human and mouse genomes resolve details of mammalian evolution. This first comprehensive analysis includes genes and proteins and their relation to human disease, repeated sequences, comparative genome-wide studies of mammalian orthologous chromosomal regions and rearrangement breakpoints, reconstruction of ancestral karyotypes and the events leading to existing species, rates of variation, and lineage-specific and lineage-independent evolutionary events such as expansion of gene families, orthology relations and protein evolution.

Gibbs, Richard A.; Weinstock, George M.; Metzker, Michael L.; Muzny, Donna M.; Sodergren, Erica J.; Scherer, Steven; Scott, Graham; Steffen, David; Worley, Kim C.; Burch, Paula E.; Okwuonu, Geoffrey; Hines, Sandra; Lewis, Lora; DeRamo, Christine; Delgado, Oliver; Dugan-Rocha, Shannon; Miner, George; Morgan, Margaret; Hawes, Alicia; Gill, Rachel; Holt, Robert A.; Adams, Mark D.; Amanatides, Peter G.; Baden-Tillson, Holly; Barnstead, Mary; Chin, Soo; Evans, Cheryl A.; Ferriera, Steven; Fosler, Carl; Glodek, Anna; Gu, Zhiping; Jennings, Don; Kraft, Cheryl L.; Nguyen, Trixie; Pfannkoch, Cynthia M.; Sitter, Cynthia; Sutton, Granger G.; Venter, J. Craig; Woodage, Trevor; Smith, Douglas; Lee, Hong-Maei; Gustafson, Erik; Cahill, Patrick; Kana, Arnold; Doucette-Stamm, Lynn; Weinstock, Keith; Fechtel, Kim; Weiss, Robert B.; Dunn, Diane M.; Green, Eric D.; Blakesley, Robert W.; Bouffard, Gerard G.; de Jong, Pieter J.; Osoegawa, Kazutoyo; Zhu, Baoli; Marra, Marco; Schein, Jacqueline; Bosdet, Ian; Fjell, Chris; Jones, Steven; Krzywinski, Martin; Mathewson, Carrie; Siddiqui, Asim; Wye, Natasja; McPherson, John; Zhao, Shaying; Fraser, Claire M.; Shetty, Jyoti; Shatsman, Sofiya; Geer, Keita; Chen, Yixin; Abramzon, Sofyia; Nierman, William C.; Havlak, Paul H.; Chen, Rui; Durbin, K. James; Egan, Amy; Ren, Yanru; Song, Xing-Zhi; Li, Bingshan; Liu, Yue; Qin, Xiang; Cawley, Simon; Cooney, A.J.; D'Souza, Lisa M.; Martin, Kirt; Wu, Jia Qian; Gonzalez-Garay, Manuel L.; Jackson, Andrew R.; Kalafus, Kenneth J.; McLeod, Michael P.; Milosavljevic, Aleksandar; Virk, Davinder; Volkov, Andrei; Wheeler, David A.; Zhang, Zhengdong; Bailey, Jeffrey A.; Eichler, Evan E.; Tuzun, Eray; Birney, Ewan; Mongin, Emmanuel; Ureta-Vidal, Abel; Woodwark, Cara; Zdobnov, Evgeny; Bork, Peer; Suyama, Mikita; Torrents, David; Alexandersson, Marina; Trask, Barbara J.; Young, Janet M.; et al.



Environmental Lighting Has a Selective Influence on Ethanol Intake in Rats  

E-Print Network (OSTI)

rats. PHYSIOL BEHAV 66(2) 323328, 1999.The effect of lighting condition on levels of absolute ethanol intake were systematically examined in the present study. Wistar rats were exposed to one of three lighting conditions: constant light, constant dark, and a standard 12?12 light/dark cycle. The animals were acclimatized to lighting conditions for 2 weeks prior to ethanol (EtOH) acquisition with water and food available ad lib. EtOH was then presented in increasing concentrations from 2 % (v/v; 95 % with tap water) to 10 % on alternate days in free choice with water. Immediately following the acquisition phase, a maintenance period was initiated that began with everyday presentations of 10 % EtOH solution in free choice with water. After 10 days, lighting conditions for the constant light and dark groups were switched to normal lighting (12/12 light/ dark). EtOH and water intake were recorded for an additional 10 days. Rats exposed to constant light during EtOH acquisition and maintenance consumed less EtOH during the maintenance period than rats exposed to normal lighting conditions. When lighting conditions were switched to a normal cycle, water consumption increased significantly but EtOH intake did not change. Rats living in constant dark during EtOH acquisition and maintenance consumed less EtOH during the acquisition period when compared with rats living in normal lighting conditions. Unlike animals trained under constant lighting, switching to normal lighting conditions had no effect on EtOH or water intake. There were no differences in water consumption levels among the groups during acquisition and maintenance, suggesting a specificity of the effects of lighting condition on EtOH intake. The present study, therefore, has attempted to show that an environmental variable such as lighting may exert

F. L. W. Goodwin; S. Amir; Z. Amit




SciTech Connect

Association of a distinctive taste stimulus with exposure to x rays results in a conditioned aversion toward the stimulus in rats, mice, and cats. This is manifested by a progressive reduction in the amount of flavored fluid consumed during a series of x-ray exposures and subsequently by the acquired value of the flavored fluid to act as a con- ditioned stiraulus for aversive behavior in the absence of radiation. Saccharin-flavored water was effective as a conditioned stimulus for rats and mice, and chocolateflavored milk was effective for cats. Some implications of these observations for the study of behavior are discussed. (auth)

Kimeldorf, D.J.; Garcia, J.; Rubadeau, D.O.



Dietary quercetin exacerbates the development of estrogen-induced breast tumors in female ACI rats  

Science Conference Proceedings (OSTI)

Phytoestrogens are plant compounds that structurally mimic the endogenous estrogen 17{beta}-estradiol (E{sub 2}). Despite intense investigation, the net effect of phytoestrogen exposure on the breast remains unclear. The objective of the current study was to examine the effects of quercetin on E{sub 2}-induced breast cancer in vivo. Female ACI rats were given quercetin (2.5 g/kg food) for 8 months. Animals were monitored weekly for palpable tumors, and at the end of the experiment, rats were euthanized, breast tumor and different tissues excised so that they could be examined for histopathologic changes, estrogen metabolic activity and oxidant stress. Quercetin alone did not induce mammary tumors in female ACI rats. However, in rats implanted with E{sub 2} pellets, co-exposure to quercetin did not protect rats from E{sub 2}-induced breast tumor development with 100% of the animals developing breast tumors within 8 months of treatment. No changes in serum quercetin levels were observed in quercetin and quercetin + E{sub 2}-treated groups at the end of the experiment. Tumor latency was significantly decreased among rats from the quercetin + E{sub 2} group relative to those in the E{sub 2} group. Catechol-O-methyltransferase (COMT) activity was significantly downregulated in quercetin-exposed mammary tissue. Analysis of 8-isoprostane F{sub 2{alpha}} (8-iso-PGF{sub 2{alpha}}) levels as a marker of oxidant stress showed that quercetin did not decrease E{sub 2}-induced oxidant stress. These results indicate that quercetin (2.5 g/kg food) does not confer protection against breast cancer, does not inhibit E{sub 2}-induced oxidant stress and may exacerbate breast carcinogenesis in E{sub 2}-treated ACI rats. Inhibition of COMT activity by quercetin may expose breast cells chronically to E{sub 2} and catechol estrogens. This would permit longer exposure times to the carcinogenic metabolites of E{sub 2} and chronic exposure to oxidant stress as a result of metabolic redox cycling to estrogen metabolites, and thus quercetin may exacerbate E{sub 2}-induced breast tumors in female ACI rats.

Singh, Bhupendra [Division of Pharmacology and Toxicology, School of Pharmacy, University of Missouri-Kansas City, Kansas City, MO 64108 (United States); Mense, Sarah M. [Department of Environmental Health Sciences, Columbia University, New York, NY 10032 (United States); Bhat, Nimee K. [Division of Pharmacology and Toxicology, School of Pharmacy, University of Missouri-Kansas City, Kansas City, MO 64108 (United States); Putty, Sandeep; Guthiel, William A. [Division of Pharmaceutical Sciences, School of Pharmacy, University of Missouri-Kansas City, Kansas City, MO 64108 (United States); Remotti, Fabrizio [Department of Pathology, Columbia University, New York, NY 10032 (United States); Bhat, Hari K., E-mail: bhath@umkc.ed [Division of Pharmacology and Toxicology, School of Pharmacy, University of Missouri-Kansas City, Kansas City, MO 64108 (United States)



Mutations of the Apc gene in experimental colorectal carcinogenesis induced by azoxymethane in F344 rats  

E-Print Network (OSTI)

Summary We investigated in the rat the role of the Apc gene, which is mutated in familial adenomatous polyposis and sporadic colon cancer in the process leading from normal colonic mucosa to aberrant crypt foci (ACF) and finally to adenomas and adenocarcinomas. We analysed mutations in exon 15 of the rat Apc gene using in vitro synthesized protein assay in 66 ACF and in 28 colon tumours induced by azoxymethane. No Apc mutations were found in ACF, whereas five mutations were found in the tumours. The data suggest that mutations of the Apc gene are associated with the transition from ACF to adenoma and adenocarcinoma and not from normal mucosa to ACF.

G Caderni; M Bazzicalupo; C Briani; A Giannini; M Fazi; P Dolaral



Metabolism and disposition of 1-bromopropane in rats and mice following inhalation or intravenous administration  

SciTech Connect

Workplace exposure to 1-bromopropane (1-BrP) can potentially occur during its use in spray adhesives, fats, waxes, and resins. 1-BrP may be used to replace ozone depleting solvents, resulting in an increase in its annual production in the US, which currently exceeds 1 million pounds. The potential for human exposure to 1-BrP and the reports of adverse effects associated with potential occupational exposure to high levels of 1-BrP have increased the need for the development of biomarkers of exposure and an improved understanding of 1-BrP metabolism and disposition. In this study, the factors influencing the disposition and biotransformation of 1-BrP were examined in male F344 rats and B6C3F1 mice following inhalation exposure (800 ppm) or intravenous administration (5, 20, and 100 mg/kg). [1,2,3-{sup 13}C]1-BrP and [1-{sup 14}C]1-BrP were administered to enable characterization of urinary metabolites using NMR spectroscopy, LC-MS/MS, and HPLC coupled radiochromatography. Exhaled breath volatile organic chemicals (VOC), exhaled CO{sub 2}, urine, feces, and tissues were collected for up to 48 h post-administration for determination of radioactivity distribution. Rats and mice exhaled a majority of the administered dose as either VOC (40-72%) or {sup 14}CO{sub 2} (10-30%). For rats, but not mice, the percentage of the dose exhaled as VOC increased between the mid ({approx} 50%) and high ({approx} 71%) dose groups; while the percentage of the dose exhaled as {sup 14}CO{sub 2} decreased (19 to 10%). The molar ratio of exhaled {sup 14}CO{sub 2} to total released bromide, which decreased as dose increased, demonstrated that the proportion of 1-BrP metabolized via oxidation relative to pathways dependent on glutathione conjugation is inversely proportional to dose in the rat. [{sup 14}C]1-BrP equivalents were recovered in urine (13-17%, rats; 14-23% mice), feces (< 2%), or retained in the tissues and carcass (< 6%) of rats and mice administered i.v. 5 to 100 mg/kg [{sup 14}C]1-BrP. Metabolites characterized in urine of rats and mice include N-acetyl-S-propylcysteine, N-acetyl-3-(propylsulfinyl)alanine, N-acetyl-S-(2-hydroxypropyl)cysteine, 1-bromo-2-hydroxypropane-O-glucuronide, N-acetyl-S-(2-oxopropyl)cysteine, and N-acetyl-3-[(2-oxopropyl)sulfinyl]alanine. These metabolites may be formed following oxidation of 1-bromopropane to 1-bromo-2-propanol and bromoacetone and following subsequent glutathione conjugation with either of these compounds. Rats pretreated with 1-aminobenzotriazole (ABT), a potent inhibitor of P450 excreted less in urine ({down_arrow}30%), exhaled as {sup 14}CO2 ({down_arrow}80%), or retained in liver ({down_arrow}90%), with a concomitant increase in radioactivity expired as VOC ({up_arrow}52%). Following ABT pretreatment, rat urinary metabolites were reduced in number from 10 to 1, N-acetyl-S-propylcysteine, which accounted for > 90% of the total urinary radioactivity in ABT pretreated rats. Together, these data demonstrate a role for cytochrome P450 and glutathione in the dose-dependent metabolism and disposition of 1-BrP in the rat.

Garner, C.E. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States)]. E-mail: cegarner@rti.org; Sumner, S.C.J. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Davis, J.G. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Burgess, J.P. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Yueh, Y. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Demeter, J. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Zhan, Q. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Valentine, J. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Jeffcoat, A.R. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Burka, L.T. [National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States); Mathews, J.M. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States)




SciTech Connect

The reaction of the thyroid gland of white male rats to x irradiation (800 r) depends upon the age and individual reactivity of the animal. In young rats the irradiation provokes marked changes in the thyroid gland, which in some instances are expressed by an insignificant rise of the activity (in the first hours and days after irradiation) followed by its decrease (from the 5th to 30th day). In other cases a drop of the activity is seen already in the first hours. In all rats of this group the thyroid gland reverts tu normal towards the second month. In adult rats (5- 7-month-old) the above dose of irradiation provokes less pronounced changes in the structure of the gland, as compared to young rats. Towards the l8th day after irradiation the structure of the thyroid gland normalizes. Irradiation (800 r) of old rats does not cause noticeable changes in the histological picture of the thyroid gland. In young rats with a severe course of radiation sickness, sacrificed in the agonal state on the 9th-l3th day following irradiation, there is a sharp drop of the thyroid gland activity. (auth)

Loskutova, E.A.



Pulmonary toxicity, distribution, and clearance of intratracheally instilled silicon nanowires in rats  

Science Conference Proceedings (OSTI)

Silicon nanowires (SiNWs) are being manufactured for use as sensors and transistors for circuit applications. The goal was to assess pulmonary toxicity and fate of Si NWusing an in vivo experimental model. Male Sprague-Dawley rats were intratracheally ...

Jenny R. Roberts; Robert R. Mercer; Rebecca S. Chapman; Guy M. Cohen; Sarunya Bangsaruntip; Diane Schwegler-Berry; James F. Scabilloni; Vincent Castranova; James M. Antonini; Stephen S. Leonard



Increased angiotensin II receptors in brain nuclei of DOCA-salt hypertensive rats  

SciTech Connect

We analyzed angiotensin II (ANG II) receptors by in vitro autoradiography in selective brain nuclei of control, salt-treated (1% NaCl in drinking water), deoxycorticosterone acetate (DOCA)-treated (DOCA pivalate, 25 mg/kg sc weekly), and DOCA-salt-treated (DOCA + salt treatments) uninephrectomized male Wistar-Kyoto rats. After 4 wk of treatment, only the DOCA-salt group developed hypertension. ANG II binding increased in median preoptic nucleus and subfornical organ of salt- and DOCA-treated rats. DOCA-treated rats also showed increased ANG II binding in paraventricular nucleus. DOCA-salt-treated rats showed higher ANG II binding in nucleus of the solitary tract and area postrema, as well as in the areas mentioned before. Although salt and/or DOCA treatments alone increased ANG II receptors in some brain nuclei, after combined DOCA-salt treatment there was significantly higher ANG II binding in all areas, except the median preoptic nucleus. These results suggest that increased ANG II receptors in selected brain areas may play a role in the pathophysiology of mineralocorticoid-salt experimental hypertension.

Gutkind, J.S.; Kurihara, M.; Saavedra, J.M.



Evaluation of deltamethrin kinetics and dosimetry in the maturing rat using a PBPK model  

Science Conference Proceedings (OSTI)

Immature rats are more susceptible than adults to the acute neurotoxicity of pyrethroid insecticides like deltamethrin (DLM). A companion kinetics study (Kim et al., in press) revealed that blood and brain levels of the neuroactive parent compound were inversely related to age in rats 10, 21, 40 and 90 days old. The objective of the current study was to modify a physiologically based pharmacokinetic (PBPK) model of DLM disposition in the adult male Sprague-Dawley rat (Mirfazaelian et al., 2006), so blood and target organ dosimetry could be accurately predicted during maturation. Age-specific organ weights and age-dependent changes in the oxidative and hydrolytic clearance of DLM were modeled with a generalized Michaelis-Menten model for growth and the summary equations incorporated into the PBPK model. The model's simulations compared favorably with empirical DLM time-courses in plasma, blood, brain and fat for the four age-groups evaluated (10, 21, 40 and 90 days old). PND 10 pups' area under the 24-h brain concentration time curve (AUC{sub 0-24h}) was 3.8-fold higher than that of the PND 90 adults. Our maturing rat PBPK model allows for updating with age- and chemical-dependent parameters, so pyrethroid dosimetry can be forecast in young and aged individuals. Hence, this model provides a methodology for risk assessors to consider age-specific adjustments to oral Reference Doses on the basis of PK differences.

Tornero-Velez, Rogelio, E-mail: tornero-velez.rogelio@epa.go [National Exposure Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC 27711 (United States); Mirfazaelian, Ahmad, E-mail: amirfazaelian@gmail.co [Department of Chemical Injuries, Baghiatallah University of Medical Sciences, Tehran (Iran, Islamic Republic of); Kim, Kyu-Bong, E-mail: kimkb@rx.uga.ed [Department of Pharmaceutical Engineering, College of Engineering, Inje University, Obang-dong, Gimhae, Gyungnam 621-749 (Korea, Republic of); Anand, Sathanandam S., E-mail: satheesh.s.anand@usa.dupont.co [Dupont Haskell Global Centers for Health and Environmental Sciences, 1090 Elkton Road, Newark, DE 19714 (United States); Kim, Hyo J., E-mail: hyokimm@yahoo.co.k [Department of Pharmaceutical and Biomedical Sciences, College of Pharmacy, University of Georgia, Athens, GA 30602-2352 (United States); Haines, Wendy T., E-mail: toxicology@unc.ed [Curriculum in Toxicology, University of North Carolina, Chapel Hill, CB 7270, NC 27599-7270 (United States); Bruckner, James V., E-mail: bruckner@rx.uga.ed [Department of Pharmaceutical and Biomedical Sciences, College of Pharmacy, University of Georgia, Athens, GA 30602-2352 (United States); Fisher, Jeffrey W., E-mail: jwfisher@uga.ed [Department of Environmental Health, College of Public Health, University of Georgia, Athens, GA 30602 (United States)



A Glucose BioFuel Cell Implanted in Rats Philippe Cinquin1  

E-Print Network (OSTI)

A Glucose BioFuel Cell Implanted in Rats Philippe Cinquin1 *, Chantal Gondran2 , Fabien Giroud2 powerful ones, Glucose BioFuel Cells (GBFCs), are based on enzymes electrically wired by redox mediators applications. Citation: Cinquin P, Gondran C, Giroud F, Mazabrard S, Pellissier A, et al. (2010) A Glucose BioFuel

Paris-Sud XI, Université de


Hyperamplification of centrosomes and asynchronous nuclear division induced by N-nitrosodimethylamine in rats  

Science Conference Proceedings (OSTI)

Mechanisms of hepatocyte multinucleation was investigated in rats exposed to N-nitrosodimethylamine (NDMA). By using immunohistochemical reaction to ?-tubulin it was established that the number of cells containing three and more centrosomes increased ... Keywords: asynchronous DNA synthesis, centrosomes, cytochrome P4502E1, multinucleated hepatocytes, multipolar mitosis, oxidative stress

Bauyrzhan Umbayev; Tamara Shalakhmetova; William Au



The effect of methylsulfonylmethane on the experimental colitis in the rat  

Science Conference Proceedings (OSTI)

Methylsulfonylmethane (MSM), naturally occurring in green plants, fruits and vegetables, has been shown to exert anti-inflammatory and antioxidant effects. MSM is an organosulfur compound and a normal oxidative metabolite of dimethyl sulfoxide. This study was carried out to investigate the effect of MSM in a rat model of experimental colitis. Colitis was induced by intracolonic instillation of 1 ml of 5% of acetic acid. Rats were treated with MSM (400 mg/kg/day, orally) for 4 days. Animals were euthanized and distal colon evaluated histologically and biochemically. Tissue samples were used to measurement of malondialdehyde (MDA), myeloperoxidase (MPO), catalase (CAT), glutathione (GSH) and proinflammatory cytokine (TNF-{alpha} and IL-1{beta}) levels. Results showed that MSM decreased macroscopic and microscopic colonic damage scores caused by administration of acetic acid. MSM treatment also significantly reduced colonic levels of MDA, MPO and IL-1{beta}, while increased the levels of GSH and CAT compared with acetic acid-induced colitis group. It seems that MSM as a natural product may have a protective effect in an experimental ulcerative colitis. - Research Highlights: > Methylsulfonylmethane occurs naturally in some green plants, fruits and vegetables. > Methylsulfonylmethane (MSM) has anti-inflammatory and antioxidant effects. > We evaluated the effects of MSM in a rat model of experimental ulcerative colitis. > MSM has protective effect against acetic acid-induced colitis in rat.

Amirshahrokhi, K., E-mail: k.amirshahrokhi@arums.ac.ir [Department of Pharmacology, School of Medicine, Ardabil University of Medical Sciences, P.O. Box 56197, Ardabil (Iran, Islamic Republic of); Bohlooli, S. [Department of Pharmacology, School of Medicine, Ardabil University of Medical Sciences, P.O. Box 56197, Ardabil (Iran, Islamic Republic of); Chinifroush, M.M. [Department of Pathology, School of Medicine, Ardabil University of Medical Sciences, Ardabil (Iran, Islamic Republic of)



Inhalation developmental toxicology studies: Teratology study of acetone in mice and rats: Final report  

SciTech Connect

Acetone, an aliphatic ketone, is a ubiquitous industrial solvent and chemical intermediate; consequently, the opportunity for human exposure is high. The potential for acetone to cause developmental toxicity was assessed in Sprague-Dawley rats exposed to 0, 440, 2200, or 11000 ppm, and in Swiss (CD-1) mice exposed to 0, 440, 2200, and 6600 ppm acetone vapors, 6 h/day, 7 days/week. Each of the four treatment groups consisted of 10 virgin females (for comparison), and approx.32 positively mated rats or mice. Positively mated mice were exposed on days 6-17 of gestation (dg), and rats on 6-19 dg. The day of plug or sperm detection was designated as 0 dg. Body weights were obtained throughout the study period, and uterine and fetal body weights were obtained at sacrifice (rats, 20 dg; mice, 18 dg). Implants were enumerated and their status recorded. Live fetuses were sexed and examined for gross, visceral, skeletal, and soft-tissue craniofacial defects. 46 refs., 6 figs., 27 tabs.

Mast, T.J.; Evanoff, J.J.; Rommereim, R.L.; Stoney, K.H.; Weigel, R.J.; Westerberg, R.B.



Prenatal PCBs disrupt early neuroendocrine development of the rat hypothalamus  

SciTech Connect

Neonatal exposure to endocrine disrupting chemicals (EDCs) such as polychlorinated biphenyls (PCBs) can interfere with hormone-sensitive developmental processes, including brain sexual differentiation. We hypothesized that disruption of these processes by gestational PCB exposure would be detectable as early as the day after birth (postnatal day (P) 1) through alterations in hypothalamic gene and protein expression. Pregnant Sprague-Dawley rats were injected twice, once each on gestational days 16 and 18, with one of the following: DMSO vehicle; the industrial PCB mixture Aroclor 1221 (A1221); a reconstituted mixture of the three most prevalent congeners found in humans, PCB138, PCB153, and PCB180; or estradiol benzoate (EB). On P1, litter composition, anogenital distance (AGD), and body weight were assessed. Pups were euthanized for immunohistochemistry of estrogen receptor {alpha} (ER{alpha}) or TUNEL labeling of apoptotic cells or quantitative PCR of 48 selected genes in the preoptic area (POA). We found that treatment with EB or A1221 had a sex-specific effect on developmental apoptosis in the neonatal anteroventral periventricular nucleus (AVPV), a sexually dimorphic hypothalamic region involved in the regulation of reproductive neuroendocrine function. In this region, exposed females had increased numbers of apoptotic nuclei, whereas there was no effect of treatment in males. For ER{alpha}, EB treatment increased immunoreactive cell numbers and density in the medial preoptic nucleus (MPN) of both males and females, while A1221 and the PCB mixture had no effect. PCR analysis of gene expression in the POA identified nine genes that were significantly altered by prenatal EDC exposure, in a manner that varied by sex and treatment. These genes included brain-derived neurotrophic factor, GABA{sub B} receptors-1 and -2, IGF-1, kisspeptin receptor, NMDA receptor subunits NR2b and NR2c, prodynorphin, and TGF{alpha}. Collectively, these results suggest that the disrupted sexual differentiation of the POA by prenatal EDC exposures is already evident as early as the day after birth, effects that may change the trajectory of postnatal development and compromise adult reproductive function.

Dickerson, Sarah M.; Cunningham, Stephanie L. [Center for Molecular and Cellular Toxicology, Division of Pharmacology and Toxicology, University of Texas at Austin, Austin, TX 78712 (United States); Gore, Andrea C., E-mail: andrea.gore@mail.utexas.edu [Center for Molecular and Cellular Toxicology, Division of Pharmacology and Toxicology, University of Texas at Austin, Austin, TX 78712 (United States); Institute for Neuroscience, University of Texas at Austin, Austin, TX 78712 (United States); Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, TX 78712 (United States)



Effect of synthetic ANP on renal and loop of Henle functions in the young rat  

SciTech Connect

The present studies were undertaken to determine, by recollection micropuncture, the effect of a synthetic atrial natriuretic peptide (ANP) on the absolute and fractional deliveries of water and sodium to the juxtamedullary end-descending limb. Two groups of young female Munich-Wistar rats were studied: 1) control received the vehicle only; and 2) ANP received a prime followed by the constant infusion of a synthetic rat atrial peptide (28 amino acids). With the infusion of ANP, clearance of p-( UC)aminohippurate (( UC(PAH) and glomerular filtration rate (GFR) fell significantly. Despite this fall in GFR and renal plasma flow, ANP produced a 2-fold increase in urine volume and a 10-fold increase in sodium excretion. Absolute and fractional sodium deliveries to the end-descending limb increased by approx.30% in the ANP group, whereas mean juxtamedullary single-nephron glomerular filtration rate (SNGFR) remained stable. In three additional rats prepared for micropuncture of the superficial end-accessible proximal tubule, ANP reduced cortical SNGFR by approx.15%. By contrast, GFR did not decline in response to ANP in larger rats, when treated identically. The authors conclude that 1) in young rats ANP can produce a natriuresis in the absence of a rise in GFR; 2) the fall in GFR observed following ANP is due presumably to the immaturity of the animals used in these studies; and 3) ANP produces a rise in absolute and fractional water and sodium deliveries to the end-descending limb that cannot be attributed to a change in SNGFR. The relatively small rise in fractional sodium delivery to the end-descending limb, most probably due to inhibition of sodium and water reabsorption in the juxtamedullary proximal tubule and/or thin descending limb, accounts for only a smallproportion of sodium excretion in the final urine.

Roy, D.R.



Studies on Pentoxifylline and Tocopherol Combination for Radiation-Induced Heart Disease in Rats  

SciTech Connect

Purpose: To investigate whether the application of pentoxifylline (PTX) and tocopherol l (Vit. E) could modify the development of radiation-induced heart disease and downregulate the expression of transforming growth factor (TGF)-{beta}1mRNA in rats. Methods and Materials: A total of 120 Sprague-Dawley rats were separated into four groups: control group, irradiated group, experimental group 1, and experiment group 2. Supplementation was started 3 days before irradiation; in experimental group 1, injection of PTX (15 mg/kg/d) and Vit. E (5.5 mg/kg/d) continued till the 12th week postirradiation, whereas in experimental group 2 it was continued until the 24th week postirradiation. All rats were administrated a single dose of 20 Gy irradiation to the heart except the control group. Histopathologic evaluation was performed at various time points (Days 1, 2, 4, 8, and 12 and 24th week) up to 24 weeks after irradiation. Changes of levels of TGF-{beta}1 mRNA expression were also investigated at the same time points using competitive polymerase chain reaction. Results: Compared with the irradiated group, levels of TGF-{beta}1 mRNA of the rat hearts were relatively low in the two experimental groups on the 12th week postirradiation. In experimental group 1, there was a rebound expression of TGF-{beta}1 mRNA on the 24th week postirradiation, whereas that of the experimental group 2 remained low (p < 0.05). The proportions of collagen fibers of the two experimental groups were lower than that of irradiated group (p < 0.05). A rebound could be observed in the experimental group 1. Conclusion: PTX and Vit. E downregulated the expression of TGF-{beta}1 mRNA. The irradiated rat hearts showed a marked pathologic response to the drugs. The withdrawal of drugs in the 12th week postirradiation could cause rebound effects of the development of fibrosis.

Liu Hui [State Key Laboratory of Oncology in South China, Guangzhou, Guangdong (China); Department of Radiotherapy, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Xiong Mai [Department of Cardiac Surgery, the First Affiliated Hospital, Sun Yat-sen University, Guangzhou, Guangdong (China); Xia Yunfei; Cui Nianji; Lu Rubiao [State Key Laboratory of Oncology in South China, Guangzhou, Guangdong (China); Department of Radiotherapy, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Deng Ling [State Key Laboratory of Oncology in South China, Guangzhou, Guangdong (China); Department of Pathology, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Lin Yuehao [State Key Laboratory of Oncology in South China, Guangzhou, Guangdong (China); Clinical Laboratory, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Rong Tiehua [State Key Laboratory of Oncology in South China, Guangzhou, Guangdong (China); Department of Thoracic Surgery, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China)], E-mail: esophagus2003@yahoo.com.cn




SciTech Connect

A ration containing 35% beef irradiated with 2.79 megarad fed to 12 male Sprague-Dawley rats caused the death of 9 rats because of hemorrhage. The mean reciprocal of the prothrombin time was 0.068 plus or minus 0.018 sec/sup -/. When 3 male cats and 3 male dogs were fed a ration containing irradiated bsef for 40 weeks, all gained weight and the prothrombin time of the blood remained normal. The amount of vitamin K in the ration was calculated to be 6 mu g/100 g of ration solids, which was adequate to prevent prolonged prothrombin times of the blood of cats and dogs, although it was inadequate for rats. Irradintion of beef with 2.8 megarad was previously shown to cause a 50--85% loss in vitamin K content. Rats fed a ration containing nonirradiated beef survived and there was no prolonged prothrombin time of the blood. (H.H.D.)

Reber, E.F.; Malhotra, Om.P.



Decreased angiotensin II binding affinity and binding capacity in the anterior pituitary gland of adult spontaneously hypertensive rats  

SciTech Connect

Angiotensin II (ANG) binding sites were quantified in single pituitary glands from 4-week-old and 14-week-old male spontaneously hypertensive rats (SHR) and age-matched male normotensive Wistar-Kyoto (WKY) control rats after incubation with /sup 125/I-(Sar/sup 1/)-ANG, autoradiography with computerized densitometry, and comparison to /sup 125/I-standards. The maximum binding capacity (B/sub max/) decreased while the dissociation constant (K/sub d/) for ANG increased in 14-week-old SHR when compared to age-matched WKY control rats. Conversely, no difference between rat strains was found in 4-week-old animals. Our results suggest that pituitary ANG binding sites may play a role in the pathophysiology of established genetic hypertension.

Gutkind, J.S.; Castren, E.; Saavedra, J.M.


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Critical period window for spectral tuning defined in the primary auditory cortex (A1) in the rat  

E-Print Network (OSTI)

Repair Critical Period Window for Spectral Tuning Defined inregulation of the CP window is tied to sensory experience,of the critical period window for the rat primary auditory

de Villers-Sidani, Etienne; Chang, Edward F; Bao, Shaowen; Merzenich, Michael M



Theoretical study of 3-D molecular similarity and ligand binding modes of orthologous human and rat D2 dopamine receptors  

Science Conference Proceedings (OSTI)

The D"2 dopamine receptor (D"2DR) is an important target for the treatment of some central nervous system disorders, such as Parkinson disease, schizophrenia and drug-dependence. In this work, we built 3-D models of the long form of human and rat D"2DRs ... Keywords: 7TM receptor, D2 dopamine receptor ligands, Drug development, Molecular modeling, Parkinson's disease, Rat striatum

Marvin A. Soriano-Ursa; Jorge O. Ocampo-Lpez; Karina Ocampo-Mendoza; Jos G. Trujillo-Ferrara; Jos Correa-Basurto



A Cytogenetic Footprint for Mammary Carcinomas Induced by PhIP in Rats  

SciTech Connect

PhIP (2-amino-1-methyl-6-phenylimidazo [4,5-b] pyridine), a mutagen/carcinogen belonging to the class of heterocyclic amines (HCAs) found in cooked meats, is a mammary gland carcinogen in rats and has been implicated in the etiology of certain human cancers including breast cancer. To gain insight into the genomic alterations associated with PhIP-induced mammary gland carcinogenesis, we used comparative genomic hybridization (CGH) to examine chromosomal abnormalities in rat mammary carcinomas induced by PhIP, and for comparison, by DMBA (7,12-dimethylbenz[a]anthracene), a potent experimental mammary carcinogen. There was a consistent and characteristic pattern of chromosome-region loss in PhIP-induced carcinomas that clearly distinguished them from carcinomas induced by DMBA.

Christian, A T



Dynamic uptake of radioactive substance in rat salivary gland following /sup 3/H-melatonin administration  

SciTech Connect

Dynamics of radioactive accumulation in rat greater salivary gland following systemic administration of /sup 3/H-melatonin was studied to determine a possible action of the hormone in the gland. Progressive decline of /sup 3/H-melatonin concentrations was found in the serum, lung, skeletal muscle, liver, kidney, and salivary gland during 60 min following the administration. On the contrary, there was a progressive accumulation of radioactive substance other than /sup 3/H-melatonin in the salivary gland but not in other tissues mentioned. The radioactivity was also progressively and preferentially localized in the nuclear fraction of the gland cells. These results suggest a possible direct action of melatonin derivative in rat salivary gland.

Withyachumnarnkul, B.; Wongprapairot, P.; Trakulrungsi, W.




E-Print Network (OSTI)

Abstract The present study assessed the efficacy of the cannabinoid CBi receptor antagonist, SR-141716, in reducing voluntary ethanol intake in selectively bred Sardinian alcohol-preferring (sP) rats. Ethanol (10%, v/v) and food were available in daily 4h scheduled access periods; water was present 24 h/day. The acute administration of a 2.5 and a 5 mg/kg dose of SR-141716 selectively reduced ethanol intake, whereas a 10 mg/kg dose of SR-141716 reduced to a similar extent both ethanol and food intake. These results suggest that the cannabinoid CBi receptor is involved in the mediation of the ethanolreinforcing effects in sP rats.

unknown authors



Development of a multi-electrode array for spinal cord epidural stimulation to facilitate stepping and standing after a complete spinal cord injury in adult rats  

E-Print Network (OSTI)

segments via ascending projections from the sacral segmentsof hindlimb nerve projections to the rat spinal cord: a663. Nelson S, Mendell L: Projection of single knee flexor



Cross-linking of atrial natriuretic peptide to binding sites in rat olfactory bulb membranes  

SciTech Connect

Binding sites for /sup 125/I-atrial natriuretic peptide (ANP)2 in rat olfactory bulb membranes have been studied using pharmacological and biochemical methods. Various unlabeled ANP-related peptides were tested for the ability to inhibit the binding of the radioligand in membrane binding assays. ANP(92-126) and ANP(99-126) were the most potent inhibitors tested, both exhibiting an IC50 value of 0.40 nM. ANP(103-126) and ANP(103-123) were 3 and 70 times less potent, respectively. ANP(111-126) was unable to inhibit the binding of the radioligand at a concentration of 1 microM. Several peptides unrelated to ANP were unable to inhibit the binding of the radioligand to rat olfactory bulb membranes. Membranes labeled with /sup 125/I-ANP were incubated with cross-linking agents and subjected to SDS-PAGE followed by autoradiography. A band possessing an apparent molecular mass of 116 kDa was identified. The labeling of this band was progressively decreased by increasing concentrations of unlabeled ANP(99-126) (IC50 = 0.6 nM) and by several other ANP-related peptides at nanomolar concentrations. For comparison purposes, ANP binding sites in rat aorta membranes were labeled with /sup 125/I-ANP and cross-linked using identical techniques. Three bands possessing molecular masses of 120, 72, and 62 kDa were identified. These results indicate that the ANP binding site in rat olfactory bulb membranes displays pharmacological and biochemical properties similar to peripheral ANP receptors.

Wildey, G.M.; Glembotski, C.C.



X-ray intravital microscopy for functional imaging in rat hearts using synchrotron radiation coronary microangiography  

SciTech Connect

An X-ray intravital microscopy technique was developed to enable in vivo visualization of the coronary, cerebral, and pulmonary arteries in rats without exposure of organs and with spatial resolution in the micrometer range and temporal resolution in the millisecond range. We have refined the system continually in terms of the spatial resolution and exposure time. X-rays transmitted through an object are detected by an X-ray direct-conversion type detector, which incorporates an X-ray SATICON pickup tube. The spatial resolution has been improved to 6 {mu}m, yielding sharp images of small arteries. The exposure time has been shortened to around 2 ms using a new rotating-disk X-ray shutter, enabling imaging of beating rat hearts. Quantitative evaluations of the X-ray intravital microscopy technique were extracted from measurements of the smallest-detectable vessel size and detection of the vessel function. The smallest-diameter vessel viewed for measurements is determined primarily by the concentration of iodinated contrast material. The iodine concentration depends on the injection technique. We used ex vivo rat hearts under Langendorff perfusion for accurate evaluation. After the contrast agent is injected into the origin of the aorta in an isolated perfused rat heart, the contrast agent is delivered directly into the coronary arteries with minimum dilution. The vascular internal diameter response of coronary arterial circulation is analyzed to evaluate the vessel function. Small blood vessels of more than about 50 {mu}m diameters were visualized clearly at heart rates of around 300 beats/min. Vasodilation compared to the control was observed quantitatively using drug manipulation. Furthermore, the apparent increase in the number of small vessels with diameters of less than about 50 {mu}m was observed after the vasoactive agents increased the diameters of invisible small blood vessels to visible sizes. This technique is expected to offer the potential for direct investigation of mechanisms of vascular dysfunctions.

Umetani, K. [Japan Synchrotron Radiation Research Institute, SPring-8, Sayo-cho, Sayo-gun, Hyogo 679-5198 (Japan); Fukushima, K. [National Cerebral and Cardiovascular Center Hospital, Fujishirodai, Suita-shi, Osaka 565-8565 (Japan)



Lipidomic changes in rat liver after long-term exposure to ethanol  

Science Conference Proceedings (OSTI)

Alcoholic liver disease (ALD) is a serious health problem with significant morbidity and mortality. In this study we examined the progression of ALD along with lipidomic changes in rats fed ethanol for 2 and 3 months to understand the mechanism, and identify possible biomarkers. Male Fischer 344 rats were fed 5% ethanol or caloric equivalent of maltose-dextrin in a Lieber-DeCarli diet. Animals were killed at the end of 2 and 3 months and plasma and livers were collected. Portions of the liver were fixed for histological and immunohistological studies. Plasma and the liver lipids were extracted and analyzed by nuclear magnetic resonance (NMR) spectroscopy. A time dependent fatty infiltration was observed in the livers of ethanol-fed rats. Mild inflammation and oxidative stress were observed in some ethanol-fed rats at 3 months. The multivariate and principal component analysis of proton and phosphorus NMR spectroscopy data of extracted lipids from the plasma and livers showed segregation of ethanol-fed groups from the pair-fed controls. Significant hepatic lipids that were increased by ethanol exposure included fatty acids and triglycerides, whereas phosphatidylcholine (PC) decreased. However, both free fatty acids and PC decreased in the plasma. In liver lipids unsaturation of fatty acyl chains increased, contrary to plasma, where it decreased. Our studies confirm that over-accumulation of lipids in ethanol-induced liver steatosis accompanied by mild inflammation on long duration of ethanol exposure. Identified metabolic profile using NMR lipidomics could be further explored to establish biomarker signatures representing the etiopathogenesis, progression and/or severity of ALD. - Highlights: > Long term exposure to ethanol was studied. > A nuclear magnetic resonance (NMR) spectroscopy based lipidomic approach was used. > We examined the clustering pattern of the NMR data with principal component analysis. > NMR data were compared with histology and immunohistochemistry data. > Biochemical parameters were compared with the observed NMR lipid data.

Fernando, Harshica; Bhopale, Kamlesh K. [Department of Pathology, University of Texas Medical Branch, Galveston, TX, 77555 (United States); Kondraganti, Shakuntala [Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, TX, 77555 (United States); Kaphalia, Bhupendra S. [Department of Pathology, University of Texas Medical Branch, Galveston, TX, 77555 (United States); Shakeel Ansari, G.A., E-mail: sansari@utmb.edu [Department of Pathology, University of Texas Medical Branch, Galveston, TX, 77555 (United States); Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, TX, 77555 (United States)



The effects of ethanol on strychnine sensitive glycine receptors in the rat basolateral amygdala  

E-Print Network (OSTI)

The major relationship between ethanol and the behavioral response to environmental stressors indicates that ethanol functions to reduce the effects of stress. The most classical presentation of the anxiety-reduction hypothesis of alcoholism, presented by Cogner (1956), theorized that alcoholism was induced by the anxiolytic effects of ethanol, which in turn reinforced intake of ethanol. If this holds true, then it is reasonable to hypothesize that the CNS effects of ethanol may be dominant in the area of the brain that controls or influences anxiety. Given the known role of the amygdala in fear and anxiety-induced responses, we hypothesized that the anxiety reducing effects of ethanol would be observed within the amygdala and may be measured as alterations of neuronal excitability. The first aim of this thesis was to establish an animal model of alcoholism in the laboratory. This was done by introducing a nutritionally complete ethanol containing liquid diet. We compared two liquid diet formularies, one prepared in-house and one commercially prepared. The second aim enlisted a behavioral experiment to test our hypothesis of alterations of the anxiety response in the chronically ethanol treated rats. We utilized the light/dark box apparatus to measure the anxiolytic and anxiogenic effects of chronic ethanol ingestion and withdrawal. In these tests we found that both the ethanol and control rats displayed a slightly greater interest in exploring the dark side of the box, while the ethanol withdrawal rats spent a significant percent of their total time on the light side. The third aim was to use whole-cell patch clamp electrophysiology to study the cellular effects of ethanol on the rat basolateral amygdala neurons. Initially we were able to demonstrate that the acutely isolated BLA neurons contained strychnine-sensitive glycine receptors. However, we found no significant alteration in the glycine-, GABA-, or NMDA-mediated response within these neurons with chronic ethanol exposure or withdrawal.

Botting, Shaleen Kaye



The correlation dimension of rat hearts in an experimentally controlled environment  

Science Conference Proceedings (OSTI)

The electric response of several isolated rat hearts in a controlled environment was studied experimentally. The correlation dimension D 2 was estimated and was found to be between 4 and 6.5 when the response was nearly periodic. The variation of D 2 with the concentration of calcium was studied and a general trend of its increase with increasing concentration was found. Two types of ventricular fibrillation (VF) were observed

Guy Dori; Shmuel Fishman; S. A. Ben-Haim



Characterization of angiotensin-binding sites in the bovine adrenal and the rat brain  

SciTech Connect

The first study was designed to determine whether systemically administered MSG affects neurons in the CVOs that are potentially important in mediating angiotensin-dependent responses. Rats were pretreated with MSG and the receptors for angiotensin II were assayed by radioligand binding in brain homogenates from the septum anteroventral third ventricular region (AV3V) and the thalamus/hypothalamus region using {sup 125}I-angiotensin II as the radioligand. The results of this experiment indicate that systematically administered MSG in the rat significantly reduced the number (Bmax) of Ang II receptors in a tissue sample which contained both extra blood-brain barrier organs as well as tissue within the blood-brain barrier with no change in the affinity (Kd) of the binding sites. The second chapter reports the successful solubilization of bovine adrenal {sup 125}I Ang II and {sup 125}I Sar{sup 1},Ile{sup 8}-Ang II binding sites with the detergent CHAPS. The results of our studies indicate the presence of two angiotensin binding sites. The one site is specific for naturally occurring angiotensins as well as sarcosine-1 substituted angiotensin analogues. The other site which can be optimally stabilized be re-addition of 0.3% CHAPS into the incubation assay binds sarcosine-1 substituted angiotensins exclusively. Hydrophobic interaction chromatography experiments suggest that these sites, possibly, represent distinct proteins. The third chapter discusses the successful solubilization and partial characterization of the rat brain angiotensin receptor.

Rogulja, I.



Evidence for selective expression of angiotensin II receptors on atretic follicles in the rat ovary: an autoradiographic study  

SciTech Connect

Ovarian angiotensin II (Ang II) receptors display a cyclical pattern of variation during the rat estrous cycle. Ang II receptors, estimated by the specific binding of the Ang II receptor antagonist (/sup 125/I)iodo-(Sar1,Ile8) Ang II to ovarian membranes, were lowest at estrus (binding site density (Bmax) = 35 +/- 2 fmol/mg; binding site affinity (KD) = 2.0 +/- 0.2 nM) and highest at diestrus I (Bmax = 59 +/- 3 fmol/mg; KD = 1.6 +/- 0.1 nM). We have previously shown that Ang II receptors in the rat ovary predominantly exist on the granulosa cell layer of a subpopulation of follicles. Our present studies show that the Ang II receptor-containing follicles in the rat ovary are mainly atretic (approximately 80%) or show signs of early atresia (approximately 15%) during all stages of the estrous cycle. A small number of Ang II receptor-containing follicles were healthy (approximately 5%). In contrast to the Ang II receptor-containing follicles, the FSH receptor-containing follicles were predominantly healthy (greater than 90%). Follicles which contained both Ang II receptors and FSH receptors were mainly early atretic. Since Ang II receptor-containing follicles in the rat ovary were mainly atretic these studies suggest that in the rat Ang II may be a major factor in regulating the function of atretic ovarian follicles.

Daud, A.I.; Bumpus, F.M.; Husain, A.



Comparative in vitro cytotoxicity of nickel oxides and nickel-copper oxides to rat, mouse, and dog pulmonary alveolar macrophages  

SciTech Connect

Metal oxides containing either Ni alone (NiO's) or both Ni and Cu (Ni-CuO's) are encountered during Ni refining. Six NiO compounds calcined at temperatures ranging from < 650 to 1045/sup 0/ and four Ni-CuO's containing from 6.9 to 28% Cu and 44 to 69% Ni were screened for their in vitro cytotoxicity to alveolar macrophages (AM). NiO's were less toxic to rat AM than were the Ni-CuO compounds. The toxicity of the Ni-CuO compounds increased with increasing Cu content and decreasing Ni content of the molecules, indicating that the toxicity was due to the Cu content of the molecules. AM obtained from beagle dogs, F344/N rats, and B6C3F/sub 1/ mice displayed the following species sensitivities: dog > rat approx. = mouse, with dog AM being most sensitive. The observed differences in species sensitivities correlated with differences in the phagocytic abilities of dog, rat, and mouse AM, with the ranking of phagocytic abilities of the AM in decreasing order of ability being dog > rat > mouse.

Benson, J.M.; Henderson, R.F.; Pickrell, J.A.



Modulation of Intestinal Micrornas by a Chemoprotective Diet  

E-Print Network (OSTI)

We have hypothesized that dietary modulation of intestinal miRNA expression may contribute to the chemoprotective effects of nutritional bioactives (fish oil and pectin). Using a rat colon carcinogen model, we determined miRNAs-let-7d, miR-15b, miR-107, miR-191 and miR-324-5p were modulated by fish oil + pectin. We also demonstrated that BACE1 and PTEN are targets of miR-107 and miR-21, respectively. To further elucidate the biological effects of diet and carcinogen on miRNAs, we integrated global miRNAs, total and polysomal gene expression datasets obtained from the above mentioned study and used four computational approaches. We demonstrated that polysomal profiling is tightly related to microRNA changes when compared with total mRNA profiling. In addition, diet and carcinogen exposure modulated a number of microRNAs and complementary gene expression analyses showed that oncogenic PTK2B, PDE4B, and TCF4 were suppressed by the chemoprotective diet at both the mRNA and protein levels. To determine the function of select diet and colon carcinogen modulated miRNAs and to validate their targets, we carried out a series of loss and gain of function experiments along with luciferase reporter assays. We verified that PDE4B and TCF4 are direct targets of miR-26b and miR-203, respectively. PTK2B was determined to be an indirect target of miR-19b. In addition, microRNA physiological function was assessed by examining effects on apoptosis and cell proliferation. To better understand how the colonic stem cell population responds to environmental factors such as diet and carcinogen, we investigated the chemoprotective effects of dietary agents on miRNAs in colonic stem cells obtained from Lgr5-EGFP-IRES-creERT2 knock in mice injected with AOM. We demonstrated that based on relative expression of miR-125a-5p, miR-190b and miR-191 in stem cells vs. daughter cells and differentiated cells, these miRNAs may be stem cell specific miRNAs. We also identified miR-21 to be significantly reduced in stem cells compared to differentiated cells and selectively modulated by these dietary agents in stem cells. In summary, our results indicate for the first time that fish oil plus pectin protect against colon tumorigenesis in part by modulating a subset of miRNAs and their target genes (mRNAs) implicated in the regulation of the colon stem cell niche and tumor development.

Shah, Manasvi 1984-



Localization of atrial natriuretic peptide mRNA and immunoreactivity in the rat heart and human atrial appendage  

SciTech Connect

The localization of mRNA encoding preproatrial natriuretic peptide was investigated in tissue sections and cultures of rat heart and in sections of human right atrial appendage using the technique of in situ hybridization with /sup 32/P- and /sup 35/S-labeled RNA probes. Rat atrial natriuretic peptide (ANP) transcripts were demonstrated in numerous atrial myocytes and, to a lesser extent, in ventricular myocytes in both tissue sections and newborn rat heart cultures. These findings are consistent with those obtained by RNA blot analysis of rat heart total RNA, indicating that a single prepro-ANP transcript of approx. 900 nucleotides was present in the ventricles as well as the atria. Using a /sup 35/S-labeled RNA probe for human ANP mRNA, ANP transcripts were also localized to the majority of myocytes in the human right atrial appendage. Only background levels of autoradiographic labeling were obtained when RNA probes identical to the coding sequence of rat or human ANP mRNA were used. A close correlation was found between the distribution of ANP immunoreactivity and prepro-ANP mRNA in these preparations. These results provide unequivocal evidence for the expression of the ANP gene in the rat ventricles, as well as the atria, because myocytes in these tissues have been established as the sites of both ANP localization and precursor biosynthesis. The combined use of cardiac cultures and in situ hybridization may be of value in future studies investigating the regulation of ANP synthesis in cardiac myocytes.

Hamid, Q.; Wharton, J.; Terenghi, G.; Hassall, C.J.S.; Aimi, J.; Taylor, K.M.; Nakazato, H.; Dixon, J.E.; Burnstock, G.; Polak, J.M.



Charcterization of atrial natriuretic peptide receptors (ANP-R) in rat kidney and lung tissues  

SciTech Connect

The ability of several rat ANP analogues to compete with SVI-ANP(1-28) for binding to plasma membranes of rat kidney cortex (RKPM) and rat lung (RLPM) was examined. Their ability to compete on RKPM was: ANP(1-28)>pro-ANP>ANP(5-28)>ANP(5-27), ANP(5-25) being inactive. Conversely, the potency of the analogues on RLPM was: ANP(5-28)>ANP(5-27)>ANP(1-28)>ANP-(5-25), pro-ANP being unable to compete. The stimulation of particulate guanylate cyclase by these peptides paralleled their ability to compete. Truncation of the C-terminal therefore decreases the binding of the peptide to RKPM. In contrast, the N-terminal seems to be important for interaction with ANP-R on RLPM. ANP-R were photolabeled with SVI-iodo-azidosalicylyl-ANP(1-28) (ASA-ANP) or azidobenzoyl- SVI-ANP(1-28) (AB-ANP) in which the C-terminal tyrosine is iodinated. In ASA-ANP, the iodine is located on the benzene ring. ASA-ANP identified a protein of approx.140 kDa in RKPM. AB-ANP recognized an additional protein of approx.120 kDa. The bulkier N-terminal of the ASA-ANP seems to hinder the binding of the analogue to the approx.120-kDa protein. In RLPM only the approx.120-kDa protein was detected by AB-ANP. The approx.140-kDa receptor may be unique to the kidney. ANF-R in RKPM and RLPM respectively, appear to interact with different domains of ANP suggesting the existence of two forms of the ANP-R.

Tallerico-Melnyk, T.; Yu, H.; Flynn, T.G.; Yip, C.C.



Reversal of docosahexaenoic acid deficiency in the rat brain, retina, liver, and serum  

E-Print Network (OSTI)

Abstract The loss of docosahexaenoic acid (DHA) from the retina or brain has been associated with a loss in nervoussystem function in experimental animals, as well as in human infants fed vegetable oil-based formulas. The reversibility of the loss of DHA and the compensation by an increase in the n-6 docosapentaenoic acid (DPAn-6) was studied in young adult rats. Long-Evans rats were subjected to a very low level of n-3 fatty acids through two generations. The F2 generation, n-3-deficient animals at 7 weeks of age were provided a repletion diet containing both ?-linolenate and DHA. A separate group of F2 generation rats had been maintained on an n-3-adequate diet of the same composition. Tissues from the brain, retina, liver, and serum were collected on weeks 0, 1, 2, 4, and 8 from both groups of animals. The concentrations of DHA, DPAn-6, and other fatty acids were determined and the rate of recovery and length of time needed to complete DHA recovery were determined for each tissue. The DHA level in the brain at 1 and 2 weeks after diet reversal was only partially recovered, rising to approximately 20 % and 35%, respectively, of the n-3-adequate group level. Full recovery was not obtained until 8 weeks after initiation of the repletion diet. Although the initial rate of retinal DHA accretion was greater than that of brain DHA, the half-time for DHA recovery was only marginally greater. On the other hand, the levels of DHA in the serum and liver were approximately 90 % and 100 % replaced, respectively, within 2 weeks of diet reversal. A consideration of the total amounts and time courses of DHA repleted in the nervous system compared with the liver and circulation suggests that transport-related processes may limit the rate of DHA repletion in the retina and brain.Moriguchi, T., J.

Toru Moriguchi; James Loewke; Megan Garrison; Janice Nicklay Catalan; Norman Salem



Effects of cadmium on the renal and skeletal muscle microcirculation in rats  

SciTech Connect

The effects of cadmium on the arteriolar diameters of the kidney and skeletal muscle were quantified, because of the hypertensive effect of cacmium. The effect of cacmium on the constrictor response of the renal arterioles to angiotensin II (Ang II) were also assessed. In vivo preparations of the rat hydronephrotic kidney and cremaster muscle were used for direct visualization of the microvessels with intravital television microscopy. Hydronephrosis was induced in twenty-seven male Wistar-Kyoto rats (150-180 g) by unilateral ureter ligation. The hydronephrotic kidney, with intact cortical circulation and innervation, was exteriorized in a specially designed bath for microcirculation observation 6-8 weeks following the ureter ligation. The cremaster muscle experiments were conducted in another thirty-seven male WKY rats (120-180 g). Disparate effects of cadmium were observed in these two microcirculation beds. Topical cadmium (1.35 [mu]M-0.45 mM) increased the diameters of the pre- and postglomerular vessels in the hydronephrotic kidney maximally by 15-26%. Cadmium (0.27 mM) inhibited the Ang II response of the arterioles non-competitively. However, intraperitoneally injected cadmium (2 mg/kg), which significantly increased the mean arterial pressure, did not dilate the arterioles nor alter the Ang II response. On the other hand, cadmium (13.5 [mu]M-0.72 mM) constricted the larger arterioles in the cremaster muscle (60-160 [mu]m) concentration-dependently, but not small arterioles (15-30 [mu]m). In summary, topical cadmium dilates renal arterioles and decreases their reactivity to Ang II, but constricts the larger cremaster arterioles. The disparate effects of cadmium suggest different Ca[sup 2+] utilization mechanisms in different vascular beds. The construction of the cremaster arterioles may contribute to cadmium-induced hypertension by increasing peripheral resistance.

Zhang Chong.



Impaired mitochondrial respiration and protein nitration in the rat hippocampus after acute inhalation of combustion smoke  

SciTech Connect

Survivors of massive inhalation of combustion smoke endure critical injuries, including lasting neurological complications. We have previously reported that acute inhalation of combustion smoke disrupts the nitric oxide homeostasis in the rat brain. In this study, we extend our findings and report that a 30-minute exposure of awake rats to ambient wood combustion smoke induces protein nitration in the rat hippocampus and that mitochondrial proteins are a sensitive nitration target in this setting. Mitochondria are central to energy metabolism and cellular signaling and are critical to proper cell function. Here, analyses of the mitochondrial proteome showed elevated protein nitration in the course of a 24-hour recovery following exposure to smoke. Mass spectrometry identification of several significantly nitrated mitochondrial proteins revealed diverse functions and involvement in central aspects of mitochondrial physiology. The nitrated proteins include the ubiquitous mitochondrial creatine kinase, F1-ATP synthase {alpha} subunit, dihydrolipoamide dehydrogenase (E3), succinate dehydrogenase Fp subunit, and voltage-dependent anion channel (VDAC1) protein. Furthermore, acute exposure to combustion smoke significantly compromised the respiratory capacity of hippocampal mitochondria. Importantly, elevated protein nitration and reduced mitochondrial respiration in the hippocampus persisted beyond the time required for restoration of normal oxygen and carboxyhemoglobin blood levels after the cessation of exposure to smoke. Thus, the time frame for intensification of the various smoke-induced effects differs between blood and brain tissues. Taken together, our findings suggest that nitration of essential mitochondrial proteins may contribute to the reduction in mitochondrial respiratory capacity and underlie, in part, the brain pathophysiology after acute inhalation of combustion smoke.

Lee, Heung M.; Reed, Jason; Greeley, George H. [Department of Surgery, University of Texas Medical Branch (United States); Englander, Ella W. [Department of Surgery, University of Texas Medical Branch (United States); Shriners Hospitals for Children, Galveston, TX (United States)], E-mail: elenglan@utmb.edu


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


RatBot: anti-enumeration peer-to-peer botnets  

SciTech Connect

Botnets have emerged as one of the most severe cyber threats in recent years. To obtain high resilience against a single point of failure, the new generation of botnets have adopted the peer-to-peer (P2P) structure. One critical question regarding these P2P botnets is: how big are they indeed? To address this question, researchers have proposed both actively crawling and passively monitoring methods to enumerate existing P2P botnets. In this work, we go further to explore the potential strategies that botnets may have to obfuscate their true sizes. Towards this end, this paper introduces RatBot, a P2P botnet that applies some statistical techniques to defeat existing P2P botnet enumeration methods. The key ideas of RatBot are two-fold: (1) there exist a fraction of bots that are indistinguishable from their fake identities, which are spoofing IP addresses they use to hide themselves; (2) we use a heavy-tailed distribution to generate the number of fake identities for each of these bots so that the sum of observed fake identities converges only slowly and thus has high variation. We use large-scale high-fidelity simulation to quantify the estimation errors under diverse settings, and the results show that a naive enumeration technique can overestimate the sizes of P2P botnets by one order of magnitude. We believe that our work reveals new challenges of accurately estimating the sizes of P2P botnets, and hope that it will raise the awareness of security practitioners with these challenges. We further suggest a few countermeasures that can potentially defeat RatBot's anti-enumeration scheme.

Yan, Guanhua [Los Alamos National Laboratory; Eidenbenz, Stephan [Los Alamos National Laboratory; Chen, Songqing [GEORGE MASON UNIV.




E-Print Network (OSTI)

Abstract Aims: Intermittent presentations of the ethanol sipper have been reported to induce more ethanol drinking in rats than when the ethanol sipper was continuously available during the session. This intermittent sipper effect was observed in a social drinking situation, in which subjects experienced intermittent opportunities to interact briefly with a conspecific rat. The objective of this study was to evaluate the effects of the intermittent sipper procedure in situations providing for intermittent presentations of food, and, in addition, in situations that do not provide for intermittent presentations of another rewarding event. Methods: Four groups of male Long-Evans hooded rats, arranged in a 2 2 factorial design with two levels of Sipper Procedure (Intermittent vs Continuous) and two levels of Food procedure (Food vs No Food), were trained in drinking chambers. During each daily session, Intermittent Sipper groups received access to the ethanol sipper during each of 25 trials of 10 s each, while Continuous Sipper groups had access to the ethanol sipper during the entire session ( 30 min). During each session, Food groups received 25 presentations of food pellets while No Food groups received no food pellets. Ethanol concentrations in the sipper [3, 4, 6, 8, and 10 % (vol./vol.)] increased across sessions. Results: More rapid escalation of ethanol intake was observed in the Intermittent Sipper groups than in the Continuous Sipper groups, and this effect was observed in both the Food and No Food conditions (Ps ethanol sipper, yet induced more ethanol drinking than Continuous Sipper procedures. The intermittent sipper effect is not dependent on presentations of food. Implications for scheduleinduced polydipsia and Pavlovian autoshaping are discussed.

Arthur Tomie; William C. Miller; Erik Dranoff; Larissa A. Pohorecky



Altered cardiovascular reactivity and osmoregulation during hyperosmotic stress in adult rats developmentally exposed to polybrominated diphenyl ethers (PBDEs)  

Science Conference Proceedings (OSTI)

Polybrominated diphenyl ethers (PBDEs) and the structurally similar chemicals polychlorinated biphenyls (PCBs) disrupt the function of multiple endocrine systems. PCBs and PBDEs disrupt the secretion of vasopressin (VP) from the hypothalamus during osmotic activation. Since the peripheral and central vasopressinergic axes are critical for osmotic and cardiovascular regulation, we examined whether perinatal PBDE exposure could impact these functions during physiological activation. Rats were perinatally dosed with a commercial PBDE mixture, DE-71. Dams were given 0 (corn oil control), 1.7 (low dose) or 30.6 mg/kg/day (high dose) in corn oil from gestational day (GD) 6 through postnatal day (PND) 21 by oral gavage. In the male offspring exposed to high dose PBDE plasma thyroxine and triiodothyronine levels were reduced at PND 21 and recovered to control levels by PND 60 when thyroid stimulating hormone levels were elevated. At 14-18 months of age, cardiovascular responses were measured in four groups of rats: Normal (Oil, normosmotic condition), Hyper (Oil, hyperosmotic stress), Hyper PBDE low (1.7 mg/kg/day DE-71 perinatally, hyperosmotic stress), and Hyper PBDE high (30.6 mg/kg/day DE-71 perinatally, hyperosmotic stress). Systolic blood pressure (BP), diastolic BP, and heart rate (HR) were determined using tail cuff sphygmomanometry and normalized to pretreatment values (baseline) measured under basal conditions. Hyperosmotic treatment yielded significant changes in systolic BP in PBDE exposed rats only. Hyper PBDE low and high dose rats showed 36.1 and 64.7% greater systolic BP responses at 3 h post hyperosmotic injection relative to pretreatment baseline, respectively. No treatment effects were measured for diastolic BP and HR. Hyper and Hyper PBDE rats showed increased mean plasma osmolality values by 45 min after injection relative to normosmotic controls. In contrast to Hyper rats, Hyper PBDE (high) rats showed a further increase in mean plasma osmolality at 3 h (358.3 {+-} 12.4 mOsm/L) relative to 45 min post hyperosmotic injection (325.1 {+-} 11.4 mOsm/L). Impaired osmoregulation in PBDE-treated animals could not be attributed to decreased levels of plasma vasopressin. Our findings suggest that developmental exposure to PBDEs may disrupt cardiovascular reactivity and osmoregulatory responses to physiological activation in late adulthood. - Highlights: > We examined whether PBDE exposure could impact osmotic and cardiovascular regulation. > Hyperosmotic treatment yielded significant changes in systolic BP in PBDE exposed rats only. > PBDEs may disrupt cardiovascular and osmoregulatory responses to physiological activation.

Shah, Ashini [Department of Cell Biology and Neuroscience, University of California, Riverside, 92521 (United States); Coburn, Cary G. [Environmental Toxicology Graduate Program, University of California, Riverside, 92521 (United States); Watson-Siriboe, Abena; Whitley, Rebecca; Shahidzadeh, Anoush; Gillard, Elizabeth R.; Nichol, Robert [Department of Cell Biology and Neuroscience, University of California, Riverside, 92521 (United States); Leon-Olea, Martha [Neuromorfologia Funcional, Direccion de Investigaciones en Neurociencias, Instituto Nacional de Psiquiatria Ramon de la Fuente Muniz, Mexico City (Mexico); Gaertner, Mark [Department of Cell Biology and Neuroscience, University of California, Riverside, 92521 (United States); Kodavanti, Prasada Rao S. [Neurotoxicology Branch, NHEERL/ORD, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Curras-Collazo, Margarita C., E-mail: margarita.curras@ucr.edu [Environmental Toxicology Graduate Program, University of California, Riverside, 92521 (United States); Department of Cell Biology and Neuroscience, University of California, Riverside, 92521 (United States)




E-Print Network (OSTI)

ABSTRACT: The extracts of bark, leaves and stem of A. indica, fruits of P. longum, berries of E. officinalis and seeds of G. indicum were prepared using different solvents. Three different combinations of these extracts were tried on the female albino rats for their effect on the estrous cycle. The combination consisting of alcoholic extracts of leaves and stem of A. indica, fruits of P. longum, berries of E. officinalis and seeds of G. indicum has exhibited considerable effect on estrous cycle by prolongation of diestrous phase.

C. K. Kokate; M. Krishna; Reddy; N. Chari



An integrated functional genomic study of acute phenobarbital exposure in the rat  

E-Print Network (OSTI)

in drinking water following exposure for three years [8]. Isenberg et al. reported that in F344 rats, exposure to 500 ppm PB in the diet for 1-2 weeks produces an increase in relative liver weight which is reversible on returning the animals to control diet... ) in PB treated animals compared to controls (table 1) at all time points for 500 and 1000 ppm. Body weight was significantly increased in the 500 and 1000 ppm groups at day 14 (p intake for the 500...

Waterman, Claire L; Currie, Richard A; Cottrell, Lisa A; Dow, Jacky; Wright, Jayne; Waterfield, Catherine J; Griffin, Julian L



Therapeutic efficacy of dimercaptosuccinic acid and thiamine/ascorbic acid on lead intoxication in rats  

SciTech Connect

Thiamine, folic acid, pyridoxine and ascorbic acid either individually or in combination have been proven to be effective in reducing the toxic manifestations of lead and in enhancing the antidotal efficacy of CaNa{sub 2}EDTA. In a recent report from the authors' laboratory, it was observed that given combination of thiamine and ascorbic acid with thiol chelators improved the ability of the animals to excrete lead thereby reducing body lead burden. In view of the beneficial effect of these two vitamins, it was considered of interest to evaluate their potential to modify the prophylactic action of DMS in lead intoxication in rat after repeated administration.

Tandon, S.K.; Flora, S.J.S. (Industrial Toxicology Research Centre, Lucknow (India))



Exercise training regulation of extracellular matrix and remodeling in the aging rat heart  

E-Print Network (OSTI)

Aging is characterized by a progressive impairment of cardiac structure and function. The cardiac remodeling involves loss of cardiac myocytes, reactive hypertrophy of the remaining cells, and increased extracellular matrix (ECM) and fibrosis in the aging heart. In contrast, exercise training not only improves cardiac function, but also reduces the risk of heart disease. However, the ability of exercise training to modulate ECM and remodeling in the aging heart remains unknown. Therefore, the purpose of this study was to determine the effects of exercise training on ECM remodeling in the aging heart. We hypothesized that (1) exercise training would attenuate age-related changes in left ventricle morphology including extramyocyte space and collagen contents, and (2) exercise training would ameliorate age-induced changes in ECM-related factors including MMPs, TIMPs, TNF-?, TGF-?1, and ?-SMA in the heart. Three and 31 month old Fischer 344 Brown Norway F1 hybrid rats were assigned to four groups: young sedentary (YS), young exercise-trained (YE), old sedentary (OS), and old exercise-trained (OE). Exercise training groups walked briskly on a treadmill for 45 min/day (12 incline) at 20m/min (young) or 10 m/min (old), 5 d/wk for 12 wk. We found that endurance exercise training might ameliorate the ageinduced increase in extramyocyte space and collagen contents of the left ventricle. Exercise training might protect against age-induced fibrosis by increasing MMP-2, MMP-14 in the soluble fraction and MMP-1, MMP-3, MMP-14 in the insoluble fraction of old rat hearts. Conversely, exercise training might reduce the fibrosis by decreasing TIMP-1 in the soluble fraction of old rat hearts. Further, exercise training reduced potential upstream pro-fibrotic mediators including TNF-? and TGF-?1 in the aging rat hearts. These results are the first to demonstrate that exercise training has a protective effect against age-induced extracellular collagen matrix remodeling in the aging heart, associated with increased MMP-1, -2, -3, -14 and decreased TIMP-1, TNF-?, and TGF- ?1.

Kwak, Hyo Bum



Intracranial electrode implantation produces regional neuroinflammation and memory deficits in rats  

SciTech Connect

Deep brain stimulation (DBS) is an established treatment for advanced Parkinson's disease (PD). The procedure entails intracranial implantation of an electrode in a specific brain structure followed by chronic stimulation. Although the beneficial effects of DBS on motor symptoms in PD are well known, it is often accompanied by cognitive impairments, the origin of which is not fully understood. To explore the possible contribution of the surgical procedure itself, we studied the effect of electrode implantation in the subthalamic nucleus (STN) on regional neuroinflammation and memory function in rats implanted bilaterally with stainless steel electrodes. Age-matched sham and intact rats were used as controls. Brains were removed 1 or 8 weeks post-implantation and processed for in vitro autoradiography with [(3)H]PK11195, an established marker of microglial activation. Memory function was assessed by the novel object recognition test (ORT) before surgery and 2 and 8 weeks after surgery. Electrode implantation produced region-dependent changes in ligand binding density in the implanted brains at 1 as well as 8 weeks post-implantation. Cortical regions showed more intense and widespread neuroinflammation than striatal or thalamic structures. Furthermore, implanted animals showed deficits in ORT performance 2 and 8 weeks post-implantation. Thus, electrode implantation resulted in a widespread and persistent neuroinflammation and sustained memory impairment. These results suggest that the insertion and continued presence of electrodes in the brain, even without stimulation, may lead to inflammation-mediated cognitive deficits in susceptible individuals, as observed in patients treated with DBS.

Kuttner-Hirshler, Y.; Biegon, A.; Kuttner-Hirshler, Y.; Polat, U.; Biegon, A.



Autofluorescence dynamics during reperfusion following long-term renal ischemia in a rat model  

SciTech Connect

Optical properties of near-surface kidney tissue were monitored in order to assess response during reperfusion to long (20 minutes) versus prolonged (150 minutes) ischemia in an in vivo rat model. Specifically, autofluorescence images of the exposed surfaces of both the normal and the ischemic kidneys were acquired during both injury and reperfusion alternately under 355 nm and 266 nm excitations. The temporal profile of the emission of the injured kidney during the reperfusion phase under 355 nm excitation was normalized to that under 266 nm as a means to account for changes in tissue optical properties independent of ischemia as well as changes in the illumination/collection geometrical parameters in future clinical implementation of this technique using a hand-held probe. The scattered excitation light signal was also evaluated as a reference signal and found to be inadequate. Characteristic time constants were extracted using fit to a relaxation model and found to have larger mean values following 150 minutes of injury. The mean values were then compared with the outcome of a chronic survival study where the control kidney had been removed. Rat kidneys exhibiting longer time constants were much more likely to fail. This may lead to a method to assess kidney viability and predict its ability to recover in the initial period following transplantation or resuscitation.

Raman, R N; Pivetti, C D; Matthews, D L; Troppmann, C; Demos, S G



In vitro macro- and micro-autoradiographic localization of atrial natriuretic peptide in the rat kidney  

SciTech Connect

We investigated the receptor localization of atrial natriuretic peptide (ANP) in the rat kidney, by in vitro macro- and micro-autoradiography (ARG) of (/sup 125/I)-ANP using nonfixed frozen sections. First, we examined the optimum conditions for ARG with respect to the effects of polyethylenimine (PEI), thickness of section, incubation time and degradation of (/sup 125/I)-ANP. Saturation experiments of (/sup 125/I)-ANP using rat kidney sections revealed the presence of high affinity binding sites of (/sup 125/I)-ANP in the renal cortex (Kd = 0.52 nM). Macro-autoradiograms showed that the dense grains representing specific binding sites of (/sup 125/I)-ANP were distributed in the cortex in a punctate pattern. Using micro-autoradiography, the localization of the dense grains on the emulsion was compared with the staining pattern of the same section subjected to double staining. In the renal cortex, the dense grains were observed on the glomerulus, blood vessels and proximal tubules. Dense grains were also observed in the mesangium area of glomeruli, the inside wall of blood vessels (especially endothelium), and the inside wall of proximal tubules (possibly brush border). These results suggested that the physiological action of ANP in the kidney is mediated by its receptors. Also, ARG was useful for accurately detecting the action sites of ANP.

Yamamoto, I.; Ogura, T.; Ota, Z.



Gel entrapment culture of rat hepatocytes for investigation of tetracycline-induced toxicity  

SciTech Connect

This paper aimed to explore three-dimensionally cultured hepatocytes for testing drug-induced nonalcoholic steatohepatitis. Gel entrapped rat hepatocytes were applied for investigation of the tetracycline-induced steatohepatitis, while hepatocyte monolayer was set as a control. The toxic responses of hepatocytes were systematically evaluated by measuring cell viability, liver-specific function, lipid accumulation, oxidative stress, adenosine triphosphate content and mitochondrial membrane potential. The results suggested that gel entrapped hepatocytes showed cell death after 96 h of tetracycline treatment at 25 {mu}M which is equivalent to toxic serum concentration in rats, while hepatocyte monolayer showed cell death at a high dose of 200 {mu}M. The concentration-dependent accumulation of lipid as well as mitochondrial damage were regarded as two early events for tetracycline hepatotoxicity in gel entrapment culture due to their detectability ahead of subsequent increase of oxidative stress and a final cell death. Furthermore, the potent protection of fenofibrate and fructose-1,6-diphosphate were evidenced in only gel entrapment culture with higher expressions on the genes related to {beta}-oxidation than hepatocyte monolayer, suggesting the mediation of lipid metabolism and mitochondrial damage in tetracycline toxicity. Overall, gel entrapped hepatocytes in three-dimension reflected more of the tetracycline toxicity in vivo than hepatocyte monolayer and thus was suggested as a more relevant system for evaluating steatogenic drugs.

Shen Chong [College of Materials Science and Chemical Engineering, Zhejiang University, Zhejiang 310027 (China); Meng Qin [College of Materials Science and Chemical Engineering, Zhejiang University, Zhejiang 310027 (China)], E-mail: mengq@zju.edu.cn; Schmelzer, Eva; Bader, Augustinus [Biotechnological-Biomedical Center, Cell Techniques and Applied Stem Cell Biology, University of Leipzig, Deutscher Platz 5, Leipzig 04103 (Germany)



Changes in expression of a functional G sub i protein in cultured rat heart cells  

SciTech Connect

The muscarinic cholinergic agonist, carbachol, and pertussis toxin were used to examine the functional status of the guanine nucleotide-binding protein that inhibits adenylate cyclase (G{sub i}) in cultured neonatal rat heart myocytes. The isoproterenol stimulation of adenylate cyclase activity in myocyte membranes and adenosine 3{prime},5{prime}-cyclic monophosphate (cAMP) accumulation in intact cells (4 days in culture) were insensitive to carbachol. However, in cells cultured for 11 days, carbachol inhibited isoproterenol-stimulated cAMP accumulation by 30%. Angiotensin II (ANG II) was also found to inhibit isoproterenol-stimulated cAMP accumulation in day 11 cells in a dose-dependent manner. Pertussis toxin treatment reversed the inhibitory effects of both ANG II and carbachol, suggesting a role for G{sub i} in the process. Carbachol binding to membranes from day 4 cells was relatively insensitive to guanine nucleotides when compared with binding to membranes from day 11 or adult cells. Furthermore, pertussis toxin-mediated {sup 32}P incorporation into a 39- to 41-kDa substrate in day 11 membranes was increased 3.2-fold over that measured in day 4 membranes. These findings support the view that, although G{sub i} is expressed, it is nonfunctional in 4-day-old cultured neonatal rat heart myocytes and acquisition of functional G{sub i} is dependent on culture conditions. Furthermore, the ANG II receptor can couple to G{sub i} in heart.

Allen, I.S.; Gaa, S.T.; Rogers, T.B. (Univ. of Maryland School of Medicine, Baltimore (USA))



Angiotensin receptors and angiotensin I-converting enzyme in rat intestine  

SciTech Connect

The purpose of this study was to map the distribution of angiotensin II (ANG II) receptors and ANG I-converting enzyme (ACE) in rat intestine. ANG II binding sites were visualized by in vitro autoradiography using iodinated (Sar1, Ile8)ANG II. The distribution of ACE was mapped using an iodinated derivative of lisinopril. Male Sprague-Dawley rats were killed and the interior of the whole intestine washed with ice-cold saline. Segments of duodenum, jejunum, ileum, and colon were quickly frozen in a mixture of isopentane and dry ice. Twenty-micron frozen sections were thaw-mounted onto gelatin-coated slides, incubated with either ligand, and exposed to X-ray film. After exposure and subsequent development, the films were quantitated by computerized densitometry. ANG II receptors were most dense in the colon, followed by the ileum, duodenum, and jejunum. Within each segment of intestine, specific ANG II binding sites were localized exclusively to the muscularis. In contrast, ACE was present in both the mucosa and the muscularis. The colocalization of ANG II receptors and ACE may suggest a role for locally generated ANG II in the control of intestinal function. The luminal orientation of ACE in the mucosa of the small intestine may suggest that at this site ACE serves primarily to hydrolyze dietary peptides.

Duggan, K.A.; Mendelsohn, F.A.; Levens, N.R. (Austin Hospital, Melbourne, Victoria (Australia))



Estrogen effects on angiotensin receptors are modulated by pituitary in female rats  

SciTech Connect

The present studies were designed to test the hypothesis that changes in angiotensin II (ANG II) receptors might modulate the layered target tissue responsiveness accompanying estradiol administration. Estradiol was infused continuously in oophorectomized female rats. Aldosterone was also infused in control and experimental animals to avoid estrogen-induced changes in renin and ANG II. ANG II binding constants were determined in radioreceptor assays. Estradiol increased binding site concentration in adrenal glomerulosa by 76% and decreased binding sites of uterine myometrium and glomeruli by 45 and 24%, respectively. There was an accompanying increase in the affinity of ANG II binding to adrenal glomerulosa and uterine myometrium. Because estrogen is a potent stimulus of prolactin release from the pituitary of rodents, studies were also designed to test the hypothesis that prolactin may mediate some or all of the estrogen-induced effects observed. Hypophysectomy abolished estradiol stimulation of prolactin release and most ANG II receptor changes. Prolactin administration to pituitary intact rats was associated with a 50% increase in receptor density of adrenal glomerulosa simulating estradiol administration. However, the changes in glomeruli and uterine myometrium were opposite in that both tissues also increased receptor density, suggesting that prolactin was not the sole mediator of the estrogen-induced receptor changes. In conclusion, regulation of ANG II receptors in a number of diverse target tissues by estradiol is complex with contributions from estrogens and pituitary factors, which include but do not exclusively involve prolactin.

Douglas, J.G.



Distinct angiotensin II receptor in primary cultures of glial cells from rat brain  

SciTech Connect

Angiotensin II (Ang-II) has profound effects on the brain. Receptors for Ang-II have been demonstrated on neurons, but no relationship between glial cells and Agn-II has been established. Glial cells (from the hypothalamus and brain stem of 1-day-old rat brains) in primary culture have been used to demonstrate the presence of specific Ang-II receptors. Binding of /sup 125/I-Ang-II to glial cultures was rapid, reversible, saturable, and specific for Ang-II. The rank order of potency of /sup 125/I-Ang-II binding was determined. Scatchard analysis revealed a homogeneous population of high-affinity binding sites with a B/sub max/ of 110 fmol/mg of protein. Light-microscopic autoradiography of /sup 125/I-Ang-II binding supported the kinetic data, documenting specific Ang-II receptors on the glial cells. Ang-II stimulated a dose-dependent hydrolysis of phosphatidylinositols in glial cells, an effect mediated by Ang-II receptors. However, Ang-II failed to influence (/sup 3/H) norepinephrine uptake, and catecholamines failed to regulate Ang-II receptors, effects that occur in neurons. These observations demonstrate the presence of specific Ang-II receptors on the glial cells in primary cultures derived from normotensive rat brain. The receptors are kinetically similar to, but functionally distinct from, the neuronal Ang-II receptors.

Raizada, M.K.; Phillips, M.I.; Crews, F.T.; Sumners, C.



Availability of cadmium to rats from crops grown on cadmium-enriched soil  

SciTech Connect

The research was initiated to enhance understanding of the availability to animals of Cd present in edible plants. Such information is of considerable importance since agricultural crops can accumulate high concentrations of the metal when grown in certain soils or with sewage sludge as a fertilizer. Edible plants were labeled with /sup 109/Cd by growing them on /sup 109/CdCl/sup 2/ treated soil. The availability of /sup 109/Cd to male and female rats was then determined by feeding semisynthetic diets containing either freeze-dried radioactive spinach, lettuce, soybean, carrots, tomatoes, or wheat flour, or comparable nonradioactive plant powders spiked with /sup 109/CdCl/sup 2/. Retention of /sup 109/Cd by liver and kidney was determined after a 14-day feeding period. With the exception of spinach, Cd accumulation by rats was not found to be significantly influenced by the form of Cd in the diet whether supplied as plant-bound /sup 109/Cd or added to nonradioactive diets as /sup 109/CdCl/sup 2/. The mean retention of Cd in liver and kidney was 0.17% of the dose consumed for males and 0.26% for females consuming diets containing wheat, soybean, carrots, lettuce, or tomatoes.

Buhler, D.R.; Tinsley, I.J.



Dynamics of some parameters of the endocrine and lymphatic systems in rats during cold adaptation  

Science Conference Proceedings (OSTI)

This paper examines the combined behavior of the endocrine and lymphatic systems in rats at stages of long-term adaptation of the animals to moderate cold. After decapitation of male Wister rats, the corticosterone concentration in the blood plasma was determined by saturation analysis and serum levels of thyroxine (T/sub 4/) and triiodothyronine (T/sub 3/) were determined by radioimmunoassay. The thymus was weighed and the structure of the popliteal lymph nodes (LN) was studied in histological sections stained with hematoxylin and eosin and with azure II-eosin. Morphometry of the structural components of LN was undertaken and the numbers of the various cell forms per 1000 cells were counted in different zones of LN. The increase in activity of the lymphoid tissue in the phase of adaptation may be connected with intensification of the peripheral action of thyroid hormones. During long-term adaptation, in the phase of consistently increased specific resistance, a new type of endocrine-lymphoid relation is formed, and it differs significantly both in the original state and in the acute phase of stress.

Borodin, Yu.I.; Sedova, L.A.; Selyatitskaya, V.G.; Shorin, Yu.P.



Absorption of zinc and iron by rats fed meals containing sorghum food products  

Science Conference Proceedings (OSTI)

Zinc and iron absorption from freeze-dried traditionally-prepared sorghum food products was studied in rats. After a period of marginal zinc or iron depletion, rats were fed test meals containing 1 of 4 sorghum foods cooked maize gruel or an inorganic mineral each of which was extrinsically labeled with either /sup 65/Zn or /sup 59/Fe before being added to the diets. Absorption was determined by whole body percent retention of the initial radioisotope dose over a period of 19 days. Iron was highly available from all products tested (75-83%) with no significant differences in absorption among groups (p>0.05). Zinc from fermented Aceta (97%) was more available than that from the other sorghum products (69-78%) or maize gruel (76%). Zinc from acid To (78%) and Aceta (97%) was as available as that from zinc oxide in the control diet (93%) (p>0.05). There were no significant differences in zinc absorption among groups fed Acid To (78%), neutral To (76), alkali To (69%) or maize gruel (76%) (psorghum foods. Iron and zinc were highly available from all sorghum foods. Reduction phytate by fermentation increased Zn availability.

Stuart, S.M.A.; Johnson, P.E.; Hamaker, B.; Kirleis, A.



Angiotensin II induces secretion of plasminogen activator inhibitor 1 and a tissue metalloprotease inhibitor-related protein from rat brain astrocytes  

SciTech Connect

The present study investigates angiotensin (Ang) II effects on secretory protein synthesis in brain astrocytes cultured from neonatal and 21-day-old rats. Ang II-induced changes in the de novo synthesis of (35S)methionine-labeled secretory proteins were visualized using two-dimensional NaDodSO4/PAGE. Astrocytes from 21-day-old rat brain possess specific high-affinity receptors for Ang II. These cells express two Ang II-induced secretory proteins with Mr 55,000 (AISP-55K) and Mr 30,000 (AISP-30K), which were time- and dose-dependent (EC50, 1 nM). (Sar1, Ile8)Ang II (where Sar is sarcosine) inhibited Ang II-induced secretion of AISP-55K but not AISP-30K. N-terminal amino acid sequencing indicates that AISP-55K is identical to rat plasminogen activator inhibitor 1, whereas AISP-30K exhibits 72-81% identity to three closely related proteins: human tissue inhibitor of metalloproteases, a rat phorbol ester-induced protein, and the murine growth-responsive protein 16C8. Immunofluorescent staining with rat plasminogen activator inhibitor 1 antibody was induced in the majority of cells in culture after Ang II treatment of astrocytes from 21-day-old rat brains. Absence of this response to Ang II in astrocytes from neonatal rat brain provides evidence that this action of Ang II on astrocytes is developmentally regulated.

Olson, J.A. Jr.; Shiverick, K.T.; Ogilvie, S.; Buhi, W.C.; Raizada, M.K. (Univ. of Florida College of Medicine, Gainesville (USA))



PhyloChip microarray analysis reveals altered gastrointestinal microbial communities in a rat model of colonic hypersensitivity  

Science Conference Proceedings (OSTI)

Irritable bowel syndrome (IBS) is a chronic, episodic gastrointestinal disorder that is prevalent in a significant fraction of western human populations; and changes in the microbiota of the large bowel have been implicated in the pathology of the disease. Using a novel comprehensive, high-density DNA microarray (PhyloChip) we performed a phylogenetic analysis of the microbial community of the large bowel in a rat model in which intracolonic acetic acid in neonates was used to induce long lasting colonic hypersensitivity and decreased stool water content and frequency, representing the equivalent of human constipation-predominant IBS. Our results revealed a significantly increased compositional difference in the microbial communities in rats with neonatal irritation as compared with controls. Even more striking was the dramatic change in the ratio of Firmicutes relative to Bacteroidetes, where neonatally irritated rats were enriched more with Bacteroidetes and also contained a different composition of species within this phylum. Our study also revealed differences at the level of bacterial families and species. The PhyloChip is a useful and convenient method to study enteric microflora. Further, this rat model system may be a useful experimental platform to study the causes and consequences of changes in microbial community composition associated with IBS.

Nelson, T.A.; Holmes, S.; Alekseyenko, A.V.; Shenoy, M.; DeSantis, T.; Wu, C.H.; Andersen, G.L.; Winston, J.; Sonnenburg, J.; Pasricha, P.J.; Spormann, A.


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Detecting Radiation-Induced Injury Using Rapid 3D Variogram Analysis of CT Images of Rat Lungs  

SciTech Connect

A new heterogeneity analysis approach to discern radiation-induced lung damage was tested on CT images of irradiated rats. The method, combining octree decomposition with variogram analysis, demonstrated a significant correlation with radiation exposure levels, whereas conventional measurements and pulmonary function tests did not. The results suggest the new approach may be highly sensitive for assessing even subtle radiation-induced changes

Jacob, Rick E.; Murphy, Mark K.; Creim, Jeffrey A.; Carson, James P.




E-Print Network (OSTI)

Abstract Aim: Chronic ethanol treatment induces an increase in oxidative stress. As polyphenolic compounds are potent antioxidants, we aimed to examine whether dietary supplementation of resveratrol may attenuate lipid peroxidation, the major end-point of oxidative damage resulting from chronic ethanol administration. Method: Three groups of male Wistar rats were used. The first group served as control and received a daily intraperitoneal injection of 0.9 % saline. The second group of rats was daily injected with 35% ethanol at 3 g/kg body weight. The third group was given the same dose of ethanol and supplemented with resveratrol (5 g/kg) in the standard diet. Malondialdehyde (MDA), an indicator of oxidative stress, was measured in the liver, heart, brain, and testis. Results: At the end of a 6 weeks treatment period, MDA levels were significantly increased by 51.5, 53.7, 72.7, and 40.5 % in the liver, heart, brain, and testis, respectively. However, when ethanol treated rats were given resveratrol the increase in MDA levels was significantly reduced in all organs to nearly those of control rats. Conclusion: Resveratrol is able to inhibit the ethanol-induced lipid peroxidation and have protective effect against oxidative injury.

A. Kasdallah-grissa; B. Mornagui; E. Aouani; M. Hammami; N. Gharbi; A. Kamoun; S. El-fazaa



Metabolism of selenium (Se) in rats chronically poisoned with D- or L-selenomethionine (SeMet), selenite or selenate  

SciTech Connect

L-SeMet is a potential cancer chemoprevention agent for humans. Little difference was seen in the acute toxicity of L vs. D-SeMet in rats. To study chronic toxicity, weanling male rats were fed purified diets containing 2.5, 5.0 or 10 ppm Se as L-SeMet, D-SeMet, Na/sub 2/SeO/sub 3/ or Na/sub 2/SeO/sub 4/ for 6 weeks. Controls received 0.1 ppm Se as selenite. All rats fed 10 ppm Se died within 29 days. Se fed as D-SeMet was retained in the tissues as strongly as L-SeMet. Rats fed D or L-SeMet deposited large amounts of Se in muscle not reflected by proportionate increases in either plasma or RBC Se. Therefore, attempts to follow increases in Se body burden in individuals supplemented with large doses of L-SeMet by monitoring plasma or whole blood Se levels should be interpreted with caution.

McAdam, P.A.; Levander, O.A.



Cross-talk between the calcium-sensing receptor and the epidermal growth factor receptor in Rat-1 fibroblasts  

Science Conference Proceedings (OSTI)

The calcium-sensing receptor (CaR) is a G-protein coupled receptor that is activated by extracellular calcium (Ca2+o). Rat-1 fibroblasts have been shown to proliferate and increase ERK activity in response to elevation of [Ca2+]o, and these responses are dependent on functional CaR expression. In this report, we examined the role of cross-talk between the CaR and the epidermal growth factor receptor (EGFR) in mediating these responses in Rat-1 cells. This report shows that AG1478, a specific inhibitor of the EGFR kinase, significantly inhibits the increase in proliferation induced by elevated Ca2+o. Further, we show that AG1478 acts downstream or separately from G-protein subunit activation of phospholipase C. AG1478 significantly inhibits Ca2+o-stimulated ERK phosphorylation and in vitro kinase activity. A similar inhibition of ERK phosphorylation was observed in response to the inhibitor AG494. In addition, treatment with inhibitors of metalloproteases involved in shedding of membrane anchored EGF family ligands substantially inhibited the increase in ERK activation in response to elevated Ca2+o. This is consistent with the known expression of TGFa by Rat-1 cells. These results indicate that EGFR transactivation is an important component of the CaR mediated response to increased Ca2+o in Rat-1 fibroblasts, and most likely involves CaR-mediated induction of regulated proteolysis and ligand shedding.

Tomlins, Scott A.; Bollinger, Nikki; Creim, Jeffrey A.; Rodland, Karin D.



Effects of head-up tilt on mean arterial pressure, heart rate, and regional cardiac output distribution in aging rats  

E-Print Network (OSTI)

Many senescent individuals demonstrate an inability to regulate mean arterial pressure (MAP) in response to standing or head-up tilt; however, whether this aging effect is the result of depressed cardiac function or an inability to reduce peripheral vascular conductance remains unknown. Therefore, the purpose of this research was to investigate the effects of aging on MAP, heart rate (HR), regional blood flow (via radioactive-microspheres), and vascular conductance during head-up tilt in conscious young (4 mo; n=12) and old (24 mo; n=10) male Fischer-344 rats. Heart rate and MAP were measured continuously during normal posture and during 10 minutes of head-up tilt. Blood flow was determined during normal posture and at the end of 10 minutes of head-up tilt. Young rats increased MAP significantly at the onset of head-up tilt and generally maintained the increase in MAP for the duration of head-up tilt, while aged rats showed a significant reduction in MAP after 10 minutes of head-up tilt. In the normal posture, aged rats demonstrated lower blood flow to splanchnic, bone, renal, and skin tissues versus young rats. With tilt there were decreases in blood flow to skin, bone, and hind-limb in both age groups and in fat, splanchnic, reproductive, and renal tissues in the young. Bone blood flow was attenuated with age across both conditions in hind foot, distal femur, femur marrow, and proximal and distal tibia. Head-up tilt caused a decrease in blood flow across both age groups in all bones sampled with the exception of the hind foot. These results provide evidence that the initial maintenance of MAP in aged rats during head-up tilt occurs through decreased regional blood flow and vascular conductance, and that the fall in pressure is not attributable to an increase in tissue blood flow and vascular conductance. Therefore, reductions in arterial pressure during headup tilt are likely a result of an old age-induced reduction in cardiac performance. In addition, this is the first study to demonstrate a decreased bone vascular conductance in both young and old rats during head-up tilt.

Ramsey, Michael Wiechmann



Autoradiographic localization and characterization of atrial natriuretic peptide binding sites in the rat central nervous system and adrenal gland  

SciTech Connect

Atrial natriuretic peptides (ANP) have recently been identified in both heart and CNS. These peptides possess potent natriuretic, diuretic, and vasorelaxant activities, and are all apparently derived from a single prohormone. Specific ANP binding sites have been characterized in the adrenal zona glomerulosa and kidney cortex, and one study reported ANP binding sites in the CNS. However, a detailed examination of the localization of ANP binding sites throughout the brain has not been reported. In this study, quantitative autoradiography was employed to examine the distribution of ANP receptors in the rat CNS. The binding of (3-/sup 125/I-iodotyrosyl28) rat ANP-28 to binding sites in the rat CNS was saturable, specific for ANP-related peptides, and displayed high affinity (Kd = 600 pM). When the relative concentrations of ANP binding sites were determined throughout the rat brain, the highest levels of ANP binding were localized to the circumventricular organs, including the area postrema and subfornical organ, and the olfactory apparatus. Moderate levels of ANP binding sites were present throughout the midbrain and brain stem, while low levels were found in the forebrain, diencephalon, basal ganglia, cortex, and cerebellum. The presence of ANP binding sites in the subfornical organ and the area postrema, regions considered to be outside the blood-brain barrier, suggests that peripheral ANP levels may regulate some aspects of CNS control of salt and water balance. The possible functions of ANP binding sites in other regions of the rat brain are not known, but, like many other peptides, ANP may act as a neurotransmitter or neuromodulator at these loci.

Gibson, T.R.; Wildey, G.M.; Manaker, S.; Glembotski, C.C.



Expression of the Bcl-2 protein in nasal epithelia of F344/N rats during mucous cell metaplasia and remodeling  

E-Print Network (OSTI)

Exposure to ozone induces mucous cell metaplasia in rat airway epithelia. During the regeneration process, apoptotic mechanisms may be responsible for eliminating metaplastic cells. Therefore, the present study investigated expression of Bcl-2, a regulator of apoptosis, in ozone-induced mucous cell metaplasias. Adjacent metaplastic mucous cells in nasal airway epithelia that were exposed to ozone were heterogeneous in their expression of Bcl-2; some cells expressed high levels, whereas others expressed low levels or no Bcl-2. On Western blot analysis, Bcl-2 was detected in protein extracts from nasal epithelia of rats exposed to 0.5 ppm ozone for 1 mo but not in control rats exposed to filtered air. The number of metaplastic mucous cells in transitional epithelia of rat nasal airways was increased from 0 to about 200 after 3 and 6 mo of exposure to ozone; only 0 to 10 metaplastic mucous cells remained after a recovery period of 13 wk in rats exposed to ozone for 3 mo. The number of mucous cells of the respiratory epithelium lining the midseptum did not change after ozone exposure or recovery. The percentage of Bcl-2-positive cells lining the midseptum increased from 7 to 14 % after a 3- and 6-mo ozone exposure, respectively. In transitional epithelia of the lateral wall and the nasoturbinates and maxilloturbinates, 35 to 55 % of cells were Bcl-2-positive after a 1-mo exposure and 10 to 18 % after both a 3- and a 6-mo exposure to ozone. Bcl-2 reactivity decreased to 0 to 8 % after a recovery period of 13 wk. These observations suggest that Bcl-2 plays a role in

Johannes Tesfaigzi; Jon A. Hotchkiss; Jack R. Harkema



Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael




Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake



E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...

Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks



E-Print Network (OSTI)

In 1961, Dubos and Schaedler (1) reported a reduction in water intake in animals treated with bacterial endotoxin. Mice were raised in a pathogen-free environment and subsequently tested with one of several toxins. Alteration in daily water intake was found to occur at doses well below the LDs0. Because of the long-standing interest in this laboratory in drive states, their behavioral consequences, and physiological basis (2), this property of endotoxin was explored in the albino rat. Our animals were not raised in a pathogen-free environment. Using fairly large doses of toxin, we were able to confirm the findings of Dubos and Schaedler, and, in addition, demonstrate a profound toxin effect on food intake and body temperature. Using behavioral and physiological techniques, we made exploratory studies of resistance and sensitization to toxin and of its possible site of action. Materials and Methods Animals.--AU the animals were male Sprague-Dawley albino rats, 90 to 120 days old, weighing 300 gm or more. They were housed in individual wire cages in a temperature-controlled room, and were fed Purina lab chow and tap water. Water intakes were measured by making water bottles available for 30 minutes every day and weighing the bottles before and after consumption. After several "familiarization " days the rats would drink a fairly standard amount each day. Food intake was measured by weighing the food in the cages every 24 hours, the food being continuously available. Animals on food-intake measurement were given water ad lib and those on water-intake measurement were given food ad lib. Temperatures were taken with an ordinary rectal thermometer, lubricated and inserted almost its entire length. The animals showed no unusual distress and tolerated the procedure day after day. Thermometers were left in place 3 to 5 minutes and then read. Thermometem that dropped out were replaced for 3 additional minutes. A paper towel on the cage floor facilitated recovery of lost thermometers. Toxin.--A eommerdally prepared lipopolysaccharide extract of Eschericlda coli was used

E. Holmes; Neal; E. Miller, Ph.D.



Level of osteopenia and bone recovery in alcohol-fed adolescent rats  

E-Print Network (OSTI)

Adolescence is a period in human growth and development that is a time of rapid and drastic change. It is also known to be an age of widespread alcohol abuse. Studies addressing the reversibility of the deleterious effects of chronic alcohol consumption on young, actively growing adolescent bones have not been done. The objective of this study was to determine the level of bone recovery, if any, once an adolescent ceases alcohol consumption. Fifty, 4-week old, female, Sprague-Dawley rats were individually housed and maintained in an American Association for the Accreditation of Laboratory Animal Care-accredited facility at Texas A&M. The rats (n = 6 or 7 per group) were fed either alcohol (35% ethanol-derived calories), isocaloric liquid diet, or chow for 2 or 4 weeks, depending on the experimental group. The weekly blood alcohol concentrations averaged 309 [] 9 mg/dl. The rats were sacrificed 2 and 4 weeks after the experimental feeding began. The BioQuant Morphometric System was used to perform the histomorphometric analyses of the proximal tibia. Tibia bone volume per trabecular volume (BV/TV) in both age groups of alcohol and pair-fed animals was significantly less when compared to the chow 4 week animals. BV/TV was increased in the alcohol recovery group when compared to the alcohol 2 and 4 week groups, but the level of growth never reached the chow-fed 4 week group. Femur length, diameter and volume measurements increased in the alcohol recovery group when compared to both the alcohol 2 and 4 week groups. However, the length and volume parameters did not fully recover to equal those of the control chow 4 week animals, or even the some-age pair-fed animals. Femur diameter of the alcohol recovery animals was comparable to the alcohol 4 week animals, but less than the chow-fed. Alcohol also suppressed IGF-I levels. Full bone recovery did not occur within two weeks after removal of alcohol from the diet, suggesting the detrimental effects due to alcohol were not completely reversible during this time frame.

Spears, Heather Lynae



miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


Dietary Fats and Risk of Chronic DiseaseChapter 7 Dietary Conjugated Linolenic Acid Modifies Body Fat Mass, and Serum and Liver Lipid Levels in Rats  

Science Conference Proceedings (OSTI)

Dietary Fats and Risk of Chronic Disease Chapter 7 Dietary Conjugated Linolenic Acid Modifies Body Fat Mass, and Serum and Liver Lipid Levels in Rats Health Nutrition Biochemistry eChapters Health - Nutrition - Biochemistry Press ...


Dietary Fats and Risk of Chronic DiseaseChapter 17 Docosahexaenoic Acid Intake and Lipid peroxidation in Retinal Membranes of Rats  

Science Conference Proceedings (OSTI)

Dietary Fats and Risk of Chronic Disease Chapter 17 Docosahexaenoic Acid Intake and Lipid peroxidation in Retinal Membranes of Rats Health Nutrition Biochemistry eChapters Health - Nutrition - Biochemistry Press Download


Effects of 4-phenylbutyric acid on the process and development of diabetic nephropathy induced in rats by streptozotocin: Regulation of endoplasmic reticulum stress-oxidative activation  

Science Conference Proceedings (OSTI)

Oxidative stress may contribute to the pathogenesis of diabetic nephropathy (DN), although the precise regulatory mechanism is still unclear. Recent reports have shown that chemical molecular chaperone 4-phenylbutyric acid (4-PBA) can suppress oxidative stress by attenuating endoplasmic reticulum (ER) stress. We therefore hypothesized that 4-PBA could provide renoprotection through the suppression of oxidative stress in DN rats. Male Sprague-Dawley (SD) rats were randomly divided into three groups: a normal control (NC) group, a streptozotocin (STZ)-induced DN model group, and a DN plus 4-PBA (1 g/kg) treatment group. At the end of 4, 8, and 12 weeks, hydroxyproline content, NADPH oxidase activity and the expression of phosphorylation of inositol-requiring enzyme-1{alpha} (p-IRE1{alpha}), p47phox, nitrotyrosine (NT) and NF-E2-related factor 2 (Nrf2) in the kidneys of all rats were determined; malondialdehyde (MDA) levels and superoxide dismutase (SOD) activity in serum and urine were also detected; renal nuclear factor {kappa}B (NF-{kappa}B) activity in all of the rats was examined at the end of 12 weeks. Compared with the NC group, the DN rats showed a significant increase in hydroxyproline content, NADPH oxidase activity, NF-{kappa}B activity, the expression of p-IRE1{alpha}, p47phox, NT and Nrf2 in renal tissue; markedly, MDA levels were higher and SOD activity was lower in serum and urine of DN rats than in NC rats for the indicated time. These alterations were inhibited by the administration of 4-PBA. These findings first demonstrated that treatment with 4-PBA significantly inhibits the process and development of diabetic nephropathy in rats through the regulation of ER stress-oxidative activation.

Luo Zhifeng [Institute of Nephrology of Chongqing and Department of Nephrology, Xinqiao Hospital, Third Military Medical University, Chongqing 400037 (China); Feng Bing, E-mail: fxb12@yahoo.com.c [Institute of Nephrology of Chongqing and Department of Nephrology, Xinqiao Hospital, Third Military Medical University, Chongqing 400037 (China); Mu Jiao; Qi Wei; Zeng Wei; Guo Yanhong; Pang Qi; Ye Zilin; Liu Li; Yuan Fahuan [Institute of Nephrology of Chongqing and Department of Nephrology, Xinqiao Hospital, Third Military Medical University, Chongqing 400037 (China)



Losartan attenuates chronic cigarette smoke exposure-induced pulmonary arterial hypertension in rats: Possible involvement of angiotensin-converting enzyme-2  

Science Conference Proceedings (OSTI)

Chronic cigarette smoking induces pulmonary arterial hypertension (PAH) by largely unknown mechanisms. Renin-angiotensin system (RAS) is known to function in the development of PAH. Losartan, a specific angiotensin II receptor antagonist, is a well-known antihypertensive drug with a potential role in regulating angiotensin-converting enzyme-2 (ACE2), a recently found regulator of RAS. To determine the effect of losartan on smoke-induced PAH and its possible mechanism, rats were daily exposed to cigarette smoke for 6 months in the absence and in the presence of losartan. Elevated right ventricular systolic pressure (RVSP), thickened wall of pulmonary arteries with apparent medial hypertrophy along with increased angiotensin II (Ang II) and decreased ACE2 levels were observed in smoke-exposed-only rats. Losartan administration ameliorated pulmonary vascular remodeling, inhibited the smoke-induced RVSP and Ang II elevation and partially reversed the ACE2 decrease in rat lungs. In cultured primary pulmonary artery smooth muscle cells (PASMCs) from 3- and 6-month smoke-exposed rats, ACE2 levels were significantly lower than in those from the control rats. Moreover, PASMCs from 6-month exposed rats proliferated more rapidly than those from 3-month exposed or control rats, and cells grew even more rapidly in the presence of DX600, an ACE2 inhibitor. Consistent with the in vivo study, in vitro losartan pretreatment also inhibited cigarette smoke extract (CSE)-induced cell proliferation and ACE2 reduction in rat PASMCs. The results suggest that losartan may be therapeutically useful in the chronic smoking-induced pulmonary vascular remodeling and PAH and ACE2 may be involved as part of its mechanism. Our study might provide insight into the development of new therapeutic interventions for PAH smokers.

Han Suxia; He Guangming; Wang Tao; Chen Lei; Ning Yunye; Luo Feng; An Jin; Yang Ting; Dong Jiajia; Liao Zenglin; Xu Dan [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, and Department of Respiratory Medicine, West China Hospital of Sichuan University, Chengdu, Sichuan 610041 (China); Wen Fuqiang, E-mail: wenfuqiang.scu@gmail.co [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, and Department of Respiratory Medicine, West China Hospital of Sichuan University, Chengdu, Sichuan 610041 (China)



Autoradiographic localization of atrial natriuretic peptide receptor subtypes in rat kidney  

SciTech Connect

The distribution of atrial natriuretic peptide (ANP) clearance receptors in rat kidney was investigated by in vitro autoradiography using des(Gln18,Ser19,Gly20,Leu21,Gly22)-ANP-(4- 23) (C-ANP) and 125I-Tyr0-ANP-(5-25) as relatively specific ligands of this receptor. Alpha-125I-ANP (100 pM) bound reversibly but with high affinity to glomeruli, outer medullary vasa recta bundles, and inner medulla. C-ANP (10 microM) inhibited greater than 60% of this glomerular binding but did not inhibit the binding of alpha-125I-ANP to medullary tissues. Alpha-125I-ANP also bound reversibly to the renal arteries up to the glomerulus. This arterial binding was only partly inhibited by 10 microM C-ANP. In the presence of 10 microM C-ANP, increasing concentrations of alpha-125I-ANP bound to a residue of glomerular sites with apparent dissociation constants of 0.82 +/- 0.16 to 2.73 +/- 1.20 nM at different cortical levels. 125I-Tyr0-ANP-(5-25) bound significantly to glomeruli and intrarenal arteries but not to vasa recta bundles or inner medulla. This glomerular binding also occurred with nanomolar dissociation constants. It was completely inhibited by 1 microM alpha-ANP and 10 microM C-ANP, but not by unrelated peptides such as gastrin. These results suggest that renal ANP clearance receptors are restricted in vivo to the glomeruli and renal arterial system of the rat.

Brown, J.; Salas, S.P.; Singleton, A.; Polak, J.M. (Univ. of Cambridge (England))



Arecoline augments cellular proliferation in the prostate gland of male Wistar rats  

Science Conference Proceedings (OSTI)

Areca nut chewing is the fourth most popular habit in the world due to its effects as a mild stimulant, causing a feeling of euphoria and slightly heightened alertness. Areca nuts contain several alkaloids and tannins, of which arecoline is the most abundant and known to have several adverse effects in humans, specially an increased risk of oral cancer. On evaluating the effects of arecoline on the male endocrine physiology in Wistar rats, it was found that arecoline treatment led to an overall enlargement and increase in the wet weight of the prostate gland, and a two-fold increase in serum gonadotropin and testosterone levels. Since the prostate is a major target for testosterone, the consequences of arecoline consumption were studied specifically in the prostate gland. Arecoline treatment led to an increase in the number of rough endoplasmic reticulum and reduction of secretory vesicles, signifying a hyperactive state of the prostate. Increased expression of androgen receptors in response to arecoline allowed for enhanced effect of testosterone in the prostate of treated animals, which augmented cell proliferation, subsequently confirmed by an increase in the expression of Ki-67 protein. Cellular proliferation was also the outcome of concomitant over expression of the G{sub 1}-to-S cell cycle regulatory proteins, cyclin D1 and CDK4, both at the transcriptional and translational levels. Taken together, the findings provide the first evidence that regular use of arecoline may lead to prostatic hyperplasia and hypertrophy, and eventually to disorders associated with prostate enlargement. - Highlights: > Effect of arecoline was investigated on the endocrine physiology of male Wistar rats. > Increase observed in prostate size, wet weight, serum testosterone and gonadotropins. > Arecoline increased RER, expression of androgen receptor and cellular proliferation. > Upregulation of cyclin D1 and CDK4 seen at transcriptional and translational levels. > It may cause disorders associated with prostatic hyperplasia and hyperactivity.

Saha, Indraneel; Chatterjee, Aniruddha; Mondal, Anushree; Maiti, Bishwa Ranjan; Chatterji, Urmi, E-mail: urmichatterji@gmail.com



Effect of the NMDA receptor antagonist MK-801 on recovery from spinal cord injury in rats given uncontrollable stimulation  

E-Print Network (OSTI)

The eventual outcome of spinal cord injury is largely influenced by damage that occurs after the injury. Damaged connections between spinal cord cells and the brain allow a positive feedback mechanism to go unchecked when activated by ascending pain messages. Over-excitation then causes secondary damage. This study examines whether a pharmacological manipulation that should attenuate over-excitation reduces the adverse effects of shock treatment. Rats received spinal impact injuries and, the next day, were given the NMDA receptor antagonist MK-801 (0.08 mg/kg, i.p.) or its vehicle before receiving either a bout of uncontrollable stimulation or identical treatment without the stimulation itself. Their hindlimb motor activity was monitored for 21 days. Results indicate a significant effect of the drug on rats that received uncontrollable stimulation. The study has clinical implications for the treatment of spinal cord injuries in humans.

Petrich, Christine



Metabolic Rate Constants for Hydroquinone in F344 Rat and Human Liver Isolated Hepatocytes: Application to a PBPK model.  

SciTech Connect

Hydroquinone (HQ) is an important industrial chemical that also occurs naturally in foods and in the leaves and bark of a number of plant species. Exposure of laboratory animals to HQ may result in a species-, sex-, and strain-specific nephrotoxicity. The sensitivity of male F344 vs. female F344 and Sprague-Dawley rats or B6C3F1 mice appears to be related to differences in the rates of formation and further metabolism of key nephrotoxic metabolites. Metabolic rate constants for the conversion of HQ through several metabolic steps to the mono-glutathione conjugate and subsequent detoxification via mercapturic acid were measured in suspension cultures of hepatocytes isolated from male F344 rats and humans. An in vitro mathematic kinetic model was used to analyze each metabolic step by simultaneously fitting the disappearance of each substrate and the appearance of subsequent metabolites. An iterative, nested approach was used whereby downstream metabolites were considered first and the model was constrained by the requirement that rate constants determined during analysis of individual metabolic steps must also satisfy the complete, integrated metabolism scheme, including competitive pathways. The results from this study indicated that the overall capacity for metabolism of HQ and its mono-glutathione conjugate is greater in hepatocytes from humans than those isolated from rats, suggesting a greater capacity for detoxification of the glutathione conjugates. Metabolic rate constants were applied to an existing physiologically based pharmacokinetic model and the model was used to predict total glutathione metabolites produced in the liver. The results showed that body burdens of these metabolites will be much higher in rats than humans.

Poet, Torka S.; Wu, Hong; English, J C.; Corley, Rick A.



Novel function of glutathione transferase in rat liver mitochondrial membrane: Role for cytochrome c release from mitochondria  

Science Conference Proceedings (OSTI)

Microsomal glutathione transferase (MGST1) is activated by oxidative stress. Although MGST1 is found in mitochondrial membranes (mtMGST1), there is no information about the oxidative activation of mtMGST1. In the present study, we aimed to determine whether mtMGST1 also undergoes activation and about its function. When rats were treated with galactosamine/lipopolysaccharide (GalN/LPS), mtMGST1 activity was significantly increased, and the increased activity was reduced by the disulfide reducing agent dithiothreitol. In mitochondria from GalN/LPS-treated rats, disulfide-linked mtMGST1 dimer and mixed protein glutathione disulfides (glutathionylation) were detected. In addition, cytochrome c release from mitochondria isolated from GalN/LPS-treated rats was observed, and the release was inhibited by anti-MGST1 antibodies. Incubation of mitochondria from control rats with diamide and diamide plus GSH in vitro resulted in dimer- and mixed disulfide bond-mediated activation of mtMGST1, respectively. The activation of mtMGST1 by diamide plus GSH caused cytochrome c release from the mitochondria, and the release was prevented by treatment with anti-MGST1 antibodies. In addition, diamide plus GSH treatment caused mitochondrial swelling accompanied by cytochrome c release, which was inhibited by cyclosporin A (CsA) and bongkrekic acid (BKA), inhibitors of the mitochondrial permeability transition (MPT) pore. Furthermore, mtMGST1 activity was also inhibited by CsA and BKA. These results indicate that mtMGST1 is activated through mixed disulfide bond formation that contributes to cytochrome c release from mitochondria through the MPT pore.

Lee, Kang Kwang; Shimoji, Manami; Hossain, Quazi Sohel [Laboratory of Molecular Genetics and Pharmacology, School of Health Sciences, Faculty of Medicine, University of the Ryukyus, 207 Uehara, Nishihara, Okinawa 903-0215 (Japan); Sunakawa, Hajime [Department of Oral and Maxillofacial Functional Rehabilitation, Faculty of Medicine, University of the Ryukyus, 207 Uehara, Nishihara, Okinawa 903-0215 (Japan); Aniya, Yoko [Laboratory of Molecular Genetics and Pharmacology, School of Health Sciences, Faculty of Medicine, University of the Ryukyus, 207 Uehara, Nishihara, Okinawa 903-0215 (Japan)], E-mail: yaniya@med.u-ryukyu.ac.jp



Effect of Hypericum perforatum CO2 extract on the motivational properties of ethanol in alcohol-preferring rats  

E-Print Network (OSTI)

Abstract Aims: Extracts of Hypericum perforatum (HPE) attenuate voluntary ethanol intake in different lines of alcohol-preferring rats. The present study evaluated the effect of the intragastric (IG) administration of a CO 2 Hypericum perforatum extract (HPCO 2) on operant ethanol self-administration, as well as on voluntary ethanol intake, after a period of ethanol deprivation in genetically selected Marchigian Sardinian alcohol-preferring rats. Methods: HPCO 2 was administered by means of an indwelling IG catheter, 1 h before the tests. For the self-administration experiments, the rats were trained to self-administer 10 % (v/v) ethanol in 30-min daily sessions under a fixed ratio 1 schedule of reinforcement. HPCO 2 was also tested on 0.2 % w/v saccharin self-administration. For the ethanol deprivation experiments, rats that had a previous experience with voluntary ethanol drinking were deprived of ethanol for 9 days, whereas water and food were freely available; HPCO 2 was given by IG injection 1 h before the ethanol re-presentation. Results: HPCO 2 in doses of 31 or 125 mg/kg but not 7 mg/kg, significantly reduced ethanol self-administration, while it did not modify saccharin self-administration. The same doses of the extract abolished the increased ethanol intake following ethanol deprivation. Conclusions: These findings provide evidence that HPCO 2 markedly reduces the reinforcing properties of ethanol in the selfadministration paradigm, as well as the increase of ethanol intake following ethanol deprivation. These findings further support the view that the use of HPE may represent an interesting pharmacological approach in the treatment of alcohol abuse and alcoholism.

Marina Perfumi; Laura Mattioli; Laura Forti; Maurizio Massi; Roberto Ciccocioppo



Cross-talk between the calcium-sensing receptor and the epidermal growth factor receptor in Rat-1 fibroblasts  

Science Conference Proceedings (OSTI)

The calcium-sensing receptor (CaR) is a G-protein-coupled receptor that is activated by extracellular calcium (Ca {sub o} {sup 2+}). Rat-1 fibroblasts have been shown to proliferate and increase ERK activity in response to elevation of [Ca{sup 2+}] {sub o}, and these responses are dependent on functional CaR expression. In this report, we examined the role of cross-talk between the CaR and the epidermal growth factor receptor (EGFR) in mediating these responses in Rat-1 cells. This report shows that AG1478, a specific inhibitor of the EGFR kinase, significantly inhibits the increase in proliferation induced by elevated Ca {sub o} {sup 2+}. Furthermore, we show that AG1478 acts downstream or separately from G protein subunit activation of phospholipase C. AG1478 significantly inhibits Ca {sub o} {sup 2+}-stimulated ERK phosphorylation and in vitro kinase activity. A similar inhibition of ERK phosphorylation was observed in response to the inhibitor AG494. In addition, treatment with inhibitors of metalloproteases involved in shedding of membrane anchored EGF family ligands substantially inhibited the increase in ERK activation in response to elevated Ca {sub o} {sup 2+}. This is consistent with the known expression of TGF{alpha} by Rat-1 cells. These results indicate that EGFR transactivation is an important component of the CaR-mediated response to increased Ca {sub o} {sup 2+} in Rat-1 fibroblasts and most likely involves CaR-mediated induction of regulated proteolysis and ligand shedding.

Tomlins, Scott A. [University of Michigan Medical School, Ann Arbor, MI 48109 (United States); Bolllinger, Nikki [Biological Sciences Division, Battelle for the US DOE, PO Box 999, 790 Sixth Street, Richland, WA 99352 (United States); Creim, Jeffrey [Biological Sciences Division, Battelle for the US DOE, PO Box 999, 790 Sixth Street, Richland, WA 99352 (United States); Rodland, Karin D. [Biological Sciences Division, Battelle for the US DOE, PO Box 999, 790 Sixth Street, Richland, WA 99352 (United States)]. E-mail: Karin.rodland@pnl.gov



Major carcinogenic pathways identified by gene expression analysis of peritoneal mesotheliomas following chemical treatment in F344 rats  

SciTech Connect

This study was performed to characterize the gene expression profile and to identify the major carcinogenic pathways involved in rat peritoneal mesothelioma (RPM) formation following treatment of Fischer 344 rats with o-nitrotoluene (o-NT) or bromochloracetic acid (BCA). Oligo arrays, with over 20,000 target genes, were used to evaluate o-NT- and BCA-induced RPMs, when compared to a non-transformed mesothelial cell line (Fred-PE). Analysis using Ingenuity Pathway Analysis software revealed 169 cancer-related genes that were categorized into binding activity, growth and proliferation, cell cycle progression, apoptosis, and invasion and metastasis. The microarray data were validated by positive correlation with quantitative real-time RT-PCR on 16 selected genes including igf1, tgfb3 and nov. Important carcinogenic pathways involved in RPM formation included insulin-like growth factor 1 (IGF-1), p38 MAPkinase, Wnt/{beta}-catenin and integrin signaling pathways. This study demonstrated that mesotheliomas in rats exposed to o-NT- and BCA were similar to mesotheliomas in humans, at least at the cellular and molecular level.

Kim, Yongbaek [Environmental Toxicology Program, National Institute of Environmental Health Sciences, MD B3-08, 111 Alexander Drive, Research Triangle Park, NC 27709 (United States); Thai-Vu Ton [Environmental Toxicology Program, National Institute of Environmental Health Sciences, MD B3-08, 111 Alexander Drive, Research Triangle Park, NC 27709 (United States); De Angelo, Anthony B. [Environmental Protection Agency, Research Triangle Park, NC 27709 (United States); Morgan, Kevin [Aventis, Bridgewater, NJ 08807 (United States); Devereux, Theodora R. [Environmental Carcinogenesis Program, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States); Anna, Colleen [Environmental Carcinogenesis Program, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States); Collins, Jennifer B. [Microarray Group, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States); Paules, Richard S. [Microarray Group, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States); Crosby, Lynn M. [Wyeth Research, Chazy, NY 12921 (United States); Sills, Robert C. [Environmental Toxicology Program, National Institute of Environmental Health Sciences, MD B3-08, 111 Alexander Drive, Research Triangle Park, NC 27709 (United States)]. E-mail: sills@niehs.nih.gov



Atrial natriuretic peptide (ANP) increases urinary albumin excretion (UAE) in intact and uninephrectomized (UNX) rats  

SciTech Connect

Previous experimental observations have suggested that ANP increases the transcapillary shift of water and albumin. The present studies were conducted in anesthetized euvolemic rats 6 weeks after UNX or sham operation. The effect of iv infusion of 103-126 hANP was assessed on GFR and ERPF ({sup 99}Tc.DTPA and {sup 131}I-hippuran clearances), and UAE (nephelemetric method). ANP infusion was associated with no change in mean arterial pressure during the low dose (LD) and a 30 mm Hg decrease during the high dose (HD). ANP induced a dose-dependent and reversible increase in UNaV. Both proximal (as assessed by lithium excretion) and distal reabsorption of sodium were decreased by ANP. GFR was altered whereas ERPF decreased only during HD-AMP; filtration fraction (FF) dose-dependently increased in response to ANP. UAE increased dose-dependently and to a similar extent in both groups in response to ANP. The increase in UAE was readily reversible after discontinuation of ANP. There was a positive correlation between changes in UAE and changes in FF induced by ANP. These results indicate that ANP has a potent albuminuric effect. The simultaneous increase in UAE and FF, which could explain the effect of ANP on proximal tubular handling of sodium, may result from an ANP-induced rise in intraglomerular capillary pressure and/or an increase in glomerular permeability to albumin.

Valentin, J.P.; Ribstein, J.; Mimran, A. (CHU, Montpellier (France))



Gene Expression of ANP, BNP and ET-1 in the Heart of Rats during Pulmonary Embolism  

E-Print Network (OSTI)

Aims: Atrial natriuretic petide (ANP), brain natriuretic peptide (BNP) and endothelin-1 (ET-1) may reflect the severity of right ventricular dysfunction (RVD) in patients with pulmonary embolism (PE). The exact nature and source of BNP, ANP and ET-1 expression and secretion following PE has not previously been studied. Methods and Results: Polystyrene microparticles were injected to induce PE in rats. Gene expression of BNP, ANP and ET-1 were determined in the 4 cardiac chambers by quantitative real time polymerase chain reaction (QPCR). Plasma levels of ANP, BNP, ET-1 and cardiac troponin I (TNI) were measured in plasma. PE dose-dependently increased gene expression of ANP and BNP in the right ventricle (RV) and increased gene expression of ANP in the right atrium (RA). In contrast PE dosedependently decreased BNP gene expression in both the left ventricle (LV) and the left atrium (LA). Plasma levels of BNP, TNI and ET-1 levels dose-dependently increased with the degree of PE. Conclusion: We found a close correlation between PE degree and gene-expression of ANP, and BNP in the cardiac chambers with a selective increase in the right chambers of the heart. The present data supports the idea of natriuretic peptides as

Henrik Gutte; Jytte Oxbl; Ulrik Sloth Kristoffersen; Jann Mortensen; Andreas Kjr



Phytic acid plus calcium, but not phytic acid alone, decreases fluoride bioavailability in the rat  

Science Conference Proceedings (OSTI)

Results of in vitro studies have suggested that fluoride becomes insoluble when some soy-based infant formulas are diluted with fluoridated water because of the presence of phytate, added calcium or a combination of these factors. The present study was designed to test this hypothesis in vivo. Male albino rats were fed a purified diet containing phytic acid, calcium and fluoride for 4 weeks in a factorial design of treatments. Phytic acid was added to the diet by chemically reacting a phytic acid concentrate with casein prior to diet preparation to mimic a soy-protein. Food intake, weight gain and femur P were unaffected by dietary treatments. Both phytic acid and supplemental calcium alone had little or no effect upon fluoride uptake into either bone or teeth. The combination of phytic acid plus supplemental calcium, however, significantly increased % of fluoride intake found in the feces which was reflected in a significant decrease in fluoride concentration of femur, 2nd molar teeth and vertebrate bone. These results provide evidence that insoluble complex formation produced by a calcium and phytate interaction can explain reduced fluoride solubility in some soy-based infant formulas as well as decreased fluoride absorbability in vivo.

Cerklewski, F.L. (Oregon State Univ., Corvallis (United States))



Intrarenal renin-angiotensin system modulates glomerular angiotensin receptors in the rat  

SciTech Connect

The aim of this study was to test the hypothesis that the intrarenal renin-angiotensin system (RAS) modulates glomerular angiotensin II (ANG II) receptors. In one protocol ANG II receptors were measured 7 days after unilateral denervation of the left kidney in rats. There were 50% more receptors in the glomeruli from denervated compared with innervated kidneys, which was associated with a 63% reduction in left renal vein renin. The differences in ANG II receptors between the left and right kidneys were not longer present when angiotensin-converting enzyme was inhibited with enalapril or when pharmacological amounts of ANG II were infused. In a second protocol, renal cortical renin content was raised in the left kidney by placing a 0.20-mm clip on the left renal artery. At 7 days, glomerular ANG II receptors were reduced by 72.3% in the clipped compared with the contralateral kidneys. The differences in ANG II receptors were no longer present after enalapril treatment. Pharmacological maneuvers that either blocked ANG II formation or increased circulating ANG II resulted in an equal number of ANG II receptors in the right and left kidneys. The data indicate that the intrarenal RAS modulates the density of glomerular ANG II receptors and is a more important receptor modulation than plasma ANG II.

Wilkes, B.M.; Pion, I.; Sollott, S.; Michaels, S.; Kiesel, G. (North Shore Univ. Hospital and Cornell Univ. Medical College, Manhasset, NY (USA))



Evidence for extracellular, but not intracellular, generation of angiotensin II in the rat adrenal zona glomerulosa  

SciTech Connect

Based on the observation that high levels of renin and angiotensin II (Ang II) are found in the adrenal zona glomerulosa (ZG), it has been postulated that Ang II is formed intracellularly by the renin-converting enzyme cascade in this tissue. To test this hypothesis, the authors examined renin-angiotensin system components in subcellular fractions of the rat adrenal ZG. Renin activity and immunoreactive-Ang II (IR-Ang II) were observed in vesicular fractions but were not colocalized. In addition, angiotensinogen, angiotensin I, and converting enzyme were not observed in the renin or IR-Ang II-containing vesicular fractions. These data do not support the hypothesis that Ang II is formed intracellularly within the renin-containing vesicles of the ZG. Rather, since modulatable renin release from adrenal ZG slices was observed and renin activity was found in dense vesicular fractions (33-39% sucrose), it is likely that Ang II formation in the ZG is extracellular and initiated by the release of vesicular renin. In ZG lysomal fractions {sup 125}I-labeled Ang II was degraded to {sup 125}I-labeled des-(Phe{sup 8})Ang II. Since Ang II antibodies do not recognize des-(Phe{sup 8})Ang II, these finding explain why IR-Ang II in the ZG is due predominantly to Ang II and not to its C-terminal immunoreactive fragments.

Urata, H.; Khosla, M.C.; Bumpus, M.; Husain, A. (Research Institute of the Cleveland Clinic Foundation, OH (USA))



Piezoelectric Drop-on-Demand Inkjet Printing of Rat Fibroblast Cells: Survivability Study and Pattern Printing  

E-Print Network (OSTI)

A novel piezoelectric, drop-on-demand (DOD) inkjet system has been developed and used to print L929 rat fibroblast cells. We investigate the survivability of the cells subjected to the large stresses during the printing process. These stresses are varied by changing the diameter of the orifice (36 to 119 microns) through which the cells are dispensed, as well as changing the electrical pulse used to drive the piezoelectric element. It is shown that for the smallest 36 microns diameter orifice, cell survival rates fall from 95% to approximately 76% when the ejection velocity is increased from 2 to 16 m/s. This decrease in survival rates is less significant when the larger orifice diameters of 81 microns and 119 microns are used. Analysis shows that there is a clear inverse relationship between cell survival rates and the mean shear rates during drop formation. By using the same printing set-up, fibroblast cells are printed onto alginate and collagen into patterns. Printed cells are cultured over a period of da...

Li, Er Qiang; Thoroddsen, Sigurdur Tryggvi



Influence of copper and iron on subacute cadmium intoxication in protein-malnourished rats  

Science Conference Proceedings (OSTI)

Male albino rats maintained on low-protein (9%) diets were dosed intraperitoneally with 0.75 mg Cd/kg, as cadmium chloride, for 20 days. Groups of these animals were provided with diets supplemented with 40 ppm Cu, 400 ppm Fe or a combination of both during the exposure period. Hepatic and renal distribution of Cd, Zn, Cu, and Fe along with activity of acid and alkaline phosphatases and ribonuclease and glutathione content were studied. Uptake of Cd both in liver and in kidney was significant and was accompanied by increased Zn and depletion of Fe concentration. The Cu level remained unaltered. Dietary supplementation of Cu or Fe interacted effectively and influenced the metal distribution. Acid and alkaline phosphatases in both liver and kidney were inhibited by Cd exposure. However, Cu and/or Fe supplements could to a varying degree offset the Cd-induced inhibition. Cadmium exposure did not, however, elicit any effect on hepatic and renal ribonuclease activity of low-protein-fed animals. The glutathione concentration registered profound increase on Cd exposure, possibly to act as a defense mechanism.

Tewari, P.C.; Kachru, D.N.; Tandon, S.K.


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Imaging Nicotine in Rat Brain Tissue by Use of Nanospray Desorption Electrospray Ionization Mass Spectrometry  

SciTech Connect

Imaging mass spectrometry offers simultaneous detection of drugs, drug metabolites and endogenous substances in a single experiment. This is important when evaluating effects of a drug on a complex organ system such as the brain, where there is a need to understand how regional drug distribution impacts function. Nicotine is an addictive drug and its action in the brain is of high interest. Here we use nanospray desorption electrospray ionization, nano-DESI, imaging to discover the localization of nicotine in rat brain tissue after in vivo administration of nicotine. Nano-DESI is a new ambient technique that enables spatially-resolved analysis of tissue samples without special sample pretreatment. We demonstrate high sensitivity of nano-DESI imaging that enables detection of only 0.7 fmole nicotine per pixel in the complex brain matrix. Furthermore, by adding deuterated nicotine to the solvent, we examined how matrix effects, ion suppression, and normalization affect the observed nicotine distribution. Finally, we provide preliminary results suggesting that nicotine localizes to the hippocampal substructure called dentate gyrus.

Lanekoff, Ingela T.; Thomas, Mathew; Carson, James P.; Smith, Jordan N.; Timchalk, Charles; Laskin, Julia



In vivo determination of triglyceride (TG) secretion in rats fed different dietary saturated fats using (2- sup 3 H)-glycerol  

Science Conference Proceedings (OSTI)

Male, Sprague-Dawley rats (154{plus minus}1 g) were fed diets containing 2% corn oil (CO) + 14% butterfat (BF), beef tallow (BT), olive oil (OO) or coconut oil (CN) vs a 16% CO control diet for 5 weeks. Changes in plasma TG specific activity (dpm/mg TG) were determined in individual unanesthetized rats after injection of 100 {mu}Ci (2-{sup 3}H)-glycerol via a carotid cannula. Fractional rate constants were obtained using a 2-compartment model and nonlinear regression analysis. Results demonstrated no difference in the fractional rate constants among dietary groups; but, differences in the rates of hepatic TG secretion were noted. Rats fed BT showed a higher rate of hepatic TG secretion than rats fed CO. Rats fed BF, OO or CN showed somewhat higher rates of hepatic TG secretion than CO. VLDL TG, phospholipid, and apolipoprotein B and E levels were higher with saturated fats vs CO. The data suggest that the higher plasma TG levels noted in response to feeding saturated fats vs corn oil can be explained, in part, by an increased flux of hepatic TG secretion.

Lai, H.C.; Yang, H.; Lasekan, J.; Clayton, M.; Ney, D.M. (Univ. of Wisconsin, Madison (United States))



Evaluation of S-values and dose distributions for {sup 90}Y, {sup 131}I, {sup 166}Ho, and {sup 188}Re in seven lobes of the rat liver  

Science Conference Proceedings (OSTI)

Purpose: Rats have been widely used in radionuclide therapy research for the treatment of hepatocellular carcinoma (HCC). This has created the need to assess rat liver absorbed radiation dose. In most dose estimation studies, the rat liver is considered as a homogeneous integrated target organ with a tissue composition assumed to be similar to that of human liver tissue. However, the rat liver is composed of several lobes having different anatomical and chemical characteristics. To assess the overall impact on rat liver dose calculation, the authors use a new voxel-based rat model with identified suborgan regions of the liver. Methods: The liver in the original cryosectional color images was manually segmented into seven individual lobes and subsequently integrated into a voxel-based computational rat model. Photon and electron particle transport was simulated using the MCNPX Monte Carlo code to calculate absorbed fractions and S-values for {sup 90}Y, {sup 131}I, {sup 166}Ho, and {sup 188}Re for the seven liver lobes. The effect of chemical composition on organ-specific absorbed dose was investigated by changing the chemical composition of the voxel filling liver material. Radionuclide-specific absorbed doses at the voxel level were further assessed for a small spherical hepatic tumor. Results: The self-absorbed dose for different liver lobes varied depending on their respective masses. A maximum difference of 3.5% was observed for the liver self-absorbed fraction between rat and human tissues for photon energies below 100 keV. {sup 166}Ho and {sup 188}Re produce a uniformly distributed high dose in the tumor and relatively low absorbed dose for surrounding tissues. Conclusions: The authors evaluated rat liver radiation doses from various radionuclides used in HCC treatments using a realistic computational rat model. This work contributes to a better understanding of all aspects influencing radiation transport in organ-specific radiation dose evaluation for preclinical therapy studies, from tissue composition to organ morphology and activity distribution.

Xie Tianwu; Liu Qian; Zaidi, Habib [Britton Chance Center for Biomedical Photonics, Wuhan National Laboratory for Optoelectronics, Huazhong University of Science and Technology, Wuhan 430074 (China) and Key Laboratory of Biomedical Photonics of Ministry of Education, Huazhong University of Science and Technology, Wuhan 430074 (China); Britton Chance Center for Biomedical Photonics, Wuhan National Laboratory for Optoelectronics, Huazhong University of Science and Technology, Wuhan 430074 (China); Key Laboratory of Biomedical Photonics of Ministry of Education, Huazhong University of Science and Technology, Wuhan 430074 (China) and Division of Nuclear Medicine and Molecular Imaging, Geneva University Hospital, CH-1211 Geneva (Switzerland); Division of Nuclear Medicine and Molecular Imaging, Geneva University Hospital, CH-1211 Geneva (Switzerland); Geneva Neuroscience Center, Geneva University, CH-1211 Geneva (Switzerland) and Department of Nuclear Medicine and Molecular Imaging, University Medical Center Gronigen, University of Groningen, 9700 RB Groningen (Netherlands)



Rat MHC-linked peptide transporter alleles strongly influence peptide binding by HLA-B27 but not B27-associated inflammatory disease  

SciTech Connect

Rats transgenic for the human MHC molecule HLA-B27 were used to study the effect of two alleles, cim{sup a} and cim{sup b}, which are associated with peptide transport by the MHC-encoded Tap2 transporter, on the function of HLA-B27 as a restriction element for CTL recognition of the male H-Y minor H Ag and on the multisystem inflammatory disease characteristic of B27 transgenic rats. Anti-H-Y CTL generated in cim{sup a} B27 transgenic rats lysed male B27 cim{sup b/b} targets significantly less well than cim{sup a/a} or cim{sup a/b} targets. Addition of exogenous H-Y peptides to male B27 cim{sup b/b} targets increased susceptibility to lysis to the level of cim{sup a/a} targets sensitized with exogenous H-Y peptides. {sup 3}H-labeled peptides eluted from B27 molecules of lymphoblasts from rats of two cim{sup b} and three cim{sup a} RT1 haplotypes showed that the cim{sup b} peptide pool favors comparatively longer and/or more hydrophobic peptides. These results indicate that RT1-linked Tap2 polymorphism in the rat strongly influences peptide loading of HLA-B27. Nonetheless, the prevalence and severity of multisystem inflammatory lesions were comparable in backcross rats bearing either cim{sup a/b} or cim{sup b/b}. It thus appears either that binding of specific peptides to B27 is unimportant in the pathogenesis of B27-associated disease or that the critical peptides, unlike H-Y and many others, are not influenced by Tap transporter polymorphism. 42 refs., 6 figs., 3 tabs.

Simmons, W.A.; Satumtira, Nimman; Taurog, J.D. [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States)] [and others



MRP2 and the handling of mercuric ions in rats exposed acutely to inorganic and organic species of mercury  

Science Conference Proceedings (OSTI)

Mercuric ions accumulate preferentially in renal tubular epithelial cells and bond with intracellular thiols. Certain metal-complexing agents have been shown to promote extraction of mercuric ions via the multidrug resistance-associated protein 2 (MRP2). Following exposure to a non-toxic dose of inorganic mercury (Hg{sup 2+}), in the absence of complexing agents, tubular cells are capable of exporting a small fraction of intracellular Hg{sup 2+} through one or more undetermined mechanisms. We hypothesize that MRP2 plays a role in this export. To test this hypothesis, Wistar (control) and TR{sup -} rats were injected intravenously with a non-nephrotoxic dose of HgCl{sub 2} (0.5 {mu}mol/kg) or CH{sub 3}HgCl (5 mg/kg), containing [{sup 203}Hg], in the presence or absence of cysteine (Cys; 1.25 {mu}mol/kg or 12.5 mg/kg, respectively). Animals were sacrificed 24 h after exposure to mercury and the content of [{sup 203}Hg] in blood, kidneys, liver, urine and feces was determined. In addition, uptake of Cys-S-conjugates of Hg{sup 2+} and methylmercury (CH{sub 3}Hg{sup +}) was measured in inside-out membrane vesicles prepared from either control Sf9 cells or Sf9 cells transfected with human MRP2. The amount of mercury in the total renal mass and liver was significantly greater in TR{sup -} rats than in controls. In contrast, the amount of mercury in urine and feces was significantly lower in TR{sup -} rats than in controls. Data from membrane vesicles indicate that Cys-S-conjugates of Hg{sup 2+} and CH{sub 3}Hg{sup +} are transportable substrates of MRP2. Collectively, these data indicate that MRP2 plays a role in the physiological handling and elimination of mercuric ions from the kidney.

Bridges, Christy C., E-mail: Bridges_cc@mercer.edu; Joshee, Lucy; Zalups, Rudolfs K.



Retinal ganglion cell survival and axon regeneration in WldS transgenic rats after optic nerve crush and lens injury  

E-Print Network (OSTI)

the latter inactive in WldS trans- genic rats. WldS is a fusion protein that consists of nicotinamide mononucleotide adenylyl-transferase-1 (Nmnat1) and a short fragment of the ubiquitin assem- bly protein UFD2. Whilst several reports have suggested... - fered saline (PBS) followed by 4% paraformaldehyde. Eyes and optic nerves were removed and post-fixed by immersion overnight in cold 4% paraformaldehyde. Tis- sue was then washed with PBS and transferred to 30% sucrose solution (overnight at 4 C...

Lorber, Barbara; Tassoni, Alessia; Bull, Natalie D; Moschos, Marilita M; Martin, Keith R



Synthesis, internalization, and localization of atrial natriuretic peptide in rat adrenal medulla  

SciTech Connect

Some, though not all studies, have indicated that atrial natriuretic peptide (ANP) can bind to adrenal medullary cells. ANP-like immunoreactivity (ANP-LI) has also been identified in catecholamine-secreting cells. Together, these findings suggest that ANP may be taken up and/or synthesized in the adrenal medulla. The present study was designed to ascertain, by in situ hybridization, whether adrenal chromaffin cells could synthesize ANP, to define by an in vivo ultrastructural autoradiographic approach, whether ANP could, in fact, bind to rat adrenal medulla cells, to determine whether there was a cellular (noradrenaline (NA) vs. adrenaline (A)) selectivity in the binding process, and to establish whether extracellular (125I)ANP could be internalized by these cells. The cellular and subcellular distribution of endogenous ANP-LI was also investigated in both cell types by cryoultramicrotomy and immunocytochemical approaches. The in situ hybridization studies indicate the presence of mRNA to ANP in about 15% of adrenal medullary cells. Intravenous injection of (125I)ANP resulted in a 3-fold, preferential and specific radiolabeling of A-as compared to NA-containing cells. In A-containing cells, plasma membranes were significantly labeled 2 and 5 min post injection; cytoplasmic matrix, mitochondria, and secretory granules throughout the time course studied (1-30 min post injection). Lysosomes, rough endoplasmic reticulum, Golgi apparatus, and nuclei were not labeled. ANP-LI was identified in both NA- and A-containing cells; in the former, it was almost exclusively localized in secretory vesicles, in the latter it was detected in plasma membranes, cytoplasmic matrix, nuclear euchromatin, some mitochondria and relatively fewer granules than in NA-containing cells.

Morel, G.; Chabot, J.G.; Garcia-Caballero, T.; Gossard, F.; Dihl, F.; Belles-Isles, M.; Heisler, S.



Piezoelectric Drop-on-Demand Inkjet Printing of Rat Fibroblast Cells: Survivability Study and Pattern Printing  

E-Print Network (OSTI)

A novel piezoelectric, drop-on-demand (DOD) inkjet system has been developed and used to print L929 rat fibroblast cells. We investigate the survivability of the cells subjected to the large stresses during the printing process. These stresses are varied by changing the diameter of the orifice (36 to 119 microns) through which the cells are dispensed, as well as changing the electrical pulse used to drive the piezoelectric element. It is shown that for the smallest 36 microns diameter orifice, cell survival rates fall from 95% to approximately 76% when the ejection velocity is increased from 2 to 16 m/s. This decrease in survival rates is less significant when the larger orifice diameters of 81 microns and 119 microns are used. Analysis shows that there is a clear inverse relationship between cell survival rates and the mean shear rates during drop formation. By using the same printing set-up, fibroblast cells are printed onto alginate and collagen into patterns. Printed cells are cultured over a period of days to verify their long-term viability. Fibroblasts printed onto the collagen are found to successfully adhere, spread and proliferate, subsequently forming a denser patterns after 5 days in culture. Cell agglomeration is found to affect the printing performance, especially for the printhead with the smallest orifice, leading to frequent clogging of the nozzle. We also study the number of cells in each droplet, when printed under optimal conditions. The probability density of this number follows a binomial distribution, which consistent with a uniform distribution of cells in the medium and within the printhead.

Er Qiang Li; Eng Khoon Tan; Sigurdur Tryggvi Thoroddsen



A physiologically based pharmacokinetic model for developmental exposure to BDE-47 in rats  

Science Conference Proceedings (OSTI)

Polybrominated diphenyl ethers (PBDEs) are used commercially as additive flame retardants and have been shown to transfer into environmental compartments, where they have the potential to bioaccumulate in wildlife and humans. Of the 209 possible PBDEs, 2,2',4,4'-tetrabromodiphenyl ether (BDE-47) is usually the dominant congener found in human blood and milk samples. BDE-47 has been shown to have endocrine activity and produce developmental, reproductive, and neurotoxic effects. The objective of this study was to develop a physiologically based pharmacokinetic (PBPK) model for BDE-47 in male and female (pregnant and non-pregnant) adult rats to facilitate investigations of developmental exposure. This model consists of eight compartments: liver, brain, adipose tissue, kidney, placenta, fetus, blood, and the rest of the body. Concentrations of BDE-47 from the literature and from maternal-fetal pharmacokinetic studies conducted at RTI International were used to parameterize and evaluate the model. The results showed that the model simulated BDE-47 tissue concentrations in adult male, maternal, and fetal compartments within the standard deviations of the experimental data. The model's ability to estimate BDE-47 concentrations in the fetus after maternal exposure will be useful to design in utero exposure/effect studies. This PBPK model is the first one designed for any PBDE pharmaco/toxicokinetic description. The next steps will be to expand this model to simulate BDE-47 pharmacokinetics and distributions across species (mice), and then extrapolate it to humans. After mouse and human model development, additional PBDE congeners will be incorporated into the model and simulated as a mixture.

Emond, Claude, E-mail: claude.emond@umontreal.c [Departement de sante environnementale et sante au travail Faculte de medecine, Universite de Montreal, P.O. Box 6128, Main Station, Montreal, Quebec, H3C 3J7 (Canada); BioSimulation Consulting Inc., Newark, DE 19711 (United States); Raymer, James H.; Studabaker, William B.; Garner, C. Edwin [RTI International, Research Triangle Park, NC 27709 (United States); Birnbaum, Linda S. [Office of Research and Development, National Center for Environmental Assessment, U.S. Environmental Protection Agency, Research Triangle Park, NC 27709 (United States)



Involvement of calcium-sensing receptor in ischemia/reperfusion-induced apoptosis in rat cardiomyocytes  

Science Conference Proceedings (OSTI)

The calcium-sensing receptor (CaR) is a seven-transmembrane G-protein coupled receptor, which activates intracellular effectors, for example, it causes inositol phosphate (IP) accumulation to increase the release of intracellular calcium. Although intracellular calcium overload has been implicated in the cardiac ischemia/reperfusion (I/R)-induced apoptosis, the role of CaR in the induction of apoptosis has not been fully understood. This study tested the hypothesis that CaR is involved in I/R cardiomyocyte apoptosis by increasing [Ca{sup 2+}]{sub i}. The isolated rat hearts were subjected to 40-min ischemia followed by 2 h of reperfusion, meanwhile GdCl{sub 3} was added to reperfusion solution. The expression of CaR increased at the exposure to GdCl{sub 3} during I/R. By laser confocal microscopy, it was observed that the intracellular calcium was significantly increased and exhibited a collapsed {delta}{psi} {sub m}, as monitored by 5,5',6,6'-tetrachloro-1,1',3,3'- tetraethylbenzimidazolcarbocyanine iodide (JC-1) during reperfusion with GdCl{sub 3}. Furthermore, the number of apoptotic cells was significantly increased as shown by TUNEL assay. Typical apoptotic cells were observed with transmission electron microscopy in I/R with GdCl{sub 3} but not in the control group. The expression of cytosolic cytochrome c and activated caspase-9 and caspase-3 was significantly increased whereas the expression of mitochondrial cytochrome c significantly decreased in I/R with GdCl{sub 3} in comparison to the control. In conclusion, these results suggest that CaR is involved in the induction of cardiomyocyte apoptosis during ischemia/reperfusion through activation of cytochrome c-caspase-3 signaling pathway.

Zhang Weihua [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China); Fu Songbin [Department of Genetics, Harbin Medical University, Harbin 150086 (China); Bio-pharmaceutical Key Laboratory of Heilongjiang Province, Harbin 150086 (China); Lu Fanghao [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China)]. E-mail: lufanghao1973@yahoo.com.cn; Wu Bo [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China); Gong Dongmei [Department of Pharmacology, Harbin Medical University, Harbin 150086 (China); Pan, Zhen-wei [Department of Pharmacology, Harbin Medical University, Harbin 150086 (China); Lv Yanjie [Department of Pharmacology, Harbin Medical University, Harbin 150086 (China); Zhao Yajun [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China); Li Quanfeng [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China); Wang Rui [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China); Department of Biology, Lakehead University, Thunder Bay, Ont., P7B5E1 (Canada); Yang Baofeng [Department of Pharmacology, Harbin Medical University, Harbin 150086 (China); Bio-pharmaceutical Key Laboratory of Heilongjiang Province, Harbin 150086 (China); Xu Changqing [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China) and Bio-pharmaceutical Key Laboratory of Heilongjiang Province, Harbin 150086 (China)]. E-mail: xucq@163.com




E-Print Network (OSTI)

Summary.-Regional and distant lymph node cells, thoracic duct cells and peripheral blood lymphocytes from rats bearing a spontaneously metastasizing and apparently non-immunogenic sarcoma were assayed for cytotoxic activity on microcultures of tumour cells at 7, 14 and 21 days of tumour growth. In the regional lymph nodes detectable cytotoxicity was present at 7 days and the overall activity remained constant at 14 and 21 days. At Day 7 of tumour growth the cytotoxic cell population in the regional node was tumour specific in its cytotoxic effect, very radiosensitive and could not be removed by nylon wool column purification. In contrast the cells in the regional nodes at Day 21 were nonspecifically cytotoxic and could be completely removed by nylon wool treatment. In the peripheral blood, cytotoxic lymphoid cells not removed by nylon wool, were detectable at all stages of tumour growth. The thoracic duct lymph cells were, however, without cytotoxic activity throughout the period of tumour growth studied. Distant lymph node cells were assayed for cytotoxicity and it was found that they acquired significant cytocidal properties only late in tumour growth. The sera from tumour-bearing rats were tested for inhibitory

G. A. Currii; J. Gage



Schwann cell but not olfactory ensheathing glia transplants improve hindlimb locomotor performance in the moderately contused adult rat thoracic spinal cord  

E-Print Network (OSTI)

Cultured adult rat Schwann cells (SCs) or olfactory ensheathing glia (OEG), or both, were transplanted in the adult Fischer rat thoracic (T9) spinal cord 1 week after a moderate contusion (10 gm, 12.5 mm, NYU impactor). Rats received either a total of 2 ? 10 6 cells suspended in culture medium or culture medium only (controls). At 12 weeks after injury, all grafted animals exhibited diminished cavitation. Although in medium-injected rats 33 % of spinal tissue within a 5-mm-long segment of cord centered at the injury site was spared, significantly more tissue was spared in SC (51%), OEG (43%), and SC/OEG (44%) grafted animals. All three types of glial grafts were filled with axons, primarily of spinal origin. SC grafts contained more myelinated axons than SC/OEG and OEG grafts. Both types of SC-containing grafts expressed more intense staining for glial fibrillary acidic protein and chondroitin sulfate proteoglycan compared with OEG-only

Toshihiro Takami; Martin Oudega; Margaret L. Bates; Patrick M. Wood; Naomi Kleitman; Mary Bartlett Bunge



Dietary apigenin and naringenin protect against colon carcinogenesis by lowering high multiplicity aberrant crypt foci and enhancing apoptosis in azoxymethane-treated rats  

E-Print Network (OSTI)

Colon cancer is the third most common cancer in the United States. However, evidence indicates that a proper diet abundant in fruits and vegetables may be protective against colon cancer development. Bioactive compounds in fruits and vegetables, such as flavonoids and limonoids, have been shown to possess anti-proliferative and antitumorigenic effects in various in vitro and in vivo models of cancer. Since there are few animal studies involving flavonoids and limonoids and colon cancer, this experiment investigated the potentially protective effects of four citrus flavonoids and one limonoid mixture against the promotion stage of chemically-induced colon cancer in rats. Male SD rats (n =60; 10 rats/group) were assigned to receive diets containing 0.1% apigenin, 0.02% naringenin, 0.1% hesperidin, 0.01% nobiletin, 0.035% limonin glucoside/obacunone glucoside mixture, or a control diet (0% flavonoid/limonoid). Rats received the diets for 10 wk and were injected with azoxymethane (15 mg/kg) at wk 3 and 4. The excised colons were evaluated for aberrant crypt foci (ACF) formation, cell proliferation (PCNA assay), apoptosis (TUNEL assay), and iNOS and COX-2 expression. When compared to the control diet, apigenin lowered the number of high multiplicity ACF (> 4 AC/focus) by 57% (PACF by 51% (PACF are indicative of future tumor development in both humans and rats. Furthermore, dysregulated proliferation and apoptosis may also lead to tumorigenesis. Therefore, the ability of dietary apigenin and naringenin to reduce high multiplicity ACF, lower proliferation, and increase apoptosis may contribute toward colon cancer prevention. However, their protection is not due to their influence on iNOS and COX-2 protein levels.

Leonardi, Tety



Characterization of Solubilized Atrial Natriuretic Peptide Receptors from Rat Olfactory Bulb and A10 Cultured Smooth Muscle Cells  

E-Print Network (OSTI)

Atrial natriuretic peptide (ANP) receptors from Al 0 cultured vascular smooth muscle cells (VSMC) and rat olfactory bulbs have been solubilized and then pharmacologically and biochemically compared. The dissociation constant for *% ANP(99-126) was 12.7 PM for the VSMC-derived receptor and 164 PM for the olfactory receptor. Competition binding between 1251-ANP(99-1 26) and several unlabeled ANP analogs with the soluble olfactory receptor, demonstrated a rank order potency of ANP(99-126) = ANP ( 103-l 26)>>> ANP ( 103-l 23). However, the rank order potency of the soluble VSMC ANP receptor was ANP(99-126) = ANP ( 103-l 26) = ANP ( 103-l 23). Therefore, the olfactory ANP receptor appears to require the complete COOH-terminal sequence of ANP as compared with the VSMC ANP receptor. When the 2 soluble receptor preparations were applied to a GTP-agarose

T. Ft. Gibson; A. D. Zyskind; C. C. Glembotski



Effects of x-irradiation on steroid biotransformations by testicular tissue. Final report, May 1, 1966--July 31, 1976. [Rats  

SciTech Connect

A number of parameters of testicular and body function were investigated after various dosages of x-irradiation to ascertain: what relationship they have to the radiation syndrome and testicular repression and regeneration of the rat; and how sensitive these parameters are to radiation. Changes in androgen synthesis were not well correlated with either body or gonad weights, hematocrit values or testicular histology. Lipid peroxidation, catalase activity, metabolism of testosterone, prostaglandins, cyclic nucleotides and serotonin metabolism were all related to the direct effects of radiation on the male gonad. Indirect effects on the testis appear to be mediated by serotonin and the pineal gland. The pineal gland appeared to be responsible for variations in androgen synthesis and radiosensitivity of the testis through its secretory products-melatonin and arginine vasopressin. These compounds have the capacity of inducing endocrine rhythms by affecting: the hypothalamus-pituitary axis; the liver; and/or the gonad directly.

Ellis, L.C.



On-off intermittency of thalamo-cortical oscillations in the electroencephalogram of rats with genetic predisposition to absence epilepsy  

E-Print Network (OSTI)

Spike-wave discharges (SWD) are electroencephalographic hallmarks of absence epilepsy. SWD are known to originate from thalamo-cortical neuronal network that normally produce sleep spindle oscillations. Although both sleep spindles and SWD are considered as thalamo-cortical oscillations, functional relationship between them is still uncertain. The present study describes temporal dynamics of SWD and sleep spindles as determined in long-term EEG recordings in WAG/Rij rat model of absence epilepsy. It was found that non-linear dynamics of SWD fits well to the law of 'on-off intermittency'. Typical sleep spindles that occur during slow-wave sleep (SWS) also demonstrated 'on-off intermittency' behavior, in contrast to high-voltage spindles during intermediate sleep stage, whose dynamics was uncertain. This implies that both SWS sleep spindles and SWD are controlled by a system-level mechanism that is responsible for regulating circadian activity and/or sleep-wake transitions.

Evgenia Sitnikova; Alexander E. Hramov; Alexey A. Ovchinnikov; Alexey A. Koronovskii



Original article Microinjection of NMDA Receptor Agents into the Central Nucleus of the Amygdale Alters Water Intake in Rats  

E-Print Network (OSTI)

Objective(s) The central nucleus of the amygdala (CeA) is a forebrain structure which is important in regulation of ingestive behavior and there is direct and circumstantial evidence to indicate that some circuits involved with feeding behavior include glutamatergic elements. The present study examined whether administration of NMA (N-Methyl-DL-aspartic acid) or MK801 into the CeA altered water intake under deprivation. Materials and Methods Animals were deprived for 24 hr before tested for water intake. NMDA (N-methyl-D-aspartate) glutamatergic receptor agonist, NMA and its antagonist, MK801 were infused bilaterally, and water intake measured for 1 hr thereafter. Results The intra-CeA injection of NMDA glutamatergic agonist, NMA (0.25, 0.5 and 0.75 g/rat) increased water intake (Pwater intake significantly (Pwater intake in this nucleus.

Jalal Solati; Ramin Hajikhani



Printed in U.S.A. Effect of Acute Ethanol on Striatal Dopamine Neurotransmission in Ambulatory Rats  

E-Print Network (OSTI)

The effect of ethanol on evoked dopamine release in the caudate putamen has been measured in behaving animals with in vivo electrochemistry. Dopamine was measured with fast-scan cyclic voltammetry in adult male rats to resolve the competing processes of dopamine uptake and release. Ethanol dose dependently decreased dopamine efflux compared with salinetreated animals: to 89 % of controls with 0.5 g/kg, 70 % with 1 g/kg, 34 % with 2.5 g/kg, and 18 % with 5 g/kg. This decrease was not due to a change in uptake, as measured by the rate of dopamine disappearance after stimulation, and therefore can be attributed to decreased dopamine release. Additionally, it was not mediated by a decrease in biosynthesis, as measured by L-DOPA accumulation after NSD 1015 administration. The selective dopamine uptake inhibitor GBR 12909 compensated

Evgeny A. Budygin; Paul E. M. Phillips; Donita L. Robinson; Andrew P. Kennedy; Raul R. Gainetdinov; R. Mark Wightman



Block of voltage-gated potassium channels by Pacific ciguatoxin-1 contributes to increased neuronal excitability in rat sensory neurons  

SciTech Connect

The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na{sub v}) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na{sub v} channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na{sub v} currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na{sub v} channel gating, observed clinically in response to ciguatera poisoning.

Birinyi-Strachan, Liesl C. [Neurotoxin Research Group, Department of Health Sciences, University of Technology, Sydney, Broadway NSW (Australia); Gunning, Simon J. [Neurotoxin Research Group, Department of Health Sciences, University of Technology, Sydney, Broadway NSW (Australia); Lewis, Richard J. [Institute for Molecular Bioscience, University of Queensland, Brisbane QLD (Australia); Nicholson, Graham M. [Neurotoxin Research Group, Department of Health Sciences, University of Technology, Sydney, Broadway NSW (Australia)]. E-mail: Graham.Nicholson@uts.edu.au



Pharmacokinetic and metabolism studies of the antiarrhythmic drug meobentine (N-(4-methoxybenzyl)-N prime , N double prime -dimethylguanidine) and its N-(4-trifluoromethyoxybenzyl)-N prime , N double prime - dimethylguanidine analogue, fluorobentine in the rat, dog and man  

SciTech Connect

A radioimmunoassay (RIA) was developed that was able to detect 40 pg meobentine (M) in 0.1 ml plasma. Cross-reactivity of suspected M metabolites was very low. This RIA was later also used to assay for fluorobentine (F), a fluorine analogue of M. M exhibits three-compartment open model iv kinetics in the rat, dog, and man. Terminal drug half-life in the rat, dog, and man; total-body clearance in the rat, dog, and man; and terminal-phase volume of distribution in the rat, dog, and man were determined. (14C)-M absorption is essentially complete in the rat and dog, but this parameter could not be directly ascertained in man. Relative oral drug bioavailability is linear in the rat and dog but falls off between 5-10 mg/kg in man. F was synthesized in an attempt to counteract suspected problems with M's poor absorption or extensive metabolism that might be affecting its efficacy in humans. F would likely be unavailable for O-demethylation, might well be more lipophilic than M, and yet still be active.

Warren, J.T.


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Bath and Shower Effects in the Rat Parotid Gland Explain Increased Relative Risk of Parotid Gland Dysfunction After Intensity-Modulated Radiotherapy  

Science Conference Proceedings (OSTI)

Purpose: To assess in a rat model whether adding a subtolerance dose in a region adjacent to a high-dose irradiated subvolume of the parotid gland influences its response (bath-and-shower effect). Methods and Materials: Irradiation of the whole, cranial 50%, and/or the caudal 50% of the parotid glands of Wistar rats was performed using 150-MeV protons. To determine suitable (i.e., subtolerance) dose levels for a bath-dose, both whole parotid glands were irradiated with 5 to 25 Gy. Subsequently groups of Wistar rats received 30 Gy to the caudal 50% (shower) and 0 to 10 Gy to the cranial 50% (bath) of both parotid glands. Stimulated saliva flow rate (function) was measured before and up to 240 days after irradiation. Results: Irradiation of both glands up to a dose of 10 Gy did not result in late loss of function and is thus regarded subtolerance. Addition of a dose bath of 1 to 10 Gy to a high-dose in the caudal 50% of the glands resulted in enhanced function loss. Conclusion: Similar to the spinal cord, the parotid gland demonstrates a bath and shower effect, which may explain the less-than-expected sparing of function after IMRT.

Luijk, Peter van [Department of Radiation Oncology, University Medical Center Groningen, University of Groningen, Groningen (Netherlands)], E-mail: p.van.luijk@rt.umcg.nl; Faber, Hette [Department of Radiation Oncology, University Medical Center Groningen, University of Groningen, Groningen (Netherlands); Schippers, Jacobus M. [Department of Radiation Oncology, University Medical Center Groningen, University of Groningen, Groningen (Netherlands); Accelerator Department, Paul Scherrer Institut, Villigen (Switzerland); Brandenburg, Sytze [Kernfysisch Versneller Instituut, University of Groningen, Groningen (Netherlands); Langendijk, Johannes A.; Meertens, Harm [Department of Radiation Oncology, University Medical Center Groningen, University of Groningen, Groningen (Netherlands); Coppes, Robert P. [Department of Radiation Oncology, University Medical Center Groningen, University of Groningen, Groningen (Netherlands); Department of Cell Biology, Section Radiation and Stress Cell Biology, University Medical Center Groningen, University of Groningen, Groningen (Netherlands)




E-Print Network (OSTI)

Abstract Previous findings from our group indicate that accumbal glycine receptors (GlyRs) are involved in mediating the dopamine (DA) activating effects of ethanol (EtOH), and that administration of glycine locally into the nucleus accumbens (nAc) reduces EtOH consumption in EtOH high-preferring rats. Aims: The present study examines the influence of a systemically administered glycine reuptake inhibitor, Org 25935, on EtOH preference and intake, in male Wistar rats with an EtOH preference>60 % (during continuous access to a bottle of EtOH, 6 % v/v, and a bottle of water), called EP>60 rats, as well as in animals with an EtOH preference 60 and EPwater. Results: Org 25935 decreased EtOH intake and EtOH preference, as compared with vehicle, whereas water intake was unaffected. This effect was dose-dependent, developed gradually and was sustained for up to 40 days, also after introduction of an alcohol deprivation period. Conclusion: It is suggested that Org 25935, and possibly also other GlyT1 inhibitors, can represent a new pharmacological treatment principle for alcohol dependence or abuse.

Anna Molander; Helga Hifdt Lid; Elin Lf; Mia Ericson; Bo Sderpalm



Effect of angiotensin II on Ca sup 2+ kinetics and contraction in cultured rat glomerular mesangial cells  

SciTech Connect

This in vitro study was undertaken to determine the changes in Ca{sup 2+} kinetics and cell shape of cultured putative glomerular mesangial cells in the rat in response to angoitensin II (ANG II). Intracellular Ca{sup 2+} ((Ca{sup 2+}){sub i}) was measured using quin 2. ANG II-stimulated {sup 45}Ca{sup 2+} efflux was also determined. ANG II induced rapid concentration-dependent increases in (Ca{sup 2+}){sub i} and {sup 45}Ca{sup 2+} efflux. ANG II also induced contraction of mesangial cells as assessed by alterations in cell shape. Even in Ca{sup 2+}-free medium, ANG II increased (Ca{sup 2+}){sub i} and {sup 45}Ca{sub 2+} efflux, but to a lesser extent. Under this condition, contraction of mesangial cells induced by ANG II was also observed. Readdition of extracellular Ca{sup 2+} and the ANG II-induced increase in (Ca{sup 2+}){sub i} caused a second and slower (Ca{sup 2+}){sub i} increase. High potassium (50 mM) induced a change of (Ca{sup 2+}){sub i}, but to a lesser extent compared with the ANG II-induced change. The Ca{sup 2+} channel blocker verapamil partially inhibited ANG II-induced {sup 45}Ca{sup 2+} influx but totally blocked the increase in (Ca{sup 2+}){sub i} induced by high potassium. Verapamil did not inhibit ANG II-stimulated Ca{sup 2+} efflux or the change in cell shape. Dantrolene (10{sup {minus}4} M), a blocker of Ca{sup 2+} release from endoplasmic reticulum, inhibited ANG II-stimulated Ca{sup 2+} efflux and change in cell shape. These results indicate that ANG II rapidly increases (Ca{sup 2+}){sub i} in cultured rat mesangial cells, in part by mobilizing Ca{sup 2+} from dantrolene-sensitive intracellular pools and in part through activation of receptor-operated and voltage-dependent Ca{sup 2+} channels. The (Ca{sup 2+}){sub i} mobilization, however, seems to be the primary modulator of initial glomerular mesangial cell contraction.

Takeda, Katsuji; Meyer-Lehnert, H.; Kim, J.K.; Schrier, R.W. (Univ. of Colorado School of Medicine, Denver (USA))



Characterization of the Bone Loss and Recovery Response at the Distal Femur Metaphysis of the Adult Male Hindlimb Unloaded Rat  

E-Print Network (OSTI)

Extended periods of mechanical unloading are known to be detrimental to bone health. Astronauts who spend months in microgravity aboard the International Space Station (ISS) are at particular risk. It is anticipated that NASA will not drastically increase the size of the astronaut corps, and this will mean increased likelihood of repeat missions for more astronauts. Thus, it is important to better understand the effects that prolonged, multiple bouts of unloading have on bone. This study utilized the hindlimb unloaded (HU) rat model to examine bone loss and recovery for single and double unloading bouts. Adult male Sprague-Dawley rats (6 months old) were randomized into the following groups: baseline (sacrificed at 6 months), 1HU7 (unloaded for 1 month, weight-bearing recovery for 3 months), 2HU10 (unloaded for 1 month, recovered for 2 months, unloaded for another month, and then recovered 2 months), 1HU10 (normal cage activity until 1 month HU ending at month 10, 2 month recovery followed), and aging controls (remained ambulatory throughout experiment). Every month (28 days), animals were terminated and the left femurs were excised, resulting in n=15 per group for each time point. Mineral and geometric properties were measured using peripheral quantitative computed tomography (pQCT) at the distal femur metaphysis, and quasi-static reduced platen compression (RPC) was used to estimate the mechanical properties of cancellous bone. Strength indices based on pQCT parameters were calculated as predictors of mechanical properties. Bone mass properties decreased due to HU and recovered within 2-3 months post-HU. A combination of increased periosteal apposition and endocortical resorption also occurred during HU. The initial HU bout suppressed normal age-related increases in mechanical properties and recovered within 1-2 months. Cancellous compressive strength index (CSI) most closely matched changes in mechanical properties. A second HU bout after two months recovery had a less detrimental effect on pQCT parameters but a greater negative impact on mechanical properties, when compared to pre-HU values. The opposite is true for mechanical properties if loss is characterized relative to aging controls. Recovery after the second HU period did not appear to be significantly affected by a previous bout of HU.

Davis, Joshua Morgan



Effects of aging and exercise training on the mechanisms of Angiotensin II-induced vasoconstriction in rat skeletal muscle arterioles  

E-Print Network (OSTI)

Aging is associated with increases in regional and systemic vascular resistance and impaired ability to increase blood flow to active muscles during exercise. Aging enhances vasoconstrictor responsiveness in both humans and animals, and an increase in Angiotensin II-induced vasoconstriction is one possible mechanism for old age-associated increase in muscle vascular resistance. The purpose of this study was to determine 1) whether aging alters Ang II-induced vasoconstriction, 2) whether exercise training attenuates the age-associated alteration in Ang II-mediated vasoconstriction, and 3) the mechanism(s) through which aging and exercise training alter Ang II-induced vasoconstriction in rat skeletal muscle arterioles. Male Fischer 344 rats were assigned to 4 groups: Young sedentary (YS; 4 months), old sedentary (OS; 24 months), young trained (YT) and old trained (OT). Exercise-trained groups performed treadmill exercises for 60 min/day at 15 m/min, on a 15 incline for 5 days/week for 10-12 weeks. First-order (1A) arterioles were isolated from soleus and gastrocnemius muscles for in vitro experimentation. Intraluminal diameter changes were determined in response to the cumulative addition of Ang II (310-11 - 310-5 M). Ang II dose responses were then determined following the removal of endothelium and treatment with NG-nitro-L-arginine methyl ester (L-NAME, 10-5 M), a nitric oxide synthase (NOS) inhibitor. Ang II-induced vasoconstriction was augmented in the aged skeletal muscle arterioles, both in soleus and gastrocnemius muscles, and age-associated increases in Ang II-induced vasoconstriction were abolished with the removal of endothelium and with L-NAME. Exercise training ameliorated the age-induced increase in Ang II-vasoconstriction, and this alteration was eliminated by the removal of endothelium and with NOS inhibition. These findings suggest that aging enhances Ang II-induced vasoconstrictor responses in the arterioles from both soleus, high oxidative, and white portion of gastrocnemius, low oxidative glycolytic muscles, and this age-associated change occurs through an endothelium-dependent NOS signaling pathway. These results also demonstrated that exercise training can ameliorate the age-associated increase in Ang II vasoconstriction in the arterioles from both high oxidative and low oxidative glycolytic muscles through an endothelium-mediated NOS mechanism.

Park, Yoonjung



Multiphoton spectral analysis of benzo[a]pyrene uptake and metabolism in a rat liver cell line  

SciTech Connect

Dynamic analysis of the uptake and metabolism of polycyclic aromatic hydrocarbons (PAHs) and their metabolites within live cells in real time has the potential to provide novel insights into genotoxic and non-genotoxic mechanisms of cellular injury caused by PAHs. The present work, combining the use of metabolite spectra generated from metabolite standards using multiphoton spectral analysis and an 'advanced unmixing process', identifies and quantifies the uptake, partitioning, and metabolite formation of one of the most important PAHs (benzo[a]pyrene, BaP) in viable cultured rat liver cells over a period of 24 h. The application of the advanced unmixing process resulted in the simultaneous identification of 8 metabolites in live cells at any single time. The accuracy of this unmixing process was verified using specific microsomal epoxide hydrolase inhibitors, glucuronidation and sulfation inhibitors as well as several mixtures of metabolite standards. Our findings prove that the two-photon microscopy imaging surpasses the conventional fluorescence imaging techniques and the unmixing process is a mathematical technique that seems applicable to the analysis of BaP metabolites in living cells especially for analysis of changes of the ultimate carcinogen benzo[a]pyrene-r-7,t-8-dihydrodiol-t-9,10-epoxide. Therefore, the combination of the two-photon acquisition with the unmixing process should provide important insights into the cellular and molecular mechanisms by which BaP and other PAHs alter cellular homeostasis.

Barhoumi, Rola, E-mail: rmouneimne@cvm.tamu.edu [Department of Veterinary Integrative Biosciences, Texas A and M University, College Station, TX 77843-4458 (United States); Mouneimne, Youssef [American University of Beirut, Beirut (Lebanon); Ramos, Ernesto [Department of Veterinary Integrative Biosciences, Texas A and M University, College Station, TX 77843-4458 (United States); Morisseau, Christophe; Hammock, Bruce D. [Department of Entomology and Cancer Center, University of California at Davis, Davis, CA 95616 (United States); Safe, Stephen [Department of Veterinary Physiology and Pharmacology, Texas A and M University, College Station, TX 77843 (United States); Parrish, Alan R. [Department of Pharmacology and Physiology, University of Missouri, Colombia, MO 65211 (United States); Burghardt, Robert C., E-mail: rburghardt@cvm.tamu.edu [Department of Veterinary Integrative Biosciences, Texas A and M University, College Station, TX 77843-4458 (United States)



Cyclic Nucleotide-Gated Channels Contribute to Thromboxane A2-Induced Contraction of Rat Small Mesenteric Arteries  

E-Print Network (OSTI)

Background: Thromboxane A 2 (TxA 2)-induced smooth muscle contraction has been implicated in cardiovascular, renal and respiratory diseases. This contraction can be partly attributed to TxA2-induced Ca 2+ influx, which resulted in vascular contraction via Ca 2+-calmodulin-MLCK pathway. This study aims to identify the channels that mediate TxA2-induced Ca 2+ influx in vascular smooth muscle cells. Methodology/Principal Findings: Application of U-46619, a thromboxane A2 mimic, resulted in a constriction in endothelium-denuded small mesenteric artery segments. The constriction relies on the presence of extracellular Ca 2+, because removal of extracellular Ca 2+ abolished the constriction. This constriction was partially inhibited by an L-type Ca 2+ channel inhibitor nifedipine (0.51 mM). The remaining component was inhibited by L-cis-diltiazem, a selective inhibitor for CNG channels, in a dose-dependent manner. Another CNG channel blocker LY83583 [6-(phenylamino)-5,8-quinolinedione] had similar effect. In the primary cultured smooth muscle cells derived from rat aorta, application of U46619 (100 nM) induced a rise in cytosolic Ca 2+ ([Ca 2+]i), which was inhibited by L-cis-diltiazem. Immunoblot experiments confirmed the presence of CNGA2 protein in vascular smooth muscle cells. Conclusions/Significance: These data suggest a functional role of CNG channels in U-46619-induced Ca 2+ influx and contraction of smooth muscle cells.

Yuk Ki Leung; Juan Du; Yu Huang; Xiaoqiang Yao



but Not of MMP-9, Depends on the Emergence of GAP-43 Positive Axons in the Adult Rat Cochlear Nucleus  

E-Print Network (OSTI)

License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The matrix metalloproteinases MMP-9 and MMP-2, major modulators of the extracellular matrix (ECM), were changed in amount and distribution in the rat anteroventral cochlear nucleus (AVCN) following its sensory deafferentation by cochlear ablation. To determine what causal relationships exist between the redistribution of MMP-9 and MMP-2 and deafferentation-induced reinnervation, kainic acid was stereotaxically injected into the ventral nucleus of the trapezoid body (VNTB) prior to cochlear ablation, killing cells that deliver the growth associated protein 43 (GAP-43) into AVCN. Deafferentation-induced changes in the pattern of MMP-9 staining remained unaffected by VNTB lesions. By contrast, changes in the distribution of MMP-2 normally evoked by sensory deafferentation were reversed if GAP-43 positive axons were prevented to grow in AVCN. In conclusion, GAP-43-containing axons emerging in AVCN after cochlear ablation seem to be causal for the maintenance of MMP-2-mediated ECM remodeling. 1.

Michaela Fredrich; Robert-benjamin Illing



doi:10.1093/alcalc/agh065, available online at www.alcalc.oupjournals.org DUAL EFFECT OF ETHANOL ON CELL DEATH IN PRIMARY CULTURE OF HUMAN AND RAT HEPATOCYTES  

E-Print Network (OSTI)

Abstract Aims: In-vivo and in-vitro studies have shown that ethanol induces hepatocyte damage. The aim of the present study was to evaluate the effect of a broad range of ethanol concentrations on apoptosis and necrosis in primary culture of human and rat hepatocytes. Methods: Human and rat hepatocytes were isolated from human hepatectomies and male Wistar rats (200250 g) using the classical collagenase perfusion method. After stabilization of cell culture, ethanol (010 mmol/l) was administered and the parameters were measured 24 h after ethanol addition. Apoptosis was studied by DNA fragmentation, iodide propidiumDNA staining, caspase-3 activity and annexin V binding in hepatocytes. Necrosis was evaluated by lactate dehydrogenase (LDH) release. Malondialdehyde (MDA) and GSH/GSSG were used as parameters of oxidative stress. Results: Ethanol enhanced dose-dependently all the parameters associated with apoptosis in human and rat hepatocytes. Low or high ethanol concentrations induced an opposite action against cell necrosis in cultured hepatocytes. Low concentrations of ethanol (12 mmol/l) reduced LDH release from human and rat hepatocytes. However, the highest ethanol concentration (10 mmol/l) induced a sharp increase in cell necrosis. The effect of ethanol on cell necrosis was related to lipid peroxidation in hepatocytes. Conclusions: Ethanol differentially regulates apoptosis or necrosis in cultured hepatocytes. Although ethanol exerted a dose-dependent induction of apoptosis, low ethanol concentrations were able to reduce basal lipid peroxidation and necrosis in hepatocytes. The highest ethanol concentration (10 mmol/l) induced apoptosis and necrosis in human and rat cultured hepatocytes.

Rafael Castilla; Ral Gonzlez; Dalia Fouad; Enrique Fraga; Jordi Muntan




SciTech Connect

Fischer 344 rats were exposed to 0.0, 0.4, 1.4, or 4.0 ppm acrolein for 62 days. The major objective of the study was to relate the results of a series of pulmonary function tests to biochemical and pathological alterations observed in the lung. Cytological and reproductive potential endpoints were also assessed after acrolein exposure. Rats were exposed to acrolein for 6 hours/day, 5 days/week for 62 days. Mortality was observed only in the 4.0 ppm chamber where 32 of 57 exposed males died; however, none of the 8 exposed females died. Most of the mortality occurred within the first 10 exposure days. Histologic examination indicated that the animals died of acute bronchopneumonia. The surviving males and females exposed to 4.0 ppm acrolein gained weight at a significantly slower rate than control animals. The growth of both sexes in the 0.4 and 1.4 ppm groups was similar to that of their respective controls. Histopathologic examination of animals after 62 days of exposure revealed bronchiolar epithelial necrosis and sloughing, bronchiolar edema with macrophages, and focal pulmonary edema in the 4.0 ppm group. These lesions were, in some cases, associated with edema of the trachea and peribronchial lymph nodes, and acute rhinitis which indicated an upper respiratory tract effect of acrolein. Of particular interest was the variability of response between rats in the 4.0 ppm group, some not affected at all while others were moderately affected. Intragroup variability in toxicity was also apparent in the 1.4 ppm exposure group where only 3 of 31 animals examined had lesions directly related to acrolein exposure. Extra respiratory organs appeared unaffected.




Characterization of angiotensin I-converting enzyme (ACE)-containing follicles in the rat ovary during the estrous cycle and effects of ACE inhibitor on ovulation  

SciTech Connect

Ovarian angiotensin I (Ang I)-converting enzyme (ACE), estimated by the specific binding of the ACE inhibitor (125I)iodo-MK-351A, is localized on multiple ovarian structures, including follicular granulosa cells, corpora lutea, terminal epithelium, and ovarian blood vessels, but total ovarian ACE does not display a cyclic pattern of variation during the rat estrous cycle. We have previously shown that ACE is localized on the granulosa cell layer of a subpopulation of rat ovarian follicles. Our present study shows that ovarian granulosa cells contain high affinity (binding site affinity (Kd), approximately 90 pM) and low capacity (binding site density (Bmax), approximately 12 fmol/2.5 X 10(5) cells) (125I)iodo-MK-351A-binding sites and convert (125I)iodo-Ang I to (125I)iodo-Ang II (greater than 85% of this conversion was inhibited by the ACE inhibitor captopril). Throughout the rat estrous cycle, 94-100% of developing follicles and 89-96% of atretic follicles contained high levels of ACE; however, ACE was either not observed or its levels were very low in preovulatory follicles. These findings indicate the presence of high levels of biologically active ACE on the surface of granulosa cells and suggest a potential role for follicular ACE in early stages of follicular maturation and atresia. Although ACE is known to process a variety of peptides found within the ovary, and these peptides may have opposing effects on follicular maturation, we attempted to define the cumulative effect of ACE inhibition on follicular maturation.

Daud, A.I.; Bumpus, F.M.; Husain, A. (Research Institute of the Cleveland Clinic Foundation, OH (USA))



Adipose tissue stearoyl-CoA desaturase 1 index is increased and linoleic acid is decreased in obesity-prone rats fed a high-fat diet  

E-Print Network (OSTI)

in the adipose tissue and whether these changes occur simul- taneously across lipid fractions. It has previously been found that a HFD, especially a diet rich in SFA, decreases SCD expression in both rat liver and adipose tissue [33,34]. A HFD has also been shown... of petroleum ether containing 0.005% butylated hydroxytolvene after addition of 1.5 ml distilled water. The phases were separated after thorough mixing and centrifugation at 1500 g for 10 min. The petroleum ether phase was pipetted off and the solvent...

Cedernaes, Jonathan; Alsi, Johan; Vstermark, ke; Risrus, Ulf; Schith, Helgi B



Characterization of solubilized atrial natriuretic peptide receptors from rat olfactory bulb and A10 cultured smooth muscle cells  

SciTech Connect

Atrial natriuretic peptide (ANP) receptors from A10 cultured vascular smooth muscle cells (VSMC) and rat olfactory bulbs have been solubilized and then pharmacologically and biochemically compared. The dissociation constant for 125I-ANP(99-126) was 12.7 pM for the VSMC-derived receptor and 164 pM for the olfactory receptor. Competition binding between 125I-ANP(99-126) and several unlabeled ANP analogs with the soluble olfactory receptor, demonstrated a rank order potency of ANP(99-126) = ANP(103-126) much greater than ANP(103-123). However, the rank order potency of the soluble VSMC ANP receptor was ANP(99-126) = ANP(103-126) = ANP(103-123). Therefore, the olfactory ANP receptor appears to require the complete COOH-terminal sequence of ANP as compared with the VSMC ANP receptor. When the 2 soluble receptor preparations were applied to a GTP-agarose column, a portion of the olfactory ANP receptor was retained on the column and could be eluted with 5 mM GTP, while the VSMC ANP receptor did not adsorb to the column. Since the olfactory bulb ANP receptor has been shown to contain a binding component of 116 kDa, while the VSMC ANP receptor binding component is 66 kDa, these receptors appear to be similar to the 2 receptor classes described recently in which the 120 kDa receptor that binds GTP is postulated to be coupled to guanylate cyclase, while the 60 kDa receptor does not bind GTP, is not coupled to guanylate cyclase, and may possess a hormone clearance function. Taken together, these data indicate that cyclic GMP appears to be a second messenger for ANP in the brain.

Gibson, T.R.; Zyskind, A.D.; Glembotski, C.C.



Long-term mequindox treatment induced endocrine and reproductive toxicity via oxidative stress in male Wistar rats  

SciTech Connect

Mequindox (MEQ) is a synthetic antimicrobial chemical of quinoxaline 1, 4-dioxide group. This study was designed to investigate the hypothesis that MEQ exerts testicular toxicity by causing oxidative stress and steroidal gene expression profiles and determine mechanism of MEQ testicular toxicity. In this study, adult male Wistar rats were fed with MEQ for 180 days at five different doses as 0, 25, 55, 110 and 275 mg/kg, respectively. In comparison to control, superoxide dismutase (SOD), reduced glutathione (GSH) and 8-hydroxydeoxyguanosine (8-OHdG) levels were elevated at 110 and 275 mg/kg MEQ, whereas the malondialdehyde (MDA) level was slightly increase at only 275 mg/kg. Furthermore, in LC/MS-IT-TOF analysis, one metabolite 2-isoethanol 4-desoxymequindox (M11) was found in the testis. There was significant decrease in body weight, testicular weight and testosterone at 275 mg/kg, serum follicular stimulating hormone (FSH) at 110 and 275 mg/kg, while lutinizing hormone (LH) levels were elevated at 110 mg/kg. Moreover, histopathology of testis exhibited germ cell depletion, contraction of seminiferous tubules and disorganization of the tubular contents of testis. Compared with control, mRNA expression of StAR, P450scc and 17{beta}-HSD in testis was significantly decreased after exposure of 275 mg/kg MEQ while AR and 3{beta}-HSD mRNA expression were significantly elevated at the 110 mg/kg MEQ group. Taken together, our findings provide the first and direct evidence in vivo for the formation of free radicals during the MEQ metabolism through N {yields} O group reduction, which may have implications to understand the possible mechanism of male infertility related to quinoxaline derivatives.

Ihsan, Awais, E-mail: awais.dr@gmail.com [National Reference Laboratory of Veterinary Drug Residues and MOA Key Laboratory of Food Safety Evaluation, Huazhong Agricultural University, Wuhan 430070 (China); Wang Xu [National Reference Laboratory of Veterinary Drug Residues and MOA Key Laboratory of Food Safety Evaluation, Huazhong Agricultural University, Wuhan 430070 (China); Liu Zhaoying [National Reference Laboratory of Veterinary Drug Residues and MOA Key Laboratory of Food Safety Evaluation, Huazhong Agricultural University, Wuhan 430070 (China); College of Veterinary Medicine, Hunan Agricultural University, Changsha, Hunan 410128 (China); Wang Yulian [National Reference Laboratory of Veterinary Drug Residues and MOA Key Laboratory of Food Safety Evaluation, Huazhong Agricultural University, Wuhan 430070 (China); Huang Xianju [National Reference Laboratory of Veterinary Drug Residues and MOA Key Laboratory of Food Safety Evaluation, Huazhong Agricultural University, Wuhan 430070 (China); College of Pharmacy, South-Central University for Nationalities, Wuhan 430074 (China); Liu Yu; Yu Huan; Zhang Hongfei; Li Tingting; Yang Chunhui [National Reference Laboratory of Veterinary Drug Residues and MOA Key Laboratory of Food Safety Evaluation, Huazhong Agricultural University, Wuhan 430070 (China); Yuan Zonghui, E-mail: yuan5802@mail.hzau.edu.cn [National Reference Laboratory of Veterinary Drug Residues and MOA Key Laboratory of Food Safety Evaluation, Huazhong Agricultural University, Wuhan 430070 (China)



Mefenamic acid bi-directionally modulates the transient outward K{sup +} current in rat cerebellar granule cells  

Science Conference Proceedings (OSTI)

The effect of non-steroidal anti-inflammatory drugs (NSAIDs) on ion channels has been widely studied in several cell models, but less is known about their modulatory mechanisms. In this report, the effect of mefenamic acid on voltage-activated transient outward K{sup +} current (I{sub A}) in cultured rat cerebellar granule cells was investigated. At a concentration of 5 {mu}M to 100 {mu}M, mefenamic acid reversibly inhibited I{sub A} in a dose-dependent manner. However, mefenamic acid at a concentration of 1 {mu}M significantly increased the amplitude of I{sub A} to 113 {+-} 1.5% of the control. At more than 10 {mu}M, mefenamic acid inhibited the amplitude of I{sub A} without any effect on activation or inactivation. In addition, a higher concentration of mefenamic acid induced a significant acceleration of recovery from inactivation with an increase of the peak amplitude elicited by the second test pulse. Intracellular application of mefenamic acid could significantly increase the amplitude of I{sub A}, but had no effect on the inhibition induced by extracellular mefenamic acid, implying that mefenamic acid may exert its effect from both inside and outside the ion channel. Furthermore, the activation of current induced by intracellular application of mefenamic acid was mimicked by other cyclooxygenase inhibitors and arachidonic acid. Our data demonstrate that mefenamic acid is able to bi-directionally modulate I{sub A} channels in neurons at different concentrations and by different methods of application, and two different mechanisms may be involved.

Zhang Man; Shi Wenjie; Fei Xiaowei; Liu Yarong; Zeng Ximin [Institute of Brain Science, School of Life Sciences and State Key Laboratory of Medical Neurobiology, Fudan University, Shanghai 200433 (China); Mei Yanai [Institute of Brain Science, School of Life Sciences and State Key Laboratory of Medical Neurobiology, Fudan University, Shanghai 200433 (China)], E-mail: yamei@fudan.edu.cn



A comparative integrated transcript analysis and functional characterization of differential mechanisms for induction of liver hypertrophy in the rat  

SciTech Connect

The main goal of the present work was to better understand the molecular mechanisms underlying liver hypertrophy (LH), a recurrent finding observed following acute or repeated drug administration to animals, using transcriptomic technologies together with the results from conventional toxicology methods. Administration of 5 terminated proprietary drug candidates from participating companies involved in the EU Innomed PredTox Project or the reference hepatotoxicant troglitazone to rats for up to a 14-day duration induced LH as the main liver phenotypic toxicity outcome. The integrated analysis of transcriptomic liver expression data across studies turned out to be the most informative approach for the generation of mechanistic models of LH. In response to a xenobiotic stimulus, a marked increase in the expression of xenobiotic metabolizing enzymes (XME) was observed in a subset of 4 studies. Accumulation of these newly-synthesized proteins within the smooth endoplasmic reticulum (SER) would suggest proliferation of this organelle, which most likely is the main molecular process underlying the LH observed in XME studies. In another subset of 2 studies (including troglitazone), a marked up-regulation of genes involved in peroxisomal fatty acid {beta}-oxidation was noted, associated with induction of genes involved in peroxisome proliferation. Therefore, an increase in peroxisome abundance would be the main mechanism underlying LH noted in this second study subset. Together, the use of transcript profiling provides a means to generate putative mechanistic models underlying the pathogenesis of liver hypertrophy, to distinguish between subtle variations in subcellular organelle proliferation and creates opportunities for improved mechanism-based risk assessment.

Boitier, Eric, E-mail: eric.boitier@sanofi-aventis.com [sanofi aventis R and D, Disposition, Safety and Animal Research, Vitry sur Seine (France); Amberg, Alexander [sanofi aventis R and D, Disposition, Safety and Animal Research, Frankfurt (Germany); Barbie, Valerie [Merck Serono S.A., Stratified Medicine, Geneva (Switzerland); Blichenberg, Arne [Nycomed GmbH, Institute for Pharmacology and Preclinical Drug Safety, Barsbuettel (Germany); Brandenburg, Arnd; Gmuender, Hans [Genedata AG, Basel (Switzerland); Gruhler, Albrecht [Novo Nordisk A/S, Protein Science, Malov (Denmark); McCarthy, Diane [Bio-Rad Laboratories, Hercules, CA (United States); Meyer, Kirstin; Riefke, Bjoern; Raschke, Marian [Bayer Schering Pharma AG, Investigational Toxicology, Berlin (Germany); Schoonen, Willem [MSD, Toxicology and Drug Disposition, Oss (Netherlands); Sieber, Maximilian [Universitaet Wuerzburg, Institut fuer Toxikologie, Wuerzburg (Germany); Suter, Laura [Hoffmann-La Roche Ltd., Investigative Toxicology, Basel (Switzerland); Thomas, Craig E. [Eli Lilly and Company, Investigative Toxicology, Indianapolis, IN (United States); Sajot, Nicolas [Servier, Drug Safety Assessment, Orleans-Gidy (France)




E-Print Network (OSTI)

Abstract Aims: This study aimed at comparing the cerebral cytotoxicity of ethanol and its main metabolite acetaldehyde after acute or chronic exposures of rat astrocytes in primary culture. Methods: Cytotoxicity was evaluated on the cell reduction of viability (MTT reduction test) and on the characterization of DNA damage by single cell gel electrophoresis (or comet assay). Results: Changes in astrocyte survival and in DNA integrity only occurred when the astrocytes were chronically exposed to ethanol (20 mM; 3, 6 or 9 days). On the other hand, viability and DNA integrity were deeply affected by acute exposure to acetaldehyde. Both effects were dependent on the concentration of acetaldehyde. The cytotoxic effect of acetaldehyde was also indirectly evaluated after modifications of the normal ethanol metabolism by the use of different inducers or inhibitors. In presence of ethanol, the concomitant induction of catalase (i.e. by glucose oxidase) and inhibition of aldehyde dehydrogenase (i.e. by methylene blue) led to acetaldehyde accumulation within cells. It was followed by both a reduction in viability and a substantial increase in DNA strand breaks. Conclusions: These data were thus consistent with a possible predominant role of acetaldehyde during brain ethanol metabolism. On the other hand, the effects observed after AMT could also suggest a possible direct ethanol effect and a role for free radical attacks. These data were thus consistent with a possible predominant role of acetaldehyde during brain ethanol metabolism. On the other hand, the effects observed after AMT could also suggest a possible direct ethanol effect and a role for free radical attacks.

N. Signorini-allibe; B. Gonthier; F. Lamarche; H. Eysseric; L. Barret



Nicotine dose-concentration relationship and pregnancy outcomes in rat: Biologic plausibility and implications for future research  

Science Conference Proceedings (OSTI)

Cigarette smoke (CS) exposure during pregnancy can lead to profound adverse effects on fetal development. Although CS contains several thousand chemicals, nicotine has been widely used as its surrogate as well as in its own right as a neuroteratogen. The justification for the route and dose of nicotine administration is largely based on inferential data suggesting that nicotine 6 mg/kg/day infused continuously via osmotic mini pumps (OMP) would mimic maternal CS exposure. We provide evidence that 6 mg/kg/day nicotine dose as commonly administered to pregnant rats leads to plasma nicotine concentrations that are 3-10-fold higher than those observed in moderate to heavy smokers and pregnant mothers, respectively. Furthermore, the cumulative daily nicotine dose exceeds by several hundred fold the amount consumed by human heavy smokers. Our study does not support the widely accepted notion that regardless of the nicotine dose, a linear nicotine dose-concentration relationship exists in a steady-state OMP model. We also show that total nicotine clearance increases with advancing pregnancy but no significant change is observed between the 2nd and 3rd trimester. Furthermore, nicotine infusion even at this extremely high dose has little effect on a number of maternal and fetal biologic variables and pregnancy outcome suggesting that CS constituents other than nicotine mediate the fetal growth restriction in infants born to smoking mothers. Our current study has major implications for translational research in developmental toxicology and pharmacotherapy using nicotine replacement treatment as an aid to cessation of cigarette smoking in pregnant mothers.

Hussein, Jabeen [Department of Pediatrics, Health Sciences Center, 3330 Hospital Drive NW, Calgary, Alberta, T2N 4N1 (Canada); Farkas, Svetlana [Department of Pediatrics, Health Sciences Center, 3330 Hospital Drive NW, Calgary, Alberta, T2N 4N1 (Canada); MacKinnon, Yolanda [Department of Pediatrics, Health Sciences Center, 3330 Hospital Drive NW, Calgary, Alberta, T2N 4N1 (Canada); Ariano, Robert E. [Pharmacology and Therapeutics, University of Manitoba, Winnipeg, Manitoba (Canada); Sitar, Daniel S. [Departments of Internal Medicine and, Pediatrics and Child Health, University of Manitoba, Winnipeg, Manitoba (Canada); Pharmacology and Therapeutics, University of Manitoba, Winnipeg, Manitoba (Canada); Hasan, Shabih U. [Department of Pediatrics, Health Sciences Center, 3330 Hospital Drive NW, Calgary, Alberta, T2N 4N1 (Canada)]. E-mail: hasans@ucalgary.ca



Synergistic acceleration of thyroid hormone degradation by phenobarbital and the PPAR{alpha} agonist WY14643 in rat hepatocytes  

Science Conference Proceedings (OSTI)

Energy balance is maintained by controlling both energy intake and energy expenditure. Thyroid hormones play a crucial role in regulating energy expenditure. Their levels are adjusted by a tight feedback-controlled regulation of thyroid hormone production/incretion and by their hepatic metabolism. Thyroid hormone degradation has previously been shown to be enhanced by treatment with phenobarbital or other antiepileptic drugs due to a CAR-dependent induction of phase II enzymes of xenobiotic metabolism. We have recently shown, that PPAR{alpha} agonists synergize with phenobarbital to induce another prototypical CAR target gene, CYP2B1. Therefore, it was tested whether a PPAR{alpha} agonist could enhance the phenobarbital-dependent acceleration of thyroid hormone elimination. In primary cultures of rat hepatocytes the apparent half-life of T3 was reduced after induction with a combination of phenobarbital and the PPAR{alpha} agonist WY14643 to a larger extent than after induction with either compound alone. The synergistic reduction of the half-life could be attributed to a synergistic induction of CAR and the CAR target genes that code for enzymes and transporters involved in the hepatic elimination of T3, such as OATP1A1, OATP1A3, UGT1A3 and UGT1A10. The PPAR{alpha}-dependent CAR induction and the subsequent induction of T3-eliminating enzymes might be of physiological significance for the fasting-induced reduction in energy expenditure by fatty acids as natural PPAR{alpha} ligands. The synergism of the PPAR{alpha} agonist WY14643 and phenobarbital in inducing thyroid hormone breakdown might serve as a paradigm for the synergistic disruption of endocrine control by other combinations of xenobiotics.

Wieneke, N.; Neuschaefer-Rube, F. [University of Potsdam, Institute of Nutrition Science, Biochemistry of Nutrition, Arthur-Scheunert-Allee 114-116, D14558 Nuthetal (Germany); Bode, L.M. [University of Potsdam, Institute of Nutrition Science, Food Chemistry, Arthur-Scheunert-Allee 114-116, D14558 Nuthetal (Germany); Kuna, M. [University of Potsdam, Institute of Nutrition Science, Biochemistry of Nutrition, Arthur-Scheunert-Allee 114-116, D14558 Nuthetal (Germany); Andres, J. [Charite - Campus Benjamin Franklin, Department of Endocrinology, Diabetes and Nutrition, Hindenburgdamm 30, 12200 Berlin (Germany); Carnevali, L.C. [Universidade de Sao Paulo, Departamento de Biologia Celular e Desenvolvimento, Instituto de Ciencias Biomedicas, Sao Paulo, SP (Brazil); Hirsch-Ernst, K.I. [Georg-August-Universitaet Goettingen, Institute of Pharmakology and Toxikology, Molekular Pharmakology, Robert-Koch-Str. 40, D-37075 Goettingen (Germany); Pueschel, G.P. [University of Potsdam, Institute of Nutrition Science, Biochemistry of Nutrition, Arthur-Scheunert-Allee 114-116, D14558 Nuthetal (Germany)], E-mail: gpuesche@uni-potsdam.de




co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...

Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel



Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.



Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela


Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P


Effect of protein kinase C inhibitors on the actions of phorbol esters on vascular tone and adrenergic transmission in the isolated rat kidney  

SciTech Connect

The effect of protein kinase C (PKC) inhibitors 1-(5-isoquinoline-sulfonyl)-2-methylpiperazine (H-7), polymyxin B (PMB), D-sphingosine (SPH), sangivamycin (SNG) and staurosporin (ST) on the action of PKC activators phorbol 12,13-dibutyrate (PDBu) and 12-o-tetradecanoylphorbol-13-acetate (TPA), on adrenergic neuroeffector events was investigated to determine the contribution of PKC in adrenergic transmission in the rat kidney. Infusion of TPA (5 x 10(-6) mM) or PDBu (6 x 10(-6) mM) produced renal vasoconstriction and enhanced the overflow of tritium elicited by periarterial renal nerve stimulation (RNS) (2 Hz) in the isolated rat kidney perfused with Tyrode's solution and prelabeled with (3H)norepinephrine. H-7 (2.7 x 10(-3) mM) and ST (2 x 10(-5) mM) did not alter RNS-induced overflow of tritium but attenuated the vasoconstrictor response to RNS and exogenous NE. PMB (1 x 10(-8) mM) and SPH (3.3 x 10(-4) mM) but not SNG (3.3 x 10(-3) mM) attenuated the RNS-induced overflow of tritium but increased the basal renal vascular tone and enhanced the vasoconstrictor response to RNS and exogenous NE. H-7, PMB, SPH, SNG or ST failed to alter the effects of PDBu to increase basal vascular tone and the overflow of tritium and the increase in renal vasoconstriction to RNS. PMB at 1 x 10(-9) mM but not at 1 x 10(-8) mM and SPH (3.3 x 10(-4) mM) but not H-7, SNG or ST inhibited the effect of TPA to increase the overflow of tritium. The effect of TPA on the vasoconstrictor response to RNS or to increase basal vascular tone was not altered by PKC inhibitors. These data suggest that in the rat kidney, PKC is either resistant to the actions of H-7, PMB, SPH, SNG and ST, or PDBu and TPA produce renal vasoconstriction and facilitate adrenergic transmission by a mechanism unrelated to PKC activation.

Sehic, E.; Malik, K.U. (Univ. of Tennessee, Memphis (USA))



DHA down-regulates phenobarbital-induced cytochrome P450 2B1 gene expression in rat primary hepatocytes by attenuating CAR translocation  

Science Conference Proceedings (OSTI)

The constitutive androstane receptor (CAR) plays an important role in regulating the expression of detoxifying enzymes, including cytochrome P450 2B (CYP 2B). Phenobarbital (PB) induction of human CYP 2B6 and mouse CYP 2b10 has been shown to be mediated by CAR. Our previous study showed that PB-induced CYP 2B1 expression in rat primary hepatocytes is down-regulated by both n-6 and n-3 polyunsaturated fatty acids (PUFAs), especially docosahexaenoic acid (DHA); however, the mechanism for this down-regulation by DHA was previously unknown. The objective of the present study was to determine whether change in CAR translocation is involved in the down-regulation by n-6 and n-3 PUFAs of PB-induced CYP 2B1 expression in rat primary hepatocytes. We used 100 {mu}M arachidonic acid, linoleic acid, eicosapentaenoic acid, and DHA to test this hypothesis. PB triggered the translocation of CAR from the cytosol into the nucleus in a dose-dependent and time-dependent manner in our hepatocyte system, and the CAR distribution in rat primary hepatocytes was significantly affected by DHA. DHA treatment decreased PB-inducible accumulation of CAR in the nuclear fraction and increased it in the cytosolic fraction in a dose-dependent manner. The down-regulation of CYP 2B1 expression by DHA occurred in a dose-dependent manner, and a similar pattern was found for the nuclear accumulation of CAR. The results of immunoprecipitation showed a CAR/RXR heterodimer bound to nuclear receptor binding site 1 (NR-1) of the PB-responsive enhancer module (PBREM) of the CYP 2B1gene. The EMSA results showed that PB-induced CAR binding to NR-1 was attenuated by DHA. Taken together, these results suggest that attenuation of CAR translocation and decreased subsequent binding to NR-1 are involved in DHA's down-regulation of PB-induced CYP 2B1 expression.

Li, C.-C.; Lii, C.-K.; Liu, K.-L. [Department of Nutrition, Chung Shan Medical University, Taichung, Taiwan (China); Yang, J.-J. [School of Dentistry, Chung Shan Medical University, Taichung, Taiwan (China); Chen, H.-W. [Department of Nutrition, Chung Shan Medical University, Taichung, Taiwan (China)], E-mail: hawwen@csmu.edu.tw



Effects of chloroquine and hepatic stimulator substance on cellular accumulation and nuclear binding of sup 125 I-epidermal growth factor in primary culture of adult rat hepatocytes  

SciTech Connect

The effects of chloroquine and hepatic stimulator substance (HSS) on cellular accumulation and nuclear binding of {sup 125}I-epidermal growth factor (EGF) were examined in primary culture of adult rat hepatocytes. When intact hepatocytes were incubated at 37{degrees}C with {sup 125}I-EGF, the cellular accumulation and the nuclear binding reached a peak at 1 h and declined thereafter, where the nuclear binding was 2.49% at 1 h and 2.53% at 2 h. Chloroquine resulted in a time-dependent increase in the cellular accumulation and the nuclear binding was 3.37% at 1 h and 3.72% at 2 h. In contrast, HSS produced no change in each value, suggesting that HSS does not modulate EGF receptors in plasma membrane and nucleus.

Murawaki, Y.; Storkenmaier, R.; Fleig, W.E.; Hahn, E.G. (Tottori Univ. School of Medicine, Yonago (Japan))



Determination of the functional size of oxytocin receptors in plasma membranes from mammary gland and uterine myometrium of the rat by radiation inactivation  

Science Conference Proceedings (OSTI)

Gel filtration of detergent-solubilized oxytocin (OT) receptors in plasma membrane fractions from both regressed mammary gland and labor myometrium of the rat, showed that specific (/sup 3/H)OT binding was associated with a heterogeneously sized population of macromolecules. As radiation inactivation is the only method available to measure the apparent molecular weights of membrane proteins in situ, we used this approach to define the functional sizes of OT receptors. The results indicate that both mammary and myometrial receptors are uniform in size and of similar molecular mass. Mammary and myometrial receptors were estimated to be 57.5 +/- 3.8 (SD) and 58.8 +/- 1.6 kilodaltons, respectively. Knowledge of the functional size of OT receptors will be useful in studies involving the purification and characterization of the receptor and associated membrane components.

Soloff, M.S.; Beauregard, G.; Potier, M.


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Toxicometabolomics approach to urinary biomarkers for mercuric chloride (HgCl{sub 2})-induced nephrotoxicity using proton nuclear magnetic resonance ({sup 1}H NMR) in rats  

Science Conference Proceedings (OSTI)

The primary objective of this study was to determine and characterize surrogate biomarkers that can predict nephrotoxicity induced by mercuric chloride (HgCl{sub 2}) using urinary proton nuclear magnetic resonance ({sup 1}H NMR) spectral data. A procedure for {sup 1}H NMR urinalysis using pattern recognition was proposed to evaluate nephrotoxicity induced by HgCl{sub 2} in Sprague-Dawley rats. HgCl{sub 2} at 0.1 or 0.75 mg/kg was administered intraperitoneally (i.p.), and urine was collected every 24 h for 6 days. Animals (n = 6 per group) were sacrificed 3 or 6 days post-dosing in order to perform clinical blood chemistry tests and histopathologic examinations. Urinary {sup 1}H NMR spectroscopy revealed apparent differential clustering between the control and HgCl{sub 2} treatment groups as evidenced by principal component analysis (PCA) and partial least square (PLS)-discriminant analysis (DA). Time- and dose-dependent separation of HgCl{sub 2}-treated animals from controls was observed by PCA of {sup 1}H NMR spectral data. In HgCl{sub 2}-treated rats, the concentrations of endogenous urinary metabolites of glucose, acetate, alanine, lactate, succinate, and ethanol were significantly increased, whereas the concentrations of 2-oxoglutarate, allantoin, citrate, formate, taurine, and hippurate were significantly decreased. These endogenous metabolites were selected as putative biomarkers for HgCl{sub 2}-induced nephrotoxicity. A dose response was observed in concentrations of lactate, acetate, succinate, and ethanol, where severe disruption of the concentrations of 2-oxoglutarate, citrate, formate, glucose, and taurine was observed at the higher dose (0.75 mg/kg) of HgCl{sub 2}. Correlation of urinary {sup 1}H NMR PLS-DA data with renal histopathologic changes suggests that {sup 1}H NMR urinalysis can be used to predict or screen for HgCl{sub 2}-induced nephrotoxicity{sub .}

Kim, Kyu-Bong, E-mail: kyubong@inje.ac.k [Korea Food and Drug Administration, 5-Nokbun-dong, Eunpyung-gu, Seoul 122-704 (Korea, Republic of); Department of Pharmaceutical Engineering, Inje University, Obang-dong, Gimhae, Gyungnam 621-749 (Korea, Republic of); Um, So Young, E-mail: syum@kfda.go.k [Korea Food and Drug Administration, 5-Nokbun-dong, Eunpyung-gu, Seoul 122-704 (Korea, Republic of); Chung, Myeon Woo, E-mail: mwchung@kfda.go.k [Korea Food and Drug Administration, 5-Nokbun-dong, Eunpyung-gu, Seoul 122-704 (Korea, Republic of); Jung, Seung Chul, E-mail: ipipe4@nate.co [Korea Food and Drug Administration, 5-Nokbun-dong, Eunpyung-gu, Seoul 122-704 (Korea, Republic of); Oh, Ji Seon, E-mail: aquajs24@nate.co [Korea Food and Drug Administration, 5-Nokbun-dong, Eunpyung-gu, Seoul 122-704 (Korea, Republic of); Kim, Seon Hwa, E-mail: hwa2003@kfda.go.k [Korea Food and Drug Administration, 5-Nokbun-dong, Eunpyung-gu, Seoul 122-704 (Korea, Republic of); Na, Han Sung, E-mail: nhk1515@korea.k [Korea Food and Drug Administration, 5-Nokbun-dong, Eunpyung-gu, Seoul 122-704 (Korea, Republic of); Lee, Byung Mu, E-mail: bmlee@skku.ed [College of Pharmacy, Sungkyunkwan University, 300 Cheoncheon-dong, Jangan-gu, Suwon, Gyeonggi-do 440-746 (Korea, Republic of); Choi, Ki Hwan, E-mail: hyokwa11@korea.k [Korea Food and Drug Administration, 5-Nokbun-dong, Eunpyung-gu, Seoul 122-704 (Korea, Republic of)



Effect of Treating Streptozotocin-induced Diabetic Rats With Sorbinil, Myo-inositol or Aminoguanidine on Endoneurial Blood Flow, Motor Nerve Conduction Velocity and Vascular Function of Epineurial Arterioles of the Sciatic Nerve  

E-Print Network (OSTI)

Previously we have demonstrated that diabetes causes impairment in vascular function of epineurial vessels, which precedes the slowing of motor nerve conduction velocity. Treatment of diabetic rats with aldose reductase inhibitors, aminoguanidine or myo-inositol supplementation have been shown to improve motor nerve conduction velocity and/or decreased endoneurial blood flow. However, the effect these treatments have on vascular reactivity of epineurial vessels of the sciatic nerve is unknown. In these studies we examined the effect of treating streptozotocininduced rats with sorbinil, aminoguanidine or myo-inositol on motor nerve conduction velocity, endoneurial blood flow and endotheliumdependent vascular relaxation of arterioles that provide circulation to the region of the sciatic nerve. Treating diabetic rats with sorbinil, aminoguanidine or myo-inositol improved the reduction of endoneurial blood flow and motor nerve conduction velocity. However, only sorbinil treatment significantly improved the diabetes-induced impairment of acetylcholinemediated vasodilation of epineurial vessels of the sciatic nerve. All three treatments were efficacious in preventing the appropriate metabolic derangements associated with either activation of the polyol pathway or increased nonenzymatic glycation. In addition, sorbinil was shown to prevent the diabetes-induced decrease in lens glutathione level. However, other mark-

Lawrence J. Coppey; Jill S. Gellett; Eric P. Davidson; Joyce A. Dunlap; Mark; A. Yorek



Solubilization and molecular characterization of the atrial natriuretic peptide (ANP) receptor in human platelets: Comparison with ANP receptors in rat tissues  

SciTech Connect

We have previously demonstrated the presence of binding sites for atrial natriuretic peptide (ANP) in human platelets. These sites have pharmacological characteristics similar to those of rat vascular smooth muscle. They are subject to regulation by circulating levels of ANP in plasma, varying inversely with the latter after high sodium intake, in arterial hypertension and congestive heart failure. We have now solubilized these platelet receptors with the nonionic detergent Triton X-100 (0.6%). The preparations were incubated with (125I)ANP in the presence of increasing concentrations of ANP-(99-126), ANP-(101-126), ANP-(103-126), and ANP-(103-123). The order of potency of these peptides to displace (125I)ANP was similar for the solubilized and particulate receptor. Bound (125I)ANP was covalently cross-linked to the receptor with 5 mM disuccinimidyl suberate. Autoradiography of the sodium dodecyl sulfate-polyacrylamide gel showed that (125I)ANP specifically interacts with a 125-kDa membrane component, some of which may be reduced by 2% mercaptoethanol or 10 mmol/L dithiothreitol to a 70-kDa species. A small proportion of a 70-kDa peptide is also found under nonreducing conditions. The concentration of ANP-(99-126) that inhibits binding of (125I)ANP by 50% to both the 125-kDa and the 70-kDa species was 0.1 nM, while that for ANP-(103-123) was 3 nM. The internally ring-deleted analog Des(Gln116,Ser117,Gly118,Leu119,Gly120)ANP -(102-121) or C-ANP displaced with equal potency ANP binding to the high and low mol wt (Mr) bands, as also found in cultured rat vascular smooth muscle cells, but not in the mesemteric arteries these cells are derived from. In the latter, C-ANP displaced only binding from the lower Mr band. These results show that the ANP receptor in human platelets is heterogeneous.

Schiffrin, E.L.; Carrier, F.; Thibault, G.; Deslongchamps, M. (Clinical Research Institute of Montreal, Quebec (Canada))



Effects of pre- and postnatal exposure to the UV-filter Octyl Methoxycinnamate (OMC) on the reproductive, auditory and neurological development of rat offspring  

Science Conference Proceedings (OSTI)

Octyl Methoxycinnamate (OMC) is a frequently used UV-filter in sunscreens and other cosmetics. The aim of the present study was to address the potential endocrine disrupting properties of OMC, and to investigate how OMC induced changes in thyroid hormone levels would be related to the neurological development of treated offspring. Groups of 14-18 pregnant Wistar rats were dosed with 0, 500, 750 or 1000 mg OMC/kg bw/day during gestation and lactation. Serum thyroxine (T{sub 4}), testosterone, estradiol and progesterone levels were measured in dams and offspring. Anogenital distance, nipple retention, postnatal growth and timing of sexual maturation were assessed. On postnatal day 16, gene expression in prostate and testes, and weight and histopathology of the thyroid gland, liver, adrenals, prostate, testes, epididymis and ovaries were measured. After weaning, offspring were evaluated in a battery of behavioral and neurophysiological tests, including tests of activity, startle response, cognitive and auditory function. In adult animals, reproductive organ weights and semen quality were investigated. Thyroxine (T{sub 4}) levels showed a very marked decrease during the dosing period in all dosed dams, but were less severely affected in the offspring. On postnatal day 16, high dose male offspring showed reduced relative prostate and testis weights, and a dose-dependent decrease in testosterone levels. In OMC exposed female offspring, motor activity levels were decreased, while low and high dose males showed improved spatial learning abilities. The observed behavioral changes were probably not mediated solely by early T{sub 4} deficiencies, as the observed effects differed from those seen in other studies of developmental hypothyroxinemia. At eight months of age, sperm counts were reduced in all three OMC-dosed groups, and prostate weights were reduced in the highest dose group. Taken together, these results indicate that perinatal OMC-exposure can affect both the reproductive and neurological development of rat offspring, which may be a cause of concern, as humans are systematically exposed to the compound through usage of sunscreens and other cosmetics.

Axelstad, Marta, E-mail: maap@food.dtu.dk [Division of Toxicology and Risk Assessment, National Food Institute, Technical University of Denmark, Morkhoj Bygade 19, DK-2860 Soborg (Denmark); Boberg, Julie [Division of Toxicology and Risk Assessment, National Food Institute, Technical University of Denmark, Morkhoj Bygade 19, DK-2860 Soborg (Denmark); Hougaard, Karin Sorig [National Research Centre for the Working Environment, Lerso Parkalle 105, DK-2100, Copenhagen O (Denmark); Christiansen, Sofie; Jacobsen, Pernille Rosenskjold; Mandrup, Karen Riiber; Nellemann, Christine [Division of Toxicology and Risk Assessment, National Food Institute, Technical University of Denmark, Morkhoj Bygade 19, DK-2860 Soborg (Denmark); Lund, Soren Peter [National Research Centre for the Working Environment, Lerso Parkalle 105, DK-2100, Copenhagen O (Denmark); Hass, Ulla [Division of Toxicology and Risk Assessment, National Food Institute, Technical University of Denmark, Morkhoj Bygade 19, DK-2860 Soborg (Denmark)



Research Article Curcumin Decreased Oxidative Stress, Inhibited NF-?B Activation, and Improved Liver Pathology in Ethanol-Induced Liver Injury in Rats  

E-Print Network (OSTI)

To study the mechanism of curcumin-attenuated inflammation and liver pathology in early stage of alcoholic liver disease, female Sprague-Dawley rats were divided into four groups and treated with ethanol or curcumin via an intragastric tube for 4 weeks. A control group treated with distilled water, and an ethanol group was treated with ethanol (7.5 g/kg bw). Treatment groups were fed with ethanol supplemented with curcumin (400 or 1 200 mg/kg bw). The liver histopathology in ethanol group revealed mild-tomoderate steatosis and mild necroinflammation. Hepatic MDA, hepatocyte apoptosis, and NF-?B activation increased significantly in ethanol-treated group when compared with control. Curcumin treatments resulted in improving of liver pathology, decreasing the elevation of hepatic MDA, and inhibition of NF-?B activation. The 400 mg/kg bw of curcumin treatment revealed only a trend of decreased hepatocyte apoptosis. However, the results of SOD activity, PPAR? protein expression showed no difference among the groups. In conclusion, curcumin improved liver histopathology in early stage of ethanol-induced liver injury by reduction of oxidative stress and inhibition of NF-?B activation. Copyright 2009 Suchittra Samuhasaneeto et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 1.

Suchittra Samuhasaneeto; Duangporn Thong-ngam; Onanong Kulaputana; Doungsamon Suyasunanont; Naruemon Klaikeaw



A method for in vitro culture of rat Zymbal gland: use in mechanistic studies of benzene carcinogenesis in combination with 2P-postlabeling. Environ. Health Perspect. 82  

E-Print Network (OSTI)

Zymbal glands were excised bilaterally from the ear ducts of female Sprague-Dawley rats (three/group), minced into approximately four fragments per gland, and transferred into a microtiter plate containing 1.5 mL per well of Waymouth's tissue culture medium supplemented with fetal calf serum, hydrocortisone, insulin, and gentamicin. After addition of a test compound or solvent vehicle, plates were incubated for 6, 24, 48, or 96 hr at 37C in a humidified atmosphere of 5 % CO2 in air. Tissue in culture for 6 hr was histologically indistinguishable from the freshly excised tissue, while that in culture for 24, 48, and 96 hr showed a progressive deterioration often with necrosis and/or squamous metaplasia. More pronounced deterioration was noted in samples treated with 750 or 1500 pg/mL of benzene. Using a nuclease Pi-enhanced 32P-postlabeling assay, aromatic DNA adducts were detected in cultured Zymbal glands exposed for 48 hr to benzene and its derivatives, as well as to 7,12-dimethylbenzanthracene (DMBA) and 2-acetylaminofluorene (AAF). Benzene produced very low levels of adducts (0.5 adducts per 109 nucleotides), whereas its congeners produced relatively high levels of adducts (50-2000 lesions per 109 nucleotides), which decreased in the order benzoquinone> hydroquinone> phenol> benzenetriol> catechol. Each adduct profile overall was characteristic for the compound studied, suggesting the formation of compound-specific electrophiles. AAF and DMBA adducts were identical to those formed in vivo in animals. Our results show that the Zymbal glands are capable of metabolizing different carcinogens to DNA-reactive intermediates, a process that may be causally associated with tumor formation in vivo in this organ.

M. Vijayaraj Reddy; Gary R. Blackburn; Susan E. Irwin; Choudari Kommineni; Carl R. Mackerer; Myron A. Mehiman



Arsenite reduces insulin secretion in rat pancreatic {beta}-cells by decreasing the calcium-dependent calpain-10 proteolysis of SNAP-25  

SciTech Connect

An increase in the prevalence of type 2 diabetes has been consistently observed among residents of high arsenic exposure areas. We have previously shown that in rat pancreatic {beta}-cells, low arsenite doses impair the secretion of insulin without altering its synthesis. To further study the mechanism by which arsenite reduces insulin secretion, we evaluated the effects of arsenite on the calcium-calpain pathway that triggers insulin exocytosis in RINm5F cells. Cell cycle and proliferation analysis were also performed to complement the characterization. Free [Ca{sup 2+}]i oscillations needed for glucose-stimulated insulin secretion were abated in the presence of subchronic low arsenite doses (0.5-2 {mu}M). The global activity of calpains increased with 2 {mu}M arsenite. However, during the secretion of insulin stimulated with glucose (15.6 mM), 1 {mu}M arsenite decreased the activity of calpain-10, measured as SNAP-25 proteolysis. Both proteins are needed to fuse insulin granules with the membrane to produce insulin exocytosis. Arsenite also induced a slowdown in the {beta} cell line proliferation in a dose-dependent manner, reflected by a reduction of dividing cells and in their arrest in G2/M. Data obtained showed that one of the mechanisms by which arsenite impairs insulin secretion is by decreasing the oscillations of free [Ca{sup 2+}]i, thus reducing calcium-dependent calpain-10 partial proteolysis of SNAP-25. The effects in cell division and proliferation observed with arsenite exposure can be an indirect consequence of the decrease in insulin secretion.

Diaz-Villasenor, Andrea [Department of Genomic Medicine and Environmental Toxicology, Instituto de Investigaciones Biomedicas, Universidad Nacional Autonoma de Mexico (Mexico); Burns, Anna L. [Department of Genomic Medicine and Environmental Toxicology, Instituto de Investigaciones Biomedicas, Universidad Nacional Autonoma de Mexico (Mexico); Facultad de Medicina, Universidad Nacional Autonoma de Mexico (Mexico); Salazar, Ana Maria; Sordo, Monserrat [Department of Genomic Medicine and Environmental Toxicology, Instituto de Investigaciones Biomedicas, Universidad Nacional Autonoma de Mexico (Mexico); Hiriart, Marcia [Department of Biophysics, Instituto de Fisiologia Celular, Universidad Nacional Autonoma de Mexico (Mexico); Cebrian, Mariano E. [Section of Environmental Toxicology, CINVESTAV, IPN (Mexico); Ostrosky-Wegman, Patricia [Department of Genomic Medicine and Environmental Toxicology, Instituto de Investigaciones Biomedicas, Universidad Nacional Autonoma de Mexico (Mexico)], E-mail: ostrosky@servidor.unam.mx



Relationship between calcium loading and impaired energy metabolism during Na+, K+ pump inhibition and metabolic inhibition in cultured neonatal rat cardiac myocytes  

SciTech Connect

This study tested the hypothesis that the initiating mechanism is a major determinant of the response to calcium (Ca) accumulation in myocardium. Cultured neonatal rat ventriculocytes were exposed to Na+, K+ pump inhibition with 1 mM ouabain and metabolic inhibition with 20 mM 2-deoxy-D-glucose and 1 mM cyanide (DOG-CN) for up to 2 h. Microspectrofluorometry of myocytes loaded with fura-2 showed that ouabain resulted in a relatively rapid increase in (Ca2+)i up to 2-3 microM (two to threefold above peak systolic level) and that DOG-CN produced an initial decrease and then a relatively slow increase in (Ca2+)i up to peak systolic level. Electron probe x-ray microanalysis (EPMA) showed prominent increases in Na and Ca and decreases in K and Mg in cytoplasm and mitochondria with both interventions, although the increases in Ca were greater with ouabain than DOG-CN. ATP was reduced by 58% after 1 and 2 h of ouabain and by 70 and 90% after 1 and 2 h of DOG-CN, respectively. Thus, ouabain produced greater calcium accumulation and less ATP reduction than DOG-CN. Upon return to normal medium for 30 min, myocytes showed recovery of most electrolyte alterations and resumption of normal Ca2+ transients after 1 h exposure to either ouabain or DOG-CN; however, recovery was less after 2 h of either treatment, with elevated (Ca2+)i maintained in many myocytes. We conclude that the severity of myocyte injury is influenced by the magnitude and duration of both ATP reduction and calcium accumulation.

Morris, A.C.; Hagler, H.K.; Willerson, J.T.; Buja, L.M.



Polybrominated diphenyl ether (PBDE)-induced alterations in vitamin A and thyroid hormone concentrations in the rat during lactation and early postnatal development  

Science Conference Proceedings (OSTI)

In experimental animals fed standard laboratory diets, penta-BDE mixtures can decrease circulating thyroid hormone and liver vitamin A concentrations. A substantial number of pregnant women and their children have marginal vitamin A status, potentially increasing their risk of adverse effects to penta-BDE exposure. The current study investigated the effects of maternal gestational and lactational penta-BDE exposure on thyroid hormone and vitamin A homeostasis in rats of sufficient vitamin A (VAS) or marginal vitamin A (VAM) status and their offspring. Dams were administered daily oral doses of 18 mg/kg DE-71 (a penta-BDE mixture) or a corn oil vehicle from gestation day 6 through lactation day (LD) 18. Thyroid hormone and vitamin A homeostasis were assessed in plasma and tissues of LD 19 dams and postnatal day (PND) 12, 18, and 31 pups. DE-71 exposure induced hepatomegaly in VAS and VAM pups at all timepoints and increased testes weights at PND 31. While liver vitamin A concentrations were low in DE-71 treated dams and pups, plasma retinol concentrations and plasma retinol binding protein levels were only low in VAM animals exposed to DE-71. DE-71 exposure lowered plasma thyroxine concentrations in VAS and VAM dams and pups. Plasma thyroid stimulating hormone concentrations were high in VAM dams exposed to DE-71, suggesting that marginal vitamin A status enhances the susceptibility to thyroid hormone axis disruption by DE-71. These results support the concept that marginal vitamin A status in pregnant women may increase the risk for PBDE-induced disruptions in vitamin A and thyroid hormone homeostasis.

Ellis-Hutchings, Robert G. [Department of Nutrition, University of California-Davis, Davis, CA 95616 (United States); Department of Environmental Toxicology, University of California-Davis, Davis, CA 95616 (United States); Cherr, Gary N. [Department of Nutrition, University of California-Davis, Davis, CA 95616 (United States); Department of Environmental Toxicology, University of California-Davis, Davis, CA 95616 (United States); Bodega Marine Laboratory, University of California-Davis, Bodega Bay, CA 94923 (United States); Hanna, Lynn A. [Department of Nutrition, University of California-Davis, Davis, CA 95616 (United States); Keen, Carl L. [Department of Nutrition, University of California-Davis, Davis, CA 95616 (United States) and Department of Internal Medicine, University of California-Davis, Davis, CA 95616 (United States)]. E-mail: clkeen@ucdavis.edu



Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti



Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius



Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.



1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.



I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc


Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl


Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION

Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS


I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals


Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of


Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.


Long-Lasting Reductions of Ethanol Drinking, Enhanced Ethanol-Induced Sedation, and Decreased c-fos Expression in the Edinger-Westphal Nucleus in Wistar Rats Exposed to  

E-Print Network (OSTI)

Intermittent or continuous exposure to a wide variety of chemically unrelated environmental pollutants might result in the development of multiple chemical intolerance and increased sensitivity to drugs of abuse. Interestingly, clinical evidence suggests that exposure to organophosphates might be linked to increased ethanol sensitivity and reduced voluntary consumption of ethanol-containing beverages in humans. The growing body of clinical and experimental evidence emerging in this new scientific field that bridges environmental health sciences, toxicology, and drug research calls for well-controlled studies aimed to analyze the nature of the neurobiological interactions of drugs and pollutants. Present study specifically evaluated neurobiological and behavioral responses to ethanol in Wistar rats that were previously exposed to the pesticide organophosphate chlorpyrifos (CPF). In agreement with clinical data, animals pretreated with a single injection of CPF showed long-lasting ethanol avoidance that

The Organophosphate Chlorpyrifos; Francisca Carvajal; Matilde Lpez-grancha; Montserrat Navarro; Maria Del Carmen Snchez-amate; Inmaculada Cubero



Follicle-stimulating hormone receptor-mediated uptake of sup 45 Ca sup 2+ by proteoliposomes and cultured rat sertoli cells: Evidence for involvement of voltage-activated and voltage-independent calcium channels  

Science Conference Proceedings (OSTI)

We have previously reported incorporation into liposomes of Triton X-100-solubilized FSH receptor-G-protein complexes derived from purified bovine calf testis membranes. In the present study we have used this model system to show that FSH induces flux of 45Ca2+ into such proteoliposomes in a hormone-specific concentration-dependent manner. FSH, inactivated by boiling, had no stimulatory effect on 45Ca2+ flux, nor did isolated alpha- or beta-subunits of FSH. Addition of GTP (or its analogs 5'-guanylylimidodiphosphate and guanosine-5'-O-(3-thiotriphosphate)) or sodium fluoride (in the presence or absence of GTP or its analogs) failed to induce 45Ca2+ flux into proteoliposomes, suggesting that the uptake of 45Ca2+ was receptor, and not G-protein, related. Voltage-independent (ruthenium red and gadolinium chloride) and voltage-activated (methyoxyverapamil and nifedipine) calcium channel-blocking agents reduced FSH-stimulated 45Ca2+ flux into proteoliposomes to control levels. FSH also induced uptake of 45Ca2+ by cultured rat Sertoli cells. Ruthenium red and gadolinium chloride had no effect on basal levels of 45Ca2+ uptake or estradiol secretion by cultured rat Sertoli cells, nor did methoxyverapamil or nifedipine. All four calcium channel blockers, however, were able to reduce FSH-induced 45Ca2+ uptake to basal levels and FSH-stimulated conversion of androstenedione to estradiol by up to 50%, indicating an involvement of Ca2+ in FSH-stimulated steroidogenesis. Our results suggest that the well documented changes in intracellular calcium levels consequent to FSH binding may be due, at least in part, to an influx of calcium through FSH receptor-regulated calcium channels.

Grasso, P.; Reichert, L.E. Jr. (Albany Medical College, NY (USA))



Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...


Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard



Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...


Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...


--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...


Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob



Whither the Keiretsu, Japan's Business Networks? How Were They Structured? What Did They Do? Why Are They Gone?  

E-Print Network (OSTI)

Construction Nippon Flour Mills Kirin Brewery Oji PaperSa Textile NIPPON FLOUR MILLS Mi Food TORAY INDUSTRIES Mi

Lincoln, James R.; Shimotani, Masahiro



Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsa- miR-195. Hsa-miR-30a and hsa-miR-195 were...



Science Conference Proceedings (OSTI)

The principal objective of the study was to test a new analytical technique, Solid-Phase Microextraction (SPME), for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. This involved measuring the effectiveness of SPME to extract hydrocarbons under controlled conditions in the laboratory. As part of the study, a field demonstration was undertaken to assess the validity and usefulness of the laboratory results. Presented in this quarterly report is the condensed version of the Case History and Well Summary for the Bear Lake area in Manistee County, Michigan. The full version will be in the annual report. The condensed case history presents the important technical details regarding the geochemistry and horizontal lateral for Bear Lake, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan




SciTech Connect

The geochemical sampling team collected additional 148 samples at Vernon Field along 5 new traverses. Most of the locations were sampled for three types of analyses: microbial, iodine and enzyme leach; no results from the second batch of samples were available in time for this report. In addition to the sampling, a study was begun on the feasibility of collecting and analyzing hydrocarbon gases (C1-C8) directly. Although several companies offer these services, the cost ($200-300/sample w/o sampling fee) is high, on par with the cost of a 3D seismic survey, and may not include the raw data. However direct sampling of reservoir gases collecting in the soil appear to offer the best approach and should be included in this study. It would probably work well at Vernon Field. It may be possible to lower costs considerably; initial estimates of $20/sample for GCMS (Gas Chromatography--mass spectrometry) analysis are attractive and might induce to Michigan producers to include soil surveys in their routine field work-ups. A complete set of digital data was assembled for Vernon Field and nearby locations. The set consists of well locations, formation top picks, lithologies and scanned images of driller's reports and scout tickets. Well logs are still being located. The annual meeting for the Class Revisit work group is tentatively scheduled for the week of March 1-7 in Tampa, Fl. By that time all of the geochemical data will be available and final decisions regarding drilling can be made.

James R. Wood; T.J. Bornhorst; S.D. Chittichk; William B. Harrison; W. Quinlan




SciTech Connect

A principal goal of the Budget Period I was to demonstrate that surface geochemistry could be used to locate bypassed hydrocarbons in old fields. This part of the program was successful. A surface geochemical survey, employing 5 different techniques, was carried out in the Spring and Summer of 2000 and a demonstration well, the State Vernon & Smock 13-23 HD1 (permit number: PN 53945) was drilled in Vernon Township, Isabella County, Michigan in the late fall of 2000. A demonstration well was selected and drilled based on geologic considerations and surface geochemistry. Over 460 soil samples were collected and analyzed over the drill site. A good anomaly was detected near the proposed well site and the demonstration well, the Smock 13-23, was drilled to a depth of 3157 feet by November 17, 2000. Two laterals were drilled, and hydrocarbons were located in a zone approximately 175 feet in length. However, it was determined that the pay zone was too small and difficult reservoir conditions (water production) prevented putting the well in production. The Smock 13-23 was shut in and abandoned January 15, 2001. A post-mortem determined that the main reason the well was not economic was because the zone was nearly completely flushed by earlier recovery operations. The post mortem also revealed the presence of an unmapped shale plug crossing the first lateral. It appears that this shale was detected by the geochemical survey, but its significance was not appreciated at the time. It is possible that sections of the well were faulty, ''porposing'' up and down so as to create water blockages. We are continuing to use the Vernon Field and the demonstration well to calibrate the geochemical data. Eventually, this study may provide a standard site that can be used to test and calibrate geochemical anomalies, something that does not presently exist. A postmortem report on the well, including the geology and geochemistry used to site the well, is presented in Appendix I. Five geochemical techniques have been tested in Phase I. These include surface iodine, microbial, enzyme leaching, soil gas and subsurface iodine. We are most comfortable with the results of the microbial surveys but feel that direct measurement of soil gas is the best method if analytical difficulties can be overcome. The reason the microbial surveys are presently favored is because they provide a logical, consistent picture that is easy to interpret and easy to explain. This in turn is because the microbial anomaly is manifested as an ''apical'' as opposed to an ''edge'' or ''halo'' anomaly. Several lessons were learned during Phase I activities. The main one was that surface geochemistry could locate anomalies over old fields such as Vernon. We also learned that horizontal drilling has advantages and disadvantages in situations such as this. On the plus side, it does provide a means to probe for pockets of bypassed oil, but it is expensive relative to vertical (or slant wells?) and is difficult to control in a narrow pay zone. We tentatively conclude that horizontal wells do not provide a cost-effective solution in this setting and suggest that geochemical anomalies be investigated via a single vertical well or multiple vertical wells.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan; E. Taylor


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. A major part of the remaining project will focus on using surface geochemistry to delineate prospects. A Niagaran reef field geochemical survey, the Bagley Prospect area in Otsego County, Michigan is scheduled to take place this summer. Previous wells drilled in Bagley Prospect area in the early 1970's and in place in late 2002 and early 2003 resulted in discoveries and numerous hydrocarbon shows in the Brown Niagaran reservoir interval. The Bagley region is still considered an area of interest by the industry and appears ripe for a geochemical survey. Our industry partner is interested in a possible test in the Bagley prospect because subsurface geophysical and geological interpretation indicates the presence of structures. Anomalous production and pressure data further suggest the region is not yet well understood and should not be considered mature. The most recent well, the Bagley 1-22A sidetrack, was unsuccessful at locating a new reef culmination to the south of the original vertical well and did not encounter hydrocarbon shows. The sidetrack and well were plugged and abandoned. The proposed geochemical survey will concentrate on areas away from the Bagley 1-22A to the north and west but will include the entire prospect so that the existing data can be used in interpretations. Bagley appears to offer a unique combination of potential and data for a geochemical study that focuses on looking for new oil in an area that has exhausted traditional geologic and geophysical methods. The Bear Lake pinnacle reef trend in Manistee County, Michigan, is also scheduled for further geochemical work this summer. Industry interest, mostly by small companies, is picking up in this area and it is also ripe for targeted geochemical surveys for the same reasons cited above.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

One of the main objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, several field demonstrations were undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The important observations from each of these field demonstrations are briefly reviewed in this annual report. These demonstrations have been successful in identifying the presence or lack of hydrocarbons in the subsurface and can be summarized as follows: (1) The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path of the State Springdale & O'Driscoll No.16-16 horizontal demonstration well in Manistee County, Michigan. The well was put on production in December 2003. To date, the well is flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which is a good well in Michigan. Reserves have not been established yet. Two successful follow-up horizontal wells have also been drilled in the Springdale area. Additional geochemistry data will be collected in the Springdale area in 2004. (2) The surface geochemistry sampling in the Bear Lake demonstration site in Manistee County, Michigan was updated after the prospect was confirmed and production begun; the original subsurface and seismic interpretation used to guide the location of the geochemical survey for the Charlich Fauble re-entry was different than the interpretation used by the operator who ultimately drilled the well. As expected, the anomaly appears to be diminishing as the positive (apical) microbial anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. (3) The geochemical sampling program over the Vernon Field, Isabella County, Michigan is now interpreted as a large negative anomaly associated with the entire field. The results of the State Smock horizontal well and the Bowers 4-25 well confirmed the lack of additional recoverable hydrocarbons in the Vernon Field. (4) The surface geochemistry data showed a strong anomaly in the Myrtle Beach, Burke County, North Dakota area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the geological and geophysical data; the microbial values here were the highest we have observed. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling, however, a pipeline has not yet been completed that would allow the wells to be placed into production. We also present in this annual report the results of recent efforts to map carbonate facies tracts in the middle Devonian Dundee and Rogers City Limestones using gamma ray, bulk density, and photoelectric effect geophysical well log amplitudes. This work was undertaken to identify fairways for exploration in the Dundee and Rogers City where surface geochemical techniques could then be used to screen potential leads.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Two major accomplishments resulted from Phase I. One is the success of the surface geochemistry program, which collected over 800 samples from the site of the 1st demonstration well in Vernon Field and has pretty well provided us with the tools to delineate favorable ground from unfavorable. The second is the recent detailed mapping of the Central Michigan Basin that for the first time revealed the presence of at least two major faults that control the location of many of the reservoirs in the Michigan Basin. These faults were located from structure maps obtained by contouring the surface of the Dundee Formation using top picks from 9861 wells in 14 counties. Faults were inferred where the contour lines were most dense (''stacked'').

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan




SciTech Connect

The fault study continues to find more faults and develop new techniques to visualize them. Data from the Dundee Formation has been used to document 11 major faults in the Michigan Basin which have now been verified using data from other horizons. These faults control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new GC laboratory is now functional and has been fully staffed as of December. The annual project review was held March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer. A request was made to extend the scope of the project to include the Willison Basin. A demonstration well has been suggested in Burke County, N. Dakota, following a review of 2D seismic and surface geochem. A 3D seismic survey is scheduled for the prospect.

James R. Wood; T.J. Bornhorst; William B. Harrison; W. Quinlan




SciTech Connect

In this reporting period, we extended the fault study to include more faults and developed new techniques to visualize the faults. We now have used data from the Dundee Formation to document 11 major faults in the Michigan Basin and are in the process of reviewing data from other horizons. These faults appear to control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new laboratory is now functional and has been fully staffed as of December. The annual project review has been set for March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan



Role of microRNA?155 in dendritic cells and macrophages MiR?155 directly targets PU.1 and IL13R1.  

E-Print Network (OSTI)

??In search of genes differentially expressed between M1 (pro?Th1 or pro?inflammatory) and M2 (pro?Th2 or pro?tolerogenic) macrophages, BIC (microRNA 155 hosting gene) was found up (more)

Martinez?Nunez, Rocio Teresa



1. (P) M.I. Ojovan, W.E. Lee. New Developments in Glassy Nuclear Wasteforms. Nova Science Publishers, New York, 131p. (2007).  

E-Print Network (OSTI)

xxx Keywords: A. Intermetallics, miscellaneous B. Phase diagrams B. Thermodynamic and thermochemical in the Vienna ab-initio simulation package (VASP) [27]. We used the generalized gradient approximation (GGA, Lamoreaux RH. Molybdenum: physicochemical properties of its compounds and alloys. I. thermochemical

Ojovan, Michael


Summary of the EPRI Early Event Analysis of the Fukushima Daiichi Spent Fuel Pools Following the March 11, 2011 Earthquake and Tsuna mi in Japan  

Science Conference Proceedings (OSTI)

Damage to the Fukushima Daiichi Unit 4 reactor building observed on March 15, 2011, initially generated confusion and concern throughout the nuclear industry. The reactor had been defueled approximately 100 days prior to the March 11 earthquake and tsunami; therefore, any explosion in Unit 4 could not be linked to a recently operating reactor within that unit. With the full core in the spent fuel pool, suspicions immediately turned to hydrogen generated by oxidation of overheating spent fuel cladding fol...



Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

converting any H 2 gas produced to water) and measuring thefor the tritium produced in pore water of the fractured rockfor the tritium produced in pore water of the fractured rock



LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 16, 1994 Place Time Name GroupGroup Place Time Name GroupGroup  

E-Print Network (OSTI)

-49 8 30 11:56.7 Dan Gheng Wool 40-49 1 89 13 of the participants. The official number of finishers was 780, including babies in strollers page 7 #12;HISTORY OF LBL



SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The main news this reporting period is the confirmed discovery of producing hydrocarbons at the State Springdale & O'Driscoll No.16-16 demonstration well in Manistee County. This well was spudded in late November, tested and put on production in December 2003. To date it is flowing nearly 100 barrels of liquid hydrocarbons per day, which is a good well in Michigan. Reserves have not been established yet. The surface geochemistry sampling at the Springdale demonstration site will be repeated this spring after the well has been on production for several months to see if the anomaly pattern changes. We expect that the anomaly will diminish as the original positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. This is the behavior that we observed at the Bear lake demonstration well reported last quarter.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

In this reporting period two main accomplishments stand out. The Springdale task is in play in the northern Michigan Basin and the geochemical survey work over the Springdale prospect continued to progress. We still need to characterize the play in terms of the type of trap (basal reef diagenetic (?)) and its relation to the well documented pinnacle reef play. Also, we have become aware that Capac Field in the southern reef trend (Figure 1) is a possible analog to Springdale and so will be looking more closely at the literature on that field, particularly the work by Bowers (1987). Future work is directed toward further defining the Springdale project via more wells and examination and characterization of well cuttings. One to two more geochemical surveys are planned, one this spring and a final one in early fall. Based on current oil prices and Springdale production as of January 2005, an ROI, (defined as Total liquids revenue, $5.45m/DOE support, $1.45m) better than 3.75. This does not include gas revenues, which have not yet been calculated.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

Three horizontal wells have been completed (St. Springdale & Trezil 9-15 HD, St. Springdale 13-14 HD, St. Springdale & Stedronsky 10-15 HD) and three more wells were spudded (St. Springdale & CSX 2-22 HD, St. Springdale & Mann 9-21 HD and St. Springdale 7-22 HD) in the Springdale play this past reporting period. All are horizontal wells in the Brown Niagaran. This brings the total wells in the play to 12 with seven wells contributing to a total daily production exceeding 350 bbls/day. Data from these wells has been converted from drillers logs (footage calls) and converted to Michigan GeoRef coordinates and plotted. The Gamma Ray data along the well bore was available since it was used to steer the tool during drilling and this data was superimposed on the well trajectories in an effort to help distinguish pay zones from unproductive rock. One new geochemical survey was conducted over the projected surface path of the State Springdale & Stedronsky 14-15 HD and a final project survey was planned over one of the unsurveyed wells. This will bring the total surveyed wells to five and should provide enough data to determine if the idea of only sampling along the well bore is a sound strategy.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, plans were finalized for additional surface geochemical sampling in the new Springdale Prospect field demonstration in Manistee County, Michigan. Plans were also developed to acquire additional surface geochemical data in the vicinity of the Bagley Prospect area in Otsego County, Michigan. The main news this reporting period is the continued success in the Springdale demonstration area. The State Springdale & O'Driscoll No.16-16 and the State Springdale & Herban 12-16 horizontal demonstration wells in Manistee County, Michigan are both flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which are good wells in Michigan. Reserves have not been established yet. A third horizontal well, the State Springdale & Wilburn 1-21 HD has been drilled and is waiting on completion. Two more horizontal wells have been permitted in the Springdale area by our industry partner.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Springdale prospect area in Manistee County, Michigan. The samples were taken along the trace of the proposed horizontal wells. The samples are presently being analyzed and the results will be reported in the next quarterly report. The main news this reporting period is that the Springdale prospect area in Manistee County, Michigan, continues to see drilling activity. Our industry partner, Jordan Development Company, LLC, is permitting additional horizontal wells following their success in the prospect area.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Presented in this quarterly report is the Case History and Well Summary for the Vernon Field demonstration project in Isabella County, Michigan. This new case history and well summary format organizes and presents the technical and historical details of the Vernon Field demonstration, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion. Planning for the annual project meeting in Tampa, Florida has begun. This meeting will be held March 7-9, 2003 at the same site as the last three meetings. The goals of this project were to: (1) test the use of multi-lateral wells to recover bypassed hydrocarbons and (2) to access the potential of using surface geochemistry to reduce drilling risk. Two new demonstration wells, the State-Smock and the Bowers 4-25, were drilled to test the Dundee Formation at Vernon Field for bypassed oil. Neither well was commercial, although both produced hydrocarbon shows. An extensive geochemical survey in the vicinity of Vernon Field, covering much of Isabella County, has produced a base map for interpretation of anomalies in Michigan. Several potential new anomalies were discovered that could be further investigated.

James R. Wood; W. Quinlan




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The surface geochemistry sampling at the original Bear Lake demonstration site was updated several months after the prospect was confirmed and production begun. As expected, the anomaly appears to be diminishing as the positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir.

James R. Wood; W. Quinlan



Functional miRNA regulation of metastatic genes promotes tumor cell dissemination in non-small cell and small cell lung carcinomas  

E-Print Network (OSTI)

Tumor progression, from initiation to advanced metastatic disease, requires the orchestration of a diverse group of cell-intrinsic and extrinsic factors. This multifactorial disease is promoted by an accumulation of genetic ...

Blat, Irene Catherine



Energetics of gas-driven limnic and volcanic eruptions Department of Geological Sciences, The University of Michigan, Ann Arbor, MI 48109-1063, USA  

E-Print Network (OSTI)

and when equilibrium is reached between the gas and liquid phases Natural silicate melts often contain two.3. Dynamics of reversible gas-driven eruptions through a fluid medium Because buoyancy plays an important roleEnergetics of gas-driven limnic and volcanic eruptions Y. Zhang* Department of Geological Sciences

Zhang, Youxue


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

from three different sources (fractured rock, concrete, and+Rock Concentration, no Decay, Rock Source Concentration,Decay, Rock Source Mass Storage, no Decay, Rock Source Mass


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

nontritium-bearing drilling fluid during the coring process,nontritium-bearing drilling fluid during the coring process,cores be drilled with drilling fluid spiked with a tracer.




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, a field demonstration was undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a strong anomaly in the Myrtle Beach area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the 3D seismic data. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling. Presented in this quarterly report is the Case History and Well Summary for the Myrtle Beach area in Burke County, North Dakota. This case history presents the important technical details regarding the geochemistry and the two vertical wells that are part of this field demonstration, and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and is being used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan



AND FINANCIAL 2011 Edition | EConoMiC And FinAnCiAL PRoFiLE oF QUBEC  

E-Print Network (OSTI)

ENERGY AGENCY. SOURCE: HYDRO-QU?BEC, COMPARISON OF ELECTRICITY PRICES IN MAJOR NORTH AMERICAN CITIES renewable energy, hydro-electricity in particular. It supports the development of wind power through its Energy Strategy 2006-2015, Hydro-Québec is actively pursuing development of Québec's hydroelectric

Rosei, Federico



SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Trusty Steed prospect area in Grand Traverse County, Michigan. The samples were analyzed using the Microbial Oil Surveying Technique (MOST) technique and revealed only a local (1-point) anomaly. A decision to resample over that point is pending, but drilling has been postponed for the time being. The main news this reporting period is that in the Bear Lake area, northwest Michigan, Federated Oil & Gas Properties' Charlich-Fauble 2-9HD horizontal lateral, has cumulative production of more than 72,000 barrels of oil and is still producing 50 to 75 bopd from a Silurian Niagaran reef reservoir eighteen months after the well was completed. Surface geochemical surveys conducted in the demonstration area were consistent with production results although the ultimate decision to drill was based on interpretation of conventional subsurface and 2D seismic data. The surface geochemical techniques employed were Solid Phase MicroExtraction (SPME) and MOST. The geochemical results have been submitted to World Oil for publication. New geochemical surveys are planned for November in the Springdale quadrangle in Manistee County, Michigan. These surveys will concentrate on sampling over the trace of the proposed horizontal wells rather than a broad grid survey.

James R. Wood; A. Wylie; W. Quinlan



The Metabolism of Curium in the RAT  

E-Print Network (OSTI)

alpha particle transmutation of plutonium by the follow- ingan alpha. particle to form plutonium 238 which, in turn, isits radioactive daughter, plutonium 238, has a half-life of

Hamilton, J.



Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsamiR- 195. Hsa-miR-30a and hsa-miR-195 were...


,"Michigan Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050MI3","N3010MI3","N3020MI3","N3035MI3","N3045MI3" "Date","Natural Gas Citygate Price in Michigan (Dollars per Thousand Cubic Feet)","Michigan Price of...


Applications in the Nuclear Industry for Thermal Spray Amorphous Metal and Ceramic Coatings  

E-Print Network (OSTI)

Science & Technology 2007, Detroit, MI, Sept. 16 20, 2007,2007, Sept. 1620, 2007, Detroit, MI, American CeramicExhib. , Sept. 1620, 2007, Detroit, MI, American Ceramic

Blink, J.; Farmer, J.; Choi, J.; Saw, C.




NLE Websites -- All DOE Office Websites (Extended Search)

Vehicle Usage Number of trips 773,602 Total distance traveled (mi) 5,558,155 Avg trip distance (mi) 7.2 Avg distance traveled per day when the vehicle was driven (mi) 30.2 Avg...


Computational Enhancements in Low-Rank Semidefinite ...  

E-Print Network (OSTI)

Jul 12, 2004 ... curvature condition necessary for L-BFGS, to be more efficient than the WP linesearch if the ... The precise condition ..... (Mi D)Mi, Mi := AiR.


Tradeoffs between Costs and Greenhouse Gas Emissions in the Design of Urban Transit Systems  

E-Print Network (OSTI)

mi) Maintenance emissions (g/veh-mi) Total emissions (g/veh-mi) Total emissions (g/veh-km) Comments 15,300 Based onfrom Chester (2008); emissions from EIO-LCA (CMU 2012) 1,841

Griswold, Julia Baird



Energy Information Administration/Oil and Gas Field Code ...  

U.S. Energy Information Administration (EIA)

mississippi union 01-26n-9w grand traverse mi 055 003557 n 1969 union 02-26n-9w grand traverse mi 055 006252 n 1973 union 03-26n-9w grand traverse mi ...


Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

816 Maple St. 738 E. Gull Lake Dr. Three Rivers, MI 49093 Augusta, MI 49012 Business: Steam, air & hot water systems Business: Pharmaceutical manufacturing Tom Henry, Director of...


Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

experiments with approximately 25 hours and 51 minutes of luminosity - NuMI off due to power supply - MI transformer replaced Monday evening - Store established Tuesday morning...


Subsidized Housing and Neighborhood Change  

E-Print Network (OSTI)

97 Figure 3-6a Detroit, MI PMSA Neighborhood Quintile98 Figure 3-6b Detroit, MI PMSA Neighborhood Quintileinterviewing from the Detroit Area Study. Neighborhood

Wilson, Florence Louise



DOE - Office of Legacy Management -- General Motors Co - Flint...  

Office of Legacy Management (LM)

Motors Co - Flint - MI 07 FUSRAP Considered Sites Site: GENERAL MOTORS CO. (MI.07 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate...


E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve



NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Clean Energy Coalition - Michigan Green Fleets This CX form is for installing propane refueling infrastructure at one site in MI. This CX is for project selected under...



Science Conference Proceedings (OSTI)

...Tim Webber, IPG Photonics, Oxford, MA Frank Brennan, Trumpf, Plymouth, MI Rainer Uhlig, ABB, Fort Collins, CO Jim Cann, Rofin Sinar, Plymouth, MI Urban Widén, Permanova, Mölndal, Sweden Robert Borgstrom, Precitec, New Hudson, MI Scott Green, LT Ultra, New Hudson, MI Mike...

Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Supporting Information Evolution of Dendritic Platinum Nanosheets  

E-Print Network (OSTI)

87131. 3 Toyota Technical Center, Toyota Motor Engineering & Manufacturing North America, Ann Arbor, MI

Shelnutt, John A.


Civil Works Fact Sheets  

E-Print Network (OSTI)

HAMILTON DAM, FLINT RIVER, FLINT, MI ............................................ LRD-19 HOLES CREEK, WEST

US Army Corps of Engineers


MicroRNA expression in canine mammary cancer  

E-Print Network (OSTI)

MicroRNAs (miRNAs) play a vital role in differentiation, proliferation and tumorigenesis by binding to messenger RNAs (mRNA) and inhibiting translation. To initiate an investigation into the identification of miRNAs in the domestic dog, an emerging model for human disease, a comparison of the human and canine genetic databases was conducted. The bioinformatics work revealed significant conservation of miRNA genes between the two species. Proof of principle experiments, including serial dilutions and sequencing, were performed to verify that primers made to amplify human mature miRNAs can be used to amplify canine miRNAs, providing that the mature sequences are conserved. TaqMan Real-time RT-PCR, a sensitive and specific method, was used to isolate the first miRNA mature products from canine tissues. The expression levels of miR-17-3p, miR-17-5p, miR-18, miR-19a, miR-19b, miR-20, and miR-92 were evaluated in five canine tissues (heart, lung, brain, kidney, and liver). Because miRNAs have been found to act as both tumor suppressors and oncogenes in several different cancers, expression patterns of ten miRNAs (miR-15a, miR-16, miR-17-5p, miR-21, miR-29b, miR-125b, miR-145, miR-155, miR-181b, let-7f) known to be associated with human breast cancer were compared between malignant canine mammary tumors (n=6) and normal canine mammary tissue (n=10). Resulting data revealed miR-29b and miR-21 to have a statistically significant (p<0.05) up-regulation in cancerous samples. Overall expression patterns showed nine of the ten miRNAs follow the same pattern of expression in the domestic dog as the human, while the miR-145 expression does not show a difference between the normal and cancerous samples.

Boggs, Rene' Michelle




NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi)¹ 45 Overall DC electrical energy consumption (DC Wh/mi)² 22 Total number of trips 1,585 Total distance traveled (mi) 14,910 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 34 DC electrical energy consumption (DC Wh/mi) 49 Number of trips 883 Percent of trips city | highway 81% | 19% Distance traveled (mi) 4,778 Percent of total distance traveled 32%



NLE Websites -- All DOE Office Websites (Extended Search)

4 4 Overall AC electrical energy consumption (AC Wh/mi)¹ 64 Overall DC electrical energy consumption (DC Wh/mi)² 31 Total number of trips 831 Total distance traveled (mi) 7,559 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 35 DC electrical energy consumption (DC Wh/mi) 54 Number of trips 541 Percent of trips city | highway 79% | 21% Distance traveled (mi) 3,402 Percent of total distance traveled 45%


IL-1 beta and TNF-alpha upregulate angiotensin II type 1 (AT(1)) receptors on cardiac fibroblasts and are associated with increased AT(1) density in the post-MI heart  

E-Print Network (OSTI)

broblasts and the infarcted heart. Am J Physiol 1998;274:matrix remodeling in heart failure: a role for de novoin right and left heart after myocardial infarction. Mol

Gurantz, D; Cowling, R T; Varki, N; Frikovsky, E; Moore, C D; Greenberg, Barry H




E-Print Network (OSTI)

doxycycline make a difference? Maybe, but here was the catch: To slow IMHA's destruction of red blood cells- tion. How to get out of this catch-22? Start the doxycycline but "contin- ue to treat the IMHA because

Tufts University


Radiobiology of normal rat lung in Boron Neutron Capture Therapy  

E-Print Network (OSTI)

Boron Neutron Capture Therapy (BNCT) is a binary cancer radiation therapy that utilizes biochemical tumor cell targeting and provides a mixed field of high and low Linear Energy Transfer (LET) radiation with differing ...

Kiger, Jingli Liu



Pulmonary Edemagenesis in F-344 Rats Exposed to SFE ...  

Science Conference Proceedings (OSTI)

... initial cell damage -then type I1 cell proliferation), other enzyme ... of the active channels of this ... fluid will follow the path of least resistance (ie move to ...



Fluid shear-induced hypertrophy in neonatal rat ventricular myocytes  

E-Print Network (OSTI)

32 Figure 1: BNP and ANP Expression relative to GAPDH forNo Shear Ratio for BNP & ANP for Cardiomyocytes on Glass34 Figure 15: BNP and ANP Expression relative to Ef1 for

Fujimura, Atsushi



Pramipexole effects on startle gating in rats and normal men  

E-Print Network (OSTI)

brain regional activity of catechol-O-methyl transferase (reflex depends on the catechol O-methyltransferase Val158Met

Swerdlow, Neal R.; Lelham, Sophia A.; Sutherland Owens, Ashley N.; Chang, Wei-Li; Sassen, Sebastiaan D.; Talledo, Jo A.



Fluid shear-induced hypertrophy in neonatal rat ventricular myocytes  

E-Print Network (OSTI)

subjected to low shear rates, increase their beating ratedue to shear. Beating rates increase nearly 3 fold, which isstress increases protein synthesis rate and induces

Fujimura, Atsushi



Arginine and Conjugated Linoleic Acid Reduce Fat Mass in Rats  

E-Print Network (OSTI)

We hypothesized that subcutaneous (s.c.) adipose tissue would differ in monounsaturated (MUFA) and saturated fatty acid (SFA) composition among different depots throughout a beef carcass. To test this, 50 carcasses from a variety of breed types and backgrounds were sampled. External fat samples were collected from eight different carcass locations: round, sirloin, loin, rib, chuck, brisket, plate and flank. Samples were used to provide information on slip points, fatty acid composition and MUFA:SFA ratios. Lipids were extracted from s.c. adipose tissue by a modified chloroform:methanol procedure, and fatty acid composition and slip points were measured. The brisket was significantly lower in palmitic (16:0) and stearic (18:0) acid than the other seven sampling sites (P = 0.001). The brisket demonstrated the highest values of MUFA (P = 0.001) with the exception of possessing the lowest value of transvaccenic (18:1t11) acid (P = 0.002). There were also significant differences in the amounts of PUFA among the eight sampling sites. The lowest values were from the brisket with a mean of 25.1. The flank had the highest slip point with a mean of 39.0 (P ? 0.001). There was a high negative correlation shown between palmitoleic and stearic acid (R2 = 0.827). The brisket displayed the highest values for MUFA:SFA ratios (P = 0.001), whereas the flank was the lowest. Due to the significant differences amongst fat depots within bovine carcasses in their fatty acid composition we conclude that substantial differences exist across fat depots.

Nall, Jennifer L.



Water Retrieval by Norway Rats: Behavior as Deduction  

E-Print Network (OSTI)

by five rest. Average water intake for the days fiveon score sheets. Average water intake per day for five days

Wallace, R J



Cyclooxygenase-2 is Upregulated in Copper-Deficient Rats  

Science Conference Proceedings (OSTI)

the SOD mimetic Tempol (Cu-D/T; 1 mM in drinking water) for 4 weeks. COX-2 protein ... INTRODUCTION. Inadequate dietary intake of copper is known to.


Meeting the oxygen requirements of an isolated perfused rat liver  

E-Print Network (OSTI)

Liver perfusion systems can be used as organ culture platforms for metabolic, genetic and systems engineering, tissue regeneration, pharmacokinetics, organ storage and marginal donor reconditioning for transplantation. The ...

Izamis, Maria-Louisa, 1979-



Single Glucose Biofuel Cells Implanted in Rats Power Electronic Devices  

E-Print Network (OSTI)

fuel cells10­12 . These systems generate electricity under mild conditions through the oxidation the first implanted glucose biofuel cell (GBFC) that is capable of generating sufficient power from a mammal, vibra- tions or body movements to generate power for an implanted device are limited because

Recanati, Catherine


Spontaneous death of isolated adult rat cardiocytes in culture in ...  

Science Conference Proceedings (OSTI)

internucleosomal cleavage of genomic DNA. Apoptosis . Vol 2 . No 2 . 1997. S. Yamamoto, K. Yasui,* P. T. Palade and T. N. James. World Health Organization...


Formation of a Simple Cognitive Map by Rats  

E-Print Network (OSTI)

Thomas R. Zentall University of Kentucky, U.S.A. Cognitiveof Psychology, University of Kentucky, Lexington, KY 40506-was in accordance with University of Kentucky institutional

Singer, Rebecca A.; Abroms, Benjamin D.; Zentall, Thomas R.



Replay of memories of extended behavior in the rat hippocampus  

E-Print Network (OSTI)

The hippocampus is a highly conserved structure in the medial temporal lobe of the brain that is known to be critical for spatial learning in rodents, and spatial and episodic memory in humans. During pauses in exploration, ...

Davidson, Thomas James Damon Cheakamus


Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A Kallikrein 15 (KLK15) single nucleotide polymorphism located close to a novel exon shows evidence of association with poor ovarian cancer survival  

E-Print Network (OSTI)

of the UTR and splice site SNPs. Analysis for putative microRNA (miRNA) sites was performed using miRBase Targets V4, Target scan, miRanda, PicTar and Patrocles. Cell culture, RT PCR and sequencing of KLK15 putative promoter region The normal ovarian cell... intronic SNPs located within 30 bp of exon- intron boundaries. We also predicted miRNA binding sites using three different software programs; Target Scan, miRanda and Patrocles. A maximum of 32 miRNA bind- ing sites scattered throughout the gene were...

Batra, Jyotsna; Nagle, Christina M; O'Mara, Tracy; Higgins, Melanie; Dong, Ying; Tan, Olivia L; Lose, Felicity; Skeie, Lene Marie; Srinivasan, Srilakshmi; Bolton, Kelly L; Song, Honglin; Ramus, Susan J; Gayther, Simon A; Pharoah, Paul D P; Kedda, Mary-Anne; Spurdle, Amanda B; Clements, Judith A




NLE Websites -- All DOE Office Websites (Extended Search)

74 74 Number of trips 399 Distance traveled (mi) 148 Percent of total distance traveled (%) 73% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 6.3 Average Stops per mile 35.5 Percent of Regen Braking Energy Recovery (%) 11% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 423 Number of trips 27 Distance traveled (mi) 54 Percent of total distance traveled (%) 27% Average Trip Distance (mi) 2.0 Average Driving Speed (mph) 20.7 Average Stops per mile 3.5 Percent of Regen Braking Energy Recovery (%) 15% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 0 Number of trips 0 Distance traveled (mi) 0 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.0 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi)¹ 111 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 61 Total number of trips 1,135 Total distance traveled (mi) 4,408 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 296 Number of trips 264 Percent of trips city | highway 100% | 0% Distance traveled (mi) 781 Percent of total distance traveled 18% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 19 DC electrical energy consumption (DC Wh/mi) 141 Number of trips 44 Percent of trips city | highway 96% | 4% Distance traveled CD | CS (mi) 333 | 389 Percent of total distance traveled CD | CS



NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 493 Distance traveled (mi) 189 Percent of total distance traveled (%) 38% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 4.9 Average Stops per mile 28.7 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 377 Number of trips 67 Distance traveled (mi) 275 Percent of total distance traveled (%) 56% Average Trip Distance (mi) 4.1 Average Driving Speed (mph) 17.9 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 438 Number of trips 1 Distance traveled (mi) 29 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 28.7 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

505 505 Number of trips 601 Distance traveled (mi) 245 Percent of total distance traveled (%) 62% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.4 Average Stops per mile 34.8 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 373 Number of trips 35 Distance traveled (mi) 124 Percent of total distance traveled (%) 31% Average Trip Distance (mi) 3.5 Average Driving Speed (mph) 23.0 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 319 Number of trips 3 Distance traveled (mi) 25 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 8.5 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

1 1 Overall AC electrical energy consumption (AC Wh/mi)¹ 93 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 40 Total number of trips 11,047 Total distance traveled (mi) 119,879 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 25 DC electrical energy consumption (DC Wh/mi) 208 Number of trips 4,491 Percent of trips city | highway 92% | 8% Distance traveled (mi) 30,376 Percent of total distance traveled 25% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 71 Number of trips 1,352 Percent of trips city | highway 69% | 31% Distance traveled CD | CS (mi) 12,772 | 20,001 Percent of total distance traveled CD | CS



NLE Websites -- All DOE Office Websites (Extended Search)

613 613 Number of trips 89 Distance traveled (mi) 9 Percent of total distance traveled (%) 30% Average Trip Distance (mi) 0.1 Average Driving Speed (mph) 7.0 Average Stops per mile 44.5 Percent of Regen Braking Energy Recovery (%) 9% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 8 Distance traveled (mi) 5 Percent of total distance traveled (%) 16% Average Trip Distance (mi) 0.6 Average Driving Speed (mph) 25.0 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 6% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 7 Distance traveled (mi) 16 Percent of total distance traveled (%) 54% Average Trip Distance (mi) 2.3 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 1,610 Distance traveled (mi) 372 Percent of total distance traveled (%) 72% Average Trip Distance (mi) 0.2 Average Driving Speed (mph) 5.2 Average Stops per mile 32.1 Percent of Regen Braking Energy Recovery (%) 13% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 383 Number of trips 114 Distance traveled (mi) 144 Percent of total distance traveled (%) 28% Average Trip Distance (mi) 1.3 Average Driving Speed (mph) 18.3 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 16% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 549 Number of trips 5 Distance traveled (mi) 2 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.4 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

530 530 Number of trips 1,308 Distance traveled (mi) 495 Percent of total distance traveled (%) 69% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.6 Average Stops per mile 31.4 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 471 Number of trips 91 Distance traveled (mi) 175 Percent of total distance traveled (%) 24% Average Trip Distance (mi) 1.9 Average Driving Speed (mph) 16.6 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 357 Number of trips 2 Distance traveled (mi) 49 Percent of total distance traveled (%) 7% Average Trip Distance (mi) 24.7 Average Driving Speed (mph)


Computational and experimental analysis of plant microRNAs  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are small, endogenous, non-coding RNAs that mediate gene regulation in plants and animals. We demonstrated that Arabidopsis thaliana miRNAs are highly complementary (0-3 mispairs in an ungapped alignment) ...

Jones-Rhoades, Matthew W. (Matthew William)



Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

Johnson Controls, Inc. Ford Motor Company 2875 High Meadow Cir. 550 Town Center Dr., Ste 200 Auburn Hills, MI 48326-2773 Dearborn, MI 48126 Business: Building Automation, Facility...


Bang smad Villages New Year in 2011  

E-Print Network (OSTI)

and Mi Nyag Tibetan ??????? ??????????????????? Performer(s)'s first / native language Khams Tibetan and Mi Nyag Tibetan ??????? last updated by World Oral Literature Project staff on Wednesday, Tuesday, June 8, 2010 ??????????????????? Performer...

Bkar shis bzang po


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050mi2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050mi2a.htm" ,"Source:","Energy Information...


C:\\DS\\08-2225 - Final with Errata Page.wpd  

NLE Websites -- All DOE Office Websites (Extended Search)

per liter MgO magnesium oxide mi milemiles mi 2 square miles mL millilitermilliliters MOU memorandum of understanding mph miles per hour mrem milliremmillirem MRL method...


Screening SNPs residing in the microRNA-binding sites of Hepatocellular Carcinoma related genes  

Science Conference Proceedings (OSTI)

Single nucleotide polymorphisms located at miRNA-binding sites are likely to affect the expression of the miRNA targets and may contribute to the susceptibility of humans to common diseases. Here we selected 289 candidate Hepatocellular Carcinoma ...

Jun Ding; Yuzhen Gao; Yan He; Yifeng Zhou; Moli Huang; Haiyan Liu




NLE Websites -- All DOE Office Websites (Extended Search)

with battery state of charge below 90% (for charging events with SOC reported) Vehicle Usage Number of trips 3,364 Total distance traveled (mi) 21,706 Avg trip distance (mi) 5.8...


Many families of Caenorhabditis elegans microRNAs are not essential for development or viability  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are approximately 23 nt regulatory RNAs that posttranscriptionally inhibit the functions of protein-coding mRNAs. We previously found that most C. elegans miRNAs are individually not essential for ...

Alvarez-Saavedra, Ezequiel


Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

Technical Publications website. The URA tracks the number of theses we produce each year. Power Outage News MI-65 October 25 Power will be off to the MI-65 service building and...


PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Chow, T. Edwin  

E-Print Network (OSTI)

a ; Michael E. Hodgson b a Department of Earth and Resource Science, University of Michigan--Flint, Flint, MI*{ and MICHAEL E. HODGSON{ {Department of Earth and Resource Science, University of Michigan--Flint, Flint, MI

Chow, Tzeekiu Edwin


GTdemo (.mw) - CECM  

E-Print Network (OSTI)

Algorithm: Backtracking (Branch & Bound) MaximumIndependentSet(G); NygiIiMiIiQiIiYiIiciIigiIzc= MaximumClique(G); NyUiIiMiIikiIio= ChromaticNumber( G...

Note: This page contains sample records for the topic "democ rat mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Species Revision and Generic Systematics of World Rileyinae (Hymenoptera: Eurytomidae)  

E-Print Network (OSTI)

Woolley (9F TAMU); 23 mi. S. Trona, 13.v.1980, J. Woolley,Gates (2m UCR); 23 mi. S. Trona, 13.v.1980, J. Woolley (1m

Gates, Michael William



PowerPoint Presentation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

law * Tech transfer and licensing Why do GIV and V2G make sense? Basic GIVV2G Math * US car used 1 hour day, parked 23 h d * Battery 100 mi, daily travel 30 mi, thus * Drive...


Semiconductor Landing  

Science Conference Proceedings (OSTI)

Title Goes Here. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Sed malesuada accumsan mi, et adipiscing nunc varius quis. ...




E-Print Network (OSTI)

: Gole Mi" Myrtle Williomson. Deye Muey. Chris Moderl. led Row: Dr. Gron· yille Price. Deen Judd. Ed

O'Laughlin, Jay


Particulate matter chemistry and dynamics in the Twilight Zone at VERTIGO ALOHA and K2 Sites  

E-Print Network (OSTI)

Marine Chemistry 105, 208 Volk, T. , Hoffert, M.I. , 1985.Broecker and Peng, 1982; Volk and Hoffert, 1985; Armstrong

Bishop, James K.B.



The export of carbon mediated by mesopelagic fishes in the northeast Pacific Ocean  

E-Print Network (OSTI)

Chapman and Hall, New York. Volk, T. , Hoffert, M.I. , 1985.the biological pump (Volk and Hoffert, 1985). The

Davison, Peter Charles



I Cant Walk! Acute Thrombosis of Descending Aorta Causing Paraplegia  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, Michigan Supervising SectionWest Grand Boulevard, CFP-258, Detroit, MI 48202. Email:

Mitchell, Matthew Lee; Yucebey, Elif; Weaver, Mitchell R; Jaehne, A Kathrin; Rivers, Emanuel P



Observation of a Narrow Charm-Strange Meson D A.V. Evdokimov,8  

E-Print Network (OSTI)

University of Iowa, Iowa City, IA 52242, USA 17 University of Michigan-Flint, Flint, MI 48502, USA 18

Akgun, Ugur


Preserving the U.S. Underground and Alternative Press of the 1960s and '70s: History, Prospects, and Microform Sources  

E-Print Network (OSTI)

Reporter, Washington, DC, 1985- , UMI Navajo Times, WindowWashington, DC Native Sun, Detroit, MI Navajo Times, Window

Tsang, Daniel C



Materials Technology @ TMS  

Science Conference Proceedings (OSTI)

... MI; Elizabeth Holm, Carnegie Mellon University, Pittsburgh, PA; Peter Gumbsch, Fraunhofer Institute for Mechanics of Materials IWM, Freiburg, Germany.


2012 Proceedings of the Performance Metrics for Intelligent ...  

Science Conference Proceedings (OSTI)

Page 1. NIST Special Publication 1136 2012 Proceedings of the Performance Metrics for Intelligent Systems (PerMI '12) Workshop ...



The FASEB Journal Research Communication Structure-function analysis of human l-prostaglandin D  

E-Print Network (OSTI)

the commercially available PGD2-MOX ELISA kit (Cay- man Chemicals, Ann Arbor, MI, USA). One unit of enzyme activity

Zhijie, Liu



NLE Websites -- All DOE Office Websites (Extended Search)

Sciences STATE: MI PROJECT TITLE : Manufacturing Industrial Development for the Alternative Energy Systems Funding Opportunity Announcement Number Procurement Instrument...



Science Conference Proceedings (OSTI)

... the permission of GJ Ackland and MI Mendelev. These potentials are not designed for simulations of radiation damage. ...



Thermal Insulation Materials  

Science Conference Proceedings (OSTI)

... IN. Knauf Insulation Product Testing Laboratory, Shelbyville, IN [200883- 0] MI. Dow Chemical Building Solutions Product Perf. ...



Project Brief: Michigan Aerospace Corporation  

Science Conference Proceedings (OSTI)

... RECIPIENT: Michigan Aerospace Corporation, Ann Arbor, MI. Project duration: 3 Years; Total NIST Funding: $1,499,463. ...



Mark Iadicola  

Science Conference Proceedings (OSTI)

... 2002-2003 Postdoctoral Research Fellow University of Michigan, Ann Arbor, MI. 1996-2002 University of Michigan, Ann ...



California Cuckoo Wasps in the Family Chrysididae (Hymenoptera)  

E-Print Network (OSTI)

Panamint Springs; 13 mi. n Trona; Lone Pine; Death Valley;San Bernardino Co. : Trona. Map 89. California distribution

Kimsey, Lynn S.



Available Technologies: Long-term Growth of Finite Life ...  

APPLICATIONS OF TECHNOLOGY: Examine carcinogenesis, aging, expression of genes, proteins and miRNA, signaling pathways, epigenetics, and genomic ...


U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI : 140 : 2011-2013: Marysville, MI: 176 : 1,080: 14 : 2011-2013: St. Clair, MI: 1,562: 1,422: 2 : 26 : 2011-2013: Noyes, MN: 13,380: 14,460: 20,624: 33,889 ...