National Library of Energy BETA

Sample records for defense grant-aid shipments

  1. defense

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4)9 Federal RegisterStorm1 3446 YEAR/%2A en Defense

  2. Info for Shipment Requests -------Original Message --------

    E-Print Network [OSTI]

    Movileanu, Liviu

    , Certified, etc. and insure it as well). Please note: Any prepaid shipment with label can be placed

  3. Waste shipment engineering data management plan

    SciTech Connect (OSTI)

    Marquez, D.L.

    1995-05-01

    This plan documents current data management practices and future data management improvements for TWRS Waste Shipment Engineering.

  4. Secretary of Defense Department of Defense

    E-Print Network [OSTI]

    Cooperation Agency Defense Security Service Defense Threat Reduction Agency * Missile Defense Agency National Geospatial-Intelligence Agency * National Reconnaissance Office * National Security Agency/Central Security Security Service Defense Threat Reduction Agency * Missile Defense Agency National Geospatial

  5. Removing nuclear waste, one shipment at a time

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Removing nuclear waste, one shipment at a time Removing nuclear waste, one shipment at a time The Lab's 1,000th shipment of transuranic waste recently left Los Alamos, on its way...

  6. Portsmouth Site Delivers First Radioactive Waste Shipment to...

    Office of Environmental Management (EM)

    Portsmouth Site Delivers First Radioactive Waste Shipment to Disposal Facility in Texas Portsmouth Site Delivers First Radioactive Waste Shipment to Disposal Facility in Texas...

  7. WIPP - Shipment & Disposal Information

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopmentat LENA|UpcomingVisit UsNews ThisPrivacy Act QuickShipment

  8. THESIS DEFENSE REPORT FORM Defense Date

    E-Print Network [OSTI]

    Emmons, Scott

    THESIS DEFENSE REPORT FORM Defense Date: Student: Department: Dissertation Title: Please hand: (718) 430-8655 Committee Member Decision Signature P CP F (Chair) The decision of the Thesis Defense' on the scientific merit of the Thesis Defense and the Dissertation, but with substantial revisions. If someone other

  9. Removing nuclear waste, one shipment June 26, 2012

    E-Print Network [OSTI]

    shipments that have been transported to WIPP this year. #12;- 2 - A milestone to be proud of Laboratory

  10. Overseas shipments of 48Y cylinders

    SciTech Connect (OSTI)

    Tanaka, R.T.; Furlan, A.S. [Cameco Corp., Port Hope, Ontario (Canada)

    1991-12-31

    This paper describes experiences with two incidents of overseas shipments of uranium hexafluoride (UF{sub 6}) cylinders. The first incident involved nine empty UF{sub 6} cylinders in enclosed sea containers. Three UF{sub 6} cylinders broke free from their tie-downs and damaged and contaminated several sea containers. This paper describes briefly how decontamination was carried out. The second incident involved a shipment of 14 full UF{sub 6} cylinders. Although the incident did not cause an accident, the potential hazard was significant. The investigation of the cause of the near accident is recounted. Recommendations to alleviate future similar incidents for both cases are presented.

  11. Idaho, Navy, DOE agree on shipments to, from INEL

    SciTech Connect (OSTI)

    Tompkins, B.

    1995-12-01

    This report describes aspects of a legal agreement between the U.S. Navy, the state of Idaho, and the United States Department of Energy (US DOE) regarding shipments of radioactive wastes. The agreement will allow for the shipment of 244 spent fuel shipments from the Fort St Vrain facility in Colorado, if a repository or interim storage facility outside Idaho is open and accepting spent fuel from INEL. The number of shipments to the INEL will be limited to 1133, instead of the 1940 originally planned. The Navy will be allowed 575 total shipments through the year 2035.

  12. Public information circular for shipments of irradiated reactor fuel

    SciTech Connect (OSTI)

    1996-07-01

    This circular provides information on shipment of spent fuel subject to regulation by US NRC. It provides a brief description of spent fuel shipment safety and safeguards requirement of general interest, a summary of data for 1979-1995 highway and railway shipments, and a listing, by State, of recent highway and railway shipment routes. The enclosed route information reflects specific NRC approvals that have been granted in response to requests for shipments of spent fuel. This publication does not constitute authority for carriers or other persons to use the routes described to ship spent fuel, other categories of nuclear waste, or other materials.

  13. DOE Shipment Activities: What We Accomplished and a Look Forward...

    Office of Environmental Management (EM)

    Accomplished and a Look Forward Presented by Stephen O'Connor, Director of Office of Packaging and Transportation. DOE Shipment Activities: What We Accomplished and a Look Forward...

  14. Enhancements to System for Tracking Radioactive Waste Shipments...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    features are new mapping tools, multi-mode, two-way communication that automatically switches between terrestrial and satellite, in-depth shipment reporting, event alerts and a...

  15. Naval Spent Fuel Rail Shipment Accident Exercise Objectives

    Office of Environmental Management (EM)

    NAVAL SPENT FUEL RAIL SHIPMENT ACCIDENT EXERCISE OBJECTIVES * Familiarize stakeholders with the Naval spent fuel ACCIDENT EXERCISE OBJECTIVES Familiarize stakeholders with the...

  16. DOE Shipment Activities: What We Accomplished and a Look Forward

    Office of Environmental Management (EM)

    wims.arc.fiu.eduwims 5 Plans for future shipments. . . * Waste Incidental to Reprocessing (WIR) Draft Evaluation for WVDP Melter * Depleted Uranium Oxide (DUO) from...

  17. User Shipments | Stanford Synchrotron Radiation Lightsource

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 - 19PortalStatusUserUserHome ContactUserShipments

  18. LNG shipments in 1994 set records

    SciTech Connect (OSTI)

    1996-01-15

    Worldwide LNG shipments by ocean-going vessels in 1994 increased to 1,619 voyages, according to an LNG shipping industry statistical annual. LNG Log 20 published the recently compiled 1994 data in the last quarter of 1995. The publication is from the Society of International Gas Tanker and Terminal Operators Ltd., London. The year`s total was 8.8% more than for 1993 and the most in 35 years of records. The trips were made and the vessels loaded and discharged without report of serious safety or environmental incident, says the publication. Of the voyages completed during the year, 596 were to European receiving terminals (up 2.8% over 1993), and 1,003 went to the Far East (an increase of 10.7%); shipments to the US, however, dropped to 20, from 32 in 1993. This paper shows that the 1,619 voyages represent 3.6 million nautical miles logged by 78 vessels active during the year. These ships pumped ashore record annual volumes of approximately 144.3 million cu m of LNG, 110.1 million cu m (76.3%) of which went to Far Eastern customers. The paper also summarizes containment systems in use in 1994 and since LNG began to be shipped in 1959.

  19. defense nuclear security

    National Nuclear Security Administration (NNSA)

    3%2A en Defense Nuclear Security http:www.nnsa.energy.govaboutusourprogramsnuclearsecurity

  20. Department of Defense INSTRUCTION

    E-Print Network [OSTI]

    US Army Corps of Engineers

    of the Inspector General of the Department of Defense, the Defense Agencies, the DoD Field Activities, and all of the DoD VE Program. b. Implements the reporting requirements of Reference (c). c. Establishes referred to in paragraph 2f of Enclosure 3 of this instruction has been assigned report control symbol DD

  1. Estimating carbon emissions from less-than-truckload (LTL) shipments

    E-Print Network [OSTI]

    Veloso de Aguiar, Guilherme

    2014-01-01

    Less-than-truckload (LTL) is a $32-billion sector of the trucking industry that focuses on moving smaller shipments, typically with weights between 100 and 10,000 pounds, that do not require a full trailer to be moved. ...

  2. "TRU" Success: SRS Recovery Act Prepares to Complete Shipment...

    Broader source: Energy.gov (indexed) [DOE]

    Act Prepares to Complete Shipment of More Than 5,000 Cubic Meters of Nuclear Waste to WIPP More Documents & Publications TRUPACT-III Quick Facts EIS-0026-SA-06: Supplement...

  3. Pipe overpack container for trasuranic waste storage and shipment

    DOE Patents [OSTI]

    Geinitz, Richard R. (Arvada, CO); Thorp, Donald T. (Broomfield, CO); Rivera, Michael A. (Boulder, CO)

    1999-01-01

    A Pipe Overpack Container for transuranic waste storage and shipment. The system consists of a vented pipe component which is positioned in a vented, insulated 55 gallon steel drum. Both the vented pipe component and the insulated drum are capable of being secured to prevent the contents from leaving the vessel. The vented pipe component is constructed of 1/4 inch stainless steel to provide radiation shielding. Thus, allowing shipment having high Americium-241 content. Several Pipe Overpack Containers are then positioned in a type B, Nuclear Regulatory Commission (NRC) approved, container. In the current embodiment, a TRUPACT-II container was employed and a maximum of fourteen Pipe Overpack Containers were placed in the TRUPACT-II. The combination received NRC approval for the shipment and storage of transuranic waste.

  4. Air Shipment of Spent Nuclear Fuel from Romania to Russia

    SciTech Connect (OSTI)

    Igor Bolshinsky; Ken Allen; Lucian Biro; Alexander Buchelnikov

    2010-10-01

    Romania successfully completed the world’s first air shipment of spent nuclear fuel transported in Type B(U) casks under existing international laws and without shipment license special exceptions when the last Romanian highly enriched uranium (HEU) spent nuclear fuel was transported to the Russian Federation in June 2009. This air shipment required the design, fabrication, and licensing of special 20 foot freight containers and cask tiedown supports to transport the eighteen TUK 19 shipping casks on a Russian commercial cargo aircraft. The new equipment was certified for transport by road, rail, water, and air to provide multi modal transport capabilities for shipping research reactor spent fuel. The equipment design, safety analyses, and fabrication were performed in the Russian Federation and transport licenses were issued by both the Russian and Romanian regulatory authorities. The spent fuel was transported by truck from the VVR S research reactor to the Bucharest airport, flown by commercial cargo aircraft to the airport at Yekaterinburg, Russia, and then transported by truck to the final destination in a secure nuclear facility at Chelyabinsk, Russia. This shipment of 23.7 kg of HEU was coordinated by the Russian Research Reactor Fuel Return Program (RRRFR), as part of the U.S. Department of Energy Global Threat Reduction Initiative (GTRI), in close cooperation with the Rosatom State Atomic Energy Corporation and the International Atomic Energy Agency, and was managed in Romania by the National Commission for Nuclear Activities Control (CNCAN). This paper describes the planning, shipment preparations, equipment design, and license approvals that resulted in the safe and secure air shipment of this spent nuclear fuel.

  5. Developing an institutional strategy for transporting defense transuranic waste materials

    SciTech Connect (OSTI)

    Guerrero, J.V.; Kresny, H.S.

    1986-01-01

    In late 1988, the US Department of Energy (DOE) expects to begin emplacing transuranic waste materials in the Waste Isolation Pilot Plant (WIPP), an R and D facility to demonstrate the safe disposal of radioactive wastes resulting from defense program activities. Transuranic wastes are production-related materials, e.g., clothes, rags, tools, and similar items. These materials are contaminated with alpha-emitting transuranium radionuclides with half-lives of > 20 yr and concentrations > 100 nCi/g. Much of the institutional groundwork has been done with local communities and the State of New Mexico on the siting and construction of the facility. A key to the success of the emplacement demonstration, however, will be a qualified transportation system together with institutional acceptance of the proposed shipments. The DOE's Defense Transuranic Waste Program, and its contractors, has lead responsibility for achieving this goal. The Joint Integration Office (JIO) of the DOE, located in Albuquerque, New Mexico, is taking the lead in implementing an integrated strategy for assessing nationwide institutional concerns over transportation of defense transuranic wastes and in developing ways to resolve or mitigate these concerns. Parallel prototype programs are under way to introduce both the new packaging systems and the institutional strategy to interested publics and organizations.

  6. Composite Variable Formulations for Express Shipment Service Network Design

    E-Print Network [OSTI]

    Gendron, Bernard

    · Cynthia Barnhart · Keith A. Ware Department of Management, United States Air Force Academy, Colorado, Kentucky 40223 In this paper we describe a new approach to solving the express shipment service net- work design problem. Conventional polyhedral methods for network design and network loading problems do

  7. China's Defense Electronics and Information Technology Industry

    E-Print Network [OSTI]

    RAGLAND, LeighAnn; MCREYNOLDS, Joe; GEARY, Debra

    2013-01-01

    2013 China’s Defense Electronics and Information Technologythe Chinese defense electronics and information technology (is moving the defense electronics and IT industry toward

  8. Status and use of the Rocky Flats Environmental Technology Site Pipe Overpack Container for TRU waste storage and shipments

    SciTech Connect (OSTI)

    Thorp, D.T.; Geinitz, R.R.; Rivera, M.A.

    1998-03-03

    The Pipe Overpack Container was designed to optimize shipments of high plutonium content transuranic waste from Rocky Flats Environmental Technology Site (RFETS) to Waste Isolation Pilot Plant (WIPP). The container was approved for use in the TRUPACT-II shipping container by the Nuclear Regulatory Commission in February 1997. The container optimizes shipments to WIPP by increasing the TRUPACT-II criticality limit from 325 fissile grams equivalent (FGE) to 2,800 FGE and provides additional shielding for handling wastes with high americium-241 (Am-241) content. The container was subsequently evaluated and approved for storage of highly dispersible TRU wastes and residues at RFETS. Thermal evaluation of the container shows that the container will mitigate the impact of a worst case thermal event from reactive or potentially pyrophoric materials. These materials contain hazards postulated by the Defense Nuclear Facilities Safety Board for interim storage. Packaging these reactive or potentially pyrophoric residues in the container without stabilizing the materials is under consideration at RFETS. The design, testing, and evaluations used in the approvals, and the current status of the container usage, will be discussed.

  9. Defense on the Move: Ant-Based Cyber Defense

    SciTech Connect (OSTI)

    Fink, Glenn A.; Haack, Jereme N.; McKinnon, Archibald D.; Fulp, Errin W.

    2014-04-15

    Many common cyber defenses (like firewalls and IDS) are as static as trench warfare allowing the attacker freedom to probe them at will. The concept of Moving Target Defense (MTD) adds dynamism to the defender side, but puts the systems to be defended themselves in motion, potentially at great cost to the defender. An alternative approach is a mobile resilient defense that removes attackers’ ability to rely on prior experience without requiring motion in the protected infrastructure itself. The defensive technology absorbs most of the cost of motion, is resilient to attack, and is unpredictable to attackers. The Ant-Based Cyber Defense (ABCD) is a mobile resilient defense providing a set of roaming, bio-inspired, digital-ant agents working with stationary agents in a hierarchy headed by a human supervisor. The ABCD approach provides a resilient, extensible, and flexible defense that can scale to large, multi-enterprise infrastructures like the smart electric grid.

  10. AIR SHIPMENT OF SPENT NUCLEAR FUEL FROM THE BUDAPEST RESEARCH REACTOR

    SciTech Connect (OSTI)

    Dewes, J.

    2014-02-24

    The shipment of spent nuclear fuel is usually done by a combination of rail, road or sea, as the high activity of the SNF needs heavy shielding. Air shipment has advantages, e.g. it is much faster than any other shipment and therefore minimizes the transit time as well as attention of the public. Up to now only very few and very special SNF shipments were done by air, as the available container (TUK6) had a very limited capacity. Recently Sosny developed a Type C overpack, the TUK-145/C, compliant with IAEA Standard TS-R-1 for the VPVR/M type Skoda container. The TUK-145/C was first used in Vietnam in July 2013 for a single cask. In October and November 2013 a total of six casks were successfully shipped from Hungary in three air shipments using the TUK-145/C. The present paper describes the details of these shipments and formulates the lessons learned.

  11. Packaging and Transportation for Offsite Shipment of Materials...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of Materials of National Security Interests by Matthew Weber Functional areas: Defense Nuclear Facility Safety and Health Requirement, Packaging and Transportation, Security,...

  12. Packaging and Transportation for Offsite Shipment of Materials of National Security Interests

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2015-04-20

    The Order establishes requirements and responsibilities for ensuring the safety of packaging and transportation for offsite shipments of Materials of National Security Interest.

  13. Ensuring Safe Shipment of Hazardous Materials | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n cEnergyNatural GasDepartmentApril 13,truck carries a waste shipment from

  14. Hanford Shipment Arrives Safely At Waste Isolation Pilot Plant

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Lowï‚—34October 201422T Office36ZHanford Shipment

  15. Milestone reached: Waste shipment leaves Los Alamos National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJessework uses concrete7 Assessment ofLana7, atScienceWaste shipment leaves

  16. Thesis / Dissertation Defense Announcement and Scheduling Form

    E-Print Network [OSTI]

    Hutcheon, James M.

    Thesis / Dissertation Defense Announcement and Scheduling Form Completed form must be received of the following: Thesis Defense Dissertation Defense Public Seminar Only Thesis Associate Dean Only Thesis/Dissertation/Seminar location and time listed above is: Confirmed

  17. OFFICE OF THE UNDER SECRETARY OF DEFENSE

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    DEFENSE 3000 DEFENSE PENTAGON WASHINGTON, DC 20301 -3000 ACQUISITION TECHNOLOGY AND LOGISTICS MEMORANDUM FOR ASSISTANT SECRETARY OF THE ARMY (ACQUISITION, LOGISTICS AND...

  18. Independent Activity Report, Defense Nuclear Facilities Safety...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Defense Nuclear Facilities Safety Board Public Meeting - October 2012 Independent Activity Report, Defense Nuclear Facilities Safety Board Public Meeting - October 2012 October...

  19. Toward directed energy planetary defense

    E-Print Network [OSTI]

    Lubin, Philip

    Asteroids and comets that cross Earth’s orbit pose a credible risk of impact, with potentially severe disturbances to Earth and society. We propose an orbital planetary defense system capable of heating the surface of ...

  20. SUSTAINABILITY REPORTING NATURAL RESOURCES DEFENSE

    E-Print Network [OSTI]

    Qian, Ning

    SUSTAINABILITY REPORTING AND THE NATURAL RESOURCES DEFENSE COUNCIL AUGUST 2012 Capstone Team RELEVANCE/CONTEXT 4 HISTORY OF SUSTAINABILITY REPORTING 4 ORGANIZATIONAL PROFILE 7 METHODOLOGY 8 FINDINGS AND DISCUSSION 11 FINDINGS FROM INTERVIEWS 11 SUSTAINABILITY FRAMEWORK ASSESSMENT 12

  1. AIR SHIPMENT OF HIGHLY ENRICHED URANIUM SPENT NUCLEAR FUEL FROM ROMANIA AND LIBYA

    SciTech Connect (OSTI)

    Christopher Landers; Igor Bolshinsky; Ken Allen; Stanley Moses

    2010-07-01

    In June 2009 Romania successfully completed the world’s first air shipment of highly enriched uranium (HEU) spent nuclear fuel transported in Type B(U) casks under existing international laws and without special exceptions for the air transport licenses. Special 20-foot ISO shipping containers and cask tiedown supports were designed to transport Russian TUK 19 shipping casks for the Romanian air shipment and the equipment was certified for all modes of transport, including road, rail, water, and air. In December 2009 Libya successfully used this same equipment for a second air shipment of HEU spent nuclear fuel. Both spent fuel shipments were transported by truck from the originating nuclear facilities to nearby commercial airports, were flown by commercial cargo aircraft to a commercial airport in Yekaterinburg, Russia, and then transported by truck to their final destinations at the Production Association Mayak facility in Chelyabinsk, Russia. Both air shipments were performed under the Russian Research Reactor Fuel Return Program (RRRFR) as part of the U.S. National Nuclear Security Administration (NNSA) Global Threat Reduction Initiative (GTRI). The Romania air shipment of 23.7 kg of HEU spent fuel from the VVR S research reactor was the last of three HEU fresh and spent fuel shipments under RRRFR that resulted in Romania becoming the 3rd RRRFR participating country to remove all HEU. Libya had previously completed two RRRFR shipments of HEU fresh fuel so the 5.2 kg of HEU spent fuel air shipped from the IRT 1 research reactor in December made Libya the 4th RRRFR participating country to remove all HEU. This paper describes the equipment, preparations, and license approvals required to safely and securely complete these two air shipments of spent nuclear fuel.

  2. Interim Guidance on the Grant Aiding and Planting

    E-Print Network [OSTI]

    harvesting. FCS is in the process of establishing 6 energy forestry trial sites. Three species of Eucalyptus of short rotations · Hydrology and water quality · Biodiversity · Fire risk · Protection of soils when harvesting · Impact on soil fertility and carbon of consecutive short rotations RISK OF PHYSICAL DAMAGE

  3. Terminating Safeguards on Excess Special Nuclear Material: Defense TRU Waste Clean-up and Nonproliferation - 12426

    SciTech Connect (OSTI)

    Hayes, Timothy; Nelson, Roger

    2012-07-01

    The Department of Energy (DOE) and the National Nuclear Security Administration (NNSA) manages defense nuclear material that has been determined to be excess to programmatic needs and declared waste. When these wastes contain plutonium, they almost always meet the definition of defense transuranic (TRU) waste and are thus eligible for disposal at the Waste Isolation Pilot Plant (WIPP). The DOE operates the WIPP in a manner that physical protections for attractiveness level D or higher special nuclear material (SNM) are not the normal operating condition. Therefore, there is currently a requirement to terminate safeguards before disposal of these wastes at the WIPP. Presented are the processes used to terminate safeguards, lessons learned during the termination process, and how these approaches might be useful for future defense TRU waste needing safeguards termination prior to shipment and disposal at the WIPP. Also described is a new criticality control container, which will increase the amount of fissile material that can be loaded per container, and how it will save significant taxpayer dollars. Retrieval, compliant packaging and shipment of retrievably stored legacy TRU waste has dominated disposal operations at WIPP since it began operations 12 years ago. But because most of this legacy waste has successfully been emplaced in WIPP, the TRU waste clean-up focus is turning to newly-generated TRU materials. A major component will be transuranic SNM, currently managed in safeguards-protected vaults around the weapons complex. As DOE and NNSA continue to consolidate and shrink the weapons complex footprint, it is expected that significant quantities of transuranic SNM will be declared surplus to the nation's needs. Safeguards termination of SNM varies due to the wide range of attractiveness level of the potential material that may be directly discarded as waste. To enhance the efficiency of shipping waste with high TRU fissile content to WIPP, DOE designed an over-pack container, similar to the pipe component, called the criticality control over-pack, which will significantly enhance the efficiency of disposal. Hundreds of shipments of transuranic SNM, suitably packaged to meet WIPP waste acceptance criteria and with safeguards terminated have been successfully emplaced at WIPP (primarily from the Rocky Flats site clean-up) since WIPP opened. DOE expects that thousands more may eventually result from SNM consolidation efforts throughout the weapons complex. (authors)

  4. Safety evaluation for packaging 222-S laboratory cargo tank for onetime type B material shipment

    SciTech Connect (OSTI)

    Nguyen, P.M.

    1994-08-19

    The purpose of this Safety Evaluation for Packaging (SEP) is to evaluate and document the safety of the onetime shipment of bulk radioactive liquids in the 222-S Laboratory cargo tank (222-S cargo tank). The 222-S cargo tank is a US Department of Transportation (DOT) MC-312 specification (DOT 1989) cargo tank, vehicle registration number HO-64-04275, approved for low specific activity (LSA) shipments in accordance with the DOT Title 49, Code of Federal Regulations (CFR). In accordance with the US Department of Energy, Richland Operations Office (RL) Order 5480.1A, Chapter III (RL 1988), an equivalent degree of safety shall be provided for onsite shipments as would be afforded by the DOT shipping regulations for a radioactive material package. This document demonstrates that this packaging system meets the onsite transportation safety criteria for a onetime shipment of Type B contents.

  5. Recovery Act Funding Leads to Record Year for Transuranic Waste Shipments

    Broader source: Energy.gov [DOE]

    With the help of American Recovery and Reinvestment Act funding, the Waste Isolation Pilot Plant (WIPP) received the most transuranic waste shipments in a single year since waste operations began...

  6. Packaging and Transportation for Offsite Shipment of Materials of National Security Interest

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2010-12-20

    The purpose of this Order is to make clear that the packaging and transportation of all offsite shipments of materials of national security interest for DOE must be conducted in accordance with DOT and Nuclear Regulatory Commission (NRC) regulations that would be applicable to comparable commercial shipments, except where an alternative course of action is identified in this Order. Supersedes DOE O 461.1A.

  7. An approach to determine a defensible spent fuel ratio.

    SciTech Connect (OSTI)

    Durbin, Samuel G.; Lindgren, Eric Richard

    2014-03-01

    Sabotage of spent nuclear fuel casks remains a concern nearly forty years after attacks against shipment casks were first analyzed and has a renewed relevance in the post-9/11 environment. A limited number of full-scale tests and supporting efforts using surrogate materials, typically depleted uranium dioxide (DUO2), have been conducted in the interim to more definitively determine the source term from these postulated events. In all the previous studies, the postulated attack of greatest interest was by a conical shape charge (CSC) that focuses the explosive energy much more efficiently than bulk explosives. However, the validity of these large-scale results remain in question due to the lack of a defensible Spent Fuel Ratio (SFR), defined as the amount of respirable aerosol generated by an attack on a mass of spent fuel compared to that of an otherwise identical DUO2 surrogate. Previous attempts to define the SFR have resulted in estimates ranging from 0.42 to 12 and include suboptimal experimental techniques and data comparisons. Different researchers have suggested using SFR values of 3 to 5.6. Sound technical arguments exist that the SFR does not exceed a value of unity. A defensible determination of the SFR in this lower range would greatly reduce the calculated risk associated with the transport and dry storage of spent nuclear fuel. Currently, Oak Ridge National Laboratory (ORNL) is in possession of several samples of spent nuclear fuel (SNF) that were used in the original SFR studies in the 1980's and were intended for use in a modern effort at Sandia National Laboratories (SNL) in the 2000's. A portion of these samples are being used for a variety of research efforts. However, the entirety of SNF samples at ORNL is scheduled for disposition at the Waste Isolation Pilot Plant (WIPP) by approximately the end of 2015. If a defensible SFR is to be determined for use in storage and transportation security analyses, the need to begin this effort is urgent in order to secure the only known available SNF samples with a clearly defined path to disposal.

  8. China’s Defense Electronics Industry: Innovation, Adaptation, and Espionage

    E-Print Network [OSTI]

    Mulvenon, James; Luce, Matthew

    2010-01-01

    2010 China’s Defense Electronics Industry: Innovation,of the Chinese defense electronics sector can be attributedAdvanced defense electronics components and systems play a

  9. 5th Defense Renewable Energy Summit

    Office of Energy Efficiency and Renewable Energy (EERE)

    The 5th Defense Renewable Energy Summit brings together U.S. Department of Defense (DOD) and military decision-makers with renewable energy developers, utilities, and leading financiers to...

  10. DRAFT - DOE O 461.1C, Packaging and Transportation for Offsite Shipment of Materials of National Security Interest

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    The Order establishes requirements and responsibilities for ensuring the safety of packaging and transportation for offsite shipments of Materials of National Security Interest.

  11. THESIS DEFENSE COMMITTEE FORM Mentor:Department

    E-Print Network [OSTI]

    Emmons, Scott

    THESIS DEFENSE COMMITTEE FORM Student: Mentor:Department: Thesis Seminar Date: 2. 1 be submitted to the Graduate Office at least 2 months prior to the Defense date. § The thesis defense seminar announcement and full CV must be submitted together with this form. Check if Collaborator Attended Thesis

  12. Homeland Security and Defense Applications

    ScienceCinema (OSTI)

    None

    2015-01-09

    Homeland Security and Defense Applications personnel are the best in the world at detecting and locating dirty bombs, loose nukes, and other radiological sources. The site trains the Nation's emergency responders, who would be among the first to confront a radiological or nuclear emergency. Homeland Security and Defense Applications highly training personnel, characterize the threat environment, produce specialized radiological nuclear detection equipment, train personnel on the equipment and its uses, test and evaluate the equipment, and develop different kinds of high-tech equipment to defeat terrorists. In New York City for example, NNSS scientists assisted in characterizing the radiological nuclear environment after 9/11, and produced specialized radiological nuclear equipment to assist local officials in their Homeland Security efforts.

  13. Homeland Security and Defense Applications

    SciTech Connect (OSTI)

    None

    2014-11-06

    Homeland Security and Defense Applications personnel are the best in the world at detecting and locating dirty bombs, loose nukes, and other radiological sources. The site trains the Nation's emergency responders, who would be among the first to confront a radiological or nuclear emergency. Homeland Security and Defense Applications highly training personnel, characterize the threat environment, produce specialized radiological nuclear detection equipment, train personnel on the equipment and its uses, test and evaluate the equipment, and develop different kinds of high-tech equipment to defeat terrorists. In New York City for example, NNSS scientists assisted in characterizing the radiological nuclear environment after 9/11, and produced specialized radiological nuclear equipment to assist local officials in their Homeland Security efforts.

  14. Air Shipment of Highly Enriched Uranium Spent Nuclear Fuel from Romania

    SciTech Connect (OSTI)

    K. J. Allen; I. Bolshinsky; L. L. Biro; M. E. Budu; N. V. Zamfir; M. Dragusin

    2010-07-01

    Romania safely air shipped 23.7 kilograms of Russian origin highly enriched uranium (HEU) spent nuclear fuel from the VVR S research reactor at Magurele, Romania, to the Russian Federation in June 2009. This was the world’s first air shipment of spent nuclear fuel transported in a Type B(U) cask under existing international laws without special exceptions for the air transport licenses. This shipment was coordinated by the Russian Research Reactor Fuel Return Program (RRRFR), part of the U.S. Department of Energy Global Threat Reduction Initiative (GTRI), in cooperation with the Romania National Commission for Nuclear Activities Control (CNCAN), the Horia Hulubei National Institute of Physics and Nuclear Engineering (IFIN-HH), and the Russian Federation State Corporation Rosatom. The shipment was transported by truck to and from the respective commercial airports in Romania and the Russian Federation and stored at a secure nuclear facility in Russia where it will be converted into low enriched uranium. With this shipment, Romania became the 3rd country under the RRRFR program and the 14th country under the GTRI program to remove all HEU. This paper describes the work, equipment, and approvals that were required to complete this spent fuel air shipment.

  15. Research Reactor Preparations for the Air Shipment of Highly Enriched Uranium from Romania

    SciTech Connect (OSTI)

    K. J. Allen; I. Bolshinsky; L. L. Biro; M. E. Budu; N. V. Zamfir; M. Dragusin; C. Paunoiu; M. Ciocanescu

    2010-03-01

    In June 2009 two air shipments transported both unirradiated (fresh) and irradiated (spent) Russian-origin highly enriched uranium (HEU) nuclear fuel from two research reactors in Romania to the Russian Federation for conversion to low enriched uranium. The Institute for Nuclear Research at Pitesti (SCN Pitesti) shipped 30.1 kg of HEU fresh fuel pellets to Dimitrovgrad, Russia and the Horia Hulubei National Institute of Physics and Nuclear Engineering (IFIN-HH) shipped 23.7 kilograms of HEU spent fuel assemblies from the VVR S research reactor at Magurele, Romania, to Chelyabinsk, Russia. Both HEU shipments were coordinated by the Russian Research Reactor Fuel Return Program (RRRFR) as part of the U.S. Department of Energy Global Threat Reduction Initiative (GTRI), were managed in Romania by the National Commission for Nuclear Activities Control (CNCAN), and were conducted in cooperation with the Russian Federation State Corporation Rosatom and the International Atomic Energy Agency. Both shipments were transported by truck to and from respective commercial airports in Romania and the Russian Federation and stored at secure nuclear facilities in Russia until the material is converted into low enriched uranium. These shipments resulted in Romania becoming the 3rd country under the RRRFR program and the 14th country under the GTRI program to remove all HEU. This paper describes the research reactor preparations and license approvals that were necessary to safely and securely complete these air shipments of nuclear fuel.

  16. NNSA and Defense Nuclear Facilities

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on771/6/14 Contact: JanetSite |Customs | National Nuclearand Defense

  17. Public information circular for shipments of irradiated reactor fuel. Revision 9

    SciTech Connect (OSTI)

    Not Available

    1993-03-01

    This circular has been prepared to provide information on the shipment of irradiated reactor fuel (spent fuel) subject to regulation by the Nuclear Regulatory Commission (NRC), and to meet the requirements of Public Law 96--295. The report provides a brief description of NRC authority for certain aspects of transporting spent fuel. It provides descriptive statistics on spent fuel shipments regulated by the NRC from 1979 to 1992. It also lists detailed highway and railway segments used within each state from October 1, 1987 through December 31, 1992.

  18. Defense Innovation and Industrialization in South Korea

    E-Print Network [OSTI]

    Moon, Chung-in; Paek, Jae-Ok

    2010-01-01

    September 2010 Defense Innovation and Industrialization inby tracing the stages of innovation. We also delineate a settransformation. The Study of Innovation and Technology in

  19. Dynamic defense workshop : from research to practice.

    SciTech Connect (OSTI)

    Crosby, Sean Michael; Doak, Justin E.; Haas, Jason J.; Helinski, Ryan; Lamb, Christopher C.

    2013-02-01

    On September 5th and 6th, 2012, the Dynamic Defense Workshop: From Research to Practice brought together researchers from academia, industry, and Sandia with the goals of increasing collaboration between Sandia National Laboratories and external organizations, de ning and un- derstanding dynamic, or moving target, defense concepts and directions, and gaining a greater understanding of the state of the art for dynamic defense. Through the workshop, we broadened and re ned our de nition and understanding, identi ed new approaches to inherent challenges, and de ned principles of dynamic defense. Half of the workshop was devoted to presentations of current state-of-the-art work. Presentation topics included areas such as the failure of current defenses, threats, techniques, goals of dynamic defense, theory, foundations of dynamic defense, future directions and open research questions related to dynamic defense. The remainder of the workshop was discussion, which was broken down into sessions on de ning challenges, applications to host or mobile environments, applications to enterprise network environments, exploring research and operational taxonomies, and determining how to apply scienti c rigor to and investigating the eld of dynamic defense.

  20. Foundations of a defense digital platform : business systems governance in the Department of Defense

    E-Print Network [OSTI]

    Ziegler, Dustin P

    2012-01-01

    In 2010, the United States Department of Defense (DoD) spent more than $35 billion on information systems development and sustainment, with nearly $7 billion to defense business systems investments alone. It is not surprising ...

  1. Transportation impact analysis for the shipment of low specific activity nitric acid. Revisison 1

    SciTech Connect (OSTI)

    Green, J.R.

    1995-05-16

    This is in support of the Plutonium-Uranium Extraction (PUREX) Facility Low Specific Activity (LSA) Nitric Acid Shipment Environmental Assessment. It analyzes potential toxicological and radiological risks associated with transportation of PUREX Facility LSA Nitric Acid from the Hanford Site to Portsmouth VA, Baltimore MD, and Port Elizabeth NJ.

  2. United States Home Information Center | Customer Support | Site Map Track Shipments

    E-Print Network [OSTI]

    Bartholdi III, John J.

    United States Home Information Center | Customer Support | Site Map Search Track Shipments Detailed your detailed tracking results (optional) Enter your email, submit up to three email addresses | Service Info | About FedEx | Investor Relations | Careers | fedex.com Terms of Use | Privacy Policy

  3. United States Home Information Center | Customer Support | Site Map Track Shipments

    E-Print Network [OSTI]

    Bartholdi III, John J.

    United States Home Information Center | Customer Support | Site Map Search Track Shipments Detailed results (optional) Enter your email, submit up to three email addresses (separated by commas), add yourEx | Investor Relations | Careers | fedex.com Terms of Use | Privacy Policy This site is protected by copyright

  4. Cyber Security Basic Defenses and Attack Trends

    E-Print Network [OSTI]

    Sastry, S. Shankar

    37 38 39 40 41 4273 MTC 4 Cyber Security Basic Defenses and Attack Trends Alvaro A. Cárdenas, Tanya for a successful defense. Cyber security is the branch of security dealing with digital or information technology.1 This chapter presents a selected overview on topics in cyber security. 1. Throughout the chapter, we use

  5. Report on Comprehensive Examination/Thesis Defense Name: ____________________________________________________________________________________________________________

    E-Print Network [OSTI]

    Hutcheon, James M.

    Report on Comprehensive Examination/Thesis Defense Name: _______________________________ Major ________________________________________ REPORT COMPREHENSIVE/TERMINAL EXAM THESIS DEFENSE Pass of classes for the term during which the Comprehensive Exam/Thesis defense is taken. Return to: College

  6. National Defense Authorization Act for Fiscal Year 1993 (PL 102...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    National Defense Authorization Act for Fiscal Year 1993 (PL 102-484) National Defense Authorization Act for Fiscal Year 1993 (PL 102-484) Section 3162 of the National Defense...

  7. The State of U.S. Defense Innovation

    E-Print Network [OSTI]

    ROSS, Andrew L.

    2014-01-01

    IGCC Defense Innovation Briefs January 2014 The State ofU.S. Defense Innovation Andrew L. ROSS University of Newwounds, U.S. defense innovation—whether technologi- cal,

  8. Guidance for generating legally defensible data

    SciTech Connect (OSTI)

    Rosecrance, A.; Kibler, L. [Core Labs., Houston, TX (United States). Analytical Chemistry Division

    1994-12-31

    The current emphasis on enforcement to achieve compliance with environmental regulations places increased demands on environmental professionals to generate legally defensible data. Since any environmental data may potentially be used in civil or criminal litigation, it must be suitable for use as admissible evidence. Although data cannot be guaranteed to be legally defensible because the proof of defensibility can only be determined in actual legal proceedings, there are steps that can be taken to enhance or increase the chances of admissibility. In order for data to be defensible and of known and documented quality, all sampling and analysis activities must meet applicable technical standards and be fully documented. Record keeping must be stressed throughout all sampling and analysis activities; failure to keep proper records is a common allegation in enforcement actions and a cause for lack of data defensibility. Though there is extensive reference documentation on the requirements for technical data quality, there is limited guidance available on data defensibility procedures. This paper provides guidance to assist field samplers, laboratory personnel, and project managers in planning for and generating legally defensible data. A example checklist that can be used in the planning and verification stages of the data generation process is provided.

  9. Linton Brooks Assumes Post as Deputy Administrator for NNSA Defense...

    National Nuclear Security Administration (NNSA)

    Administrator for NNSA Defense Nuclear Nonproliferation Office Press Release Oct 30, 2001 Linton Brooks Assumes Post as Deputy Administrator for NNSA Defense Nuclear...

  10. Departments of Energy, Defense Partner to Install Fuel Cell Backup...

    Energy Savers [EERE]

    Departments of Energy, Defense Partner to Install Fuel Cell Backup Power Units at Eight Military Installations Departments of Energy, Defense Partner to Install Fuel Cell Backup...

  11. Defense Nuclear Facilities Safety Board (DNFSB) Update - Dale...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Defense Nuclear Facilities Safety Board (DNFSB) Update - Dale Govan, Departmental Representative to the DNFSB Defense Nuclear Facilities Safety Board (DNFSB) Update - Dale Govan,...

  12. COLLOQUIUM: Fusion Rockets for Planetary Defense | Princeton...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    December 9, 2015, 4:00pm to 5:30pm Colloquia MBG AUDITORIUM COLLOQUIUM: Fusion Rockets for Planetary Defense Dr. Glen Wurden Los Alamos National Laboratory Colloquium Committee:...

  13. Doctoral Defense "Thermal-hydro-mechanical model

    E-Print Network [OSTI]

    Kamat, Vineet R.

    Doctoral Defense "Thermal-hydro-mechanical model for freezing and thawing soils" Yao Zhang Date been implemented in a finite element system, with a thermal-hydro- mechanical framework being used

  14. Escape & Defense I. Interactions with predators

    E-Print Network [OSTI]

    Dever, Jennifer A.

    - threatening defense mechanisms (toxins) Chinese fire-bellied toad see fig. 11.6 Unken reflex #12;4 from Brodie & Janzen, 1995 Plastic snake replicas were used to demonstrate that free-ranging avian predators generalize

  15. ELUCIDATING THE DIFFERENCES BETWEEN ONSITE AND OFFSITE SHIPMENT OF RADIOACTIVE MATERIALS

    SciTech Connect (OSTI)

    Loftin, B.; Watkins, R.

    2013-06-19

    Federal regulations stipulate how radioactive materials are transported within the United States. However, the Department of Energy, under Department of Energy Order, has the authority to operate, within the boundaries of their physical site, to other stipulations. In many cases the DOE sites have internal reviews for onsite transfers that rival reviews performed by the regulatory authorities for offsite shipments. Most of the differences are in the level or type of packaging that is required, but in some cases it may be in the amount and type of material that is allowed to be transferred. This paper will describe and discuss those differences and it will discuss ways to effectively align the onsite rules for transferring materials with those for offsite shipment.

  16. A rationale for maintaining the double containment requirement for plutonium shipments

    SciTech Connect (OSTI)

    Channell, James K.; Anastas, George

    2003-12-31

    Current U.S. Nuclear Regulatory Commission (NRC) transportation regulations (10 CFR 71.63 (b)) require that all shipments containing more than 20 curies of plutonium must be transported in packages that provide double containment. On April 30, 2002 the NRC issued a proposed rule that would eliminate §71.63(b) and the double containment requirement. NRC’s reasons for proposing elimination of §71.63(b) are: (1) compatibility with International Atomic Energy Agency Transportation Safety Standards (which do not have the requirement); (2) the current rule is inconsistent with the A1/A2 system since it applies only to plutonium; (3) double containment causes a heavier package and results in higher transportation costs; (4) the separate inner containment results in additional radiation exposure; and (5) while there would be additional protection from a separate inner container in an accident; this type of approach is not “risk informed nor performance based.” The Environmental Evaluation Group (EEG) has been a proponent of the double containment requirement for the Waste Isolation Pilot Plant (WIPP) shipments for twenty years. This requirement affects shipments to WIPP much more than any other current or planned shipping campaign because reactor fuel elements, metal or metal alloy, and vitrified high-level waste are exempt from §71.63(b). EEG submitted comments on the Proposed Rule on July 26, 2002 (Appendix C). This report is an update and expansion of the July 26, 2002 comments. Actual WIPP experience with shipments in the double contained TRUPACT-II package is used to respond to NRC arguments for deletion of §71.63(b) and offers a rationale for maintaining the current requirement.

  17. Department of Defense Nuclear/Biological/Chemical (NBC) defense: Annual report to Congress. Annual report

    SciTech Connect (OSTI)

    1997-03-01

    The National Defense Authorization Act for Fiscal Year 1994, Public Law No. 103-160, Section 1703 (50 USC 1522), mandates the consolidation of all Department of Defense chemical and biological (CB) defense programs. As part of this consolidation, the Secretary of Defense is directed to submit an assessment and a description of plans to improve readiness to survive, fight and win in a nuclear, biological and chemical (NBC) contaminated environment. This report contains modernization plan summaries that highlight the Department`s approach to improve current NBC defense equipment and resolve current shortcomings in the program. 50 USC 1522 has been a critical tool for ensuring the elimination of redundant programs, focusing funds on program priorities, and enhancing readiness. While many problems remain in consolidating the NBC defense program, significant and measurable progress has been made in fulfilling the letter and the intent of Congress. There has been a consolidation of the research, development and acquisition organizations for NBC defense, including the consolidation of all research, development, test and evaluation, and procurement funds for NBC defense. There has been significant progress in the development of Joint training, doctrine development, and requirements generation. Modernization and technology plans have been developed that will begin to show real savings and true consolidation of efforts among the Services. The fruits of these plans will be realized over the next few years as the public law has time to take effect and will result in the increased readiness of U.S. forces. The objective of the Department of Defense (DoD) NBC defense program is to enable our forces to survive, fight, and win in NBC warfare environments. Numerous rapidly changing factors continually influence the program and its management.

  18. Packaging and Transportation for Offsite Shipment of Materials of National Security Interest

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2016-01-05

    The Order establishes requirements and responsibilities for ensuring the safety of packaging and transportation for offsite shipments of Materials of National Security Interest. DOE Order 461.1C received a significant number of major and suggested comments the first time it was reviewed in RevCom. As a result of the number of comments received, the OPI have a second RevCom review. This revision of DOE O 461.1C incorporates changes which resulted from the comment resolution process of the initial draft.

  19. Packaging and Transportation for Offsite Shipment of Materials of National Security Interests

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2015-09-25

    The Order establishes requirements and responsibilities for ensuring the safety of packaging and transportation for offsite shipments of Materials of National Security Interest. DOE Order 461.1C received a significant number of major and suggested comments the first time it was reviewed in RevCom. As a result of the number of comments received, the OPI have a second RevCom review. This revision of DOE O 461.1C incorporates changes which resulted from the comment resolution process of the initial draft.

  20. Doctoral Defense "Structural reliability assessment under fire"

    E-Print Network [OSTI]

    Kamat, Vineet R.

    Doctoral Defense "Structural reliability assessment under fire" Qianru Guo Date: December 11, 2014 Engineering Structural safety under fire has received significant attention in recent years. Current approaches to structural fire design are based on prescriptive codes that emphasize insulation of steel

  1. SOIL, WATER, AND CLIMATE MS DEFENSE SEMINAR

    E-Print Network [OSTI]

    Minnesota, University of

    SOIL, WATER, AND CLIMATE MS DEFENSE SEMINAR Case study for Determining the Presence of the Moorsh- Forming Process in Drained Peat (Markey Muck) Soils, Anoka County, Minnesota, USA by Allyz Kramer Polacsek Soil Science Advisor: Jay Bell Friday, May 15, 2009 9:00 ­ 10:00 am S415 Soil Science Building ABSTRACT

  2. Predator induced defenses in prey with diverse predators 

    E-Print Network [OSTI]

    Garza, Mark Isaac

    2006-04-12

    Phenotypic plasticity is an environmentally based change in phenotype and can be adaptive. Often, the change in an organism's phenotype is induced by the presence of a predator and serves as a defense against that predator. Defensive phenotypes...

  3. Their best defense is good fiscal sense (Daily Press) | Jefferson...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    https:www.jlab.orgnewsarticlestheir-best-defense-good-fiscal-sense-daily-press Their best defense is good fiscal sense Top Guard Security finds it can be a good idea to say,...

  4. The Defense Logistics Agency, Hydrogen-Powered Forklift Test...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    The Defense Logistics Agency, Hydrogen-Powered Forklift Test-Bed Brief The Defense Logistics Agency, Hydrogen-Powered Forklift Test-Bed Brief This presentation by Leo Grassilli...

  5. Legacy Management Work Progresses on Defense-Related Uranium...

    Broader source: Energy.gov (indexed) [DOE]

    (LM) continues to work on a report to Congress regarding defense-related legacy uranium mines. LM was directed by the U.S. Congress in the National Defense Authorization Act...

  6. The Defense Logistics Agency, Hydrogen-Powered Forklift Test...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Defense Logistics Agency, Hydrogen-Powered Forklift Test-Bed Brief The Defense Logistics Agency, Hydrogen-Powered Forklift Test-Bed Brief This presentation by Leo Grassilli focuses...

  7. Present experience of NRI REZ with preparation of spent nuclear fuel shipment to Russian Federation

    SciTech Connect (OSTI)

    Svitak, F.; Broz, V.; Hrehor, M.; Marek, M.; Novosad, P.; Podlaha, J.; Rychecky, J. [Nuclear Research Institute Rez plc, Husinec 130, CZ-25068 (Czech Republic)

    2008-07-15

    The Nuclear Research Institute Rez plc (NRI) jointed the Russian Research Reactor Fuel Return (RRRFR) programme under the US-Russian Global Threat Reduction Initiative (GTRI) initiative and started the preparation of the spent nuclear fuel (SNF) shipment from the LVR-15 research reactor back to the Russian Federation (RF). The transport of 16 SKODA VPVR/M casks with EK-10, IRT-2M 80 %, and IRT-2M 36% fuel types is planned for the autumn of 2007. The paper describes the experience gained so far during the preparatory works for the SNF shipment (facility equipment modification, cask licenses) and the actual preparation of the SNF for transport, in particular its checking, repacking in a hot cell, loading into the VPVR/M casks, drying, manipulation, completion of the transport documentation, etc., including its transport to the SNF storage facility at the NRI before it is shipped to the RF. The paper also briefly describes a regulatory framework for these activities with a focus on legislative and methodological aspects of the return of vitrified waste back to the Czech Republic. (author)

  8. Available 45 MILITARY TECHNOLOGY, WEAPONRY, AND NATIONAL DEFENSE...

    Office of Scientific and Technical Information (OSTI)

    NATIONAL DEFENSE; CHEMICAL EXPLOSIONS; SHOCK WAVES; INDUSTRIAL PLANTS; ACCIDENTS; SAFETY; MECHANICAL STRUCTURES; BLAST EFFECTS; DYNAMIC LOADS; BUILDINGS; CHEMICAL EXPLOSIVES;...

  9. THE DEPARTMENT OF DEFENSE HIGH LEVEL ARCHITECTURE Judith S. Dahmann

    E-Print Network [OSTI]

    , recommended the architecture to the Under Secretary of Defense (Acquisition and Technology) for approvalTHE DEPARTMENT OF DEFENSE HIGH LEVEL ARCHITECTURE Judith S. Dahmann Defense Modeling and Simulation Institute of Technology Atlanta, GA 30332-0280 Richard M. Weatherly The MITRE Corporation 7525 Colshire

  10. Defense waste processing facility startup progress report

    SciTech Connect (OSTI)

    Iverson, D.C.; Elder, H.H.

    1992-07-01

    The Savannah River Site (SRS) has been operating a nuclear fuel cycle since the 1950`s to produce nuclear materials in support of the national defense effort. About 83 million gallons of high level waste produced since operation began have been consolidated into 33 million gallons by evaporation at the waste tank farm. The Department of Energy has authorized the construction of the Defense Waste Processing Facility (DWPF) to immobilize the waste as a durable borosilicate glass contained in stainless steel canisters, prior to emplacement in a federal repository. The DWPF is now mechanically complete and undergoing commissioning and run-in activities. Cold startup testing using simulated non-radioactive feeds is scheduled to begin in November 1992 with radioactive operation scheduled to begin in May 1994. While technical issues have been identified which can potentially affect DWPF operation, they are not expected to negatively impact the start of non-radioactive startup testing.

  11. Defense waste processing facility startup progress report

    SciTech Connect (OSTI)

    Iverson, D.C.; Elder, H.H.

    1992-01-01

    The Savannah River Site (SRS) has been operating a nuclear fuel cycle since the 1950's to produce nuclear materials in support of the national defense effort. About 83 million gallons of high level waste produced since operation began have been consolidated into 33 million gallons by evaporation at the waste tank farm. The Department of Energy has authorized the construction of the Defense Waste Processing Facility (DWPF) to immobilize the waste as a durable borosilicate glass contained in stainless steel canisters, prior to emplacement in a federal repository. The DWPF is now mechanically complete and undergoing commissioning and run-in activities. Cold startup testing using simulated non-radioactive feeds is scheduled to begin in November 1992 with radioactive operation scheduled to begin in May 1994. While technical issues have been identified which can potentially affect DWPF operation, they are not expected to negatively impact the start of non-radioactive startup testing.

  12. Department of Defense Nuclear/Biological/Chemical (NBC) warfare defense, annual report to Congress. Final report FY96

    SciTech Connect (OSTI)

    1996-04-01

    The National Defense Authorization Act for Fiscal Year 1994, Public Law No. 103-160, Section 1703, mandates the consolidation of all Department of Defense chemical and biological defense programs. As part of this consolidation, the Secretary of Defense is directed to submit an assessment and a description of plans to improve readiness to survive, fight and win in a chemically or biologically contaminated environment. This report contains modernizations plan summaries which highlight the Department`s approach to improve current NBC defense equipment and resolve current shortcomings in the program.

  13. Introduction Aim of the Paper Game Model Defense Mechanism 1 Defense Mechanism 2 Hidden Difficulty Puzzle Conclusions Game Theoretic Resistance to DoS Attacks Using

    E-Print Network [OSTI]

    Swift, Michael

    Introduction Aim of the Paper Game Model Defense Mechanism 1 Defense Mechanism 2 Hidden Difficulty Model Defense Mechanism 1 Defense Mechanism 2 Hidden Difficulty Puzzle Conclusions Outline 1 Introduction 2 Aim of the Paper 3 Game Model Player Actions Payoff Functions 4 Defense Mechanism 1

  14. Toward a defense-dominated world

    SciTech Connect (OSTI)

    Wood, L.

    1993-08-01

    Maintaining the large-scale peace in a defense-dominated world necessarily will require not only passive but also active defenses against large-scale aggression that are technically feasible, practical and easy to employ -- and robust against perversion into support of aggression. Such peace maintenance tool-sets will feature means for effectively rebuking aggression as well as providing timely and very widely available seaming of aggression underway anywhere. This report discusses the technology base which currently exists to provide world-wide, high-quality imagery at moderate (5--10 meter) spatial resolution or imagery of 1% of the Earth`s land surface at high ({le} 1 meter) resolution no less frequently than daily, at a total cost of the order of $1 B, with operational capability in the later `90s. Such systems could provide timely warning of aggressive actions anywhere. Similarly, space-based means of defeating aggression conducted with even quite short-range ballistic missiles anywhere in the world could be brought into existence by the end of the `90s for a total cost of about $10 B, and small high-altitude, long flight-duration robotic aircraft carrying high-performance sensors and interceptor missilery could provide both seaming and active defenses against attacks conducted with very short range ballistic missiles, as well as attacks launched with air-breathing threats such as bombers and cruise missiles, for a cost per defended area of the order of $10/km{sup 2}. It appears that all of the associated sensors can find apt dual-use as high-performance systems for monitoring physical aspects of the human environment.

  15. New Lighting Technologies Demonstrated at Defense Commissaries

    SciTech Connect (OSTI)

    Parker, Steven A.; Konrade, Joseph; Shepherd III, E Carroll

    2008-10-02

    New and emerging lighting technologies, such as LEDs, can improve lighting quality while reducing maintenance and energy costs. The Defense Commissary Agency, with support from the Department of Energy's Federal Energy Management Program and the Pacific Northwest National Laboratory, demonstrsted the use of LED lighting in a large freezer storage room and fiber optic lighting in a series of verticial reach-in display freezer cases at the Fort George G. Meade Commissary. The LEDs resulted in an 85% reduction in lighting energy and a reduction in maintenance requirements. The fiber optic lighting system resulted in a 56% reduction in lighting energy.

  16. New Lighting Technologies Demonstrated at Defense Commissaries

    SciTech Connect (OSTI)

    Parker, Steven; Konrade, Joseph; Shepherd III, E Carroll

    2009-01-31

    New and emerging lighting technologies, such as LEDs, can improve lighting quality while reducing maintenance and energy costs. The Defense Commissary Agency, with support from the Department of Energy's Federal Energy Management Program and the Pacific Northwest National Laboratory, demonstrsted the use of LED lighting in a large freezer storage room and fiber optic lighting in a series of verticial reach-in display freezer cases at the Fort George G. Meade Commissary. The LEDs resulted in an 85% reduction in lighting energy and a reduction in maintenance requirements. The fiber optic lighting system resulted in a 56% reduction in lighting energy.

  17. Sandia Energy - Defense Waste Management Programs

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid youOxygen GenerationTechnologies |EducationChemicalContact UsDefense

  18. ARM - Defensive Shotgun - Remington 870 Operator's Guide

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Comments? WeDatastreamstps Documentation DataDatastreamsxsacrcwrhiDatastreamsxsaprrhiAlaskaDefensive Shotgun -

  19. Environmental Defense Fund (EDF) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EA Jump to:ofEnia SpA Jump to:Energy Tech Services LtdBancCreditDefense

  20. National Defense Authorization Act for Fiscal Year 2000 § 3164...

    Broader source: Energy.gov (indexed) [DOE]

    Scope: Section 3164 of the National Defense Authorization Act for Fiscal Year 2000 implements a whistleblower protection program to ensure that covered individuals may...

  1. Control Systems Cyber Security: Defense in Depth Strategies ...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Cyber Security: Defense in Depth Strategies More Documents & Publications Good Practice Guide on Firewall Deployment for SCADA and Process Control Networks Mitigations for...

  2. DOE weapons laboratories' contributions to the nation's defense technology base

    SciTech Connect (OSTI)

    Hecker, S.S.

    1988-04-01

    The question of how the Department of Energy (DOE) weapons laboratories can contribute to a stronger defense technology base is addressed in testimony before the Subcommittee on Defense Industry and Technology of the Senate Armed Services Committee. The importance of the defense technology base is described, the DOE technology base is also described, and some technology base management and institutional issues are discussed. Suggestions are given for promoting a more stable, long-term relationship between the DOE weapons laboratories and the Department of Defense. 12 refs., 2 figs.

  3. National Defense Authorization Act for Fiscal Year 2005, Information...

    Broader source: Energy.gov (indexed) [DOE]

    Section 3116 from "National Defense Authorization Act for Fiscal Year 2005" (Public Law 108-375 Oct. 28 2004) Transition20082009EMAdditionalMaterialMACopy.pdf PUBLIC LAW...

  4. NA 10 - Deputy Administrator for Defense Programs | National...

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics NA 10 - Deputy Administrator for Defense Programs NA 10 - Deputy Administrator for...

  5. NA 70 - Associate Administrator for Defense Nuclear Security...

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics NA 70 - Associate Administrator for Defense ... NA 70 - Associate Administrator...

  6. NA 20 - Deputy Administrator for Defense Nuclear Nonproliferation...

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics NA 20 - Deputy Administrator for Defense ... NA 20 - Deputy Administrator for...

  7. Uncertainty, Risk Aversion, and Optimal Defense Against Interruptions in Supply

    E-Print Network [OSTI]

    MCGUIRE, MARTIN C

    2006-01-01

    defense, oil imports, and bio-energy technology. Yale Schoolenergy (e.g. MacAvoy , Ames, and Corridore, 2004) and bio-

  8. Analysis of engineering management characteristics employed in the defense industry

    E-Print Network [OSTI]

    Gutiérrez, Sara S. (Sara Sofia Gutiérrez Cervantes)

    2009-01-01

    An analysis of the engineering management characteristics present in companies in the defense industry was performed. These aspects include the organization characteristics of structure, hierarchy, and standards and ...

  9. Shipment and Disposal of Solidified Organic Waste (Waste Type IV) to the Waste Isolation Pilot Plant (WIPP)

    SciTech Connect (OSTI)

    D'Amico, E. L; Edmiston, D. R.; O'Leary, G. A.; Rivera, M. A.; Steward, D. M.

    2006-07-01

    In April of 2005, the last shipment of transuranic (TRU) waste from the Rocky Flats Environmental Technology Site to the WIPP was completed. With the completion of this shipment, all transuranic waste generated and stored at Rocky Flats was successfully removed from the site and shipped to and disposed of at the WIPP. Some of the last waste to be shipped and disposed of at the WIPP was waste consisting of solidified organic liquids that is identified as Waste Type IV in the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC) document. Waste Type IV waste typically has a composition, and associated characteristics, that make it significantly more difficult to ship and dispose of than other Waste Types, especially with respect to gas generation. This paper provides an overview of the experience gained at Rocky Flats for management, transportation and disposal of Type IV waste at WIPP, particularly with respect to gas generation testing. (authors)

  10. Annual Transportation Report for Radioactive Waste Shipments to and from the Nevada Test Site, Fiscal Year 2009

    SciTech Connect (OSTI)

    U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office

    2010-02-01

    In February 1997, the U.S. Department of Energy (DOE), Nevada Operations Office (now known as the Nevada Site Office) issued the Mitigation Action Plan which addressed potential impacts described in the “Final Environmental Impact Statement for the Nevada Test Site and Off-Site Locations in the State of Nevada” (DOE/EIS 0243). The DOE, Nevada Operations Office committed to several actions, including the preparation of an annual report, which summarizes waste shipments to and from the Nevada Test Site (NTS) Radioactive Waste Management Site (RWMS) at Area 5 and Area 3. Since 2006, the Area 3 RWMS has been in cold stand-by. This document satisfies requirements regarding low-level radioactive waste (LLW) and mixed low-level radioactive waste (MLLW) transported to and from the NTS during FY 2009. In addition, this document provides shipment, volume, and route information on transuranic (TRU) waste shipped from the NTS to the Idaho National Laboratory, near Idaho Falls, Idaho.

  11. Draft Supplement Analysis: Two Proposed Shipments of Commercial Spent Nuclear Fuel to Idaho National Laboratory for Research and Development Purposes

    Broader source: Energy.gov [DOE]

    DOE is proposing to transport, in two separate truck shipments, small quantities of commercial power spent nuclear fuel (SNF) to the Idaho National Laboratory (INL) Site for research purposes consistent with the mission of the DOE Office of Nuclear Energy. DOE is preparing a Supplement Analysis to determine whether an existing environmental impact statement should be supplemented, a new environmental impact statement should be prepared, or that no further NEPA documentation is required for this proposed action.

  12. Full-Scale Cask Testing and Public Acceptance of Spent Nuclear Fuel Shipments - 12254

    SciTech Connect (OSTI)

    Dilger, Fred; Halstead, Robert J.; Ballard, James D.

    2012-07-01

    Full-scale physical testing of spent fuel shipping casks has been proposed by the National Academy of Sciences (NAS) 2006 report on spent nuclear fuel transportation, and by the Presidential Blue Ribbon Commission (BRC) on America's Nuclear Future 2011 draft report. The U.S. Nuclear Regulatory Commission (NRC) in 2005 proposed full-scale testing of a rail cask, and considered 'regulatory limits' testing of both rail and truck casks (SRM SECY-05-0051). The recent U.S. Department of Energy (DOE) cancellation of the Yucca Mountain project, NRC evaluation of extended spent fuel storage (possibly beyond 60-120 years) before transportation, nuclear industry adoption of very large dual-purpose canisters for spent fuel storage and transport, and the deliberations of the BRC, will fundamentally change assumptions about the future spent fuel transportation system, and reopen the debate over shipping cask performance in severe accidents and acts of sabotage. This paper examines possible approaches to full-scale testing for enhancing public confidence in risk analyses, perception of risk, and acceptance of spent fuel shipments. The paper reviews the literature on public perception of spent nuclear fuel and nuclear waste transportation risks. We review and summarize opinion surveys sponsored by the State of Nevada over the past two decades, which show consistent patterns of concern among Nevada residents about health and safety impacts, and socioeconomic impacts such as reduced property values along likely transportation routes. We also review and summarize the large body of public opinion survey research on transportation concerns at regional and national levels. The paper reviews three past cask testing programs, the way in which these cask testing program results were portrayed in films and videos, and examines public and official responses to these three programs: the 1970's impact and fire testing of spent fuel truck casks at Sandia National Laboratories, the 1980's regulatory and demonstration testing of MAGNOX fuel flasks in the United Kingdom (the CEGB 'Operation Smash Hit' tests), and the 1980's regulatory drop and fire tests conducted on the TRUPACT II containers used for transuranic waste shipments to the Waste Isolation Pilot Plant in New Mexico. The primary focus of the paper is a detailed evaluation of the cask testing programs proposed by the NRC in its decision implementing staff recommendations based on the Package Performance Study, and by the State of Nevada recommendations based on previous work by Audin, Resnikoff, Dilger, Halstead, and Greiner. The NRC approach is based on demonstration impact testing (locomotive strike) of a large rail cask, either the TAD cask proposed by DOE for spent fuel shipments to Yucca Mountain, or a similar currently licensed dual-purpose cask. The NRC program might also be expanded to include fire testing of a legal-weight truck cask. The Nevada approach calls for a minimum of two tests: regulatory testing (impact, fire, puncture, immersion) of a rail cask, and extra-regulatory fire testing of a legal-weight truck cask, based on the cask performance modeling work by Greiner. The paper concludes with a discussion of key procedural elements - test costs and funding sources, development of testing protocols, selection of testing facilities, and test peer review - and various methods of communicating the test results to a broad range of stakeholder audiences. (authors)

  13. A National Tracking Center for Monitoring Shipments of HEU, MOX, and Spent Nuclear Fuel: How do we implement?

    SciTech Connect (OSTI)

    Mark Schanfein

    2009-07-01

    Nuclear material safeguards specialists and instrument developers at US Department of Energy (USDOE) National Laboratories in the United States, sponsored by the National Nuclear Security Administration (NNSA) Office of NA-24, have been developing devices to monitor shipments of UF6 cylinders and other radioactive materials , . Tracking devices are being developed that are capable of monitoring shipments of valuable radioactive materials in real time, using the Global Positioning System (GPS). We envision that such devices will be extremely useful, if not essential, for monitoring the shipment of these important cargoes of nuclear material, including highly-enriched uranium (HEU), mixed plutonium/uranium oxide (MOX), spent nuclear fuel, and, potentially, other large radioactive sources. To ensure nuclear material security and safeguards, it is extremely important to track these materials because they contain so-called “direct-use material” which is material that if diverted and processed could potentially be used to develop clandestine nuclear weapons . Large sources could be used for a dirty bomb also known as a radioactive dispersal device (RDD). For that matter, any interdiction by an adversary regardless of intent demands a rapid response. To make the fullest use of such tracking devices, we propose a National Tracking Center. This paper describes what the attributes of such a center would be and how it could ultimately be the prototype for an International Tracking Center, possibly to be based in Vienna, at the International Atomic Energy Agency (IAEA).

  14. Automating Risk Assessments of Hazardous Material Shipments for Transportation Routes and Mode Selection

    SciTech Connect (OSTI)

    Barbara H. Dolphin; William D. RIchins; Stephen R. Novascone

    2010-10-01

    The METEOR project at Idaho National Laboratory (INL) successfully addresses the difficult problem in risk assessment analyses of combining the results from bounding deterministic simulation results with probabilistic (Monte Carlo) risk assessment techniques. This paper describes a software suite designed to perform sensitivity and cost/benefit analyses on selected transportation routes and vehicles to minimize risk associated with the shipment of hazardous materials. METEOR uses Monte Carlo techniques to estimate the probability of an accidental release of a hazardous substance along a proposed transportation route. A METEOR user selects the mode of transportation, origin and destination points, and charts the route using interactive graphics. Inputs to METEOR (many selections built in) include crash rates for the specific aircraft, soil/rock type and population densities over the proposed route, and bounding limits for potential accident types (velocity, temperature, etc.). New vehicle, materials, and location data are added when available. If the risk estimates are unacceptable, the risks associated with alternate transportation modes or routes can be quickly evaluated and compared. Systematic optimizing methods will provide the user with the route and vehicle selection identified with the lowest risk of hazardous material release. The effects of a selected range of potential accidents such as vehicle impact, fire, fuel explosions, excessive containment pressure, flooding, etc. are evaluated primarily using hydrocodes capable of accurately simulating the material response of critical containment components. Bounding conditions that represent credible accidents (i.e; for an impact event, velocity, orientations, and soil conditions) are used as input parameters to the hydrocode models yielding correlation functions relating accident parameters to component damage. The Monte Carlo algorithms use random number generators to make selections at the various decision points such as; crash, location, etc. For each pass through the routines, when a crash is randomly selected, crash parameters are then used to determine if failure has occurred using either external look up tables, correlations functions from deterministic calculations, or built in data libraries. The effectiveness of the software was recently demonstrated in safety analyses of the transportation of radioisotope systems for the US Dept. of Energy. These methods are readily adaptable to estimating risks associated with a variety of hazardous shipments such as spent nuclear fuel, explosives, and chemicals.

  15. Second Line of Defense Spares Program Assessment

    SciTech Connect (OSTI)

    Henderson, Dale L.; Muller, George; Mercier, Theresa M.; Brigantic, Robert T.; Perkins, Casey J.; Cooley, Scott K.

    2012-11-20

    The Office of the Second Line of Defense (SLD) is part of the Department of Energy‘s (DOE) National Nuclear Security Administration (NNSA). The SLD Program accomplishes its critical global security mission by forming cooperative relationships with partner countries to install passive radiation detection systems that augment traditional inspection and law enforcement measures by alerting border officials to the presence of special nuclear or other radiological materials in cross-border traffic. An important tenet of the program is to work collaboratively with these countries to establish the necessary processes, procedures, infrastructure and conditions that will enable them to fully assume the financial and technical responsibilities for operating the equipment. As the number of operational deployments grows, the SLD Program faces an increasingly complex logistics process to promote the timely and efficient supply of spare parts.

  16. History of Hanford Site Defense Production (Brief)

    SciTech Connect (OSTI)

    GERBER, M S

    2001-02-01

    This paper acquaints the audience with the history of the Hanford Site, America's first full-scale defense plutonium production site. The paper includes the founding and basic operating history of the Hanford Site, including World War II construction and operations, three major postwar expansions (1947-55), the peak years of production (1956-63), production phase downs (1964-the present), a brief production spurt from 1984-86, the end of the Cold War, and the beginning of the waste cleanup mission. The paper also delineates historical waste practices and policies as they changed over the years at the Hanford Site, past efforts to chemically treat, ''fractionate,'' and/or immobilize Hanford's wastes, and resulting major waste legacies that remain today. This paper presents original, primary-source research into the waste history of the Hanford Site. Finally, the paper places the current Hanford Site waste remediation endeavors in the broad context of American and world history.

  17. Thesis/Dissertation Defense Checklist Review the Graduation Deadlines

    E-Print Network [OSTI]

    Raina, Ramesh

    Thesis/Dissertation Defense Checklist Review the Graduation Deadlines Submit a Program of Study Advisor Consult your thesis/dissertation advisor to begin preparation for your defense. Be sure that you are aware of all departmental procedures and regulations that pertain to your thesis/dissertation and oral

  18. Deception used for Cyber Defense of Control Systems

    SciTech Connect (OSTI)

    Wayne F. Boyer; Miles A. McQueen

    2009-05-01

    Control system cyber security defense mechanisms may employ deception to make it more difficult for attackers to plan and execute successful attacks. These deceptive defense mechanisms are organized and initially explored according to a specific deception taxonomy and the seven abstract dimensions of security previously proposed as a framework for the cyber security of control systems.

  19. Costs and benefits of Daphnia defense against Chaoborus in nature

    E-Print Network [OSTI]

    Costs and benefits of Daphnia defense against Chaoborus in nature Wiebke J. Boeing, Björn Wissel, and Charles W. Ramcharan Abstract: To estimate costs and benefits of antipredator defenses in the Chaoborus) and the other nonresponsive (NRC) to Chaoborus kairomone, was estimated for each predator treatment. Cost

  20. EIS-0082: Defense Waste Processing Facility, Savannah River Plant

    Broader source: Energy.gov [DOE]

    The Office of Defense Waste and Byproducts Management developed this EIS to provide environmental input into both the selection of an appropriate strategy for the permanent disposal of the high-level radioactive waste currently stored at the Savannah River Plant (SRP) and the subsequent decision to construct and operate a Defense Waste Processing Facility at the SRP site.

  1. A perspective on the status of coal research from shipments of samples

    SciTech Connect (OSTI)

    Vorres, K.S. [Argonne National Lab., IL (United States); Kruse, C.W. [Illinois State Geological Survey, Champaign, IL (United States); Nater, K.A. [deGrote Vos, Zeeweg 37, 1753 BB St. Martenzee, NL (Netherlands); Glick, D.C.; Davis, A. [Pennsylvania State Univ., University Park, PA (United States). Coal and Organic Petrology Labs.

    1993-12-31

    Research on all aspects of coal research, at least for more small scale work, involves the use of samples at the beginning of experimental work. Most research workers for smaller scale work do not collect their own coal samples, but rather order them from a group of sample suppliers. The number of suppliers meeting the major needs in the US, as well as for the world, is not very large. An examination of the shipments of samples from each of these suppliers will give an interesting insight into the general trends in volume of work in the field. The suppliers involved in this study include the Argonne Premium Coal Sample Program, the Illinois Basin Coal Sample Program, the SBN and the several groups of samples from the Pennsylvania State University Coal Sample Bank. Each of these supplies a different number of samples in varying quantities. The quantities and variety of samples is important to the individual worker in selecting a supplier. The type of work to be done frequently affects the quantities and choice of sample, which in turn affects the choice of supplier. In general these data indicate that researchers realize the advantages of acquiring samples from centralized sample banks. These advantages include a lower cost than would be incurred from individual sampling and preparation; availability of analyzed samples; preservation of samples and the possibility of comparing results with others who have worked on the same samples.

  2. Second Line of Defense Spares Program

    SciTech Connect (OSTI)

    Henderson, Dale L.; Holmes, Aimee E.; Muller, George; Mercier, Theresa M.; Brigantic, Robert T.; Perkins, Casey J.; Cooley, Scott K.; Thorsen, Darlene E.

    2012-11-20

    During Fiscal Year 2012, a team from the Pacific Northwest National Laboratory (PNNL) conducted an assessment and analysis of the Second Line of Defense (SLD) Sustainability spare parts program. Spare parts management touches many aspects of the SLD Sustainability Program including contracting and integration of Local Maintenance Providers (LMP), equipment vendors, analyses and metrics on program performance, system state of health, and maintenance practices. Standardized spares management will provide better data for decisions during site transition phase and will facilitate transition to host country sustainability ownership. The effort was coordinated with related SLD Sustainability Program initiatives, including a configuration items baselining initiative, a metrics initiative, and a maintenance initiative. The spares study has also led to pilot programs for sourcing alternatives that include regional intermediate inventories and partnering agreements that leverage existing supply chains. Many partners from the SLD Sustainability program contributed to and were consulted in the course of the study. This document provides a description of the findings, recommendations, and implemented solutions that have resulted from the study.

  3. Sequential Threat Detection for Harbor Defense: An X-ray Physics...

    Office of Scientific and Technical Information (OSTI)

    Sequential Threat Detection for Harbor Defense: An X-ray Physics-Based Bayesian Approach Citation Details In-Document Search Title: Sequential Threat Detection for Harbor Defense:...

  4. Higher Education and China’s Defense Science and Technology Establishment

    E-Print Network [OSTI]

    ALDERMAN, Daniel

    2015-01-01

    7 January 2015 Higher Education and China’s Defense Sciencetalented personnel. The education of China’s defense scienceits institutes of higher education are not better preparing

  5. China’s Defense Innovation System: Making the Wheels Spin

    E-Print Network [OSTI]

    Walsh, Kathleen A; Francis, Ed

    2011-01-01

    2011 China’s Defense Innovation System: Making the Wheelsis developing a defense innovation system (DIS) as part of aeffort to construct a national innovation system (NIS) that

  6. Rejuvenating the Chinese Defense Economy: Present Developments and Future Trends

    E-Print Network [OSTI]

    CHEUNG, Tai Ming

    2011-01-01

    2011 Rejuvenating the Chinese Defense Economy: Presentand future prospects of the Chinese defense economy. Fifteeneven accelerate, as long as the Chinese leadership remains

  7. Rejuvenating the Chinese Defense Economy: Present Developments and Future Trends

    E-Print Network [OSTI]

    CHEUNG, Tai Ming

    2011-01-01

    AND ENGINEERING TALENT The Chinese defense economy has aand engineering graduates to satisfy demand from both the civilian and defense economies,

  8. Radioactive waste shipments to Hanford Retrievable Storage from the General Electric Vallecitos Nuclear Center, Pleasanton, California

    SciTech Connect (OSTI)

    Vejvoda, E.J.; Pottmeyer, J.A.; DeLorenzo, D.S.; Weyns-Rollosson, M.I. [Los Alamos Technical Associates, Inc., NM (United States); Duncan, D.R. [Westinghouse Hanford Co., Richland, WA (United States)

    1993-10-01

    During the next two decades the transuranic (TRU) wastes now stored in the burial trenches and storage facilities at the Hanford Site are to be retrieved, processed at the Waste Receiving and Processing Facility, and shipped to the Waste Isolation Pilot Plant near Carlsbad, New Mexico for final disposal. Approximately 3.8% of the TRU waste to be retrieved for shipment to WIPP was generated at the General Electric (GE) Vallecitos Nuclear Center (VNC) in Pleasanton, California and shipped to the Hanford Site for storage. The purpose of this report is to characterize these radioactive solid wastes using process knowledge, existing records, and oral history interviews. The waste was generated almost exclusively from the activities, of the Plutonium Fuels Development Laboratory and the Plutonium Analytical Laboratory. Section 2.0 provides further details of the VNC physical plant, facility operations, facility history, and current status. The solid radioactive wastes were associated with two US Atomic Energy Commission/US Department of Energy reactor programs -- the Fast Ceramic Reactor (FCR) program, and the Fast Flux Test Reactor (FFTR) program. These programs involved the fabrication and testing of fuel assemblies that utilized plutonium in an oxide form. The types and estimated quantities of waste resulting from these programs are discussed in detail in Section 3.0. A detailed discussion of the packaging and handling procedures used for the VNC radioactive wastes shipped to the Hanford Site is provided in Section 4.0. Section 5.0 provides an in-depth look at this waste including the following: weight and volume of the waste, container types and numbers, physical description of the waste, radiological components, hazardous constituents, and current storage/disposal locations.

  9. Successful Completion of the Largest Shipment of Russian Research Reactor High-Enriched Uranium Spent Nuclear Fuel from Czech Republic to Russian Federation

    SciTech Connect (OSTI)

    Michael Tyacke; Dr. Igor Bolshinsky; Jeff Chamberlin

    2008-07-01

    On December 8, 2007, the largest shipment of high-enriched uranium spent nuclear fuel was successfully made from a Russian-designed nuclear research reactor in the Czech Republic to the Russian Federation. This accomplishment is the culmination of years of planning, negotiations, and hard work. The United States, Russian Federation, and the International Atomic Energy Agency have been working together on the Russian Research Reactor Fuel Return (RRRFR) Program in support of the Global Threat Reduction Initiative. In February 2003, RRRFR Program representatives met with the Nuclear Research Institute in Rež, Czech Republic, and discussed the return of their high-enriched uranium spent nuclear fuel to the Russian Federation for reprocessing. Nearly 5 years later, the shipment was made. This paper discusses the planning, preparations, coordination, and cooperation required to make this important international shipment.

  10. Evaluation of nuclear facility decommissioning projects. Three Mile Island Unit 2. Radioactive waste and laundry shipments. Volume 9. Summary status report

    SciTech Connect (OSTI)

    Doerge, D. H.; Miller, R. L.; Scotti, K. S.

    1986-05-01

    This document summarizes information concerning radioactive waste and laundry shipments from the Three Mile Island Nuclear Station Unit 2 to radioactive waste disposal sites and to protective clothing decontamination facilities (laundries) since the loss of coolant accident experienced on March 28, 1979. Data were collected from radioactive shipment records, summarized, and placed in a computerized data information retrieval/manipulation system which permits extraction of specific information. This report covers the period of April 9, 1979 to May 5, 1985. Included in this report are: waste disposal site locations, dose rates, curie content, waste description, container type and number, volumes and weights. This information is presented in two major categories: protective clothing (laundry) and radioactive waste. Each of the waste shipment reports is in chronological order.

  11. Identifying enterprise leverage points in Defense Acquisition Program performance

    E-Print Network [OSTI]

    Wirthlin, Joseph Robert, 1970-

    2009-01-01

    Large, complex systems development programs in the Department of Defense are finding it more difficult to deliver desired capabilities to the end user on time and on budget than ever before. Evidence exists that almost all ...

  12. Department of Defense Representatives Visit Hanford to Benchmark Safety

    Broader source: Energy.gov [DOE]

    RICHLAND, Wash., December 16, 2005, Representatives of the Department of Defense's (DoD's) Voluntary Protection Program Center of Excellence (VPP CX) working to reduce injuries at selected (DoD)...

  13. Frameworks for Analyzing Chinese Defense and Military Innovation

    E-Print Network [OSTI]

    Cheung, Tai Ming; Mahnken, Thomas G; Ross, Andrew L

    2011-01-01

    include those between product innovation (improved means)defense and military innovation and its concrete products.products, processes, and services for military and dual-use applications, and military innovation

  14. Record of Decision; Defense Waste Processing Facility at the...

    Office of Environmental Management (EM)

    8:45 am BILLING CODE 4000-01-M DEPARTMENT OF ENERGY Record of Decision; Defense Waste Processing Facility at the Savannah River Site, Aiken, SC AGENCY: Department of...

  15. Interface with the Defense Nuclear Facilities Safety Board

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1996-12-30

    The manual defines the process DOE will use to interface with the Defense Nuclear Facilities Safety Board and its staff. Canceled by DOE M 140.1-1A. Does not cancel other directives.

  16. Interface with the Defense Nuclear Facilities Safety Board

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2001-03-30

    This Manual presents the process the Department of Energy will use to interface with the Defense Nuclear Facilities Safety Board (DNFSB) and its staff. Supersedes DOE M 140.1-1A.

  17. Interface with the Defense Nuclear Facilities Safety Board

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1999-01-26

    This Manual presents the process the Department of Energy will use to interface with the Defense Nuclear Facilities Safety Board (DNFSB) and its staff. Cancels DOE M 140.1-1.

  18. Microsoft Word - Defense Science Quarterly 02-08.doc

    National Nuclear Security Administration (NNSA)

    year the team plans to complete up to 18 experiments. Monty Wood (LANL) and Don Smith (LLNL) discuss data during the alpha-can II exercise Page 4 NNSA Office of Defense...

  19. Departments of Energy and Defense Launch ENERGY STAR® Operation...

    Broader source: Energy.gov (indexed) [DOE]

    CAMP LEJEUNE, NC - U.S. Secretary of Energy Samuel W. Bodman on Earth Day launched a joint Department of Energy (DOE) and Defense campaign to challenge military bases nationwide to...

  20. Nuclear Weapon Surety Interface with the Department of Defense

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2009-05-14

    This Order establishes Department of Energy and National Nuclear Security Administration requirements and responsibilities for addressing joint nuclear weapon and nuclear weapon system surety activities in conjunction with the Department of Defense. Supersedes DOE O 452.6.

  1. National Defense Authorization Act for Fiscal Year 2005, Information...

    Office of Environmental Management (EM)

    EMAdditionalMaterialMACopy.pdf PUBLIC LAW 108-375-OCT. 28, 2004 118 STAT. 1811 Public Law 108-375, 108th Congress National Defense Authorization Act for Fiscal Year 2005,...

  2. Partitioning a graph into defensive k-alliances

    E-Print Network [OSTI]

    Yero, Ismael G; Rodriguez-Velazquez, Juan A; Sigarreta, Jose M

    2009-01-01

    A defensive $k$-alliance in a graph is a set $S$ of vertices with the property that every vertex in $S$ has at least $k$ more neighbors in $S$ than it has outside of $S$. A defensive $k$-alliance $S$ is called global if it forms a dominating set. In this paper we study the problem of partitioning the vertex set of a graph into (global) defensive $k$-alliances. The (global) defensive $k$-alliance partition number of a graph $\\Gamma=(V,E)$, ($\\psi_{k}^{gd}(\\Gamma)$) $\\psi_k^{d}(\\Gamma)$, is defined to be the maximum number of sets in a partition of $V$ such that each set is a (global) defensive $k$-alliance. We obtain tight bounds on $\\psi_k^{d}(\\Gamma)$ and $\\psi_{k}^{gd}(\\Gamma)$ in terms of several parameters of the graph including the order, size, maximum and minimum degree, the algebraic connectivity and the isoperimetric number. Moreover, we study the close relationships that exist among partitions of $\\Gamma_1\\times \\Gamma_2$ into (global) defensive $(k_1+k_2)$-alliances and partitions of $\\Gamma_i$ into...

  3. Defense programs beryllium good practice guide

    SciTech Connect (OSTI)

    Herr, M.

    1997-07-01

    Within the DOE, it has recently become apparent that some contractor employees who have worked (or are currently working) with and around beryllium have developed chronic beryllium disease (CBD), an occupational granulomatous lung disorder. Respiratory exposure to aerosolized beryllium, in susceptible individuals, causes an immunological reaction that can result in granulomatous scarring of the lung parenchyma, shortness of breath, cough, fatigue, weight loss, and, ultimately, respiratory failure. Beryllium disease was originally identified in the 1940s, largely in the fluorescent light industry. In 1950, the Atomic Energy Commission (AEC) introduced strict exposure standards that generally curtailed both the acute and chronic forms of the disease. Beginning in 1984, with the identification of a CBD case in a DOE contractor worker, there was increased scrutiny of both industrial hygiene practices and individuals in this workforce. To date, over 100 additional cases of beryllium-specific sensitization and/or CBD have been identified. Thus, a disease previously thought to be largely eliminated by the adoption of permissible exposure standards 45 years ago is still a health risk in certain workforces. This good practice guide forms the basis of an acceptable program for controlling workplace exposure to beryllium. It provides (1) Guidance for minimizing worker exposure to beryllium in Defense Programs facilities during all phases of beryllium-related work, including the decontamination and decommissioning (D&D) of facilities. (2) Recommended controls to be applied to the handling of metallic beryllium and beryllium alloys, beryllium oxide, and other beryllium compounds. (3) Recommendations for medical monitoring and surveillance of workers exposed (or potentially exposed) to beryllium, based on the best current understanding of beryllium disease and medical diagnostic tests available. (4) Site-specific safety procedures for all processes of beryllium that is likely to generate dusts, mists, fumes, or small particulates. A beryllium exposure control program should minimize airborne concentrations, the potential for and spread of contamination, the number of times individuals are exposed to beryllium, and the number of employees who may be potentially exposed.

  4. Natural SelectionsDepartment of Defense Natural Resources Program Spring 2013

    E-Print Network [OSTI]

    of its annual Strategic Sustainability Performance Plan (SSPP), the Department of Defense has released

  5. The science, technology, and politics of ballistic missile defense

    SciTech Connect (OSTI)

    Coyle, Philip E. [Center for Arms Control and Non-Proliferation, Washington, DC (United States)

    2014-05-09

    America's missile defense systems are deployed at home and abroad. This includes the Groundbased Missile Defense (GMD) system in Alaska and California, the Phased Adaptive Approach in Europe (EPAA), and regional systems in the Middle East and Asia. Unfortunately these systems lack workable architectures, and many of the required elements either don't work or are missing. Major review and reconsideration is needed of all elements of these systems. GMD performance in tests has gotten worse with time, when it ought to be getting better. A lack of political support is not to blame as the DoD spends about $10 billion per year, and proposes to add about $5 billion over the next five years. Russia objects to the EPAA as a threat to its ICBM forces, and to the extensive deployment of U.S. military forces in countries such as Poland, the Czech Republic and Romania, once part of the Soviet Union. Going forward the U.S. should keep working with Russia whose cooperation will be key to diplomatic gains in the Middle East and elsewhere. Meanwhile, America's missile defenses face an enduring set of issues, especially target discrimination in the face of attacks designed to overwhelm the defenses, stage separation debris, chaff, decoys, and stealth. Dealing with target discrimination while also replacing, upgrading, or adding to the many elements of U.S. missiles defenses presents daunting budget priorities. A new look at the threat is warranted, and whether the U.S. needs to consider every nation that possesses even short-range missiles a threat to America. The proliferation of missiles of all sizes around the world is a growing problem, but expecting U.S. missile defenses to deal with all those missiles everywhere is unrealistic, and U.S. missile defenses, effective or not, are justifying more and more offensive missiles.

  6. Notice of Intent to Revise Department of Energy Order 461.1B, Packaging and Transportation for Offsite Shipment of Materials of National Security Interest

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2015-01-15

    The purpose of this memorandum is to provide justification for the proposed revision of DOE O 461.1B, Packaging and Transportation for Offsite Shipment of Materials of National Security Interest, dated 12-16-2010, as part of the the quadrennial review and recertification as required by DOE O 251.1C, Departmental Directives Program.

  7. Preparation of the Second Shipment of Spent Nuclear Fuel from the Ustav Jaderneho Vyzkumu Rez (UJV Rez), a.s., Czech Republic to the Russian Federation for Reprocessing - 13478

    SciTech Connect (OSTI)

    Trtilek, Radek; Podlaha, Josef [UJV Rez, a. s., Hlavni 130, 25068 Husinec-Rez (Czech Republic)] [UJV Rez, a. s., Hlavni 130, 25068 Husinec-Rez (Czech Republic)

    2013-07-01

    After more than 50 years of operation of the LVR-15 research reactor operated by the UJV Rez, a. s. (formerly Nuclear Research Institute - NRI), a large amount of the spent nuclear fuel (SNF) of Russian origin has been accumulated. In 2005 UJV Rez, a. s. jointed the Russian Research Reactor Fuel Return (RRRFR) program under the United States (US) - Russian Global Threat Reduction Initiative (GTRI) and started the process of SNF shipment from the LVR-15 research reactor back to the Russian Federation (RF). In 2007 the first shipment of SNF was realized. In 2011, preparation of the second shipment of spent fuel from the Czech Republic started. The experience obtained from the first shipment will be widely used, but some differences must be taken into the account. The second shipment will be realized in 2013 and will conclude the return transport of all, both fresh and spent, high-enriched nuclear fuel from the Czech Republic to the Russian Federation. After the shipment is completed, there will be only low-enriched nuclear fuel on the territory of the Czech Republic, containing maximum of 20% of U-235, which is the conventionally recognized limit between the low- and high-enriched nuclear materials. The experience (technical, organizational, administrative, logistic) obtained from the each SNF shipment as from the Czech Republic as from other countries using the Russian type research reactors are evaluated and projected onto preparation of next shipment of high enriched nuclear fuel back to the Russian Federation. The results shown all shipments provided by the UJV Rez, a. s. in the frame of the GTRI Program have been performed successfully and safely. It is expected the experience and results will be applied to preparation and completing of the Chinese Miniature Neutron Source Reactors (MNSR) Spent Nuclear Fuel Repatriation in the near future. (authors)

  8. Radioactive waste shipments to Hanford retrievable storage from Westinghouse Advanced Reactors and Nuclear Fuels Divisions, Cheswick, Pennsylvania

    SciTech Connect (OSTI)

    Duncan, D.; Pottmeyer, J.A.; Weyns, M.I.; Dicenso, K.D.; DeLorenzo, D.S.

    1994-04-01

    During the next two decades the transuranic (TRU) waste now stored in the burial trenches and storage facilities at the Hanford Sits in southeastern Washington State is to be retrieved, processed at the Waste Receiving and Processing Facility, and shipped to the Waste Isolation Pilot Plant (WIPP), near Carlsbad, New Mexico for final disposal. Approximately 5.7 percent of the TRU waste to be retrieved for shipment to WIPP was generated by the decontamination and decommissioning (D&D) of the Westinghouse Advanced Reactors Division (WARD) and the Westinghouse Nuclear Fuels Division (WNFD) in Cheswick, Pennsylvania and shipped to the Hanford Sits for storage. This report characterizes these radioactive solid wastes using process knowledge, existing records, and oral history interviews.

  9. Key regulatory drivers affecting shipments of mixed transuranic waste from Los Alamos National Laboratory to the Waste Isolation Pilot Plant

    SciTech Connect (OSTI)

    Schumann, P.B.; Bacigalupa, G.A.; Kosiewicz, S.T.; Sinkule, B.J.

    1997-02-01

    A number of key regulatory drivers affect the nature, scope, and timing of Los Alamos National Laboratory`s (LANL`s) plans for mixed transuranic (MTRU) waste shipments to the Waste Isolation Pilot Plant (WIPP), which are planned to commence as soon as possible following WIPP`s currently anticipated November, 1997 opening date. This paper provides an overview of some of the key drivers at LANL, particularly emphasizing those associated with the hazardous waste component of LANL`s MTRU waste (MTRU, like any mixed waste, contains both a radioactive and a hazardous waste component). The key drivers discussed here derive from the federal Resource Conservation and Recovery Act (RCRA) and its amendments, including the Federal Facility Compliance Act (FFCAU), and from the New Mexico Hazardous Waste Act (NMHWA). These statutory provisions are enforced through three major mechanisms: facility RCRA permits; the New Mexico Hazardous Waste Management Regulations, set forth in the New Mexico Administrative Code, Title 20, Chapter 4, Part 1: and compliance orders issued to enforce these requirements. General requirements in all three categories will apply to MTRU waste management and characterization activities at both WIPP and LANL. In addition, LANL is subject to facility-specific requirements in its RCRA hazardous waste facility permit, permit conditions as currently proposed in RCRA Part B permit applications presently being reviewed by the New Mexico Environment Department (NNED), and facility-specific compliance orders related to MTRU waste management. Likewise, permitting and compliance-related requirements specific to WIPP indirectly affect LANL`s characterization, packaging, record-keeping, and transportation requirements for MTRU waste. LANL must comply with this evolving set of regulatory requirements to begin shipments of MTRU waste to WIPP in a timely fashion.

  10. Stakeholder Transportation Scorecard: Reviewing Nevada's Recommendations for Enhancing the Safety and Security of Nuclear Waste Shipments - 13518

    SciTech Connect (OSTI)

    Dilger, Fred C.; Ballard, James D.; Halstead, Robert J.

    2013-07-01

    As a primary stakeholder in the Yucca Mountain program, the state of Nevada has spent three decades examining and considering national policy regarding spent nuclear fuel and high-level radioactive waste transportation. During this time, Nevada has identified 10 issues it believes are critical to ensuring the safety and security of any spent nuclear fuel transportation program, and achieving public acceptance. These recommendations are: 1) Ship the oldest fuel first; 2) Ship mostly by rail; 3) Use dual-purpose (transportable storage) casks; 4) Use dedicated trains for rail shipments; 5) Implement a full-scale cask testing program; 6) Utilize a National Environmental Policy Act (NEPA) process for the selection of a new rail spur to the proposed repository site; 7) Implement the Western Interstate Energy Board (WIEB) 'straw man' process for route selection; 8) Implement Section 180C assistance to affected States, Tribes and localities through rulemaking; 9) Adopt safety and security regulatory enhancements proposed states; and 10) Address stakeholder concerns about terrorism and sabotage. This paper describes Nevada's proposals in detail and examines their current status. The paper describes the various forums and methods by which Nevada has presented its arguments and sought to influence national policy. As of 2012, most of Nevada's recommendations have been adopted in one form or another, although not yet implemented. If implemented in a future nuclear waste program, the State of Nevada believes these recommendations would form the basis for a successful national transportation plan for shipments to a geologic repository and/or centralized interim storage facility. (authors)

  11. INTERNAL DEFENSES OF CRUSTACEA: A REVIEWl CARL J. SINDERMANN"

    E-Print Network [OSTI]

    defense perimeter in many crustaceans. Efficacy of phagocytes in destroying in- vading microorganisms varies, depending on the species of the microorganism, as well as host physiology and environmental-again with the possible exception of the mollusks and insects. One mi- crobial pathogen of Crustacea that has received

  12. Defense from a distance ORNL robotics sensors detect underwater

    E-Print Network [OSTI]

    SCIENCE Defense from a distance ORNL robotics sensors detect underwater explosive ordnance Modern of the future are not human oriented, but robotics oriented. For robots to perform their mission of safety at the forefront of robotics design, these are the droids we are looking for. ­Dylan Platz Karnowski analyzes

  13. MS Thesis Defense A Combined Discrete-dislocation/Scale-

    E-Print Network [OSTI]

    Grujicic, Mica

    MS Thesis Defense A Combined Discrete-dislocation/Scale- dependent Crystal Plasticity Analysis of Deformation and Fracture in Nanomaterials A Combined Discrete-dislocation/Scale- dependent Crystal Plasticity der Giessen, Needleman 1995) Crystal Plasticity Model Results and ComparisonII. Micro-beam Bending

  14. Leading Edge Antiviral Strategies: Building a Better Defense

    E-Print Network [OSTI]

    Ferguson, Andrew

    Leading Edge Select Antiviral Strategies: Building a Better Defense Viruses are a widespread demand. In this Select, we look at recent papers that are helping to advance antiviral research that are surrounded by a lipid bilayer that is needed for cellular entry and infec- tivity (enveloped), and those

  15. BETAVOLTAIC BATTERIES Long-Life Power for Defense & Medical Markets

    E-Print Network [OSTI]

    BETAVOLTAIC BATTERIES Long-Life Power for Defense & Medical Markets NREL Industry Growth Forum Jonathan W. Greene, CEO November 2, 2009 #12;·! Patented Betavoltaics ­ tiny, long life batteries targeting electronic and isotope powered batteries MS - 14 yrs management and engineering ·!Expert in patent

  16. Smart-Phone Attacks and Defenses Chuanxiong Guo

    E-Print Network [OSTI]

    Wang, Bing

    Smart-Phone Attacks and Defenses Chuanxiong Guo xguo@ieee.org Microsoft Research Helen J. Wang smart-phones), and our environment (e.g., through the use of sensors, actuators, and RFIDs). While is becoming a reality: Smart-phones, interoperable between the telecom networks and the Inter- net

  17. Doctoral Defense "Feasibility Study of High Performance Cutoff Walls for

    E-Print Network [OSTI]

    Kamat, Vineet R.

    for a candidate ECC mix. Also, revisions to existing levee seismic design guidelines are proposed, basedDoctoral Defense "Feasibility Study of High Performance Cutoff Walls for Levees in Seismic Regions state or length of their cutoff walls, and 2) seismic activity poses serious risks to many existing

  18. RISK MANAGEMENT AND TORT DEFENSE Sub-Chapter 2

    E-Print Network [OSTI]

    Dyer, Bill

    1 #12;2 RISK MANAGEMENT AND TORT DEFENSE 2.6.203 Sub-Chapter 2 State Vehicle Use 2.6.201 INTRODUCTION (1) The following rules define acceptable uses for state-owned or leased motor pool vehicles guidelines, policies, insurance coverage exclusions, or regulations for vehicle/equipment fleet operations

  19. On the effectiveness of service registration-based worm defense

    E-Print Network [OSTI]

    Bahk, Saewoong

    &D Center Samsung Electronics Email: jin ho.kim@samsung.com Hyogon Kim Department of Computer Science and Computer Science Seoul National University Email: sbahk@snu.ac.kr Abstract-- Existing Internet worm but the progress is slow because worm is fast. In case of virus the defense is easier since the propagation is slow

  20. Randomizing AMI Configuration for Proactive Defense in Smart Grid

    E-Print Network [OSTI]

    Wang, Yongge

    Randomizing AMI Configuration for Proactive Defense in Smart Grid Muhammad Qasim Ali, Ehab Al: {mali12, ealshaer, qiduan}@uncc.edu Abstract--Smart grids are capable of bi-directional commu- nication between smart meters and headend systems. It is a core feature of smart grid provided by the underlying

  1. Ph.D. in Mathematics Education Dissertation Defense

    E-Print Network [OSTI]

    Elzanowski, Marek

    Ph.D. in Mathematics Education Dissertation Defense Kate Melhuish The Creation and Validation of a Group Theory Concept Inventory MS (Western Carolina University, 2010) BS (Gwynedd-Mercy College, 2007 Goforth, PhD Abstract The Group Concept Inventory (GCI) is an assessment tool that measures conceptual

  2. Embedded Electrical and Computer Engineering MASTER ORAL DEFENSE

    E-Print Network [OSTI]

    Mahmoodi, Hamid

    Embedded Electrical and Computer Engineering MASTER ORAL DEFENSE TITLE: Low Power Scanner for High of this research is to design a low power integrated system that can be used in vivo for scanning the electrode. A model created in Python provides input vectors and output comparison for the verification process

  3. Energy Attacks and Defense Techniques for Wireless Systems

    E-Print Network [OSTI]

    Potkonjak, Miodrag

    Energy Attacks and Defense Techniques for Wireless Systems Sheng Wei Jong Hoon Ahnn Miodrag {shengwei, jhahnn, miodrag}@cs.ucla.edu ABSTRACT This paper addresses the energy attacks towards wireless in the wireless systems and trigger ultra-high energy increases at runtime. Then, we develop a non-destructive HT

  4. Are three-dimensional spider webs defensive adaptations?

    E-Print Network [OSTI]

    Blackledge, Todd

    LETTER Are three-dimensional spider webs defensive adaptations? Todd A. Blackledge1 *, Jonathan A-mail: tab42@cornell.edu Abstract Spider webs result from complex behaviours that have evolved under many selective pressures. Webs have been primarily considered to be foraging adaptations, neglecting

  5. Embedded Electrical and Computer Engineering MASTER ORAL DEFENSE

    E-Print Network [OSTI]

    Mahmoodi, Hamid

    Embedded Electrical and Computer Engineering MASTER ORAL DEFENSE TITLE: Embedded Systems Design are the devices which involve both hardware and software design in one system simultaneously. There are diverse etc. In order to reflect these trends in education in a hands-on manner, a platform is needed

  6. Defense High Level Waste Disposal Container System Description

    SciTech Connect (OSTI)

    2000-10-12

    The Defense High Level Waste Disposal Container System supports the confinement and isolation of waste within the Engineered Barrier System of the Monitored Geologic Repository (MGR). Disposal containers are loaded and sealed in the surface waste handling facilities, transferred to the underground through the accesses using a rail mounted transporter, and emplaced in emplacement drifts. The defense high level waste (HLW) disposal container provides long-term confinement of the commercial HLW and defense HLW (including immobilized plutonium waste forms (IPWF)) placed within disposable canisters, and withstands the loading, transfer, emplacement, and retrieval loads and environments. U.S. Department of Energy (DOE)-owned spent nuclear fuel (SNF) in disposable canisters may also be placed in a defense HLW disposal container along with commercial HLW waste forms, which is known as 'co-disposal'. The Defense High Level Waste Disposal Container System provides containment of waste for a designated period of time, and limits radionuclide release. The disposal container/waste package maintains the waste in a designated configuration, withstands maximum handling and rockfall loads, limits the individual canister temperatures after emplacement, resists corrosion in the expected handling and repository environments, and provides containment of waste in the event of an accident. Defense HLW disposal containers for HLW disposal will hold up to five HLW canisters. Defense HLW disposal containers for co-disposal will hold up to five HLW canisters arranged in a ring and one DOE SNF canister in the ring. Defense HLW disposal containers also will hold two Multi-Canister Overpacks (MCOs) and two HLW canisters in one disposal container. The disposal container will include outer and inner cylinders, outer and inner cylinder lids, and may include a canister guide. An exterior label will provide a means by which to identify the disposal container and its contents. Different materials will be selected for the disposal container inner and outer cylinders. The two metal cylinders, in combination with the Emplacement Drift System, drip shield, and natural barrier, will support the design philosophy of defense-in-depth. The use of materials with different properties prevents a single mode failure from breaching the waste package. The inner cylinder and inner cylinder lids will be constructed of stainless steel and the outer cylinder and outer cylinder lids will be a barrier made of high-nickel alloy. The defense HLW disposal container interfaces with the emplacement drift environment and the internal waste by transferring heat from the canisters to the external environment and by protecting the canisters and their contents from damage/degradation by the external environment. The disposal container also interfaces with the canisters by limiting access of moderator and oxidizing agents to the waste. A loaded and sealed disposal container (waste package) interfaces with the Emplacement Drift System's emplacement drift waste package supports upon which the waste packages are placed. The disposal container interfaces with the Canister Transfer System, Waste Emplacement /Retrieval System, Disposal Container Handling System, and Waste Package Remediation System during loading, handling, transfer, emplacement, and retrieval for the disposal container/waste package.

  7. China’s Defense High-Tech Leadership: Implications for S&T Innovation

    E-Print Network [OSTI]

    Hagt, Eric

    2011-01-01

    2011 China’s Defense High-Tech Leadership: Implications foran effective defense high-tech innovation system. Thein the PLA and advises on high-tech and strategic platforms.

  8. EIS-0347: Long-Term Management of the National Defense Stockpile Inventory of Excess Mercury

    Broader source: Energy.gov [DOE]

    This Defense Logistics Agency EIS evaluated alternatives for managing the Defense National Stockpile Center inventory of excess mercury. DOE was a cooperating agency for preparation of the draft EIS.

  9. China’s Defense High-Tech Leadership: Implications for S&T Innovation

    E-Print Network [OSTI]

    Hagt, Eric

    2011-01-01

    Implications for S&T Innovation Eric Hagt Summary O ver theeffective defense high-tech innovation system. The Sciencevision for future defense innovation that the PLA needs. The

  10. Practical matters for defense contractors converting DoD technology to commercial markets

    E-Print Network [OSTI]

    Ting, Carina Maria

    2012-01-01

    This thesis asks if and how the defense contractor can profitably transfer the technology and institutional learning obtained from DoD funded R&D to commercial markets. There are numerous examples of very successful defense ...

  11. Smartphone Dual Defense Protection Framework: Detecting Malicious Applications in Android Markets

    E-Print Network [OSTI]

    Chuah, Mooi-Choo "Mooi"

    Smartphone Dual Defense Protection Framework: Detecting Malicious Applications in Android Markets X dual defense protection framework that allows Official and Alternative Android Markets to detect malware applications. If suspicious network traffic is observed, the relevant Android markets

  12. Inhabiting cycles of maritime obsolescence : redirecting the National Defense Reserve Fleet

    E-Print Network [OSTI]

    Polansky, Nicholas W. (Nicholas Wilkes)

    2014-01-01

    Defense is in a state of obsolescence. The metrics of risk have changed from threat of military invasion to that of weather. Infrastructure is in a state of transition. The Maritime Administration's National Defense Reserve ...

  13. Department of Defense National Security Personnel System : the transition to pay for performance

    E-Print Network [OSTI]

    Davies, Rebecca L. (Rebecca Leigh), 1960-

    2004-01-01

    The 2004 National Defense Authorization Act (Public Law 10-136, November 24, 2003) gives the Department of Defense (DoD) authority to establish the National Security Personnel System (NSPS). This system will mark the most ...

  14. Ontogeny of Defense : Does Life History Affect Predator Response Behavior in the Pygmy Octopus, Octopus Bocki?

    E-Print Network [OSTI]

    Himes, Julie E.

    2006-01-01

    ONTOGENY OF DEFENSE: DOES LIFE HISTORY AFFECT PREDATORdoes seem to be a shift toward communication over the life history

  15. The calcification of Staphylococcus aureus bacteria : a potential defense mechanism against infections

    E-Print Network [OSTI]

    Arellano, Catherine Krystle

    2010-01-01

    in Serum: A Possible Mechanism for Biomineralization. J.Bacteria: A Potential Defense Mechanism Against Infections Amechanism

  16. Comment submitted by the Natural Resources Defense Council (NRDC) regarding the Energy Star Verification Testing Program

    Broader source: Energy.gov [DOE]

    This document is a comment submitted by the Natural Resources Defense Council (NRDC) regarding the Energy Star Verification Testing Program

  17. Requirements And Instructions For Shipping Halon To The Defense Logistics Agency (DLA) Halon Repository

    Broader source: Energy.gov [DOE]

    Disposition of excess Halon 1301 is now done in accordance with Executive Order 13148 — “Greening the Government Through Leadership in Environmental Management ”, Section 505 (c). An SF-122 form (or equivalent documentation) should be approved by the DLA prior to shipment.

  18. A Taxonomy of DDoS Attack and DDoS Defense Mechanisms

    E-Print Network [OSTI]

    Lee, Ruby B.

    A Taxonomy of DDoS Attack and DDoS Defense Mechanisms Jelena Mirkovic 449 Smith Hall Computer the attacks and the defense approaches is overwhelming. This paper presents two taxonomies for classifying. The defense taxonomy classifies the body of existing DDoS de- fenses based on their design decisions

  19. Financial assistance to states and tribes to support emergency preparedness and response and the safe transportation of hazardous shipments: 1996 Update

    SciTech Connect (OSTI)

    Bradbury, J.A.; Leyson, J.; Lester, M.K.

    1996-07-01

    This report revises and updates the 1995 report Financial Assistance to States and Tribes to Support Emergency Preparedness and Response and the Safe Transportation of Hazardous Shipments, PNL-10260 (UC-620). The presentation of data and some of the data reported have been changed; these data supersede those presented in the earlier publication. All data have been updated to fiscal year 1995, with the exception of FEMA data that are updated to fiscal year 1994 only. The report identifies and summarizes existing sources of financial assistance to States and Tribes in preparing and responding to transportation emergencies and ensuring the safe transportation of hazardous shipments through their jurisdictions. It is intended for use as an information resource for the U.S. Department of Energy`s Office of Environmental Management (EM), Office of Transportation, Emergency Management, and Analytical Services (EM-76).

  20. Fall Protection Procedures for Sealing Bulk Waste Shipments by Rail Cars at Formerly Utilized Sites Remedial Action Program (FUSRAP) Sites - 13509

    SciTech Connect (OSTI)

    Boyle, J.D.; Fort, E. Joseph; Lorenz, William; Mills, Andy

    2013-07-01

    Rail-cars loaded with radioactive materials must be closed and fastened to comply with United States Department of Transportation (DOT) requirements before they shipped. Securing waste shipments in a manner that meets these regulations typically results in the use of a sealable rail-car liner. Workers accessing the tops of the 2.74 m high rail-cars to seal and inspect liners for compliance prior to shipment may be exposed to a fall hazard. Relatively recent revisions to the Fall Protection requirements in the Safety and Health Requirements Manual (EM385-1-1, U.S. Army Corps of Engineers) have necessitated modifications to the fall protection systems previously employed for rail-car loading at Formerly Utilized Sites Remedial Action Program (FUSRAP) sites. In response these projects have developed site-specific procedures to protect workers and maintain compliance with the improved fall protection regulations. (authors)

  1. Department of Defense Nuclear/Biological/Chemical (NBC) warfare defense. Annual report to Congress, June 1994. Final report, 1 October 1992-30 September 1993

    SciTech Connect (OSTI)

    Not Available

    1994-06-01

    The National Defense Authorization Act for Fiscal Year 1994, Public Law 103-160, Title XVII, Chemical and Biological Weapons Defense, section 1703, directed the Secretary of Defense to submit an assessment and a description of plans to improve readiness. The DoD objective is to enable our forces to survive, fight and win in NBC contaminated environments. Discussed are new management objectives impacted by declining resources and force structure versus an ever changing threat environment. Nuclear biological, Chemical, NBC, Defense, Logistics, Readiness, Training, Contamination avoidance, Protection, Decontamination.

  2. Nuclear Weapon Surety Interface with the Department of Defense

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2006-10-19

    The Order prescribes how the Department of Energy participates with the Department of Defense (DoD) to ensure the surety (safety, security and control) of military nuclear weapon systems deployed around the world. The Order establishes National Nuclear Security Administration requirements and responsibilities for addressing joint nuclear weapon and nuclear weapon system surety activities in conjunction with the DoD. Cancels DOE O 5610.13. Canceled by DOE O 452.6A.

  3. Defense, Interior Departments Pursue Renewable Energy on Federal Lands |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department8, 20153Daniel BoffDepartment of Energy Defense, Interior

  4. Defense Programs: the mission | Y-12 National Security Complex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit theCovalent Bonding Low-Cost2 DOENERSCDecemberDeclarationHANFORD8,Defense

  5. United States Department of Defense | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York:Power Company Jump to: navigation,Defense Jump to:

  6. Meeting Department of Defense non-hazardous solid waste goals

    SciTech Connect (OSTI)

    Eakes, W.S.; Comstock, J.

    1999-07-01

    This paper will discuss the previous and present Department of Defense (DOD) non-hazardous solid waste goals and how Navy and Marine Corps installation collect solid waste data and measure the goals. The installation and central data collection systems used, data collection problems and solutions, data quality, and the yearly measure. The paper will also discuss the original solid waste reduction and diversion goal and how the Navy and Marine Corps performed. The new DOD landfill and incineration diversion goal will be discussed and some techniques the Navy will use to meet the new goals.

  7. Indiana Office of Energy Defense Development | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13 (Vt. Water Res.:01Energy Defense Development Jump to:

  8. Unmanned and Unattended Response Capability for Homeland Defense

    SciTech Connect (OSTI)

    BENNETT, PHIL C.

    2002-11-01

    An analysis was conducted of the potential for unmanned and unattended robotic technologies for forward-based, immediate response capabilities that enables access and controlled task performance. The authors analyze high-impact response scenarios in conjunction with homeland security organizations, such as the NNSA Office of Emergency Response, the FBI, the National Guard, and the Army Technical Escort Unit, to cover a range of radiological, chemical and biological threats. They conducted an analysis of the potential of forward-based, unmanned and unattended robotic technologies to accelerate and enhance emergency and crisis response by Homeland Defense organizations. Response systems concepts were developed utilizing new technologies supported by existing emerging threats base technologies to meet the defined response scenarios. These systems will pre-position robotic and remote sensing capabilities stationed close to multiple sites for immediate action. Analysis of assembled systems included experimental activities to determine potential efficacy in the response scenarios, and iteration on systems concepts and remote sensing and robotic technologies, creating new immediate response capabilities for Homeland Defense.

  9. Materials for defense/aerospace applications (NON-SV)

    SciTech Connect (OSTI)

    Ellis, A. R.

    2012-03-01

    Through this effort, Sandia and Lockheed Martin Aeronautics Company (LM Aero) sought to assess the feasibility of (1) applying special materials to a defense application; (2) developing a piezoelectric-based micro thermophotovoltaic (TPV) cell; and (3) building and delivering a prototype laboratory emission measurement system. This project supported the Stockpile Research & Development Program by contributing to the development of radio frequency (RF) MEMS- and optical MEMS-based components - such as switches, phase shifters, oscillators, and filters - with improved performance and reduced weight and size. Investigation of failure mechanisms and solutions helped to ensure that MEMS-based technology will meet performance requirements and long term reliability goals in the specified environments dictated by Lockheed Martin's commercial and defense applications. The objectives of this project were to (1) fabricate and test materials for military applications; (2) perform a feasibility study of a piezoelectric-based micro TPV cell; and (3) build and deliver a prototype laboratory emission measurement system. Sandia fabricated and tested properties of materials, studied options for manufacturing scale-up, and delivered a prototype IR Emissometer. LM Aero provided material requirements and designs. Both participated in the investigation of attachment methods and environmental effects on material performance, a feasibility study of piezoelectric TPV cells, an investigation and development of new approaches to implement the required material functionality, and analysis and validation of material performance physics, numerical models, and experimental metrology.

  10. Defense waste vitrification studies during FY-1981. Summary report

    SciTech Connect (OSTI)

    Bjorklund, W.J. (comp.)

    1982-09-01

    Both simulated alkaline defense wastes and simulated acidic defense wastes (formed by treating alkaline waste with formic acid) were successfully vitrified in direct liquid-fed melter experiments. The vitrification process was improved while using the formate-treated waste. Leach resistance was essentially the same. Off-gas entrainment was the primary mechanism for material exiting the melter. When formate waste was vitrified, the flow behavior of the off gas from the melter changed dramatically from an erratic surging behavior to a more quiet, even flow. Hydrogen and CO were detectable while processing formate feed; however, levels exceeding the flamability limits in air were never approached. Two types of melter operation were tested during the year, one involving boost power. Several boosting methods located within the melter plenum were tested. When lid heating was being used, water spray cooling in the off gas was required. Countercurrent spray cooling was more effective than cocurrent spray cooling. Materials of construction for the off-gas system were examined. Inconel-690 is preferred in the plenum area. Inspection of the pilot-scale melter found that corrosion of the K-3 refractory and Inconel-690 electrodes was minimal. An overheating incident occurred with the LFCM in which glass temperatures up to 1480/sup 0/C were experienced. Lab-scale vitrification tests to study mercury behavior were also completed this year. 53 figures, 63 tables.

  11. Defense High-Level Waste Leaching Mechanisms Program. Final report

    SciTech Connect (OSTI)

    Mendel, J.E. (compiler)

    1984-08-01

    The Defense High-Level Waste Leaching Mechanisms Program brought six major US laboratories together for three years of cooperative research. The participants reached a consensus that solubility of the leached glass species, particularly solubility in the altered surface layer, is the dominant factor controlling the leaching behavior of defense waste glass in a system in which the flow of leachant is constrained, as it will be in a deep geologic repository. Also, once the surface of waste glass is contacted by ground water, the kinetics of establishing solubility control are relatively rapid. The concentrations of leached species reach saturation, or steady-state concentrations, within a few months to a year at 70 to 90/sup 0/C. Thus, reaction kinetics, which were the main subject of earlier leaching mechanisms studies, are now shown to assume much less importance. The dominance of solubility means that the leach rate is, in fact, directly proportional to ground water flow rate. Doubling the flow rate doubles the effective leach rate. This relationship is expected to obtain in most, if not all, repository situations.

  12. Developing a Framework to Identify Innovation in the Defense Research, Development, and Acquistion Processes

    E-Print Network [OSTI]

    MARCUM, Maggie

    2013-01-01

    a Framework to Identify Innovation in the Defense Research,methodology to characterize innovation factors in defenseof states. The Study of Innovation and Technology in China (

  13. Understanding Military Innovation: Chinese Defense S&T in Historical and Theoretical Perspective

    E-Print Network [OSTI]

    Mahnken, Thomas G

    2010-01-01

    ABILITY TO DETECT INNOVATION There are several additionaland recog- nize Chinese innovation. These include: Thomas G.Understanding Military Innovation: Chinese Defense S&T in

  14. Defense Program Equivalencies for Technical Qualification Standard Competencies12/12/1995

    Broader source: Energy.gov [DOE]

    Defense Programs has undertaken an effort to compare the competencies in the GeneralTechnical Base Qualification Standard and the Functional Area Qualification Standards withvarious positions in...

  15. An army for the people : the self- defense forces and society in postwar Japan

    E-Print Network [OSTI]

    Sasaki, Tomoyuki

    2009-01-01

    purpose of defense. ” Judge Fukushima, however, stated thatof the base. Judge Fukushima Shigeo argued that tree fellingfiled their lawsuit. Judge Fukushima Shigeo, the same judge

  16. Defense waste processing facility radioactive operations. Part 1 - operating experience

    SciTech Connect (OSTI)

    Little, D.B.; Gee, J.T.; Barnes, W.M.

    1997-12-31

    The Savannah River Site`s Defense Waste Processing Facility (DWPF) near Aiken, SC is the nation`s first and the world`s largest vitrification facility. Following a ten year construction program and a 3 year non-radioactive test program, DWPF began radioactive operations in March 1996. This paper presents the results of the first 9 months of radioactive operations. Topics include: operations of the remote processing equipment reliability, and decontamination facilities for the remote processing equipment. Key equipment discussed includes process pumps, telerobotic manipulators, infrared camera, Holledge{trademark} level gauges and in-cell (remote) cranes. Information is presented regarding equipment at the conclusion of the DWPF test program it also discussed, with special emphasis on agitator blades and cooling/heating coil wear. 3 refs., 4 figs.

  17. SECURITY MODELING FOR MARITIME PORT DEFENSE RESOURCE ALLOCATION

    SciTech Connect (OSTI)

    Harris, S.; Dunn, D.

    2010-09-07

    Redeployment of existing law enforcement resources and optimal use of geographic terrain are examined for countering the threat of a maritime based small-vessel radiological or nuclear attack. The evaluation was based on modeling conducted by the Savannah River National Laboratory that involved the development of options for defensive resource allocation that can reduce the risk of a maritime based radiological or nuclear threat. A diverse range of potential attack scenarios has been assessed. As a result of identifying vulnerable pathways, effective countermeasures can be deployed using current resources. The modeling involved the use of the Automated Vulnerability Evaluation for Risks of Terrorism (AVERT{reg_sign}) software to conduct computer based simulation modeling. The models provided estimates for the probability of encountering an adversary based on allocated resources including response boats, patrol boats and helicopters over various environmental conditions including day, night, rough seas and various traffic flow rates.

  18. Control Systems Cyber Security: Defense-in-Depth Strategies

    SciTech Connect (OSTI)

    Mark Fabro

    2007-10-01

    Information infrastructures across many public and private domains share several common attributes regarding IT deployments and data communications. This is particularly true in the control systems domain. A majority of the systems use robust architectures to enhance business and reduce costs by increasing the integration of external, business, and control system networks. However, multi-network integration strategies often lead to vulnerabilities that greatly reduce the security of an organization, and can expose mission-critical control systems to cyber threats. This document provides guidance and direction for developing ‘defense-in-depth’ strategies for organizations that use control system networks while maintaining a multi-tier information architecture that requires: • Maintenance of various field devices, telemetry collection, and/or industrial-level process systems • Access to facilities via remote data link or modem • Public facing services for customer or corporate operations • A robust business environment that requires connections among the control system domain, the external Internet, and other peer organizations.

  19. Control Systems Cyber Security:Defense in Depth Strategies

    SciTech Connect (OSTI)

    David Kuipers; Mark Fabro

    2006-05-01

    Information infrastructures across many public and private domains share several common attributes regarding IT deployments and data communications. This is particularly true in the control systems domain. A majority of the systems use robust architectures to enhance business and reduce costs by increasing the integration of external, business, and control system networks. However, multi-network integration strategies often lead to vulnerabilities that greatly reduce the security of an organization, and can expose mission-critical control systems to cyber threats. This document provides guidance and direction for developing ‘defense-in-depth’ strategies for organizations that use control system networks while maintaining a multi-tier information architecture that requires: Maintenance of various field devices, telemetry collection, and/or industrial-level process systems Access to facilities via remote data link or modem Public facing services for customer or corporate operations A robust business environment that requires connections among the control system domain, the external Internet, and other peer organizations.

  20. Active, Non-Intrusive Inspection Technologies for Homeland Defense

    SciTech Connect (OSTI)

    James L. Jones

    2003-06-01

    Active, non-intrusive inspection or interrogation technologies have been used for 100 years - with the primary focus being radiographic imaging. During the last 50 years, various active interrogation systems have been investigated and most have revealed many unique and interesting capabilities and advantages that have already benefited the general public. Unfortunately, except for medical and specific industrial applications, these unique capabilities have not been widely adopted, largely due to the complexity of the technology, the overconfident reliance on passive detection systems to handle most challenges, and the unrealistic public concerns regarding radiation safety issues for a given active inspection deployment. The unique homeland security challenges facing the United States today are inviting more "out-of-the-box" solutions and are demanding the effective technological solutions that only active interrogation systems can provide. While revolutionary new solutions are always desired, these technology advancements are rare, and when found, usually take a long time to fully understand and implement for a given application. What's becoming more evident is that focusing on under-developed, but well-understood, active inspection technologies can provide many of the needed "out-of-the-box" solutions. This paper presents a brief historical overview of active interrogation. It identifies some of the major homeland defense challenges being confronted and the commercial and research technologies presently available and being pursued. Finally, the paper addresses the role of the Idaho National Engineering and Environmental Laboratory and its partner, the Idaho Accelerator Center at Idaho State University, in promoting and developing active inspection technologies for homeland defense.

  1. 388 Federal Funds--Continued ENVIRONMENTAL AND OTHER DEFENSE ACTIVITIES--Continued

    E-Print Network [OSTI]

    Management to accomplish its mission. Office of Civilian Radioactive Waste Management.--The pro- gram ...................................................... 658 993 965 f DEFENSE NUCLEAR WASTE DISPOSAL For nuclear waste disposal activities to carry out of Legacy Management (Defense).--The programs within this office support long-term stewardship activities

  2. The Impact of Emerging MEMS-Based Microsystems on US Defense Applications

    SciTech Connect (OSTI)

    STAPLE,BEVAN D.; JAKUBCZAK II,JEROME F.

    2000-01-20

    This paper examines the impact of inserting Micro-Electro-Mechanical Systems (MEMS) into US defense applications. As specific examples, the impacts of micro Inertial Measurement Units (IMUs), radio frequency MEMS (RF MEMS), and Micro-Opto-Electro-Mechanical Systems (MOEMS) to provide integrated intelligence, communication, and control to the defense infrastructure with increased affordability, functionality, and performance are highlighted.

  3. Adaptive Network Defense Management for Countering Smart Attack and Selective Capture

    E-Print Network [OSTI]

    Cao, Yong

    , humidity, tempera- ture, electrical characteristics, and radiation. · Smart City [46]: A query-based WSN1 Adaptive Network Defense Management for Countering Smart Attack and Selective Capture in Wireless network defense management for countering smart attack and se- lective capture which aim to cripple

  4. Defenses projectes de tesi / SETEMBRE / 2013-14 ESTUDIANT LLOC President tribunal Vocal tribunal Vocal departament DATA HORA

    E-Print Network [OSTI]

    Verschure, Paul

    Defenses projectes de tesi / SETEMBRE / 2013-14 ESTUDIANT LLOC President tribunal Vocal tribunal:30-13:15 #12;Defenses projectes de tesi / SETEMBRE / 2013-14 ESTUDIANT LLOC President tribunal Vocal tribunal

  5. Defensive Investments and the Demand for Air Quality: Evidence from the NOx Budget Program and Ozone Reductions

    E-Print Network [OSTI]

    Deschênes, Olivier

    Willingness to pay for air quality is a function of health and the costly defensive investments that contribute to health, but there is little research assessing the empirical importance of defensive investments. The setting ...

  6. RH_SRS_Shipment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts on Global TechnologyProceeding SignPrice Volatility

  7. SGP Shipment Notification Form

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) byMultidayAlumni > The2/01/12 Page 1 of 24Department2/01/123 SGP

  8. Environmental management requirements/defensible costs project. Final report

    SciTech Connect (OSTI)

    1996-02-01

    Lockheed Idaho Technologies Company (LITCO) used a systems engineering approach to develop the first formal requirements baseline for Idaho National Engineering Laboratory (INEL) Environmental Management (EM) Programs. The recently signed Settlement Agreement with the State of Idaho (Batt Agreement), along with dramatically reduced EM funding targets from Department of Energy (DOE) headquarters, drove the immediacy of this effort. Programs have linked top-level requirements to work scope to cost estimates. All EM work, grouped by decision units, was scrubbed by INEL EM programs and by an independent {open_quotes}Murder Board.{close_quotes} Direct participation of upper level management from LITCO and the DOE-Idaho Operations Office ensured best information and decisions. The result is a scrubbed down, defensible budget tied to top-level requirements for use in the upcoming DOE-Headquarters` budget workout, the Internal Review Board, the FY98 Activity Data Sheets submittal, and preparation of the FY97 control accounts and out-year plans. In addition to the remarkable accomplishments during the past eight weeks, major issues were identified and documented and follow-on tasks are underway which will lead to further improvements in INEL EM program management.

  9. Defense Nuclear Material Stewardship Integrated Inventory Information Management System (IIIMS).

    SciTech Connect (OSTI)

    Aas, Christopher A.; Lenhart, James E.; Bray, Olin H.; Witcher, Christina Jenkin

    2004-11-01

    Sandia National Laboratories was tasked with developing the Defense Nuclear Material Stewardship Integrated Inventory Information Management System (IIIMS) with the sponsorship of NA-125.3 and the concurrence of DOE/NNSA field and area offices. The purpose of IIIMS was to modernize nuclear materials management information systems at the enterprise level. Projects over the course of several years attempted to spearhead this modernization. The scope of IIIMS was broken into broad enterprise-oriented materials management and materials forecasting. The IIIMS prototype was developed to allow multiple participating user groups to explore nuclear material requirements and needs in detail. The purpose of material forecasting was to determine nuclear material availability over a 10 to 15 year period in light of the dynamic nature of nuclear materials management. Formal DOE Directives (requirements) were needed to direct IIIMS efforts but were never issued and the project has been halted. When restarted, duplicating or re-engineering the activities from 1999 to 2003 is unnecessary, and in fact future initiatives can build on previous work. IIIMS requirements should be structured to provide high confidence that discrepancies are detected, and classified information is not divulged. Enterprise-wide materials management systems maintained by the military can be used as overall models to base IIIMS implementation concepts upon.

  10. The J-20 Fighter Aircraft and the State of China's Defense Science, Technology, and Innovation Potential

    E-Print Network [OSTI]

    CHEUNG, Tai Ming

    2011-01-01

    For example, the Chinese aero-engine sector has yet to beginWithout reliable Chinese aero-engines, China has had toto Russia for Type 117S aero- engines during annual defense

  11. Methodology for technology selection for Department of Defense research and development programs

    E-Print Network [OSTI]

    Nair, Michael L. (Michael Lawrie), 1979-

    2011-01-01

    In recent years, many of the Department of Defense's major acquisition programs have experienced significant budget overruns and schedule delays. Closer examination of these programs reveals that in many cases, technologies ...

  12. Defense acquisition program manager as program leader : improving program outcomes through key competencies and relationship management

    E-Print Network [OSTI]

    Baumann, B. Marc

    2013-01-01

    The US defense acquisition system is a massive enterprise charged with developing and acquiring state-of-the-art military technology and systems. For the past 65 years, many broad-reaching studies and commissions have ...

  13. Feasibility of very deep borehole disposal of US nuclear defense wastes

    E-Print Network [OSTI]

    Dozier, Frances Elizabeth

    2011-01-01

    This thesis analyzes the feasibility of emplacing DOE-owned defense nuclear waste from weapons production into a permanent borehole repository drilled ~4 km into granite basement rock. Two canister options were analyzed ...

  14. Sequential Threat Detection for Harbor Defense: An X-ray Physics...

    Office of Scientific and Technical Information (OSTI)

    Sequential Threat Detection for Harbor Defense: An X-ray Physics-Based Bayesian Approach Candy, J V 42 ENGINEERING; 73 NUCLEAR PHYSICS AND RADIATION PHYSICS Abstract not provided...

  15. A Case Study of the Defense Support of Civil Authorities Program 

    E-Print Network [OSTI]

    Johnston, Suzanne 1963-

    2013-01-04

    The intent of this record of study is to examine the effectiveness of the Defense Support of Civil Authorities program through the theoretical lens of adult learning. The study explores the program graduates’ individual and organizational attempts...

  16. Design for affordability in defense and aerospace systems using tradespace-based methods

    E-Print Network [OSTI]

    Wu, Marcus Shihong

    2014-01-01

    Program failures have plagued the defense and aerospace industry for decades, as unanticipated cost and schedule overruns have rendered the development of systems ineffective in terms of time and cost considerations. This ...

  17. A spillway infrastructure for defense against Distributed Denial of Service attacks 

    E-Print Network [OSTI]

    Barkley, Andrew Holman

    2000-01-01

    Distributed Denial of Service (DDoS) attacks have proven to be disruptive forces on the Internet. There is currently no means of defense from such attacks, as they are exploitations of mechanisms that are critical for normal operation...

  18. Defense Industry Conversion, Base Closure, and the California Economy: A Review of the Literature and Annotated Bibliography

    E-Print Network [OSTI]

    Bradshaw, Ted K.; Kroll, Cynthia A.; Corley, Mary; Kirschenbaum, Josh; Harlan, Lyn

    1994-01-01

    Project, 1992; and Kimbell, 1993). Their 1993 forecast ofover the next four years (Kimbell, 1993). Other reports putCouncil, December 1993. A-32 Kimbell, Larry]. "Defense

  19. A systems-based approach to the design, management and integration of enterprise-level change in defense shipbuilding

    E-Print Network [OSTI]

    Bond, Andrew S., 1975-

    2005-01-01

    Continually declining Navy surface combatant acquisitions, the war on terror, shifting Congressional priorities and a consolidated shipbuilding industrial base are forcing fundamental changes in the defense shipbuilding ...

  20. Reentrant phase transitions and defensive alliances in social dilemmas with informed strategies

    E-Print Network [OSTI]

    Szolnoki, Attila

    2015-01-01

    Knowing the strategy of an opponent in a competitive environment conveys obvious evolutionary advantages. But this information is costly, and the benefit of being informed may not necessarily offset the additional cost. Here we introduce social dilemmas with informed strategies, and we show that this gives rise to two cyclically dominant triplets that form defensive alliances. The stability of these two alliances is determined by the rotation velocity of the strategies within each triplet. A weaker strategy in a faster rotating triplet can thus overcome an individually stronger competitor. Fascinating spatial patterns favor the dominance of a single defensive alliance, but enable also the stable coexistence of both defensive alliances in very narrow regions of the parameter space. A continuous reentrant phase transition reveals before unseen complexity behind the stability of strategic alliances in evolutionary social dilemmas.

  1. AN EVALUATION OF PYROLYSIS OIL PROPERTIES AND CHEMISTRY AS RELATED TO PROCESS AND UPGRADE CONDITIONS WITH SPECIAL CONSIDERATION TO PIPELINE SHIPMENT

    SciTech Connect (OSTI)

    Bunting, Bruce G; Boyd, Alison C

    2012-01-01

    One factor limiting the development of commercial biomass pyrolysis is challenges related to the transportation of the produced pyrolysis oil. The oil has different chemical and physical properties than crude oil, including more water and oxygen and has lower H/C ratio, higher specific gravity and density, higher acidity, and lower energy content. These differences could limit its ability to be transported by existing petroleum pipelines. Pyrolysis oil can also be treated, normally by catalytic hydrodeoxygenation, and approaches crude oil and petroleum condensates at higher severity levels. This improvement also results in lower liquid yield and high hydrogen consumption. Biomass resources for pyrolysis are expected to become plentiful and widely distributed in the future, mainly through the use of crop residuals and growing of energy crops such as perennial grasses, annual grasses, and woody crops. Crude oil pipelines are less well distributed and, when evaluated on a county level, could access about 18% of the total biomass supply. States with high potential include Texas, Oklahoma, California, and Louisiana. In this study, published data on pyrolysis oil was compiled into a data set along with bio-source source material, pyrolysis reactor conditions, and upgrading conditions for comparison to typical crude oils. Data of this type is expected to be useful in understanding the properties and chemistry and shipment of pyrolysis oil to refineries, where it can be further processed to fuel or used as a source of process heat.

  2. Defense-related transcription factors WRKY70 and WRKY54 modulate osmotic stress tolerance by regulating stomatal

    E-Print Network [OSTI]

    Palva, Tapio

    Defense-related transcription factors WRKY70 and WRKY54 modulate osmotic stress tolerance words: abscisic acid (ABA), Arabidopsis, gene regulation, osmotic stress, salicylic acid (SA), stomata and WRKY54, to osmotic stress tolerance. These TFs are positive regulators of plant defense, and co

  3. SILK MEDIATED DEFENSE BY AN ORB WEB SPIDER AGAINST PREDATORY MUD-DAUBER WASPS

    E-Print Network [OSTI]

    Blackledge, Todd

    SILK MEDIATED DEFENSE BY AN ORB WEB SPIDER AGAINST PREDATORY MUD-DAUBER WASPS by TODD A. BLACKLEDGE conspicuous silk included at the centers of many spider webs. We examined the association of stabilimenta and Sceliphron caementarium (Hymenoptera, Sphecidae) when spiders included stabilimenta in webs. This association

  4. Critical Role of HIF-1a in Keratinocyte Defense against Bacterial Infection

    E-Print Network [OSTI]

    Nizet, Victor

    Skin, the first barrier against invading microorganisms, is hypoxic, even under baseline conditions defense through production of cationic antimicrobial peptides capable of inactivating many microorganisms, HIF-1a is hydroxylated by iron-dependent prolyl hydroxylases and is then degraded through

  5. NOD2 contributes to cutaneous defense against Staphylococcus aureus through -toxin-dependent

    E-Print Network [OSTI]

    Nizet, Victor

    NOD2 contributes to cutaneous defense against Staphylococcus aureus through -toxin-dependent innate containing (NOD) 2/caspase recruitment domain (CARD) 15 detects muramyl dipeptide from bacterial pep of these observations is not well defined. Here we show that NOD2-deficient mice exhibit a delayed but ultimately

  6. Enhanced the expression of an apple gene that switches on a tree's natural defenses

    E-Print Network [OSTI]

    · Enhanced the expression of an apple gene that switches on a tree's natural defenses when fire the roots and killing the tree. Fire blight can kill an apple tree in as little as 30 days. It's called fire Sundin/MSU George Sundin/MSU #12;Enhanced the expression of an apple gene that switches on a tree

  7. The Pollution Attack in P2P Live Video Streaming: Measurement Results and Defenses

    E-Print Network [OSTI]

    Saxena, Nitesh

    The Pollution Attack in P2P Live Video Streaming: Measurement Results and Defenses Prithula Dhungel in the recent years. In this paper, we examine the stream pollution attack, for which the attacker mixes polluted chunks into the P2P distribu- tion, degrading the quality of the rendered media at the receivers

  8. Doctoral Defense "Frost Deterioration in Concrete Due to Deicer Salt Exposure

    E-Print Network [OSTI]

    Kamat, Vineet R.

    Doctoral Defense "Frost Deterioration in Concrete Due to Deicer Salt Exposure: Mechanism-freeze climate zone. During winter a deicer-salt application is needed to melt snow on highways. Freezing in the presence of a deicer salt solution is considered a severe concrete exposure condition. Prolonged exposure

  9. Pollution Attack Defense for Coding Based Sensor Levente Buttyan, Laszlo Czap, Istvan Vajda

    E-Print Network [OSTI]

    Bencsáth, Boldizsár

    Pollution Attack Defense for Coding Based Sensor Storage Levente Butty´an, L´aszl´o Czap, Istv to make network coding based storage secure against pollution attacks in sensor networks. The approach], [12], [13]. We present a scheme that resists pollution attacks, meaning that our scheme makes possible

  10. Implementation of Section 1072 of the National Defense Authorization Act for Fiscal Year 2008

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2009-08-12

    This Notice provides guidance for implementing the mandates of Section 1072 of the National Defense Authorization Act for Fiscal Year 2008, commonly referred to as the Bond Amendment. Extended until 9-28-11 by DOE N 251.90 dated 9-28-10. Canceled by DOE O 472.2. Does not cancel other directives.

  11. Doctoral Defense "Carbon Dioxide Capture on Elastic Layered Metal-Organic

    E-Print Network [OSTI]

    Kamat, Vineet R.

    Doctoral Defense "Carbon Dioxide Capture on Elastic Layered Metal-Organic Framework Adsorbents Professor, Civil & Environmental Engineering The steady rising level of atmospheric carbon dioxide resulting to the economy that is heavily relied on fossil fuels. Although the transition of the existing carbon

  12. Pollution Attacks and Defenses in Wireless Inter-flow Network Coding Systems

    E-Print Network [OSTI]

    Nita-Rotaru, Cristina

    1 Pollution Attacks and Defenses in Wireless Inter-flow Network Coding Systems Jing Dong, Reza Abstract--We study data pollution attacks in wireless inter-flow network coding systems. Although several the existing systems, and use it to analyze the impact of pollution attacks. Our analysis shows

  13. COURSE SYLLABUS Microbial pathogens versus plants: molecular weapons, defenses, and rules of engagement

    E-Print Network [OSTI]

    Chen, Tsuhan

    COURSE SYLLABUS Microbial pathogens versus plants: molecular weapons, defenses, and rules-evolutionary molecular battle between microbial pathogens and plants has game-like properties whose rules are emerging pieces and collective behaviors of pathogen virulence and plant immune systems, similarities between

  14. Doctoral Defense "Big Data for Urban Sustainability:Integrating Human Mobility

    E-Print Network [OSTI]

    Eustice, Ryan

    Doctoral Defense "Big Data for Urban Sustainability:Integrating Human Mobility Dynamics data, neglecting the individual heterogeneity. Individual travel patterns affect charging behavior to be taken into account in environmental assessments. Using vehicle trajectory data of over 10,000 taxis

  15. EIS-0082-S1: Defense Waste Processing Facility, Savannah River Site, Aiken, South Carolina

    Broader source: Energy.gov [DOE]

    The U.S. Department of Energy developed this Supplemental Environmental Impact Statement to assess the potential environmental impacts of completing construction and operating the Defense Waste Processing Facility, a group of associated facilities and structures, to pretreat, immobilize, and store high-level radioactive waste at the Savannah River Site.

  16. abstract word representations 1 In defense of abstractionist theories of repetition priming and word identification.

    E-Print Network [OSTI]

    Bowers, Jeff

    abstract word representations 1 In defense of abstractionist theories of repetition priming and word identification. Jeffrey S. Bowers Department of Experimental Psychology University of Bristol 8 Woodland Rd Bristol, BS8-1TN j.bowers@bris.ac.uk 011 44 0117 928-8573 Running head: abstract word

  17. U.S. Department of Defense Third-Party Financing Authorities

    Broader source: Energy.gov [DOE]

    Presentation—given at the Fall 2011 Federal Utility Partnership Working Group (FUPWG) meeting—covers the U.S. Department of Defense's (DoDs) purchase power agreements (PPAs), enhanced use leases (EULs), energy savings performance contracts (ESPCs), and utility energy service contracts (UESCs).

  18. Effect of Iron on the Defensive Mutualism of Drosophila Flies and Spiroplasma Bacteria 

    E-Print Network [OSTI]

    Winter, Caitlyn

    2013-02-04

    and the wasp for a limiting resource. In this study, we investigated the role of iron in the Spiroplasma-mediated defense against the parasitoid wasp Leptopilina boulardi. Iron levels in the fly host were manipulated by rearing flies on diets that differed...

  19. Fiscal Year 1985 Congressional budget request. Volume 1. Atomic energy defense activities

    SciTech Connect (OSTI)

    Not Available

    1984-02-01

    Contents include: summaries of estimates by appropriation, savings from management initiatives, staffing by subcommittee, staffing appropriation; appropriation language; amounts available for obligation; estimates by major category; program overview; weapons activities; verification and control technology; materials production; defense waste and by-products management; nuclear safeguards and security; security investigations; and naval reactors development.

  20. TESLA-Based Defense Against Pollution Attacks in P2P Systems with Network Coding

    E-Print Network [OSTI]

    Markopoulou, Athina

    TESLA-Based Defense Against Pollution Attacks in P2P Systems with Network Coding Anh Le, Athina and time asymmetry (as in TESLA [1]) to provide source authentication for the detection scheme and non; pollution; detection; identification; TESLA; homomorphic MAC. I. INTRODUCTION Peer-to-peer (P2P) systems

  1. Sulfur Volatiles in Guava (Psidium guajava L.) Leaves: Possible Defense Mechanism

    E-Print Network [OSTI]

    Burns, Jacqueline K.

    dioxide, methanethiol, dimethyl sulfide (DMS), dimethyl disulfide (DMDS), methional, and dimethyl-Wax, and PLOT columns and MS spectra in the case of DMDS and DMS. DMDS is an insect toxic, defensive volatile for the protective effect of guava against the HLB vector. DMDS is formed immediately after crushing, becoming

  2. Defense Transuranic Waste Program. Transuranic waste transportation assessment and guidance report

    SciTech Connect (OSTI)

    Not Available

    1985-08-01

    The Transportation Assessment and Guidance Report (TAGR) is designed to provide DOE-managed defense sites with guidance and citable analyses addressing National Environmental Policy Act (NEPA) requirements for qualifying and transporting transuranic (TRU) wastes to the Waste Isolation Pilot Plant (WIPP) in southeastern New Mexico.

  3. Commercial nuclear fuel from U.S. and Russian surplus defense inventories: Materials, policies, and market effects

    SciTech Connect (OSTI)

    NONE

    1998-05-01

    Nuclear materials declared by the US and Russian governments as surplus to defense programs are being converted into fuel for commercial nuclear reactors. This report presents the results of an analysis estimating the market effects that would likely result from current plans to commercialize surplus defense inventories. The analysis focuses on two key issues: (1) the extent by which traditional sources of supply, such as production from uranium mines and enrichment plants, would be displaced by the commercialization of surplus defense inventories or, conversely, would be required in the event of disruptions to planned commercialization, and (2) the future price of uranium considering the potential availability of surplus defense inventories. Finally, the report provides an estimate of the savings in uranium procurement costs that could be realized by US nuclear power generating companies with access to competitively priced uranium supplied from surplus defense inventories.

  4. Comparison and Analysis of Regulatory and Derived Requirements for Certain DOE Spent Nuclear Fuel Shipments; Lessons Learned for Future Spent Fuel Transportation Campaigns

    SciTech Connect (OSTI)

    Kramer, George L., Ph.D.; Fawcett, Rick L.; Rieke, Philip C.

    2003-02-27

    Radioactive materials transportation is stringently regulated by the Department of Transportation and the Nuclear Regulatory Commission to protect the public and the environment. As a Federal agency, however, the U.S. Department of Energy (DOE) must seek State, Tribal and local input on safety issues for certain transportation activities. This interaction has invariably resulted in the imposition of extra-regulatory requirements, greatly increasing transportation costs and delaying schedules while not significantly enhancing the level of safety. This paper discusses the results an analysis of the regulatory and negotiated requirements established for a July 1998 shipment of spent nuclear fuel from foreign countries through the west coast to the Idaho National Engineering and Environmental Laboratory (INEEL). Staff from the INEEL Nuclear Materials Engineering and Disposition Department undertook the analysis in partnership with HMTC, to discover if there were instances where requirements derived from stakeholder interactions duplicate, contradict, or otherwise overlap with regulatory requirements. The study exhaustively lists and classifies applicable Department of Transportation (DOT) and Nuclear Regulatory Commission (NRC) regulations. These are then compared with a similarly classified list of requirements from the Environmental Impact Statements (EIS) and those developed during stakeholder negotiations. Comparison and analysis reveals numerous attempts to reduce transportation risk by imposing more stringent safety measures than those required by DOT and NRC. These usually took the form of additional inspection, notification and planning requirements. There are also many instances of overlap with, and duplication of regulations. Participants will gain a greater appreciation for the need to understand the risk-oriented basis of the radioactive materials regulations and their effectiveness in ensuring safety when negotiating extra-regulatory requirements.

  5. Implementation plan for the Defense Nuclear Facilities Safety Board Recommendation 90-7. Revision 1

    SciTech Connect (OSTI)

    Borsheim, G.L.; Cash, R.J.; Dukelow, G.T.

    1992-12-01

    This document revises the original plan submitted in March 1991 for implementing the recommendations made by the Defense Nuclear Facilities Safety Board in their Recommendation 90-7 to the US Department of Energy. Recommendation 90-7 addresses safety issues of concern for 24 single-shell, high-level radioactive waste tanks containing ferrocyanide compounds at the Hanford Site. The waste in these tanks is a potential safety concern because, under certain conditions involving elevated temperatures and low concentrations of nonparticipating diluents, ferrocyanide compounds in the presence of oxidizing materials can undergo a runaway (propagating) chemical reaction. This document describes those activities underway by the Hanford Site contractor responsible for waste tank safety that address each of the six parts of Defense Nuclear Facilities Safety Board Recommendation 90-7. This document also identifies the progress made on these activities since the beginning of the ferrocyanide safety program in September 1990. Revised schedules for planned activities are also included.

  6. Broad Overview of Energy Efficiency and Renewable Energy Opportunities for Department of Defense Installations

    SciTech Connect (OSTI)

    Anderson, E.; Antkowiak, M.; Butt, R.; Davis, J.; Dean, J.; Hillesheim, M.; Hotchkiss, E.; Hunsberger, R.; Kandt, A.; Lund, J.; Massey, K.; Robichaud, R.; Stafford, B.; Visser, C.

    2011-08-01

    The Strategic Environmental Research and Developmental Program (SERDP)/Environmental Security Technology Certification Program (ESTCP) is the Department of Defense?s (DOD) environmental science and technology program focusing on issues related to environment and energy for the military services. The SERDP/ESTCP Office requested that the National Renewable Energy Laboratory (NREL) provide technical assistance with strategic planning by evaluating the potential for several types of renewable energy technologies at DOD installations. NREL was tasked to provide technical expertise and strategic advice for the feasibility of geothermal resources, waste-to-energy technology, photovoltaics (PV), wind, microgrids, and building system technologies on military installations. This technical report is the deliverable for these tasks.

  7. Multi-service briefing on radioisotope systems for defense applications, briefing notes and supporting information

    SciTech Connect (OSTI)

    Jarrett, J.H.; Tingey, G.L.

    1990-05-01

    A briefing on isotope systems technology and applications was held at the Pentagon on 9 May 1990, cosponsored by the Department of Defense and the Department of Energy. The objective was to provide isotope systems information to interested individuals and offices from the DOD and the Services, and then to discuss potential uses of this technology within the defense community. Presentations were given on the useful characteristics of radioactive decay, isotope sources, properties of specific isotopes, and details of isotope systems that have been deployed for terrestrial and space applications. Application areas covered included: electrical, thermal and mechanical energy conversion systems; radiation applications; and radioluminescent lights. Talks were also given on system licensing and approvals, and conclusions from the 1986 workshop on isotope systems applications. This document contains the meeting agenda, copies of the vu-graphs used in the presentations, face sheets given to meeting attendees, a list of attendees, and supplementary information requested during the meeting.

  8. Progress of the High Level Waste Program at the Defense Waste Processing Facility - 13178

    SciTech Connect (OSTI)

    Bricker, Jonathan M.; Fellinger, Terri L.; Staub, Aaron V.; Ray, Jeff W.; Iaukea, John F. [Savannah River Remediation, Aiken, South Carolina, 29808 (United States)] [Savannah River Remediation, Aiken, South Carolina, 29808 (United States)

    2013-07-01

    The Defense Waste Processing Facility at the Savannah River Site treats and immobilizes High Level Waste into a durable borosilicate glass for safe, permanent storage. The High Level Waste program significantly reduces environmental risks associated with the storage of radioactive waste from legacy efforts to separate fissionable nuclear material from irradiated targets and fuels. In an effort to support the disposition of radioactive waste and accelerate tank closure at the Savannah River Site, the Defense Waste Processing Facility recently implemented facility and flowsheet modifications to improve production by 25%. These improvements, while low in cost, translated to record facility production in fiscal years 2011 and 2012. In addition, significant progress has been accomplished on longer term projects aimed at simplifying and expanding the flexibility of the existing flowsheet in order to accommodate future processing needs and goals. (authors)

  9. Joint probability safety assessment for NPP defense infrastructure against extreme external natural hazards

    SciTech Connect (OSTI)

    Guilin, L.; Defu, L.; Huajun, L.; Fengqing, W.; Tao, Z.

    2012-07-01

    With the increasing tendency of natural hazards, the typhoon, hurricane and tropical Cyclone induced surge, wave, precipitation, flood and wind as extreme external loads menacing Nuclear Power Plants (NPP) in coastal and inland provinces of China. For all of planned, designed And constructed NPP the National Nuclear Safety Administration of China and IAEA recommended Probable Maximum Hurricane /Typhoon/(PMH/T), Probable Maximum Storm Surge (PMSS), Probable Maximum Flood (PMF), Design Basis Flood (DBF) as safety regulations for NPP defense infrastructures. This paper discusses the joint probability analysis of simultaneous occurrence typhoon induced extreme external hazards and compare with IAEA 2006-2009 recommended safety regulation design criteria for some NPP defense infrastructures along China coast. (authors)

  10. Defense-in-Depth, How Department of Energy Implements Radiation Protection

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department8, 20153Daniel BoffDepartment of Energy Defense, Interiorin

  11. Final Report for Bio-Inspired Approaches to Moving-Target Defense Strategies

    SciTech Connect (OSTI)

    Fink, Glenn A.; Oehmen, Christopher S.

    2012-09-01

    This report records the work and contributions of the NITRD-funded Bio-Inspired Approaches to Moving-Target Defense Strategies project performed by Pacific Northwest National Laboratory under the technical guidance of the National Security Agency’s R6 division. The project has incorporated a number of bio-inspired cyber defensive technologies within an elastic framework provided by the Digital Ants. This project has created the first scalable, real-world prototype of the Digital Ants Framework (DAF)[11] and integrated five technologies into this flexible, decentralized framework: (1) Ant-Based Cyber Defense (ABCD), (2) Behavioral Indicators, (3) Bioinformatic Clas- sification, (4) Moving-Target Reconfiguration, and (5) Ambient Collaboration. The DAF can be used operationally to decentralize many such data intensive applications that normally rely on collection of large amounts of data in a central repository. In this work, we have shown how these component applications may be decentralized and may perform analysis at the edge. Operationally, this will enable analytics to scale far beyond current limitations while not suffering from the bandwidth or computational limitations of centralized analysis. This effort has advanced the R6 Cyber Security research program to secure digital infrastructures by developing a dynamic means to adaptively defend complex cyber systems. We hope that this work will benefit both our client’s efforts in system behavior modeling and cyber security to the overall benefit of the nation.

  12. Similarities of host defense mechanisms against pulmonary infectious disease in animals and man

    SciTech Connect (OSTI)

    Green, G.M.

    1984-01-01

    Evidence linking exposure to air pollutants with increased susceptibility to infectious diseases in humans comes from epidemiological, clinical, and experimental laboratory studies. The data suggest that the most common, and perhaps the most sensitive, index of the pulmonary effect of air pollutant exposure is on post upper respiratory infection, prolonged cough, phlegm, and purulent sputum. Experimental models of these relationships for extrapolation to humans should be able to measure such minor changes in symptomatology and physiology rather than require major lethal events. The bacterial aerosol model for quantifying nonspecific defense mechanisms of the bronchopulmonary tree utilizing nonpathogenic organisms fulfills this criterion. The function of the six major components of pulmonary antimicrobial defense mechanisms - including aerodynamic filtration, secretory respiratory tract fluid, fluid transport at the alveolar and bronchial levels, the phagocytic function of alveolar macrophages, the augmenting mechanisms of blood-derived inflammatory cells, and the secretory and cellular-specific immune mechanisms and their mediator products - can all be quantified by this experimental animal model system. The defensive functions are remarkably similar across animal species, and available human data suggest that findings obtained using the model may be extrapolatred to humans.

  13. Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

    SciTech Connect (OSTI)

    Price, D E; Durling, R L

    2005-10-10

    The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented.

  14. A High-Resolution Genetic Map of Yellow Monkeyflower Identifies Chemical Defense QTLs and Recombination Rate Variation

    E-Print Network [OSTI]

    Holeski, Liza M.; Monnahan, Patrick J.; Koseva, Boryana S.; McCool, Nick; Lindroth, Richard L.; Kelly, John K.

    2014-05-04

    for the production of several secondary compounds (PPGs) of the phenylpropanoid pathway implicated in defense against herbivores. Levels of different PPGs are correlated across recombinant inbred lines suggesting joint regulation of the phenylpropanoid pathway...

  15. The "+Add" Model : a proposed strategic framework to create agile high performance aerospace and defense product support supply chains

    E-Print Network [OSTI]

    Riwes, Mina (Mina Diaa)

    2013-01-01

    The U.S. Aerospace and Defense industry is a vital organ for national security and humanitarian disaster response as well as an economic powerhouse creating jobs and driving exports. News headlines often stop at the sale ...

  16. PhD Dissertation Defense EXPOSURE TO 2,3,7,8-TETRACHLORODIBENZO-p-DIOXIN DIFFERENTIALLY

    E-Print Network [OSTI]

    PhD Dissertation Defense EXPOSURE TO 2,3,7,8-TETRACHLORODIBENZO-p-DIOXIN DIFFERENTIALLY IMPACTS KEY and maintaining immune homeostasis. Exposure to the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin

  17. How beetles explode : new insights into the operation, structure, and materials of bombardier beetle (Brachinini) defensive glands

    E-Print Network [OSTI]

    Arndt, Eric Michael

    2015-01-01

    Bombardier beetles possess one of the most remarkable defense mechanisms in nature, using explosions inside their bodies to synthesize and eject a hot, noxious spray at attackers. The chemical reactions that enable this ...

  18. Characterization of Medicago truncatula mutants defective in infection persistence and defense response during Rhizobium-legume symbiosis 

    E-Print Network [OSTI]

    Prabhu, Radhika

    1998-01-01

    Plant mutants with defects in their symbiotic phenotypes can be used as tools to unravel and understand plant functions. To understand the symbiotic process and the role of plant defense responses in regulation of rhizobial infection and modulation...

  19. 1. INTRODUCTION. The Integrated Defense Acquisition, Technology and Logistics Life Cycle Management Framework Chart is a training aid for

    E-Print Network [OSTI]

    Rhoads, James

    1. INTRODUCTION. The Integrated Defense Acquisition, Technology and Logistics Life Cycle Management additional information: Acquisition, Technology & Logistics Knowledge Sharing System (AKSS). http on acquisition, technology and logistics processes. ACC has links to acquisition-related Communities of Practice

  20. defense programs

    National Nuclear Security Administration (NNSA)

    reaching approximately 100 billion Joules per cubic meter (the energy density of a hydrogen molecule) corresponding to a pressure of approximately 1 Mbar.  Free electrons...

  1. Defense Gallery

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB Packet HanfordDOEDanielDe novo Design ofDefects Lead to Order

  2. defense programs

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4) August 20123/%2A en46A NAME6/%2A encore3/%2A en9/%2A

  3. ing delivery of shipment. For

    E-Print Network [OSTI]

    Galef Jr., Bennett G.

    satisfactory food is available and in which no monophage could sur- UfO: ~NETT G. GALEF, JR. AND MATTHEW BECK

  4. Waste Shipment Approval - Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0Photos and Videos/01/2012 Page 1 of 10Sampling andAbout

  5. Operations start and shipments begin

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass mapSpeeding access toOctober 1996Technologies /JuneOperating OakoakOperations

  6. WIPP Receives 100th Shipment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *4 o**ColoradoDOE Awards4 WIPPWaste

  7. WIPP Receives 200th Shipment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *4 o**ColoradoDOE Awards4

  8. LANL Resumes Shipments to WIPP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousand Cubic Feet)MultimaterialforLAESFGettingLANLLANL GoLANL

  9. LANL reaches waste shipment milestone

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse Bergkamp Graduate student Subtask2 J.N.open to badge holders onlyLANL

  10. LysM receptor-like kinases to improve plant defense response against fungal pathogens

    DOE Patents [OSTI]

    Wan, Jinrong; Stacey, Gary; Stacey, Minviluz; Zhang, Xuecheng

    2013-10-15

    Perception of chitin fragments (chitooligosaccharides) is an important first step in plant defense response against fungal pathogen. LysM receptor-like kinases (LysM RLKs) are instrumental in this perception process. LysM RLKs also play a role in activating transcription of chitin-responsive genes (CRGs) in plants. Mutations in the LysM kinase receptor genes or the downstream CRGs may affect the fungal susceptibility of a plant. Mutations in LysM RLKs or transgenes carrying the same may be beneficial in imparting resistance against fungal pathogens.

  11. Tank 42 sludge-only process development for the Defense Waste Processing Facility (DWPF)

    SciTech Connect (OSTI)

    Lambert, D.P.

    2000-03-22

    Defense Waste Processing Facility (DWPF) requested the development of a sludge-only process for Tank 42 sludge since at the current processing rate, the Tank 51 sludge has been projected to be depleted as early as August 1998. Testing was completed using a non-radioactive Tank 42 sludge simulant. The testing was completed under a range of operating conditions, including worst case conditions, to develop the processing conditions for radioactive Tank 42 sludge. The existing Tank 51 sludge-only process is adequate with the exception that 10 percent additional acid is recommended during sludge receipt and adjustment tank (SRAT) processing to ensure adequate destruction of nitrite during the SRAT cycle.

  12. LysM receptor-like kinases to improve plant defense response against fungal pathogens

    DOE Patents [OSTI]

    Wan, Jinrong (Columbia, MO); Stacey, Gary (Columbia, MO); Stacey, Minviluz (Columbia, MO); Zhang, Xuecheng (Columbia, MO)

    2012-01-17

    Perception of chitin fragments (chitooligosaccharides) is an important first step in plant defense response against fungal pathogen. LysM receptor-like kinases (LysM RLKs) are instrumental in this perception process. LysM RLKs also play a role in activating transcription of chitin-responsive genes (CRGs) in plants. Mutations in the LysM kinase receptor genes or the downstream CRGs may affect the fungal susceptibility of a plant. Mutations in LysM RLKs or transgenes carrying the same may be beneficial in imparting resistance against fungal pathogens.

  13. Startup of Savannah River`s Defense Waste Processing Facility to produce radioactive glass

    SciTech Connect (OSTI)

    Bennett, W.M. [Westinghouse Savannah River Company, AIKEN, SC (United States)

    1997-08-06

    The Savannah River Site (SRS) began production of radioactive glass in the Defense Waste Process Facility (DWPF) in 1996 following an extensive test program discussed earlier. Currently DWPF is operating in a `sludge only` mode to produce radioactive glass consisting of washed high-level waste sludge and glass frit. Future operations will produce radioactive glass consisting of washed high-level waste sludge, precipitated cesium, and glass frit. This paper provides an update of processing activities to date, operational problems encountered since entering radioactive operations, and the programs underway to solve them.

  14. DESIGN ANALYSIS FOR THE DEFENSE HIGH-LEVEL WASTE DISPOSAL CONTAINER

    SciTech Connect (OSTI)

    G. Radulesscu; J.S. Tang

    2000-06-07

    The purpose of ''Design Analysis for the Defense High-Level Waste Disposal Container'' analysis is to technically define the defense high-level waste (DHLW) disposal container/waste package using the Waste Package Department's (WPD) design methods, as documented in ''Waste Package Design Methodology Report'' (CRWMS M&O [Civilian Radioactive Waste Management System Management and Operating Contractor] 2000a). The DHLW disposal container is intended for disposal of commercial high-level waste (HLW) and DHLW (including immobilized plutonium waste forms), placed within disposable canisters. The U.S. Department of Energy (DOE)-managed spent nuclear fuel (SNF) in disposable canisters may also be placed in a DHLW disposal container along with HLW forms. The objective of this analysis is to demonstrate that the DHLW disposal container/waste package satisfies the project requirements, as embodied in Defense High Level Waste Disposal Container System Description Document (SDD) (CRWMS M&O 1999a), and additional criteria, as identified in Waste Package Design Sensitivity Report (CRWMS M&Q 2000b, Table 4). The analysis briefly describes the analytical methods appropriate for the design of the DHLW disposal contained waste package, and summarizes the results of the calculations that illustrate the analytical methods. However, the analysis is limited to the calculations selected for the DHLW disposal container in support of the Site Recommendation (SR) (CRWMS M&O 2000b, Section 7). The scope of this analysis is restricted to the design of the codisposal waste package of the Savannah River Site (SRS) DHLW glass canisters and the Training, Research, Isotopes General Atomics (TRIGA) SNF loaded in a short 18-in.-outer diameter (OD) DOE standardized SNF canister. This waste package is representative of the waste packages that consist of the DHLW disposal container, the DHLW/HLW glass canisters, and the DOE-managed SNF in disposable canisters. The intended use of this analysis is to support Site Recommendation reports and to assist in the development of WPD drawings. Activities described in this analysis were conducted in accordance with the Development Plan ''Design Analysis for the Defense High-Level Waste Disposal Container'' (CRWMS M&O 2000c) with no deviations from the plan.

  15. Department of Defense 3 GW Solar Target | OpenEI Community

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EA Jump to: navigation,Department of Defense 3 GW Solar Target Home

  16. Microsoft Word - Defense Science Quarterly - 2july09 - FINAL.doc

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia NationalSecurityNuclearH-canyon |I6Summer 2009 Defense

  17. International technology exchange in support of the Defense Waste Processing Facility wasteform production

    SciTech Connect (OSTI)

    Kitchen, B.G.

    1989-08-23

    The nearly completed Defense Waste Processing Facility (DWPF) is a Department of Energy (DOE) facility at the Savannah River Site that is designed to immobilize defense high level radioactive waste (HLW) by vitrification in borosilicate glass and containment in stainless steel canisters suitable for storage in the future DOE HLW repository. The DWPF is expected to start cold operation later this year (1990), and will be the first full scale vitrification facility operating in the United States, and the largest in the world. The DOE has been coordinating technology transfer and exchange on issues relating to HLW treatment and disposal through bi-lateral agreements with several nations. For the nearly fifteen years of the vitrification program at Savannah River Laboratory, over two hundred exchanges have been conducted with a dozen international agencies involving about five-hundred foreign national specialists. These international exchanges have been beneficial to the DOE`s waste management efforts through confirmation of the choice of the waste form, enhanced understanding of melter operating phenomena, support for paths forward in political/regulatory arenas, confirmation of costs for waste form compliance programs, and establishing the need for enhancements of melter facility designs. This paper will compare designs and schedules of the international vitrification programs, and will discuss technical areas where the exchanges have provided data that have confirmed and aided US research and development efforts, impacted the design of the DWPF and guided the planning for regulatory interaction and product acceptance.

  18. International technology exchange in support of the Defense Waste Processing Facility wasteform production

    SciTech Connect (OSTI)

    Kitchen, B.G.

    1989-08-23

    The nearly completed Defense Waste Processing Facility (DWPF) is a Department of Energy (DOE) facility at the Savannah River Site that is designed to immobilize defense high level radioactive waste (HLW) by vitrification in borosilicate glass and containment in stainless steel canisters suitable for storage in the future DOE HLW repository. The DWPF is expected to start cold operation later this year (1990), and will be the first full scale vitrification facility operating in the United States, and the largest in the world. The DOE has been coordinating technology transfer and exchange on issues relating to HLW treatment and disposal through bi-lateral agreements with several nations. For the nearly fifteen years of the vitrification program at Savannah River Laboratory, over two hundred exchanges have been conducted with a dozen international agencies involving about five-hundred foreign national specialists. These international exchanges have been beneficial to the DOE's waste management efforts through confirmation of the choice of the waste form, enhanced understanding of melter operating phenomena, support for paths forward in political/regulatory arenas, confirmation of costs for waste form compliance programs, and establishing the need for enhancements of melter facility designs. This paper will compare designs and schedules of the international vitrification programs, and will discuss technical areas where the exchanges have provided data that have confirmed and aided US research and development efforts, impacted the design of the DWPF and guided the planning for regulatory interaction and product acceptance.

  19. Alternate approaches to verifying the structural adequacy of the Defense High Level Waste Shipping Cask

    SciTech Connect (OSTI)

    Zimmer, A.; Koploy, M.

    1991-12-01

    In the early 1980s, the US Department of Energy/Defense Programs (DOE/DP) initiated a project to develop a safe and efficient transportation system for defense high level waste (DHLW). A long-standing objective of the DHLW transportation project is to develop a truck cask that represents the leading edge of cask technology as well as one that fully complies with all applicable DOE, Nuclear Regulatory Commission (NRC), and Department of Transportation (DOT) regulations. General Atomics (GA) designed the DHLW Truck Shipping Cask using state-of-the-art analytical techniques verified by model testing performed by Sandia National Laboratories (SNL). The analytical techniques include two approaches, inelastic analysis and elastic analysis. This topical report presents the results of the two analytical approaches and the model testing results. The purpose of this work is to show that there are two viable analytical alternatives to verify the structural adequacy of a Type B package and to obtain an NRC license. It addition, this data will help to support the future acceptance by the NRC of inelastic analysis as a tool in packaging design and licensing.

  20. DWPF (Defense Waste Processing Facility) canister impact testing and analyses for the Transportation Technology Center

    SciTech Connect (OSTI)

    Farnsworth, R.K.; Mishima, J.

    1988-12-01

    A legal weight truck cask design has been developed for the US Department of Energy by GA Technologies, Inc. The cask will be used to transport defense high-level waste canisters produced by the Defense Waste Processing Facility (DWPF) at the Savannah River Plant. The development of the cask required the collection of impact data for the DWPF canisters. The Materials Characterization Center (MCC) performed this work under the guidance of the Transportation Technology Center (TTC) at Sandia National Laboratories. Two full-scale DWPF canisters filled with nonradioactive borosilicate glass were impacted under ''normal'' and ''hypothetical'' accident conditions. Two canisters, supplied by the DWPF, were tested. Each canister was vertically dropped on the bottom end from a height of either 0.3 m or 9.1 m (for normal or hypothetical accident conditions, respectively). The structural integrity of each canister was then examined using helium leak and dye penetrant testing. The canisters' diameters and heights, which had been previously measured, were then remeasured to determine how the canister dimensions had changed. Following structural integrity testing, the canisters were flaw leak tested. For transportation flaw leak testing, four holes were fabricated into the shell of canister A-27 (0.3 m drop height). The canister was then transported a total distance of 2069 miles. During transport, the waste form material that fell from each flaw was collected to determine the amount of size distribution of each flaw release. 2 refs., 8 figs., 12 tabs.

  1. Quarterly report on Defense Nuclear Facilities Safety Board Recommendation 90-7 for the period ending June 30, 1993

    SciTech Connect (OSTI)

    Cash, R.J.; Dukelow, G.T.; Forbes, C.J.; Meacham, J.E.

    1993-10-01

    This is the ninth quarterly report on the progress of activities that address safety issues associated with Hanford Site high-level radioactive waste tanks containing ferrocyanide compounds. Milestones completed this quarter include (1) a report on the credibility of hot spots and a recommendation on infrared scans; (2) a document discussing the strength and limitations of proposed moisture monitoring technologies; (3) limited calibration of the neutron probe in simulant-filled drums; (4) a report interpreting data from auger surface samples of ferrocyanide tank 241-BY-104; (5) a document on the effect of possible catalyst, initiator, and diluents on ferrocyanide reactivity; (6) a report on small scale sensitivity tests of ferrocyanide flowsheet simulants; and (7) preparation and shipment of T Plant simulants for calorimetric and dryout tests.

  2. U.S. second line of defense: preventing nuclear smuggling across Russia's borders

    SciTech Connect (OSTI)

    Ball, D. Y.

    1998-11-16

    Preventing the theft of weapons-usable highly enriched uranium and plutonium in Russia is one of the central security concerns facing the US today. The dissolution of the highly centralized USSR and the resulting societal crisis has endangered Russia's ability to protect its more than 200 metric tons of plutonium and 1000 tons of highly enriched uranium (roughly 8 kg Pu or 25 kg HEU is sufficient to make a bomb). Producing this fissile material is the most difficult and expensive part of nuclear weapons production and the US must make every effort to ensure that fissile material (and nuclear-related technologies) does not reach the hands of terrorist groups, rogue states or other potential proliferators. In response to this concern, the US has undertaken a number of initiatives in partnership with Russia and other FSU states to prevent the theft of fissile material. The Material Protection, Control and Accounting Program (MPC&A) was begun in 1993 to prevent the theft of nuclear materials from Russian civilian complexes, that is facilities not under control of the Ministry of Defense, which is largely responsible for possession and oversight of nuclear weapons. The MPC&A program is considered the first line of defense against theft of nuclear material because its goal is to prevent theft of material at production and storage facilities. This year the Department of Energy (DOE) initiated a new program called the Second Line of Defense (SLD), the goal of which is to assist Russia in preventing the smuggling of nuclear material and weapons at its borders, either by land, sea or air. The SLD program represents an important phase in the overall effort to ensure the security of nuclear material and weapons in Russia. However, as the US engages Russian customs officials in this important project, Americans should keep in mind that providing equipment--even indigenous equipment--is insufficient by itself; material aid must be accompanied by rigorous inspection and accounting procedures. In addition, the equipment must be assessed according to international standards to ensure a high degree of confidence in its nuclear detection capability.

  3. Criteria for choosing among competing alternatives for ATBM defenses. Final report

    SciTech Connect (OSTI)

    NONE

    1995-05-01

    The Center for Strategic and International Studies (CSIS) established an executive review panel to assess the paper written by Peter Zimmerman. The panel consisted of experts on theater missile defenses, U.S. relations with former Soviet Union/Russia, the ABM compliance issues. The panel was NOT able to reach a consensus on the issues raised by the paper. NOR was it able to validate the criteria developed therein. A majority of the panel took exception to many to the facts, findings, and conclusions of the paper. The major points under dispute are: the characterization of the threat, the definition of technical risk, system performance requirements, limits on ATBM systems imposed by the ABM Treaty, Congressional views, cost and IOC dates. The issues are discussed in detail in this review.

  4. A cognitive and economic decision theory for examining cyber defense strategies.

    SciTech Connect (OSTI)

    Bier, Asmeret Brooke

    2014-01-01

    Cyber attacks pose a major threat to modern organizations. Little is known about the social aspects of decision making among organizations that face cyber threats, nor do we have empirically-grounded models of the dynamics of cooperative behavior among vulnerable organizations. The effectiveness of cyber defense can likely be enhanced if information and resources are shared among organizations that face similar threats. Three models were created to begin to understand the cognitive and social aspects of cyber cooperation. The first simulated a cooperative cyber security program between two organizations. The second focused on a cyber security training program in which participants interact (and potentially cooperate) to solve problems. The third built upon the first two models and simulates cooperation between organizations in an information-sharing program.

  5. A functional role in plant defense mechanism and a predicted structure of the U-box domain combined

    E-Print Network [OSTI]

    Sjölander, Kimmen

    1 A functional role in plant defense mechanism and a predicted structure of the U-box domain of Bioengineering, University of California, Berkeley *For correspondence email hrazavi@uclink.berkeley.edu Abstract-terminus. To predict function, tools such as BLAST, PSI-BLAST, SAM HMM software and FlowerPower were used. Because

  6. Induced Release of a Plant-Defense Volatile `Deceptively' Attracts Insect Vectors to Plants Infected with a Bacterial

    E-Print Network [OSTI]

    Burns, Jacqueline K.

    , and pathogen. Pathogen-induced plant responses can include changes in volatile and nonvolatile secondary metabolites as well as major plant nutrients. Experiments were conducted to understand how a plant pathogenicInduced Release of a Plant-Defense Volatile `Deceptively' Attracts Insect Vectors to Plants

  7. A proposed approach to assess supply chain risks to meet the new challenges in the Defense industry

    E-Print Network [OSTI]

    Chou, Cheng-Lung (Cheng-Lung John)

    2012-01-01

    Department of Defense (DoD) had doubled its planned investments in new weapon systems from about $700 billion in 2001 to nearly $1.4 trillion in 2006. Despite the technical superiority of its weapon systems, DoD's weapon ...

  8. Social Issues and Policy Review, Vol. 3, No. 1, 2009, pp. 211--271 The Food Marketing Defense Model: Integrating

    E-Print Network [OSTI]

    Bargh, John A.

    Social Issues and Policy Review, Vol. 3, No. 1, 2009, pp. 211--271 The Food Marketing Defense Model. Brownell, and John A. Bargh Yale University Marketing practices that promote calorie-dense, nutrient for government action and industry change to protect young people from the negative effects of food marketing

  9. IEEE TRANSACTIONS ON WIRELESS COMMUNICATIONS, VOL. 6, NO. 10, OCTOBER 2007 1 Distance-Bounding Based Defense Against

    E-Print Network [OSTI]

    Wu, Dapeng Oliver

    -Bounding Based Defense Against Relay Attacks in Wireless Networks Caimu Tang, Member, IEEE, and Dapeng Oliver Wu invulnerable to the relay attack. We propose to use the order statistic for the detection of relay attackers outlier test. I. INTRODUCTION RECENT years have witnessed the urgent needs to secure networks of low power

  10. Designing System-level Defenses against Cellphone Malware Liang Xie* Xinwen Zhang Ashwin Chaugule* Trent Jaeger* Sencun Zhu*

    E-Print Network [OSTI]

    Zhu, Sencun

    Designing System-level Defenses against Cellphone Malware Liang Xie* Xinwen Zhang Ashwin Chaugule}@cse.psu.edu xinwen.z@samsung.com Abstract--Cellphones are increasingly becoming attractive targets of various malware, which not only cause privacy leakage, extra charges, and depletion of battery power, but also introduce

  11. Quarterly report on Defense Nuclear Facilities Safety Board Recommendation 90-7 for the period ending December 31, 1992

    SciTech Connect (OSTI)

    Cash, R.J.; Dukelow, G.T.; Forbes, C.J.

    1993-03-01

    This is the seventh quarterly report on the progress of activities addressing safety issues associated with Hanford Site high-level radioactive waste tanks that contain ferrocyanide compounds. In the presence of oxidizing materials, such as nitrates or nitrites, ferrocyanide can be made to explode in the laboratory by heating it to high temperatures [above 285{degrees}C (545{degrees}F)]. In the mid 1950s approximately 140 metric tons of ferrocyanide were added to 24 underground high-level radioactive waste tanks. An implementation plan (Cash 1991) responding to the Defense Nuclear Facilities Safety Board Recommendation 90-7 (FR 1990) was issued in March 1991 describing the activities that were planned and underway to address each of the six parts of Recommendation 90-7. A revision to the original plan was transmitted to US Department of Energy by Westinghouse Hanford Company in December 1992. Milestones completed this quarter are described in this report. Contents of this report include: Introduction; Defense Nuclear Facilities Safety Board Implementation Plan Task Activities (Defense Nuclear Facilities Safety Board Recommendation for enhanced temperature measurement, Recommendation for continuous temperature monitoring, Recommendation for cover gas monitoring, Recommendation for ferrocyanide waste characterization, Recommendation for chemical reaction studies, and Recommendation for emergency response planning); Schedules; and References. All actions recommended by the Defense Nuclear Facilities Safety Board for emergency planning by Hanford Site emergency preparedness organizations have been completed.

  12. SUBJECT: Sustainable Design and Development Policy Update m. Memorandum, Office of the Under Secretary of Defense, 19 Jan 2010,

    E-Print Network [OSTI]

    US Army Corps of Engineers

    Section 438 of the Energy Independence and Security Act. n. Memorandum, ASA(IE&E), 24 Aug 2012, subject of the Under Secretary of Defense, 19 Jan 2010, subject: DoD Implementation of Storm Water Requirements under, subject: Exterior Lighting Technologies Policy. p. Memorandum, ASA(IE&E), 20 Dec 2012, subject: Water Goal

  13. 372 IEEE INTERNET OF THINGS JOURNAL, VOL. 1, NO. 5, OCTOBER 2014 Sybil Attacks and Their Defenses

    E-Print Network [OSTI]

    Shen, Xuemin "Sherman"

    372 IEEE INTERNET OF THINGS JOURNAL, VOL. 1, NO. 5, OCTOBER 2014 Sybil Attacks and Their Defenses in the Internet of Things Kuan Zhang, Student Member, IEEE, Xiaohui Liang, Member, IEEE, Rongxing Lu, Member, IEEE, and Xuemin Shen, Fellow, IEEE Abstract--The emerging Internet-of-Things (IoT) are vulnera- ble to Sybil

  14. CHARACTERIZATION THROUGH DATA QUALITY OBJECTIVES AND CERTIFICATION OF REMOTE-HANDLED TRANSURANIC WASTE GENERATOR/STORAGE SITES FOR SHIPMENT TO THE WIPP

    SciTech Connect (OSTI)

    Spangler, L.R.; Most, Wm.A.; Kehrman, R.F.; Gist, C.S.

    2003-02-27

    The Waste Isolation Pilot Plant (WIPP) is operating to receive and dispose of contact-handled (CH) transuranic (TRU) waste. The Department of Energy (DOE) Carlsbad Field Office (CBFO) is seeking approval from the Environmental Protection Agency (EPA) and the New Mexico Environment Department (NMED) of the remote-handled (RH) TRU characterization plan to allow disposal of RH TRU waste in the WIPP repository. In addition, the DOE-CBFO has received approval from the Nuclear Regulatory Commission (NRC) to use two shipping casks for transporting RH TRU waste. Each regulatory agency (i.e., EPA, NMED, and NRC) has different requirements that will have to be met through the use of information collected by characterizing the RH TRU waste. Therefore, the DOE-CBFO has developed a proposed characterization program for obtaining the RH TRU waste information necessary to demonstrate that the waste meets the applicable regulatory requirements. This process involved the development of a comprehensive set of Data Quality Objectives (DQOs) comprising the various regulatory requirements. The DOE-CBFO has identified seven DQOs for use in the RH TRU waste characterization program. These DQOs are defense waste determination, TRU waste determination, RH TRU determination, activity determination, RCRA physical and chemical properties, prohibited item determination, and EPA physical and chemical properties. The selection of the DQOs were based on technical, legal and regulatory drivers that assure the health and safety of the workers, the public, to protect the environment, and to comply with the requirements of the regulatory agencies. The DOE-CBFO also has the responsibility for the certification of generator/storage sites to ship RH TRU mixed waste to the WIPP for disposal. Currently, thirteen sites across the DOE complex are generators of RH TRU waste or store the waste at their location for other generators. Generator/storage site certification involves review and approval of site-specific programmatic documents that demonstrate compliance with the WIPP waste characterization and transportation requirements. Additionally, procedures must be developed to implement programmatic requirements and adequacy of those procedures determined. Finally, on-site audits evaluate the technical and administrative implementation and effectiveness of the operating procedures.

  15. A protocol for storage and long-distance shipment of Mediterranean fruit fly (Diptera: Tephritidae) eggs. 1. Effect of temperature, embryo age , and storage time on survival and quality

    SciTech Connect (OSTI)

    Caceres, C.; Wornoayporn, V.; Islam, S.M.; Ahmad, S. [Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, Agency's Laboratories, A-2444 Seibersdorf (Austria); Ramirez, E. [Programa Moscamed-Guatemala, Planta de Produccion de Mosca del Mediterraneo km 48, Carretera a El Salvador, El Cerinal, Barberena, Santa Rosa (Guatemala)

    2007-03-15

    The operational use of Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann), genetic sexing strains in Sterile Insect Technique applications can be maximized by developing methods for effective shipment of eggs. This would enable a central production facility to maintain the relevant mother stocks and large colonies to supply eggs to satellite centers that would mass produce only males for irradiation and release. In order to achieve this, the survival of medfly embryos of different ages was assessed after storage at 5, 10, 15, 20, and 25 deg. C in water for different periods of time. Survival was affected by all 3 variables, i.e., embryo age, water temperature, and length of storage. Storage of embryos at any temperature for 120 h resulted in almost no survival. Controlling the age of the embryo at the time of the temperature treatment is crucial for the success of this procedure. Embryos collected between 0 to 12 h after oviposition and pre-incubated at 25 deg. C for 12 h provide a suitable 72 h window for shipment when maintained between 10 to 15 deg. C. Under these conditions, no significant reductions in survival during all the developmental stages were observed. (author) [Spanish] El uso operacional de cepas de la mosca del mediterraneo Ceratitis capitata (Wiedemann) en las cuales es posible separar los sexos a traves de mecanismos geneticos para su utilizacion en la Tecnica del Insecto Esteril (TIE), puede ser maximizado con el desarrollo de metodos efectivos para el envio y transporte de huevos. Esto permite que un laboratorio de produccion centralizada mantenga las respectivas colonias responsables por la produccion de huevos para este abastecer laboratorios satelites responsables por la produccion masiva de solamente machos para subsiguiente irradiacion y liberacion. Para ser posible esta alternativa fue evaluada la supervivencia de embriones de diferentes edades despues de su almacenamiento en agua a 5, 10, 15, 20 y 25 deg. C por diferentes periodos de tiempo. La supervivencia fue afectada por las 3 variables evaluadas, la edad del embrion, la temperatura del agua y el periodo de almacenamiento. El almacenamiento de los embriones a cualquier temperatura por 120 horas dio como resultado la casi no supervivencia. Una edad controlada de los embriones a tratar es crucial para el exito de este protocolo. Embriones colectados entre 0 a 12 horas despues de la oviposicion y su previa incubacion a 25 deg. C por 12 horas brinda un margen de hasta de 72 horas de duracion del almacenamiento y transporte, siempre y cuando estos se mantengan en una temperatura de entre 10 a 15{sup o}C. En estas condiciones, fue registrada una reduccion no significante de la supervivencia de los diferentes estados de desarrollo. (author)

  16. Basic Data Report -- Defense Waste Processing Facility Sludge Plant, Savannah River Plant 200-S Area

    SciTech Connect (OSTI)

    Amerine, D.B.

    1982-09-01

    This Basic Data Report for the Defense Waste Processing Facility (DWPF)--Sludge Plant was prepared to supplement the Technical Data Summary. Jointly, the two reports were intended to form the basis for the design and construction of the DWPF. To the extent that conflicting information may appear, the Basic Data Report takes precedence over the Technical Data Summary. It describes project objectives and design requirements. Pertinent data on the geology, hydrology, and climate of the site are included. Functions and requirements of the major structures are described to provide guidance in the design of the facilities. Revision 9 of the Basic Data Report was prepared to eliminate inconsistencies between the Technical Data Summary, Basic Data Report and Scopes of Work which were used to prepare the September, 1982 updated CAB. Concurrently, pertinent data (material balance, curie balance, etc.) have also been placed in the Basic Data Report. It is intended that these balances be used as a basis for the continuing design of the DWPF even though minor revisions may be made in these balances in future revisions to the Technical Data Summary.

  17. National cyber defense high performance computing and analysis : concepts, planning and roadmap.

    SciTech Connect (OSTI)

    Hamlet, Jason R.; Keliiaa, Curtis M.

    2010-09-01

    There is a national cyber dilemma that threatens the very fabric of government, commercial and private use operations worldwide. Much is written about 'what' the problem is, and though the basis for this paper is an assessment of the problem space, we target the 'how' solution space of the wide-area national information infrastructure through the advancement of science, technology, evaluation and analysis with actionable results intended to produce a more secure national information infrastructure and a comprehensive national cyber defense capability. This cybersecurity High Performance Computing (HPC) analysis concepts, planning and roadmap activity was conducted as an assessment of cybersecurity analysis as a fertile area of research and investment for high value cybersecurity wide-area solutions. This report and a related SAND2010-4765 Assessment of Current Cybersecurity Practices in the Public Domain: Cyber Indications and Warnings Domain report are intended to provoke discussion throughout a broad audience about developing a cohesive HPC centric solution to wide-area cybersecurity problems.

  18. INSTALLATION OF BUBBLERS IN THE SAVANNAH RIVER SITED DEFENSE WASTE PROCESSING FACILITY MELTER

    SciTech Connect (OSTI)

    Smith, M.; Iverson, D.

    2010-12-08

    Savannah River Remediation (SRR) LLC assumed the liquid waste contract at the Savannah River Site (SRS) in the summer of 2009. The main contractual agreement was to close 22 High Level Waste (HLW) tanks in eight years. To achieve this aggressive commitment, faster waste processing throughout the SRS liquid waste facilities will be required. Part of the approach to achieve faster waste processing is to increase the canister production rate of the Defense Waste Processing Facility (DWPF) from approximately 200 canisters filled with radioactive waste glass per year to 400 canisters per year. To reach this rate for melter throughput, four bubblers were installed in the DWPF Melter in the late summer of 2010. This effort required collaboration between SRR, SRR critical subcontractor EnergySolutions, and Savannah River Nuclear Solutions, including the Savannah River National Laboratory (SRNL). The tasks included design and fabrication of the bubblers and related equipment, testing of the bubblers for various technical issues, the actual installation of the bubblers and related equipment, and the initial successful operation of the bubblers in the DWPF Melter.

  19. THE DEVELOPMENT OF COAL-BASED TECHNOLOGIES FOR DEPARTMENT OF DEFENSE FACILITIES

    SciTech Connect (OSTI)

    Bruce G. Miller; Sharon Falcone Miller; Sarma V. Pisupati; Chunshan Song; Ronald S. Wasco; Ronald T. Wincek; Xiaochun Xu; Alan W. Scaroni; Richard Hogg; Subhash Chander; M. Thaddeus Ityokumbul; Mark S. Klima; Peter T. Luckie; Adam Rose; Richard L. Gordon; Jeffrey Lazo; A. Michael Schaal

    2004-01-30

    The third phase of a three-phase project investigating the development of coal-based technologies for US Department of Defense (DOD) facilities was completed. The objectives of the project were to: decrease DOD's dependence on foreign oil and increase its use of coal; promote public and private sector deployment of technologies for utilizing coal-based fuels in oil-designed combustion equipment; and provide a continuing environment for research and development of coal-based fuel technologies for small-scale applications at a time when market conditions in the US are not favorable for the introduction of coal-fired equipment in the commercial and industrial capacity ranges. The Phase III activities were focused on evaluating deeply-cleaned coals as fuels for industrial boilers and investigating emissions control strategies for providing ultra-low emissions when firing coal-based fuels. This was addressed by performing coal beneficiation and preparation studies, and bench- to demonstration-scale emissions reduction studies. In addition, economic studies were conducted focused on determining cost and market penetration, selection of incentives, and regional economic impacts of coal-based technologies.

  20. In Defense of the National Labs and Big-Budget Science

    SciTech Connect (OSTI)

    Goodwin, J R

    2008-07-29

    The purpose of this paper is to present the unofficial and unsanctioned opinions of a Visiting Scientist at Lawrence Livermore National Laboratory on the values of LLNL and the other National Labs. The basic founding value and goal of the National Labs is big-budget scientific research, along with smaller-budget scientific research that cannot easily be done elsewhere. The most important example in the latter category is classified defense-related research. The historical guiding light here is the Manhattan Project. This endeavor was unique in human history, and might remain so. The scientific expertise and wealth of an entire nation was tapped in a project that was huge beyond reckoning, with no advance guarantee of success. It was in many respects a clash of scientific titans, with a large supporting cast, collaborating toward a single well-defined goal. Never had scientists received so much respect, so much money, and so much intellectual freedom to pursue scientific progress. And never was the gap between theory and implementation so rapidly narrowed, with results that changed the world, completely. Enormous resources are spent at the national or international level on large-scale scientific projects. LLNL has the most powerful computer in the world, Blue Gene/L. (Oops, Los Alamos just seized the title with Roadrunner; such titles regularly change hands.) LLNL also has the largest laser in the world, the National Ignition Facility (NIF). Lawrence Berkeley National Lab (LBNL) has the most powerful microscope in the world. Not only is it beyond the resources of most large corporations to make such expenditures, but the risk exceeds the possible rewards for those corporations that could. Nor can most small countries afford to finance large scientific projects, and not even the richest can afford largess, especially if Congress is under major budget pressure. Some big-budget research efforts are funded by international consortiums, such as the Large Hadron Collider (LHC) at CERN, and the International Tokamak Experimental Reactor (ITER) in Cadarache, France, a magnetic-confinement fusion research project. The postWWII histories of particle and fusion physics contain remarkable examples of both international competition, with an emphasis on secrecy, and international cooperation, with an emphasis on shared knowledge and resources. Initiatives to share sometimes came from surprising directions. Most large-scale scientific projects have potential defense applications. NIF certainly does; it is primarily designed to create small-scale fusion explosions. Blue Gene/L operates in part in service to NIF, and in part to various defense projects. The most important defense projects include stewardship of the national nuclear weapons stockpile, and the proposed redesign and replacement of those weapons with fewer, safer, more reliable, longer-lived, and less apocalyptic warheads. Many well-meaning people will consider the optimal lifetime of a nuclear weapon to be zero, but most thoughtful people, when asked how much longer they think this nation will require them, will ask for some time to think. NIF is also designed to create exothermic small-scale fusion explosions. The malapropos 'exothermic' here is a convenience to cover a profusion of complexities, but the basic idea is that the explosions will create more recoverable energy than was used to create them. One can hope that the primary future benefits of success for NIF will be in cost-effective generation of electrical power through controlled small-scale fusion reactions, rather than in improved large-scale fusion explosions. Blue Gene/L also services climate research, genomic research, materials research, and a myriad of other computational problems that become more feasible, reliable, and precise the larger the number of computational nodes employed. Blue Gene/L has to be sited within a security complex for obvious reasons, but its value extends to the nation and the world. There is a duality here between large-scale scientific research machines and the supercomputers used

  1. Contact lens wear with the USAF protective integrated hood/mask chemical defense ensemble

    SciTech Connect (OSTI)

    Dennis, R.J.; Miller, R.E. II; Peterson, R.D.; Jackson, W.G. Jr. (USAF, Armstrong Laboratory, Brooks AFB, TX (United States))

    1992-07-01

    The Protective Integrated Hood/Mask (PIHM) chemical defense aircrew ensemble blows air from the mask's plenum across the visor at a rate of approximately 15 L/min in order to prevent fogging of the visor and to cool the aircrew member's face. This study was designed to determine the effect of the PIHM airflow on soft contact lens (SCL) dehydration, contact lens comfort, and corneal integrity. There were 26 subjects who participated in this study: 15 SCL wearers, six rigid gas-permeable (RGP) wearers, and five nonspectacle wearing controls. Contrast acuity with the three Regan charts, subjective comfort, and relative humidity (RH) and temperature readings under the PIHM mask were monitored every 0.5 h during 6-h laboratory rides. Slit-lamp examinations and SCL water content measurements with a hand-held Abbe refractometer were made before and after the rides. High RH under the mask may have accounted for the moderate SCL dehydration (8.3 percent), no decrease in contrast acuity for any group, and lack of corneal stress. Although all groups experienced some inferior, epithelial, punctate keratopathy, RGP wearers had the most significant effects. SCLs performed relatively well in the PIHM mask environment. Testing with other parameter designs is necessary before recommending RGPs with the PIHM system. 19 refs.

  2. Potential Collaborative Research topics with Korea’s Agency for Defense Development

    SciTech Connect (OSTI)

    Farrar, Charles R.; Todd, Michael D.

    2012-08-23

    This presentation provides a high level summary of current research activities at the Los Alamos National Laboratory (LANL)-University of California Jacobs School of Engineering (UCSD) Engineering Institute that will be presented at Korea's Agency for Defense Development (ADD). These research activities are at the basic engineering science level with different level of maturity ranging from initial concepts to field proof-of-concept demonstrations. We believe that all of these activities are appropriate for collaborative research activities with ADD subject to approval by each institution. All the activities summarized herein have the common theme that they are multi-disciplinary in nature and typically involved the integration of high-fidelity predictive modeling, advanced sensing technologies and new development in information technology. These activities include: Wireless Sensor Systems, Swarming Robot sensor systems, Advanced signal processing (compressed sensing) and pattern recognition, Model Verification and Validation, Optimal/robust sensor system design, Haptic systems for large-scale data processing, Cyber-physical security for robots, Multi-source energy harvesting, Reliability-based approaches to damage prognosis, SHMTools software development, and Cyber-physical systems advanced study institute.

  3. Assessment of cogeneration technologies for use at Department of Defense installations. Final report

    SciTech Connect (OSTI)

    Binder, M.J.; Cler, G.L.

    1996-01-01

    Cogeneration is the simultaneous generation of two types of energy, usually electricity and thermal energy, from a single energy source such as natural gas or diesel fuel. Cogeneration systems can be twice (or more) as efficient than conventional energy systems since both the electricity and the available thermal energy produced as a by-product of the electric generation, are used. This study identified cogeneration technologies and equipment capable of meeting Department of Defense (DOD) requirements for generation of electrical and thermal energy and described a wide range of successful cogeneration system configurations potentially applicable to DOD energy plants, including: cogeneration system prime movers, electrical generating equipment, heat recovery equipment, and control systems. State of the art cogeneration components are discussed in detail along with typical applications and analysis tools that are currently available to assist in the evaluation of potential cogeneration projects. A basic analysis was performed for 55 DOD installations to determine the economic benefits of cogeneration to the DOD. The study concludes that, in general, cogeneration systems can be a very cost effective method of providing the military with its energy needs.

  4. Civil defense shelters: A state-of-the-art assessment, 1986

    SciTech Connect (OSTI)

    Chester, C.V.; Zimmerman, G.P.

    1987-02-01

    The literature on the design, construction, testing, and cost of blast and fallout shelters was reviewed, and a bibliography of over 1000 documents was assembled. It was found that nuclear weapon effects and shelter design are well understood. An important barrier to construction of permanent shelters is cost. Single-purpose shelters cost in the high hundreds to low thousands of dollars per occupant (or per space), depending on size, hardness, location, and whether the shelter is part of new construction or retrofit. Multiplied by a risk area population of approximately 160 million, the cost of a blast shelter construction program would rival that of a major strategic weapon system. Options in the mid-range of expense, a few tens to a few hundreds of dollars per space include (1) requiring modified limestone mining practices, where appropriate, to generate usable shelter space near cities; (2) encouraging the construction of earth-sheltered housing and other buildings; and (3) requiring and/or subsidizing the construction of dual-use basement shelter in new construction. A program using this approach would require an annual expenditure of approximately 1% of the annual defense budget for 10 or more years. 950 refs., 68 figs., 9 tabs.

  5. Civil defense shelters: a state-of-the-art assessment - 1986. Final report

    SciTech Connect (OSTI)

    Chester, C.V.; Zimmerman, G.P.

    1986-12-01

    The literature on the design, construction, testing, and cost of blast and fallout shelters was reviewed, and a bibliography of over 1000 documents was assembled. It was found that nuclear weapon effects and shelter design are well understood. The principal technical barrier to construction of permanent shelters is cost. Single-purpose blast shelters cost in the high hundreds to low thousands of dollars per space, depending on size, hardness, location, and whether the shelter is part of new construction or retrofit. The risk area population requiring blast protection is approximately 160 million. The very-low-cost options open to the U.S. Government, with its present civil defense budget, remain: (1) maintain the inventory on fallout shelter and identify space with some blast protection potential; (2) plan for crisis upgrading to improve existing space in a crisis, and (3) plan for construction of expedient shelter in a crisis. Fallout shelters might be mandated in appropriate new construction outside risk areas at little cost to the government. Options in the mid-range of expense, a few tens to a few hundreds of dollars per space include: (1) requiring modified limestone-mining practices, where appropriate, to generate useable shelter space near cities; (2) encouraging the construction of earth-sheltered housing and other buildings, and (3) requiring and/or subsidizing the construction of dual-use basement shelter in new construction.

  6. IMPACTS OF ANTIFOAM ADDITIONS AND ARGON BUBBLING ON DEFENSE WASTE PROCESSING FACILITY REDUCTION/OXIDATION

    SciTech Connect (OSTI)

    Jantzen, C.; Johnson, F.

    2012-06-05

    During melting of HLW glass, the REDOX of the melt pool cannot be measured. Therefore, the Fe{sup +2}/{Sigma}Fe ratio in the glass poured from the melter must be related to melter feed organic and oxidant concentrations to ensure production of a high quality glass without impacting production rate (e.g., foaming) or melter life (e.g., metal formation and accumulation). A production facility such as the Defense Waste Processing Facility (DWPF) cannot wait until the melt or waste glass has been made to assess its acceptability, since by then no further changes to the glass composition and acceptability are possible. therefore, the acceptability decision is made on the upstream process, rather than on the downstream melt or glass product. That is, it is based on 'feed foward' statistical process control (SPC) rather than statistical quality control (SQC). In SPC, the feed composition to the melter is controlled prior to vitrification. Use of the DWPF REDOX model has controlled the balanjce of feed reductants and oxidants in the Sludge Receipt and Adjustment Tank (SRAT). Once the alkali/alkaline earth salts (both reduced and oxidized) are formed during reflux in the SRAT, the REDOX can only change if (1) additional reductants or oxidants are added to the SRAT, the Slurry Mix Evaporator (SME), or the Melter Feed Tank (MFT) or (2) if the melt pool is bubble dwith an oxidizing gas or sparging gas that imposes a different REDOX target than the chemical balance set during reflux in the SRAT.

  7. Solidification of commercial and defense low-level radioactive waste in polyethylene

    SciTech Connect (OSTI)

    Franz, E.M.; Heiser, L.H.; Colombo, P.

    1987-08-01

    A process was developed for the solidification of salt wastes, incinerator ash and ion-exchange resins in polyethylene. Of the salt wastes, sodium sulfate and boric acid are representative of the wastes produced at commercial nuclear facilities while sodium nitrate in a typical high-volume waste generated at defense-related facilities. Ease of processibility and high loading efficiencies were obtained through the use of low-density polyethylene with melt indices ranging from 2.0 to 55.0 g/minute. The process utilized a commercially available single-screw extruder to incorporate the wastes into the polyethylene at about 120/sup 0/C to produce a homogeneous mixture. Although present studies utilize dry wastes, wet wastes can also be processed using vented extruders of the type used commercially for the bitumen solidification process. Tests were performed on the waste forms to determine leachability and mechanical properties. To confirm the compatibility of polyethylene and nitrate salt waste at elevated temperatures, the self-ignition temperatures were measured and a differential scanning calorimeter was used to characterize the thermal behavior of oxidizing compounds contained in the simulated waste, as well as the real Savannah River Plant waste. No exothermic reactions were observed over the temperature range studied from 50/sup 0/C to 400/sup 0/C. 18 refs., 7 figs., 8 tabs.

  8. IMPACT OF THE SMALL COLUMN ION EXCHANGE PROCESS ON THE DEFENSE WASTE PROCESSING FACILITY - 12112

    SciTech Connect (OSTI)

    Koopman, D.; Lambert, D.; Fox, K.; Stone, M.

    2011-11-07

    The Savannah River Site (SRS) is investigating the deployment of a parallel technology to the Salt Waste Processing Facility (SWPF, presently under construction) to accelerate high activity salt waste processing. The proposed technology combines large waste tank strikes of monosodium titanate (MST) to sorb strontium and actinides with two ion exchange columns packed with crystalline silicotitanate (CST) resin to sorb cesium. The new process was designated Small Column Ion Exchange (SCIX), since the ion exchange columns were sized to fit within a waste storage tank riser. Loaded resins are to be combined with high activity sludge waste and fed to the Defense Waste Processing Facility (DWPF) for incorporation into the current glass waste form. Decontaminated salt solution produced by SCIX will be fed to the SRS Saltstone Facility for on-site immobilization as a grout waste form. Determining the potential impact of SCIX resins on DWPF processing was the basis for this study. Accelerated salt waste treatment is projected to produce a significant savings in the overall life cycle cost of waste treatment at SRS.

  9. Anthropogenic increase in carbon dioxide compromises plant defense against invasive insects

    SciTech Connect (OSTI)

    Zavala, J.; Casteel, C.; DeLucia, E.; Berenbaum, M.

    2008-04-01

    Elevated levels of atmospheric carbon dioxide (CO{sub 2}), a consequence of anthropogenic global change, can profoundly affect the interactions between crop plants and insect pests and may promote yet another form of global change: the rapid establishment of invasive species. Elevated CO{sub 2} increased the susceptibility of soybean plants grown under field conditions to the invasive Japanese beetle (Popillia japonica) and to a variant of western corn rootworm (Diabrotica virgifera virgifera) resistant to crop rotation by down-regulating gene expression related to defense signaling [lipoxygenase 7 (lox7), lipoxygenase 8 (lox8), and 1-aminocyclopropane-1-carboxylate synthase (acc-s)]. The down-regulation of these genes, in turn, reduced the production of cysteine proteinase inhibitors (CystPIs), which are specific deterrents to coleopteran herbivores. Beetle herbivory increased CystPI activity to a greater degree in plants grown under ambient than under elevated CO{sub 2}. Gut cysteine proteinase activity was higher in beetles consuming foliage of soybeans grown under elevated CO{sub 2} than in beetles consuming soybeans grown in ambient CO{sub 2}, consistent with enhanced growth and development of these beetles on plants grown in elevated CO{sub 2}. These findings suggest that predicted increases in soybean productivity under projected elevated CO{sub 2} levels may be reduced by increased susceptibility to invasive crop pests.

  10. An Analysis of Department of Defense Instruction 8500.2 'Information Assurance (IA) Implementation.'

    SciTech Connect (OSTI)

    Campbell, Philip LaRoche

    2012-01-01

    The Department of Defense (DoD) provides its standard for information assurance in its Instruction 8500.2, dated February 6, 2003. This Instruction lists 157 'IA Controls' for nine 'baseline IA levels.' Aside from distinguishing IA Controls that call for elevated levels of 'robustness' and grouping the IA Controls into eight 'subject areas' 8500.2 does not examine the nature of this set of controls, determining, for example, which controls do not vary in robustness, how this set of controls compares with other such sets, or even which controls are required for all nine baseline IA levels. This report analyzes (1) the IA Controls, (2) the subject areas, and (3) the Baseline IA levels. For example, this report notes that there are only 109 core IA Controls (which this report refers to as 'ICGs'), that 43 of these core IA Controls apply without variation to all nine baseline IA levels and that an additional 31 apply with variations. This report maps the IA Controls of 8500.2 to the controls in NIST 800-53 and ITGI's CoBIT. The result of this analysis and mapping, as shown in this report, serves as a companion to 8500.2. (An electronic spreadsheet accompanies this report.)

  11. Quarterly report on Defense Nuclear Facilities Safety Board recommendation 90-7 for the period ending September 30, 1993

    SciTech Connect (OSTI)

    Meacham, J.E.; Cash, R.J.; Dukelow, G.T.

    1993-12-01

    This is the tenth quarterly repose on the progress of activities addressing safety issues associated with Hanford Site high-level radioactive waste tanks that contain ferrocyanide compounds. In the Presence of oxidizing materials, such as nitrates or nitrites, ferrocyanide can be made to explode in the laboratory by hearing it to high temperatures [above 285{degree} C (545{degree} F)]. In the mid 1950s, approximately 140 metric tons of ferrocyanide were added to waste now stored in underground high-level radioactive waste tanks. An implementation plan responding to the Defense Nuclear Facilities Safety Board Recommendation 90-7 (FR 1990){sup 2} was issued in March 1991 describing the activities that were planned and underway to address each of the six parts of Recommendation 90-7. A revision to the original plan was transmitted to the US Department of Energy by Westinghouse Hanford in December 1992, and subsequently to the Defense Nuclear Facilities Safety Board in 1993.

  12. Process of Integrating Screening and Detailed Risk-based Modeling Analyses to Ensure Consistent and Scientifically Defensible Results

    SciTech Connect (OSTI)

    Buck, John W.; McDonald, John P.; Taira, Randal Y.

    2002-11-01

    To support cleanup and closure of these tanks, modeling is performed to understand and predict potential impacts to human health and the environment. Pacific Northwest National Laboratory developed a screening tool for the United States Department of Energy, Office of River Protection that estimates the long-term human health risk, from a strategic planning perspective, posed by potential tank releases to the environment. This tool is being conditioned to more detailed model analyses to ensure consistency between studies and to provide scientific defensibility. Once the conditioning is complete, the system will be used to screen alternative cleanup and closure strategies. The integration of screening and detailed models provides consistent analyses, efficiencies in resources, and positive feedback between the various modeling groups. This approach of conditioning a screening methodology to more detailed analyses provides decision-makers with timely and defensible information and increases confidence in the results on the part of clients, regulators, and stakeholders.

  13. Annual Report To Congress. Department of Energy Activities Relating to the Defense Nuclear Facilities Safety Board, Calendar Year 2003

    SciTech Connect (OSTI)

    None, None

    2004-02-28

    The Department of Energy (Department) submits an Annual Report to Congress each year detailing the Department’s activities relating to the Defense Nuclear Facilities Safety Board (Board), which provides advice and recommendations to the Secretary of Energy (Secretary) regarding public health and safety issues at the Department’s defense nuclear facilities. In 2003, the Department continued ongoing activities to resolve issues identified by the Board in formal recommendations and correspondence, staff issue reports pertaining to Department facilities, and public meetings and briefings. Additionally, the Department is implementing several key safety initiatives to address and prevent safety issues: safety culture and review of the Columbia accident investigation; risk reduction through stabilization of excess nuclear materials; the Facility Representative Program; independent oversight and performance assurance; the Federal Technical Capability Program (FTCP); executive safety initiatives; and quality assurance activities. The following summarizes the key activities addressed in this Annual Report.

  14. Annual report to Congress: Department of Energy activities relating to the Defense Nuclear Facilities Safety Board, calendar year 1998

    SciTech Connect (OSTI)

    1999-02-01

    This is the ninth Annual Report to the Congress describing Department of Energy (Department) activities in response to formal recommendations and other interactions with the Defense Nuclear Facilities Safety Board (Board). The Board, an independent executive-branch agency established in 1988, provides advice and recommendations to the Secretary of energy regarding public health and safety issues at the Department`s defense nuclear facilities. The Board also reviews and evaluates the content and implementation of health and safety standards, as well as other requirements, relating to the design, construction, operation, and decommissioning of the Department`s defense nuclear facilities. The locations of the major Department facilities are provided. During 1998, Departmental activities resulted in the proposed closure of one Board recommendation. In addition, the Department has completed all implementation plan milestones associated with four other Board recommendations. Two new Board recommendations were received and accepted by the Department in 1998, and two new implementation plans are being developed to address these recommendations. The Department has also made significant progress with a number of broad-based initiatives to improve safety. These include expanded implementation of integrated safety management at field sites, a renewed effort to increase the technical capabilities of the federal workforce, and a revised plan for stabilizing excess nuclear materials to achieve significant risk reduction.

  15. Annual report to Congress: Department of Energy activities relating to the Defense Nuclear Facilities Safety Board, Calendar Year 1999

    SciTech Connect (OSTI)

    None

    2000-02-01

    This is the tenth Annual Report to the Congress describing Department of Energy activities in response to formal recommendations and other interactions with the Defense Nuclear Facilities Safety Board (Board). The Board, an independent executive-branch agency established in 1988, provides advice and recommendations to the Secretary of Energy regarding public health and safety issues at the Department's defense nuclear facilities. The Board also reviews and evaluates the content and implementation of health and safety standards, as well as other requirements, relating to the design, construction, operation, and decommissioning of the Department's defense nuclear facilities. During 1999, Departmental activities resulted in the closure of nine Board recommendations. In addition, the Department has completed all implementation plan milestones associated with three Board recommendations. One new Board recommendation was received and accepted by the Department in 1999, and a new implementation plan is being developed to address this recommendation. The Department has also made significant progress with a number of broad-based initiatives to improve safety. These include expanded implementation of integrated safety management at field sites, opening of a repository for long-term storage of transuranic wastes, and continued progress on stabilizing excess nuclear materials to achieve significant risk reduction.

  16. Quarterly report on Defense Nuclear Facilities Safety Board Recommendation 90-7

    SciTech Connect (OSTI)

    Cash, R.J.; Dukelow, G.T.

    1991-10-01

    This is the second quarterly report on the progress of activities addressing safety issues associated with Hanford Site high-level radioactive waste tanks that contain ferrocyanide compounds. An implementation plan (Cash 1991) responding to the Defense Nuclear Facilities Safety Board Recommendation 90-7 (FR 1990) was issued in March 1991 describing the activities planned and underway to address each of the six parts of the recommendation. All of the activities listed in the implementation plan are underway, including the multifunctional instrument tree and infrared tasks which resumed in late July. Although technical difficulties and resource limitations delayed some work, noteworthy progress has been made in completing a number of ferrocyanide program milestones. Thermal modeling shows that the heat loading of tank 241-BY-104 is much lower than previously listed and that significant hot spots within the waste are highly unlikely, if not possible. Computerized continuous temperature monitoring was installed on schedule on five of the highest interest tanks and five additional tanks will be on-line in December. Tank intrusive sampling is proceeding and the first vapor samples were obtained in mid-October. Spectral scans were completed for twelve tanks and substantial progress was made on design of an infrared scanning system. Chemical reaction studies are underway with synthetic ferrocyanide compounds believed to be more representative of the ferrocyanide materials actually deposited in the tanks. Tests indicate that water plays a major role in impeding a possible runaway reaction. An emergency planning exercise was conducted in May, emergency procedures were updated this quarter, and validation of the procedures and a second emergency exercise is scheduled for October.

  17. Formic Acid Free Flowsheet Development To Eliminate Catalytic Hydrogen Generation In The Defense Waste Processing

    SciTech Connect (OSTI)

    Lambert, Dan P.; Stone, Michael E.; Newell, J. David; Fellinger, Terri L.; Bricker, Jonathan M.

    2012-09-14

    The Defense Waste Processing Facility (DWPF) processes legacy nuclear waste generated at the Savannah River Site (SRS) during production of plutonium and tritium demanded by the Cold War. The nuclear waste is first treated via a complex sequence of controlled chemical reactions and then vitrified into a borosilicate glass form and poured into stainless steel canisters. Converting the nuclear waste into borosilicate glass canisters is a safe, effective way to reduce the volume of the waste and stabilize the radionuclides. Testing was initiated to determine whether the elimination of formic acid from the DWPF's chemical processing flowsheet would eliminate catalytic hydrogen generation. Historically, hydrogen is generated in chemical processing of alkaline High Level Waste sludge in DWPF. In current processing, sludge is combined with nitric and formic acid to neutralize the waste, reduce mercury and manganese, destroy nitrite, and modify (thin) the slurry rheology. The noble metal catalyzed formic acid decomposition produces hydrogen and carbon dioxide. Elimination of formic acid by replacement with glycolic acid has the potential to eliminate the production of catalytic hydrogen. Flowsheet testing was performed to develop the nitric-glycolic acid flowsheet as an alternative to the nitric-formic flowsheet currently being processed at the DWPF. This new flowsheet has shown that mercury can be reduced and removed by steam stripping in DWPF with no catalytic hydrogen generation. All processing objectives were also met, including greatly reducing the Slurry Mix Evaporator (SME) product yield stress as compared to the baseline nitric/formic flowsheet. Ten DWPF tests were performed with nonradioactive simulants designed to cover a broad compositional range. No hydrogen was generated in testing without formic acid.

  18. An Assessment of the Degree of Implementation of the Lean Aerospace Initiative Principles and Practices within the US Aerospace and Defense Industry

    E-Print Network [OSTI]

    Shaw, Thomas E.

    This report is a formal documentation of the results of an assessment of the degree to which Lean Principles and Practices have been implemented in the US Aerospace and Defense Industry. An Industry Association team prepared ...

  19. Mercury Reduction and Removal from High Level Waste at the Defense Waste Processing Facility - 12511

    SciTech Connect (OSTI)

    Behrouzi, Aria [Savannah River Remediation, LLC (United States); Zamecnik, Jack [Savannah River National Laboratory, Aiken, South Carolina, 29808 (United States)

    2012-07-01

    The Defense Waste Processing Facility processes legacy nuclear waste generated at the Savannah River Site during production of enriched uranium and plutonium required by the Cold War. The nuclear waste is first treated via a complex sequence of controlled chemical reactions and then vitrified into a borosilicate glass form and poured into stainless steel canisters. Converting the nuclear waste into borosilicate glass is a safe, effective way to reduce the volume of the waste and stabilize the radionuclides. One of the constituents in the nuclear waste is mercury, which is present because it served as a catalyst in the dissolution of uranium-aluminum alloy fuel rods. At high temperatures mercury is corrosive to off-gas equipment, this poses a major challenge to the overall vitrification process in separating mercury from the waste stream prior to feeding the high temperature melter. Mercury is currently removed during the chemical process via formic acid reduction followed by steam stripping, which allows elemental mercury to be evaporated with the water vapor generated during boiling. The vapors are then condensed and sent to a hold tank where mercury coalesces and is recovered in the tank's sump via gravity settling. Next, mercury is transferred from the tank sump to a purification cell where it is washed with water and nitric acid and removed from the facility. Throughout the chemical processing cell, compounds of mercury exist in the sludge, condensate, and off-gas; all of which present unique challenges. Mercury removal from sludge waste being fed to the DWPF melter is required to avoid exhausting it to the environment or any negative impacts to the Melter Off-Gas system. The mercury concentration must be reduced to a level of 0.8 wt% or less before being introduced to the melter. Even though this is being successfully accomplished, the material balances accounting for incoming and collected mercury are not equal. In addition, mercury has not been effectively purified and collected in the Mercury Purification Cell (MPC) since 2008. A significant cleaning campaign aims to bring the MPC back up to facility housekeeping standards. Two significant investigations are being undertaken to restore mercury collection. The SMECT mercury pump has been removed from the tank and will be functionally tested. Also, research is being conducted by the Savannah River National Laboratory to determine the effects of antifoam addition on the behavior of mercury. These path forward items will help us better understand what is occurring in the mercury collection system and ultimately lead to an improved DWPF production rate and mercury recovery rate. (authors)

  20. Elimination Of Catalytic Hydrogen Generation In Defense Waste Processing Facility Slurries

    SciTech Connect (OSTI)

    Koopman, D. C.

    2013-01-22

    Based on lab-scale simulations of Defense Waste Processing Facility (DWPF) slurry chemistry, the addition of sodium nitrite and sodium hydroxide to waste slurries at concentrations sufficient to take the aqueous phase into the alkaline region (pH > 7) with approximately 500 mg nitrite ion/kg slurry (assuming <25 wt% total solids, or equivalently 2,000 mg nitrite/kg total solids) is sufficient to effectively deactivate the noble metal catalysts at temperatures between room temperature and boiling. This is a potential strategy for eliminating catalytic hydrogen generation from the list of concerns for sludge carried over into the DWPF Slurry Mix Evaporator Condensate Tank (SMECT) or Recycle Collection Tank (RCT). These conclusions are drawn in large part from the various phases of the DWPF catalytic hydrogen generation program conducted between 2005 and 2009. The findings could apply to various situations, including a solids carry-over from either the Sludge Receipt and Adjustment Tank (SRAT) or Slurry Mix Evaporator (SME) into the SMECT with subsequent transfer to the RCT, as well as a spill of formic acid into the sump system and transfer into an RCT that already contains sludge solids. There are other potential mitigating factors for the SMECT and RCT, since these vessels are typically operated at temperatures close to the minimum temperatures that catalytic hydrogen has been observed to occur in either the SRAT or SME (pure slurry case), and these vessels are also likely to be considerably more dilute in both noble metals and formate ion (the two essential components to catalytic hydrogen generation) than the two primary process vessels. Rhodium certainly, and ruthenium likely, are present as metal-ligand complexes that are favored under certain concentrations of the surrounding species. Therefore, in the SMECT or RCT, where a small volume of SRAT or SME material would be significantly diluted, conditions would be less optimal for forming or sustaining the catalytic ligand species. Such conditions are likely to adversely impact the ability of the transferred mass to produce hydrogen at the same rate (per unit mass SRAT or SME slurry) as in the SRAT or SME vessels.

  1. Qualification of the Nippon Instrumentation for use in Measuring Mercury at the Defense Waste Processing Facility

    SciTech Connect (OSTI)

    Edwards, T.; Mahannah, R.

    2011-07-05

    The Nippon Mercury/RA-3000 system installed in 221-S M-14 has been qualified for use. The qualification was a side-by-side comparison of the Nippon Mercury/RA-3000 system with the currently used Bacharach Mercury Analyzer. The side-by-side testing included standards for instrument calibration verifications, spiked samples and unspiked samples. The standards were traceable back to the National Institute of Standards and Technology (NIST). The side-by-side work included the analysis of Sludge Receipt and Adjustment Tank (SRAT) Receipt, SRAT Product, and Slurry Mix Evaporator (SME) samples. With the qualification of the Nippon Mercury/RA-3000 system in M-14, the DWPF lab will be able to perform a head to head comparison of a second Nippon Mercury/RA-3000 system once the system is installed. The Defense Waste Processing Facility (DWPF) analyzes receipt and product samples from the Sludge Receipt and Adjustment Tank (SRAT) to determine the mercury (Hg) concentration in the sludge slurry. The SRAT receipt is typically sampled and analyzed for the first ten SRAT batches of a new sludge batch to obtain an average Hg concentration. This average Hg concentration is then used to determine the amount of steam stripping required during the concentration/reflux step of the SRAT cycle to achieve a less than 0.6 wt% Hg in the SRAT product solids. After processing is complete, the SRAT product is sampled and analyzed for mercury to ensure that the mercury concentration does not exceed the 0.45 wt% limit in the Slurry Mix Evaporator (SME). The DWPF Laboratory utilizes Bacharach Analyzers to support these Hg analyses at this facility. These analyzers are more than 10 years old, and they are no longer supported by the manufacturer. Due to these difficulties, the Bacharach Analyzers are to be replaced by new Nippon Mercury/RA-3000 systems. DWPF issued a Technical Task Request (TTR) for the Savannah River National Laboratory (SRNL) to assist in the qualification of the new systems. SRNL prepared a task technical and quality assurance (TT&QA) plan that outlined the activities that are necessary and sufficient to meet the objectives of the TTR. In addition, TT&QA plan also included a test plan that provided guidance to the DWPF Lab in collecting the data needed to qualify the new Nippon Mercury/RA-3000 systems.

  2. Second Line of Defense, Port of Buenos Aires and Exolgan Container Terminal Operational Testing and Evaluation Plan, Buenos Aires, Argentina

    SciTech Connect (OSTI)

    Roberts, Bryan W.

    2012-08-23

    The Office of the Second Line of Defense (SLD) Megaports project team for Argentina will conduct operational testing and evaluation (OT&E) at Exolgan Container Terminal at the Port of Dock Sud from July 16-20, 2012; and at the Port of Buenos Aires from September 3-7, 2012. SLD is installing radiation detection equipment to screen export, import, and transshipment containers at these locations. The purpose of OT&E is to validate and baseline an operable system that meets the SLD mission and to ensure the system continues to perform as expected in an operational environment with Argentina Customs effectively adjudicating alarms.

  3. Qualification of the First ICS-3000 ION Chromatograph for use at the Defense Waste Processing Facility

    SciTech Connect (OSTI)

    Edwards, T; Mahannah, R.

    2011-07-05

    The ICS-3000 Ion Chromatography (IC) system installed in 221-S M-13 has been qualified for use. The qualification was a head to head comparison of the ICS-3000 with the currently used DX-500 IC system. The crosscheck work included standards for instrument calibration and calibration verifications and standards for individual anion analysis, where the standards were traceable back to the National Institute of Standards and Technology (NIST). In addition the crosscheck work included the analysis of simulated Sludge Receipt Adjustment Tank (SRAT) Receipt, SRAT Product, and Slurry Mix Evaporator (SME) samples, along with radioactive Sludge Batch 5 material from the SRAT and SME tanks. Based upon the successful qualification of the ICS-3000 in M-13, it is recommended that this task proceed in developing the data to qualify, by a head to head comparison of the two ICS-3000 instruments, a second ICS-3000 to be installed in M-14. The Defense Waste Processing Facility (DWPF) requires the analysis of specific anions at various stages of its processing of high level waste (HLW). The anions of interest to the DWPF are fluoride, formate, chloride, nitrite, nitrate, sulfate, oxalate, and phosphate. The anion analysis is used to evaluate process chemistry including formic acid/nitric acid additions to establish optimum conditions for mercury stripping, reduction-oxidation (REDOX) chemistry for the melter, nitrite destruction, organic acid constituents, etc. The DWPF Laboratory (Lab) has been using Dionex DX-500 ion chromatography (IC) systems since 1998. The vendor informed DWPF in 2006 that the instruments would no longer be supported by service contracts after 2008. DWPF purchased three new ICS-3000 systems in September of 2006. The ICS-3000 instruments are (a) designed to be more stable using an eluent generator to make eluent, (b) require virtually no daily chemical handling by the analysts, (c) require less line breaks in the hood, and (d) generally require less maintenance due to the pump configuration only using water versus the current system where the pump uses various hydroxide concentrations. The ICS-3000 instruments also allow the DWPF to maintain current service contracts, which support routine preventive maintenance and emergency support for larger problems such as component failure. One of the three new systems was set up in the DWPF Lab trailers in January of 2007 to be used for the development of methods and procedures. This system will continue to be used for training, new method development and potential improvements to current methods. The qualification of the other two ICS-3000 instruments is to be a phased effort. This effort is to be supported by the Applied Computational Engineering and Statistical (ACES) group of the Savannah River National Laboratory (SRNL) as authorized by the Technical Task Request (TTR) and as directed by the corresponding Task Technical and Quality Assurance (TT&QA) plan. The installation of the first 'rad' system into the M-13 Lab module required modifications to both the Lab module and to the radiohood. The installation was completed in July 2008. The testing of this system was conducted as directed by the TT&QA plan. The purpose of this technical report is to provide a review of the data generated by these tests that will lead to the recommendation for the qualification of the M-13 ICS-3000 instrument. With the successful qualification of this first ICS-3000, plans will be developed for the installation of the second 'rad' system in the M-14 Lab module later in fiscal year 2009. When the second 'rad' ICS-3000 system is installed, the DX-500 systems will be removed and retired from service.

  4. Evaluation Of A Turbidity Meter For Use At The Defense Waste Processing Facility

    SciTech Connect (OSTI)

    Mahannah, R. N.; Edwards, T. B.

    2013-01-15

    Savannah River Remediation's (SRR's) Defense Waste Processing Facility (DWPF) Laboratory currently tests for sludge carry-over into the Recycle Collection Tank (RCT) by evaluating the iron concentration in the Slurry Mix Evaporator Condensate Tank (SMECT) and relating this iron concentration to the amount of sludge solids present. A new method was proposed for detecting the amount of sludge in the SMECT that involves the use of an Optek turbidity sensor. Waste Services Laboratory (WSL) personnel conducted testing on two of these units following a test plan developed by Waste Solidification Engineering (WSE). Both Optek units (SN64217 and SN65164) use sensor model AF16-N and signal converter model series C4000. The sensor body of each unit was modified to hold a standard DWPF 12 cc sample vial, also known as a ''peanut'' vial. The purpose of this testing was to evaluate the use of this model of turbidity sensor, or meter, to provide a measurement of the sludge solids present in the SMECT based upon samples from that tank. During discussions of the results from this study by WSE, WSL, and Savannah River National Laboratory (SRNL) personnel, an upper limit on the acceptable level of solids in SMECT samples was set at 0.14 wt%. A ''go/no-go'' decision criterion was to be developed for the critical turbidity response, which is expressed in concentration units (CUs), for each Optek unit based upon the 0.14 wt% solids value. An acceptable or a ''go'' decision for the SMECT should reflect the situation that there is an identified risk (e.g. 5%) for a CU response from the Optek unit to be less than the critical CU value when the solids content of the SMECT is actually 0.14 wt% or greater, while a ''no-go'' determination (i.e., an Optek CU response above the critical CU value, a conservative decision relative to risk) would lead to additional evaluations of the SMECT to better quantify the possible solids content of the tank. A sludge simulant was used to develop standards for testing both Optek units and to determine the viability of a ''go/no-go'' CU response for each of the units. Statistical methods were used by SRNL to develop the critical CU value for the ''go/no-go'' decision for these standards for each Optek unit. Since only one sludge simulant was available for this testing, the sensitivity of these results to other simulants and to actual sludge material is not known. However, limited testing with samples from the actual DWPF process (both SRAT product samples and SMECT samples) demonstrated that the use of the ''go/no-go'' criteria developed from the sludge simulant testing was conservative for these samples taken from Sludge Batch 7b (SB7b), the sludge batch currently being processed. While both of the Optek units performed very reliably during this testing, there were statistically significant differences (although small on a practical scale) between the two units. Thus, testing should be conducted on any new unit of this Optek model to qualify it before it is used to support the DWPF operation.

  5. EVALUATION OF A TURBIDITY METER FOR USE AT THE DEFENSE WASTE PROCESSING FACILITY

    SciTech Connect (OSTI)

    Mahannah, R.; Edwards, T.

    2013-06-04

    Savannah River Remediation’s (SRR’s) Defense Waste Processing Facility (DWPF) Laboratory currently tests for sludge carry-over into the Recycle Collection Tank (RCT) by evaluating the iron concentration in the Slurry Mix Evaporator Condensate Tank (SMECT) and relating this iron concentration to the amount of sludge solids present. A new method was proposed for detecting the amount of sludge in the SMECT that involves the use of an Optek turbidity sensor. Waste Services Laboratory (WSL) personnel conducted testing on two of these units following a test plan developed by Waste Solidification Engineering (WSE). Both Optek units (SN64217 and SN65164) use sensor model AF16-N and signal converter model series C4000. The sensor body of each unit was modified to hold a standard DWPF 12 cc sample vial, also known as a “peanut” vial. The purpose of this testing was to evaluate the use of this model of turbidity sensor, or meter, to provide a measurement of the sludge solids present in the SMECT based upon samples from that tank. During discussions of the results from this study by WSE, WSL, and Savannah River National Laboratory (SRNL) personnel, an upper limit on the acceptable level of solids in SMECT samples was set at 0.14 weight percent (wt%). A “go/no-go” decision criterion was to be developed for the critical turbidity response, which is expressed in concentration units (CUs), for each Optek unit based upon the 0.14 wt% solids value. An acceptable or a “go” decision for the SMECT should reflect the situation that there is an identified risk (e.g. 5%) for a CU response from the Optek unit to be less than the critical CU value when the solids content of the SMECT is actually 0.14 wt% or greater, while a “no-go” determination (i.e., an Optek CU response above the critical CU value, a conservative decision relative to risk) would lead to additional evaluations of the SMECT to better quantify the possible solids content of the tank. Subsequent to the issuance of the initial version of this report but under the scope of the original request for technical assistance, WSE asked for this report to be revised to include the “go/no-go” CU value corresponding to 0.28 wt% solids. It was this request that led to the preparation of Revision 1 of the report. The results for the 0.28 wt% solids value were developed following the same approach as that utilized for the 0.14 wt% solids value. A sludge simulant was used to develop standards for testing both Optek units and to determine the viability of a “go/no-go” CU response for each of the units. Statistical methods were used by SRNL to develop the critical CU value for the “go/no-go” decision for these standards for each Optek unit. Since only one sludge simulant was available for this testing, the sensitivity of these results to other simulants and to actual sludge material is not known. However, limited testing with samples from the actual DWPF process (both SRAT product samples and SMECT samples) demonstrated that the use of the “go/no-go” criteria developed from the sludge simulant testing was conservative for these samples taken from the sludge batch, Sludge Batch 7b, being processed at the time of this testing. While both of the Optek units performed very reliably during this testing, there were statistically significant differences (although small on a practical scale) between the two units. Thus, testing should be conducted on any new unit of this Optek model to qualify it before it is used to support the DWPF operation.

  6. SUMMARY OF FY11 SULFATE RETENTION STUDIES FOR DEFENSE WASTE PROCESSING FACILITY GLASS

    SciTech Connect (OSTI)

    Fox, K.; Edwards, T.

    2012-05-08

    This report describes the results of studies related to the incorporation of sulfate in high level waste (HLW) borosilicate glass produced at the Savannah River Site (SRS) Defense Waste Processing Facility (DWPF). A group of simulated HLW glasses produced for earlier sulfate retention studies was selected for full chemical composition measurements to determine whether there is any clear link between composition and sulfate retention over the compositional region evaluated. In addition, the viscosity of several glasses was measured to support future efforts in modeling sulfate solubility as a function of predicted viscosity. The intent of these studies was to develop a better understanding of sulfate retention in borosilicate HLW glass to allow for higher loadings of sulfate containing waste. Based on the results of these and other studies, the ability to improve sulfate solubility in DWPF borosilicate glasses lies in reducing the connectivity of the glass network structure. This can be achieved, as an example, by increasing the concentration of alkali species in the glass. However, this must be balanced with other effects of reduced network connectivity, such as reduced viscosity, potentially lower chemical durability, and in the case of higher sodium and aluminum concentrations, the propensity for nepheline crystallization. Future DWPF processing is likely to target higher waste loadings and higher sludge sodium concentrations, meaning that alkali concentrations in the glass will already be relatively high. It is therefore unlikely that there will be the ability to target significantly higher total alkali concentrations in the glass solely to support increased sulfate solubility without the increased alkali concentration causing failure of other Product Composition Control System (PCCS) constraints, such as low viscosity and durability. No individual components were found to provide a significant improvement in sulfate retention (i.e., an increase of the magnitude necessary to have a dramatic impact on blending, washing, or waste loading strategies for DWPF) for the glasses studied here. In general, the concentrations of those species that significantly improve sulfate solubility in a borosilicate glass must be added in relatively large concentrations (e.g., 13 to 38 wt % or more of the frit) in order to have a substantial impact. For DWPF, these concentrations would constitute too large of a portion of the frit to be practical. Therefore, it is unlikely that specific additives may be introduced into the DWPF glass via the frit to significantly improve sulfate solubility. The results presented here continue to show that sulfate solubility or retention is a function of individual glass compositions, rather than a property of a broad glass composition region. It would therefore be inappropriate to set a single sulfate concentration limit for a range of DWPF glass compositions. Sulfate concentration limits should continue to be identified and implemented for each sludge batch. The current PCCS limit is 0.4 wt % SO{sub 4}{sup 2-} in glass, although frit development efforts have led to an increased limit of 0.6 wt % for recent sludge batches. Slightly higher limits (perhaps 0.7-0.8 wt %) may be possible for future sludge batches. An opportunity for allowing a higher sulfate concentration limit at DWPF may lay lie in improving the laboratory experiments used to set this limit. That is, there are several differences between the crucible-scale testing currently used to define a limit for DWPF operation and the actual conditions within the DWPF melter. In particular, no allowance is currently made for sulfur partitioning (volatility versus retention) during melter processing as the sulfate limit is set for a specific sludge batch. A better understanding of the partitioning of sulfur in a bubbled melter operating with a cold cap as well as the impacts of sulfur on the off-gas system may allow a higher sulfate concentration limit to be established for the melter feed. This approach would have to be taken carefully to ensure that a

  7. Transgenic expression of the dicotyledonous pattern recognition receptor EFR in rice leads to ligand-dependent activation of defense responses

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Schwessinger, Benjamin; Bahar, Ofir; Thomas, Nicolas; Holton, Nicolas; Nekrasov, Vladimir; Ruan, Deling; Canlas, Patrick E.; Daudi, Arsalan; Petzold, Christopher J.; Singan, Vasanth R.; et al

    2015-03-30

    Plant plasma membrane localized pattern recognition receptors (PRRs) detect extracellular pathogen-associated molecules. PRRs such as Arabidopsis EFR and rice XA21 are taxonomically restricted and are absent from most plant genomes. Here we show that rice plants expressing EFR or the chimeric receptor EFR::XA21, containing the EFR ectodomain and the XA21 intracellular domain, sense both Escherichia coli- and Xanthomonas oryzae pv. oryzae (Xoo)-derived elf18 peptides at sub-nanomolar concentrations. Treatment of EFR and EFR::XA21 rice leaf tissue with elf18 leads to MAP kinase activation, reactive oxygen production and defense gene expression. Although expression of EFR does not lead to robust enhanced resistancemore »to fully virulent Xoo isolates, it does lead to quantitatively enhanced resistance to weakly virulent Xoo isolates. EFR interacts with OsSERK2 and the XA21 binding protein 24 (XB24), two key components of the rice XA21-mediated immune response. Rice-EFR plants silenced for OsSERK2, or overexpressing rice XB24 are compromised in elf18-induced reactive oxygen production and defense gene expression indicating that these proteins are also important for EFR-mediated signaling in transgenic rice. Taken together, our results demonstrate the potential feasibility of enhancing disease resistance in rice and possibly other monocotyledonous crop species by expression of dicotyledonous PRRs. Our results also suggest that Arabidopsis EFR utilizes at least a subset of the known endogenous rice XA21 signaling components.« less

  8. CHARACTERIZATION OF A PRECIPITATE REACTOR FEED TANK (PRFT) SAMPLE FROM THE DEFENSE WASTE PROCESSING FACILITY (DWPF)

    SciTech Connect (OSTI)

    Crawford, C.; Bannochie, C.

    2014-05-12

    A sample of from the Defense Waste Processing Facility (DWPF) Precipitate Reactor Feed Tank (PRFT) was pulled and sent to the Savannah River National Laboratory (SRNL) in June of 2013. The PRFT in DWPF receives Actinide Removal Process (ARP)/ Monosodium Titanate (MST) material from the 512-S Facility via the 511-S Facility. This 2.2 L sample was to be used in small-scale DWPF chemical process cell testing in the Shielded Cells Facility of SRNL. A 1L sub-sample portion was characterized to determine the physical properties such as weight percent solids, density, particle size distribution and crystalline phase identification. Further chemical analysis of the PRFT filtrate and dissolved slurry included metals and anions as well as carbon and base analysis. This technical report describes the characterization and analysis of the PRFT sample from DWPF. At SRNL, the 2.2 L PRFT sample was composited from eleven separate samples received from DWPF. The visible solids were observed to be relatively quick settling which allowed for the rinsing of the original shipping vials with PRFT supernate on the same day as compositing. Most analyses were performed in triplicate except for particle size distribution (PSD), X-ray diffraction (XRD), Scanning Electron Microscopy (SEM) and thermogravimetric analysis (TGA). PRFT slurry samples were dissolved using a mixed HNO3/HF acid for subsequent Inductively Coupled Plasma Atomic Emission Spectroscopy (ICPAES) and Inductively Coupled Plasma Mass Spectroscopy (ICP-MS) analyses performed by SRNL Analytical Development (AD). Per the task request for this work, analysis of the PRFT slurry and filtrate for metals, anions, carbon and base were primarily performed to support the planned chemical process cell testing and to provide additional component concentrations in addition to the limited data available from DWPF. Analysis of the insoluble solids portion of the PRFT slurry was aimed at detailed characterization of these solids (TGA, PSD, XRD and SEM) in support of the Salt IPT chemistry team. The overall conclusions from analyses performed in this study are that the PRFT slurry consists of 0.61 Wt.% insoluble MST solids suspended in a 0.77 M [Na+] caustic solution containing various anions such as nitrate, nitrite, sulfate, carbonate and oxalate. The corresponding measured sulfur level in the PRFT slurry, a critical element for determining how much of the PRFT slurry gets blended into the SRAT, is 0.437 Wt.% TS. The PRFT slurry does not contain insoluble oxalates nor significant quantities of high activity sludge solids. The lack of sludge solids has been alluded to by the Salt IPT chemistry team in citing that the mixing pump has been removed from Tank 49H, the feed tank to ARP-MCU, thus allowing the sludge solids to settle out. ? The PRFT aqueous slurry from DWPF was found to contain 5.96 Wt.% total dried solids. Of these total dried solids, relatively low levels of insoluble solids (0.61 Wt.%) were measured. The densities of both the filtrate and slurry were 1.05 g/mL. ? Particle size distribution of the PRFT solids in filtered caustic simulant and XRD analysis of washed/dried PRFT solids indicate that the PRFT slurry contains a bimodal distribution of particles in the range of 1 and 6 ?m and that the particles contain sodium titanium oxide hydroxide Na2Ti2O4(OH)2 crystalline material as determined by XRD. These data are in excellent agreement with similar data obtained from laboratory sampling of vendor supplied MST. Scanning Electron Microscopy (SEM) combined with Energy Dispersive X-ray Spectroscopy (EDS) analysis of washed/dried PRFT solids shows the particles to be like previous MST analyses consisting of irregular shaped micron-sized solids consisting primarily of Na and Ti. ? Thermogravimetric analysis of the washed and unwashed PRFT solids shows that the washed solids are very similar to MST solids. The TGA mass loss signal for the unwashed solids shows similar features to TGA performed on cellulose nitrate filter paper indicating significant presence of the deteriorated filter

  9. Conceptual waste package interim product specifications and data requirements for disposal of borosilicate glass defense high-level waste forms in salt geologic repositories

    SciTech Connect (OSTI)

    Not Available

    1983-06-01

    The conceptual waste package interim product specifications and data requirements presented are applicable specifically to the normal borosilicate glass product of the Defense Waste Processing Facility (DWPF). They provide preliminary numerical values for the defense high-level waste form parameters and properties identified in the waste form performance specification for geologic isolation in salt repositories. Subject areas treated include containment and isolation, operational period safety, criticality control, waste form/production canister identification, and waste package performance testing requirements. This document was generated for use in the development of conceptual waste package designs in salt. It will be revised as additional data, analyses, and regulatory requirements become available.

  10. Reevaluation Of Vitrified High-Level Waste Form Criteria For Potential Cost Savings At The Defense Waste Processing Facility

    SciTech Connect (OSTI)

    Ray, J. W.; Marra, S. L.; Herman, C. C.

    2013-01-09

    At the Savannah River Site (SRS) the Defense Waste Processing Facility (DWPF) has been immobilizing SRS's radioactive high level waste (HLW) sludge into a durable borosilicate glass since 1996. Currently the DWPF has poured over 3,500 canisters, all of which are compliant with the U. S. Department of Energy's (DOE) Waste Acceptance Product Specifications for Vitrified High-Level Waste Forms (WAPS) and therefore ready to be shipped to a federal geologic repository for permanent disposal. Due to DOE petitioning to withdraw the Yucca Mountain License Application (LA) from the Nuclear Regulatory Commission (NRC) in 2010 and thus no clear disposal path for SRS canistered waste forms, there are opportunities for cost savings with future canister production at DWPF and other DOE producer sites by reevaluating high-level waste form requirements and compliance strategies and reducing/eliminating those that will not negatively impact the quality of the canistered waste form.

  11. Quarterly report on Defense Nuclear Facilities Safety Board Recommendation 90-7 for the period ending March 31, 1993

    SciTech Connect (OSTI)

    Cash, R.J.; Dukelow, G.T.; Forbes, C.J.; Meacham, J.E.

    1993-06-01

    This is the eighth quarterly report on the progress of activities addressing safety issues associated with Hanford Site high-level radioactive waste tanks that contain ferrocyanide compounds. In the presence of oxidizing materials, such as nitrates or nitrites, ferrocyanide can be made to explode in the laboratory by heating it to high temperatures [above 285{degree}C (545{degree}F)]. In the mid 1950s, approximately 140 metric tons of ferrocyanide were added to 24 underground high-level radioactive waste tanks. An implementation plan (Cash 1991) responding to the Defense Nuclear Facilities Safety Board Recommendation 90-7 (FR 1990) was issued in March 1991 describing the activities that were planned and underway to address each of the six parts of Recommendation 90-7. A revision to the original plan was transmitted to the US Department of Energy by Westinghouse Hanford Company in December 1992.

  12. Quarterly report on Defense Nuclear Facilities Safety Board Recommendation 90-7 for the period ending March 31, 1992

    SciTech Connect (OSTI)

    Cash, R.J.; Dukelow, G.T.

    1992-05-01

    This is the fourth quarterly report on the progress of activities addressing safety issues associated with Hanford Site high-level radioactive waste tanks that contain ferrocyanide compounds. In the presence of oxidizing materials, such as nitrates or nitrites, ferrocyanide can be made to explode in the laboratory by heating it to high temperatures (above 285{degrees}C (545{degree}F)). In the mid 1950s approximately 140 metric tons of ferrocyanide were added to 24 underground high-level radioactive waste tanks. An implementation plan (Cash 1991) responding to the Defense Nuclear Facilities Safety Board Recommendation 90-7 (FR 1990) was issued in March 1991 describing the activities planned and underway to address each of the six parts of the recommendation.

  13. Quarterly report on Defense Nuclear Facilities Safety Board Recommendation 90-7 for the period ending March 31, 1992

    SciTech Connect (OSTI)

    Cash, R.J.; Dukelow, G.T.

    1992-05-01

    This is the fourth quarterly report on the progress of activities addressing safety issues associated with Hanford Site high-level radioactive waste tanks that contain ferrocyanide compounds. In the presence of oxidizing materials, such as nitrates or nitrites, ferrocyanide can be made to explode in the laboratory by heating it to high temperatures [above 285{degrees}C (545{degree}F)]. In the mid 1950s approximately 140 metric tons of ferrocyanide were added to 24 underground high-level radioactive waste tanks. An implementation plan (Cash 1991) responding to the Defense Nuclear Facilities Safety Board Recommendation 90-7 (FR 1990) was issued in March 1991 describing the activities planned and underway to address each of the six parts of the recommendation.

  14. Reevaluation of Vitrified High-Level Waste Form Criteria for Potential Cost Savings at the Defense Waste Processing Facility - 13598

    SciTech Connect (OSTI)

    Ray, J.W. [Savannah River Remediation (United States)] [Savannah River Remediation (United States); Marra, S.L.; Herman, C.C. [Savannah River National Laboratory, Savannah River Site, Aiken, SC 29808 (United States)] [Savannah River National Laboratory, Savannah River Site, Aiken, SC 29808 (United States)

    2013-07-01

    At the Savannah River Site (SRS) the Defense Waste Processing Facility (DWPF) has been immobilizing SRS's radioactive high level waste (HLW) sludge into a durable borosilicate glass since 1996. Currently the DWPF has poured over 3,500 canisters, all of which are compliant with the U. S. Department of Energy's (DOE) Waste Acceptance Product Specifications for Vitrified High-Level Waste Forms (WAPS) and therefore ready to be shipped to a federal geologic repository for permanent disposal. Due to DOE petitioning to withdraw the Yucca Mountain License Application (LA) from the Nuclear Regulatory Commission (NRC) in 2010 and thus no clear disposal path for SRS canistered waste forms, there are opportunities for cost savings with future canister production at DWPF and other DOE producer sites by reevaluating high-level waste form requirements and compliance strategies and reducing/eliminating those that will not negatively impact the quality of the canistered waste form. (authors)

  15. MvirDB: Microbial Database of Protein Toxins, Virulence Factors and Antibiotic Resistance Genes for Bio-Defense Applications

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Zhou, C. E.; Smith, J.; Lam, M.; Zemla, M. D.; Slezak, T.

    MvirDB is a cenntralized resource (data warehouse) comprising all publicly accessible, organized sequence data for protein toxins, virulence factors, and antibiotic resistance genes. Protein entries in MvirDB are annotated using a high-throughput, fully automated computational annotation system; annotations are updated periodically to ensure that results are derived using current public database and open-source tool releases. Tools provided for using MvirDB include a web-based browser tool and BLAST interfaces. MvirDB serves researchers in the bio-defense and medical fields. (taken from page 3 of PI's paper of same title published in Nucleic Acids Research, 2007, Vol.35, Database Issue (Open Source)

  16. Silicate Based Glass Formulations for Immobilization of U.S. Defense Wastes Using Cold Crucible Induction Melters

    SciTech Connect (OSTI)

    Smith, Gary L.; Kim, Dong-Sang; Schweiger, Michael J.; Marra, James C.; Lang, Jesse B.; Crum, Jarrod V.; Crawford, Charles L.; Vienna, John D.

    2014-05-22

    The cold crucible induction melter (CCIM) is an alternative technology to the currently deployed liquid-fed, ceramic-lined, Joule-heated melter for immobilizing of U.S. tank waste generated from defense related reprocessing. In order to accurately evaluate the potential benefits of deploying a CCIM, glasses must be developed specifically for that melting technology. Related glass formulation efforts have been conducted since the 1990s including a recent study that is first documented in this report. The purpose of this report is to summarize the silicate base glass formulation efforts for CCIM testing of U.S. tank wastes. Summaries of phosphate based glass formulation and phosphate and silicate based CCIM demonstration tests are reported separately (Day and Ray 2013 and Marra 2013, respectively). Combined these three reports summarize the current state of knowledge related to waste form development and process testing of CCIM technology for U.S. tank wastes.

  17. Annual report to Congress. Department of Energy activities relating to the Defense Nuclear Facilities Safety Board, calendar year 2000

    SciTech Connect (OSTI)

    2001-03-01

    This Annual Report to the Congress describes the Department of Energy's activities in response to formal recommendations and other interactions with the Defense Nuclear Facilities Safety Board. During 2000, the Department completed its implementation and proposed closure of one Board recommendation and completed all implementation plan milestones associated with two additional Board recommendations. Also in 2000, the Department formally accepted two new Board recommendations and developed implementation plans in response to those recommendations. The Department also made significant progress with a number of broad-based safety initiatives. These include initial implementation of integrated safety management at field sites and within headquarters program offices, issuance of a nuclear safety rule, and continued progress on stabilizing excess nuclear materials to achieve significant risk reduction.

  18. Annual Transportation Report for Radioactive Waste Shipments...

    National Nuclear Security Administration (NNSA)

    which routes transporters used to reach the NTS. These reports may be found on the Internet at http:www.nv.doe.govemprogramsenvironmentwastemanagementquarterlyrepo...

  19. Microsoft Word - 10000th_shipment.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OF PAGES AMENDMENT OF9-1595:UFC32:UFC896:UFC 2300.00For

  20. Microsoft Word - ORNL_first_shipment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetection of Hydrates on Gas5 15NEWS MEDIA CONTACT: FY

  1. Rocky Flats resumes shipments to WIPP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust, High-Throughput Analysis of Protein Structures Print Scientists have developedSoRocky

  2. User Shipments | Linac Coherent Light Source

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With WIPPfinalUnexpectedofWykoW03: DatatheServices Print

  3. Volume, Number of Shipments Surpass Goals

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A CountyFeet)Vladimir Koritarovshatters records

  4. WIPP Receives 500th Waste Shipment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *4 o**ColoradoDOE Awards4500 th

  5. WIPP receives 9,000th shipment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *415, 2014 Waste8,2,,WIPPWIPP

  6. Lab sets new record for waste shipments

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse Bergkamp Graduate student Subtask22BackgroundLabSanta'sNew record for

  7. Hazardous Material Shipments | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-DoseOptions for Accidental Releases of Hazardous

  8. First Savannah River Shipment Arrives At WIPP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journal Article) |Final Reportthe GrowingDirectProof ofProofFirst Savannah

  9. Los Alamos shipments to Waste Control Specialists

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousand CubicResourcelogo and-EearnstakesLosMap of scienceLos8, 2014

  10. The Board is a discretionary Federal advisory committee and shall provide independent advice to the Secretary of Defense through the Secretary of the Navy and other Navy

    E-Print Network [OSTI]

    to the Secretary of Defense through the Secretary of the Navy and other Navy Component Heads as determined by the Secretary of the Navy on matters relating to the Naval Postgraduate School and the Naval War College, facilities, and other matters of interest. The Board shall report to the Secretary of the Navy, through

  11. An Aspergillus nidulans bZIP response pathway hardwired for defensive secondary metabolism operates through aflRmmi_7986 1024..1034

    E-Print Network [OSTI]

    Gasch, Audrey P.

    is remarkable for the production of bioactive molecules commonly referred to as secondary metabolites (SMsAn Aspergillus nidulans bZIP response pathway hardwired for defensive secondary metabolism operates Microbiology and Immunology, 2 Plant Pathology, 3 Genetics and 4 Bacteriology, University of Wisconsin

  12. EIS-0063: Waste Management Operations, Double-Shell Tanks for Defense High-Level Radioactive Waste Storage, Hanford Site, Richland, Washington

    Broader source: Energy.gov [DOE]

    The U.S. Department of Energy developed this statement to evaluate the existing tank design and consider additional specific design and safety feature alternatives for the thirteen tanks being constructed for storage of defense high-level radioactive liquid waste at the Hanford Site in Richland, Washington. This statement supplements ERDA-1538, "Final Environmental Statement on Waste Management Operation."

  13. EIS-0023: Long-Term Management of Defense High-Level Radioactive Wastes (Research and Development Program for Immobilization), Savannah River Plant, Aiken, South Carolina

    Broader source: Energy.gov [DOE]

    This environmental impact statement (EIS) analyzes the environmental implications of the proposed continuation of a large Federal research and development (R&D) program directed toward the immobilization of the high-level radioactive wastes resulting from chemical separations operations for defense radionuclides production at the DOE Savannah River Plant (SRP) near Aiken, South Carolina.

  14. Guidelines for assessment PhD dissertation and public defense The assessment committee assesses the academic quality of the PhD dissertation in question.

    E-Print Network [OSTI]

    1of5 Guidelines for assessment ­ PhD dissertation and public defense The assessment committee assesses the academic quality of the PhD dissertation in question. Prior to the submission that the PhD process has been satisfactory and that all formal requirements have been met

  15. Texas A&M Forest Service Capacity Building Department Rural Fire Defense Unit P O Box 310 Lufkin, Texas 75902-0310

    E-Print Network [OSTI]

    Texas A&M Forest Service Capacity Building Department Rural Fire Defense Unit P O Box 310 Lufkin, Texas 75902-0310 TEL 936/639-8100 FAX 936/639-8138 http://www.texasfd.com TIFMAS Grant Assistance FOR FIREFIGHTER TRAINING The program will provide grants for tuition for firefighters in Texas to attend initial

  16. RECOVERY.GOV U.S. Depar

    Office of Environmental Management (EM)

    and prepare legacy TRU waste for shipment from SRS to the Waste Isolation Pilot Plant (WIPP), DOE's deep geologic repository for the permanent disposal of defense-generated TRU...

  17. The impact of out-of-theater supply flow visibility on in-theater logistics

    E-Print Network [OSTI]

    Giordano, Michael A. (Michael Anthony)

    2012-01-01

    The United States Army's end-to-end logistical network during times of conflict is made up of two separate networks. One network, managed by the Department of Defense, controls the shipment of supplies from the manufacturing ...

  18. Audit Report on "Work for Others Performed by the Department of Energy for the Department of Defense"

    SciTech Connect (OSTI)

    None

    2009-10-01

    Pursuant to the Atomic Energy Act of 1954, as amended, and the Economy Act of 1932, the Department of Energy and its semi-autonomous National Nuclear Security Administration (NNSA) provide research and technical assistance to other Federal agencies on a reimbursable, full cost recovery basis through the Work for Others (WFO) program. For the vast majority of WFO technical projects, Department Federal officials furnish administrative project oversight while the actual detailed scientific or technical work is completed by the Department's 'management and operating' contractors. These contractors are awarded a special contract type specifically created under the Federal Acquisition Regulation to manage and operate Department sites and facilities, including sophisticated laboratories and technical centers, on a government-owned, contractor-operated basis. With annual expenditures exceeding $1 billion, the Department of Defense (DoD) is one of the Department's largest WFO customers. Work performed for DoD at the Department's national laboratories and other facilities includes highly technical research in areas such as nuclear weapons systems, counter-terrorism, and in-theater troop support. The National Defense Authorization Act for Fiscal Year (FY) 2009, required the Inspectors General of the DoD and the Department to review procurement methods to determine whether the Department complied with DoD procurement requirements and/or whether alternative procurement policies were in place. In response, we focused our review on projects performed by NNSA because it completes the vast majority (approximately $900 million in FY 2008) of the Department's work for DoD. As part of this effort, and, at the specific request of the DoD Office of Inspector General (DoD OIG), we identified the universe of WFO technical projects that received new funding in the fourth quarter of FY 2008 at NNSA sites. We independently reviewed a judgmental sample of 11 projects selected by the DoD OIG to meet the objectives of this audit. Our review revealed that NNSA managed DoD WFO technical projects in a manner consistent with requirements of the Atomic Energy Act of 1954, the Federal Acquisition Regulation, and the Department's implementing guidance, the Department of Energy Acquisition Regulation. Because of the very nature of the Department's management and operating contracting model, WFO projects may not be technically compliant with DoD procurement regulations in certain instances. We found that NNSA did not let new contracts or task orders for the DoD WFO technical projects we reviewed and instead managed them under its existing internal control process as part of its management and operating contract structure. In one instance, we noted that the Department had, at DoD's request, supplemented its control structure to incorporate specific DoD procurement requirements. Senior Department of Energy procurement officials acknowledged that neither the Department nor NNSA modified their existing prime contracts to incorporate specific defense procurement requirements because such modifications would be inappropriate, costly, and inefficient. In short, they informed us that the Department had developed and implemented a series of controls designed to monitor overall contractor performance, including WFO technical projects. Department and NNSA officials noted, however, that they were willing to incorporate DoD specific requirements into work orders should DoD request and fund such efforts. Additional details regarding management of WFO technical projects are discussed in the body of this report.

  19. Conversion of Russian Defense Enterprises to the production of rechargeable batteries and battery packs. Volume 1. Export trade information

    SciTech Connect (OSTI)

    1996-06-01

    This report, prepared by E-Tech, Inc., was funded by the U.S. Trade and Development Agency on behalf of the International Integration Association of Moscow, Russia. It presents the results of a study which was conducted to assess the economic and technical feasibility of converting the facilities of three Russian defense enterprises to the production of rechargeable batteries and battery packs for sale to the Russian domestic market and to international commercial markets. The three issues that are addressed in the report include: (1) Whether or not a project of this nature can be successful in present-day Russia; (2) Are the Russian enterprises identified for this study are capable of executing the project; and (3) Whether a U.S. company with extensive battery manufacturing experience can carry out a project in Russia. The report is divided into the following sections: (1) Executive Summary; (2) Introduction; (3) Background; (4) Technical Overview; (5) Market Overview; (6) Project Description; (7) Socioeconomic Benefits; (8) Legal Structure; (9) Appendices.

  20. VERIFICATION OF THE DEFENSE WASTE PROCESSING FACILITY'S (DWPF) PROCESS DIGESTION METHOD FOR THE SLUDGE BATCH 7A QUALIFICATION SAMPLE

    SciTech Connect (OSTI)

    Click, D.; Edwards, T.; Jones, M.; Wiedenman, B.

    2011-03-14

    For each sludge batch that is processed in the Defense Waste Processing Facility (DWPF), the Savannah River National Laboratory (SRNL) performs confirmation of the applicability of the digestion method to be used by the DWPF lab for elemental analysis of Sludge Receipt and Adjustment Tank (SRAT) receipt samples and SRAT product process control samples. DWPF SRAT samples are typically dissolved using a room temperature HF-HNO{sub 3} acid dissolution (i.e., DWPF Cold Chem Method, see DWPF Procedure SW4-15.201) and then analyzed by inductively coupled plasma - atomic emission spectroscopy (ICP-AES). This report contains the results and comparison of data generated from performing the Aqua Regia (AR), Sodium peroxide/Hydroxide Fusion (PF) and DWPF Cold Chem (CC) method digestions of Sludge Batch 7a (SB7a) SRAT Receipt and SB7a SRAT Product samples. The SB7a SRAT Receipt and SB7a SRAT Product samples were prepared in the SRNL Shielded Cells, and the SRAT Receipt material is representative of the sludge that constituates the SB7a Batch or qualification composition. This is the sludge in Tank 51 that is to be transferred into Tank 40, which will contain the heel of Sludge Batch 6 (SB6), to form the Sb7a Blend composition.

  1. RECENT PROCESS AND EQUIPMENT IMPROVEMENTS TO INCREASE HIGH LEVEL WASTE THROUGHPUT AT THE DEFENSE WASTE PROCESSING FACILITY

    SciTech Connect (OSTI)

    Odriscoll, R; Allan Barnes, A; Jim Coleman, J; Timothy Glover, T; Robert Hopkins, R; Dan Iverson, D; Jeff Leita, J

    2008-01-15

    The Savannah River Site's (SRS) Defense Waste Processing Facility (DWPF) began stabilizing high level waste (HLW) in a glass matrix in 1996. Over the past few years, there have been several process and equipment improvements at the DWPF to increase the rate at which the high level waste can be stabilized. These improvements have either directly increased waste processing rates or have desensitized the process to upsets, thereby minimizing downtime and increasing production. Improvements due to optimization of waste throughput with increased HLW loading of the glass resulted in a 6% waste throughput increase based upon operational efficiencies. Improvements in canister production include the pour spout heated bellows liner (5%), glass surge (siphon) protection software (2%), melter feed pump software logic change to prevent spurious interlocks of the feed pump with subsequent dilution of feed stock (2%) and optimization of the steam atomized scrubber (SAS) operation to minimize downtime (3%) for a total increase in canister production of 12%. A number of process recovery efforts have allowed continued operation. These include the off gas system pluggage and restoration, slurry mix evaporator (SME) tank repair and replacement, remote cleaning of melter top head center nozzle, remote melter internal inspection, SAS pump J-Tube recovery, inadvertent pour scenario resolutions, dome heater transformer bus bar cooling water leak repair and new Infra-red camera for determination of glass height in the canister are discussed.

  2. Characterization of the Defense Waste Processing Facility (DWPF) Environmental Assessment (EA) glass Standard Reference Material. Revision 1

    SciTech Connect (OSTI)

    Jantzen, C.M.; Bibler, N.E.; Beam, D.C.; Crawford, C.L.; Pickett, M.A.

    1993-06-01

    Liquid high-level nuclear waste at the Savannah River Site (SRS) will be immobilized by vitrification in borosilicate glass. The glass will be produced and poured into stainless steel canisters in the Defense Waste Processing Facility (DWPF). Other waste form producers, such as West Valley Nuclear Services (WVNS) and the Hanford Waste Vitrification Project (HWVP), will also immobilize high-level radioactive waste in borosilicate glass. The canistered waste will be stored temporarily at each facility for eventual permanent disposal in a geologic repository. The Department of Energy has defined a set of requirements for the canistered waste forms, the Waste Acceptance Product Specifications (WAPS). The current Waste Acceptance Primary Specification (WAPS) 1.3, the product consistency specification, requires the waste form producers to demonstrate control of the consistency of the final waste form using a crushed glass durability test, the Product Consistency Test (PCI). In order to be acceptable, a waste glass must be more durable during PCT analysis than the waste glass identified in the DWPF Environmental Assessment (EA). In order to supply all the waste form producers with the same standard benchmark glass, 1000 pounds of the EA glass was fabricated. The chemical analyses and characterization of the benchmark EA glass are reported. This material is now available to act as a durability and/or redox Standard Reference Material (SRM) for all waste form producers.

  3. The development of coal-based technologies for Department of Defense facilities: Phase 1 final report. Volume 1: Technical report

    SciTech Connect (OSTI)

    Miller, B.G.; Morrison, J.L.; Pisupati, S.V. [Pennsylvania State Univ., University Park, PA (United States). Energy and Fuels Research Center] [and others

    1997-01-31

    The first phase of a three-phase project investigating the development of coal-based technologies for Department of Defense facilities has been completed. The objectives of the project are to: decrease DOD`s dependence on foreign oil and increase its use of coal; promote public and private sector deployment of technologies for utilizing coal-based fuels in oil-designed combustion equipment; and provide a continuing environment for research and development of coal-based fuel technologies for small-scale applications at a time when market conditions in the US are not favorable for the introduction of coal-fired equipment in the commercial and industrial capacity ranges. The Phase 1 activities were focused on developing clean, coal-based combustion technologies for the utilization of both micronized coal-water mixtures (MCWMs) and dry, micronized coal (DMC) in fuel oil-designed industrial boilers. The specific objective in Phase 1 was to deliver fully engineered retrofit options for a fuel oil-designed watertube boiler located on a DOD installation to fire either MCWM or DMC. This was achieved through a project consisting of fundamental, pilot-sale, and demonstration-scale activities investigating coal beneficiation and preparation, and MCWM and DMC combustion performance. In addition, detailed engineering designs and an economic analysis were conducted for a boiler located at the Naval Surface Warfare Center, near Crane, Indiana. Results are reported on MCWM and DMC combustion performance evaluation; engineering design; and cost/economic analysis.

  4. The development of coal-based technologies for Department of Defense facilities. Technical progress report, September 1995 - March 1996

    SciTech Connect (OSTI)

    Miller, B.G.; Pisupati, S.V.; Scaroni, A.W. [and others

    1996-10-01

    The U.S. Department of Defense (DOD), through an Interagency Agreement with the U.S. Department of Energy (DOE), has initiated a three-phase program with the Consortium for Coal-Water Slurry Fuel Technology, with the aim of decreasing DOD`s reliance on imported oil by increasing its use of coal. The program is being conducted as a cooperative agreement between the Consortium and DOE. Activities this reporting period are summarized by phase. During this reporting period, the Phase I final report was completed. Work in Phase II focused on emissions reductions, coal beneficiation/preparation studies, and economic analyses of coal use. Emissions reductions investigations included completing a study to identify appropriate SO{sub 2} and NO{sub x} control technologies for coal-fired industrial boilers. In addition, work continued on the design of a ceramic filtering device for installation on the demonstration boiler. The ceramic filtering device will be used to demonstrate a smaller and more efficient filtering device for retrofit applications. Work related to coal preparation and utilization, and the economic analysis was primarily focused on preparing the final report. Work in Phase III focused on coal preparation studies and economic analyses of coal use. Coal preparation studies were focused on continuing activities on particle size control, physical separations, surface-based separation processes, and dry processing. The economic study focused on community sensitivity to coal usage, regional economic impacts of new coal utilization technologies, and constructing a national energy portfolio.

  5. EIS-0074: Long-Term Management of Defense High-Level Radioactive Wastes Idaho Chemical Processing Plant, Idaho National Engineering Lab, Idaho

    Broader source: Energy.gov [DOE]

    The U.S. Department of Energy prepared this statement to analyze the environmental implications of the proposed selection of a strategy for long-term management of the high-level radioactive wastes generated as part of the national defense effort at the Department's Idaho Chemical Processing Plant at the Idaho National Engineering Laboratory. The project was cancelled after the Draft Environmental Impact Statement was produced.

  6. CRAD, Assessment Criteria and Guidelines for Determining the Adequacy of Software Used in the Safety Analysis and Design of Defense Nuclear Facilities

    Broader source: Energy.gov [DOE]

    These guidelines and criteria provide a consistent overall framework for assessment of the processes that are currently in place to ensure that the software being used in the safety analysis and design of the SSCs in defense nuclear facilities is adequate. These reviews will be conducted only on software that is currently in use, not on software that was previously used as part of a safety analysis and design process.

  7. A review of "Self-Defense and Religious Strife in Early Modern Europe. England and Germany 1530-1630." by Robert von Friedeburg 

    E-Print Network [OSTI]

    Paul M. Dover

    2006-01-01

    of self- defense. He endeavors to show how in the religio-political quarrels of En- gland and Scotland from the Marian period through the seventeenth century, writers on the topic looked to the historical example of Germany, drawing upon the political.... Marian exiles and Scottish Presbyterians nonetheless sought to apply German examples to Anglo-Scot- tish circumstances. The writings of David Pareus, Johannes Althusius and Henning Arnisaeus, in particular, were mined by English writers; Friedeburg?s...

  8. Gray, W. D. (2003). Cognitive factors in homeland defense: The role of human factors in the novel intelligence from massive data (NIMD) project, Human Factors and Ergonomics Society (pp. 1017-1018). Santa Monica, CA: Human

    E-Print Network [OSTI]

    Gray, Wayne

    2003-01-01

    intelligence from massive data (NIMD) project, Human Factors and Ergonomics Society (pp. 1017-1018). Santa Monica, CA: Human Factors and Ergonomics Society. COGNITIVE FACTORS IN HOMELAND DEFENSE: THE ROLE

  9. Java Defensive Optimization

    E-Print Network [OSTI]

    Wang, Haoqing

    2015-01-01

    Sympo- sium on Software Testing and Analysis, ISSTA ’07,International Symposium on Software Testing and Analysis,

  10. Java Defensive Optimization

    E-Print Network [OSTI]

    Wang, Haoqing

    2015-01-01

    Optimization . . . . . . . . . . . . . . . . .annotation optimization . . . . . . . . . . . . . . . . .Opt. is the time after optimization. Anno- phos is the time

  11. Java Defensive Optimization

    E-Print Network [OSTI]

    Wang, Haoqing

    2015-01-01

    Proceedings of the 14th ACM SIGPLAN International ConferenceICFP ’09, pages 161–172, New York, NY, USA, 2009. ACM.In Proceedings of the 2Nd ACM SIGPLAN International Workshop

  12. second line of defense

    National Nuclear Security Administration (NNSA)

    %2A en Office of Nuclear Warhead Protection http:www.nnsa.energy.govaboutusourprogramsnonproliferationprogramofficesinternationalmaterialprotectionandcooperation-0

  13. Java Defensive Optimization

    E-Print Network [OSTI]

    Wang, Haoqing

    2015-01-01

    optimization with the new Java 8 feature: type annotation.12] is an extension of Java type system and can be used withon State Of the Art in Java Program Analysis, SOAP ’13,

  14. Notices DEPARTMENT OF DEFENSE

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOEDepartmentNew JerseyEnergybenefits of6 Federal93794594879,

  15. defense nuclear security

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4) August 20123/%2A en46A NAME6/%2A encore3/%2A en

  16. department of defense

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4) August 20123/%2A en46A NAME6/%2A encore3/%2A en9/%2A|9

  17. second line of defense

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4) August 20123/%2Anational lab | National0/%2A en/%2A en

  18. Office of Defense Programs

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4) August 2012 Guidance/%2A0348Diversity in theAPAC

  19. Protections = Defenses in Depth

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) by Carbon-Rich MatricesstudentsProjectsProperty -Protected pageAbout

  20. Role of Nrf2 antioxidant defense in mitigating cadmium-induced oxidative stress in the olfactory system of zebrafish

    SciTech Connect (OSTI)

    Wang, Lu; Gallagher, Evan P.

    2013-01-15

    Exposure to trace metals can disrupt olfactory function in fish leading to a loss of behaviors critical to survival. Cadmium (Cd) is an olfactory toxicant that elicits cellular oxidative stress as a mechanism of toxicity while also inducing protective cellular antioxidant genes via activation of the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathway. However, the molecular mechanisms of Cd-induced olfactory injury have not been characterized. In the present study, we investigated the role of the Nrf2-mediated antioxidant defense pathway in protecting against Cd-induced olfactory injury in zebrafish. A dose-dependent induction of Nrf2-regulated antioxidant genes associated with cellular responses to oxidative stress was observed in the olfactory system of adult zebrafish following 24 h Cd exposure. Zebrafish larvae exposed to Cd for 3 h showed increased glutathione S-transferase pi (gst pi), glutamate–cysteine ligase catalytic subunit (gclc), heme oxygenase 1 (hmox1) and peroxiredoxin 1 (prdx1) mRNA levels indicative of Nrf2 activation, and which were blocked by morpholino-mediated Nrf2 knockdown. The inhibition of antioxidant gene induction in Cd-exposed Nrf2 morphants was associated with disruption of olfactory driven behaviors, increased cell death and loss of olfactory sensory neurons (OSNs). Nrf2 morphants also exhibited a downregulation of OSN-specific genes after Cd exposure. Pre-incubation of embryos with sulforaphane (SFN) partially protected against Cd-induced olfactory tissue damage. Collectively, our results indicate that oxidative stress is an important mechanism of Cd-mediated injury in the zebrafish olfactory system. Moreover, the Nrf2 pathway plays a protective role against cellular oxidative damage and is important in maintaining zebrafish olfactory function. -- Highlights: ? Oxidative stress is an important mechanism of Cd-mediated olfactory injury. ? Cd induces antioxidant gene expression in the zebrafish olfactory system. ? The olfactory antioxidant response is blocked by Nrf2 knockdown. ? Disruption of olfactory neurobehaviors is associated with Nrf2 knockdown. ? Nrf2 morphants show increased cell death and olfactory sensory neuron loss.

  1. Contemporary Terrorist Organizations and the Threat to Michael Walzer’s Defense of a Supreme Emergency Exemption from Jus in Bello 

    E-Print Network [OSTI]

    Ellis, Thomas H.

    2010-10-12

    of Britain during that period in order to construct his defense. The specific action in question is the decision by British leaders to engage in an area bombing campaign of German cities in which civilians were the primary victims of attack. This decision.... The example that Walzer uses as his sole paradigm case of a justified appeal to ?supreme emergency? is the decision by Britain during World War II to utilize 13 indiscriminate bombing of German cities as an offensive weapon. I will examine this example...

  2. The development of coal-based technologies for Department of Defense facilities. Semiannual technical progress report, March 28, 1994--September 27, 1994

    SciTech Connect (OSTI)

    Miller, B.G.; Bartley, D.A.; Morrison, J.L. [and others

    1995-04-14

    The US Department of Defense (DOD), through an Interagency Agreement with the US Department of Energy (DOE), has initiated a three-phase program with the Consortium for Coal Water Slurry Fuel Technology, with the aim of decreasing DOD`s reliance on imported oil by increasing its use of coal. The program is being conducted as a cooperative agreement between the Consortium and DOE and the first two phases of the program are underway. Activities this reporting period included performing coal beneficiation/preparation studies, conducting combustion performance evaluations, preparing retrofit engineering designs, determining retrofit economics, and installing a micronized coal-water mixture (MCWM) circuit.

  3. Environmental evaluation of alternatives for long-term management of Defense high-level radioactive wastes at the Idaho Chemical Processing Plant

    SciTech Connect (OSTI)

    Not Available

    1982-09-01

    The U.S. Department of Energy (DOE) is considering the selection of a strategy for the long-term management of the defense high-level wastes at the Idaho Chemical Processing Plant (ICPP). This report describes the environmental impacts of alternative strategies. These alternative strategies include leaving the calcine in its present form at the Idaho National Engineering Laboratory (INEL), or retrieving and modifying the calcine to a more durable waste form and disposing of it either at the INEL or in an offsite repository. This report addresses only the alternatives for a program to manage the high-level waste generated at the ICPP. 24 figures, 60 tables.

  4. Program Management at the National Nuclear Security Administration Office of Defense Nuclear Security: A Review of Program Management Documents and Underlying Processes

    SciTech Connect (OSTI)

    Madden, Michael S.

    2010-05-01

    The scope of this paper is to review the National Nuclear Security Administration Office of Defense Nuclear Security (DNS) program management documents and to examine the underlying processes. The purpose is to identify recommendations for improvement and to influence the rewrite of the DNS Program Management Plan (PMP) and the documentation supporting it. As a part of this process, over 40 documents required by DNS or its stakeholders were reviewed. In addition, approximately 12 other documents produced outside of DNS and its stakeholders were reviewed in an effort to identify best practices. The complete list of documents reviewed is provided as an attachment to this paper.

  5. PAPER STUDY EVALUATIONS OF THE INTRODUCTION OF SMALL COLUMN ION EXCHANGE WASTE STREAMS TO THE DEFENSE WASTE PROCESSING FACILITY

    SciTech Connect (OSTI)

    Fox, K.; Edwards, T.; Stone, M.; Koopman, D.

    2010-06-29

    The objective of this paper study is to provide guidance on the impact of Monosodium Titanate (MST) and Crystalline Silicotitanate (CST) streams from the Small Column Ion Exchange (SCIX) process on the Defense Waste Processing Facility (DWPF) flowsheet and glass waste form. A series of waste processing scenarios was evaluated, including projected compositions of Sludge Batches 8 through 17 (SB8 through SB17), MST additions, CST additions to Tank 40 or to a sludge batch preparation tank (Tank 42 or Tank 51, referred to generically as Tank 51 in this report), streams from the Salt Waste Processing Facility (SWPF), and two canister production rates. A wide array of potential glass frit compositions was used to support this assessment. The sludge and frit combinations were evaluated using the predictive models in the current DWPF Product Composition Control System (PCCS). The results were evaluated based on the number of frit compositions available for a particular sludge composition scenario. A large number of candidate frit compositions (e.g., several dozen to several hundred) is typically a good indicator of a sludge composition for which there is flexibility in forming an acceptable waste glass and meeting canister production rate commitments. The MST and CST streams will significantly increase the concentrations of certain components in glass, such as Nb{sub 2}O{sub 5}, TiO{sub 2}, and ZrO{sub 2}, to levels much higher than have been previously processed at DWPF. Therefore, several important assumptions, described in detail in the report, had to be made in performing the evaluations. The results of the paper studies, which must be applied carefully given the assumptions made concerning the impact of higher Ti, Zr, and Nb concentrations on model validity, provided several observations: (1) There was difficulty in identifying a reasonable number of candidate frits (and in some cases an inability to identify any candidate frits) when a waste loading of 40% is targeted for Sludge Batches 8, 16, and 17, regardless of the addition of SCIX or SWPF streams. This indicates that the blending strategy for these sludge batches should be reevaluated by Savannah River Remediation (SRR). (2) In general, candidate frits were available to accommodate CST additions to either Tank 40 or Tank 51. A larger number of candidate frits were typically available for the sludge batches when CST is added to Tank 51 rather than Tank 40, meaning that more compositional flexibility would be available for frit selection and DWPF operation. Note however that for SB8 and SB17, no candidate frits were available to accommodate CST going to Tank 40 with and without SWPF streams. The addition of SWPF streams generally improves the number of candidate frits available for processing of a given sludge batch. (3) The change in production rate from 40 Sludge Receipt and Adjustment Tank (SRAT) batches per year (i.e., the current production rate) to 75 SRAT batches per year, without SWPF streams included, had varied results in terms of the number of candidate frits available for processing of a given sludge batch. Therefore, this variable is not of much concern in terms of incorporating the SCIX streams. Note that the evaluation at 75 SRAT batches per year (approximately equivalent to 325 canisters per year) is more conservative in terms of the impact of SCIX streams as compared to a production rate of 400 canisters per year. Overall, the outcome of this paper study shows no major issues with the ability to identify an acceptable glass processing window when CST from the SCIX process is transferred to either Tank 40 or Tank 51. The assumptions used and the model limitations identified in this report must be addressed through further experimental studies, which are currently being performed. As changes occur to the planned additions of MST and CST, or to the sludge batch preparation strategy, additional evaluations will be performed to determine the potential impacts. As stated above, the issues with Sludge Batches 8, 16, and 17 should be further evaluated by SRR. A

  6. U.S. Department of Energy Space and Defense Power Systems Program Ten-Year Strategic Plan, Volume 1 and Volume 2

    SciTech Connect (OSTI)

    Dwight, Carla

    2013-06-01

    The Department of Energy's Space and Defense Power Systems program provides a unique capability for supplying power systems that function in remote or hostile environments. This capability has been functioning since the early 1960s and counts the National Aeronautics and Space Administration as one of its most prominent customers. This enabling technology has assisted the exploration of our solar system including the planets Jupiter, Saturn, Mars, Neptune, and soon Pluto. This capability is one-of-kind in the world in terms of its experience (over five decades), breadth of power systems flown (over two dozen to date) and range of power levels (watts to hundreds of watts). This document describes the various components of that infrastructure, work scope, funding needs, and its strategic plans going forward.

  7. Electro-Mechanical Manipulator for Use in the Remote Equipment Decontamination Cell at the Defense Waste Processing Facility, Savannah River Site - 12454

    SciTech Connect (OSTI)

    Lambrecht, Bill; Dixon, Joe [Par Systems, Shoreview, Minnesota, 55126 (United States); Neuville, John R. [Savannah River Remediation, Savannah River Site, Aiken, South Carolina, 29808 (United States)

    2012-07-01

    One of the legacies of the cold war is millions of liters of radioactive waste. One of the locations where this waste is stored is at the Savannah River Site (SRS) in South Carolina. A major effort to clean up this waste is on-going at the defense waste processing facility (DWPF) at SRS. A piece of this effort is decontamination of the equipment used in the DWPF to process the waste. The remote equipment decontamination cell (REDC) in the DWPF uses electro-mechanical manipulators (EMM) arms manufactured and supplied by PaR Systems to decontaminate DWPF process equipment. The decontamination fluid creates a highly corrosive environment. After 25 years of operational use the original EMM arms are aging and need replacement. To support continued operation of the DWPF, two direct replacement EMM arms were delivered to the REDC in the summer of 2011. (authors)

  8. The Emergency Response Network of the Great Lakes Regional Center of Excellence exists to provide aid during a bio-defense emergency related to emerging infectious diseases or an act of bioterrorism.

    E-Print Network [OSTI]

    Sherman, S. Murray

    The Emergency Response Network of the Great Lakes Regional Center of Excellence exists to provide aid during a bio- defense emergency related to emerging infectious diseases or an act of bioterrorism in the field of infectious disease and special pathogen treatment and research. The Emergency Response Network

  9. Mobile UPI | About UPI | UPI en Espaol | UPI Arabic | UPIU | My Account Search: Articles Type in your Search Term Go Defense Department Hamas-Fatah Royal Wedding Deadly storms Ullman: missions impossible

    E-Print Network [OSTI]

    Suslick, Kenneth S.

    in your Search Term Go Defense Department · Hamas-Fatah · Royal Wedding · Deadly storms · Ullman: missionsMobile UPI | About UPI | UPI en Español | UPI Arabic | UPIU | My Account Search: Articles Type 2010: Year in Review or see all Science News stories Join the conversation Enter comment here leave

  10. The development of coal-based technologies for Department of Defense facilities. Semiannual technical progress report, September 28, 1993--March 27, 1994

    SciTech Connect (OSTI)

    Miller, B.G.; Morrison, J.L.; Sharifi, R.; Shepard, J.F.; Scaroni, A.W.; Hogg, R.; Chander, S.; Cho, H.; Ityokumbul, M.T.; Klima, M.S.

    1994-11-30

    The U.S. Department of Defense (DOD), through an Interagency Agreement with the U.S. Department of Energy (DOE), has initiated a three-phase program with the Consortium for Coal-Water Slurry Fuel Technology, with the aim of decreasing DOD`s reliance on imported oil by increasing its use of coal. The program is being conducted as a cooperative agreement between the Consortium and DOE and the first two phases of the program are underway. To achieve the objectives of the program, a team of researchers was assembled. Phase I activities are focused on developing clean, coal-based combustion technologies for the utilization of both micronized coal-water slurry fuels (MCWSFS) and dry, micronized coal (DMC) in fuel oil-designed industrial boilers. Phase II research and development activities will continue to focus on industrial boiler retrofit technologies by addressing emissions control and precombustion (i.e., slagging combustion and/or gasification) strategies for the utilization of high ash, high sulfur coals. Phase III activities will examine coal-based fuel combustion systems that cofire wastes. Each phase includes an engineering cost analysis and technology assessment. The activities and status of Phases I and II are described below. The objective in Phase I is to deliver fully engineered retrofit options for a fuel oil-designed watertube boiler located on a DOD installation to fire either MCWSF or DMC. This will be achieved through a program consisting of the following five tasks: (1) Coal Beneficiation and Preparation; (2) Combustion Performance Evaluation; (3) Engineering Design; (4) Engineering and Economic Analysis; and (5) Final Report/Submission of Design Package.

  11. Final Hanford Offsite Waste Shipment Leaves Idaho Treatment Facility |

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelB IMSof 2005FAQS5 Summary ofRenewableEnergyCommitteeDepartment of

  12. DOE Seeks Trucking Services for Transuranic Waste Shipments ...

    Energy Savers [EERE]

    The TRU waste must be transported in Nuclear Regulatory Commission approved, Type-B packaging. The truck drivers must meet and maintain stringent safety and hazardous materials...

  13. SUPPLEMENT ANALYSIS PROPOSED SHIPMENT OF COMMERCIAL SPENT NUCLEAR...

    Energy Savers [EERE]

    Given that the transportation routes extend across much of the length of the Continental United States, the analysis in this SA assumes that the population along the...

  14. Moab Mill Tailings Removal Project Plans to Resume Train Shipments...

    Broader source: Energy.gov (indexed) [DOE]

    result in a cost savings to the project over the long term. Made of -inch durable plastic, the liners will prevent the tailings material, which tends to be sticky, from...

  15. Safety and Security Technologies for Radioactive Material Shipments

    Office of Environmental Management (EM)

    Technologies Study Emerging Technologies Continued 7. Nanopiezoelectronics. 8. Plastic thin-film organic solar cells. 9. Container integrity. Safety & Security Technologies...

  16. Evaluation of Shortline Railroads & SNF/HLW Rail Shipment Inspections...

    Office of Environmental Management (EM)

    INFORMATION NUMBER of GRADE CROSSINGS NUMBER of GRADE CROSSINGS ACTIVE ACTIVE - - PASSIVE PASSIVE - - Evaluation of Shortline Railroads Evaluation of Shortline Railroads...

  17. Evaluation of Shortline Railroads & SNF/HLW Rail Shipment Inspections...

    Office of Environmental Management (EM)

    the Transportation of Spent Nuclear Fuel Task: Identify Shortline Railroads Serving Nuclear Power Plants Establish Contact Information with Railroads Officials Field Review of each...

  18. Enhancements to System for Tracking Radioactive Waste Shipments...

    Energy Savers [EERE]

    the Waste Isolation Pilot Plant in New Mexico. | Photo courtesy of the National Museum of Nuclear Science & History National Museum of Nuclear Science & History Opens WIPP Exhibit...

  19. Requirements for shipment of DOE radioactive mixed waste

    SciTech Connect (OSTI)

    Gablin, K.; No, Hyo; Herman, J.

    1993-08-01

    There are several sources of radioactive mixed waste (RMW) at Argonne National Laboratory which, in the past, were collected at waste tanks and/or sludge tanks. They were eventually pumped out by special pumps and processed in an evaporator located in the waste operations area in Building No. 306. Some of this radioactive mixed waste represents pure elementary mercury. These cleaning tanks must be manually cleaned up because the RMW material was too dense to pump with the equipment in use. The four tanks being discussed in this report are located in Building No. 306. They are the Acid Waste Tank, IMOX/FLOC Tanks, Evaporation Feed Tanks, and Waste Storage Tanks. All of these tanks are characterized and handled separately. This paper discusses the process and the requirements for characterization and the associated paperwork for Argonne Waste to be shipped to Westinghouse Hanford Company for storage.

  20. SUPPLEMENT ANALYSIS PROPOSED SHIPMENT OF COMMERCIAL SPENT NUCLEAR FUEL

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematics AndBeryllium Disease |Records Management FieldSOLANA SOLANA SOLANA SOLANA-2020 STRATEGIC

  1. Enhancements to System for Tracking Radioactive Waste Shipments Benefit

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLfor Innovative SolarSavingsAugust 26,246April| DepartmentCalpineMultiple

  2. Final Transuranic Waste Shipment Leaves Rocky Flats | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRD Report to CongressApril 6,Final InformationDepartmentPage 1

  3. First Shipment of Compressors Leaves Portsmouth | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRD Report to CongressApril 6,Final9Reportjobs

  4. Microsoft Word - First LANL Shipment Arrives at WCS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OF PAGESpersonal CERTIFIED MAIL October«Customer5,5, 2012

  5. Los Alamos National Laboratory Accelerates Transuranic Waste Shipments:

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbineProcesses toDepartmentSpurred by a major

  6. Level: National Data; Row: Values of Shipments within NAICS Codes;

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963Residential Consumers (Number of33 2,297 809 245 1550473 Number Next3

  7. Level: National Data; Row: Values of Shipments within NAICS Codes;

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963Residential Consumers (Number of33 2,297 809 245 1550473 Number Next33

  8. Enhanced Driver Requirements for WIPP Shipments - Fact Sheet

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HABFES October 27th, 2010 ThanksProgram Offices EnergyCdSeEnglish. a

  9. Portsmouth, Paducah Project Leaps Past Shipment Milestone, Delivering

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills andOrder 422.1,anEnergy CompanyEnergyPortsmouth Portsmouth

  10. Rocky Flats 100th Shipments Arrives at WIPP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust, High-Throughput Analysis of Protein Structures Print Scientists have developedSo

  11. Packaging and Transportation for Offsite Shipment of Materials of National

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass mapSpeeding access| Department ofStephen PSeptember 30, 2014 City ofCubic

  12. Removing nuclear waste, one shipment at a time

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners *ReindustrializationEnergy RemoteNanostructures - EnergyRemoving

  13. Milestone Shipment Arrives at WIPP | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOE SafetyofDepartment. "NationalTechnology | Department

  14. Moab Resumes Rail Shipments After Rockslide | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOE SafetyofDepartment.Efficiency Rebate

  15. ( Sample of Shipment Notice) Federal Records Center | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s s i s t a n t S e c r e t1(TRIDEC)Wind turbinesThis

  16. Idaho Site Achieves Successful Nuclear Shipment on Newly Constructed Haul

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12,ExecutiveFinancingR Walls21,Equipment:PetroleumDepartment of Energy0ofRoad

  17. WIPP Receives First Shipment | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *4 o**ColoradoDOE Awards4500 th

  18. Portsmouth Site Delivers First Radioactive Waste Shipment to Disposal

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuilding energyDepartment of Energy Portsmouth ScienceFacility in

  19. The Security Afforded Selected Tritium Reservoir Shipments (U), IG-0619

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCEDInstallers/ContractorsPhotovoltaicsState of Pennsylvania

  20. Los Alamos National Laboratory celebrates 1000th transuranic waste shipment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCenter (LMI-EFRC)LodgingSchool »development,LANL celebrates

  1. Los Alamos National Laboratory resumes transuranic waste shipments

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillion to local United WaySixLANL remembers former

  2. Waste Shipment Tracking Technology Lowers Costs, Increases Efficiency |

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996HowFOAShowingFuel EfficiencyWashington , DC 20585 AprilWaste

  3. SR-08-03 _LEU Shipments_.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) byMultidayAlumni > The2/01/12 Page 1 ofSuper1 THISSPOTApril

  4. Laboratory increases shipments of waste to WIPP repository

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousand CubicResourcelogo and masthead BerkeleySite IndexRear

  5. Defense Nuclear Facility Safety Board

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit theCovalent Bonding Low-Cost2 DOENERSCDecemberDeclarationHANFORD8, 2014

  6. Doctoral Defense "Sustainable Wastewater Management

    E-Print Network [OSTI]

    Kamat, Vineet R.

    and quantitative stability assessment was created and linked with an anaerobic digestion process model on wastewater treatment plant energy use. Anaerobic codigestion is an emerging practice used to increase energy

  7. In Defense of the Alien

    E-Print Network [OSTI]

    Sevilla, Charles M.

    1977-01-01

    for aiding entry of illegal aliens im- proper); cf. , UnitedCir. 1976) (entry occurs when alien scales border fence near9th, Cir. 1974) (juvenile aliens released over objection of

  8. In Defense Of Concrete Explanations

    E-Print Network [OSTI]

    Yavas, Mehmet

    1979-01-01

    In recent years we have witnessed conflicting proposals in the field of phonology with regard to descriptive and explanatory power of various theories. Especially significant is the controversy involving abstract versus concrete representations...

  9. Mobile Malware Propagation and Defense

    E-Print Network [OSTI]

    Zyba, Gjergji

    Cloner, the first personal computer virus that spread on thecomputer malware increasingly be- came a tool for for-profit illegal activities. Infected machines from viruses and

  10. MS Thesis Defense Rangika Perera

    E-Print Network [OSTI]

    almost entirely on local wood supply for raw materials. #12;There are over 9,000 furniture and other to medium scale export manufacturers can thrive on these opportunities. Design and quality of wood products's wood product manufacturing sector is characterized by low volume producers, inefficient production

  11. Input Validation Errors and Defenses

    E-Print Network [OSTI]

    Sekar, R.

    = "gpg -r $send_to_list 2>&1" popen($command) · Attack: user fills in the following information-independent policies are preferable Example: SquirrelMail Command Injection Incoming Request (Untrusted input) $command="gpg popen($command) $send_to_list = $_GET[`sendto'] $command = "gpg -r $send_to_list 2>&1" Outgoing Request

  12. MECHANICALENGINEERING M.S.DEFENSE

    E-Print Network [OSTI]

    Potential Imaging of Chemical Vapor Deposition Graphene by Electrical Force Microscopy Abstract: Recently the electrical properties of chemical vapor deposition graphene and micromechanical exfoliated graphene

  13. Defense Experimentation and Stockpile Stewardship

    SciTech Connect (OSTI)

    None

    2014-10-28

    A primary mission of the site is to help ensure that the nation's nuclear weapon stockpile remains safe, secure and reliable. The stockpile stewardship program, working with the national weapons laboratories conducts a wide range of experiments using advanced diagnostic technologies, many of which were developed right here at the NNSS.

  14. Department of Defense Programs | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Science and Systems Engineering Division, Nanosystems & Structures Automation, Robotics, and Manufacturing Materials Behavior and Processing, Processing and Joining Chemical...

  15. Defense Technical Information Center thesaurus

    SciTech Connect (OSTI)

    Dickert, J.H.

    1996-10-01

    This DTIC Thesaurus provides a basic multidisciplinary subject term vocabulary used by DTIC to index and retrieve scientific and technical information from its various data bases and to aid DTIC`s users in their information storage and retrieval operations. It includes an alphabetical posting term display, a hierarchy display, and a Keywork Out of Context (KWOC) display.

  16. Defense Experimentation and Stockpile Stewardship

    ScienceCinema (OSTI)

    None

    2015-01-07

    A primary mission of the site is to help ensure that the nation's nuclear weapon stockpile remains safe, secure and reliable. The stockpile stewardship program, working with the national weapons laboratories conducts a wide range of experiments using advanced diagnostic technologies, many of which were developed right here at the NNSS.

  17. Mobile Malware Propagation and Defense

    E-Print Network [OSTI]

    Zyba, Gjergji

    Privacy in Smartphones and Mobile Devices (SPSM), pages 3–directly by the mobile devices, and that this difference isMcA] McAfee. Securing Mobile Devices: Present and Future.

  18. A defense of theistic activism 

    E-Print Network [OSTI]

    Haugen, Christopher Allen

    2003-01-01

    theism and contemporary Platonism: they argue that abstract objects are immutable and necessarily existent, but that they are dependent on God for their existence. They have named the view "theistic activism." Brian Leftow argues against the viability...

  19. Listing of Defense Nuclear Facilities

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Plant Mound Facility Fernald Environmental Management Project Site Pantex Plant Rocky Flats Environmental Technology Site, including the Oxnard Facility Savannah River Site Los...

  20. Defense HLW Glass Degradation Model

    SciTech Connect (OSTI)

    D. Strachan

    2004-10-20

    The purpose of this report is to document the development of a model for calculating the release rate for radionuclides and other key elements from high-level radioactive waste (HLW) glasses under exposure conditions relevant to the performance of the repository. Several glass compositions are planned for the repository, some of which have yet to be identified (i.e., glasses from Hanford and Idaho National Engineering and Environmental Laboratory). The mechanism for glass dissolution is the same for these glasses and the glasses yet to be developed for the disposal of DOE wastes. All of these glasses will be of a quality consistent with the glasses used to develop this report.

  1. Mobile Malware Propagation and Defense

    E-Print Network [OSTI]

    Zyba, Gjergji

    systems. Personal and Ubiquitous Computing, 10(4):255–268,for Rout- ing in Ubiquitous Computing Environments. InConference on Ubiquitous Computing (UbiComp), pages 409–428,

  2. Office of Defense Nuclear Nonproliferation

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctober 2013 Pradeep/201215,

  3. defense | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4) August 20123/%2A en46A NAME6/%2A encore3/%2A en9/%2A|

  4. Office of Defense Nuclear Nonproliferation

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4) August 2012 Guidance/%2A0348Diversity in theAPAC w/HR8

  5. Listing of Defense Nuclear Facilities

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIALU.S.Leadership on CleanUpList of EERE Waivers in theSME3Listing

  6. Feasibility Evaluation and Retrofit Plan for Cold Crucible Induction Melter Deployment in the Defense Waste Processing Facility at Savannah River Site

    SciTech Connect (OSTI)

    Barnes, A.B. [Savannah River National Laboratory, Washington Savannah River Company, Aiken, SC (United States); Iverson, D.C.; Adkins, B.J. [Liquid Waste Operations, Washington Savannah River Company, Aiken, SC (United States); Tchemitcheff, E. [AREVA NC Inc., Richland Office, Richland, WA (United States)

    2008-07-01

    Cold crucible induction melters (CCIM) have been proposed as an alternative technology for waste glass melting at the Defense Waste Processing Facility (DWPF) at Savannah River Site (SRS) as well as for other waste vitrification facilities. Proponents of this technology cite high temperature operation, high tolerance for noble metals and aluminum, high waste loading, high throughput capacity, and low equipment cost as the advantages over existing Joule Heated Melter (JHM) technology. The CCIM uses induction heating to maintain molten glass at high temperature. A water-cooled helical induction coil is connected to an AC current supply, typically operating at frequencies from 100 kHz to 5 MHz. The oscillating magnetic field generated by the oscillating current flow through the coil induces eddy currents in conductive materials within the coil. Those oscillating eddy currents, in turn, generate heat in the material. In the CCIM, the induction coil surrounds a 'Cold Crucible' which is formed by metal tubes, typically copper or stainless steel. The tubes are constructed such that the magnetic field does not couple with the crucible. Therefore, the field generated by the induction coil couples primarily with the conductive medium (hot glass) within. The crucible tubes are water cooled to maintain their temperature between 100 deg. C to 200 deg. C so that a protective layer of molten glass and/or batch material, referred to as a 'skull', forms between them and the hot, corrosive melt. Because the protective skull is the only material directly in contact with the molten glass, the CCIM doesn't have the temperature limitations of traditional refractory lined JHM. It can be operated at melt temperatures in excess of 2000 deg. C, allowing processing of high waste loading batches and difficult-to-melt compounds. The CCIM is poured through a bottom drain, typically through a water-cooled slide valve that starts and stops the pour stream. To promote uniform temperature distribution and increase heat transfer to the slurry fed High Level Waste (HLW) sludge, the CCIM may be equipped with bubblers and/or water cooled mechanical agitators. The DWPF could benefit from use of CCIM technology, especially in light of our latest projections of waste volume to be vitrified. Increased waste loading and increased throughput could result in substantial life cycle cost reduction. In order to significantly surpass the waste throughput capability of the currently installed JHM, it may be necessary to install two 950 mm CCIMs in the DWPF Melt Cell. A cursory evaluation of system design requirements and modifications to the facility that may be required to support installation and operation of two 950 mm CCIMs was performed. Based on this evaluation, it appears technically feasible to position two CCIMs in the Melt Cell of the DWPF within the existing footprint of the current melter. Interfaces with support systems and controls including Melter Feed, Power, Melter Cooling Water, Melter Off-gas, and Canister Operations must be designed to support dual CCIM operations. This paper describes the CCIM technology and identifies technical challenges that must be addressed in order to implement CCIMs in the DWPF. (authors)

  7. FEASIBILITY EVALUATION AND RETROFIT PLAN FOR COLD CRUCIBLE INDUCTION MELTER DEPLOYMENT IN THE DEFENSE WASTE PROCESSING FACILITY AT SAVANNAH RIVER SITE 8118

    SciTech Connect (OSTI)

    Barnes, A; Dan Iverson, D; Brannen Adkins, B

    2008-02-06

    Cold crucible induction melters (CCIM) have been proposed as an alternative technology for waste glass melting at the Defense Waste Processing Facility (DWPF) at Savannah River Site (SRS) as well as for other waste vitrification facilities. Proponents of this technology cite high temperature operation, high tolerance for noble metals and aluminum, high waste loading, high throughput capacity, and low equipment cost as the advantages over existing Joule Heated Melter (JHM) technology. The CCIM uses induction heating to maintain molten glass at high temperature. A water-cooled helical induction coil is connected to an AC current supply, typically operating at frequencies from 100 KHz to 5 MHz. The oscillating magnetic field generated by the oscillating current flow through the coil induces eddy currents in conductive materials within the coil. Those oscillating eddy currents, in turn, generate heat in the material. In the CCIM, the induction coil surrounds a 'Cold Crucible' which is formed by metal tubes, typically copper or stainless steel. The tubes are constructed such that the magnetic field does not couple with the crucible. Therefore, the field generated by the induction coil couples primarily with the conductive medium (hot glass) within. The crucible tubes are water cooled to maintain their temperature between 100 C to 200 C so that a protective layer of molten glass and/or batch material, referred to as a 'skull', forms between them and the hot, corrosive melt. Because the protective skull is the only material directly in contact with the molten glass, the CCIM doesn't have the temperature limitations of traditional refractory lined JHM. It can be operated at melt temperatures in excess of 2000 C, allowing processing of high waste loading batches and difficult-to-melt compounds. The CCIM is poured through a bottom drain, typically through a water-cooled slide valve that starts and stops the pour stream. To promote uniform temperature distribution and increase heat transfer to the slurry fed High Level Waste (HLW) sludge, the CCIM may be equipped with bubblers and/or water cooled mechanical agitators. The DWPF could benefit from use of CCIM technology, especially in light of our latest projections of waste volume to be vitrified. Increased waste loading and increased throughput could result in substantial life cycle cost reduction. In order to significantly surpass the waste throughput capability of the currently installed JHM, it may be necessary to install two 950 mm CCIMs in the DWPF Melt Cell. A cursory evaluation of system design requirements and modifications to the facility that may be required to support installation and operation of two 950 mm CCIMs was performed. Based on this evaluation, it appears technically feasible to position two CCIMs in the Melt Cell of the DWPF within the existing footprint of the current melter. Interfaces with support systems and controls including Melter Feed, Power, Melter Cooling Water, Melter Off-gas, and Canister Operations must be designed to support dual CCIM operations. This paper describes the CCIM technology and identifies technical challenges that must be addressed in order to implement CCIMs in the DWPF.

  8. MODELING THE IMPACT OF ELEVATED MERCURY IN DEFENSE WASTE PROCESSING FACILITY MELTER FEED ON THE MELTER OFF-GAS SYSTEM - PRELIMINARY REPORT

    SciTech Connect (OSTI)

    Zamecnik, J.; Choi, A.

    2009-03-25

    The Defense Waste Processing Facility (DWPF) is currently evaluating an alternative Chemical Process Cell (CPC) flowsheet to increase throughput. It includes removal of the steam-stripping step, which would significantly reduce the CPC processing time and lessen the sampling needs. However, its downside would be to send 100% of the mercury that come in with the sludge straight to the melter. For example, the new mercury content in the Sludge Batch 5 (SB5) melter feed is projected to be 25 times higher than that in the SB4 with nominal steam stripping of mercury. This task was initiated to study the impact of the worst-case scenario of zero-mercury-removal in the CPC on the DWPF melter off-gas system. It is stressed that this study is intended to be scoping in nature, so the results presented in this report are preliminary. In order to study the impact of elevated mercury levels in the feed, it is necessary to be able to predict how mercury would speciate in the melter exhaust under varying melter operating conditions. A homogeneous gas-phase oxidation model of mercury by chloride was developed to do just that. The model contains two critical parameters pertaining to the partitioning of chloride among HCl, Cl, Cl{sub 2}, and chloride salts in the melter vapor space. The values for these parameters were determined at two different melter vapor space temperatures by matching the calculated molar ratio of HgCl (or Hg{sub 2}Cl{sub 2}) to HgCl{sub 2} with those measured during the Experimental-Scale Ceramic Melter (ESCM) tests run at the Pacific Northwest National Laboratory (PNNL). The calibrated model was then applied to the SB5 simulant used in the earlier flowsheet study with an assumed mercury stripping efficiency of zero; the molar ratio of Cl-to-Hg in the resulting melter feed was only 0.4, compared to 12 for the ESCM feeds. The results of the model run at the indicated melter vapor space temperature of 650 C (TI4085D) showed that due to excessive shortage of chloride, only 6% of the mercury fed is expected to get oxidized, mostly as HgCl, while the remaining mercury would exist either as elemental mercury vapor (90%) or HgO (4%). Noting that the measured chloride level in the SB5 qualification sample was an order of magnitude lower than that used in the SB5 simulant, the degree of chloride shortage will be even greater. As a result, the projected level of HgCl in the actual SB5 melter exhaust will be even lower than 6% of the total mercury fed, while that of elemental mercury is likely to be greater than 90%. The homogeneous oxidation of mercury in the off-gas was deemed to be of primary importance based on the postulation that mercury and other volatile salts form submicron sized aerosols upon condensation and thus remain largely in the gas stream downstream of the quencher where they can deposit in the off-gas lines, Steam-Atomized Scrubbers (SAS), and High-Efficiency Mist Eliminator (HEME). Formation of these submicron semi-volatile salts in the condensate liquid is considered to be unlikely, so the liquid phase reactions were considered to be less important. However, subsequent oxidation of mercury in the liquid phase in the off-gas system was examined in a simplified model of the off-gas condensate. It was found that the condensate chemistry was consistent with further oxidation of elemental mercury to Hg{sub 2}Cl{sub 2} and conversion of HgO to chlorides. The results were consistent with the available experimental data. It should also be noted that the model predictions presented in this report do not include any physically entrained solids, which typically account for much of the off-gas carryover on a mass basis. The high elemental mercury vapor content predicted at the DWPF Quencher inlet means that physically entrained solids could provide the necessary surface onto which elemental mercury vapor could condense, thereby coating the solids as well as the internal surfaces of the off-gas system with mercury. Clearly, there are many process benefits to be gained by removing the steam-stripping step from the CPC c

  9. MODELING THE IMPACT OF ELEVATED MERCURY IN DEFENSE WASTE PROCESSING FACILITY MELTER FEED ON THE MELTER OFF-GAS SYSTEM-PRELIMINARY REPORT

    SciTech Connect (OSTI)

    Zamecnik, J.; Choi, A.

    2010-08-18

    The Defense Waste Processing Facility (DWPF) is currently evaluating an alternative Chemical Process Cell (CPC) flowsheet to increase throughput. It includes removal of the steam-stripping step, which would significantly reduce the CPC processing time and lessen the sampling needs. However, its downside would be to send 100% of the mercury that comes in with the sludge straight to the melter. For example, the new mercury content in the Sludge Batch 5 (SB5) melter feed is projected to be 25 times higher than that in the SB4 with nominal steam stripping of mercury. This task was initiated to study the impact of the worst-case scenario of zero-mercury-removal in the CPC on the DWPF melter offgas system. It is stressed that this study is intended to be scoping in nature, so the results presented in this report are preliminary. In order to study the impact of elevated mercury levels in the feed, it is necessary to be able to predict how mercury would speciate in the melter exhaust under varying melter operating conditions. A homogeneous gas-phase oxidation model of mercury by chloride was developed to do just that. The model contains two critical parameters pertaining to the partitioning of chloride among HCl, Cl, Cl{sub 2}, and chloride salts in the melter vapor space. The values for these parameters were determined at two different melter vapor space temperatures by matching the calculated molar ratio of HgCl (or Hg{sub 2}Cl{sub 2}) to HgCl{sub 2} with those measured during the Experimental-Scale Ceramic Melter (ESCM) tests run at the Pacific Northwest National Laboratory (PNNL). The calibrated model was then applied to the SB5 simulant used in the earlier flowsheet study with an assumed mercury stripping efficiency of zero; the molar ratio of Cl-to-Hg in the resulting melter feed was only 0.4, compared to 12 for the ESCM feeds. The results of the model run at the indicated melter vapor space temperature of 650 C (TI4085D) showed that due to excessive shortage of chloride, only 6% of the mercury fed is expected to get oxidized, mostly as HgCl, while the remaining mercury would exist either as elemental mercury vapor (90%) or HgO (4%). Noting that the measured chloride level in the SB5 qualification sample was an order of magnitude lower than that used in the SB5 simulant, the degree of chloride shortage will be even greater. As a result, the projected level of HgCl in the actual SB5 melter exhaust will be even lower than 6% of the total mercury fed, while that of elemental mercury is likely to be greater than 90%. The homogeneous oxidation of mercury in the off-gas was deemed to be of primary importance based on the postulation that mercury and other volatile salts form submicron sized aerosols upon condensation and thus remain largely in the gas stream downstream of the quencher where they can deposit in the off-gas lines, Steam-Atomized Scrubbers (SAS), and High-Efficiency Mist Eliminator (HEME). Formation of these submicron semi-volatile salts in the condensate liquid is considered to be unlikely, so the liquid phase reactions were considered to be less important. However, subsequent oxidation of mercury in the liquid phase in the off-gas system was examined in a simplified model of the off-gas condensate. It was found that the condensate chemistry was consistent with further oxidation of elemental mercury to Hg{sub 2}Cl{sub 2} and conversion of HgO to chlorides. The results were consistent with the available experimental data. It should also be noted that the model predictions presented in this report do not include any physically entrained solids, which typically account for much of the off-gas carryover on a mass basis. The high elemental mercury vapor content predicted at the DWPF Quencher inlet means that physically entrained solids could provide the necessary surface onto which elemental mercury vapor could condense, thereby coating the solids as well as the internal surfaces of the off-gas system with mercury. Clearly, there are many process benefits to be gained by removing the steam-stripping step from the CPC c

  10. 2008 Solar Technologies Market Report

    E-Print Network [OSTI]

    Price, S.

    2010-01-01

    P. (2009). Photovoltaic Manufacturer Shipments, Capacity, &P. (2009). Photovoltaic Manufacturer Shipments, Capacity, &P. (2009). Photovoltaic Manufacturer Shipments, Capacity, &

  11. Doctoral Thesis Defense Speaker: Christine Houry Kehyayan

    E-Print Network [OSTI]

    Doedel, Eusebius

    :00 Place: EV 1.162 ABSTRACT With the rapid development of genome sequencing technologies, complete genomes experimentally characterized enzymes from fungal genomes in the mycoCLAP database. Our study shows that the MCLAPhy, a novel approach for clustering proteins by leveraging the global context of complete genomes

  12. DEPARTMENT OF DEFENSE GENERAL SERVICES ADMINISTRATION NATIONAL...

    Broader source: Energy.gov (indexed) [DOE]

    inputting "FAR Case 2008-039" under the heading "Enter Keyword or ID" and selecting "Search". Select the link "Submit a Comment" that corresponds with "FAR Case 2008-039". Follow...

  13. Office of Defense Nuclear Nonproliferation | National Nuclear...

    National Nuclear Security Administration (NNSA)

    National Nuclear Security Administration (DOENNSA) and the U.K. Department of Energy and Climate Change concluded a workshop at Wilton Park, About This Site Budget IG Web Policy...

  14. SOIL, WATER, AND CLIMATE MS DEFENSE SEMINAR

    E-Print Network [OSTI]

    Minnesota, University of

    the rising concentration of atmospheric carbon dioxide (CO2) has fueled many research pursuits to better2 Production in the Upper Midwest Using Satellite Remote Sensing Technology by Jennifer Corcoran, such as the trace gas observatory (TGO) in Rosemount, MN, increase our understanding of the carbon sequestration

  15. MILITARY TECHNOLOGY, WEAPONRY, AND NATIONAL DEFENSE; NUCLEAR...

    Office of Scientific and Technical Information (OSTI)

    CONTAINERS; MATERIALS HANDLING EQUIPMENT The Weapon Container Catalog describes H-gear (shipping and storage containers, bomb hand trucks and the ancillary equipment required...

  16. Economics of Defense in a Globalized World

    E-Print Network [OSTI]

    MCGUIRE, MARTIN C

    2006-01-01

    Kahn, H. (1959), On Thermonuclear War (Princeton Universityless grave than thermonuclear annihilation. That is, anfrom the threat of thermonuclear war deserves emphasis. Even

  17. A defense of Deleuze's interpretation of Nietzsche 

    E-Print Network [OSTI]

    Stagoll, Clifford Scott

    1995-01-01

    Publication of Gilles Deleuze's interpretative text Nietzsche and Philosophy was accompanied by a resurgence of interest in the work of Friedrich Nietzsche, and its themes were taken up by "New Nietzscheans" such as Foucault and Lyotard...

  18. Cloud structures from defense meteorological satellite data 

    E-Print Network [OSTI]

    Phillips, John Frederick

    1975-01-01

    McAlester, OK OKC Oklahoma City, OK PNC Ponca City, OK PNX Perrin AFB, TX SPS Sheppard AFB, TX TUL Tulsa, OK CHA? 6 aR I INTRODUCTORY RE~ In -arly 1947, at Nhite Sands I'roving Ground, New Mexico, techni- cians mounted a camera on a captured... meteorological tool, Crowson may not have been aware of a report issued in 1946 by Project RAND arguing strongly in favor of developing an Earth orbiting satel- lite, "both as a scientific tool and for it's psychological impact on 6 ' 9' ' 1 1' 6" IG1 1 19699...

  19. Defense Board Recommendation 2014-1

    Broader source: Energy.gov [DOE]

    Presenter: William Froh, Fire Protection Engineer, NNSA Associate Administrator for Emergency Operations (NA?41)

  20. Scanning the Technology Energy Infrastructure Defense Systems

    E-Print Network [OSTI]

    Amin, S. Massoud

    -free electricity; banking and finance depends on the robustness of electric power, cable, and wireless infrastructures and increased demand for high-quality and reliable electricity for our digital economy is becoming, and algorithmic develop- ments. Keywords--Critical infrastructure protection, electric power grid, emergency

  1. Spam Value Chain : : Defensive Intervention Analysis

    E-Print Network [OSTI]

    Pitsillidis, Andreas

    2013-01-01

    Russia After selecting an item to purchase and clicking on “Checkout”, the store- front redirects the user to a payment portal

  2. Master Thesis Defense Speaker: Hossein Afshar Fotouhi

    E-Print Network [OSTI]

    Doedel, Eusebius

    -based Static Content Date: Wednesday, April 25, 2012 Time: 10:00 Place: EV 3.309 ABSTRACT Web development is an essential aspect of today's internet services. A web page is normally designed by means of HyperText Markup Language (HTML) as the web publishing language. Designing an HTML-based web-page can be done in various

  3. QER- Comment of National Resource Defense Council

    Broader source: Energy.gov [DOE]

    Please accept this paper as a comment into the QER record on siting energy and transmission resources.

  4. Master Thesis Defense Speaker: Shridhar Mohandoss

    E-Print Network [OSTI]

    Doedel, Eusebius

    .309 ABSTRACT Three dimensional models (3D) are becoming popular due to different fields like 3D printing, games

  5. Materials Science and Engineering Thesis Defense

    E-Print Network [OSTI]

    in organic solar cells with or without TiOx interlayer. The current-voltage characteristics were also tested 317 Enhanced Performance in Quantum Dot Solar Cell with TiOx and N2 Doped TiOx Interlayers Jialin Yu Advisor: G.E. Jabbour, T.L. Alford Abstract As the 3rd generation solar cell, quantum dot solar cells

  6. Analysis and Defense of Emerging Malware Attacks 

    E-Print Network [OSTI]

    Xu, Zhaoyan

    2014-05-28

    to perform effectively and efficiently targeted malware analysis. Second, this dissertation studies a new trend of massive malware intrusion and proposes a new protection scheme to proactively defend malware attack. Lastly, our focus is new P2P malware. We...

  7. Power Grid Defense Against Malicious Cascading Failure

    E-Print Network [OSTI]

    Shakarian, Paulo; Lindelauf, Roy

    2014-01-01

    An adversary looking to disrupt a power grid may look to target certain substations and sources of power generation to initiate a cascading failure that maximizes the number of customers without electricity. This is particularly an important concern when the enemy has the capability to launch cyber-attacks as practical concerns (i.e. avoiding disruption of service, presence of legacy systems, etc.) may hinder security. Hence, a defender can harden the security posture at certain power stations but may lack the time and resources to do this for the entire power grid. We model a power grid as a graph and introduce the cascading failure game in which both the defender and attacker choose a subset of power stations such as to minimize (maximize) the number of consumers having access to producers of power. We formalize problems for identifying both mixed and deterministic strategies for both players, prove complexity results under a variety of different scenarios, identify tractable cases, and develop algorithms f...

  8. Security & Defense Licenses Available | Tech Transfer | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Imaging 201303150 Quantum-Authenticated Clock Signal 201303163 Extreme Filter for Low-Output Thermocouples in High EMI Environments 201403251 Tritium Stripping from FLiBe...

  9. 17.460 Defense Politics, Fall 2002

    E-Print Network [OSTI]

    Sapolsky, Harvey M.

    This course focuses on the institutional relationships that affect the raising, maintenance and use of military forces in the United States. It is about civil/military, government/industry, military/science and military ...

  10. Attack, Defense and Contagion in Networks

    E-Print Network [OSTI]

    Goyal, Sanjeev; Vigier, Adrien

    2014-07-30

    maximize value. The presence of contagious threats reinforces this pressure and the empty network remains optimal. There is, however, a range of possible alternatives between concave and convex network value functions. In particular, in some settings...

  11. Plant Defense Signaling Mechanisms and Evolution 

    E-Print Network [OSTI]

    Jiang, Shan

    2015-08-13

    for two Salk lines. The positions of RT-PCR primers are labeled with arrows. (B) Genotyping and RT-PCR detection of ASR3 expression in Salk lines. PCR was carried out with genomic DNA or cDNA using either the full-length or RT-PCR primers as indicated... modifications and charge. 7 Supplemental Table 2. Primers used in this study. Cloning and mutation primers Gene Forward primer Reverse primer ASR3 CGGGATCCATGGCTCTGGAACAGTTAGG GAAGGCCTCATCTTATCCGCGATTT TTG ProASR3...

  12. Classes of defense for computer systems

    E-Print Network [OSTI]

    Wolff, Josephine Charlotte Paulina

    2015-01-01

    Computer security incidents often involve attackers acquiring a complex sequence of escalating capabilities and executing those capabilities across a range of different intermediary actors in order to achieve their ultimate ...

  13. Serious games for improved defense contracting

    E-Print Network [OSTI]

    Guinto, Roi John

    2014-01-01

    Gaming has been explored as a research technique in complex systems to explore human interactions within technical domains. These so-called "serious games" are designed for purposes outside of pure entertainment and are ...

  14. Second Line of Defense Master Spares Catalog

    SciTech Connect (OSTI)

    Henderson, Dale L.; Muller, George; Mercier, Theresa M.; Brigantic, Robert T.; Perkins, Casey J.; Cooley, Scott K.

    2012-11-20

    This catalog is intended to be a comprehensive listing of repair parts, components, kits, and consumable items used on the equipment deployed at SLD sites worldwide. The catalog covers detection, CAS, network, ancillary equipment, and tools. The catalog is backed by a Master Parts Database which is used to generate the standard report views of the catalog. The master parts database is a relational database containing a record for every part in the master parts catalog along with supporting tables for normalizing fields in the records. The database also includes supporting queries, database maintenance forms, and reports.

  15. Environmental Defense Fund | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, AlabamaETEC GmbH JumpEllenville, NewLtdEnergypediaEntabanEnviroMarketPark S p

  16. The Salt Defense Disposal Investigations (SDDI)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired Solar FuelTechnologyTel: Name:Department ofThe DOEThe31,

  17. NREL: Department of Defense Energy Programs - News

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on771/6/14 Contact:NewsWebmaster PleaseSpring 2014 / IssueEnergyNews

  18. NREL: Department of Defense Energy Programs - Publications

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on771/6/14 Contact:NewsWebmaster PleaseSpring 2014 /

  19. NREL: Department of Defense Energy Programs - Webmaster

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on771/6/14 Contact:NewsWebmaster PleaseSpring 2014 /Webmaster Please

  20. Protection Program Defensive Planning for Fixed Facilities

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy BillsNo. 195 - Oct. 7, 2011 | Department of EnergyHealthSTANDARD

  1. Biofuels in Defense, Aviation, and Marine

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based Fuels Researchof Energy|Make Fuels andfor4GerardUS Departmentfor thein

  2. Defense Nuclear Security | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport for the t-) S/,,5 'a CConversion

  3. Defense Programs | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport for the t-) S/,,5 'a CConversion| National Nuclear Security

  4. Natural Resources Defense Council | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation,National Marine Fisheries ServiceFuel EnergyCouncil Jump to:

  5. defense nuclear security | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLos AlamosSimulation Initiative798/%2ANewdefault Sign In About

  6. defense programs | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLos AlamosSimulation Initiative798/%2ANewdefault Sign In Aboutprograms

  7. department of defense | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLos AlamosSimulation Initiative798/%2ANewdefaultDetermination of

  8. Recommended Practice: Defense-in-Depth

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuildingBudget ||DepartmentReadoutReview of Lessons7

  9. Protection Programming Defensive Planning for Fixed Facilities

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuildingBudget || Department of EnergyNo. 154 -ClimateNOT

  10. Natural Resources Defense Council | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -Department ofDepartmentNaturalEnergy 4

  11. Department of Defense Net Assessment Summer 2009

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1 Table272/S The National Interim714

  12. Defense Health Program Department of Defense Bone Marrow Failure Research Program

    E-Print Network [OSTI]

    Charette, André

    Program Funding Opportunities for Fiscal Year 2014 Applications to the Fiscal government's single-entry #12;portal, Grants.gov. For more information about the BMFRP

  13. Japan’s Approaches to DefenseTransparency: Perspectivesfrom the Japanese and Chinese Defense Establishments

    E-Print Network [OSTI]

    Fei, John

    2012-01-01

    s firm opposition to nuclear weapons is grounded in twopossessing, or importing nuclear weapons (Hughes 2007, 85).the introduction of nuclear weapons in Japan in case of an

  14. Update on Root Chemical Defenses In Defense of Roots: A Research Agenda for Studying

    E-Print Network [OSTI]

    Agrawal, Anurag

    (Bezemer and van Dam, 2005). When attacked by herbivores, plants defend themselves through a continuum. Is this due to a general bias against studies on underground herbiv- ory (out of sight, out of mind

  15. Experts in Defense: How China’s Academicians Contribute to Its Defense Science and Technology Development

    E-Print Network [OSTI]

    WILSON, Jordan

    2015-01-01

    leader Nuclear propulsion and basic nuclear technology Groupmember Nuclear weapons technology Group leader Precisionrockets Information technology and computing Nuclear Medical

  16. Department of Defense Analysis Degree: MS in Defense Analysis (Irregular Warfare)

    E-Print Network [OSTI]

    Networks Tracking and Disrupting Dark Net Operations Planning (IW) Geo/Temporal Aspects of Dark Networks Tracking and Disrupting Dark Networks Concepts Operations Planning (IW) Geo/Temporal Aspects of Dark Networks Tracking and Disrupting Dark Networks Concepts

  17. Experts in Defense: How China’s Academicians Contribute to Its Defense Science and Technology Development

    E-Print Network [OSTI]

    WILSON, Jordan

    2015-01-01

    also well-represented in China’s shipbuilding, ordnance, andDesigner Shen Wensun, Dalian Shipbuilding Industry Co. (part of the China Shipbuilding Industry Corporation); and

  18. Analysis of International Commodity Shipping Data and the Shipment of NORM to the United States

    SciTech Connect (OSTI)

    Baciak, James E.; Ely, James H.; Schweppe, John E.; Sandness, Gerald A.; Robinson, Sean M.

    2011-10-01

    As part of the Spreader Bar Radiation Detector project, PNNL analyzed US import data shipped through US ports collected over the 12 months of 2006 (over 4.5 million containers). Using these data, we extracted a variety of distributions that are of interest to modelers and developers of active and passive detection systems used to 'scan' IMCCs for potential contraband. This report expands on some of the analysis presented in an earlier report from LLNL, by investigation the foreign port distribution of commodities shipped to the US. The majority of containers shipped to the United States are 40 ft containers ({approx}70%); about 25% are 20 ft; and about 3.6% are 45 ft containers. A small fraction (<1%) of containers are of other more specialized sizes, and very few ports actually ship these unique size containers (a full distribution for all foreign ports is shown in Appendix A below). The primary foreign ports that ship the largest fraction of each container are shown in the table below. Given that 45 ft containers comprise 1 of out every 27 containers shipped to the US, and given the foreign ports from which they are shipped, they should not be ignored in screening; further testing and analysis of radiation measurements for national security with this size container is warranted. While a large amount of NORM is shipped in IMCCs, only a few specific commodities are shipped with enough frequency to present potential issues in screening IMCCs at ports. The majority of containers with NORM will contain fertilizers (5,700 containers), granite (59,000 containers), or ceramic (225,000 containers) materials. Fertilizers were generally shipping in either 20- or 40 ft containers with equal frequency. While granite is mostly shipped in 20 ft containers, ceramic materials can be shipped in either 20- or 40 ft containers. The size of container depended on the specific use of the ceramic or porcelain material. General construction ceramics (such as floor and roofing tiles) tend to be shipped in 20 ft containers. Consumer products made from ceramic materials (e.g., tableware, sinks, and toilets) are generally shipped in 40 ft containers. This distinct discrepancy is due in large part to the packaging of the commodity. Consumer products are generally shipped packed in a box loaded with Styrofoam or other packing material to protect the product from breakage. Construction ceramic materials are generally shipped in less packing material, many times consisting of only a cardboard or wooden box. Granite is almost always shipped in a 20 ft container, given its very high density.

  19. Methods for extension of ground shipment windows through a supplier collaboration initiative

    E-Print Network [OSTI]

    Wible, David Barry

    2011-01-01

    Amazon.com is a leading retailer and UPS is the leading package delivery company in the world. Amazon spends hundreds of millions of dollars each year shipping products to customers via parcel carriers such as UPS. Arguably, ...

  20. Evaluation of drying technologies for storage and shipment of recombinant protein drug substance

    E-Print Network [OSTI]

    Vaudant, Jérôme

    2008-01-01

    With growing markets and increasing pipelines, biotechnology companies face a supply chain challenge to manufacture and distribute products using economically feasible methods that protect protein integrity. Adequate storage ...