Powered by Deep Web Technologies
Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Oc. 13, 2004Oc. 13, 2004 International Conference of Spatial CognitionInternational Conference of Spatial Cognition 2004, Frausenchiemsee, Germany2004, Frausenchiemsee, Germany  

E-Print Network [OSTI]

of Spatial Cognition 2004, Frausenchiemsee, Germany2004, Frausenchiemsee, Germany 11 Recognizing Variable & Informatics University of BremenUniversity of Bremen GermanyGermany #12;Oc. 13, 2004Oc. 13, 2004 International Conference of Spatial CognitionInternational Conference of Spatial Cognition 2004, Frausenchiemsee, Germany

Bremen, Universität

2

Klaus Pawelzik1, 2* Centre for Cognitive Sciences, Germany  

E-Print Network [OSTI]

Klaus Pawelzik1, 2* 1 Centre for Cognitive Sciences, Germany 2 University of Bremen, Institute for Theoretical Physics, Germany Financial markets are believed to be efficient in incorporating available and Movement, Giessen, Germany, 19 May - 22 May, 2010. Presentation Type: Poster Presentation Topic: Posters

Kreiter, Andreas K.

3

Organization / Contact Jacobs University Bremen gGmbH Campus Ring 1 | 28759 Bremen | Germany  

E-Print Network [OSTI]

: Energy Water, Nutrition, Health Information, Communication, Education (»Bildung«) Peace and Conflict Materials and Nanomolecular Science TEAMS: Transformations in Europe and Asia: Markets, States, Societies VISCOMX: Visual Communication and Expertise More information on: www

4

Germany 2007  

E-Print Network [OSTI]

Some Pictures to Share with You - Trip to Berlin and Leipzig, Germany, April, 2007. Inside a Berlin subway station. The subway train has come.

5

Bremen Electric Light & Power Co | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: EnergyBoston Area Solar EnergyBradbury,BraytonOpen Energy InformationBremen

6

Good-bye, Germany!  

E-Print Network [OSTI]

1990. Kurthen, Hermann. “Germany at the Crossroads: NationalLynn. “Social Memory and Germany’s Immigration Crisis: AGramling, Anton Kaes, eds. Germany in Transit: Migration,

Sollors, Werner

2004-01-01T23:59:59.000Z

7

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

8

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

9

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

10

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

11

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

12

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

13

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

14

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

15

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

16

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

17

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

18

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

19

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

20

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

22

Study in Germany / Work in Germany  

E-Print Network [OSTI]

Study in Germany / Work in Germany Opportunities Prof. Dr. Silke R. Falkner German Programme Coordinator silke.falkner@usask.ca Tel.: 966-5744 #12;Content I. Opportunities for Study in Germany II. German in Germany V. Term II courses #12;I.A. Study in Germany (Summer) 1. CSSG: Canadian Summer School in Germany

Peak, Derek

23

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

24

Freien Hansestadt Bremen 2013 Verkndet am 10. Juli 2013 Nr. 159  

E-Print Network [OSTI]

Freien Hansestadt Bremen vom 10. Juli 2013 628 (4) Mit Inkrafttreten dieser Ordnung tritt die Ã?nderung tritt nach der Genehmigung durch den Rektor mit Wirkung vom 1. Oktober 2013 in Kraft. Sie wird im

Hoffmeister, Thomas S.

25

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

26

Nr. 39 Amtsblatt der Freien Hansestadt Bremen vom 16. Mrz 2009 345 Diese nderungsordnung nach der Genehmigung  

E-Print Network [OSTI]

tritt nach der Genehmi- gung durch den Rektor der Universität Bremen am 1. April 2009 in Kraft. Sie wird,82. § 2 Diese Bekanntmachung tritt am Tage nach ihrer Veröffentlichung in Kraft. Bremen, den 12. Februar

Hoffmeister, Thomas S.

27

FREIEN HANSESTADT BREMEN 2008 Nr. 36Ausgegeben am 10. April 2008  

E-Print Network [OSTI]

Inkrafttreten (1) Diese Ordnung tritt nach der Genehmigung durch den Rektor der Universität Bremen mit Wir- kung) Mit Inkrafttreten der Ordnung vom 6. Februar 2008 tritt die Prüfungsordnung in der Fassung vom 21;236AmtsblattderFreienHansestadtBremenvom10.April2008Nr.36 Artikel 2 Diese Ordnung tritt nach der Genehmigung des

Hoffmeister, Thomas S.

28

Ordnung zur nderung der Diplomprfungsordnung der Universitt Bremen fr den Studiengang Berufs-  

E-Print Network [OSTI]

folgende Fassung: ,,(1) Diese Prüfungsordnung in der Fassung vom 13. Dezember 2006 tritt mit der tritt mit der Genehmigung durch den Rektor in Kraft. Bremen, den 6. März 2007 Der Rektor der Universität

Hoffmeister, Thomas S.

29

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

30

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

31

754 Amtsblatt der Freien Hansestadt Bremen vom 5. August 2009 Nr. 93 Diese nderung tritt nach der Genehmigung durch  

E-Print Network [OSTI]

754 Amtsblatt der Freien Hansestadt Bremen vom 5. August 2009 Nr. 93 Artikel 2 Diese Ã?nderung tritt Leistung erfolgen." Artikel 2 Diese Ã?nderung tritt nach der Genehmigung durch den Rektor mit Wirkung vom 1

Hoffmeister, Thomas S.

32

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

33

Information on Germany Scholarship  

E-Print Network [OSTI]

Information on Germany Scholarship The whole future f or half the price. Germany Scholarship achieve great things at an early age ­ academically, in their family lives and for society. Germany join forces and give talented young people their full backing. With Germany Scholarship, the Federal

Hoffmeister, Thomas S.

34

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

35

Postcolonialism, Islam, and Contemporary Germany  

E-Print Network [OSTI]

1995] In Atlas of a Tropical Germany: Essays on Politics andMacmillan, 2005. Albrecht, Monika. Postcolonial Germany?and Migration into Germany’s Colonial Past. Paper delivered

Albrecht, Monika

2011-01-01T23:59:59.000Z

36

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

37

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

38

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

39

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

40

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

University of Bonn Bonn, Germany  

E-Print Network [OSTI]

University of Bonn Bonn, Germany studyabroad 2013|2014 Contact Information · UFIC Study Abroad, Germany, for a semester or a full academic year. Highlights · Students who have not completed at least two

Jawitz, James W.

42

University of Bamberg Bamberg, Germany  

E-Print Network [OSTI]

University of Bamberg Bamberg, Germany About: The University of Bamberg (German: Otto-Friedrich-Universität Bamberg) in Bamberg, Germany, is simultaneously one of the oldest and one of the newest universities://www.uni-bamberg.de/?id=2697 FUN FACTS ABOUT BAMBERG The working week in Germany also includes Saturday. So, when looking

Duchowski, Andrew T.

43

HEIDELBERG, GERMANY, 9 May 2012  

E-Print Network [OSTI]

HEIDELBERG, GERMANY, 9 May 2012 ­ Fifty-five life scientists from Europe and around the world were Bovolenta Nicolao, Spain Jens C. Brüning, Germany Francesco Cecconi, Italy PRESS RELEASE EMBO welcomes 55, Italy Ulrike Gaul, Germany Pascal Genschik, France Urs Greber, Switzerland William A. Harris, UK Urs

Canet, Léonie

44

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

45

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

46

Take Me “Home”: Determinants of Return Migration Among Germany’s Elderly Immigrants  

E-Print Network [OSTI]

M. 2007. “After Lifetime in Germany, Turks Still Alone andof Retirement Decisions in Germany” in Jonathan Gruber andof Immigrants in Germany? : Evidence from a Longitudinal

Yahirun, Jenjira

2009-01-01T23:59:59.000Z

47

1synQPSK Univ. Paderborn, Germany; CeLight Israel; Photline, France; IPAG, Germany Univ. Paderborn, Germany  

E-Print Network [OSTI]

1synQPSK Univ. Paderborn, Germany; CeLight Israel; Photline, France; IPAG, Germany synQPSK Univ. Paderborn, Germany CeLight Israel Photline, France IPAG, Germany Contract 004631 in FP6 IST-2002 Phase Shift Keying Transmission #12;2synQPSK Univ. Paderborn, Germany; CeLight Israel; Photline, France

Noé, Reinhold

48

Checklist 1 Before your arrival in Germany  

E-Print Network [OSTI]

Checklist 1 Before your arrival in Germany Before you set off for Germany, begin by clarifying München and Germany in general? o Is my command of German adequate to make myself understood in Germany for your room, etc.) o Have I dealt with all the formalities for entry into Germany (passport, visa, etc

Kemper, Gregor

49

NAUTILUS MARINE SERVICE GMBH Blumenthalstr. 15 D-28209 Bremen Germany Tel. +49 421/20 75 40 Fax +49 421/2 07 54 20  

E-Print Network [OSTI]

and pressure testing is conducted to ISO 9001 #12;THE ACCESSORIES There is a wide range of accessories °K Chemical properties: base resistivity DIN ISO 695 : % 146 mg/dm2 acid resistivity DIN 12116 : % 0.3 mg/dm2 water resistivity DIN ISO 719 : % 31 µg Na20 per g glass (base emittance) 0,03 ml/l (HCL c=0

Buckingham, Michael

50

2, 14031427, 2002 Polarization  

E-Print Network [OSTI]

, University of Bremen, Germany 2 GKSS Research Center Geesthacht GmbH, Geesthacht, Germany Received: 30 August

Paris-Sud XI, Université de

51

Atmos. Chem. Phys., 3, 3948, 2003 www.atmos-chem-phys.org/acp/3/39/ Atmospheric  

E-Print Network [OSTI]

of Environmental Physics, University of Bremen, Germany 2GKSS Research Center Geesthacht GmbH, Geesthacht, Germany

Paris-Sud XI, Université de

52

ICC 2009 University of Germany Southampton  

E-Print Network [OSTI]

ICC 2009 University of Germany Southampton ICC2009 Germany Reduced-Rank Adaptive Least Bit Error;Outline ICC 2009 University of Germany Southampton Outline J Motivation; J Description of hybrid direct Conclusions. #12;Motivation ICC 2009 University of Germany Southampton Motivation ! UWB channels are highly

Chen, Sheng

53

Living in Germany. Studying at FAU.  

E-Print Network [OSTI]

Welcome. Living in Germany. Studying at FAU. www.fau.eu/international #12;Welcome. Living in Germany. Studying at FAU. 2 Welcome. Living in Germany. Studying at FAU. Contents Vice President`s welcome...................................................... 5 1. What you will find in this brochure .............................. 6 2. Welcome to Germany

Fiebig, Peter

54

Low Power Optimization Techniques for BDD Mapped Circuits Using  

E-Print Network [OSTI]

Engineering Univeristy of Bremen Lule°a University of Technology Mississippi State University 28359 Bremen, Germany Lule°a, Sweden Mississippi State, MS, USA drechsle@informatik.uni-bremen.de {kerttu

Thornton, Mitchell

55

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

56

Bernhard Westrich, Universitt Stuttgart, Germany; Ulrich Frstner, TU Hamburg-Harburg, Hamburg, Germany (Eds.)  

E-Print Network [OSTI]

Bernhard Westrich, Universität Stuttgart, Germany; Ulrich Förstner, TU Hamburg- Harburg, Hamburg, Germany (Eds.) Sediment Dynamics and Pollutant Mobility in Rivers An Interdisciplinary Approach

Cirpka, Olaf Arie

57

Emigration and the Foundation of West Germany, 1933-1963  

E-Print Network [OSTI]

Gustav. The Canker of Germany. Trans. Norbert S. Maiman.Hauptstadtarchiv, Wiesbaden, Germany. Fraenkel, Martha,Frankfurt, Germany. Gurland, Arcadius, Personalakte.

Strote, Noah Benezra

2011-01-01T23:59:59.000Z

58

Welfare State Integration of Immigrants: the Case of Germany  

E-Print Network [OSTI]

of immigrant integration in Germany; the good performance ofImmigrants: the Case of Germany References Beauftragte derImmigrants: the Case of Germany Friedrich Heckmann Managing

Heckmann, Friedrich

2012-01-01T23:59:59.000Z

59

Review: German Film after Germany. Toward a Transnational Aesthetic  

E-Print Network [OSTI]

Halle. German Film After Germany. Toward a Transnationalof film production in Germany has changed rapidly. Thescale. German Film After Germany: Toward a Transnational

Theisen, Bianca

2011-01-01T23:59:59.000Z

60

Philosophy & Economics "Made in Germany"  

E-Print Network [OSTI]

Philosophy & Economics "Made in Germany" The Bachelor and Master Programmes at a Glance 2011 #12 course of studies in philosophy and economics. The aim is to provide a rigorous training for understanding complex social, economic, and political decision-making. · The philosophy curriculum is focused

Müller, Cord

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Philosophy & Economics "Made in Germany"  

E-Print Network [OSTI]

Philosophy & Economics "Made in Germany" 10 Argumente für das Bachelor-Studiengang Philosophy & Economics 2011 www.pe.uni-bayreuth.de #12;1. P&E verbindet Philosophie und �konomie, um Exper- tinnen und Zentrum steht die Verzahnung von philosophi- scher und ökonomischer Perspektive. 8. P&E bereitet für

Müller, Cord

62

Checklist 3 Before your departure from Germany  

E-Print Network [OSTI]

Checklist 3 Before your departure from Germany o It is in your hands to receive the transcripts at the Citizens' Bureau o Remember to cancel all agreements/contracts signed in Germany, such as: - with the bank

Kemper, Gregor

63

Checklist 2 The first days in Germany  

E-Print Network [OSTI]

Checklist 2 The first days in Germany Further information and explanations for the following points (former E111 or E128) or EHIC-Card to one of the social insurers in Germany. You will then be issued in Germany! Only when you have a permanent address you can register with the Citizens' Bureau (Bürgerbüro

Kemper, Gregor

64

INVITED SPEAKERS S. Albeverio (Bonn, Germany)  

E-Print Network [OSTI]

INVITED SPEAKERS S. Albeverio (Bonn, Germany) J. L. Bell (Western Ontario, Canada) V. Benci (PisaIntyre (Edinburgh, UK) T. Nakamura (Tsuda, Japan) H. Osswald (Muenchen, Germany) D.A. Ross (Hawaii, USA) M. Wolff (Tuebingen, Germany). NS2002 NONSTANDARD METHODS and applications in mathematics June 10-16, 2002 Pisa

Di Nasso, Mauro

65

Workshop on Distributed Cloud Computing Dresden, Germany  

E-Print Network [OSTI]

DCC 2013 Workshop on Distributed Cloud Computing Dresden, Germany December 9-12, 2013 (Submission Pan Hui, HKUST, Hong Kong Wolfgang Kellerer, TU Munich, Germany Ruben Montero, Uni Complutense de Waterloo, Canada Marco Canini, T-Labs & TU Berlin, Germany Paolo Costa, MSR & Imperial College, UK Xiaoming

Schmid, Stefan

66

>Why I decided to study in Germany ...  

E-Print Network [OSTI]

>Why I decided to study in Germany ... SIX STUDENTS TELL THEIR STORIES _______ PAGE 04 +/+/+/ STUDYING IN GERMANY /+/+/+ #12;What are the important ingredients for a successful start? The best possible preparation sounds like a good idea. That's why the magazine "Start ­ Studying in Germany" is providing some

Hellebrand, Sybille

67

famelab-germany.de FameLab Germany wird prsentiert von  

E-Print Network [OSTI]

famelab-germany.de FameLab Germany wird präsentiert von Du ... studierst oder arbeitest in den Wissenschaftskommunikation #12;Anmeldung & Videos famelab-germany.de Let's taLK science! FameLab-Vorentscheid 22. März Medien- und Kommuni- kationstraining 5. + 6. April Berlin Finale FameLab Germany: 10. Mai Bielefeld

Hamburg,.Universität

68

Global Imbalances: Is Germany the new China? A Skeptical View  

E-Print Network [OSTI]

Global Imbalances: Is Germany the new China? A Skepticalpatterns of China and Germany. We point out that China'srecent years resembles that of Germany’s. Yet, an important

Aizenman, Joshua; Sengupta, Rajeswari

2010-01-01T23:59:59.000Z

69

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

70

Name Affiliation Country PI Prof. Dr. Gottfried Mann AIP Germany  

E-Print Network [OSTI]

Name Affiliation Country PI Prof. Dr. Gottfried Mann AIP Germany core members (project manager) Dr Sweden Germany ordinary members Frank Breitling Eoin Carley Dr. Harry Enke Dr. Norbert Jakowski Dr Germany Ireland Germany Germany UK Ireland Germany UK Ireland associated memb. Prof. Dr. John Brown Dr

71

Performing the Jewish body in contemporary Germany.  

E-Print Network [OSTI]

??The dissertation explores the work of Tanya Ury and Esther Dischereit as political interventional, contemporary, Jewish art in Germany. Ury and Dischereit analyze the power… (more)

Brungs, Juliette

2013-01-01T23:59:59.000Z

72

Fourth International Workshop on Termination Dagstuhl, Germany  

E-Print Network [OSTI]

Fourth International Workshop on Termination WST '99 Dagstuhl, Germany May 10­12, 1999 Abstracts #12; Fourth International Workshop on Termination WST '99 Dagstuhl, Germany May 10­12, 1999 Abstracts, The Netherlands) #12; Contents Hans Zantema The Termination Hierarchy for Term Rewriting

Giesl, Juergen

73

HOTEL ACCOMMODATIONS SUMMER EUROPEAN ACADEMY 2014 Passau (Germany, Bavaria)  

E-Print Network [OSTI]

HOTEL ACCOMMODATIONS SUMMER EUROPEAN ACADEMY 2014 Passau (Germany, Bavaria): Hotel Weisser Hase: +49 851 9211 100 info@weisser-hase.de Munich (Germany, Bavaria): NH Deutscher Kaiser http://www.nh Germany Tel. +49 89 54 530 Email: nhdeutscherkaiser@nh-hotels.com Garmisch (Germany, Bavaria): Garmischer

Bermúdez, José Luis

74

UGA in Germany UGA has long maintained an extensive network of connections to Germany, sending numerous students and  

E-Print Network [OSTI]

UGA in Germany July 2012 UGA has long maintained an extensive network of connections to Germany of the best universities in Germany to develop critical research. Student Exchanges: UGA has longstanding on exchange to Germany for an immersive semester or year-long experience. In return, UGA has hosted

Hall, Daniel

75

Pinhole Glasses Giuseppe Colicchia, Physics Education, Ludwig-Maximilians University, Munich, Germany  

E-Print Network [OSTI]

, Germany Martin Hopf, Physics Education, Ludwig-Maximilians University, University Munich, Germany Hartmut Wiesner, Physics Education, Ludwig-Maximilians University, University Munich, Germany Dean Zollman

Zollman, Dean

76

International Family Business Succession Planning. Recent Developments in Germany and Spain  

E-Print Network [OSTI]

Tools of transmission in Germany 2.1. Power of attorney postas being unconstitutional. 33 Germany's Constitutional CourtRecent Developments in Germany and Spain Business Roland

Krause, Roland

2009-01-01T23:59:59.000Z

77

Times of the Event: On the Aesthetico-Political in West Germany and Austria circa 1968  

E-Print Network [OSTI]

and Consumer Culture. ” In West Germany under Construction:Cinema in Democratizing Germany: Reconstructing NationalHeritage: Video Art in Germany from 1963 to the Present.

Weiner, Andrew Stefan

2011-01-01T23:59:59.000Z

78

At the Nexus of Social Policy and Capital Markets: Pension Reform and Enterprise Governance in Germany  

E-Print Network [OSTI]

Company Pension Schemes in Germany,” Monthly Report, March.2001. “Pension Reform in Germany,” draft chapter in R. Kentof Stakeholderism in Germany,”forthcoming, Industrielle

Ziegler, J. Nicholas

2008-01-01T23:59:59.000Z

79

Diode pumped solid state kilohertz disk laser system for time-resolved combustion diagnostics under microgravity at the drop tower Bremen  

SciTech Connect (OSTI)

We describe a specially designed diode pumped solid state laser system based on the disk laser architecture for combustion diagnostics under microgravity (?g) conditions at the drop tower in Bremen. The two-stage oscillator-amplifier-system provides an excellent beam profile (TEM{sub 00}) at narrowband operation (?? < 1 pm) and is tunable from 1018 nm to 1052 nm. The laser repetition rate of up to 4 kHz at pulse durations of 10 ns enables the tracking of processes on a millisecond time scale. Depending on the specific issue it is possible to convert the output radiation up to the fourth harmonic around 257 nm. The very compact laser system is integrated in a slightly modified drop capsule and withstands decelerations of up to 50 g (>11 ms). At first the concept of the two-stage disk laser is briefly explained, followed by a detailed description of the disk laser adaption to the drop tower requirements with special focus on the intended use under ?g conditions. In order to demonstrate the capabilities of the capsule laser as a tool for ?g combustion diagnostics, we finally present an investigation of the precursor-reactions before the droplet ignition using 2D imaging of the Laser Induced Fluorescence of formaldehyde.

Wagner, Volker; Paa, Wolfgang; Triebel, Wolfgang [Institute of Photonic Technology, Laser Diagnostics, Albert-Einstein-Str. 9, 07745 Jena (Germany)] [Institute of Photonic Technology, Laser Diagnostics, Albert-Einstein-Str. 9, 07745 Jena (Germany); Eigenbrod, Christian; Klinkov, Konstantin [Center of Applied Space Technology and Microgravity, University Bremen, Am Fallturm, 28359 Bremen (Germany)] [Center of Applied Space Technology and Microgravity, University Bremen, Am Fallturm, 28359 Bremen (Germany); Larionov, Mikhail; Giesen, Adolf; Stolzenburg, Christian [Institut für Strahlwerkzeuge (IFSW), Pfaffenwaldring 43, 70569 Stuttgart (Germany)] [Institut für Strahlwerkzeuge (IFSW), Pfaffenwaldring 43, 70569 Stuttgart (Germany)

2014-03-15T23:59:59.000Z

80

College/University: 1998 -2004 University of Kaiserslautern (Germany)  

E-Print Network [OSTI]

Education College/University: 1998 - 2004 University of Kaiserslautern (Germany) Diploma in Biology, billard, card-games, soccer, First name: Niels Last name: Heinz Date of birth: 07.02.1978 Country: Germany

Manstein, Dietmar J.

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Interpolation Search for Point Cloud Intersection University of Paderborn, Germany  

E-Print Network [OSTI]

janklein@uni-paderborn.de Gabriel Zachmann University of Bonn, Germany zach@cs.uni-bonn.de ABSTRACT We

Zachmann, Gabriel

82

Wage adjustment, competitiveness and unemployment East Germany after unification  

E-Print Network [OSTI]

Wage adjustment, competitiveness and unemployment ­ East Germany after unification Werner Smolny years after unification large differences of the labor market situation in East and West Germany persist adjustment in East Germany and the resulting development of competitiveness and unemployment differentials

Pfeifer, Holger

83

Following Germany's Lead: Using International Monetary Linkages to Estimate  

E-Print Network [OSTI]

Following Germany's Lead: Using International Monetary Linkages to Estimate the Effect of Monetary to countries with the weakest economic ties to Germany. We thank participants at the 2004 NBER Summer Workshop (2001). 2 Many European countries followed Germany's lead in setting their monetary policy during our

Sadoulet, Elisabeth

84

Germany Picks Up Scent of In Solving Naples's Trash Crisis  

E-Print Network [OSTI]

1 Germany Picks Up Scent of Profit In Solving Naples's Trash Crisis By STACY MEICHTRY and ALMUT incinerators across Germany that have recently cut deals with the Italian government to burn up to 200,000 tons in northern Germany charge between 150 and 250 ($237 to $394) to incinerate one ton of waste, estimates

Columbia University

85

Simplified Planning Regulations in Germany and the Effects of Landslides  

E-Print Network [OSTI]

Simplified Planning Regulations in Germany and the Effects of Landslides BODO DAMM Georg-August-University Go¨ ttingen, Department of Physical Geography, Go¨ ttingen, Germany (Received November 2005; revised¨ ttingen, Department of Physical Geography, Goldschmidtstra�e 5, D-37077 Go¨ ttingen, Germany. Email: bdamm

Damm, Bodo

86

Germany Inspires Innovation --Welcome to Europe's Leader in Science  

E-Print Network [OSTI]

Germany Inspires Innovation -- Welcome to Europe's Leader in Science #12;Welcome to the Land of Ideas Excellence in research and development Germany is the number one location for research in Europe. Germany's unique scientific tradi- tion and great variety of research offer ideal conditions--not only

Kersting, Kristian

87

March 29 31, 2012 University of Paderborn, Germany  

E-Print Network [OSTI]

Conference March 29 ­ 31, 2012 University of Paderborn, Germany Room B 3.231 supported by the DFG:30 | John Peters | Iowa, USA 03:30 | Gabriele Schabacher | Siegen, Germany 05:00 | Jana Mangold | Erfurt, Germany 06:00 | Menahem Blondheim | Elihu Katz | Jerusalem, Israel 09:30 | Grant David Bollmer | Chapel

Paderborn, Universität

88

HTST 413.02 Modern Germany: 1870-Present  

E-Print Network [OSTI]

HTST 413.02 Modern Germany: 1870-Present Summer 2012 MW 12:00-14:45 Instructor: Mikkel Dack Two - German history is anything but dull. Historically, Germany has been a country torn between the political and the Holocaust; Allied occupation; the division of Germany; the GDR and the German communist ideal

Habib, Ayman

89

GER 320 (Germany Today) Course Outcomes and Programmatic Alignment  

E-Print Network [OSTI]

1 GER 320 (Germany Today) Course Outcomes and Programmatic Alignment Students will be able, conduct presentations, and produce texts relevant to contemporary issues in Germany and the German-speaking countries Individual and small group presentations Final project on important issues in Germany 1a

Mayfield, John

90

DESY -August 7th 2007, Hamburg, Germany 1 Optically Stimulated  

E-Print Network [OSTI]

DESY - August 7th 2007, Hamburg, Germany 1 Optically Stimulated Luminescence Dosimetry Based on Sr, Germany 2 Why OSL ? A bit of History... 1950/1960: first suggestion of OSL as a dosimetry tool 80's years dosimetry system for RADECS Conference INTRODUCTION #12;DESY - August 7th 2007, Hamburg, Germany 3

91

23rd -25th September 2013 Berlin, Germany  

E-Print Network [OSTI]

23rd - 25th September 2013 Berlin, Germany Sustainable Global Conference on Manufacturing Berlin - Germany Tel.: +49 30 314-25117 Fax: +49 30 314-22759 E-Mail: gcsm@mf.tu-berlin.de Website: www" Germany, on 23rd - 25th September 2013. It will be hosted by Technische Universität Berlin. · Value

Berlin,Technische Universität

92

Germany Geothermal Region | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, searchGeaugaInformation MexicoLLC Jump to: navigation,Germany

93

Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power BasicsGermany: Energy Resources Jump to: navigation, search Loading map...

94

15-16 October 2013, Nurnberg, Germany  

E-Print Network [OSTI]

Heating supply system lowtemperature: tw2 = 40...45 ° high temperature: tw2 = 80...100 ° water heater: tw2#12;15-16 October 2013, Nurnberg, Germany 2 Heat Pump Technology for Heating supply systems I,46·10-3 Expansion-compression work ratio ls / ls 0,367 0,103 0,076 0,044 Heating water temperatures (in/out), °C 40

Oak Ridge National Laboratory

95

Arnstadt, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo Feng Bio Energy CoClimate ProjectsArnstadt, Germany:

96

Berlin, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo Feng Bio JumpVentures JumpGermany: Energy Resources Jump

97

Hannover, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power BasicsGermany: EnergyPower Finance Jump to:Information ofHannover,

98

Greenpeace Energy Germany | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat Jump to:Photon Place: Golden,GreenVoltsGreenpeace Energy Germany Jump to:

99

Contributions to the FEL2001 Conference, August 20-24, 2001 in Darmstadt, Germany  

E-Print Network [OSTI]

Contributions to the FEL2001 Conference, August 20-24, 2001 in Darmstadt, Germany October 2001¨ustefeld , (BESSY, Berlin, Germany), ¡ (DESY, Hamburg, Germany), ¢ (UCLA, Los Angeles, USA), £ (MBI, Berlin, Germany . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 V. Balandin, N. Golubeva, M. K¨orfer (DESY, Hamburg, Germany) Studies of Beam Optics

100

Interregional Migration in Germany: Characteristics and Effects for Regions and Migrants  

E-Print Network [OSTI]

Interregional Migration in Germany: Characteristics and Effects for Regions and Migrants Christian of economic activity in East Germany initiated enormous migration flows from East to West Germany. People from East Germany moved towards West Germany, where wages are higher and em- ployment opportunities are more

Pfeifer, Holger

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

ASSIMILATION IN A NEW CONTEXT: THE ROLE OF ORIGIN AND NATIONALITY ON SECOND GENERATION EDUCATIONAL ATTAINMENT IN GERMANY  

E-Print Network [OSTI]

among "Labor Migrants" in Germany“ International Migrationfor labor migrants in Germany,” International Migrationthe former Soviet Union to Germany: Background, trends and

Luthra, Renee Reichl

2008-01-01T23:59:59.000Z

102

Multilingual Development in Germany in the Crossfire of Ideology and Politics: Monolingual and Multilingual Expectations, Polylingual Practices  

E-Print Network [OSTI]

2008. MiGazin. Migration in Germany. “Merkel sagt ‘Ja’ zuW. “Multilingual development in Germany in the crossfire ofand citizenship in Germany: discourses on integration and

Pfaff, Carol W.

2011-01-01T23:59:59.000Z

103

Alister John Miskimmon, University of Birmingham. RECASTING THE SECURITY BARGAINS: GERMANY, EUROPEAN SECURITY  

E-Print Network [OSTI]

Alister John Miskimmon, University of Birmingham. RECASTING THE SECURITY BARGAINS: GERMANY recent developments in European Union (EU) security policy and their implications for Germany's bilateral of a greater EU security capability has significantly affected Germany's bilateral relations with the USA

Sheldon, Nathan D.

104

Spring 2012 Ger 3501: Contemporary Germany "Environmental Debates--Food, Energy, Politics"  

E-Print Network [OSTI]

Spring 2012 Ger 3501: Contemporary Germany "Environmental Debates--Food, Energy, Politics" Course, interpret, and appreciate literary and multi-media texts related to contemporary Germany and environmental, and personal communications). Contemporary Germany/Global Environmental Topics Charlotte Melin, University

Amin, S. Massoud

105

Integrated modelling and assessment of regional groundwater resources in Germany and Benin, West Africa  

E-Print Network [OSTI]

1 Integrated modelling and assessment of regional groundwater resources in Germany and Benin, West.J.S. SONNEVELD [1] Institute of Hydraulic Engineering, Universitaet Stuttgart, Germany (Roland Conservation University of Bonn, Germany [3] Institute of Landscape Planning and Ecology, University

Cirpka, Olaf Arie

106

NCCR Trade Regulation Brown Bag Series Dr Franziska Humbert, Policy Advisor Corporate Social Responsibility, Oxfam Germany  

E-Print Network [OSTI]

Social Responsibility, Oxfam Germany International Constitutionalism and Child Labour Wednesday, 23, Policy Advisor Corporate Social Responsibility, Oxfam Germany. Abstract The postdoctoral thesis builds of the Speaker Franziska Humbert is a policy advisor on corporate social responsibility at Oxfam Germany

Richner, Heinz

107

Climate change effects on winter chill for fruit crops in Germany  

E-Print Network [OSTI]

chill for fruit crops in Germany Abstract To quantify thechange on fruit production in Germany, this study aimed atof typical winter chill in Germany around 2010, as well as

Luedeling, Eike; Blanke, Michael; Gebauer, Jens

2009-01-01T23:59:59.000Z

108

‘All one could desire’ British women remember life in post war Germany  

E-Print Network [OSTI]

of being British in Germany was not experienced in the sameremember life in post war Germany My PhD thesis attempts toof the British occupation of Germany which took place 1945-

Easingwood, Ruth

2007-01-01T23:59:59.000Z

109

Tax Morale after the Reunification of Germany: Results from a Quasi-Natural Experiment  

E-Print Network [OSTI]

Morale Development in Germany (1990, 1997, 1999) WEIGHTEDTable 8: Tax Morale in West Germany 1981 and 1990 WEIGHTED2005) Black Activities in Germany in 2001 and in 2004: A

Feld, Lars P.; Torgler, Benno

2007-01-01T23:59:59.000Z

110

Making and Unmaking Money: Economic Planning and the Collapse of East Germany  

E-Print Network [OSTI]

and the Collapse of East Germany Jonathan R. Zatlin BostonGermans were visiting West Germany a year, while around 35is permitted to travel to West Germany, and when he returns,

Zatlin, Jonathan R

2007-01-01T23:59:59.000Z

111

from the society: 7th International Conference of the IBS to be held in Bayreuth, Germany  

E-Print Network [OSTI]

13–15 March 2013 – Göttingen, Germany   4–5 August 2013 – IBS to be held in Bayreuth,  Germany  The  International in  northern Bavaria, Germany, in early January 2015.   The 

Gavin, Daniel G.

2012-01-01T23:59:59.000Z

112

Moral Philosophy and the Origins of Modern Aesthetic Theory in Scotland and Germany  

E-Print Network [OSTI]

Stiftungen. Halle/Saale, Germany. BL British Library.Aufklärung. Halle/Saale, Germany, 9 Dezember 2009. Grunert,depravity of man. In both Germany and Scotland between the

Grote, Simon William

2010-01-01T23:59:59.000Z

113

E-Print Network 3.0 - assembly hamburg germany Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

hamburg germany Search Powered by Explorit Topic List Advanced Search Sample search results for: assembly hamburg germany Page: << < 1 2 3 4 5 > >> 1 Curriculum vitae Name: Arne...

114

GEA Refrigeration Technologies / GEA Refrigeration Germany GmbH Wolfgang Dietrich / Dr. Ole Fredrich  

E-Print Network [OSTI]

GEA Refrigeration Technologies / GEA Refrigeration Germany GmbH Wolfgang Dietrich / Dr. Ole Technologies3 Achema 2012 // heat pumps using ammonia Industrial demand on heat in Germany Heatdemandin

Oak Ridge National Laboratory

115

E-Print Network 3.0 - area germany final Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

germany final Search Powered by Explorit Topic List Advanced Search Sample search results for: area germany final Page: << < 1 2 3 4 5 > >> 1 Innovation Community Program Overview...

116

Broadband Wireless Internet Access in Public Transportation1 Andreas Roos, University of Applied Sciences Leipzig, 04277 Leipzig, Germany  

E-Print Network [OSTI]

Sciences Leipzig, 04277 Leipzig, Germany Nico Bayer, University of Applied Sciences Friedberg, 61169 Friedberg, Germany Dmitry Sivchenko, University of Applied Sciences Friedberg, 61169 Friedberg, Germany Michael Flegl, University of Applied Sciences Leipzig, 04277 Leipzig, Germany Profn. Dr. Sabine Wieland

Rakocevic, Veselin

117

Energy Department Expands Research into Methane Hydrates, a Vast...  

Broader source: Energy.gov (indexed) [DOE]

separate project funded by the EU through Universities of Bremen (Germany) and Tromso (Norway), will assess the response of methane hydrates to environmental changes at the...

118

Jan Hendrik Bruinier II Anna von Pippich Fabrizio Andreatta -Milan, Italy II Massimo Bertolini -Essen, Germany II Siegfried Bcherer -  

E-Print Network [OSTI]

Massimo Bertolini - Essen, Germany II Siegfried Böcherer - Mannheim, Germany II Thanasis Bouganis - Durham II Jay Jorgenson - New York, USA II Winfried Kohnen - Heidelberg, Germany II Jürg Kramer - Berlin, Germany II Siddarth Sankaran - Bonn, Germany II Maryna Viazovska - Bonn, Germany II Tonghai Yang - Madison

Haller-Dintelmann, Robert

119

The Mormons in Nazi Germany: History and Memory  

E-Print Network [OSTI]

of scholars at Brigham Young University. They feared that Hubener's example would incite Mormon youth to rebel against dictators abroad, hurt the church's relations with communist East Germany, and would offend recent German Mormon immigrants in Utah. A few...

Nelson, David Conley 1953-

2012-10-24T23:59:59.000Z

120

LET THE SUN SHINE: OPTIMAL DEPLOYMENT OF PHOTOVOLTAICS IN GERMANY  

E-Print Network [OSTI]

/kWh, depending on its location as well as on the size and type of PV system used (EPIA Report, 2011). InvestmentLET THE SUN SHINE: OPTIMAL DEPLOYMENT OF PHOTOVOLTAICS IN GERMANY Anna CRETI Jérôme JOAUG Cahier n:chantal.poujouly@polytechnique.edu hal-00751743,version1-14Nov2012 #12;Let the sun shine: optimal deployment of photovoltaics in Germany

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

AIMS, Dresden, Germany, May 25-28, 2010 Higher Order Operator-Splitting Methods  

E-Print Network [OSTI]

AIMS, Dresden, Germany, May 25-28, 2010 Higher Order Operator-Splitting Methods based on Zassenhaus Univerist¨at zu Berlin, D- Berlin, Germany AIMS, Dresden, Germany, May 25-28, 2010 Gamze Tanoglu, J¨urgen Geiser Higher Order Operator-Splitting Methods #12;AIMS, Dresden, Germany, May 25-28, 2010 Outline 1

Geiser, Juergen

122

More Effective Aid, More Prestige Why Germany should europeanize its humanitarian  

E-Print Network [OSTI]

More Effective Aid, More Prestige Why Germany should europeanize its humanitarian assistance 04/04/2014 | Category: Humanitarian Intervention, Germany by Matteo Garavoglia If Germany would like to play a more profile. Royal Navy Media Archive, CC BY In the field of humanitarian assistance, Germany punches below

Boyer, Edmond

123

Landfills a thing of the past in Germany where advanced waste management By Evridiki Bersi -Kathimerini  

E-Print Network [OSTI]

Landfills a thing of the past in Germany where advanced waste management rules By Evridiki Bersi but that day has already come in Germany. On June 1, 2005, Germany imposed a ban on traditional garbage dumps, replacing them with one of the most advanced waste-management systems in the world. In the 1970s, Germany

Columbia University

124

Impacts of high energy prices on long-term energy-economic scenarios for Germany  

E-Print Network [OSTI]

Impacts of high energy prices on long-term energy-economic scenarios for Germany Volker Krey1 , Dag and Technology Evaluation (IEF-STE), 52425 Jülich, Germany 2) DIW Berlin, Königin-Luise-Str. 5, 14195 Berlin, Germany 3) �ko-Institut, Novalisstr. 10, 10115 Berlin, Germany Abstract Prices of oil and other fossil

125

Eigen Lecture Hall, MPIbpc, Am Fassberg 11 Dec 5-6 , 2014, Gttingen, GermanyDec 5-6 , 2014, Gttingen, Germany  

E-Print Network [OSTI]

Eigen Lecture Hall, MPIbpc, Am Fassberg 11 Dec 5-6 , 2014, Göttingen, GermanyDec 5-6 , 2014, Göttingen, Germany Membrane Biophysics Symposium Organizers: Stefan Hell, Tobias Moser, Walter Stühmer

Gollisch, Tim

126

Denazification in the American Zone of Germany, 1945-1948  

E-Print Network [OSTI]

DENAEIFICATION IN THE AMERICAN 'ZONE OF GERMANY; 1945-1948 A Thesis RICHARD LEE MCHENRY, JR, Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement for the degree of MASTER OF ARTS December 1982... Major Subject: History DENAZIFICATION IN THE AMERICAN ZONE OF GERMANY; 1945-1948 A Thesis by RICHARD LEE MCHENRY, JR, Approved as to style and content by: a ( hairma of ommittee p-~) f l (Member (Me er Head of Departmen December 1982...

McHenry, Richard Lee

1982-01-01T23:59:59.000Z

127

Industrial heat pumps in Germany -potentials, technological development  

E-Print Network [OSTI]

1 Industrial heat pumps in Germany - potentials, technological development and application examples of Energy (IER) Universität Stuttgart ACHEMA 2012 Application of industrial heat pumps Improving energy-efficiency of industrial processes 13. Juni 2012 #12;ACHEMA 2012 - Industrial heat pumps 21st June 2012 Types of Heat Pumps

Oak Ridge National Laboratory

128

Jos Reinoso Institute of Structural Analysis, Leibniz Universitt Hannover, Germany  

E-Print Network [OSTI]

in polycrystalline quasi-brittle Materials: Application to silicon wafers 05.11.2013 Crystal structure: diamond, Germany, 05.11.2013 Damage features in polycrystalline quasi-brittle Materials: Application to silicon wafers 05.11.2013 #12;Damage features in polycrystalline quasi-brittle Materials: Application to silicon

129

Ecient elasto-plastic simulation ICA, University of Stuttgart, Germany  

E-Print Network [OSTI]

EÃ?cient elasto-plastic simulation C. Wieners ICA, University of Stuttgart, Germany Summary. In this paper we describe a method for the construction of radial re- turn algorithms to the plasticity models plasticity, the constitutive equations are determined by the free energy functional and a monotone function

Wieners, Christian

130

Fish Stocks Rainer Froese, IFM-GEOMAR, Kiel, Germany  

E-Print Network [OSTI]

Fish Stocks Rainer Froese, IFM-GEOMAR, Kiel, Germany Daniel Pauly, University of British Columbia and consisting of four elements (species names, location, time, and source). Catches The fish (or other aquatic organisms) of a given stock killed during a certain period by the operation of fishing gear. This definition

Pauly, Daniel

131

A survey of environmental needs and innovative technologies in Germany  

SciTech Connect (OSTI)

The International Technology Program (IT?), formerly the international Technology Exchange Program (ITEP), of the Department of Energy`s (DOE`s) Office of Environmental Restoration and Waste Management (EM) is responsible for promoting: (1) the import of innovative technologies to better address EM`s needs; and (2) the export of US services into foreign markets to enhance US competitiveness. Under this program: (1) the environmental restoration market in Germany was evaluated, including the description of the general types of environmental problems, the environmental regulations, and specific selected contaminated sites; and (2) potentially innovative environmental restoration technologies, either commercially available or under development in Germany, were identified, described and evaluated. It was found that: (1) the environmental restoration market in Germany is very large, on the order of several billion US dollars per year, with a significant portion possibly available to US businesses; and (2) a large number (54) of innovative environmental restoration technologies, which are either commercially available or under development in Germany, may have some benefit to the DOE EM program and should be considered for transfer to the US.

Voss, C.F.; Roberds, W.J. [Golder Associates, Inc., Redmond, WA (United States)

1995-05-01T23:59:59.000Z

132

Research in Germany seminar -IIT Madras The Deutscher Akademischer Austausch Dienst is the world`s largest  

E-Print Network [OSTI]

Research in Germany seminar -IIT Madras The Deutscher Akademischer Austausch Dienst is the world technical universities, 221 universities of applied sciences and 56 arts and science universities in Germany of German universities and research institutions and increase Germany's international competitiveness

Krishnapura, Nagendra

133

Policy Experimentation and the Search for Institutional Change: The Politics of Red-Green Reform in Germany  

E-Print Network [OSTI]

the first four years of Germany first Red-Green coalition.OF RED-GREEN REFORM IN GERMANY June 2006 J. Nicholas Zieglercoalition government in Germany between Social Democrats and

Ziegler, J. Nicholas; Leslie, John C.

2006-01-01T23:59:59.000Z

134

Another Turn of the Tide? World War II and the Writing of Military History in West Germany 1945-2005  

E-Print Network [OSTI]

Army industry and labor in Germany, 1914 – 1918 (Princeton/DVA 1979-2006; trans. Germany and the Second World War, ed.the past in contemporary Germany (Basingstoke, 2006). W.G.

Echternkamp, Joerg Jörg

2006-01-01T23:59:59.000Z

135

Radical Cosmopolitanism: W. E. B. Du Bois, Germany, and African American Pragmatist Visions for Twenty-First Century Europe  

E-Print Network [OSTI]

W. E. B. Du Bois, Germany, and African American PragmatistAmericans, Africa, and Germany in the Modern  World.   Ed.  W.E.B.  Du Bois in Nazi Germany, 1936. ” Amerikastudien/

Lenz, Günter H.

2012-01-01T23:59:59.000Z

136

Keynote speakers Susan E. Trumbore -Max-Planck-Institute for Biogeochemistry Jena, Germany  

E-Print Network [OSTI]

Keynote speakers Susan E. Trumbore - Max-Planck-Institute for Biogeochemistry Jena, Germany http for Landscape Biogeochemistry, Germany http://www.arthur-gessler.de/ PhillippeTortell, University of British

Daniel, Rosenfeld

137

E-Print Network 3.0 - altdorf se germany Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

altdorf se germany Search Powered by Explorit Topic List Advanced Search Sample search results for: altdorf se germany Page: << < 1 2 3 4 5 > >> 1 195Schweiz. Z.Forstwes. 156...

138

E-Print Network 3.0 - area west germany Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

germany Search Powered by Explorit Topic List Advanced Search Sample search results for: area west germany Page: << < 1 2 3 4 5 > >> 1 Invitation to the foreign students of Ulm...

139

E-Print Network 3.0 - aachen germany 15-17 Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

germany 15-17 Search Powered by Explorit Topic List Advanced Search Sample search results for: aachen germany 15-17 Page: << < 1 2 3 4 5 > >> 1 InvitationProgram Technology Watch...

140

Ernst-Moritz-Arndt-Universitt Greifswald (Germany) Information for 2014 / 2015  

E-Print Network [OSTI]

Ernst-Moritz-Arndt-Universität Greifswald (Germany) Information for 2014 / 2015 Full legal Name GREIFSWALD GERMANY Telephone (including country and area codes) + 49 3834 86 1116 Fax (including country

Greifswald, Ernst-Moritz-Arndt-Universität

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Climate change effects on winter chill for fruit crops in Germany  

E-Print Network [OSTI]

Dormancy release in deciduous fruit trees. Hortic Rev 7:239–effects on winter chill for fruit crops in Germany Abstracteffects of climate change on fruit production in Germany,

Luedeling, Eike; Blanke, Michael; Gebauer, Jens

2009-01-01T23:59:59.000Z

142

International Family Business Succession Planning. Recent Developments in Germany and Spain  

E-Print Network [OSTI]

4. Recents reforms in Spain 4.1. Family Protocols in theDevelopments in Germany and Spain Business Roland Krausein North America; 50% in Spain and 80 % in Germany. 8

Krause, Roland

2009-01-01T23:59:59.000Z

143

International monetary relations between the United States, France, and West Germany in the 1970s  

E-Print Network [OSTI]

and West Germany. Yet, the inability of France and the Federal Republic of Germany to form cohesive economic and monetary policies throughout international negotiations or within the European Community (EC), allowed American desires to dictate the path...

Rae, Michelle Frasher

2004-09-30T23:59:59.000Z

144

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany VERY LARGE TELESCOPE  

E-Print Network [OSTI]

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei München, Germany VERY LARGE TELESCOPE.02.2014 2 of 19 ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei München, Germany CO.02.2014 3 of 19 ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei München, Germany CHANGE RECORD

Siebenmorgen, Ralf

145

College/University: 2004-2005: University Kiel, Germany, Institute of Pathology,  

E-Print Network [OSTI]

Education College/University: 2004-2005: University Kiel, Germany, Institute of Pathology, Clinical Genetics. 2000-2003: University Kiel, Graduate Student in Medicine. 1998-2000: University Halle, Germany: Matthias Last name: Christgen Date of birth: 27.01.1979 Country: Germany E-mail: Matthias

Manstein, Dietmar J.

146

Media Transatlantic IV March 29 31, 2012, University of Paderborn, Germany  

E-Print Network [OSTI]

Media Transatlantic IV March 29 ­ 31, 2012, University of Paderborn, Germany Traffic Aiming to bring together media scholars from the United States, Canada, and Germany, the conference continues Schabacher (University of Siegen, Germany): Traffic as 'Dirt Experience'. Harold Innis' Tracing of Media. 04

Paderborn, Universität

147

Living and working in Germany A guide for international scientists at Max Planck Institutes  

E-Print Network [OSTI]

Living and working in Germany A guide for international scientists at Max Planck Institutes #12 and the hospitality in your town. You will quickly find that Germany is a country of many facets ­ a country Planck Society is Germany's most successful scientific or- ganisation in basic research. Max Planck

148

The Max Planck Society At home in Germany -present throughout the world  

E-Print Network [OSTI]

1 The Max Planck Society At home in Germany - present throughout the world Internationalisation ­ the Max Planck Society's role in safeguarding Germany's future Cooperation across national borders is one the internationalisation of science, both on its own behalf and also on behalf of Germany as a research location. To do

149

Wolfgang Ketterle Education Pre-diploma (Vordiplom), Physics, University of Heidelberg, Germany, 1978  

E-Print Network [OSTI]

Wolfgang Ketterle Education · Pre-diploma (Vordiplom), Physics, University of Heidelberg, Germany, Germany, 1982. · Ph.D., Physics, Ludwig-Maximilians University of Munich and Max-Planck Institute for Quantum Optics, Garching, Germany, 1986. Employment 1982-88 Research assistant (1982-85) and staff

150

Determinants and Income Effects of Commuting and Migration An empirical analysis for Germany after Unification  

E-Print Network [OSTI]

Determinants and Income Effects of Commuting and Migration An empirical analysis for Germany after differentials between East and West Germany led to massive commuting and migration flows. In this paper we: Human capital and income, Germany, commuting, migration, GSOEP JEL No.: J31, J61, O15 Address: Institute

Pfeifer, Holger

151

ICT Conference on Energetic Materials June 24-27, 2008 Karlsruhe, Germany  

E-Print Network [OSTI]

39th ICT Conference on Energetic Materials June 24-27, 2008 Karlsruhe, Germany 1 Detonation of Meta on Energetic Materials June 24-27, 2008 Karlsruhe, Germany 2 The smallest meta-stable carbon cluster found-27, 2008 Karlsruhe, Germany 3 accumulated energy is released upon fission of the boat ensemble

Geddes, Cameron Guy Robinson

152

CLIMATOLOGY OF VERTICAL AIR MOTION DURING RAINFALL IN NIAMEY, NIGER AND BLACK FOREST, GERMANY USING AN  

E-Print Network [OSTI]

CLIMATOLOGY OF VERTICAL AIR MOTION DURING RAINFALL IN NIAMEY, NIGER AND BLACK FOREST, GERMANY USING in Niamey, Niger and eight months in Germany's Black Forest. The AMF includes a vertically pointing 95 GHz of the orographically influenced precipitation in Germany's mountains. __________ NOTICE: This manuscript has been

153

(Re)discovering the Social Responsibility of Business in Germany Ariane Berthoin Antal  

E-Print Network [OSTI]

1 (Re)discovering the Social Responsibility of Business in Germany Ariane Berthoin Antal Professor The concept of corporate social responsibility (CSR) is a relatively recent addition to the agenda in Germany agreements. But the past decade has seen significant changes in Germany, challenging established ways

Paris-Sud XI, Université de

154

The Younger Dryas cooling in northeast Germany: summer temperature and environmental changes in  

E-Print Network [OSTI]

The Younger Dryas cooling in northeast Germany: summer temperature and environmental changes, Germany Received 9 December 2011; Revised 7 March 2012; Accepted 9 March 2012 ABSTRACT: A lake sediment record from the Friedla¨nder Grobe Wiese in northeast Germany was studied to reconstruct summer

Bern, Universität

155

April 30 May 2, 2008 SAGT 2008, Paderborn, Germany 1 Facets of the  

E-Print Network [OSTI]

April 30 ­ May 2, 2008 SAGT 2008, Paderborn, Germany 1 Facets of the Fully Mixed Nash Equilibrium Conjecture Rainer Feldmann University of Paderborn, Germany Marios Mavronicolas University of Cyprus, Cyprus Andreas Pieris University of Oxford, UK #12;April 30 ­ May 2, 2008 SAGT 2008, Paderborn, Germany 2

Mavronicolas, Marios

156

Nuremberg, Germany, 27-29 March 2001 International Congress for Particle Technology  

E-Print Network [OSTI]

- 1 - Nuremberg, Germany, 27-29 March 2001 International Congress for Particle Technology Christian 55128 Mainz Germany Email: jonas@mpip-mainz.mpg.de Abstract Session: Headline 17: Nanoscale Materials in a sub-monolayer on a cationic square. #12;- 2 - Nuremberg, Germany, 27-29 March 2001 International

Jonas, Ulrich - Institute of Electronic Structure and Laser, Foundation for Research and Technology

157

15 17 June 2011, T-Labs Berlin Germany Innovative Internet  

E-Print Network [OSTI]

15 ­ 17 June 2011, T-Labs Berlin Germany Innovative Internet Community Systems Welcome to the 11th Berlin/Germany, 15 ­ 17 June 2011 OrgTeam Deutsche Telekom Laboratories & Technische Universität Berlin #12;15 ­ 17 June 2011, T-Labs Berlin Germany Innovative Internet Community Systems Opening Session I2

Rossak, Wilhelm R.

158

Monday, March 27th Opening Remarks: Sybille Hellebrand; Paderborn University, Germany  

E-Print Network [OSTI]

Monday, March 27th Opening Remarks: Sybille Hellebrand; Paderborn University, Germany 18 Hellebrand; Paderborn University, Germany Fault Model Driven Functional Test for PowerPC Microprocessor Processor Christian Zöllin; Stuttgart University, Germany Testability Features of a 45nm Processor Design

Hellebrand, Sybille

159

The political system of Germany Das politische System DeutschlandsRalph Schneider  

E-Print Network [OSTI]

The political system of Germany Das politische System DeutschlandsRalph Schneider ASSIST-Meeting | 17.06.08 #12;ASSIST-Meeting 17.06.08 | Ralph Schneider: The political system of GermanySeite 2 Federal Republic of Germany Bundesrepublik Deutschland Basic information Democratic and social federal

Pfeifer, Holger

160

Country Profile -Germany What are my chances of getting a job?  

E-Print Network [OSTI]

1 Country Profile - Germany Job market What are my chances of getting a job? New graduates from the UK rarely secure work at a professional level in Germany, except teaching English as a foreign. How to improve your chances: you are more likely to secure graduate-level work in Germany if you first

Banaji,. Murad

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

EASA Institute of Advanced Studies on Sustainability, Munich -Germany ResponseResponse  

E-Print Network [OSTI]

EASA Institute of Advanced Studies on Sustainability, Munich - Germany ResponseResponse ofof WaterClimate Change Peter A. Wilderer Munich, Germany L. A. Colding Lecture, DTU Lyngby, Denmark, 19-06-2007 #12;EASA Institute of Advanced Studies on Sustainability, Munich - Germany content some general thoughts WS&T ­ long

Mosegaard, Klaus

162

Why Are Residential PV Prices in Germany So Much Lower Than in the United States?  

E-Print Network [OSTI]

Why Are Residential PV Prices in Germany So Much Lower Than in the United States? A Scoping is significantly lower in Germany than in the U.S., due primarily to differences in "soft" costs ­ But relatively consultant data relevant to the cost structure of residential PV in Germany · Focus is the pre

163

published in 1984 in West Germany and later released in a bilingual Ger-  

E-Print Network [OSTI]

published in 1984 in West Germany and later released in a bilingual Ger- man-English edition- grated to West Germany. In her next novel, Reisende auf einem Bein (1989; Traveling on One Leg, 1998 in Romania by starting a new life as an émigré in Germany. In her next novel, Heute wär ich mir lieber nicht

Berry, R. Stephen

164

TENDER: Grants for Partizipation University of Siegen (Germany) and Qafqaz University (Azerbaijan)  

E-Print Network [OSTI]

for Partizipation University of Siegen (Germany) and Qafqaz University (Azerbaijan) International Summer School "Security Issues in the South Caucasus and Central Asia" at Siegen (Germany) from August 12th with participants from Azerbaijan, Georgia, Germany and Kazakhstan will focus on security issues arising from

Siegen, Universität

165

Operational costs induced by fluctuating wind power production in Germany and Scandinavia  

E-Print Network [OSTI]

Operational costs induced by fluctuating wind power production in Germany and Scandinavia Peter Christoph Weber, Chair of Energy Management, University Duisburg-Essen, Germany Rüdiger Barth & Heike Brand, Institute of Energy Economics and the Rational Use of Energy, University of Stuttgart, Germany Abstract

166

CCMM 2000, Bayreuth, Germany September 19 1 Design and Synthesis of an FLC Conglomerate  

E-Print Network [OSTI]

CCMM 2000, Bayreuth, Germany · September 19 1 Design and Synthesis of an FLC Conglomerate Composed Research Center University of Colorado at Boulder #12;CCMM 2000, Bayreuth, Germany · September 19 2 Sm · Rel Polarity #12;CCMM 2000, Bayreuth, Germany · September 19 3 SmCSPF (Ferroelectric Conglomerate) Sm

Walba, David

167

Contributions to the FEL'99 Conference, August 23-28, 1999 in Hamburg, Germany  

E-Print Network [OSTI]

Contributions to the FEL'99 Conference, August 23-28, 1999 in Hamburg, Germany TESLA FEL-Report 1999-07 #12;Contents M. Dohlus, A. Kabel, T.Limberg DESY, Germany Coherent Effects of a Macrobunch, Germany Efficient Field Calculation of 3D Bunches on General Trajectories

168

Cyclical adjustment, capital-labor substitution and total factor productivity convergence East Germany after unification  

E-Print Network [OSTI]

Germany after unification Werner Smolny, University of Ulm June 22, 2011 Abstract Despite rapid economic of Ulm 89069 Ulm, GERMANY Tel.: (49) 731 50 24260, Fax: (49) 731 50 24262 e-mail: Werner.Smolny@uni-ulm.de This paper is part of the research projects "Productivity adjustment in East Germany"and "Investment in East

Pfeifer, Holger

169

CURRICULUM VITAE -Werner Weber August 16 1945 born in Urach, state Baden/Wrttemberg, Germany  

E-Print Network [OSTI]

CURRICULUM VITAE - Werner Weber August 16 1945 born in Urach, state Baden/Württemberg, Germany June 20 1964 Graduation (Abitur) Allgäu-Gymnasium Kempten, Germany November 1 1964 Study of physics at Technische Universität to February 3 1970 Munich, Germany, Degree "Diplomphysiker" July 13 1972 Ph

Anders, Frithjof

170

NETHERLANDS AND GERMANY: DAIRY GOAT PRODUCTS June 15 -June 18, 2009  

E-Print Network [OSTI]

NETHERLANDS AND GERMANY: DAIRY GOAT PRODUCTS June 15 - June 18, 2009 Written by Clara Hedrich-890-3014 babcock@cals.wisc.edu http://babcock.cals.wisc.edu ISBN 978-1-59251-121-3 #12;Netherlands and Germany cheese produced in the region of Germany where the Hedrich family originated and possibly use it in our

Wisconsin at Madison, University of

171

The event is free and open to the public "Germany in Europe" Campus Weeks  

E-Print Network [OSTI]

The event is free and open to the public "Germany in Europe" Campus Weeks German Embassy and German Educator Seattle, WA and Cologne, Germany Marcel Machill Professor of Journalism and International Media Systems University of Leipzig, Germany Randy Smith, Co-director, MU Center for the Digital Globe Donald W

Missouri-Columbia, University of

172

Hitzler & Vrandecic PPSWR05 Dagstuhl, Germany September 2005 AIFBKnowledgeWeb  

E-Print Network [OSTI]

Hitzler & Vrandecic PPSWR05 Dagstuhl, Germany September 2005 Slide 1 AIFBKnowledgeWeb Faster OWL Using Split Programs Pascal Hitzler Denny Vrandecic AIFB, University of Karlsruhe, Germany SCREECH #12;Hitzler & Vrandecic PPSWR05 Dagstuhl, Germany September 2005 Slide 2 AIFBKnowledgeWeb Problem

Hitzler, Pascal

173

Downburst-producing thunderstorms in southern Germany: Radar analysis and predictability  

E-Print Network [OSTI]

Downburst-producing thunderstorms in southern Germany: Radar analysis and predictability Nikolai der Atmosphäre, Oberpfaffenhofen, 82234 Wessling, Germany b European Severe Storms Laboratory (ESSL), Münchner Str. 20, 82234 Wessling, Germany a r t i c l e i n f o a b s t r a c t Article history: Received

174

Hitzler Neural-Symbolic Integration Osnabrck Germany November 2007 Neural-Symbolic Integration  

E-Print Network [OSTI]

Hitzler Neural-Symbolic Integration Osnabrück Germany November 2007 1/49 AIFBAIFB Neural-Symbolic Integration PD Dr. Pascal Hitzler AIFB, Universität Karlsruhe Osnabrück, Germany, November 2007 #12;Hitzler Neural-Symbolic Integration Osnabrück Germany November 2007 2/49 AIFBAIFB PD Dr. Pascal Hitzler

Hitzler, Pascal

175

Curriculum vitae 1989 -1992 Student of Biochemistry, University of Hanover, Germany  

E-Print Network [OSTI]

Curriculum vitae 1989 - 1992 Student of Biochemistry, University of Hanover, Germany 1989 - 1995, Professor Karl-Josef Dietz, University of Bielefeld, Germany 2000 - 2006 Leader of an Independently Funded-Golm, Germany Biofuture Prize, German Federal Ministry of Education and Research 07/2006 Habilitation

Gerwert, Klaus

176

August 2014 Subject: Research in Germany-Information Seminar for Young Researchers  

E-Print Network [OSTI]

26th August 2014 Subject: Research in Germany- Information Seminar for Young Researchers Warm-doctoral candidates as well as young academics interested in a research stay in Germany, towards initiating & strengthening research co operations with Germany. Date: 20th September 2014 Venue: IC & SR Auditorium, IIT

Krishnapura, Nagendra

177

The 32nd International Electric Propulsion Conference, Wiesbaden, Germany September 11 15, 2011  

E-Print Network [OSTI]

The 32nd International Electric Propulsion Conference, Wiesbaden, Germany September 11 ­ 15, 2011 1 Electric Propulsion Conference, Wiesbaden · Germany September 11 ­ 15, 2011 K. Matyash1 , Max-Planck-Institut für Plasmaphysik, EURATOM Association, Greifswald, D-17491, Germany R. Schneider2 , Greifswald

178

R E S U M E Renewable Energy for Sustainable Development of Indonesia and Germany  

E-Print Network [OSTI]

R E S U M E Renewable Energy for Sustainable Development of Indonesia and Germany (RESDIG Republic of Germany, German Alumni in Surabaya with supports from DAAD, GIZ and Goethe Institute. Through the cooperation and share experiences between Indonesia and Germany in renewable and sustainable

Peinke, Joachim

179

Yngve Kristoffersen, University of Bergen, Allegaten 41, Bergen, 5007 Norway, yngve.kristoffersen@geo.uib.no Coen Hofstede, AWI, Bremerhaven, Germany  

E-Print Network [OSTI]

.kristoffersen@geo.uib.no Coen Hofstede, AWI, Bremerhaven, Germany Olaf Eisen, AWI, Bremerhaven, Germany Lomonosov Canada Basin Coen Hofstede, AWI, Bremerhaven, Germany Olaf Eisen, AWI, Bremerhaven, Germany Richard Blenkner, Dept

Kristoffersen, Yngve

180

World Renewable Energy Congress VII, Cologne, Germany, 29 June -5 July, 2002 SOLAR RESOURCE ASSESSMENT AND SITE EVALUATION  

E-Print Network [OSTI]

World Renewable Energy Congress VII, Cologne, Germany, 29 June - 5 July, 2002 SOLAR RESOURCE, Germany ** German Aerospace Center (DLR), Institute of Atmospheric Physics, Oberpfaffenhofen, Germany VII, Cologne, Germany, 29 June - 5 July, 2002 and diffuse irradiance model of Dumortier [5]. Both use

Heinemann, Detlev

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Bundestag elections 2009: The political system of Germany Bundestagswahl 2009: Das politische System DeutschlandsRalph Schneider  

E-Print Network [OSTI]

Bundestag elections 2009: The political system of Germany Bundestagswahl 2009: Das politische Schneider: The political system of GermanySeite 2 Federal Republic of Germany Bundesrepublik Deutschland.09.09 | Ralph Schneider: The political system of GermanySeite 3 Administrative organisation

Pfeifer, Holger

182

Groups and Model TheoryGroups and Model TheoryGroups and Model TheoryGroups and Model Theory "Die Wolfsburg", Mlheim a.d.Ruhr, Germany"Die Wolfsburg", Mlheim a.d.Ruhr, Germany"Die Wolfsburg", Mlheim a.d.Ruhr, Germany"Die Wolfsburg", Mlheim a.d.Ruhr, Germa  

E-Print Network [OSTI]

Wolfsburg", Mülheim a.d.Ruhr, Germany"Die Wolfsburg", Mülheim a.d.Ruhr, Germany"Die Wolfsburg", Mülheim a.d.Ruhr, Germany"Die Wolfsburg", Mülheim a.d.Ruhr, Germany May 30May 30May 30May 30--------June 3, 2011June 3, 2011

Tent, Katrin

183

Westport Germany GmbH | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative Jump to: navigation,WesternWestley,2009294°,8908021°,Westport Germany

184

Page 1 of 4 Postfach 10 10 62 -80084 Mnchen, Germany  

E-Print Network [OSTI]

Page 1 of 4 Postfach 10 10 62 - 80084 München, Germany Telefon: +49 89 2108-0 Fax: +49 89 2108-1111 Internet: http://www.mpfp.mpg.de Jean-Paul-Stra�e 12 - 53173 Bonn, Germany Telefon: +49 228 833-0 Fax: +49 themselves in Germany or which should be developed further. The 2014 Max Planck Research Award

185

CS 2011, 15 17 June 2011, T-Labs Berlin Germany Innovative Internet  

E-Print Network [OSTI]

11th I2 CS 2011, 15 ­ 17 June 2011, T-Labs Berlin Germany Innovative Internet Community Systems I2, 15 ­ 17 June 2011, T-Labs Berlin Germany Pre-Conference Events Tuesday: Informal Welcome Reception Wednesday morning: Gro�er Tiergarten Jogging #12;11th I2 CS 2011, 15 ­ 17 June 2011, T-Labs Berlin Germany

Rossak, Wilhelm R.

186

Xenophobia in a United Germany : a unique post-reunification phenomenon?.  

E-Print Network [OSTI]

??In the years immediately following the 1990 reunification of Germany, an increase in anti-foreigner violence threatened the stability of reunification efforts and exacerbated tensions between… (more)

Carden, Alison Elizabeth

2010-01-01T23:59:59.000Z

187

The Implementation of Environmental Education in elementary schools — A Comparative Study between Sweden and Germany —.  

E-Print Network [OSTI]

??The investigation on Environmental Education (EE) and its implementation in elementary schools in the EU-member states Germany and Sweden was done through field theoretical studies… (more)

Radeiski, Jenny

2009-01-01T23:59:59.000Z

188

Fiftieth CCR reformer goes on stream in Germany  

SciTech Connect (OSTI)

The fiftieth continuous catalytic reformer built since this technology was introduced by UOP Process Division in 1971 has gone on stream in West Germany. The 21,300-b/sd unit is in Deutsche Shell AG's Godorf refinery. It is the sixth such unit put in service by Shell International. Others are in refineries at Harburg, West Germany; Shellhaven, England; Palau Bokum, Singapore; Pernis, Netherlands; and Geelong, Australia. CCR units operate at much higher severity than older reforming units. Severity is a function of higher octane, lower pressure, and feedstock. The operating severity or catalyst deactivation rate may be 20 times that of high pressure, low octane units. Continuous catalyst regeneration is then the key for maintaining long-term operations at steady state conditions. To facilitate continuous catalyst regeneration, the three reactors are stacked. This design permits the catalyst to move in essentially plug flow through the reactors at a rate determined by the rate of catalyst withdrawal to the regeneration section.

Not Available

1985-03-18T23:59:59.000Z

189

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany Data Management and Operations Division  

E-Print Network [OSTI]

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei München, Germany Data Management and Operations-Schwarzschild-Str. 2, 85748 Garching bei München, Germany CHANGE RECORD ISSUE DATE SECTION/PARA. AFFECTED REASON Phase 3 Workshop, ESO Garching, 30.11.2010. 2 07.03.2011 3, 4.11, 4.12 Added All Figures updated #12;ESO

Liske, Jochen

190

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei Mnchen, Germany Data Management and Operations Division  

E-Print Network [OSTI]

ESO, Karl-Schwarzschild-Str. 2, 85748 Garching bei München, Germany Data Management and Operations-Schwarzschild-Str. 2, 85748 Garching bei München, Germany CHANGE RECORD ISSUE DATE SECTION/PARA. AFFECTED REASON Workshop, ESO Garching, 30.11.2010. 2 07.03.2011 2.1 Keyword ASSOMi added. 3.2.1, 3.2.2 NJITTER, DIT, NDIT

Liske, Jochen

191

Consumption, Social Capital, and the 'Industrious Revolution' in Early Modern Germany  

E-Print Network [OSTI]

Consumption, Social Capital, and the “Industrious Revolution” in Early Modern Germany SHEILAGH OGILVIE Faculty of Economics, University of Cambridge Acknowledgements: I am grateful to Marco Belfanti, André... ; labour; discrimination; gender; Germany 1 Expanding market consumption is widely ascribed a key role in European economic growth before industrialization. A “Consumer Revolution” between 1650 and 1800 is thought to have seen the middle classes...

Ogilvie, Sheilagh

192

Fachbereich Informatik der Universitat Hamburg Vogt-Kolln-Str. 30 D-22527 Hamburg / Germany  

E-Print Network [OSTI]

Fachbereich Informatik der Universit¨at Hamburg Vogt-K¨olln-Str. 30 D-22527 Hamburg / Germany¨oller University of Hamburg, Computer Science Department, Vogt-K¨olln-Str. 30, 22527 Hamburg, Germany http2000), Fausto Giunchiglia and Bart Selman (eds), Breckenridge, Colorado, USA, 12-15 April 2000. 1

Hamburg,.Universität

193

Proposals in for Czech firms; cooperation likely with eastern Germany  

SciTech Connect (OSTI)

Two Western groups - Shell and a consortium made up of Agip, Conoco, and Total - have offered to buy the refining operations of Chemopetrol Litvinov and Kaucuk Kralupy, both in the Czech republic. Meanwhile, Amoco, Neste, and PCD are looking at the possibility of acquiring some of the plastics plants at Litvinov. Amoco is interested in the polypropylene operations, Neste in polyethylene, and PCD in both. The two Czech firms are included in the second wave of privatization, which will begin in midyear. So far, there have been no offers for the 80,000-m.t./year polystyrene and 60,000-m.t./year styrene butadiene rubber operations belonging to Kralupy, although Atochem representatives recently visited the plants. Litvinov is carrying out revamping operations at its core unit, a 12-year-old, 450,000-m.t./year ethylene plant. The plant, currently running at 400,000 m.t./year, supplies downstream plants, Neratovice, and sells on the export markets. An existing ethylene pipeline between Litvinov and Bohlen in eastern Germany, which used to supply an average 100,000 m.t./year of ethylene to Bohen in exchange for naphtha, is virtually unused. One proposal involves reactivating this exchange to secure ethylene feedstock for plants in eastern Germany. According to some sources, a preliminary decision has been made to shut down the 100,000-m.t./year ethylene plant at Leuna and possibly to expand the Bohlen cracker by 100,000 m.t./year, to 400,000 m.t./year by the late 1990s.

Alperowicz, N.

1993-02-10T23:59:59.000Z

194

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

195

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

196

Immigration Policy, Labor Market Regulation and the Welfare State: A Comprehensive Look at Immigrant Labor Market Integration in Germany, Great Britain, the United States and Canada  

E-Print Network [OSTI]

and the Welfare State in Germany and the United States:of Male Immigrants in Germany, European Sociological Review:in the United States and Germany. New York: Berghahn Books;

2008-01-01T23:59:59.000Z

197

Does the market value R&D investment by European firms? Evidence from a panel of manufacturing firms in France, Germany, and Italy  

E-Print Network [OSTI]

in Belgium, France, Germany and the UK: a comparison usingR&D and productivity in Germany and the United Kingdom. CEPcontrol: a study of France, Germany and the UK. Economic

Hall, Bronwyn H.; Oriani, R

2006-01-01T23:59:59.000Z

198

Jewish "Shtetls" in Postwar Germany: An Analysis of Interactions Among Jewish Displaced Persons, Germans, and Americans Between 1945 and 1957 in Bavaria  

E-Print Network [OSTI]

Middleton, Drew. "Into Germany with the First Army." NewJews in Post-Holocaust Germany, 1945-1953. Cambridge, UK ;in Post- World War II Germany. Evanston, Ill. : Northwestern

Crago-Schneider, Kierra Mikaila

2013-01-01T23:59:59.000Z

199

Atmos. Chem. Phys., 11, 90899139, 2011 www.atmos-chem-phys.net/11/9089/2011/  

E-Print Network [OSTI]

the "Halloween" solar proton event: the High Energy Particle Precipitation in the Atmosphere (HEPPA) model versus of Bremen, Bremen, Germany 11Earth Observation Unit, Finnish Meteorological Institute, Helsinki, Finland 12Department of Physics, University of Helsinki, Helsinki, Finland 13FB Physik, University of Osnabr

Meskhidze, Nicholas

200

Influence of the water content on X-ray fluorescence core-scanning measurements in soft marine sediments  

E-Print Network [OSTI]

Margins, University of Bremen, Leobener Strasse, D-28359 Bremen, Germany [1] The X-ray fluorescence (XRF properties such as density and water content on XRF core scanner data. Comparison of XRF scanner measurements of the measurements taken at the sediment surface to the amount of water in the sample volume analyzed by the XRF core

Tjallingii, Rik

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Environment Salzgitter  

E-Print Network [OSTI]

of Bremen, TZi Germany #12; Project Frame #15; UMTS protocol stack #15; Siemens AG, Salzgitter: development transformation into graph of state transitions 2. on-the- y, automatic, real-time generation / execution Bredereke, Univ. of Bremen 6 #12; Manual Interfacing to SDL human specifier Siemens: test cases executable

Bredereke, Jan - Fachbereich 3

202

Changing Ethnic Identities in Post-National Germany: A Study of Turkish-German Literature, Politics, and Society  

E-Print Network [OSTI]

1 Changing Ethnic Identities in Post-National Germany: A Study of Turkish-German Literature-Muslim immigrant communities in Germany. Women belonging to highly conservative Muslim families were murdered (The Foreign Bride), which details the practice of trafficking under-age Turkish brides to Germany

New Hampshire, University of

203

Wegelerstrae 6 53115 Bonn Germany phone +49 228 73-3427 fax +49 228 73-7527  

E-Print Network [OSTI]

Wegelerstraÿe 6 53115 Bonn Germany phone +49 228 73-3427 fax +49 228 73-7527 www Simulation, Universität Bonn, 53115 Bonn, Germany; Correspond with chernov@hcm.uni-bonn.de #12;#12;Noname Simulation, University of Bonn Endenicher Allee 60, 53115 Bonn, Germany Tel.: +49-228-7362246 Fax: +49

Bartels, Soeren

204

IAD Scientific Assembly 2013, Potsdam, Germany, Sept 1-6, 2013 On the capability of non-dedocated GPS-  

E-Print Network [OSTI]

IAD Scientific Assembly 2013, Potsdam, Germany, Sept 1-6, 2013 On the capability of non Geodesy, Graz University of Technology, Austria #12;IAD Scientific Assembly 2013, Potsdam, Germany, Sept 1-5 year data gap (?) year #12;IAD Scientific Assembly 2013, Potsdam, Germany, Sept 1-6, 2013 high-low SST

Stuttgart, Universität

205

D.D.E. Long, A. Amer and R. Burns July 2002, Munich, Germany Group-Based Management of  

E-Print Network [OSTI]

© D.D.E. Long, A. Amer and R. Burns July 2002, Munich, Germany Group-Based Management, Germany Outline Motivation The Aggregating Cache Successor prediction and tracking Client Cache, Germany Motivation Improved client & server caching by grouping Reduced miss rates means fewer demand

Pâris, Jehan-François

206

Wage differentials between East and West Germany Are they related to the location or to the people?  

E-Print Network [OSTI]

Wage differentials between East and West Germany Are they related to the location or to the people help from the Federal Government large wage differences between East and West Germany still persist. We their income in both, East and West Germany, the effect of the location can be identified. The results indicate

Pfeifer, Holger

207

Max Planck Institute for Biological Cybernetics, Tbingen, Germany VSS 2002, #18.3 ID501 Spatial updating in virtual environments  

E-Print Network [OSTI]

Max Planck Institute for Biological Cybernetics, Tübingen, Germany VSS 2002, #18.3 ID501 Spatial: What are vestibular cues good for? MPI for Biological Cybernetics, Germany 2 "Voluntary" vs Cybernetics, Germany 3 Methods - Setup · Vestibular stimuli: 6 dof Motion Platform · Visual stimuli: LCD video

208

Literaturlenz: Reading with Authors from Germany, Switzerland, and Austria Reading with Larissa Boehning, Monica Cantieni, and Linda Stift  

E-Print Network [OSTI]

Literaturlenz: Reading with Authors from Germany, Switzerland, and Austria Reading with Larissa.m. Each year Literaturlenz brings authors from Germany, Switzerland, and Austria to the UW Campus. Each Boehning from Germany, Monica Cantieni from Switzerland, and Linda Stift of Austria. The readings

Sheridan, Jennifer

209

Presented at the 21th European Photovoltaic Solar Energy Conference, Dresden, Germany, 4-8 September 2006  

E-Print Network [OSTI]

Presented at the 21th European Photovoltaic Solar Energy Conference, Dresden, Germany, 4 SonnenStrom AG, Schillerstr. 1/6, 89077 Ulm, Germany V.M. Fthenakis, vmf@bnl.gov, Phone +1 631 344 2830 in Western-Europe (mainly Germany) and designed as described in section 3. Data on material quantities were

210

Bremen, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: EnergyBoston Area Solar EnergyBradbury,BraytonOpen Energy

211

Apprentice pay in Britain, Germany, and Switzerland: institutions, market forces and market power  

E-Print Network [OSTI]

The pay of metalworking apprentices is high in Britain, middling in Germany and low in Switzerland. We analyse these differences using fieldwork evidence and survey data, drawing on both economic and institutionalist theories. Several institutional...

Ryan, Paul; Backes-Gellner, Uschi; Teuber, Silvia; Wagner, Karin

2013-07-29T23:59:59.000Z

212

System transferability of public hospital facility management between Germany and Iran.  

E-Print Network [OSTI]

??The subject of this PhD-thesis is the transferability of Facility Management (FM) by using the example of hospitals in Germany and Iran. The intention is… (more)

Banedj-Schafii, Mandana

2009-01-01T23:59:59.000Z

213

The contemporary International Building Exhibition (IBA) : innovative regeneration strategies in Germany  

E-Print Network [OSTI]

The Internationale Bauausstellung or International Building Exhibition (IBA) is a planning methodology implemented over the course of the 20th century and into the 21st century in Germany. The IBA is unique and characterized ...

Shay, Alice (Alice Ann)

2012-01-01T23:59:59.000Z

214

Disparities in nuclear power plant performance in the United States and the Federal Republic of Germany  

E-Print Network [OSTI]

This report presents data comparing the performance of light water reactors in the United States and the Federal Republic of Germany (FRG). The comparisons are made for the years 1980-1983 and include 21 Westinghouse ...

Hansen, Kent F.

1984-01-01T23:59:59.000Z

215

say Andr Schirmeisen of the University of Mnster, Germany, and his colleagues.  

E-Print Network [OSTI]

burning in Thailand and Indonesia dropped steeply across the 50-kilometre-wide boundary. They conclude for Coal Research in Mülheim an der Ruhr, Germany. Specifically, a liquid made of an alkylmethylimidazolium

Cai, Long

216

Feminist Cross-cultural Research: Observations from a Research Project in Germany  

E-Print Network [OSTI]

Recent research indicates that the rapid imposition of West German structures (policy, economy, culture) on East Germany caused economic hardships and personal insecurities which Ieave many East German women feeling vulnerable. This essay depicts...

Adler, Marina A.

1997-04-01T23:59:59.000Z

217

A comparative study of the diffusion of antihypertensive and antidepressant medications in Germany in Japan  

E-Print Network [OSTI]

This thesis analyzes and compares the diffusion of antihypertensive and antidepressant medications in Germany and Japan during the time period of 1992 and 2003. The antihypertensive medications are classified as new, middle ...

Cui, Ling, 1978-

2005-01-01T23:59:59.000Z

218

Why Are Resiential PV Prices in Germany So Much Lower Than in the United States?  

Broader source: Energy.gov [DOE]

The U.S. Department of Energy (DOE) SunShot Initiative, in conjunction with the Lawrence Berkeley National Laboratory (LBNL) discusses the installed price of residential PV being significantly lower in Germany than in the United States.

219

Energy-Optimised Building- Experience and Future Perspectives from a Demonstration Programme in Germany  

E-Print Network [OSTI]

energy savings of 50% and more compared to current practice in Germany, without exceeding conventional investment costs. A number of these projects have been awarded architectural prizes. This paper summarises key findings and explains the strategies...

Hans, O.; Voss, K.; Wagner, A.; Gossner, H.; Grunewald, J.; Petzold, H.; Herkel, S.; Pfafferott, J.; Lehmann, D.; Neumann, C.

220

Kinaesthetic impulses : aesthetic experience, bodily knowledge, and pedagogical practices in Germany, 1871-1918  

E-Print Network [OSTI]

This dissertation studies a moment of transition in German aesthetics in the late nineteenth century. Starting in the 1870s, groups of artists, architects, historians, critics, connoisseurs, and museum officials in Germany ...

Çelik, Zeynep, Ph. D. Massachusetts Institute of Technology

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Builders of a Nation: Women’s Experiences in Postwar Germany  

E-Print Network [OSTI]

?? 45 Builders of a Nation: Women’s Experiences in Postwar Germany Barbara Brennan The German women who survived the Second World War are often characterized by the familiar images of long lines of women digging the country out from... underneath the rubble. However, their contributions to the rebuilding of Germany reach much further than the act of physically rebuilding the country. The sacrifices required of them for the survival their families and themselves were tremendous...

Brennan, Barbara

2011-04-01T23:59:59.000Z

222

A Review of "Poetry and Parental Bereavement in Early Modern Lutheran Germany" by Anna Linton  

E-Print Network [OSTI]

204 seventeenth-century news Anna Linton. Poetry and Parental Bereavement in Early Modern Lutheran Germany. Oxford: Oxford University Press, 2008. xvi + 319 pp. $110.00. Review by susan r. boettcher, university of texas at austin. Anna Linton... among Lutheran authors in early modern Germany. As sources, she uses sixteenth- and seventeenth-century commemorative poetry, books of consolation, and funeral publications found at the Herzog August Bibliothek in Wolfenb...

Boettcher, Susan R.

2009-01-01T23:59:59.000Z

223

E-Print Network 3.0 - argon nitrides Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

I?MAYR Sti+ng Institutfur Werkstofiechnik... ,Badgasteiner Str: 3, 2800Bremen 33, Germany Abstract Aluminium nitride (AlN) is a ve interestin ceramic because... the use %of...

224

Data extraction from dense 3D surface models  

E-Print Network [OSTI]

Bowman,A. Bock,M. Bowman,J. Siebert,P. Compstat 2002, proc 15th Int Conf on Computational Statistics, August 24-28, Bremen, Germany, 2002

Bowman, A.; Bock, M.; Bowman, J.

225

Julia Reece, Curriculum Vitae, 2013 JULIA S. REECE  

E-Print Network [OSTI]

of mudrocks, shale gas reservoirs, and caprocks for CO2 sequestration; Shale stratigraphy; Experimental soil of Bremen, Germany NON-ACADEMIC EMPLOYMENT 2007 Geoscience Intern Shell Oil Company, E&P, Houston, TX 2003

226

Bernhard Grimm, Humboldt University, Berlin, Germany; Robert J. Porra, CSIRO Plant Industry, Canberra, ACT, Australia; Wolfhart Rdiger, Mnchen University, Mnchen, Germany; Hugo  

E-Print Network [OSTI]

interest in solar energy, this collection on the chlorophylls is most timely, covering the latest aspects the biological process of photosynthesis to include such topics as solar energy conversion, environmental science, Canberra, ACT, Australia; Wolfhart Rüdiger, München University, München, Germany; Hugo Scheer, München

Govindjee "Gov"

227

UNCCD Office location: UNCCD, Hermann-Ehlers-Str. 10, D -53113 Bonn, Germany Postal address: P.O. Box 260129, D -53153 Bonn, Germany  

E-Print Network [OSTI]

threaten the processes that sustain the global ecosphere and life on earth. 2. The United Nations.O. Box 260129, D - 53153 Bonn, Germany Achieving global sustainability through effective sustainable land.......................................................................................................................... 3 II. Achieving global sustainability through effective sustainable land management

Franz, Sven Oliver

228

Ownership Unbuilding in Electricity Markets - A Social Cost Benefit Analysis of the German TSO'S  

E-Print Network [OSTI]

OWNERSHIP UNBUNDLING IN ELECTRICITY MARKETS - A SOCIAL COST BENEFIT ANALYSIS OF THE GERMAN TSO’S Gert Brunekreeft1 Jacobs University Bremen Campus Ring 1 D-28759 Bremen Germany Email: g.brunekreeft@jacobs-university.de Version 2, August 11... , 2008 Abstract: This paper presents a social cost benefit analysis of ownership unbundling (as compared to legal und functional unbundling) of the electricity transmission system operators in Germany. The study relies on the Residual Supply Index...

Brunekreeft, Gert

229

An Exploration of the Effects of Language on the Orchestral Trombone Sound in France, Germany, and the United States.  

E-Print Network [OSTI]

??The orchestral trombone sound of France, Germany, and the United States was analyzed through the lens of language. A thorough investigation of the characteristic sounds… (more)

Mounger, Christine

2012-01-01T23:59:59.000Z

230

Greater flexibility, greater growth: A comparative study of labor and capitalist models in Japan, Germany, and the United States.  

E-Print Network [OSTI]

??After the end of the Second World War, three major economic powers emerged. Japan in Asia, Germany in Europe, and the United States in North… (more)

Thompson, Jay Arthur

2007-01-01T23:59:59.000Z

231

Jacobs University Bremen gGmbH Campus Ring 1 | 28759 Bremen  

E-Print Network [OSTI]

-of-the-art facilities. Admission to Jacobs University is need-blind and highly selective, based on academic merit · Master Thesis Proposal (semester 3) and Master Thesis (semester 4) PhD studies encompass (semesters 5 ­10

232

Comparing Germany's and California's Interconnection Processes for PV Systems (White Paper)  

SciTech Connect (OSTI)

Establishing interconnection to the grid is a recognized barrier to the deployment of distributed energy generation. This report compares interconnection processes for photovoltaic projects in California and Germany. This report summarizes the steps of the interconnection process for developers and utilities, the average length of time utilities take to process applications, and paperwork required of project developers. Based on a review of the available literature, this report finds that while the interconnection procedures and timelines are similar in California and Germany, differences in the legal and regulatory frameworks are substantial.

Tweedie, A.; Doris, E.

2011-07-01T23:59:59.000Z

233

17th European Biomass Conference and Exhibition 2009, Hamburg, Germany Lignocellulosic Ethanol: The Path to Market  

E-Print Network [OSTI]

17th European Biomass Conference and Exhibition 2009, Hamburg, Germany Lignocellulosic Ethanol of transport fuels from biomass is essential if the EU aspiration to substitute 10% of transport fuels investment in R&D in the US, Europe and Asia. The production of ethanol from lignocellulosic biomass

234

http://www.jstor.org Antiminority Riots in Unified Germany: Cultural Conflicts and Mischanneled Political  

E-Print Network [OSTI]

Political Participation Author(s): Roger Karapin Source: Comparative Politics, Vol. 34, No. 2, (Jan., 2002), pp. 147-167 Published by: Ph.D. Program in Political Science of the City University of New York@jstor.org. #12;Antiminority Riots in Unified Germany CulturalConflictsandMischanneledPoliticalParticipation Roger

Qiu, Weigang

235

Ina Lauth, Fraunhofer AIS, St. Augustin, Germany KDNet (NOE) , KDubiq (CA) and Beyond  

E-Print Network [OSTI]

1 Ina Lauth, Fraunhofer AIS, St. Augustin, Germany KDNet (NOE) , KDubiq (CA) and Beyond Codrina Lauth Fraunhofer AIS, Sankt Augustin and Institute for Computer Science III, University Bonn #12;2Lastname Outline Fraunhofer AIS and University Bonn will host ICML/ILP 2005 7-13 August 2005 EU Projects

Baeza-Yates, Ricardo

236

International Conference on Wood-based Bioenergy LIGNA+Hannover, Germany, 17-18 May 2007  

E-Print Network [OSTI]

International Conference on Wood-based Bioenergy LIGNA+Hannover, Germany, 17-18 May 2007 Photo: NTC Marketing Specialist and Sebastian Hetsch, Consultant Food and Agricultural Organization & UN Economic Commission for Europe Geneva, Switzerland #12;International Conference on Wood-based Bioenergy LIGNA

237

Fachbereich Informatik der Universitat Hamburg VogtKollnStr. 30 D22527 Hamburg / Germany  

E-Print Network [OSTI]

Fachbereich Informatik der UniversitË?at Hamburg Vogt­KË?olln­Str. 30 #6; D­22527 Hamburg / Germany MË?oller University of Hamburg, Computer Science Department, Vogt­KË?olln­Str. 30, 22527 Hamburg Selman (eds), Breckenridge, Colorado, USA, 12­15 April 2000. 1 Introduction Experiences with concept

Haarslev, Volker

238

The Role of the Green Party in Germany's Renewable Energy Policy  

E-Print Network [OSTI]

The Role of the Green Party in Germany's Renewable Energy Policy A Healthy Serving of Greens power, increasing reliance on renewable energy Renewable Energy Sources Act of 2000 and 2004 -provided grid access and stable prices for renewables Market Liberalization with the Energy Supply Act of 1998

New Hampshire, University of

239

Proceedings of Workshop on Uranium Production Environmental Restoration: An exchange between the United States and Germany  

SciTech Connect (OSTI)

Scientists, engineers, elected officials, and industry regulators from the United, States and Germany met in Albuquerque, New Mexico, August 16--20, 1993, in the first joint international workshop to discuss uranium tailings remediation. Entitled ``Workshop on Uranium Production Environmental Restoration: An Exchange between the US and Germany,`` the meeting was hosted by the US Department of Energy`s (DOE) Uranium Mill Tailings Remedial Action (UMTRA) Project. The goal of the workshop was to further understanding and communication on the uranium tailings cleanup projects in the US and Germany. Many communities around the world are faced with an environmental legacy -- enormous quantities of hazardous and low-level radioactive materials from the production of uranium used for energy and nuclear weapons. In 1978, the US Congress passed the Uranium Mill Tailings Radiation Control Act. Title I of the law established a program to assess the tailings at inactive uranium processing sites and provide a means for joint federal and state funding of the cleanup efforts at sites where all or substantially all of the uranium was produced for sale to a federal agency. The UMTRA Project is responsible for the cleanup of 24 sites in 10 states. Germany is facing nearly identical uranium cleanup problems and has established a cleanup project. At the workshop, participants had an opportunity to interact with a broad cross section of the environmental restoration and waste disposal community, discuss common concerns and problems, and develop a broader understanding of the issues. Abstracts are catalogued individually for the data base.

Not Available

1993-12-31T23:59:59.000Z

240

Max-Planck-Institute for Meteorology, Hamburg, Germany Swedish Meteorological and Hydrological Institute, Norrkoping, Sweden  

E-Print Network [OSTI]

Institute, NorrkoÃ?ping, Sweden 3 Finnish Meteorological Institute, Helsinki, Finland 4 Rossby Centre, NorrkoÃ?ping, Sweden 5 German Weather Service, Offenbach, Germany 6 Institute for Marine Research, University of Kiel, Sweden A comprehensive model inter-comparison study investigating the water budget during the BALTEX

Lindau, Ralf

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

THE CRYOGENIC SYSTEM OF TESLA S. Wolff, DESY, Notkestr. 85, 22607 Hamburg, Germany  

E-Print Network [OSTI]

THE CRYOGENIC SYSTEM OF TESLA S. Wolff, DESY, Notkestr. 85, 22607 Hamburg, Germany for the TESLA collaboration Abstract TESLA, a 33 km long 500 GeV centre-of-mass energy superconducting linear collider The 33 km long e+ e- linear collider TESLA (Tera eV Energy Superconductiong Linear Accelerator) with 500

242

OPERATIONAL EXPERIENCE WITH THE TEST FACILITIES FOR TESLA H. Weise, DESY, Hamburg, Germany  

E-Print Network [OSTI]

OPERATIONAL EXPERIENCE WITH THE TEST FACILITIES FOR TESLA H. Weise, DESY, Hamburg, Germany Abstract The TESLA superconducting electron-positron linear collider with an integrated X-ray laser laboratory government in matters of science. In preparation of this, the TESLA Test Facility was set up at DESY. More

243

Reinforcement Learning to Adjust Robot Movements to New Situations MPI Tbingen, Germany  

E-Print Network [OSTI]

, namely a kernelized version of the reward-weighted regres- sion. We show two robot applications and Peters, 2010], and even in tasks with potential industrial applications [Urbanek et al., 2004Reinforcement Learning to Adjust Robot Movements to New Situations Jens Kober MPI Tübingen, Germany

244

Multidecadal solar radiation trends in the United States and Germany and direct tropospheric aerosol forcing  

E-Print Network [OSTI]

Multidecadal solar radiation trends in the United States and Germany and direct tropospheric, the positive trend is almost equal. We attained these results by scrutinizing clear-sky global solar radiation ratio of solar radiation were used for constraining the observed trends. Increased absorption

245

SUPERCONDUCTING RF STRUCTURES TEST FACILITIES AND H. Weise, Deutsches Elektronen-Synchrotron, Hamburg, Germany  

E-Print Network [OSTI]

-Synchrotron, Hamburg, Germany for the TESLA Collaboration Abstract The design of the TESLA superconducting electron than 16 thousand hours of operation demonstrated this technology. Results of single cavity tests followed by drying in a class 100 clean room; annealing at 800°C in an Ultra High Vacuum oven to relieve

246

Christian Schuster received the Diploma degree in physics from the University of Konstanz, Germany, in 1996, and the Ph. D. degree in electrical engineering from the Swiss Federal  

E-Print Network [OSTI]

Christian Schuster received the Diploma degree in physics from the University of Konstanz, Germany of Electromagnetic Theory at the Hamburg University of Technology (TUHH), Germany. Prior to that he was with the IBM

Garmestani, Hamid

247

Information visualization for in-car communication processes Michael Sedlmair, BMW Group Research and Technology, Germany, Michael.Sedlmair@bmw.de  

E-Print Network [OSTI]

Information visualization for in-car communication processes Michael Sedlmair, BMW Group Research and Technology, Germany, Michael.Sedlmair@bmw.de Supervisor: Andreas Butz, University of Munich, Germany, Andreas

248
249

Hamburg, Germany's second largest city, is home to two of the most important urban development areas in Europe: HafenCity  

E-Print Network [OSTI]

Hamburg, Germany's second largest city, is home to two of the most important urban development for ecological sustainability and mixed use development along the Elbe River in Hamburg, Germany e m b e r 1 5 , 9 a m ­ 1 2 : 30 p m The City of Hamburg, Germany is a city-state. Like Washington

District of Columbia, University of the

250

Julian Ollesch received his Ph.D. with highest honours in 2006 of the Ruhr-University Bochum, Germany. In 2007, he joined Stanley Prusiners Institute for  

E-Print Network [OSTI]

, Germany. In 2007, he joined Stanley Prusiners Institute for Neurodegenerative Diseases in San Francisco's dementia at Marcus Fändrich's group in Halle/Saale, Germany. In 2010, he joined the Protein research Unit Ruhr within Europe, PURE at the Biophysics Department of the Ruhr- University Bochum, Germany. Margot

Gerwert, Klaus

251

College of Engineering Study Abroad: Germany Blog Welcome to the blog of Stephanie Berger, Sophomore, Biological Systems Engineering major at UNL. She  

E-Print Network [OSTI]

College of Engineering Study Abroad: Germany Blog Welcome to the blog of Stephanie Berger internship in Germany through the DAAD/RISE program. Monday, August 3, 2009 Last week was my last week Germany for a little over a week before I head back to the U.S.! Since I got this scholarship through

Farritor, Shane

252

Are there signs of acidification reversal in freshwaters of the low mountain ranges in Germany? Hydrology and Earth System Sciences, 5(3), 367378 (2001) EGS  

E-Print Network [OSTI]

Are there signs of acidification reversal in freshwaters of the low mountain ranges in Germany? 367 in freshwaters of the low mountain ranges in Germany? C. Alewell1 , M. Armbruster2 , J. Bittersohl3 , C.D. Evans4 of Bayreuth, D-95440 Bayreuth, Germany 2 Institute of Soil Science, Technical University of Dresden, D-01735

Paris-Sud XI, Université de

253

Strategies for Orchard Irrigation in South-Western Germany under the Limitation of Meeting Instream Flow Requirements of the Used Stream  

E-Print Network [OSTI]

1 Strategies for Orchard Irrigation in South-Western Germany under the Limitation of Meeting Stuttgart, Institut fuer Wasserbau, Germany www.iws.uni-stuttgart.de Condensed abstract: In South-Western Germany, orchard-irrigation farming may endanger the ecological con- ditions of streams used for supplying

Cirpka, Olaf Arie

254

G. Vlad et al. 10th IAEA TM on Energetic Particles -Kloster Seeon, Germany, 8-10/10/2007 1 Particle Simulations of Alfvn Modes  

E-Print Network [OSTI]

G. Vlad et al. 10th IAEA TM on Energetic Particles - Kloster Seeon, Germany, 8-10/10/2007 1 - Kloster Seeon, Germany, 8-10/10/2007 2 Outline · Introduction · Experimental observations · The HMGC code sensitivity) · Conclusions #12;G. Vlad et al. 10th IAEA TM on Energetic Particles - Kloster Seeon, Germany, 8

Vlad, Gregorio

255

Research position in maternity at Hannover Medical School, Hannover Medical School is one of the leading medical universities in Germany with  

E-Print Network [OSTI]

Research position in maternity at Hannover Medical School, Germany Hannover Medical School is one of the leading medical universities in Germany with excellent results in health care, research, education. In 2009, the only MSc Midwifery Programme in Germany was launched as part of the European Master

Manstein, Dietmar J.

256

FLEGT Asia, Baseline Study 1, China: Overview of Forest Law Enforcement, Governance and Trade, June 2011 This Action is funded by the European Union and Governments of Finland, France, Germany, the Netherlands and the United Kingdom.  

E-Print Network [OSTI]

, June 2011 This Action is funded by the European Union and Governments of Finland, France, Germany of Finland, France, Germany, the Netherlands and the United Kingdom. www

257

think forward OrderNumberDOC-P80-EXS026V12007BrukerAXSGmbH.PrintedinGermany.  

E-Print Network [OSTI]

AXSGmbH.PrintedinGermany. Proportional and Scintillation Counter Proportional counter for light elements Scintillation counter for heavyYour Command Wavelength dispersive X-ray fluorescence spectrometry offers: Multi element analysis from Be to U

Wells, Mathew G. - Department of Physical and Environmental Sciences, University of Toronto

258

Using Vehicle Taxes to Reduce Carbon Dioxide Emissions Rates of New Passenger Vehicles: Evidence from France, Germany, and Sweden  

E-Print Network [OSTI]

France, Germany, and Sweden link vehicle taxes to the carbon dioxide (CO2) emissions rates of passenger vehicles. Based on new vehicle registration data from 2005–2010, a vehicle’s tax is negatively correlated with its ...

Klier, Thomas

259

Does it take one or two to tango? : language skills, physical appearance, and immigrant integration in Germany  

E-Print Network [OSTI]

Breaking with a long-held political stance that Germany is, despite a sizeable share of permanent immigrant residents, not a country of immigration, the German legislature has drawn up a new immigration law, which entered ...

Wickboldt, Anne-Katrin, 1970-

2008-01-01T23:59:59.000Z

260

Corporate governance under stress : an institutional perspective on the transformation of corporate governance in France and Germany  

E-Print Network [OSTI]

This work contributes to the study of comparative political economy by examining the impact of financial deregulation on corporate governance in the two main continental European economies, France and Germany. It investigates ...

Goyer, Michel, 1964-

2004-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Nitrogen cycle of the Baltic Sea from an isotopic perspective Baltic Sea Research Institute-Warnemunde (IOW), Rostock, Germany  

E-Print Network [OSTI]

Nitrogen cycle of the Baltic Sea from an isotopic perspective M. Voss Baltic Sea Research Institute-Warnemu¨nde, Hamburg, Germany S. Hille, T. Neumann, and J. W. Dippner Baltic Sea Research Institute-Warnemu¨nde (IOW

Dippner, Joachim W.

262

American Suppliers: The Role of Americans in the Perpetuation and Maintenance of the Postwar Black Market in Germany  

E-Print Network [OSTI]

Americans are curiously absent from the literature as forces in the black market prevailing in Germany after World War II. Aside from Rundell's study of failed currency control policy during the Second World War and the subsequent occupations...

Fasulo, Micheal

2012-02-14T23:59:59.000Z

263

Cross-border transfer of climate change mitigation technologies : the case of wind energy from Denmark and Germany to India  

E-Print Network [OSTI]

This research investigated the causal factors and processes of international development and diffusion of wind energy technology by examining private sector cross-border technology transfer from Denmark and Germany to India ...

Mizuno, Emi, Ph. D. Massachusetts Institute of Technology

2007-01-01T23:59:59.000Z

264

A review of "Patterned Lives: The Lutheran Funeral Biography in Early Modern Germany" by Cornelia Niekus Moore  

E-Print Network [OSTI]

Germany. Wolfenb?tteler Forschungen 111. Wiesbaden: Harrassowitz, 2006. 403 pp. Review by AMY NELSON BURNETT, UNIVERSITY OF NEBRASKA-LINCOLN To those unfamiliar with the Lutheran funeral work, a book devoted to the biographies that were an important... about early modern Germany, but rather to discuss the genre as a whole, describing its origin, development and demise over the course of two centu- ries. The book is clearly structured around this goal. After an opening chapter that introduces...

Burnett, Amy Nelson

2007-01-01T23:59:59.000Z

265

Observation of a German farm family: their culture and values, and aspects of beginning a career in agriculture in Germany  

E-Print Network [OSTI]

OBSERVATION OF A GERMAN FARM FAMILY, THEIR CULTURE AND VALUFS, AND ASPECTS OF BEGINNING A CARFER IN AGRICULTURE IN GERMANY A PROFESSIONAL PAPER BEVERLY ANN BIANCI 11 Submitted to the College of Agriculture and Life Sciences of Texas ASM... OF BEGINNING A CAREER IN GERMANY IN AGRICULTURE A Professional Paper By BEVERLY ANN BIANCHI Approved as to style and content by: Jones E. Christlansen (Chair of Committee) Don R. Herring (Committee Member) Barbara J. Gastel (Committee Member...

Bianchi, Beverly Ann

1993-01-01T23:59:59.000Z

266

Electron effective mass and nonparabolicity in Ga 0.47In 0.53As/InP quantum wells Physik-Department E16, Technische Universitat Munchen, James-Franck-Strasse, 85747 Garching, Germany  

E-Print Network [OSTI]

-Department E16, Technische Universita¨t Mu¨nchen, James-Franck-Strasse, 85747 Garching, Germany R. Winkler Institut fu¨r Theoretische Physik, Universita¨t Regensburg, 93040 Regensburg, Germany M. Drechsler and B. K, Germany U. Ro¨ssler Institut fu¨r Theoretische Physik, Universita¨t Regensburg, 93040 Regensburg, Germany

Wetzel, Christian M.

267

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

268

Brine migration test report: Asse Salt Mine, Federal Republic of Germany: Technical report  

SciTech Connect (OSTI)

This report presents a summary of Brine Migration Tests which were undertaken at the Asse mine of the Federal Republic of Germany (FRG) under a bilateral US/FRG agreement. This experiment simulates a nuclear waste repository at the 800-m (2624-ft) level of the Asse salt mine in the Federal Republic of Germany. This report describes the Asse salt mine, the test equipment, and the pretest properties of the salt in the mine and in the vicinity of the test area. Also included are selected test data (for the first 28 months of operation) on the following: brine migration rates, thermomechaical behavior of the salt (including room closure, stress reading, and thermal profiles), borehole gas pressures, and borehole gas analyses. In addition to field data, laboratory analyses of pretest salt properties are included in this report. The operational phase of these experiments was completed on October 4, 1985, with the commencement of cooldown and the start of posttest activities. 7 refs., 68 figs., 48 tabs.

Coyle, A.J.; Eckert, J.; Kalia, H.

1987-01-01T23:59:59.000Z

269

Detection of $^{133}$Xe from the Fukushima nuclear power plant in the upper troposphere above Germany  

E-Print Network [OSTI]

After the accident in the Japanese Fukushima Dai-ichi nuclear power plant in March 2011 large amounts of radioactivity were released and distributed in the atmosphere. Among them were also radioactive noble gas isotopes which can be used as tracers to test global atmospheric circulation models. This work presents unique measurements of the radionuclide $^{133}$Xe from Fukushima in the upper troposphere above Germany. The measurements involve air sampling in a research jet aircraft followed by chromatographic xenon extraction and ultra-low background gas counting with miniaturized proportional counters. With this technique a detection limit of the order of 100 $^{133}$Xe atoms in litre-scale air samples (corresponding to about 100 mBq/m$^3$) is achievable. Our results provide proof that the $^{133}$Xe-rich ground level air layer from Fukushima was lifted up to the tropopause and distributed hemispherically. Moreover, comparisons with ground level air measurements indicate that the arrival of the radioactive plume at high altitude over Germany occurred several days before the ground level plume.

Hardy Simgen; Frank Arnold; Heinfried Aufmhoff; Robert Baumann; Florian Kaether; Sebastian Lindemann; Ludwig Rauch; Hans Schlager; Clemens Schlosser; Ulrich Schumann

2014-12-05T23:59:59.000Z

270

CW Operation of the TTF-III Input Coupler J. Knobloch, W. Anders, M. Martin and M. Schuster, BESSY GmbH, Berlin, Germany  

E-Print Network [OSTI]

GmbH, Berlin, Germany S. Bauer and M. Pekeler, ACCEL Instruments, Bergisch-Gladbach, Germany S at the 2005 Particle Accelerator Conference, Knoxville, TN Abstract Several newly proposed superconducting aspects may limit the coupler operation. To resolve this question, ACCEL Instruments, BESSY, Cornell, DESY

271

Detection of $^{133}$Xe from the Fukushima nuclear power plant in the upper troposphere above Germany  

E-Print Network [OSTI]

After the accident in the Japanese Fukushima Dai-ichi nuclear power plant in March 2011 large amounts of radioactivity were released and distributed in the atmosphere. Among them were also radioactive noble gas isotopes which can be used as tracers to probe global atmospheric circulation models. This work presents unique measurements of the radionuclide $^{133}$Xe from Fukushima in the upper troposphere above Germany. The measurements involve air sampling in a research jet aircraft followed by chromatographic xenon extraction and ultra-low background gas counting with miniaturized proportional counters. With this technique a detection limit of the order of 100 $^{133}$Xe atoms in liter-scale air samples (corresponding to about 100 mBq/m$^3$) is achievable. Our results proof that the $^{133}$Xe-rich ground level air layer from Fukushima was lifted up to the tropopause and distributed hemispherically. Moreover, comparisons with ground level air measurements indicate that the arrival of the radioactive plume in ...

Simgen, Hardy; Aufmhoff, Heinfried; Baumann, Robert; Kaether, Florian; Lindemann, Sebastian; Rauch, Ludwig; Schlager, Hans; Schlosser, Clemens; Schumann, Ulrich

2013-01-01T23:59:59.000Z

272

Fiver years of uranium mine and mill decommissioning in Germany: Progress of the Wismut environmental remediation project  

SciTech Connect (OSTI)

With the end of the Cold War and the fall of the iron curtain Germany inherited in 1990 by its reunification the legacy of 45 years of unrestricted, intensive uranium mining in the eastern part of Germany. The environmental damages and risks related to widespread soil and groundwater contamination, caused by huge tailings ponds and numerous waste rock piles in one of Germany`s most densely populated areas, made it necessary to implement one of the world`s largest environmental clean-up programs. 13 billion German Marks (8.7 billion US-$) will be spent within approx. 20 years for decommissioning and environmental restoration efforts. Five years after the start-up of the Wismut project considerable results have been achieved. Conceptual work, even regarding technically difficult issues of the program, is far advanced, and about one third of the physical work program has been completed. At the former mining and milling locations significant improvements of the environmental situation have been achieved. The further on-schedule progress of the Wismut program is an important prerequisite for the socio-economical development in the former uranium mining districts.

Mager, D. [German Federal Ministry of Economics, Bonn (Germany)

1996-12-31T23:59:59.000Z

273

International Europhysics Conference on High Energy Physics EPS, July 17th-23rd 2003 in Aachen, Germany  

E-Print Network [OSTI]

International Europhysics Conference on High Energy Physics EPS, July 17th-23rd 2003 in Aachen, Germany General Search for New Phenomena in ep Scattering at HERA M. Wessels I. Physikalisches Institut lepton and multi-lepton events Have we missed something? General Search for New Phenomena in ep

274

A Top-down and Bottom-up look at Emissions Abatement in Germany in response to the EU ETS  

E-Print Network [OSTI]

This paper uses top-down trend analysis and a bottom-up power sector model to define upper and lower boundaries on abatement in Germany in the first phase of the EU Emissions Trading Scheme (2005-2007). Long-term trend ...

Feilhauer, Stephan M. (Stephan Marvin)

2008-01-01T23:59:59.000Z

275

Proceedings of the XVI International Conference on Thermoelectrics, Dresden, Germany, August 26-29, 1997 Skutterudites: An Update  

E-Print Network [OSTI]

be meaningful for near room temperature applications [1], thermoelectric power generators which could operate technologies. This is true in particular for high power (over 200 W) automobile waste heat recovery and spaceProceedings of the XVI International Conference on Thermoelectrics, Dresden, Germany, August 26

276

Wind-Power Development in Germany and the U.S.: Multiple Streams, Advocacy Coalitions, and Turning Points  

E-Print Network [OSTI]

Wind-Power Development in Germany and the U.S.: Multiple Streams, Advocacy Coalitions, and Turning). Of the various forms of renewable energy, wind-generated electricity has a unique set of advantages, which make especially large. Wind power produces relatively low levels of environmental damage over its life cycle (like

Qiu, Weigang

277

Bernhard Grimm, Humboldt University, Berlin, Germany; Robert J. Porra, CSIRO Plant Industry, Canberra, ACT, Australia; Wolfhart Rdiger, Mnchen University, Mnchen,  

E-Print Network [OSTI]

interest in solar energy, this collection on the chlorophylls is most timely, covering the latest aspects the biological process of photosynthesis to include such topics as solar energy conversion, environmental science, Canberra, ACT, Australia; Wolfhart Rüdiger, München University, München, Germany; Hugo Scheer, München

Govindjee "Gov"

278

3rd Workshop on System-level Virtualization for High Performance Computing (HPCVirt) 2009, Nuremberg, Germany, March 30, 2009  

E-Print Network [OSTI]

3rd Workshop on System-level Virtualization for High Performance Computing (HPCVirt) 2009 for High Performance Computing (HPCVirt) 2009, Nuremberg, Germany, March 30, 2009 Outline · Background work #12;3/193rd Workshop on System-level Virtualization for High Performance Computing (HPCVirt) 2009

Engelmann, Christian

279

Power MEMS 2007, Nov. 28-29, 2007, Freiburg, Germany Fig. 1: Micro quartz combustor. (a) Schematic,  

E-Print Network [OSTI]

Power MEMS 2007, Nov. 28-29, 2007, Freiburg, Germany 265 Fig. 1: Micro quartz combustor. (a, 1.0 mm, and 1.5 mm. FLAME PROPAGATION AND QUENCHING IN ULTRA-THIN QUARTZ COMBUSTORS Yong Fan, Yuji and analysis of premixed CH4/Air flame propagation and quenching in three quartz combustors with chamber depth

Kasagi, Nobuhide

280

X-th International Workshop on Optimization and Inverse Problems in Electromagnetism September 14 17, 2008, Ilmenau, GERMANY  

E-Print Network [OSTI]

­ 17, 2008, Ilmenau, GERMANY Optimal sizing of PV based multi-source system for household application T-source system at supply side, and an optimal supply and demand co-management. A sizing and multi with a project aiming to increase the value of photovoltaic production for residential application; the main

Boyer, Edmond

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Multi-Decadal Solar Radiation Trends in the United States and Germany and Direct Tropospheric Aerosol Forcing  

E-Print Network [OSTI]

Multi-Decadal Solar Radiation Trends in the United States and Germany and Direct Tropospheric.S. the strengthening is almost equal. We attained these results by scrutinizing clear sky global solar radiation of solar radiation were used for constraining the observed trends. Increased absorption and declined light

282

7th Int. Conference on Business Process Management (BPM`09) 7-10 September 2009, Ulm, Germany  

E-Print Network [OSTI]

7th Int. Conference on Business Process Management (BPM`09) 7-10 September 2009, Ulm, Germany www.bpm2009.org Keynote Speaker A.-W. Scheer BPM 3.0 Founder of IDS Scheer, President of Bitkom, Vice on Reference Modelling ER-BPM'09 - 1st International Workshop on Empirical Research in Business Process BPD'09

Pfeifer, Holger

283

7th Int. Conference on Business Process Management (BPM`09) 7-10 September 2009, Ulm, Germany  

E-Print Network [OSTI]

7th Int. Conference on Business Process Management (BPM`09) 7-10 September 2009, Ulm, Germany www.bpm2009.org #12;General Information BPM`09 is the seventh international conference in a series and tracks for workshops, tutorials, panels and demos. The BPM`09 has the EMISA`09 as co-located conference

Ulm, Universität

284

T-Mobile Germany launches mobile social web services on web'n'walk Feb 12, 2008  

E-Print Network [OSTI]

T-Mobile Germany launches mobile social web services on web'n'walk portal Feb 12, 2008 · Agreements by companies of the Deutsche Telekom group by end of 2007. The common technology platform is based on GSM documents like reports, invoices, statements and others on the fly. Fully integrated clean-up processes also

Deutschmann, Rainer

285

The Disarmament School: US Policy for the Disarmament and Demobilization of the Germany Army, November-December 1944  

E-Print Network [OSTI]

Military Tradition. This demilitarization of Germany was the chief goal of victory and means of ensuring lasting peace in Europe. In November and December of 1944, the US Army hosted the Disarmament School, a series of lectures by experts in the field...

Wilkerson, Joseph Jr

2009-08-11T23:59:59.000Z

286

European Conference on the Mathematics of Oil Recovery --Freiberg, Germany, 3 -6 September 2002 Prediction under Uncertainty in Reservoir  

E-Print Network [OSTI]

1 8 th European Conference on the Mathematics of Oil Recovery -- Freiberg, Germany, 3 - 6 September 2002 Prediction under Uncertainty in Reservoir Modeling Mike Christie1 , Sam Subbey1 , Malcolm of Advanced Studies, Australian Nat. University, Canberra, ACT 0200, Australia Abstract Reservoir simulation

Sambridge, Malcolm

287

FB2 Biologie / Chemie www.uni-bremen.de  

E-Print Network [OSTI]

elements 2.1 Teilmodul / submodule FD 2.1 Didactics 2.1 3 ECTS-Punkte / credit points Notwendige zum Modul / further comments Biologiedidaktik 1 sollte möglichst absolviert worden sein. Didactics 1

Diekmann, Martin

288

FB2 Biologie / Chemie www.uni-bremen.de  

E-Print Network [OSTI]

of biology teaching and learning Teilmodul / submodule FD 1.2 Didactics 1.2 3 ECTS-Punkte / credit points of biology teaching and learning Teilmodul / submodule FD 1.2 Didactics 1.2 3 ECTS-Punkte / credit points

Diekmann, Martin

289

FB2 Biologie / Chemie www.uni-bremen.de  

E-Print Network [OSTI]

of biology teaching and learning Teilmodul / submodule FD 1.1 Didactics 1.1 3 ECTS-Punkte / credit points Theoretical and practical basics of biology teaching and learning Teilmodul / submodule FD 1.1 Didactics 1.1 3

Diekmann, Martin

290

FB2 Biologie / Chemie www.uni-bremen.de  

E-Print Network [OSTI]

elements 2.2 Teilmodul / submodule FD 2.2 Didactics 2.2 3 ECTS-Punkte / credit points Notwendige zum Modul / further comments Biologiedidaktik 1 sollte möglichst absolviert worden sein. Didactics 1

Diekmann, Martin

291

New Bremen, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 -Energieprojekte3InformationofServicesNeuCo IncWorkNevadaOpen EnergyLLC378469°,

292

New Bremen, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 -Energieprojekte3InformationofServicesNeuCo IncWorkNevadaOpen

293

Village of New Bremen, Ohio (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop,Save EnergyGlouster, Ohio (UtilityJohnsonMilanMuscoda, WisconsinNew

295

Aiming to bring together media scholars from the United States, Canada, and Germany, the conference continues a series of symposia that began in 2007. After ,,Re-Reading McLuhan. An International Conference on Media and  

E-Print Network [OSTI]

Aiming to bring together media scholars from the United States, Canada, and Germany, the conference of Paderborn, Germany Concept and Organisation: Hannelore Bublitz, Irina Kaldrack, Theo Röhle, Hartmut Winkler March 29 ­ 31, 2012 University of Paderborn, Germany Room B 3.231 #12;02:00 | Start / Introduction 02

Paderborn, Universität

296

Prof. Dr. Uwe Holtz Universitt Bonn Am Hofgarten 15D -53113 Bonn UHoltz@aol.com www.uni-bonn.de/~uholtz1 OECD (Hg.): DAC Peer Review Germany, Paris 2006.4  

E-Print Network [OSTI]

.uni-bonn.de/~uholtz1 6.4.072 3 OECD (Hg.): DAC Peer Review Germany, Paris 2006.4 (www.oecd.org/dataoecd/54 of poorer countries but need for greater strategic selectivity8 9 Germany has never stated a preference in favor of specific groups of countries. Germany admits10 that poorest countries need donors' full support

Franz, Sven Oliver

297

Risk based optimization procedures applied to the remediation of uranium mining and milling sites in Germany  

SciTech Connect (OSTI)

The remediation of former uranium mining and milling sites in the Eastern part of Germany represents a major environmental challenge. Due to the size and complexity of the sites and the significance of current and potential long term environmental impacts, effective approaches are required for the planning, implementation and regulatory control of reclamation measures. These have to ensure adequate protection for the people and the environment taking into account the long term nature of the hazards and the technical and economical constraints. The German regulatory framework is based upon ICRP principles of dose limitation, justification and optimization (ALARA). Application of these criteria requires as a first step the assessment of prevailing exposures and their potential long term evolution for each site. These risk assessments are based upon site characterization studies and the modelling of contaminant transfer to the environment and to man. Evaluation of the prevailing and potential future risks leads to the identification of remediation necessities. The subsequent planning of remediation measures is highly site specific and relies on the identification of possible reclamation options and their capability to reduce real risks to acceptable levels. The selection of the reclamation measures which will actually be implemented is performed within an optimization process involving assessments of possible risk reduction, technological feasibility, costs, long term stability, continuing requirements for long term active or passive institutional control and public acceptance.

Goldammer, W.; Barthel, R. [Brenk Systemplanung, Aachen (Germany)

1994-12-31T23:59:59.000Z

298

The evolution of the break preclusion concept for nuclear power plants in Germany  

SciTech Connect (OSTI)

In the updating of the Guidelines for PWR`s of the {open_quotes}Reaktor-Sicherheitskommission{close_quotes} (RSK) in 1981 the requirements on the design have been changed with respect to the postulated leaks and breaks in the primary pressure boundary. The major change was a revision in the requirements for pipe whip protection. As a logical consequence of the {open_quotes}concept of basic safety{close_quotes} a guillotine type break or any other break type resulting in a large opening is not postulated any longer for the calculation of reaction and jet forces. As an upper limit for a leak an area of 0, 1 A (A = open cross section of the pipe) is postulated. This decision was based on a general assessment of the present PWR system design in Germany. Since then a number of piping systems have been requalified in the older nuclear power plants to comply with the break preclusion concept. Also a number of extensions of the concept have been developed to cover also leak-assumptions for branch pipes. Furthermore due considerations have been given to other aspects which could contribute to a leak development in the primary circuit, like vessel penetrations, manhole covers, flanges, etc. Now the break preclusion concept originally applied to the main piping has been developed into an integrated concept for the whole pressure boundary within the containment and will be applied also in the periodic safety review of present nuclear power plants.

Schulz, H. [Gesellschaft fuer Anlagen- und Reaktorsicherheit, Koeln (Germany)

1997-04-01T23:59:59.000Z

299

Reply to Guy et al.: Support for a bottleneck in the 2011 Escherichia coli O104:H4 outbreak in Germany  

E-Print Network [OSTI]

In our paper (1), we analyzed isolates from the Escherichia coli O104:H4 outbreaks in Germany and France in May to July 2011. We concluded that, although the German outbreak was larger, the German isolates represent a clade ...

Grad, Y. H.

300

A review of "Self-Defense and Religious Strife in Early Modern Europe. England and Germany 1530-1630." by Robert von Friedeburg  

E-Print Network [OSTI]

. Self-Defense and Religious Strife in Early Modern Europe. England and Germany 1530-1630. Aldershot: Ashgate, 2002. xii + 278 pp. $99.95. Review by PAUL M. DOVER, KENNESAW STATE UNIVERSITY. With the advent of the religious controversies..., strong governmental authority, and a rigid social hierarchy, active resistance raised many dilemmas. It exercised the minds of intellectuals and common- ers alike in both Germany and the British Isles in the early modern period. Open resistance...

Paul M. Dover

2006-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Heavy-metal contamination on training ranges at the Grafenwoehr Training Area, Germany  

SciTech Connect (OSTI)

Large quantities of lead and other heavy metals are deposited in the environment of weapons ranges during training exercises. This study was conducted to determine the type, degree, and extent of heavy-metal contamination on selected handgun, rifle, and hand-grenade ranges at Grafenwoehr Training Area, Germany. Soil, vegetation, and surface-water samples were collected and analyzed using the inductively-coupled plasma atomic-emission spectroscopy (ICP-AES) method and the toxic characterization leaching procedure (TCLP). The ICP-AES results show that above-normal levels of lead and copper are in the surface soil at the handgun range, high concentrations of lead and copper are in the berm and soil surface at the rifle range, and elevated levels of cadmium and above-normal concentrations of arsenic, copper, and zinc are present in the surface soil at the hand-grenade range. The TCLP results show that surface soils can be considered hazardous waste because of lead content at the rifle range and because of cadmium concentration at the hand-grenade range. Vegetation at the handgun and rifle ranges has above-normal concentrations of lead. At the hand-grenade range, both vegetation and surface water have high levels of cadmium. A hand-held X-ray fluorescence (XRF) spectrum analyzer was used to measure lead concentrations in soils in a field test of the method. Comparison of XRF readings with ICP-AES results for lead indicate that the accuracy and precision of the hand-held XRF unit must improve before the unit can be used as more than a screening tool. Results of this study show that heavy-metal contamination at all three ranges is limited to the surface soil; heavy metals are not being leached into the soil profile or transported into adjacent areas.

Zellmer, S.D.; Schneider, J.F.

1993-05-01T23:59:59.000Z

302

7, 75097534, 2007 Cloud filtering for  

E-Print Network [OSTI]

Lulea Technical University, Dept. of Space Science, Kiruna, Sweden 2 IUP, University of Bremen, Bremen

Paris-Sud XI, Université de

303

Atmos. Chem. Phys., 12, 73917397, 2012 www.atmos-chem-phys.net/12/7391/2012/  

E-Print Network [OSTI]

mercury in the tropics: continuous observations at a coastal site in Suriname D. M¨uller1, D. Wip2, T of Bremen, Germany 2Anton de Kom Universiteit van Suriname, Paramaribo, Suriname 3University of California Nickerie (556 N, 5659 W), Suriname, provide the only continuous records of atmospheric mercury

Meskhidze, Nicholas

304

1. INTRODUCTION Fluid flows are often so complicated that laboratory  

E-Print Network [OSTI]

with vertical stratification. For a single-hemisphere basin, self-sustained oscillations of the flow and period of the oscillations are partly determined by the energy avail- able for vertical mixing if v, University of Stockholm, Sweden. 4Department of Geosciences, University of Bremen, Germany. 5Climate

Nilsson, Johan

305

Environment and climate of the last 51,000 years e new insights from the Potrok Aike maar lake Sediment Archive Drilling prOject (PASADO)  

E-Print Network [OSTI]

Environment and climate of the last 51,000 years e new insights from the Potrok Aike maar lake Sediment Archive Drilling prOject (PASADO) B. Zolitschka a,*, F. Anselmetti b , D. Ariztegui c , H-M, D-28359 Bremen, Germany b Eawag, Swiss Federal Institute of Aquatic Science and Technology

Long, Bernard

306

Zentrum fur Technomathematik Fachbereich 3 Mathematik und Informatik  

E-Print Network [OSTI]

-Time Approximations In Optimal Control of Multibody-Systems For Industrial Robots Christof B¨uskens Matthias Knauer-Time Approximations In Optimal Control Of Multibody-Systems For Industrial Robots C. B¨uskens (bueskens Bibliothekstrasse 1 28359 Bremen Germany Abstract The multibody system of an industrial robot leads to a mathe

Bremen, Universität

307

Plant species richness, vegetation structure and soil resources of urban brownfield sites linked  

E-Print Network [OSTI]

Plant species richness, vegetation structure and soil resources of urban brownfield sites linked September 2008 # Springer Science + Business Media, LLC 2008 Abstract Brownfield sites contribute of a chronosequence of urban brownfield sites in Bremen and Berlin, Germany. These parameters were linked

Kleyer, Michael

308

ReportTechnical OPEN-EASE --  

E-Print Network [OSTI]

for Computing Technologies), University of Bremen, Germany. We propose OPEN-EASE1 , a remote knowledge repre into a box, and household robots will be tasked to clean the table and unload the dishwasher [1], [2 change by packing it in different ways. When cleaning a table, the robot has to reason about the state

309

HLW Return from France to Germany - 15 Years of Experience in Public Acceptance and Technical Aspects - 12149  

SciTech Connect (OSTI)

Since in 1984 the national reprocessing concept was abandoned the reprocessing abroad was the only existing disposal route until 1994. With the amendment of the Atomic Energy Act in 2001 spent fuel management changed completely since from 1 June 2005 any delivery of spent fuel to reprocessing plants was prohibited and the direct disposal of spent fuel became mandatory. Until 2005 the total amount of spent fuel to be reprocessed abroad added up to 6080 t HM, 5309 t HM thereof in France. The waste generated from reprocessing - alternatively an equivalent amount of radioactive material - has to be returned to the country of origin according to the commercial contracts signed between the German utilities and COGEMA, now AREVA NC, in France and BNFL, now INS in UK. In addition the German and the French government exchanged notes with the obligation of both sides to enable and support the return of reprocessing residues or equivalents to Germany. The return of high active vitrified waste from La Hague to the interim storage facility at Gorleben was demanding from the technical view i. e. the cask design and the transport. Unfortunately the Gorleben area served as a target for nuclear opponents from the first transport in 1996 to the latest one in 2011. The protection against sabotage of the railway lines and mass protests needed highly improved security measures. In France and Germany special working forces and projects have been set up to cope with this extraordinary situation. A complex transport organization was established to involve all parties in line with the German and French requirements during transport. The last transport of vitrified residues from France has been completed successfully so far thus confirming the efficiency of the applied measures. Over 15 years there was and still is worldwide no comparable situation it is still unique. Summing up, the exceptional project handling challenge that resulted from the continuous anti-nuclear civil disobedience in Germany over the whole 15-year long project running time could be faced efficiently. It has to be concluded that despite of all problems the anti-nuclear activities have caused so far, all transports of vitrified HLW have always been completed successfully by adapting the commonly established safety, security and public acceptance measures to the special conditions and needs in Germany and coordinating the activities of all parties involved but at the expense of high costs for industry and government and a challenging operational complexity. Apart from an anticipatory project planning a good communication between all involved industrial parties and the French and the German government was the key to the effective management of such shipments and to minimize the radiological, economic, environmental, public and political impact. The future will show how efficiently the gained experience can be used for further return projects which are to be realized since no reprocessed waste has yet been returned from UK and neither the medium-level nor the low-level radioactive waste has been transferred from France to Germany. (author)

Graf, Wilhelm [GNS Gesellschaft fuer Nuklear-Service mbH, 45127 Essen (Germany)

2012-07-01T23:59:59.000Z

310

24th European Photovoltaic Solar Energy Conference, Hamburg, Germany, Sept. 2009 HIGLY PREDICTIVE MODELLING OF ENTIRE SI SOLAR CELLS FOR INDUSTRIAL APPLICATIONS  

E-Print Network [OSTI]

On leave from: Institute for Solar Energy Systems, Sun Yat-Sen University, 510006, Guangzhou, China24th European Photovoltaic Solar Energy Conference, Hamburg, Germany, Sept. 2009 1 HIGLY PREDICTIVE MODELLING OF ENTIRE SI SOLAR CELLS FOR INDUSTRIAL APPLICATIONS P.P. Altermatt,1,2 S. Steingrube,1,2 Y. Yang

311

3rd Work. for Young Researchers on Human-Friendly Robotics, Oct. 2010, Tubingen, Germany Towards Bilateral Teleoperation of Multi-Robot Systems  

E-Print Network [OSTI]

. For instance, robots are expected to relieve us from monotonous and physically demanding work in industrial.g., telepresence applications where the human operator capabilities are mediated/magnified by the remote robots3rd Work. for Young Researchers on Human-Friendly Robotics, Oct. 2010, T¨ubingen, Germany Towards

312

2004 35thAnnual IEEE Power Electronics SpecialistsConference Aachen, Germany. 2004 Digital Controller Design for Electronic Ballasts with Phase Control  

E-Print Network [OSTI]

2004 35thAnnual IEEE Power Electronics SpecialistsConference Aachen, Germany. 2004 Digital Controller Design for Electronic Ballasts with Phase Control Yan Yin and Regan Zane Colorado Power Electronics Center University of Colorado at Boulder Boulder, CO 80309-0425 yiny@colorado.edu, zane

313

I.N. Sviatoslavsky, M.E. Sawan, E.A. Mogahed, University of Wisconsin S. Malang, Fusion Nuclear Technology Consulting, Germany  

E-Print Network [OSTI]

Technology Consulting, Germany C.P.C. Wong, M. Friend, General Atomics S. Majumdar, Argonne National Blanket 681°C 616 °C Mixer He 480°C 660 °C HX 500 °C 500°C Outboard to turbine 681°C 500 °C586 °C 681°C

314

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

315

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

316

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

317

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

318

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

319

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

320

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

322

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

323

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

324

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

325

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

326

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

327

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

328

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

329

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

330

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

331

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

332

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

333

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

334

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

335

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

336

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

337

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

338

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

339

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

340

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

342

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

343

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

344

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

345

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

346

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

347

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

348

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

349

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

350

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

351

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

352

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

353

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

354

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

355

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

356

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

357

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

358

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

359

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

360

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

362

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

363

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

364

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

365

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

366

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

367

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

368

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

369

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

370

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

371

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

372

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

373

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

374

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

375

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

376

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

377

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

378

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

379

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

380

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

382

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

383

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

384

Atmospheric Radiation Measurement (ARM) Data from Black Forest Germany for the Convective and Orographically Induced Precipitation Study (COPS)  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

The primary goal of the ARM Program is to improve the treatment of cloud and radiation physics in global climate models in order to improve the climate simulation capabilities of these models. ARM maintains four major, permanent sites for data collection and deploys the ARM Mobile Facility (AMF) to other sites as determined. In 2007 the AMF operated in the Black Forest region of Germany as part of the Convective and Orographically Induced Precipitation Study (COPS). Scientists studied rainfall resulting from atmospheric uplift (convection) in mountainous terrain, otherwise known as orographic precipitation. This was part of a six -year duration of the German Quantitative Precipitation Forecasting (QPF) Program. COPS was endorsed as a Research and Development Project by the World Weather Research Program. This program was established by the World Meteorological Organization to develop improved and cost-effective forecasting techniques, with an emphasis on high-impact weather. A large collection of data plots based on data streams from specific instruments used at Black Forest are available via a link from ARM's Black Forest site information page. Users will be requested to create a password, but the plots and the data files in the ARM Archive are free for viewing and downloading.

385

Factors affecting lead, cadmium, and arsenic levels in house dust in a smelter town in eastern Germany  

SciTech Connect (OSTI)

Hettstedt, a city in eastern Germany with a long history of mining and smelting of nonferrous ores, has several industrial sources of heavy metals. The indoor exposure to metals of children (5 to 14 years old) in the Hettstedt area was assessed by measuring the levels of lead, cadmium, and arsenic contamination in sedimented house dust. Factors which influence the dust loading rate and the surface loading rates of these contaminants in house dust were investigated. The geometric mean of the dust loading rate was 8.9 mg/m[sup 2] day. The geometric means of surface loading rates were 1.14, 0.024, and 0.023 [micro]g/m[sup 2] day for lead, cadmium, and arsenic, respectively. Factors that were significantly associated with surface loading rates included the city area of residence, automobile traffic near home, parent with occupational exposure to heavy metals, type of heating, housing characteristics, whether child's home is damp, number of persons living in the child's home,and parents' education. The most significant of these factors was the city area of residence, which reflects the distance from the metal sources; this factor accounted for about half of the variances explained by the regression models.

Meyer, I.; Heinrich, J. (GSF-Forschungszentrum fuer Umwelt und Gesundheit, Neuherberg (Germany). Inst. fuer Epidemiologie); Lippold, U. (Inst. fuer Wasser-, Boden- und Lufthygiene des Umweltbundesamtes Berlin (Germany))

1999-07-01T23:59:59.000Z

386

EA-1977: Acceptance and Disposition of Used Nuclear Fuel Containing U.S.-Origin Highly Enriched Uranium from the Federal Republic of Germany  

Broader source: Energy.gov [DOE]

This environmental assessment (EA) will evaluate the potential environmental impacts of a DOE proposal to accept used nuclear fuel from the Federal Republic of Germany at DOE’s Savannah River Site (SRS) for processing and disposition. This used nuclear fuel is composed of kernels containing thorium and U.S.-origin highly enriched uranium (HEU) embedded in small graphite spheres that were irradiated in nuclear reactors used for research and development purposes.

387

Federal Republic of Germany  

E-Print Network [OSTI]

Business process re-engineering is becoming a main focus in today’s efforts to overcome problems and deficits in the automotive and aerospace industries (e.g., integration in international markets, product complexity, increasing number of product variants, reduction in product development time and cost). In this paper, we investigate the steps needed to apply virtual reality (VR) for virtual prototyping (VP) to verify assembly and maintenance processes. After a review of today’s business process in vehicle prototyping, we discuss CAD-VR data integration and identify new requirements for design quality. We present several new interaction paradigms so that engineers and designers can experiment naturally with the prototype. Finally, some results of a user survey performed at BMW are presented, showing the acceptance and feasability of VP and the paradigms implemented for our key process. The results show that VR will play an important role for VP in the near future.

Antonino Gomes De S; Gabriel Zachmann

388

Made in Germany  

SciTech Connect (OSTI)

This supplement was prepared in collaboration with the Association of German Mining Machine Manufacturers within VDMA to give an overview of German manufacturers' contribution to the coal industry. It has 18 short papers and a VDMA vendor matrix and directory. Papers include details of MAN Takraf's surface mining equipment, hydraulic shovels and excavators from Komatsu, Liebherr and Terex O & K, Siemens motors and electric control technology in trucks, shovels etc., new technology from DBT, IBS and Wirth, and low emission engines and drives from Deutz and DaimlerCrysler. 2 figs.

NONE

2005-09-01T23:59:59.000Z

389

Evaluation of the utilities energy monitoring and control system installed at the US Army, Europe, Pirmasens and 97th Base Support Battalion, Germany  

SciTech Connect (OSTI)

Authorized under an interagency agreements between the US Department of Energy and the US Army, evaluation of the utilities energy monitoring and control system (UEMCSs) operating at selected US Army installations in Heidelberg, Goeppingen, Pirmasens, and Baumholder, Germany, is nearing completion. This report specifically presents the results of the evaluation of the UEMCS installed at USAREUR, 21st Theater Army Area Command (TAACOM), Pirmasens and 97th Base Support Battalion, which is operated by the Directorate of Engineering and Housing (DEH) Utilities Division. The Oak Ridge National Laboratory (ORNL) was selected by Headquarters, USAREUR, Facilities Engineering Division, Utilities and Energy Branch in Heidelberg to evaluated the overall effectiveness and energy efficiency of UEMCSs at four US Army installations in Germany. The third of these systems to be evaluated, which is the scope of this report, is the UEMCS installed at Pirmasens. This evaluation relies upon existing data and information and does not involve introducing metering and instrumentation for the purpose of measuring installation energy use. The primary purpose of this evaluation is to take an in-depth look at the overall performance and effectiveness of the UEMCS installed at Pirmasens to see if it is achieving its operational objectives by resulting in energy and cost savings.

Broders, M.A.; McConnell, B.W.

1992-01-01T23:59:59.000Z

390

FREIEN HANSESTADT BREMEN 2011 Nr. 153Ausgegeben am 29. Dezember 2011  

E-Print Network [OSTI]

vereinbarten Double Degrees erforderlich ist ." Artikel 2 Diese Ã?nderung tritt nach der Genehmigung durch den abgeleistet haben ." Artikel 2 Diese Ã?nderung tritt nach der Genehmigung durch den Rektor mit Wirkung vom 1

Hoffmeister, Thomas S.

391

FREIEN HANSESTADT BREMEN 2011 Nr. 66Ausgegeben am 13. August 2012  

E-Print Network [OSTI]

mehr auf- genommen . Diese Prüfungsordnung tritt mit Ablauf des 30 . September 2017 au�er Kraft . (6 Satz 2 bleibt unberührt ." Artikel 2 Diese �nderung tritt nach der Genehmigung durch den Rektor am 1

Hoffmeister, Thomas S.

392

FREIEN HANSESTADT BREMEN 2009 Nr. 52Ausgegeben am 27. April 2009  

E-Print Network [OSTI]

Inkrafttreten (1) Diese Bekanntmachung tritt am Tag nach ihrer Veröffentlichung in Kraft. (2) Gleichzeitig tritt 2 Diese �nderung tritt nach der Genehmigung durch den Rektor mit Wirkung vom 1. Oktober 2005

Hoffmeister, Thomas S.

393

FREIEN HANSESTADT BREMEN 2008 Nr. 120Ausgegeben am 13. November 2008  

E-Print Network [OSTI]

�nderungsordnung tritt nach der Genehmi- gung durch den Rektor am 1. April 2008 in Kraft. Sie gilt für Studierende �nderungsordnung tritt nach der Genehmi- g

Hoffmeister, Thomas S.

394

Preprint of the Paper submitted to the 10th International Conference on New Actuators, Bremen,  

E-Print Network [OSTI]

)compatibility with other material have made them attractive for miniaturised and micro-technical systems [1]. Prestrainend/sensor system for applications with a high power-to-weight ratio. In addition, the new model allows using Alloy Actuator System R. Kratz, M. Stelzer and O. von Stryk Simulation and Systems Optimization Group

Stryk, Oskar von

395

European Photovoltaic Solar Energy Conference, Frankfurt, Germany, 24-28 September 2012, 2AO.2.4 HIGH EFFICIENCY BACK-CONTACT BACK-JUNCTION SILICON SOLAR CELLS WITH CELL  

E-Print Network [OSTI]

27th European Photovoltaic Solar Energy Conference, Frankfurt, Germany, 24-28 September 2012, 2AO.2 cost of energy in photovoltaics can be achieved by increasing the conversion efficiency as well into the surface of a thick silicon wafer. After sintering at 1100 °C in hydrogen atmosphere silicon is grown

396

27th European Photovoltaic Solar Energy Conference, Frankfurt, Germany, 24-28 September 2012, 2AO.1.5 IMPACT OF THE REAR SURFACE ROUGHNESS ON INDUSTRIAL-TYPE PERC SOLAR CELLS  

E-Print Network [OSTI]

-generation industrial solar cells as stated in the International Technology Roadmap [3]. An industrial PERC process flow27th European Photovoltaic Solar Energy Conference, Frankfurt, Germany, 24-28 September 2012, 2AO.1.5 IMPACT OF THE REAR SURFACE ROUGHNESS ON INDUSTRIAL-TYPE PERC SOLAR CELLS C.Kranz1 , S. Wyczanowski1 , S

397

In Proc. SPIE 4013-55, UV, Optical, and IR Space Telescopes and Instruments VI, Breckinridge & Jacobsen, eds., Munich, Germany, March 2000. Resolving Piston Ambiguities when Phasing a Segmented Mirror  

E-Print Network [OSTI]

& Jacobsen, eds., Munich, Germany, March 2000. Resolving Piston Ambiguities when Phasing a Segmented Mirror light is insensitive to segment piston errors that are a whole number of waves. If the wavefront sensing range of a wavefront sensor can be extended from on the order of ¢¡¤£ 2 in piston to several waves

Löfdahl, Mats

398

Evaluation of the utility and energy monitoring and control system installed at the US Army, Europe, 409th Base Support Battalion, Military Community at Grafenwoehr, Germany  

SciTech Connect (OSTI)

Under the provisions of Interagency Agreement DOE 1938-B090-A1 between the US Department of Energy (DOE) and the US Army Europe (USAREUR), Martin Marietta Energy Systems, Inc., is providing technical assistance to USAREUR in the areas of computer science, information engineering, energy studies, and engineering and systems development. One of the initial projects authorized under this interagency agreement is the evaluation of utility and energy monitoring and control systems (UEMCSs) installed at selected US Army installations in Europe. This report is an evaluation of the overall energy-conservation effectiveness and use of the UEMCS at the 409th Base Support Battalion located in Grafenwoehr, Germany. The 409th Base Support Battalion is a large USAREUR military training facility that comprises a large training area, leased housing, the main post area, and the camp areas that include Camps Aachen, Algier, Normandy, Cheb, and Kasserine. All of these facilities are consumers of electrical and thermal energy. However, only buildings and facilities in the main post area and Camps Aachen, Algier, and Normandy are under the control of the UEMCS. The focus of this evaluation report is on these specific areas. Recommendations to further increase energy and cost savings and to improve operation of the UEMCS are proposed.

Broders, M.A.; Ruppel, F.R.

1993-05-01T23:59:59.000Z

399

Possibilities and limitations of life cycle assessment (LCA) in the development of waste utilization systems - Applied examples for a region in Northern Germany  

SciTech Connect (OSTI)

Against the background of increasing concerns about climate change, the reduction of greenhouse gas emissions has become an integral part of processes in both the waste management and the energy industries. This is reflected in the development of new waste treatment concepts, in which domestic and commercial waste is treated with the aim of utilizing its energy content, while at the same time recycling as much of its material content as possible. Life cycle assessment (LCA) represents a method of assessing the environmental relevance of a waste management system, the basis of which is a material flow analysis of the system in question. GHG emissions from different options for thermal treatment and energy recovery from waste as applied to a region in Northern Germany have been analyzed by the LCA approach and an indicative LCA, which only considers those emissions resulting from operating stages of the system. Operating stages have the main share of emissions compared to pre-processing stages. Results show that through specific separation of waste material flows and highly efficient energy recovery, thermal treatment and energy generation from waste can be optimized resulting in reduction of emissions of greenhouse gases. There are also other areas of waste utilization, currently given little attention, such as the solar drying of sewage sludge, which can considerably contribute to the reduction of greenhouse gas emissions.

Wittmaier, M. [Institute for Recycling and Environmental Protection at Bremen University of Applied Sciences GmbH, Neustadtswall 30, 28199 Bremen (Germany)], E-mail: wittmaier@hs-bremen.de; Langer, S.; Sawilla, B. [Institute for Recycling and Environmental Protection at Bremen University of Applied Sciences GmbH, Neustadtswall 30, 28199 Bremen (Germany)

2009-05-15T23:59:59.000Z

400

LD Didactic GmbH . Leyboldstrasse 1 . D-50354 Huerth / Germany . Phone: (02233) 604-0 . Fax: (02233) 604-222 . e-mail: info@ld-didactic.de Kinetic theory of gases  

E-Print Network [OSTI]

LD LD Didactic GmbH . Leyboldstrasse 1 . D-50354 Huerth / Germany . Phone: (02233) 604-0 . Fax: (02233) 604-222 . e-mail: info@ld-didactic.de P2.5.3.1 Physics Leaflets Heat Kinetic theory of gases of degrees of freedom of the gas molecules: Rf 2 1 CV = (VI) ©by LD Didactic GmbH Printed in the Federal

Allen, Roland E.

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Wegelerstrae # . ##### Bonn . Germany phone +## ### ###### . fax +## ### ######  

E-Print Network [OSTI]

.1 Equilibrated Systems 45 3.1.1 Carbon Nanotubes 45 3.1.2 Polyethylene Matrices 47 3.1.3 Composites 47 3 [7]. Due to these properties, carbon nanotubes can be used to reinforce polymer composites. Here in the materials research community. Meanwhile, some nanotube composite materials have been characterized experi

Ferrari, Patrik L.

402

Perseus (Germany) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange CountyPennsylvania/Geothermal

403

AMF Deployment, Black Forest, Germany  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert SouthwestTechnologies |November 2011Astudies smartHistory:CONTR.l\CT

404

Immosolar Germany | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHiCalifornia:ISI SolarIdanha,Information Jump

405

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

406

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

407

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

408

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

409

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

410

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

411

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

412

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

413

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

414

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schäfer, Eberhard

415

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

416

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

417

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

418

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

419

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

420

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

422

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

423

1456 Amtsblatt der Freien Hansestadt Bremen vom 17 . November 2011 Nr . 135 Diese nderung tritt nach der Genehmigung durch  

E-Print Network [OSTI]

Ã?nderung tritt nach der Genehmigung durch den Rektor mit Wirkung vom 1 . Oktober 2009 in Kraft . Sie gilt

Hoffmeister, Thomas S.

424

Nr . 97 Amtsblatt der Freien Hansestadt Bremen vom 7 . November 2012 795 Ordnung zur nderung der fachspezifischen  

E-Print Network [OSTI]

Wintersemester 2012/13 tritt das Mo- dul Pol-M8 in der hier beschriebenen Form (fortan auch: Pol-M8 (neu)) an die . (3) Zum Wintersemester 2012/13 tritt das Modul Pol-M7a an die Stelle des Moduls Pol-M7 . Studie" ersetzt . Artikel 2 Diese Ã?nderung tritt nach der Genehmigung durch den Rektor mit Wirkung vom 1 . Oktober

Hoffmeister, Thomas S.

425

Nr . 97 Amtsblatt der Freien Hansestadt Bremen vom 7 . November 2012 793 Ordnung zur nderung der fachspezifischen  

E-Print Network [OSTI]

im Diplomstudiengang Er- ziehungswissenschaft immatrikuliert sind . Diese Prü- fungsordnung tritt am ." Artikel 2 Diese �nderung tritt nach der Genehmigung durch den Rektor am 30 . September 2012 in Kraft . Sie CP ge- wichtet ." 8 . In § 8 werden folgende Absätze ergänzt: ,,(7) Zum Wintersemester 2012/13 tritt

Hoffmeister, Thomas S.

426

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

427

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

428

Requirements of Cask-Storage and Cask-Transport Licensing According to IAEA 1996 Rules for On-Site Storage of Spent Fuel in Germany - From the Utility's Point of View  

SciTech Connect (OSTI)

As agreed between the German government and the utilities in 2001, all spent fuel assemblies (FAs) are now stored inside spent-fuel casks in on-site storage buildings. With the cask being the only route of FA disposal, cask licensing has become vital not only for cask vendors, but also for the utilities. Recently, the German authorities have taken the switch from the IAEA 1985 to the IAEA 1996 rules as the basis of the cask transport license as an opportunity to open new areas of discussion. One example is the behavior of the fuel assemblies inside the cask during and after the most harmful design accidents. Radiation-induced embrittlement of high-burn-up fuel rods (55-65 GWd/tHM FA-avg.) may cause failure of fuel rods after the 9 m drop. If one conservatively assumes the leak-tight cask to be flooded with water and if one conservatively considers at the same time the fuel released from the high-burn-up rods to be fresh fuel, one can construct a situation with questionable criticality safety. Because of these and similar considerations, the cask licensing procedure in Germany has become difficult and slow. As a result, the German utilities can not reach the FA burn-up levels granted in their operating licenses, as there is no cask type licensed that would suffice. Cask vendors, fuel vendors and utilities must work together to solve this problem. (authors)

Schmidt, Paul; Schmidt, Konrad [EnKK, Obrigheim (Germany); Geiser, Heinz [GNS, Essen (Germany); Schmidt, Paul [EnBW Kernkraft GmbH, KKP-UP, Rheinschanzinsel, 76661 Philippsburg (Germany)

2007-07-01T23:59:59.000Z

429

Page 1 of 3 Bonn, Germany  

E-Print Network [OSTI]

such as water and land degradation. Particularly, the section looks at remedial measures, resources availability explore how knowledge on mitigation and adaptation is produced, shared, maintained, and used (or not used

Ferrari, Patrik L.

430

OMV studies ethylene expansion in Germany  

SciTech Connect (OSTI)

OMV(Vienna) is evaluating plans to debottleneck its ethylene plant at Burghausen from 310,000 m.t./year to at least 400,000 m.t./year. Senior v.p. Jochen Berger says OMV is studying the limits to which the cracker can be expanded. {open_quotes}We`re pretty sure we can go to 400,000 m.t./year, but in two months we`ll have a better idea,{close_quotes} says Berger. The expansion will also depend on the future requirements of downstream operations at the Burghausen site, which include OMV plastics subsidiary PCD`s high-density polyethylene and polypropylene units and the vinyl chloride monomer and polyvinyl chloride units operated by Hoechst-Wacker joint venture Vinnolit.

NONE

1996-10-23T23:59:59.000Z

431

Hamburg, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:Greer County is a countyon State0933482°, -90.0187164°Hamburg,

432

Bonn, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarre BiomassTHIS PAGE ISJumpSphereBonita Springs, Florida:Bonn,

433

Munich, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 -Energieprojekte3 ClimateSpurr GeothermalCarmelAlum AreaMultitradeMunhall,Munich,

434

GE Wind Energy Germany | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpen EnergyBoard" form. To create aGA SNC Solar JumpGC

435

Wilhelmshaven, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop,SaveWhiskey Flats Geothermal Area Jump to:Coop IncElectric

436

GE Global Research Europe in Munich, Germany  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickr Flickr Editor's note:ComputingFusion roadmapping aboutGDB GDB

437

Cologne, Germany: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,Information Feed Jump to:ElectricCollegiateCologne,

438

Enex Power Germany | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It isInformation Contracts (ESPC)EnergyWorks NorthEnernocEnersol

439

Visit of the Federal President of Germany  

ScienceCinema (OSTI)

Le D.G. H.Schopper a le plaisir de souhaiter la bienvenue au président de la République fédérale allemande, Richard von Weizsäcker (président féderale de 1984-1994). C'est la première visite d'un président allemand dans l'histoire du Cern.

None

2011-04-25T23:59:59.000Z

440

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

442

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5’GCGCGCCCATGGGCCCTGCCACCACCCGA3’ (forward primer with NcoI restriction site), 5’GCGCGCCATATGCCTGCCACCACCCGAGGG3’ (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

443

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

444

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

445

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

446

Diese nderung tritt nach der Genehmigung durch den am 1. April 2010 in Kraft. Sie wird im Amtsblatt der Freien Hansestadt Bremen verffentlicht.  

E-Print Network [OSTI]

Artikel 2 Diese Ã?nderung tritt nach der Genehmigung durch den am 1. April 2010 in Kraft. Sie wird Kolloquium" gestrichen. Artikel 2 Diese Ã?nderung tritt nach der Genehmigung durch den Rektor am 1. April 2010

Hoffmeister, Thomas S.

447

560 Amtsblatt der Freien Hansestadt Bremen vom 16. Juni 2009 Nr. 69 1. Der Titel der Ordnung wird wie folgt gendert  

E-Print Network [OSTI]

. September 2009 verlängert. Artikel 2 Diese �nderung tritt mit der Genehmigung durch den Rektor der. Juni 2009 Nr. 69 Artikel 2 Diese �nderung tritt mit der Genehmigung durch den Rektor mit Wirkung vom 1

Hoffmeister, Thomas S.

448

800 Amtsblatt der Freien Hansestadt Bremen vom 7 . November 2012 Nr . 97 Ordnung zur nderung der fachspezifischen Prfungsordnung fr den Bachelorstudiengang  

E-Print Network [OSTI]

6 eingefügt: ,,(5) Zum Wintersemester 2012/13 tritt das Modul Pol-M8a an die Stelle des Moduls Pol anerkannt . (6) Zum Wintersemester 2012/13 tritt das Modul Pol-M7 in der hier beschriebenen Form (fortan" . 13 . In der Erläuterung zu Anlage 3 wird angefügt: ,,S = Seminar" . Artikel 2 Diese �nderung tritt

Hoffmeister, Thomas S.

449

Auszug aus: Knstliche Intelligenz, Heft 4/2007, ISSN 0933-1875, BttcherIT Verlag, Bremen, www.kuenstliche-intelligenz.de/order Engineering Adaptive Web  

E-Print Network [OSTI]

than the traditional desktop applications. The users differ in their background, culture, political and social environment, and interests. The different user types have slightly different requirements. This development brings with it several challenges in terms of the handling requirements and pref- erences

Dolog, Peter

450

An Institutional View on Categorical Logic Joseph Goguen, University of California, San Diego  

E-Print Network [OSTI]

Mossakowski, DFKI-Lab Bremen and University of Bremen Valeria de Paiva, Palo Alto Research Center, Palo Alto of institutions. The notion of institution arose within computer science as a response to the population explosion

Schröder, Lutz

451

E-Print Network 3.0 - ausgewaehlten biologischen systemen Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sich in biologischen Grundlagen einzuarbeiten Source: Folgheraiter, Michele - Robotics Innovation Center, DFKI Bremen Collection: Engineering 7 Masterstudiengang Marine...

452

E-Print Network 3.0 - auswahl und anwendung Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Anwendung auf dem ATMega128Anwendung ... Source: Folgheraiter, Michele - Robotics Innovation Center, DFKI Bremen Collection: Engineering 5 Videocodierstandards H.120,...

453

E-Print Network 3.0 - aspekte von fusions-aehnlichen Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Fragestellung beschftigt, ist der wie das Source: Folgheraiter, Michele - Robotics Innovation Center, DFKI Bremen Collection: Engineering 31 Human Resources Management...

454

E-Print Network 3.0 - autonomous navigation algorithms Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

capable of navigating within ... Source: Folgheraiter, Michele - Robotics Innovation Center, DFKI Bremen Collection: Engineering 37 Tightly-Coupled Navigation Assistance...

455

16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers  

E-Print Network [OSTI]

on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

Short, Daniel

456

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta

457

International Conference on Hydroinformatics HIC 2012, Hamburg, GERMANY  

E-Print Network [OSTI]

, CA 94305-4020, USA Water shortage is a global problem that has severe implications on economic growth water shortages. Increasing water, food and energy prices, and hampered agricultural productivity have soil damage caused by leaching (due to excessive water application) or draining (due to water shortage

Stanford University

458

Automotive Import Taxation : Trade from Germany to Finland.  

E-Print Network [OSTI]

??The automotive taxation in Finland is high on international standards. Vehicles are be-ing imported to Finland daily. A significant share - over 23 000 automobiles… (more)

Lautamäki, Lassi

2014-01-01T23:59:59.000Z

459

Germany and China -an Innovative Partnership in Information Technology  

E-Print Network [OSTI]

. Stephan STEGLICH, Fraunhofer Institute for Open Communication Systems Brief Introduction to CNNIC and IDNGermany and China - an Innovative Partnership in Information Technology Hasso Plattner Institute Internet Society of China (ISC), Chinese Academy of Engineering (CAE) Innovating information technology

Weske, Mathias

460

Emigration and the Foundation of West Germany, 1933-1963  

E-Print Network [OSTI]

assistant Edgar Alexander Emmerich to respond on his behalf.Emmerich informed Schoeps that Barth could not take part inof Lessing’s Nathan, Emmerich argued; to give up the

Strote, Noah Benezra

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Institutionalizing Dualism: Complementarities and Change in France and Germany  

E-Print Network [OSTI]

The French and German political economies have been significantly reconfigured over the past two decades. Although the changes have often been more piecemeal than revolutionary, their cumulative effects are profound. The ...

Thelen, Kathleen

462

Synchrotron infrared and Raman spectroscopy of microdiamonds from Erzgebirge, Germany  

E-Print Network [OSTI]

of Kazakhstan and the Western Gneiss Region of Norway, and differentiates them from other nitrogen­Mesozoic collisional orogenic belts of Kazakhstan (Kokchetav massif), China (Dabie and Qiadam territories), Norway concentration similar to that of Kazakhstan. In both localities, the diamonds are well preserved, although some

Cartigny, Pierre

463

CLIMATE POLICY OUTCOMES IN GERMANY Environmental Performance and Environmental Damage  

E-Print Network [OSTI]

in car travel, road freight, and electricity consumption. Research on climate and environmental policies, and be pre- pared for some surprises. Ironically, the most effective government inter- ventions may should focus on somewhat different areas of government intervention and ask different questions. KEYWORDS

Qiu, Weigang

464

MHK Projects/Munich Germany SHP | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpIncMAK Technologies JumpLuangwa Zambia5.1719°,Crossing ProjectMunich

465

MHK Projects/Rosenheim Germany SHP | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpIncMAKGalway Bay IE < MHK Project City Tunica0,LA

466

EUDEEP (Smart Grid Project) (Germany) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It is classified as ASHRAEDuvalJusticeEPS Corp JumpESV

467

EWIS European wind integration study (Smart Grid Project) (Germany) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It is classified as ASHRAEDuvalJusticeEPS CorpEVI ElectricEnergy

468

Drag and Circulation Control Flughafenstr. 19, 64347 Griesheim, Germany  

E-Print Network [OSTI]

and Material Sciences from TUD and from external research institutions in Darmstadt and Mainz (Institut für for conducting in-situ measurements on existing wind energy turbines using gloves, which can be put on the rotor blades of turbines. Detailed and time resolved measurements of blade vibrations, on-flow characteristics

Haller-Dintelmann, Robert

469

Down syndrome clusters in Germany after the Chernobyl accident  

SciTech Connect (OSTI)

In two independent studies using different approaches and covering West Berlin and Bavaria, respectively, highly significant temporal clusters of Down syndrome were found. Both sharp increases occurred in areas receiving relatively low Chernobyl fallout and concomitant radiation exposures. Only for the Berlin cluster was fallout present at the time of the affected meiosis, whereas the Nuremberg cluster preceded the radioactive contamination by 1 month. Hypotheses on possible causal relationships are compared. Radiation from the Chernobyl accident is an unlikely factor, because the associated cumulative dose was so low in comparison with natural background. Microdosimetric considerations would indicate that fewer than 1 in 200 oocyte nuclei would have experienced an ionizing event from Chernobyl radioactivity. Given the lack of understanding of what causes Down syndrome, other than factors associated with increased maternal age, additional research into environmental and infectious risk factors is warranted. 23 refs., 4 figs., 2 tabs.

Burkart, W.; Grosche, B.; Schoetzau, A. [Institute for Radiation Hygiene, Oberschleissheim (Germany)

1997-03-01T23:59:59.000Z

470

Etelligence (Smart Grid Project) (Cuxhaven, Germany) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The

471

Codes for the fast SSS QR eigens  

E-Print Network [OSTI]

Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip ...

472

Microsoft Word - VIPERS instructions.doc  

Office of Environmental Management (EM)

Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...

473

Elementary optimality conditions for nonlinear SDPs  

E-Print Network [OSTI]

Dec 6, 2010 ... ... G.Leugering, M. Stingl. Free Material Optimization for Plates and ... tems", Control of uncertain systems, Bremen, June 1989, D. Hinrichsen.

2010-12-06T23:59:59.000Z

474

E-Print Network 3.0 - anwendung auf supraleitende Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

code return 0; 3 C Programmierung - ... Source: Folgheraiter, Michele - Robotics Innovation Center, DFKI Bremen Collection: Engineering 11 Wissenschaftsmagazin Nr. 1 2009...

475

E-Print Network 3.0 - abhaengigkeit von der Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

von ,stereo vision als Basis zur ... Source: Folgheraiter, Michele - Robotics Innovation Center, DFKI Bremen Collection: Engineering 5 Die Ziege auf der kreisfoermigen...

476

E-Print Network 3.0 - avastuspe ja projekt Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ziel des ,,Rescue Robotics"-Projektes ist Source: Folgheraiter, Michele - Robotics Innovation Center, DFKI Bremen Collection: Engineering 4 Titel des Moduls: Entwurf...

477

E-Print Network 3.0 - autonomous optical neuroprocessors Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Urbana, IL 61801 delcomyn@life.uiuc.edu ... Source: Folgheraiter, Michele - Robotics Innovation Center, DFKI Bremen Collection: Engineering 40 Autonomous adaptation Most current...

478

E-Print Network 3.0 - al cual se Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

for Theoretical Physics, Universitt Bremen Collection: Physics 63 Examen Final de Metodos Numericos (I. Q.) Problemas Fecha: 12 de enero de 2009 Tiempo total: 3 horas...

479

E-Print Network 3.0 - achromatic lesions Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

- Institut fr Hirnforschung, Universitt Bremen Collection: Biology and Medicine 32 Near Infrared (NIR) Achromatic Phase Retarder J. Maa, J. Wanga, W. Caoa, C. Denkera,b, H....

480

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

Note: This page contains sample records for the topic "bremen germany zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

SEA 2014 Tentative Itinerary Day Date CITY COUNTRY  

E-Print Network [OSTI]

Passau GERMANY Sunday 25-May Passau GERMANY Monday 26-May Passau GERMANY Tuesday 27-May Passau GERMANY Wednesday 28-May Passau GERMANY Thursday 29-May Passau GERMANY Friday 30-May Passau GERMANY Saturday 31-May Passau GERMANY Sunday 1-Jun Passau GERMANY Monday 2-Jun Passau GERMANY Tuesday 3-Jun Passau GERMANY

Bermúdez, José Luis

482

Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan

483

E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

484

[ Enter captions text ] THURSDAY, AUGUST 26, 2010.  

E-Print Network [OSTI]

MARIA AND WE HAVE ZIP CAR ON CAMPUS. A CAR SHARING PROGRAM. WE HAVE AN ESCORT VAN THAT RUNS, ISSUES AROUND CAMPUS TO ZIP CAR, TRANSIT. ANYTHING ALTERNATIVE TRANSPORTATION. >> THAT'S YOUR THING

Sze, Lawrence

485

The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

486

SOLARPERMIT.ORG  

Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database  https://github.com/solarpermit/solarpermit/archive/devel.zip 

487

LIM Institut fur Meteorologie, Universitat Leipzig, Leipzig, Germany On the Inuence of Surface Heterogeneity  

E-Print Network [OSTI]

time scales, the latter does not hold true. Several investigators have found that the local energy-budget is not closed exactly, even over the long term. This so- called `non-closure' of the local energy the strategy of dominant surface type, the margin of error in the regional Bowen- ratio depends

Moelders, Nicole

488

Cognitive Structures Underlying Gendered Language Usage in Germany: Narration and Linguistic Fieldwork  

E-Print Network [OSTI]

of our human species (Armstrong 1987:5). This is the basic1978; Rosch 1973, 1975; Armstrong, Gleitman & Gleitman 1983;and gender studies (cf. Armstrong 1987; Bynam 1992; Lees

Kolar, Meredith

2011-01-01T23:59:59.000Z

489

Work by Peter Hnggi of the University of Augsburg in Germany and his  

E-Print Network [OSTI]

to be expected under carbon dioxide levels twice those of the pre-industrial world, which the Intergovernmental Irreduciblesensitivity Science 318, 629­632; 582­583 (2007) Decades of intensive work on climate change have done little for setting policy, because the concentrations of carbon dioxide associated with specific warmings can be much

490

Based on the discussions held at the IASUS Symposium in Freiburg, Germany, on  

E-Print Network [OSTI]

to soils and sustainable land management. Respondents were asked to rate the options and to give reasons was expressed about the value of addressing and em- phasising benefits of sustainable land management and soil. "Strengthen issues of soils and sus- tainable land management in existing multilateral environmental

Richner, Heinz

491

The legal status of UF{sub 6}-cylinder testing and licensing in Germany (and Europe)  

SciTech Connect (OSTI)

New German and European transport regulations for road and rail transport of UF{sub 6}-cylinders are presented, in particular those provisions which have direct impact on the majority of cylinders used in shipments touching ADR and RID member states. First experiences and difficulties in it`s application are highlighted taking into account experiences of a for running German regulation. A summary of research efforts on the behaviour of cylinders in fire environments concludes the paper.

Wieser, K.E. [Federal Institute for Material Research and Testing (BAM), Berlin (Germany); Tietze, A. [Bergische Universitaet - Gesamthochschule Wuppertal (Germany)

1991-12-31T23:59:59.000Z

492

DISMANTLING OF THE UPPER RPV COMPONENTS OF THE KARLSRUHE MULTI-PURPOSE RESEARCH REACTOR (MZFR), GERMANY  

SciTech Connect (OSTI)

The Multi-purpose Research Reactor was a pressurized-water reactor cooled and moderated with heavy water. It was built from 1961 to 1966 and went critical for the first time on 29 September 1965. After nineteen years of successful operation, the reactor was de-activated on 3 May 1984. The reactor had a thermal output of 200 MW and an electrical output of 50 MW. The MZFR not only served to supply electrical power, but also as a test bed for: - research into various materials for reactor building (e. g. zirkaloy), - the manufacturing and operating industry to gain experience in erection and operation, - training scientific and technical reactor staff, and - power supply (first nuclear combined-heat-and-power system, 1979-1984). The experience gained in operating the MZFR was very helpful for the development and operation of power reactors. At first, safe containment and enclosure of the plant was planned, but then it was decided to dismantle the plant completely, step by step, in view o f the clear advantages of this approach. The decommissioning concept for the complete elimination of the plant down to a green-field site provides for eight steps. A separate decommissioning license is required for each step. As part of the dismantling, about 72,000 Mg [metric tons] of concrete and 7,200 Mg of metal (400 Mg RPV) must be removed. About 700 Mg of concrete (500 Mg biological shield) and 1300 Mg of metal must be classified as radioactive waste.

Prechtl, E.; Suessdorf, W.

2003-02-27T23:59:59.000Z

493

AST 2009, March 26-27, Hamburg, Germany MODEL-BASED DIAGNOSTICS TECHNIQUES FOR  

E-Print Network [OSTI]

APPLICATIONS WITH RODON® Peter Bunus1,2 , Olle Isaksson1 , Beate Frey1 , Burkhard Münker1 1 Uptime Solutions AB that made the spacecraft's service module to loose oxygen and electrical power. Astronauts John Swigert, Jr, Beate Frey and Münker Burkhard 2 LMP: Okay, Right now, Houston, the voltage is - is looking good. And we

Burns, Peter

494

In IFIP TC6 International Conference on Broadband Communications (BC'98), Stuttgart, Germany, April 13, 1998  

E-Print Network [OSTI]

1­3, 1998 A study of simple usage­based charging schemes for broadband networks \\Lambda C volume of a connection), and relating these to bounds of the effective bandwidth. A requirement for usage. Keywords Usage­based charging, effective bandwidths, incentive compatibility, ATM, Internet 1 INTRODUCTION

Siris, Vasilios A.

495

Cover picture: Courtesy of Solarenergiefrderverein Bayern e.V., Germany INTERNATIONAL ENERGY AGENCY  

E-Print Network [OSTI]

, CANMET Energy Technology Center, Varennes, Canada. This report is supported by Agence française De l The International Energy Agency (IEA), founded in November 1974, is an autonomous body within the framework of solar energy into electricity. The mission of the IEA PVPS programme is: to enhance the international

Boyer, Edmond

496

Cognitive Structures Underlying Gendered Language Usage in Germany: Narration and Linguistic Fieldwork  

E-Print Network [OSTI]

Nurturant Parent system of morality (NPM) (Chapter 4). SFMstrength, and purity, while NPM is based on empathy andoccasional features of NPM reasoning, female consultants

Kolar, Meredith

2011-01-01T23:59:59.000Z

497

Aerial photographic monitoring of spruce damage in Bayerischer Wald National Park, Federal Republic of Germany  

E-Print Network [OSTI]

) August, 1989 Forest damage or '%aldschaden" has became a matter of increasing ~ in ~ ~. In 1983, 34 ~ of the forests of the F~ ~lic of ~ were found to be affected. In Southern ~'s state of Bavaria, 45 percent of the forests were found... to be In an attempt to detecnine the rate at which the forest ~ phenomenon ? particularly with ~ to Norway spruce (Picea abies Karst. ) ? is wo~ in Bayerischer Weld National Park, an air photo interpretation study was conducted utilizing large scale 1:3000 color...

Goebel, John Martin

1989-01-01T23:59:59.000Z

498

Controversial copyright regulation in Germany protection of commercial exploitation vs free/open access  

E-Print Network [OSTI]

-Commons-License: http://creativecommons.org/licenses/by-nc-sa/2.0/de// What is strong copyright/ IPR? #12;Information is strong copyright/ IPR? Strong intellectual property rights (IPR) regulations not an official legal term. but strong IPR means exclusive publication and exploitation rights for creators/authors strong legal

Kuhlen, Rainer

499

Moral Philosophy and the Origins of Modern Aesthetic Theory in Scotland and Germany  

E-Print Network [OSTI]

of A System of Moral Philosophy. By Francis Hutcheson.Meditationes, §25-7. philosophy, Baumgarten suggestsfor a new branch of philosophy and the Pietist background

Grote, Simon William

2010-01-01T23:59:59.000Z

500

Cognitive Structures Underlying Gendered Language Usage in Germany: Narration and Linguistic Fieldwork  

E-Print Network [OSTI]

in Conceptual Knowledge. Cognitive Neuropsychology 22.455- G2004. The Neural Bases of Cognitive Conflict and Control inNarrative Theory and the Cognitive Sciences. Stanford:

Kolar, Meredith

2011-01-01T23:59:59.000Z