Sample records for bone springs eagle

  1. EAGLE

    Energy Science and Technology Software Center (OSTI)

    003500WKSTN00 EAGLE: 'EAGLE'Is an' Algorithmic Graph Library for Exploration† https://github.com/ssrangan†

  2. Regional geologic characterization of the Second Bone Spring Sandstone, Delaware basin, Lea and Eddy Counties, New Mexico

    E-Print Network [OSTI]

    Downing, Amanda Beth

    2001-01-01T23:59:59.000Z

    The Bone Spring Formation is a series of interbedded siliciclastics and carbonates that were deposited in the Delaware basin during the Leonardian (Early Permian). It consists of the First, Second and Third Carbonate and the First, Second and Third...

  3. Idaho_WarEagle

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh School footballHydrogenIT |Hot Springs Site

  4. WINDExchange Webinar: Wind Energy and Eagles: The Problem, the...

    Broader source: Energy.gov (indexed) [DOE]

    WINDExchange Webinar: Wind Energy and Eagles: The Problem, the Permit, and the Path Forward WINDExchange Webinar: Wind Energy and Eagles: The Problem, the Permit, and the Path...

  5. EIS-0471: Areva Eagle Rock Enrichment Facility in Bonneville...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    1: Areva Eagle Rock Enrichment Facility in Bonneville County, ID EIS-0471: Areva Eagle Rock Enrichment Facility in Bonneville County, ID May 20, 2011 EIS-0471: Final Environmental...

  6. Secret Plans Tab by Eagles Of Death Metal, www.Ultimate-Guitar.Com SECRET PLANS -Eagles of Death Metal

    E-Print Network [OSTI]

    Reiners, Peter W.

    Secret Plans Tab by Eagles Of Death Metal, www.Ultimate-Guitar.Com ------------------------------------------------------------------------------- SECRET PLANS - Eagles of Death Metal It Secret Plans Midnight missions Wheels in motion Hoo Hoo Secret Plans Midnight mission With emotion Hou

  7. Eagle County- Eagle County Efficient Building Code (ECO-Green Build)

    Broader source: Energy.gov [DOE]

    In an effort to reduce county-wide energy consumption and improve the environment, Eagle County established their own efficient building code (ECO-Green Build) which applies to all new construction...

  8. Where Eagles FlyTM CHARLES COUNTY

    E-Print Network [OSTI]

    Maryland at College Park, University of

    with the development of new energetic systems, CECD's expansion calls for the creation of other areas of excellenceWhere Eagles FlyTM CHARLES COUNTY MARYLAND CENTER FOR ENERGETIC CONCEPTS DEVELOPMENT Dr. D. K Phone 301.405.5294 Fax 301.314.9477 dkanand@umd.edu Website: www.cecd.umd.edu ENERGETICS TECHNOLOGY

  9. Use of east Texas reservoirs by wintering bald eagles

    E-Print Network [OSTI]

    Russell, Sandra Joy

    1982-01-01T23:59:59.000Z

    roost in the United States; there are now 4 other roosting areas preserved along the Mississippi and Missouri rivers (Dunstan 1978). The Bear Valley National Wildlife Refuge in Oregon was established to protect the approximately 300 wintering bald...;. immature, 40%%u adult), b bald eagles begin arriving in east Texas in mid-November and are mostly gone by mid-14arch. Some eagles apparently wander between reservoirs and river systems throughout the winter. The eagles rely on self-caught live fish...

  10. Eagle County - Energy Smart Colorado Energy Efficiency Rebate...

    Open Energy Info (EERE)

    Eagle County - Energy Smart Colorado Energy Efficiency Rebate Program (Colorado) No revision has been approved for this page. It is currently under review by our subject matter...

  11. Eagle County- Energy Smart Colorado Energy Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    Residents of Roaring Fork Valley and Eagle, Gunnison, Lake, and Summit Counties are eligible for energy efficiency and renewable energy assistance, rebates, and financing through the Energy Smart...

  12. Fracture Conductivity of the Eagle Ford Shale

    E-Print Network [OSTI]

    Guzek, James J

    2014-07-25T23:59:59.000Z

    , and rock geomechanical properties. Therefore, optimizing conductivity by tailoring a wellís fracturing treatment to local reservoir characteristics is important to the oil and gas industry for economic reasons. The roots of hydraulic fracturing can... of the formation. Sahoo et al. (2013) identified that mineralogy, hydrocarbon filled porosity, and total organic content are most prominent parameters that control Eagle Ford well productivity. Mineral composition determines several geomechanical properties...

  13. Lead in Species of Greatest Conservation Need: Free-flying Bald Eagles as Indicators

    E-Print Network [OSTI]

    Koford, Rolf R.

    Lead in Species of Greatest Conservation Need: Free-flying Bald Eagles as Indicators Principal Wildlife Grant Goals and Objectives: o Characterize lead levels in nesting and wintering Bald Eagles in Iowa State University o Compare lead exposure in free-flying eagles with eagles admitted

  14. IPM Eagle LLP | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup | OpenHunan Runhua New Energy DevelopmentListIIFCIINTA JumpIPM Eagle LLP

  15. Eagle Energy LLC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualPropertyd8c-a9ae-f8521cbb8489 No revision| Open Jump to:(RES-AEI) | OpenEUHYFISEXARCounty,Eagle

  16. Use of east Texas reservoirs by wintering bald eagles

    E-Print Network [OSTI]

    Russell, Sandra Joy

    1982-01-01T23:59:59.000Z

    ) also found wintering bald eagles relying primarily on black-tailed jackrabbits for food. These birds shared their t 1 11 d oott tth g 1d g1 Ihttit ~ht t t). Ed d successfully trapped several bald eagles and fitted them with radio transmitters... below Toledo Bend Reservoir until the nest trees were killed by inundation. The Texas Parks and Wildlife Depar t- ment conducts an aerial survey each winter to locate bald eagle nests and to verify the success rate of each active nest. In 1979...

  17. Production Forecast, Analysis and Simulation of Eagle Ford Shale Oil†

    E-Print Network [OSTI]

    Alotaibi, Basel Z S Z J

    2014-12-02T23:59:59.000Z

    fracturing to liberate the recoverable hydrocarbon reserves. Thousands of wells that have been drilled in the major oil shale formations: Bakken, Permian Basin and Eagle Ford, where oil production peaked in the first few weeks and then showed a sharp...

  18. Double Eagle II Airport (AEG) Pavement Condition and Analysis

    E-Print Network [OSTI]

    Cal, Mark P.

    Double Eagle II Airport (AEG) Pavement Condition and Analysis Submitted to: Jane M. Lucero, AICP ...................................................................................................................FWD Analysis 11 .......................................3. Predicted Pavement Conditions Assuming No Maintenance 11 .....................Table 4. Predicted Pavement Conditions (PCI) Assuming no Maintenance 12

  19. Study of Golden Eagles Migration in the Calgary Canada

    E-Print Network [OSTI]

    Liao, Tianqing

    2013-01-01T23:59:59.000Z

    Eagles Migration in the Calgary Canada A thesis submitted inMigration in the Calgary Canada by Tianqing Liao Master ofMountains of Calgary, Canada. The project began in March

  20. Production Forecast, Analysis and Simulation of Eagle Ford Shale Oil

    E-Print Network [OSTI]

    Alotaibi, Basel Z S Z J

    2014-12-02T23:59:59.000Z

    fracturing to liberate the recoverable hydrocarbon reserves. Thousands of wells that have been drilled in the major oil shale formations: Bakken, Permian Basin and Eagle Ford, where oil production peaked in the first few weeks and then showed a sharp...

  1. Assessment of Eagle Ford Shale Oil and Gas Resources

    E-Print Network [OSTI]

    Gong, Xinglai

    2013-07-30T23:59:59.000Z

    , and to assess Eagle Ford shale oil and gas reserves, contingent resources, and prospective resources. I first developed a Bayesian methodology to generate probabilistic decline curves using Markov Chain Monte Carlo (MCMC) that can quantify the reserves...

  2. Georgia Southern University Office of Career Services Eagle Career Net/NACElink Privacy and Use of Data Policy

    E-Print Network [OSTI]

    Hutcheon, James M.

    Georgia Southern University Office of Career Services Eagle Career Net/NACElink Privacy and Use of Data Policy Georgia Southern University Office of Career Services Eagle Career Net/NACElink Privacy and the NACElink Network to provide student with Eagle Career Net. Eagle Career Net is our online system

  3. EA-1905: Double Eagle Water System, Carlsbad, New Mexico

    Broader source: Energy.gov [DOE]

    This EA, prepared by the U.S. Department of the Interiorís Bureau of Land Management Carlsbad Field Office and adopted by DOE, evaluates the expansion and upgrade of the City of Carlsbadís Double Eagle Water System.

  4. Science Requirements for EAGLE for the E-ELT

    E-Print Network [OSTI]

    C. J. Evans; M. D. Lehnert; J. -G. Cuby; S. L. Morris; A. M. Swinbank; W. D. Taylor; D. M. Alexander; N. P. F. Lorente; Y. Clenet; T. Paumard

    2008-07-18T23:59:59.000Z

    We present an overview of the EAGLE science case, which spans spatially-resolved spectroscopy of targets from five key science areas - ranging from studies of heavily-obscured Galactic star clusters, right out to the first galaxies at the highest redshifts. Here we summarise the requirements adopted for study and also evaluate the availability of natural guide stars in example fields, which will impact on the adaptive optics performance and architecture.

  5. Water Use in the Eagle Ford Shale: An Economic and Policy Analysis of Water Supply and Demand

    E-Print Network [OSTI]

    Arnett, Benton; Healy, Kevin; Jiang, Zhongnan; LeClere, David; McLaughlin, Leslie; Roberts, Joey; Steadman, Maxwell

    2014-01-01T23:59:59.000Z

    inaccessible shale reserves to produce abundant amounts of oil and gas. The oil and gas proliferation in the Eagle Ford has seen exponential growth, and production is not anticipated to decline until 2025. In addition, a typical HF well in the Eagle Ford... Figures Figure 1: Map of the Eagle Ford Shale Oil, Gas and Condensate Play .......................................................... 4 Figure 2: Production Growth within the Eagle Ford Shale...

  6. Production patterns in Eagle Ford Shale (Decline Curve Analysis) Muoz Torres, J.1

    E-Print Network [OSTI]

    Texas at Austin, University of

    , the Eagle Ford Shale (EFS) play has had a remarkable development in natural gas and oil production. EFSEG39 Production patterns in Eagle Ford Shale (Decline Curve Analysis) Mu√Īoz Torres, J.1 javier (bcf) of natural gas and 8,049 thousand barrels of oil. Up to 2020, it is expected that natural gas

  7. Eagle County, Colorado Data Dashboard | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube|6721 Federal Register / Vol.6: RecordJune- BatteryVehicles |Data Dashboard Eagle

  8. Eagle-Vail, Colorado: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand JumpConceptual Model,DOE FacilityDimondale,South, NewDyerTier2Latvia)Colorado: EnergyEagle-Vail,

  9. Alternative Fuels Data Center: Golden Eagle Distributors Inc. to Convert

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041cloth DocumentationProductsAlternative Fuels Clean CitiesStationTrucks Golden Eagle

  10. Assessment of the Mexican Eagle Ford Shale Oil and Gas Resources†

    E-Print Network [OSTI]

    Morales Velasco, Carlos Armando

    2013-08-02T23:59:59.000Z

    was not quantified. In November 2011, Petr?leos Mexicanos (PEMEX) estimated prospective gas resources in the different plays. For the Upper Cretaceous (which includes the Eagle Ford shale) the estimates were 54-106-171 TCF (P90-P50-P10). For the Eagle Ford... and Agua Nueva shales combined resources were estimated to be 27-87 TCF (P90-P10) (PEMEX 2011). An assessment of the Eagle Ford shale oil and gas resources in the US is being done by the Crisman Institute for Petroleum Research at Texas A&M University...

  11. Applying Decline Curve Analysis in the Liquid-rich Shales: Eagle Ford Shale Study†

    E-Print Network [OSTI]

    Indras, Purvi

    2014-01-09T23:59:59.000Z

    With the emergence of liquid rich shale (LRS) plays like Eagle Ford and Northern Barnett, the petroleum industry needs a simple, easily applied technique that provides reliable estimates of future production rates in this kind of reservoir...

  12. WINDExchange Webinar: Wind Energy and Eagles: The Problem, the Permit, and the Path Forward

    Broader source: Energy.gov [DOE]

    Save the date for this free webinar. Wally Erickson of WEST, Inc. will present on the conservation and permitting challenges associated with wind and eagles; Annie Mudge of Cox, Castle &...

  13. R E P O R T Soils of Eagle Crater and Meridiani Planum at the

    E-Print Network [OSTI]

    Glotch, Timothy D.

    Planum, and finally came to rest inside 20-m- diameter Eagle crater. The airbags remained clean (Plate 1 by annual global storms. Airbag bounce marks on the crater floor indicate that de- flation leaves a thin

  14. Water Value and Environmental Implications of Hydraulic Fracturing: Eagle-Ford Shale

    E-Print Network [OSTI]

    Allen, W.; Lacewell, R.; Zinn, M.

    2014-01-01T23:59:59.000Z

    to develop implications based on industry, government and institutional data, and draw conclusions relative to impacts on the environment, realized amount of water, and value of water used for a typical well in the Eagle-Ford development, a water...

  15. Water Value and Environmental Implications of Hydraulic Fracturing: Eagle-Ford Shale†

    E-Print Network [OSTI]

    Allen, W.; Lacewell, R.; Zinn, M.

    2014-01-01T23:59:59.000Z

    to develop implications based on industry, government and institutional data, and draw conclusions relative to impacts on the environment, realized amount of water, and value of water used for a typical well in the Eagle-Ford development, a water...

  16. Star Formation in the Eagle Nebula and NGC 6611

    E-Print Network [OSTI]

    B. G. Elmegreen; J. Palous; J. M. Oliveira; R. D. Jeffries; J. Th Van Loon

    Abstract. We present IZJHKL ? photometry of the core of the cluster NGC6611 in the Eagle Nebula. This photometry is used to constrain the Initial Mass Function (IMF) and the circumstellar disk frequency of the young stellar objects. Optical spectroscopy of 258 objects is used to confirm membership and constrain contamination as well as individual reddening estimates. Our overall aim is to assess the influence of the ionizing radiation from the massive stars on the formation and evolution of young low-mass stars and their disks. The disk frequency determined from the JHKL ? colour-colour diagram suggests that the ionizing radiation from the massive stars has little effect on disk evolution (Oliveira et al. 2005). The cluster IMF seems indistinguishable from those of quieter environments; however towards lower masses the tell-tale signs of an environmental influence are expected to become more noticeable, a question we are currently addressing with our recently acquired ultra-deep (ACS and NICMOS) HST images.

  17. Molecular hydrogen abundances of galaxies in the EAGLE simulations

    E-Print Network [OSTI]

    Lagos, Claudia del P; Schaye, Joop; Furlong, Michelle; Frenk, Carlos S; Bower, Richard G; Schaller, Matthieu; Theuns, Tom; Trayford, James W; Bahe, Yannick M; Vecchia, Claudio Dalla

    2015-01-01T23:59:59.000Z

    We investigate the abundance of galactic molecular hydrogen (H$_2$) in the "Evolution and Assembly of GaLaxies and their Environments" (EAGLE) cosmological hydrodynamic simulations. We assign H$_2$ masses to gas particles in the simulations in post-processing using two different prescriptions that depend on the local dust-to-gas ratio and the interstellar radiation field. Both result in H$_2$ galaxy mass functions that agree well with observations in the local and high-redshift Universe. The simulations reproduce the observed scaling relations between the mass of H$_2$ and the stellar mass, star formation rate and stellar surface density. Towards high edshifts, galaxies in the simulations display larger H$_2$ mass fractions, and correspondingly lower H$_2$ depletion timescales, also in good agreement with observations. The comoving mass density of H$_2$ in units of the critical density, $\\Omega_{\\rm H_2}$, peaks at $z\\approx 1.2-1.5$, later than the predicted peak of the cosmic star formation rate activity, a...

  18. Assessment of the Mexican Eagle Ford Shale Oil and Gas Resources

    E-Print Network [OSTI]

    Morales Velasco, Carlos Armando

    2013-08-02T23:59:59.000Z

    and for their commitment to our education. I would also like to thank Dr. Yuefeng Sun for being part of my committee and Dr. Juan Carlos Laya for serving as a substitute in my thesis defense. My special thanks to Petr?leos Mexicanos for providing me information... was not quantified. In November 2011, Petr?leos Mexicanos (PEMEX) estimated prospective gas resources in the different plays. For the Upper Cretaceous (which includes the Eagle Ford shale) the estimates were 54-106-171 TCF (P90-P50-P10). For the Eagle Ford...

  19. Salida Hot Springs (Poncha Spring) Space Heating Low Temperature...

    Open Energy Info (EERE)

    Salida Hot Springs (Poncha Spring) Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Salida Hot Springs (Poncha Spring) Space Heating Low...

  20. Key Economic Drivers Impacting Eagle Ford Development from Resource to Reserves†

    E-Print Network [OSTI]

    Del Busto Pinzon, Andres Mauricio

    2013-11-25T23:59:59.000Z

    The Eagle Ford shale of South Texas has become one of the most active and most important shale plays in the U.S. This success has been possible because of the unique geology and richness of the play, allowing significant production of natural gas...

  1. The Dalles Lock and Dam welcomes raptor (and human) visitors during Eagle Watch 2013

    E-Print Network [OSTI]

    US Army Corps of Engineers

    The Dalles Lock and Dam welcomes raptor (and human) visitors during Eagle Watch 2013 By Amber Tilton, The Dalles Lock and Dam park ranger Nestled between Oregon and Washington is the Columbia River District operates three dams on the Columbia River where visitors and employees alike often spot America

  2. The Future of BPM: Flying with the Eagles or Scratching with the Chickens?

    E-Print Network [OSTI]

    Pfeifer, Holger

    The Future of BPM: Flying with the Eagles or Scratching with the Chickens? Peter Dadam Institute-oriented architectures, business process management (BPM) systems, and BPM in general receive a lot of attention to be performed manually today. In fact, BPM has a great potential. However, to realize this potential in practice

  3. Lateral Continuity of the Eagle Ford Group Strata in Lozier Canyon and Antonio Creek, Terrell County, Texas

    E-Print Network [OSTI]

    Gardner, Rand D

    2013-09-24T23:59:59.000Z

    simplistic assumptions about relevant horizontal reservoir heterogeneities can lead to sub-optimal or uneconomical exploitation. High-resolution correlation of individual beds in the Eagle Ford Group over several miles in Lozier Canyon and Antonio Creek...

  4. Occurrence of Multiple Fluid Phases Across a Basin, in the Same Shale Gas Formation Ė Eagle Ford Shale Example

    E-Print Network [OSTI]

    Tian, Yao

    2014-04-29T23:59:59.000Z

    production data. Well deliverability was modeled to optimize oil production rate by designing appropriate operational parameters. From NW to SE, Eagle Ford fluids evolve from oil, to gas condensate and, finally, to dry gas, reflecting greater depth...

  5. Occurrence of Multiple Fluid Phases Across a Basin, in the Same Shale Gas Formation Ė Eagle Ford Shale Example†

    E-Print Network [OSTI]

    Tian, Yao

    2014-04-29T23:59:59.000Z

    Shale gas and oil are playing a significant role in US energy independence by reversing declining production trends. Successful exploration and development of the Eagle Ford Shale Play requires reservoir characterization, recognition of fluid...

  6. Dredging as remediation for white phosphorus contamination at Eagle River Flats, Alaska

    SciTech Connect (OSTI)

    Walsh, M.R.; Collins, C.M.

    1998-08-01T23:59:59.000Z

    The Eagle River Flats impact area is a Ft. Richardson Superfund site. It is a salt marsh that is contaminated with white phosphorus (WP), and remediation of sediments in permanently ponded areas may require dredging. A remotely piloted dredging system was designed, constructed, and deployed at the Flats as part of the overall site remediation feasibility study. Experience gained over two years of engineering study and contract operation indicates that, although feasible and effective, this alternative is slow, difficult, and very expensive.

  7. A review of "The Eye of the Eagle: John Donne and the Legacy of Ignatius Loyola" by Francesca Bugliani Knox

    E-Print Network [OSTI]

    Harris, Mitchell M.

    2012-01-01T23:59:59.000Z

    18 seventeenth-century news Francesca Bugliani Knox. #31;e Eye of the Eagle: John Donne and the Legacy of Ignatius Loyola. Bern: Peter Lang, 2011. Religions and Discourse Series. 342 pp. $75.95. Review by #21;#18;#19;#24;#23;#30; #21;. #23...;#25;#31;#31;#18;#26;, #25;#29;#8;#29;#26;#19;#25;#27;#25; #24;#20; #30;#8;#30; (#26;#18;#20;#29;#5; #7;#25; #26;). When I spotted the provocative title of Francesca Bugliani Knox?s #31;e Eye of the Eagle: John Donne and the Legacy of Ignatius Loyola for the #15;rst...

  8. Alternative Fuels Data Center: Golden Eagle Delivers Beer With Natural Gas

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041cloth DocumentationProductsAlternative Fuels Clean CitiesStationTrucks Golden Eagle Delivers

  9. Thermal Springs of Arizona

    SciTech Connect (OSTI)

    Witcher, J.C.; Ruscetta, C.A.; Foley, D. (eds.)

    1981-05-01T23:59:59.000Z

    An updated list of Arizona springs judged to be carrying anomalous heat. Possible heat sources are briefly outlined. (MHR)

  10. Joshua Smith Spring 2006

    E-Print Network [OSTI]

    Rosemond, Amy Daum

    Stormwater Utilities in Georgia Joshua Smith Spring 2006 #12;The UGA Land Use Clinic provides in Georgia Author: Joshua Smith Editor: Jamie Baker Roskie University of Georgia Land Use Clinic Spring 2006....................................................................................................10 #12;#12;1Stormwater Utilities in Georgia Stormwater Utilities in Georgia Joshua Smith Spring 2006

  11. WELDON SPRING FORMER ARMY

    E-Print Network [OSTI]

    1959 for the Army Reserve as the Weldon Spring Training Area. Contaminated areas are spread throughoutWELDON SPRING FORMER ARMY ORDNANCE WORKS MISSOURI EPA ID# MO5210021288 EPA Region 7 10/13/2011 City: 35 miles west of St. Louis County: St. Charles County Other Names: Weldon Springs National Guard

  12. INVEST IN YOUR BONES Bone Basics

    E-Print Network [OSTI]

    replace- ment at menopause may prevent bone loss and/or osteoporosis. Also find out if there is a need in your bones? Osteoporosis, a major health problem in America, affects over 10 million persons, with 34 million at a high risk of developing the disease (National Osteoporosis Foundation, 2010). Dubbed

  13. EIS-0471: Department of Energy Loan Guarantee to Support Proposed Eagle Rock Enrichment Facility in Bonneville County, Idaho

    Broader source: Energy.gov [DOE]

    This EIS evaluates the environmental impacts of construction, operation, and decommissioning of the proposed Eagle Rock Enrichment Facility (EREF), a gas centrifuge uranium enrichment facility to be located in a rural area in western Bonneville County, Idaho. (DOE adopted this EIS issued by NRC on 04/13/2007.)

  14. Water Use in the Eagle Ford Shale: An Economic and Policy Analysis of Water Supply and Demand†

    E-Print Network [OSTI]

    Arnett, Benton; Healy, Kevin; Jiang, Zhongnan; LeClere, David; McLaughlin, Leslie; Roberts, Joey; Steadman, Maxwell

    2014-01-01T23:59:59.000Z

    until 2025. In addition, a typical HF well in the Eagle Ford is estimated to consume about 13 acre - feet of water for a standard 5000 foot lateral . Approximately 90% of water for HF comes from fresh groundwater aquifers. This interaction of HF...

  15. Transect 24:1 (spring 2006)

    E-Print Network [OSTI]

    UC Natural Reserve System

    2007-01-01T23:59:59.000Z

    eagles away, were wiped out by DDT contamination. The baldwere vulnerable to discarded DDT that in?ltrated the marineWhen we were dumping DDT o? the southern California coast,

  16. STUDENT PULSE Spring 2013

    E-Print Network [OSTI]

    SF STATE STUDENT PULSE SURVEY Spring 2013 Academic Planning and Development Academic Institutional Research (air.sfsu.edu) March 2013 #12;SF State Student Pulse Survey, Spring 2013 Page 1 Table of Contents is most effective. 79% of all respondents reported spending most of their time in class listening while

  17. CHEMISTRY 450 Spring, 2009

    E-Print Network [OSTI]

    Stuart, Steven J.

    CHEMISTRY 450 Spring, 2009 Gautam Bhattacharyya, 363 Hunter Labs, phone: 656-1356 gautamb. This course does NOT have a separate laboratory meeting time. Course Goals CH 450 is the Chemistry Capstone to change. #12;CH 450 Spring, 2009 -2- Course Outline (Tentative) Journal due dates are designated each week

  18. Biodegradable synthetic bone composites

    DOE Patents [OSTI]

    Liu, Gao; Zhao, Dacheng; Saiz, Eduardo; Tomsia, Antoni P.

    2013-01-01T23:59:59.000Z

    The invention provides for a biodegradable synthetic bone composition comprising a biodegradable hydrogel polymer scaffold comprising a plurality of hydrolytically unstable linkages, and an inorganic component; such as a biodegradable poly(hydroxyethylmethacrylate)/hydroxyapatite (pHEMA/HA) hydrogel composite possessing mineral content approximately that of human bone.

  19. Spring 2013 National Transportation Stakeholders Forum Meeting...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Forum Spring 2013 National Transportation Stakeholders Forum Meeting, New York Spring 2013 National Transportation Stakeholders Forum Meeting, New York Spring 2013...

  20. FUPWG Spring 2010 Providence: Washington Update | Department...

    Energy Savers [EERE]

    Spring 2010 Providence: Washington Update FUPWG Spring 2010 Providence: Washington Update Presentation covers an update on Washington and is given at the Spring 2010 Federal...

  1. Spring-powered actuator

    SciTech Connect (OSTI)

    Magill, R. J.; Gaiger, D. J.; Simkins, N.

    1985-07-30T23:59:59.000Z

    A spring-powered actuator especially for operating devices such as fire and/or smoke dampers, doors, hatches, vents, traps, valves and other devices having components which are movable between at least two positions. The spring-powered actuator of the invention comprises a longitudinally-displaceable re-wind screw which is rotatable to recharge the spring of the actuator, and a tilting element on the screw which is mounted for tilting movement with respect to the screw axis to allow longitudinal movement of the re-wind screw so as to permit rapid and reliable release of energy stored in the spring. When used in a combination fire and smoke damper, it thus opens or closes the blades of the latter.

  2. The distribution of neutral hydrogen around high-redshift galaxies and quasars in the EAGLE simulation

    E-Print Network [OSTI]

    Rahmati, Alireza; Bower, Richard G; Crain, Robert A; Furlong, Michelle; Schaller, Matthieu; Theuns, Tom

    2015-01-01T23:59:59.000Z

    The observed high covering fractions of neutral hydrogen (HI) with column densities above $\\sim 10^{17} \\rm{cm}^{-2}$ around Lyman-Break Galaxies (LBGs) and bright quasars at redshifts z ~ 2-3 has been identified as a challenge for simulations of galaxy formation. We use the EAGLE cosmological, hydrodynamical simulation, which has been shown to reproduce a wide range of galaxy properties and for which the subgrid feedback was calibrated without considering gas properties, to study the distribution of HI around high-redshift galaxies. We predict the covering fractions of strong HI absorbers ($N_{\\rm{HI}} \\gtrsim 10^{17} \\rm{cm}^{-2}$) inside haloes to increase rapidly with redshift but to depend only weakly on halo mass. For massive ($M_{200} \\gtrsim 10^{12} {\\rm M_{\\odot}}$) halos the covering fraction profiles are nearly scale-invariant and we provide fitting functions that reproduce the simulation results. While efficient feedback is required to increase the HI covering fractions to the high observed values...

  3. Spring 2014 National Transportation Stakeholder Forum Meeting...

    Office of Environmental Management (EM)

    Spring 2014 National Transportation Stakeholder Forum Meeting, Minnesota Spring 2014 National Transportation Stakeholder Forum Meeting, Minnesota NTSF 2014 Meeting Agenda...

  4. Evaluating the Economics of Best Management Practices for Tarrant Regional Water Districtís Eagle Mountain Lake Watershed

    E-Print Network [OSTI]

    Johnson, Jason L.

    manag e me n t unit of analys i s is one designated wetland project encompassing 20.6 acres. In-Lake BMPs Based on feedback from TRWD personne l , it was noted that BMP 20 (Hypolimnetic Aeration ) and BMP 21 (P Inactiva t i o n with Alum... years. The manage me n t unit of analysi s is one designa t e d hypol i mn e t i c aerat i o n proj ec t withi n the Eagle Mountai n Lake watersh e d . BMP 21 P Inactivation with Alum. T h e addition of powdered alum at variou s lake depths...

  5. Invest in Your Bones Bone Mineral Calcium and Vitamin D

    E-Print Network [OSTI]

    beans, eggs, and nuts. Sardines and salmon with bones, oysters, kidney beans, and tofu made with calcium

  6. Learning From Real Springs

    E-Print Network [OSTI]

    Bassichis, William

    2013-01-29T23:59:59.000Z

    extension using the model potential energy and equating the energy with the body at rest at y 0 with the energy at Yrriax 01W has Cl 2ky+ Vrnax + (2 ? I1IIU!Jrnar (6) with the solution rn1q?3 / m1q? 2 /3S / (35 - Yrna k2V k2 (i) Thus the effect... to the bottorri involves such a force. W. Bassichis, ?Don?t Panic? (OR Publishing, New York 2005) 6 Figure Captions Fig.1. For the ideaL massless spring Hooke?s Law holds and IF! = rng = ky,,,. with m the mass of the object hung from the spring. Because...

  7. Superfund Record of Decision (EPA Region 10): Wyckoff/Eagle Harbor, WA. (First remedial action), September 1992

    SciTech Connect (OSTI)

    Not Available

    1992-09-29T23:59:59.000Z

    The 3,780-acre Wyckoff/Eagle Harbor site is located on the east side of Bainbridge Island, in Central Puget Sound, Kitsap County, Washington. The site consists of an inactive 40-acre wood treating facility owned by Wyckoff, the adjacent 500-acre Eagle Harbor and other upland sources of contamination to the Harbor, including a former shipyears. The selected remedial action for this site includes dredging, dewatering, excavating approximately 1,000 to 7,000 cubic yards of intertidal sediment that exceed levels of 5 mg/kg mercury and/or lower moderate PAH concentrations, followed by treatment using solidification/stabilization, if necessary, to comply with LDR as determined by bench scale tests; transporting sediment, which cannot be treated to meet LDR offsite for disposal at a RCRA-permitted landfill; treating wastewater from the dewatering process using carbon adsorption before discharge into the harbor; capping over sediment in areas of high concern with a 1-meter thick layer of clean sediment; placing a thin layer of clean sediment in subtidal areas of low to moderate concern to enhance natural sediment recovery; conducting long-term environmental monitoring; and implementing institutional controls to prevent exposure to contaminated fish and shellfish. The estimated present worth cost for this remedial action ranges from $6,200,000 to $16,000,000 which includes a present worth O M cost of $1,100,000 for 10 years.

  8. Engineering Momentum spring 2013

    E-Print Network [OSTI]

    Stormo, Gary

    Energy Research and Development Center to expand our global reach in solar energy research. We want you Innovators #12;spring 2013 > Engineering Momentum 1 mythbusters' tory belleci and grant imahara in graham on energy and the environment (see page 26), and last year, we joined a $125 million U.S.-India Joint Clean

  9. SPRING 2007 METRICSMECHANICAL ENGINEERING

    E-Print Network [OSTI]

    Li, Teng

    OF ENGINEERING, UNIVERSITY OF MARYLAND. Department Works Globally to Share Knowledge & Expertise IN THIS ISSUE: 2SPRING 2007 METRICSMECHANICAL ENGINEERING A. JAMES CLARK SCHOOL of ENGINEERING www.enme.umd.edu A NEWSLETTER FOR ALUMNI AND FRIENDS OF THE DEPARTMENT OF MECHANICAL ENGINEERING AT THE A. JAMES CLARK SCHOOL

  10. President's Council Spring 2008

    E-Print Network [OSTI]

    Miyashita, Yasushi

    , knowledge economy, globalization and funding ∑ University to prepare students and county for the world ≠ Academic Co-operation ≠ Industrial and Societal Application 2. Rising Economies and Changing Global Balance Spring 2008 Rising Economies and Changing Global Balance ∑ What Todai Should Do with Other Rising

  11. Spring 2014 Thermodynamics -1

    E-Print Network [OSTI]

    Virginia Tech

    Spring 2014 Thermodynamics - 1 Consider an insulated (adiabatic) piston and cylinder arrangement. Confirm this statement using the second law of thermodynamics. (b) (20) She now wants to calculate the work done by the air on the piston by using the first law of thermodynamics. Do this. Draw a T

  12. Air Pollution Spring 2010

    E-Print Network [OSTI]

    ATS 555 Air Pollution Spring 2010 T Th 11:00 ­ 12:15, NESB 101 Instructor: Prof. Sonia Kreidenweis an understanding of types and sources of air pollution. 2. Examine concentrations of air pollutants and their effects on health and welfare. Review regulations governing air pollution. 3. Examine the meteorological

  13. technologytoday Spring 2003

    E-Print Network [OSTI]

    Schmidt, Douglas C.

    technologytoday Spring 2003 Volume 2 Issue 1 http://home.ray.com/rayeng HIGHLIGHTING RAYTHEON An essential element of every system RAYTHEON Processing Technology An essential element of every system RAYTHEON Processing Technology #12;In this issue of technology today, we are highlighting processing

  14. OPERATIONS MANAGEMENT Spring 2008

    E-Print Network [OSTI]

    Almor, Amit

    the operations and supply chain strategy. This survey course in operations management introduces students1 MGSC 395 OPERATIONS MANAGEMENT Spring 2008 Course Syllabus Instructor: Professor Anand Nair Class MATERIALS Required Text Books Textbook: Krajewski, Lee, Ritzman, Larry, and Malhotra, Manoj. Operations

  15. Spring 2013 Prof. Kummerow

    E-Print Network [OSTI]

    the distribution as well as radiative effects of water vapor, clouds and precipitation, current observational for personal library: Liou, K.N., 1992: Radiation and Cloud Processes in the Atmosphere: Theory, ObservationsATS 753 Spring 2013 Prof. Kummerow Simple inspection of the global energy budget reveals

  16. Electronics Division Technical Note No. 189 File: \\\\EAGLE\\cv-cdl-sis\\Docs\\Rack\\SIS Mixer Bias Supply\\Simulation\\Report2.doc Page 1 of 5

    E-Print Network [OSTI]

    Groppi, Christopher

    1 to protect the mixer junction from static discharge1 . The mixers are powered by bias suppliesElectronics Division Technical Note No. 189 File: \\\\EAGLE\\cv-cdl-sis\\Docs\\Rack\\SIS Mixer Bias Supply\\Simulation\\Report2.doc Page 1 of 5 Stability Analysis of SIS Mixer Bias Supply with 1K Ohm

  17. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1995-05-09T23:59:59.000Z

    A device is described for stimulating bone tissue by applying a low level alternating current signal directly to the patient`s skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures. 5 figs.

  18. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, James W. (Aiken, SC)

    1995-01-01T23:59:59.000Z

    A device for stimulating bone tissue by applying a low level alternating current signal directly to the patient's skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures.

  19. Experto Universitario Java Sesin 1: Spring core

    E-Print Network [OSTI]

    Escolano, Francisco

    Enterprise Spring © 2012-2013 Depto. Ciencia de la Computaciůn e IA Spring core Puntos a tratar 2 #12;Experto Universitario Java Enterprise Spring © 2012-2013 Depto. Ciencia de la Computaciůn e IA;Experto Universitario Java Enterprise Spring © 2012-2013 Depto. Ciencia de la Computaciůn e IA Spring core

  20. Syllabus Math 553, Spring 2013

    E-Print Network [OSTI]

    2013-01-07T23:59:59.000Z

    Syllabus Math 553, Spring 2013. Meeting time and place : MWF 12.30-1.20, REC 113. Instructor: Saugata Basu. Office: Math 742 email: sbasu@math.purdue.

  1. Evaluating the Economics of Best Management Practices for Tarrant Regional Water Districtís Eagle Mountain Lake Watershed†

    E-Print Network [OSTI]

    Johnson, Jason L.

    2011-01-01T23:59:59.000Z

    Economics Texas A&M University and Texas AgriLife Extension Service Executive Summary The object i ve of this asses s me n t was to identi f y the most cost-e f f e c t i v e means of reduci n g (and/o r preven t i n g ) tota l phosph o r u s (TP...) inflow s into the Eagle Mountain Lake from a compr e h e n s i v e set of Best Manag e me n t Pract i c e s (BMPs ) . Additi o na l l y , the reduce d total nitrog e n (TN), and sedime n t inflow s result i n g from adoption of these BMPs was also...

  2. INVEST IN YOUR BONES Living with Osteoporosis

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Living with Osteoporosis Leaflet 5 Living with osteoporosis can be done environment safe to avoid falls. Early detection of bone loss or osteoporosis is now possible with bone to be most effective in reducing bone loss during the five to ten years following menopause, when bone loss

  3. Spring 2015 National Transportation Stakeholders Forum Meeting...

    Broader source: Energy.gov (indexed) [DOE]

    Spring 2015 National Transportation Stakeholders Forum Meeting, New Mexico The Spring 2015 meeting of the National Transportation Stakeholders Forum will be held on May 12-14, 2015...

  4. Algal Biofuels Strategy Workshop - Spring Event | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Algal Biofuels Strategy Workshop - Spring Event Algal Biofuels Strategy Workshop - Spring Event The U.S. Department of Energy's Office of Energy Efficiency and Renewable Energy's...

  5. Why Springs Are Valuable Natural springs are important aquatic resources.

    E-Print Network [OSTI]

    Liskiewicz, Maciej

    source of clean, high-quality groundwater that flows at a relatively constant rate and temperature hot weather and droughts. Spring streams and riparian lands provide critical water, food, refuge. Because springs are dependable, they are an increasingly valuable supply of water for people and wildlife

  6. Endocortical bone loss in osteoporosis: the role of bone surface availability

    E-Print Network [OSTI]

    Buenzli, Pascal R; Clement, John G; Pivonka, Peter

    2012-01-01T23:59:59.000Z

    Age-related bone loss and postmenopausal osteoporosis are disorders of bone remodelling, in which less bone is reformed than resorbed. Yet, this dysregulation of bone remodelling does not occur equally in all bone regions. Loss of bone is more pronounced near the endocortex, leading to cortical wall thinning and medullary cavity expansion, a process sometimes referred to as "trabecularisation" or "cancellisation". Cortical wall thinning is of primary concern in osteoporosis due to the strong reduction in bone mechanical properties that it is associated with. In this paper, we examine the possibility that the nonuniformity of microscopic bone surface availability could explain the nonuniformity of bone loss in osteoporosis. We use a simple computational model of bone remodelling, in which microscopic bone surface availability influences bone turnover rate, to simulate the evolution of the bone volume fraction profile across the midshaft of a long bone. We find that bone loss is accelerated near the endocortica...

  7. SPRING ISD CATEE 2014

    E-Print Network [OSTI]

    Windsor, J.

    2014-01-01T23:59:59.000Z

    SPRING ISD CATEE 2014 ESL-KT-14-11-05 CATEE 2014: Clean Air Through Efficiency Conference, Dallas, Texas Nov. 18-20 Benchmarking results ESL-KT-14-11-05 CATEE 2014: Clean Air Through Efficiency Conference, Dallas, Texas Nov. 18-20 Annual energy...,871,387 ē 2011-2012 $8,088,599 savings $3,615,835 ē 2012-2013 $7,418,636 savings $4,285,798 ē 2013-2014 $7,393,010 savings $4,311,424 ē Total savings over last 5 years $16,855,588 ESL-KT-14-11-05 CATEE 2014: Clean Air Through Efficiency Conference, Dallas, Texas...

  8. Idaho_HotSprings

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh School footballHydrogenIT |Hot Springs Site #0104 Latitude: N. 43 deg.

  9. Assessment of the geothermal resources of Carson-Eagle valleys and Big Smoky Valley, Nevada. First annual report, May 1, 1979-May 30, 1980

    SciTech Connect (OSTI)

    Trexler, D.T.; Koenig, B.A.; Flynn, T.; Bruce, J.L.

    1980-01-01T23:59:59.000Z

    Two geothermal investigations were completed in three Nevada locations. The regions studied were selected from areas outlined as having direct utilization potential (Trexler and others, 1979) and included the Carson-Eagle Valley, Bis Smoky Valley and Caliente. Studies were organized around the completion of a group of tasks in each area. These tasks included: geologic reconnaissance, gravity surveys, aerial photography, fluid sampling and analysis, shallow depth temperature probe surveys, soil mercury surveys, shallow electrical resistivity measurements, and temperature gradient hole drilling. Goals of the project were to provide regional information about the nature and extent of the resources and to offer a critical evaluation of the techniques employed. Results from the work in the Carson-Eagle Valley and Big Smoky Valley are presented. (MHR)

  10. Spring 2006 CS 649 1 Sensor Networks

    E-Print Network [OSTI]

    Amir, Yair

    % reliability ∑ Rapid propagation ∑ Eventual consistency ∑ Scalability (network size and density) #12;Deluge Protocol Overview Spring 2006 CS 649 5 #12;Deluge Protocol Overview Spring 2006 CS 649 6 #12;Deluge Protocol Overview Spring 2006 CS 649 7 #12;Deluge Protocol Overview Spring 2006 CS 649 8 #12;Deluge

  11. MA 15400 ONLINE Spring 2015 Syllabus

    E-Print Network [OSTI]

    Delworth, Timothy J

    2015-01-06T23:59:59.000Z

    MA 15400 ONLINE Spring 2015 Syllabus. TEXTBOOK. COURSE WEBSITE. RECORDED LESSONS. HOMEWORK. QUIZZES. EXAMS. CALCULATORS.

  12. Understanding the Interactions of Collagen with Mineral in Bone: Working Towards Developing a Realistic Composite

    E-Print Network [OSTI]

    Greenaway, Alan

    . ∑ Mini-project on bone nodule formation. ∑ Neutron scattering on whole bone. ∑ Analysis of bone explants

  13. Algal Biofuels Strategy Spring Workshop | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Algal Biofuels Strategy Spring Workshop Algal Biofuels Strategy Spring Workshop Algal Biofuels Strategy Spring Workshop Agenda algaeworkshopagenda.pdf More Documents &...

  14. alkaline thermal spring: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Websites Summary: and Laplace transforms. Fundamentals of AC power, coupled inductors (transformers), and two-port networks Spring break Apr. 04 Spring breakApr. 04 Spring break...

  15. area weldon spring: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Websites Summary: and Laplace transforms. Fundamentals of AC power, coupled inductors (transformers), and two-port networks Spring break Apr. 04 Spring breakApr. 04 Spring break...

  16. adult male spring: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Websites Summary: and Laplace transforms. Fundamentals of AC power, coupled inductors (transformers), and two-port networks Spring break Apr. 04 Spring breakApr. 04 Spring break...

  17. Spring loaded thermocouple module

    DOE Patents [OSTI]

    McKelvey, Thomas E. (Solana Beach, CA); Guarnieri, Joseph J. (San Diego, CA)

    1985-01-01T23:59:59.000Z

    A thermocouple arrangement is provided for mounting in a blind hole of a specimen. The thermocouple arrangement includes a cup-like holder member, which receives an elongated thermal insulator, one end of which is seated at an end wall of the holder. A pair of thermocouple wires, threaded through passageways in the insulator, extend beyond the insulator member, terminating in free ends which are joined together in a spherical weld bead. A spring, held captive within the holder, applies a bias force to the weld bead, through the insulator member. The outside surface of the holder is threaded for engagement with the blind hole of the specimen. When the thermocouple is installed in the specimen, the spherical contact surface of the weld bead is held in contact with the end wall of the blind hole, with a predetermined bias force.

  18. Spring loaded thermocouple module

    DOE Patents [OSTI]

    McKelvey, T.E.; Guarnieri, J.J.

    1984-03-13T23:59:59.000Z

    A thermocouple arrangement is provided for mounting in a blind hole of a specimen. The thermocouple arrangement includes a cup-like holder member, which receives an elongated thermal insulator, one end of which is seated at an end wall of the holder. A pair of thermocouple wires, threaded through passageways in the insulator, extend beyond the insulator member, terminating in free ends which are joined together in a spherical weld bead. A spring, held captive within the holder, applies a bias force to the weld bead, through the insulator member. The outside surface of the holder is threaded for engagement with the blind hole of the specimen. When the thermocouple is installed in the specimen, the spherical contact surface of the weld bead is held in contact with the end wall of the blind hole, with a predetermined bias force.

  19. Regulation of thrombopoietin in bone marrow

    E-Print Network [OSTI]

    McIntosh, Bryan James

    2007-01-01T23:59:59.000Z

    R: gacagagttagtcttgccactgcaa Prb: actgatttgctcctggcggccatMutant prb: tggagctgactgatttactactagcagcaatgc Cyclophilin (L: tggcacatgaatcctggaata Prb: ttcgagctctgagcactggagaga Bone

  20. MATH 265 Spring 2013 Syllabus

    E-Print Network [OSTI]

    CHING-JUI LAI

    2012-12-18T23:59:59.000Z

    MATH 265 Spring 2013 Syllabus. Instructor. Office Hour MWF 10:30-11:30 am at MATH 850. Sessions. MA 26500 141-UNIV 019 TR 13:30 Ė 14:45 (39/42)†...

  1. MATH 262 Spring 2015 Syllabus

    E-Print Network [OSTI]

    CHING-JUI LAI

    2015-01-08T23:59:59.000Z

    MATH 262 Spring 2015 Syllabus. Instructor. Office Hour MW 16:30-18:00 am at MATH 850. Sessions MA 26200 081-UNIV 003 TR 15:00 Ė 16:15 (CRN=64359).

  2. Homework # 3 UCLA, Spring 2004

    E-Print Network [OSTI]

    Chen, Francis F.

    Homework # 3 ChE234 UCLA, Spring 2004 Chemical Engineering Principles of Plasma Processing UCLA valve is installed to control the pressure of the reactor. The conductance of the throttle valve

  3. UAA Leadership Honors Spring 2015

    E-Print Network [OSTI]

    Pantaleone, Jim

    UAA Leadership Honors Spring 2015 Purpose UAA Leadership Honors are awarded to individuals upon graduation to recognize and honor their leadership. Leadership activities and involvement must promote individual and collective growth

  4. Advanced Policy Practice Spring 2014

    E-Print Network [OSTI]

    Grissino-Mayer, Henri D.

    Advanced Policy Practice Spring 2014 SW 548-001 Instructor course that focuses on the theory and evidence-based skill sets of policy analysis, development, implementation, and change. The course focuses on policy

  5. Bone Mineral Density, Bone Turnover, and Systemic Inflammation in Non-cirrhotics with Chronic Hepatitis C

    E-Print Network [OSTI]

    Lai, J; Shoback, DMA; Zipperstein, J; Lizaola, B; Tseng, S; Terrault, NA

    2015-01-01T23:59:59.000Z

    Munėoz-Torres M, et al. Bone mineral density, serum insulin-et al. Osteoporosis and bone mineral metabolism disorders in1069-9. 11. George J. Bone mineral density and disorders of

  6. ECOLOGY AND PRODUCTION OF JUVENILE SPRING CHINOOK SALMON, ONCORHYNCHUS TSHAWYTSCHA,

    E-Print Network [OSTI]

    ), of the spring race in Happy :Valley Reservoir, a eutrophic impoundment located on the Warm Springs Indian

  7. Biomimetic hydroxyapatite as a new consolidating agent for archaeological bone

    E-Print Network [OSTI]

    North, Alexis

    2014-01-01T23:59:59.000Z

    R.E.M. †2002. †ďBone †Diagenesis: †An †Overview †of †2000. †ďPatterns †of †Diagenesis †in †Bone †I: †The †element †Studies †of †Diagenesis †in †Prehistoric †Bone. Ē †

  8. Dr. Campbell's Bio111 Exam #3 Spring 2007 Spring 2007 Biology 111 Take Home Exam #3 BioEnergetics

    E-Print Network [OSTI]

    Campbell, A. Malcolm

    Dr. Campbell's Bio111 Exam #3 ≠ Spring 2007 1 Spring 2007 Biology 111 Take Home Exam #3 ≠ BioEnergetics

  9. Dr. Campbell's Bio111 Exam #3 Spring 2008 Spring 2008 Biology 111 Take Home Exam #3 BioEnergetics

    E-Print Network [OSTI]

    Campbell, A. Malcolm

    Dr. Campbell's Bio111 Exam #3 ≠ Spring 2008 1 Spring 2008 Biology 111 Take Home Exam #3 ≠ BioEnergetics

  10. CMPE 185 Spring 1998 Syllabus 1 Syllabus

    E-Print Network [OSTI]

    Karplus, Kevin

    CMPE 185 Spring 1998 Syllabus 1 Syllabus 1 Administrative details Location and timeKresge 327, MWF 12;2 Syllabus CMPE 185 Spring 1998 participation in discussions (both in class

  11. Spring 2006 CS 649 1 Sensor Networks

    E-Print Network [OSTI]

    Amir, Yair

    Terzis http://hinrg.cs.jhu.edu/wsn06/ #12;Outline Spring 2006 CS 649 2 ∑ (Simple) Radio Power loss models ∑ Reality ∑ (More) Radio Power loss models #12;Motivation Spring 2006 CS 649 3 ∑ Communication between nodes

  12. Mechanical energy storage in carbon nanotube springs

    E-Print Network [OSTI]

    Hill, Frances Ann

    2011-01-01T23:59:59.000Z

    Energy storage in mechanical springs made of carbon nanotubes is a promising new technology. Springs made of dense, ordered arrays of carbon nanotubes have the potential to surpass both the energy density of electrochemical ...

  13. Spring 2014 Composite Data Products: Backup Power

    SciTech Connect (OSTI)

    Kurtz, J.; Sprik, S.; Saur, G.

    2014-06-01T23:59:59.000Z

    This report includes 30 composite data products (CDPs) produced in Spring 2014 for fuel cell backup power systems.

  14. Economic and Conservation Evaluation of Capital Renovation Projects: Maverick County Water Control and Improvement District No. 1 (Eagle Pass) Ė Lining Main Canal Ė Preliminary

    E-Print Network [OSTI]

    Rister, M. Edward; Lacewell, Ronald D.; Sturdivant, Allen W.; Robinson, John R.C.; Popp, Michael C.

    is the only source of water for the City of Eagle Pass and the towns of Quemado and El Indio. Recent agricultural water use during calendar years 1994-1998 for the District has ranged from 42,677 ac-ft to 105,893 ac-ft, with the five-year average at 71,657 ac... savings forthcoming from the total project are estimated, using amortization procedures, to be 8,084 ac-ft of water per year and 2,041,095,338 BTUs (598,211 kwh) of energy per year. The calculated economic and financial cost of water savings is estimated...

  15. Motor gasoline assessment, Spring 1997

    SciTech Connect (OSTI)

    NONE

    1997-07-01T23:59:59.000Z

    The springs of 1996 and 1997 provide an excellent example of contrasting gasoline market dynamics. In spring 1996, tightening crude oil markets pushed up gasoline prices sharply, adding to the normal seasonal gasoline price increases; however, in spring 1997, crude oil markets loosened and crude oil prices fell, bringing gasoline prices down. This pattern was followed throughout the country except in California. As a result of its unique reformulated gasoline, California prices began to vary significantly from the rest of the country in 1996 and continued to exhibit distinct variations in 1997. In addition to the price contrasts between 1996 and 1997, changes occurred in the way in which gasoline markets were supplied. Low stocks, high refinery utilizations, and high imports persisted through 1996 into summer 1997, but these factors seem to have had little impact on gasoline price spreads relative to average spread.

  16. Spring Cleaning | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual Site EnvironmentalEnergySafelyVirtual Toolkit Spring 2015 Virtual Toolkit VirtualSpring

  17. Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair Compared to the Trochlea in a

    E-Print Network [OSTI]

    Buschmann, Michael

    Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair femoral condylar (MFC) versus femoral trochlear (TR) defects 3 months after bone marrow stimulation: cartilage repair; medial femoral condyle; trochlea; bone marrow stimulation; meniscus degeneration Articular

  18. Positive modulator of bone morphogenic protein-2

    DOE Patents [OSTI]

    Zamora, Paul O. (Gaithersburg, MD); Pena, Louis A. (Poquott, NY); Lin, Xinhua (Plainview, NY); Takahashi, Kazuyuki (Germantown, MD)

    2009-01-27T23:59:59.000Z

    Compounds of the present invention of formula I and formula II are disclosed in the specification and wherein the compounds are modulators of Bone Morphogenic Protein activity. Compounds are synthetic peptides having a non-growth factor heparin binding region, a linker, and sequences that bind specifically to a receptor for Bone Morphogenic Protein. Uses of compounds of the present invention in the treatment of bone lesions, degenerative joint disease and to enhance bone formation are disclosed.

  19. BONE CARE FOR THE POSTMENOPAUSAL WOMAN

    E-Print Network [OSTI]

    Shihadeh, Alan

    Osteoporosis is a disease characterized by low bone mass and deterioration in the microarchitecture of bone tissue, leading to an increased risk of fracture. Osteoporosis occurs when the bone mass decreases more fracture). Osteoporosis has no signs or symptoms until a fracture occurs ≠ this is why it is often called

  20. Spring 2014 Organization Development & Training

    E-Print Network [OSTI]

    Wu, Shin-Tson

    Spring 2014 Organization Development & Training Catalog University of Central Florida Office of Organization Development & Training 3280 Progress Drive Orlando, FL 32826-2912 (407) 823-0440 February 7, 2014 Volume 2, Number 3 The current Catalog is published at http://www.hr.ucf.edu/web/training

  1. DEAN'S LIST Spring Semester 2010

    E-Print Network [OSTI]

    Wong, Pak Kin

    . Campbell, Eric B. Cascketta, Eric C. Grantham, Jack D. Gross, Glendon Marston Grusenmeyer, Christopher RDEAN'S LIST Spring Semester 2010 Chai, Jun Christopher, Joseph Thomas Chu, Clayton N. Chu, Wesley D. Bloom, John Tyler Bond-Choquette, Claire Marie Bradford, Jonathan W. Brown, Thomas C. Bruns, Jared M

  2. Spring 2005 by Misti Richardson

    E-Print Network [OSTI]

    Lawrence, Rick L.

    Spring 2005 by Misti Richardson What do Croatia, distance delivery programs, and students in Croatia. He spent six months in Croatia as a 2004-2005 Fulbright Scholar, has made numerous trips in the European coun- try is due to the potential to develop a study-abroad program for MSU students in Croatia

  3. SPRING 2014 wind energy's impact

    E-Print Network [OSTI]

    Tullos, Desiree

    SPRING 2014 wind energy's impact on birds, bats......... 2-3 school news........... 4-5 alumni news measurable benefits reaped by the use of wind energy. But, it is a fact: all energy sources, alternative Interactions with Offshore Wind Energy Facilities," involves the design, deployment and testing

  4. Spring 2014 Heat Transfer -1

    E-Print Network [OSTI]

    Virginia Tech

    Spring 2014 1 Heat Transfer - 1 Consider a cylindrical nuclear fuel rod of length L and diameter df the fuel rod, and the volumetric generation rate is known to vary sinusoidally with distance along the rod to exist between the surface of the rod and the water. Axial conduction can be neglected in rod and fluid

  5. SOUTHWEST CATALYSIS 2013 SPRING SYMPOSIUM

    E-Print Network [OSTI]

    Natelson, Douglas

    -free Substrates" 11:05 AM Southwest Catalysis Society Excellence in Applied Catalysis Award James "Jerry" SpiveySOUTHWEST CATALYSIS SOCIETY 2013 SPRING SYMPOSIUM Friday, April 26, 2013 Grand Hall of the Ley registration fee is $50, which includes North American Catalysis Society and SWCS yearly membership dues, along

  6. SOUTHWEST CATALYSIS 2012 SPRING SYMPOSIUM

    E-Print Network [OSTI]

    ) "Catalysis to Meet the Energy Challenge" 11:00 AM Southwest Catalysis Society Excellence in Applied CatalysisSOUTHWEST CATALYSIS SOCIETY 2012 SPRING SYMPOSIUM April 20, 2012 Duncan Hall - McMurtry Auditorium registration fee is $50, which includes North American Catalysis Society and SWCS yearly membership dues, along

  7. UNIVERSITY LIBRARY Spring Quarter 2013

    E-Print Network [OSTI]

    Ferrara, Katherine W.

    -class virtual library designed for the digital era Subgoal 1: Develop a compelling "virtual library" experienceUC DAVIS UNIVERSITY LIBRARY TOWN HALL Spring Quarter 2013 June 11, 2013 UC Davis University Library, including the Q&A portion June 11, 2013 UC Davis University Library Town Hall 2 #12;Overview Strategic Plan

  8. Highlights of Spring 2011 Environmental

    E-Print Network [OSTI]

    Niebur, Ernst

    Highlights of Spring 2011 Environmental Politics and Policy Political and International Relations Theory Spotlight: The Middle East Beltway Politics and American Ideals Issues in International Our Planet Emma Huvos Political Science Class of 2013 The American Dream: One Size Fits All Maxi

  9. Chemistry Department Colloquium: Spring, 2012

    E-Print Network [OSTI]

    Sheridan, Jennifer

    Chemistry Department Colloquium: Spring, 2012 Friday, March 16; 3:30 Seminar Hall (room 1315 Chemistry) Lost in Translation: How Regulators Use Science and How Scientists Can Help Bridge Gaps Stephanie to combine her Chemistry background with a legal education to improve the use of science in environmental

  10. Mesoscale Dynamics Spring Semester 2012

    E-Print Network [OSTI]

    Birner, Thomas

    ATS 735 Mesoscale Dynamics (3 cr) Spring Semester 2012 Instructor: Richard H. Johnson, Room ATS 305: There are no required texts. The recent book Mesoscale Meteorology in Midlatitudes by Markowski and Richardson covers with mesoscale-related research. A set of notes will be made available for the course, although we will not cover

  11. Mesoscale Modeling Spring Semester 2014

    E-Print Network [OSTI]

    ATS730 Mesoscale Modeling Spring Semester 2014 Meeting Times: T/TH: 9-10:15am Room: ATS 101 is to present the development of the basic equations used in mesoscale models, as well as the various methods than on actual simulations of mesoscale phenomena or the evaluation of specific mesoscale models

  12. Mesoscale Dynamics Spring Semester 2014

    E-Print Network [OSTI]

    ATS 735 Mesoscale Dynamics (3 cr) Spring Semester 2014 Instructor: Richard H. Johnson, Room ATS 305: There are no required texts. The recent book Mesoscale Meteorology in Midlatitudes by Markowski and Richardson covers with mesoscale-related research. A set of notes will be made available for the course, although we will not cover

  13. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    x ORIGINAL ARTICLE Bone mineral density and fractures inwas associated with lower bone mineral density (BMD) at theKeywords Bone loss . Bone mineral density . Elderly .

  14. Geological Hazards Labs Spring 2010

    E-Print Network [OSTI]

    Chen, Po

    Geological Hazards Labs Spring 2010 TA: En-Jui Lee (http://www.gg.uwyo.edu/ggstudent/elee8/site - An Indispensible Tool in Hazard Planning 3 26/1; 27/1 Lab 2: Geologic Maps - Mapping the Hazards 4 2/2; 3/2 Lab 3: Population - People at Risk 5 9/2; 10/2 Lab 4: Plate Tectonics - Locating Geologic Hazards 6 16/2; 17/2 Lab 5

  15. Spring 2014 Heat Transfer -2

    E-Print Network [OSTI]

    Virginia Tech

    Spring 2014 Heat Transfer - 2 A thin electronic chip is in the shape of a square wafer, b = 1 cm surface of the chip with a heat transfer coefficient of h = 100 W/m2 -K. Assume the chip has a uniform per side with a mass of m = 0.3 grams and specific heat of C = 103 J/kg-K. The chip is mounted

  16. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-01-01T23:59:59.000Z

    The present invention relates to the electrical treatment of biological tissue. In particular, the present invention discloses a device that produces discrete electrical pulse trains for treating osteoporosis and accelerating bone growth. According to its major aspects and broadly stated, the present invention consists of an electrical circuit configuration capable of generating Bassett-type waveforms shown with alternative signals provide for the treatment of either fractured bones or osteoporosis. The signal generator comprises a quartz clock, an oscillator circuit, a binary divider chain, and a plurality of simple, digital logic gates. Signals are delivered efficiently, with little or no distortion, and uniformly distributed throughout the area of injury. Perferably, power is furnished by widely available and inexpensive radio batteries, needing replacement only once in several days. The present invention can be affixed to a medical cast without a great increase in either weight or bulk. Also, the disclosed stimulator can be used to treat osteoporosis or to strengthen a healing bone after the cast has been removed by attaching the device to the patient`s skin or clothing.

  17. Spring Term 2010 Assessment Report Page 1 Spring Term 2010: Assessment of the Learning Outcomes

    E-Print Network [OSTI]

    Marsh, David

    focused on the student learning experience, particularly the teaching methods employed in #12;Spring Term carries many aspects with it, but our main focus has always been on our central learning objectiveSpring Term 2010 Assessment Report Page 1 Spring Term 2010: Assessment of the Learning Outcomes

  18. Spring Fever Alfalfa The Pitfalls of Spring Seeding Alfalfa in West Texas

    E-Print Network [OSTI]

    Mukhtar, Saqib

    Spring Fever Alfalfa≠ The Pitfalls of Spring Seeding Alfalfa in West Texas Calvin Trostle producers are thinking about planting in the spring which is not recommended in West Texas for several, Extension Agronomy, Texas A&M≠Lubbock, (806) 746-6101, c-trostle@tamu.edu Updated February 2003 I have

  19. Athletic Training Coordinator Hometown: Colorado Springs, CO

    E-Print Network [OSTI]

    Van Stryland, Eric

    WHO WE ARE Gaby Bell Athletic Training Coordinator Hometown: Colorado Springs, CO Certifications Athletic Training Graduate Assistant Jonathan Hodapp Student Athletic Trainer Mike Carlson Student Athletic

  20. Detachment Faulting & Geothermal Resources - Pearl Hot Spring...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Faulting & Geothermal Resources - Pearl Hot Spring, NV Conducting a 3D Converted Shear Wave Project to Reduce Exploration Risk at Wister, CA Crump Geyser: High Precision...

  1. Go Global Newsletter, Winter/Spring 2006

    E-Print Network [OSTI]

    Global & International Studies

    2006-01-01T23:59:59.000Z

    HARRIS was named last Spring as an Aspen Institute Scholarby the prestigious Aspen Institute. Thisin connection with the Aspen Institute Executive Seminar,

  2. Brushless Motor Controller Report Spring 2010

    E-Print Network [OSTI]

    Ruina, Andy L.

    Brushless Motor Controller Report Spring 2010 May 15, 2010 Brian Clementi MAE of 2010 322 Bogert ...................................................................................................... 5 A. Motor Description...................................................................................................... 5 B. The Motor Controller Board

  3. Colorado Springs Utilities- Energy Efficient Builder Program

    Broader source: Energy.gov [DOE]

    The Colorado Springs Utilities (CSU) Energy Efficient Builder Program offers an incentive to builders who construct ENERGY STARģ qualified homes within the CSU service area. The incentive range...

  4. Chena Hot Springs Resort - Electric Power Generation Using Geothermal...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Hot Springs Resort - Electric Power Generation Using Geothermal Fluid Coproduced from Oil andor Gas Wells Chena Hot Springs Resort - Electric Power Generation Using Geothermal...

  5. Isotopic Analysis- Fluid At Indian Valley Hot Springs Geothermal...

    Open Energy Info (EERE)

    Activity: Isotopic Analysis- Fluid At Indian Valley Hot Springs Geothermal Area (1990) Exploration Activity Details Location Indian Valley Hot Springs Geothermal Area...

  6. Steamboat Villa Hot Springs Spa Space Heating Low Temperature...

    Open Energy Info (EERE)

    Villa Hot Springs Spa Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Steamboat Villa Hot Springs Spa Space Heating Low Temperature Geothermal...

  7. Broadwater Athletic Club & Hot Springs Space Heating Low Temperature...

    Open Energy Info (EERE)

    Athletic Club & Hot Springs Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Broadwater Athletic Club & Hot Springs Space Heating Low Temperature...

  8. Roosevelt Warm Springs Institute for Rehab. Space Heating Low...

    Open Energy Info (EERE)

    Jump to: navigation, search Name Roosevelt Warm Springs Institute for Rehab. Space Heating Low Temperature Geothermal Facility Facility Roosevelt Warm Springs Institute for...

  9. Jackson Hot Springs Lodge Space Heating Low Temperature Geothermal...

    Open Energy Info (EERE)

    Hot Springs Lodge Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Jackson Hot Springs Lodge Space Heating Low Temperature Geothermal Facility...

  10. Waunita Hot Springs Ranch Space Heating Low Temperature Geothermal...

    Open Energy Info (EERE)

    Springs Ranch Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Waunita Hot Springs Ranch Space Heating Low Temperature Geothermal Facility...

  11. Pagosa Springs District Heating District Heating Low Temperature...

    Open Energy Info (EERE)

    Pagosa Springs District Heating District Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Pagosa Springs District Heating District Heating Low...

  12. Water Sampling At Valles Caldera - Sulphur Springs Geothermal...

    Open Energy Info (EERE)

    Water Sampling At Valles Caldera - Sulphur Springs Geothermal Area (Goff, Et Al., 1982) Exploration Activity Details Location Valles Caldera - Sulphur Springs Geothermal Area...

  13. Teleseismic-Seismic Monitoring At Valles Caldera - Sulphur Springs...

    Open Energy Info (EERE)

    Teleseismic-Seismic Monitoring At Valles Caldera - Sulphur Springs Geothermal Area (Roberts, Et Al., 1991) Exploration Activity Details Location Valles Caldera - Sulphur Springs...

  14. WRITTEN IN BONE: Bone Biographer's Casebook Douglas Owsley and Karin Bruwelheide

    E-Print Network [OSTI]

    Mathis, Wayne N.

    afflictions that would have made daily life miserable. In addition to dental disease and gout, his bones were

  15. A study of spring rates of dynamically loaded helical springs

    E-Print Network [OSTI]

    Whitwell, Franklin Carroll

    1965-01-01T23:59:59.000Z

    95. 0 95. 0 95. 0 41 Table 9. Dimensionless Values Run Numbers Inclusive F2/F. l Y2/YI Key for Figure 14 1 ? 12 13 -24 25 ? 36 3. 48 2. 63 3. 39 3. 72 2. 74 3. 39 37 - 48 49 ? 60 61- 72 12. 00 8. 98 5. 81 12. 00 8. 72 5. 58... Y2 Yl FIGURE 14. GRAPH Of VALUES FROM TABLE 9 FOR ALL SPRINGS EXCEPT NO. 6 44 55 54 / / / t 52 51 50 49 48 F2 Ibf 47 45 44 43 / / I / / / / / / / / / / / / / / / / / / / / / q/ G / Q&l qP/ / / / / i...

  16. J Bone Miner Metab . Author manuscript Mineral maturity and crystallinity index are distinct characteristics of bone

    E-Print Network [OSTI]

    Paris-Sud XI, Universitť de

    J Bone Miner Metab . Author manuscript Page /1 13 Mineral maturity and crystallinity index are distinct characteristics of bone mineral Delphine Farlay 1 * , G rard Panczerť 2 , Christian Rey 3 , Pierre the hypothesis that mineral maturity and crystallinity index are two different characteristics of bone mineral

  17. PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism

    E-Print Network [OSTI]

    Toledo, University of

    PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism Beata regulating systemic energy homeostasis. In this article, we review current knowledge on the role of PPARs of bone marrow microenvironment and its possible contribution to the systemic regulation of energy

  18. Dr. Campbell's Bio111 Exam #3 Spring 2008 Spring 2008 Biology 111 In-Class Exam #3 BioEnergetics

    E-Print Network [OSTI]

    Campbell, A. Malcolm

    Dr. Campbell's Bio111 Exam #3 ≠ Spring 2008 1 Spring 2008 Biology 111 In-Class Exam #3 ≠ BioEnergetics

  19. Dr. Campbell's Bio111 Exam #3 Spring 2007 Spring 2007 Biology 111 In-Class Exam #3 BioEnergetics

    E-Print Network [OSTI]

    Campbell, A. Malcolm

    Dr. Campbell's Bio111 Exam #3 ≠ Spring 2007 1 Spring 2007 Biology 111 In-Class Exam #3 ≠ BioEnergetics

  20. A quantification strategy for missing bone mass in case of osteolytic bone lesions

    SciTech Connect (OSTI)

    Fršnzle, Andrea, E-mail: a.fraenzle@dkfz.de; Giske, Kristina [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Bretschi, Maren; Bšuerle, Tobias [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Hillengass, Jens [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany)] [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany); Bendl, Rolf [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)

    2013-12-15T23:59:59.000Z

    Purpose: Most of the patients who died of breast cancer have developed bone metastases. To understand the pathogenesis of bone metastases and to analyze treatment response of different bone remodeling therapies, preclinical animal models are examined. In breast cancer, bone metastases are often bone destructive. To assess treatment response of bone remodeling therapies, the volumes of these lesions have to be determined during the therapy process. The manual delineation of missing structures, especially if large parts are missing, is very time-consuming and not reproducible. Reproducibility is highly important to have comparable results during the therapy process. Therefore, a computerized approach is needed. Also for the preclinical research, a reproducible measurement of the lesions is essential. Here, the authors present an automated segmentation method for the measurement of missing bone mass in a preclinical rat model with bone metastases in the hind leg bones based on 3D CT scans. Methods: The affected bone structure is compared to a healthy model. Since in this preclinical rat trial the metastasis only occurs on the right hind legs, which is assured by using vessel clips, the authors use the left body side as a healthy model. The left femur is segmented with a statistical shape model which is initialised using the automatically segmented medullary cavity. The left tibia and fibula are segmented using volume growing starting at the tibia medullary cavity and stopping at the femur boundary. Masked images of both segmentations are mirrored along the median plane and transferred manually to the position of the affected bone by rigid registration. Affected bone and healthy model are compared based on their gray values. If the gray value of a voxel indicates bone mass in the healthy model and no bone in the affected bone, this voxel is considered to be osteolytic. Results: The lesion segmentations complete the missing bone structures in a reasonable way. The mean ratiov{sub r}/v{sub m} of the reconstructed bone volume v{sub r} and the healthy model bone volume v{sub m} is 1.07, which indicates a good reconstruction of the modified bone. Conclusions: The qualitative and quantitative comparison of manual and semi-automated segmentation results have shown that comparing a modified bone structure with a healthy model can be used to identify and measure missing bone mass in a reproducible way.

  1. Spring 2006 CS 649 1 Sensor Networks

    E-Print Network [OSTI]

    Amir, Yair

    Energy efficiency Scalability & Self- configuration Fairness not important Message-level Latency Trade for energy Adaptivity Adaptivity #12;MAC and Its Classification Spring 2006 CS 649 4 · Medium Access Control Attributes Spring 2006 CS 649 5 · Collision avoidance · Basic task of a MAC protocol · Energy efficiency

  2. RMI 357e spring 2013 Risk Management

    E-Print Network [OSTI]

    Ghosh, Joydeep

    RMI 357e ≠ spring 2013 1 Risk Management R M 357e Professor: Christopher McClellan Office: CBA 3 thomaspjacob@utexas.edu Syllabus ≠ spring 2013 Textbook Risk Management for Enterprises and Individuals, v.1://students.flatworldknowledge.com/course/1112649 Risk Management: 357E. Risk Management - Upper-Division Course Principles of risk management

  3. PAID INTERNSHIP OPPORTUNITIES SPRING AND SUMMER 2014

    E-Print Network [OSTI]

    Buehrer, R. Michael

    PAID INTERNSHIP OPPORTUNITIES SPRING AND SUMMER 2014 ABOUT THE PROGRAM: The Virginia Space Grant colleges are offering the Commonwealth STEM Industry Internship Program (CSIIP). CSIIP is a free resource for finding paid spring, summer, and fall internships. CSIIP provides an online system where undergraduate

  4. Spanish & Portuguese -Teaching Assistants Spring 2014

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    Spanish & Portuguese - Teaching Assistants Spring 2014 Abreu-GonzŠlez, Kallie ........................................................................................ 2-3128 Spanish 102 Head TA pananth@wisc.edu 770 Van Hise Hall Office Hours: 9:55 ≠ 10:55 MR Teach 383 VH #12;Spanish & Portuguese - Teaching Assistants Spring 2014 BeltrŠn, Edith

  5. Geothermal Energy in Iceland Spring 2009

    E-Print Network [OSTI]

    Prevedouros, Panos D.

    Geothermal Energy in Iceland Kaeo Ahu CEE 491 Spring 2009 Final Presentation #12;HISTORY Creating the availability of geothermal resources #12;HISTORY & BACKGROUND Iceland's first settlers used geothermal springs for bathing, cooking & laundering Iceland's capital named Reykjavik or "Smokey Bay" after

  6. Diabetes Experience Spring 2014 Interprofessional Diabetes Experience

    E-Print Network [OSTI]

    Thomas, David D.

    Diabetes Experience Spring 2014 Interprofessional Diabetes Experience Phar 6226/Nurs 5011 Spring the opportunity to learn in-depth knowledge of diabetes mellitus through active, hands-on learning experience of living with diabetes, in which they will give "insulin" injections and check blood glucoses

  7. Spring Already? | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual Site EnvironmentalEnergySafelyVirtual Toolkit Spring 2015 Virtual Toolkit Virtual

  8. Spring Valley | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-f < RAPID‚ÄéSolarCity Corp JumpsourceSouthlake,AeHJump to:SpringValley

  9. Idaho_LavaHotSprings

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh School footballHydrogenIT |Hot Springs Site #0104 Latitude: N. Lava

  10. Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor is enhanced by compressive

    E-Print Network [OSTI]

    Paris-Sud XI, Universitť de

    Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor la Santť et de la Recherche Mťdicale Running title Cancellous bone culture in a dynamic 3D bioreactor

  11. Curr Pharm Des . Author manuscript Bisphosphonates and bone diseases: past, present and future

    E-Print Network [OSTI]

    Paris-Sud XI, Universitť de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget s disease of bone

  12. Shell Formation and Bone Strength Laying Hens

    E-Print Network [OSTI]

    Shell Formation and Bone Strength in Laying Hens Effects of Age, Daidzein and Exogenous Estrogen Cover aquarelle: E. Spörndly-Nees #12;Shell Formation and Bone Strength in Laying Hens Effects of Age eggshells as shell quality declines with age during the laying period. This is a concern for food safety

  13. Mechanical bone strength in the proximal tibia

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    . These findings were a pilot study of the technique, which will subsequently be used for human tibial bone. Such data is relevant in the human with respect to the ability of the bone at various distances from the condyle to support the "flat-plate" loading...

  14. Ibuprofen Administered Pre- or Post- Simulated Resistance Exercise Training Does Not Diminsh Gains in Bone Formation or Bone Mass

    E-Print Network [OSTI]

    Cunningham, David

    2012-02-14T23:59:59.000Z

    IBUPROFEN ADMINSTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINISH GAINS IN BONE FORMATION OR BONE MASS A Thesis by DAVID ARTHUR CUNNINGHAM Submitted to the Office of Graduate Studies of Texas A... Training Does Not Diminish Gains in Bone Formation or Bone Mass Copyright 2011 David Arthur Cunningham IBUPROFEN ADMINISTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINSH GAINS IN BONE FORMATION OR BONE MASS A Thesis...

  15. A study of spring rates of dynamically loaded helical springs

    E-Print Network [OSTI]

    Whitwell, Franklin Carroll

    1965-01-01T23:59:59.000Z

    in 'Table 7, the curves in Figure 15 are of doubtful accuracy Table 2. Test Results for Spring No. Run No. lbf 5. 8 5. 8 5. 8 5. 8 5. 8 1d lbf lbf 5. 8 5. 8 5. 8 5. 8 5. 8 F2' lbf 36. 4 36. 4 36. 4 36. 4 36. 4 '2d lbf F2 lbf 36. 4... 33. 2 23. 5 0. 184 0. 184 0. 184 0. 184 0. 172 0. 684 0. 684 0. 684 0. 684 0. 472 25. 0 28. 6 33. 0 39. 9 0 47. 3 47. 3 47. 3 47. 3 48. 5 Table 2 (Cont. ) Run No. 1 1d 1 2 2ti 2 1 Y2 f k lbf lbf lbf lbf lbf lbf in . in. cps 1...

  16. Spring/dimple instrument tube restraint

    DOE Patents [OSTI]

    DeMario, E.E.; Lawson, C.N.

    1993-11-23T23:59:59.000Z

    A nuclear fuel assembly for a pressurized water nuclear reactor has a spring and dimple structure formed in a non-radioactive insert tube placed in the top of a sensor receiving instrumentation tube thimble disposed in the fuel assembly and attached at a top nozzle, a bottom nozzle, and intermediate grids. The instrumentation tube thimble is open at the top, where the sensor or its connection extends through the cooling water for coupling to a sensor signal processor. The spring and dimple insert tube is mounted within the instrumentation tube thimble and extends downwardly adjacent the top. The springs and dimples restrain the sensor and its connections against lateral displacement causing impact with the instrumentation tube thimble due to the strong axial flow of cooling water. The instrumentation tube has a stainless steel outer sleeve and a zirconium alloy inner sleeve below the insert tube adjacent the top. The insert tube is relatively non-radioactivated inconel alloy. The opposed springs and dimples are formed on diametrically opposite inner walls of the insert tube, the springs being formed as spaced axial cuts in the insert tube, with a web of the insert tube between the cuts bowed radially inwardly for forming the spring, and the dimples being formed as radially inward protrusions opposed to the springs. 7 figures.

  17. Executive summary: Weldon Spring Site Environmental Report for calendar year 1992. Weldon Spring Site Remedial Action Project, Weldon Spring, Missouri

    SciTech Connect (OSTI)

    Not Available

    1993-06-01T23:59:59.000Z

    This report has been prepared to provide information about the public safety and environmental protection programs conducted by the Weldon Spring Site Remedial Action Project. The Weldon Spring site is located in southern St. Charles County, Missouri, approximately 48 km (30 mi) west of St. Louis. The site consists of two main areas, the Weldon Spring Chemical Plant and raffinate pits and the Weldon Spring Quarry. The objectives of the Site Environmental Report are to present a summary of data from the environmental monitoring program, to characterize trends and environmental conditions at the site, and to confirm compliance with environmental and health protection standards and requirements. The report also presents the status of remedial activities and the results of monitoring these activities to assess their impacts on the public and environment. The scope of the environmental monitoring program at the Weldon Spring site has changed since it was initiated. Previously, the program focused on investigations of the extent and level of contaminants in the groundwater, surface waters, buildings, and air at the site. In 1992, the level of remedial activities required monitoring for potential impacts of those activities, particularly on surface water runoff and airborne effluents. This report includes monitoring data from routine radiological and nonradiological sampling activities. These data include estimates of dose to the public from the Weldon Spring site; estimates of effluent releases; and trends in groundwater contaminant levels. Also, applicable compliance requirements, quality assurance programs, and special studies conducted in 1992 to support environmental protection programs are reviewed.

  18. Think of your bones as a "bank" where

    E-Print Network [OSTI]

    Baker, Chris I.

    can get osteoporosis (ah-stee-oh-puh- ROH-sis) when you get older. Osteoporosis is a disease in which the bones become weak and more likely to break (fracture). People with osteoporosis most often break bones in the hip, spine, and wrist. 1 #12;Normal bone Bone with osteoporosis Reprinted from The Surgeon General

  19. Term: Spring 2013 University of Pittsburgh

    E-Print Network [OSTI]

    Sibille, Etienne

    Term: Spring 2013 1 University of Pittsburgh HOUSING/DINING SERVICES CONTRACT This Housing/Dining Services Contract (this "Contract") is made by and between the University of Pittsburgh

  20. Term: Spring 2012 University of Pittsburgh

    E-Print Network [OSTI]

    Sibille, Etienne

    Term: Spring 2012 1 University of Pittsburgh HOUSING/DINING SERVICES CONTRACT This Housing/Dining Services Contract (this "Contract") is made by and between the University of Pittsburgh

  1. Spring 2013 Composite Data Products - Backup Power

    SciTech Connect (OSTI)

    Kurtz, J.; Wipke, K.; Sprik, S.; Ramsden, T.; Ainscough, C.; Saur, G.; Post, M.; Peters, M.

    2013-05-01T23:59:59.000Z

    This presentation from the U.S. Department of Energy's National Renewable Energy Laboratory includes 21 composite data products (CDPs) produced in Spring 2013 for fuel cell backup power systems.

  2. CNR GRADUATION SURVEY RESULTS Spring, 2005

    E-Print Network [OSTI]

    Hughes o Local 229 o New Belgium Brewing Company o Newmont Mining Company o Pason Systems 86 Productions 72% are employed or attending grad school vs. 76% Spring, 2004 #12;Range Ecology: No range

  3. SP.778 Toy Product Design, Spring 2007

    E-Print Network [OSTI]

    Kudrowitz, Barry M. (Barry Matthew)

    Toy Product Design is a MIT Public Service Center learning design course offered in the Spring semester. This course is an introduction to the product design process with a focus on designing for play and entertainment. ...

  4. amagazineforalumniandfriendsoftheinstituteoftechnology|spring/summer2008 ENVIRONMENTAL

    E-Print Network [OSTI]

    Minnesota, University of

    amagazineforalumniandfriendsoftheinstituteoftechnology|spring/summer2008 ENVIRONMENTAL IMPACT making their mark in the workforce >> Student solar competitions begin to heat up >> #12;InventErmit PAttison Environmental Impact ∑ 16 Institute of Technology faculty are working to solve today

  5. 2012 Spring Issue Page The Critical Path

    E-Print Network [OSTI]

    Christian, Eric

    and spring have continued our string of extremely busy seasons. The Tracking and Data Relay Satellite ≠ K integration and is proceeding through environmental test. It has had some late bumps in the road but the team

  6. BE 780: Brain Machine Interfaces Spring 2013

    E-Print Network [OSTI]

    Vajda, Sandor

    BE 780: Brain Machine Interfaces Spring 2013 Instructor: Jason Ritt the readings for an assigned class. Homework 30% Mid-semester Report 30, code, or files of any kind. Reports and final projects must

  7. Insights into Spring 2008 Gasoline Prices

    Reports and Publications (EIA)

    2008-01-01T23:59:59.000Z

    Gasoline prices rose rapidly in spring 2007 due a variety of factors, including refinery outages and lower than expected imports. This report explores those factors and looks at the implications for 2008.

  8. The Cultivar, Spring/Summer 2008

    E-Print Network [OSTI]

    Brown, Martha

    2008-01-01T23:59:59.000Z

    awareness of foodís ďcarbon footprint,Ē or a desire to knowabout, such as their carbon footprint and global warm-part of a campusís ďcarbon footprint. Ē With the Spring 2008

  9. ME 872 -Finite Element Methods Spring 2014

    E-Print Network [OSTI]

    Diaz, Alejandro

    Element Method: Linear Static and Dynamic Finite Element Analysis (Dover Civil and Mechanical Engineering problems Special topics: Lagrange multipliers, adaptive finite elements, sensitivity analysis, nonlinearME 872 - Finite Element Methods Spring 2014 Catalog Description: Theory and application

  10. Mechanical and Industrial Engineering 230 Spring 2012

    E-Print Network [OSTI]

    Rothstein, Jonathan

    cycles Refrigeration and heat pump systems Final Exam (Date and time TBA) Suggested Reading Chapter 1Mechanical and Industrial Engineering 230 Spring 2012 Thermodynamics Course Syllabus Date Week 1 (1

  11. Fiscal Year 1997 (Summer 1996-Spring 1997)

    E-Print Network [OSTI]

    Willson, Stephen J.

    Fiscal Year 1997 (Summer 1996-Spring 1997) A total of 517 students studied abroad; an additional 62) N Am: 36 (10) #12;Oceania: 39 (1) S Am: 100 (2) July, 1997 #12;

  12. Optical spring effect in nanoelectromechanical systems

    SciTech Connect (OSTI)

    Tian, Feng; Zhou, Guangya, E-mail: mpezgy@nus.edu.sg; Du, Yu; Chau, Fook Siong [Department of Mechanical Engineering, National University of Singapore, 9 Engineering Drive 1, Singapore 117576 (Singapore); Deng, Jie [Institute of Materials Research and Engineering, A*STAR (Agency for Science, Technology, and Research), 3 Research Link, Singapore 117602 (Singapore)

    2014-08-11T23:59:59.000Z

    In this Letter, we report a hybrid system consisting of nano-optical and nano-mechanical springs, in which the optical spring effect works to adjust the mechanical frequency of a nanoelectromechanical systems resonator. Nano-scale folded beams are fabricated as the mechanical springs and double-coupled one-dimensional photonic crystal cavities are used to pump the ďoptical spring.Ē The dynamic characteristics of this hybrid system are measured and analyzed at both low and high input optical powers. This study leads the physical phenomenon of optomechanics in complex nano-opto-electro-mechanical systems (NOEMS) and could benefit the future applications of NOEMS in chip-level communication and sensing.

  13. Colorado Springs Utilities- Renewable Energy Rebate Program

    Broader source: Energy.gov [DOE]

    Through its Renewable Energy Rebate Program, Colorado Springs Utilities (CSU) offers a rebate to customers who install grid-connected solar-electric (PV) systems, wind systems, and solar water...

  14. MATH 373 Spring 2014 Test 1

    E-Print Network [OSTI]

    jeffb_000

    2014-08-16T23:59:59.000Z

    MATH 373. Spring 2014. Test 1. February 18, 2013. 1. Amar wants to accumulate 1 million (1,000,000) by the time that he is 50 years old. Amar is currently 20†...

  15. Application of synchrotron radiation computed microtomography for quantification of bone microstructure in human and rat bones

    SciTech Connect (OSTI)

    Parreiras Nogueira, Liebert; Barroso, Regina Cely; Pereira de Almeida, Andre; Braz, Delson; Almeida, Carlos Eduardo de; Borba de Andrade, Cherley; Tromba, Giuliana [Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Physics Institute / State University of Rio de Janeiro, 20550-900, Rio de Janeiro (Brazil); Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Laboratory of Radiological Sciences / State University of Rio de Janeiro, Rio de Janeiro (Brazil); Sincrotrone Trieste SCpA, Strada Statale S.S. 14 km 163.5, 34012 Basovizza, Trieste (Italy)

    2012-05-17T23:59:59.000Z

    This work aims to evaluate histomorphometric quantification by synchrotron radiation computed microto-mography in bones of human and rat specimens. Bones specimens are classified as normal and pathological (for human samples) and irradiated and non-irradiated samples (for rat ones). Human bones are specimens which were affected by some injury, or not. Rat bones are specimens which were irradiated, simulating radiotherapy procedures, or not. Images were obtained on SYRMEP beamline at the Elettra Synchrotron Laboratory in Trieste, Italy. The system generated 14 {mu}m tomographic images. The quantification of bone structures were performed directly by the 3D rendered images using a home-made software. Resolution yielded was excellent what facilitate quantification of bone microstructures.

  16. Microdamage accumulation in bovine trabecular bone

    E-Print Network [OSTI]

    Moore, Tara L. Arthur (Tara Lee Arthur), 1972-

    2001-01-01T23:59:59.000Z

    When bone is loaded beyond its failure point, it develops damage in the form of microcracks. Normally, microcracks are repaired by the remodeling process, limiting the number of in vivo microcracks. However, if the rate ...

  17. CORTICAL BONE FRACTURE R. O. RITCHIE

    E-Print Network [OSTI]

    Ritchie, Robert

    with menopause in aging women, can lead to osteoporosis, a condition of low bone mass associated the therapeutic benefits of antiresorptive agents in treating osteoporosis (6,7) has re-emphasized the ne- cessity

  18. Composite gelatin delivery system for bone regeneration

    E-Print Network [OSTI]

    Hager, Elizabeth A. (Elizabeth Ann)

    2005-01-01T23:59:59.000Z

    In this thesis, the chemical/mechanical properties and biocompatibility of gelatin were investigated to produce a gelatin scaffold for the release of bone morphogenetic proteins (BMPs) from composite particles. This delivery ...

  19. User`s guide to EAGLES Version 1.1: An electric- and gasoline-vehicle fuel-efficiency software package

    SciTech Connect (OSTI)

    Marr, W.W.

    1995-01-01T23:59:59.000Z

    EAGLES is an interactive microcomputer software package for the analysis of fuel efficiency in electric-vehicle (EV) applications or the estimation of fuel economy for a gasoline vehicle. The principal objective of the EV analysis is to enable the prediction of EV performance on the basis of laboratory test data for batteries. The EV model included in the software package provides a second-by-second simulation of battery voltage and current for any specified vehicle velocity/time or power/time profile. The capability of the battery is modeled by an algorithm that relates the battery voltage to the withdrawn (or charged) current, taking into account the effect of battery depth-of-discharge. Alternatively, the software package can be used to determine the size of the battery needed to satisfy given vehicle mission requirements. For gasoline vehicles, a generic fuel-economy model based on data from EPA Test Car List 1991 is included in the software package. For both types of vehicles, effects of heating/cooling loads on vehicle performance, including range penalty for EVs, can be studied. Also available is an option to estimate the time needed by a specified vehicle to reach a certain speed with the application of a constant power and an option to compute the fraction of time and/or distance in a driving cycle at speeds exceeding a specified value. Certain parameters can be changed interactively prior to a run.

  20. Cross-shaped torsional spring

    DOE Patents [OSTI]

    Williamson, Matthew M. (Boston, MA); Pratt, Gill A. (Lexington, MA)

    1999-06-08T23:59:59.000Z

    The invention provides an elastic actuator consisting of a motor and a motor drive transmission connected at an output of the motor. An elastic element is connected in series with the motor drive transmission, and this elastic element is positioned to alone support the full weight of any load connected at an output of the actuator. A single force transducer is positioned at a point between a mount for the motor and an output of the actuator. This force transducer generates a force signal, based on deflection of the elastic element, that indicates force applied by the elastic element to an output of the actuator. An active feedback force control loop is connected between the force transducer and the motor for controlling the motor. This motor control is based on the force signal to deflect the elastic element an amount that produces a desired actuator output force. The produced output force is substantially independent of load motion. The invention also provides a torsional spring consisting of a flexible structure having at least three flat sections each connected integrally with and extending radially from a central section. Each flat section extends axially along the central section from a distal end of the central section to a proximal end of the central section.

  1. Cross-shaped torsional spring

    DOE Patents [OSTI]

    Williamson, M.M.; Pratt, G.A.

    1999-06-08T23:59:59.000Z

    The invention provides an elastic actuator consisting of a motor and a motor drive transmission connected at an output of the motor. An elastic element is connected in series with the motor drive transmission, and this elastic element is positioned to alone support the full weight of any load connected at an output of the actuator. A single force transducer is positioned at a point between a mount for the motor and an output of the actuator. This force transducer generates a force signal, based on deflection of the elastic element, that indicates force applied by the elastic element to an output of the actuator. An active feedback force control loop is connected between the force transducer and the motor for controlling the motor. This motor control is based on the force signal to deflect the elastic element an amount that produces a desired actuator output force. The produced output force is substantially independent of load motion. The invention also provides a torsional spring consisting of a flexible structure having at least three flat sections each connected integrally with and extending radially from a central section. Each flat section extends axially along the central section from a distal end of the central section to a proximal end of the central section. 30 figs.

  2. Weldon Spring historical dose estimate

    SciTech Connect (OSTI)

    Meshkov, N.; Benioff, P.; Wang, J.; Yuan, Y.

    1986-07-01T23:59:59.000Z

    This study was conducted to determine the estimated radiation doses that individuals in five nearby population groups and the general population in the surrounding area may have received as a consequence of activities at a uranium processing plant in Weldon Spring, Missouri. The study is retrospective and encompasses plant operations (1957-1966), cleanup (1967-1969), and maintenance (1969-1982). The dose estimates for members of the nearby population groups are as follows. Of the three periods considered, the largest doses to the general population in the surrounding area would have occurred during the plant operations period (1957-1966). Dose estimates for the cleanup (1967-1969) and maintenance (1969-1982) periods are negligible in comparison. Based on the monitoring data, if there was a person residing continually in a dwelling 1.2 km (0.75 mi) north of the plant, this person is estimated to have received an average of about 96 mrem/yr (ranging from 50 to 160 mrem/yr) above background during plant operations, whereas the dose to a nearby resident during later years is estimated to have been about 0.4 mrem/yr during cleanup and about 0.2 mrem/yr during the maintenance period. These values may be compared with the background dose in Missouri of 120 mrem/yr.

  3. Bone Growth, Maintenance and Loss in the Neolithic Community of «atalhŲyŁk, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Bone Growth, Maintenance and Loss in the Neolithic CommunityThe examination of bone maintenance and loss is another wellchanging patterns of bone maintenance typically observed in

  4. Armored spring-core superconducting cable and method of construction

    DOE Patents [OSTI]

    McIntyre, Peter M. (611 Montclair, College Station, TX 77840); Soika, Rainer H. (1 Hensel, #X4C, College Station, TX 77840)

    2002-01-01T23:59:59.000Z

    An armored spring-core superconducting cable (12) is provided. The armored spring-core superconducting cable (12) may include a spring-core (20), at least one superconducting strand (24) wound onto the spring-core (20), and an armored shell (22) that encases the superconducting strands (24). The spring-core (20) is generally a perforated tube that allows purge gases and cryogenic liquids to be circulated through the armored superconducting cable (12), as well as managing the internal stresses within the armored spring-core superconducting cable (12). The armored shell (22) manages the external stresses of the armored spring-core superconducting cable (12) to protect the fragile superconducting strands (24). The armored spring-core superconducting cable (12) may also include a conductive jacket (34) formed outwardly of the armored shell (22).

  5. 2009 Spring Tuesday Seminar Series Sponsored by UPGG and IGSP

    E-Print Network [OSTI]

    Richardson, David

    2009 Spring Tuesday Seminar Series Sponsored by UPGG and IGSP 12:30pm ≠ Room 147 Nanaline Duke 01: Ashley Chi) #12;2009 Spring Tuesday Seminar Series (cont.) Sponsored by UPGG and IGSP 12:30pm ≠ Room 147

  6. adult spring chinook: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    is replaced by a quantum source. Rai, Amit 2008-01-01 171 Learning From Real Springs Texas A&M University - TxSpace Summary: Many springs do not obey Hooke's Law because they...

  7. CMPE 185 Spring 1998 Syllabus 1 1 Administrative details

    E-Print Network [OSTI]

    Karplus, Kevin

    CMPE 185 Spring 1998 Syllabus 1 Syllabus 1 Administrative details Location and time Kresge 327, MWF of the quarter, and 10% on in­class work, Karplus & Larrabee Info 1 #12; 2 Syllabus CMPE 185 Spring 1998

  8. Nonlinear springs with applications to flow regulation valves and mechanisms

    E-Print Network [OSTI]

    Freeman, David Calvin

    2008-01-01T23:59:59.000Z

    This thesis focuses on the application of nonlinear springs for fluid flow control valves where geometric constraints, or fabrication technologies, limit the use of available solutions. Types of existing nonlinear springs ...

  9. Isotopic Analysis- Rock At Valles Caldera - Sulphur Springs Geothermal...

    Open Energy Info (EERE)

    navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Isotopic Analysis- Rock At Valles Caldera - Sulphur Springs Geothermal Area (Phillips, 2004)...

  10. Cuttings Analysis At Roosevelt Hot Springs Area (Christensen...

    Open Energy Info (EERE)

    navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Cuttings Analysis At Roosevelt Hot Springs Area (Christensen, Et Al., 1983) Exploration Activity...

  11. Isotopic Analysis- Rock At Valles Caldera - Sulphur Springs Geothermal...

    Open Energy Info (EERE)

    navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Isotopic Analysis- Rock At Valles Caldera - Sulphur Springs Geothermal Area (Ito & Tanaka, 1995)...

  12. Isotopic Analysis- Rock At Valles Caldera - Sulphur Springs Area...

    Open Energy Info (EERE)

    navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Isotopic Analysis- Rock At Valles Caldera - Sulphur Springs Area (Ito & Tanaka, 1995) Exploration...

  13. Detachment Faulting & Geothermal Resources- Pearl Hot Spring, NV

    Broader source: Energy.gov [DOE]

    Detachment Faulting & Geothermal Resources - Pearl Hot Spring, NV presentation at the April 2013 peer review meeting held in Denver, Colorado.

  14. Pressure Temperature Log At Roosevelt Hot Springs Geothermal...

    Open Energy Info (EERE)

    navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Pressure Temperature Log At Roosevelt Hot Springs Geothermal Area (Faulder, 1991) Exploration Activity...

  15. Water Sampling At Valles Caldera - Sulphur Springs Geothermal...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Valles Caldera - Sulphur Springs Geothermal Area (Trainer, 1974)...

  16. West Virginia Business & Economic Review, Spring 2010 1 West Virginia

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    West Virginia Business & Economic Review, Spring 2010 1 West Virginia Business & Economic Bureau 18 Spring 2010 #12;West Virginia Business & Economic Review, Spring 2010 West Virginia Economy Hits Bottom In 2010 Excerpt From the West Virginia Economic Outlook 2010 by George W. Hammond, Associate

  17. Torsion Spring Oscillator with Dry Friction Eugene Butikov

    E-Print Network [OSTI]

    Butikov, Eugene

    at investigation of free oscillations of a torsion spring pendulum damped by dry (Coulomb) friction. An idealizedTorsion Spring Oscillator with Dry Friction Manual Eugene Butikov Annotation. The manual includes as a prerequisite for the virtual lab "Torsion Spring Oscillator with Dry Friction." The manual includes also a set

  18. Photoplethysmography for non-invasive measurement of bone hemodynamic responses to changes in external pressure

    E-Print Network [OSTI]

    Mateus, Jaime (Pereira de Mateus Silva)

    2011-01-01T23:59:59.000Z

    Adequate blood supply and circulation in bones is required to maintain a healthy skeleton, and inadequate blood perfusion is associated with numerous bone pathologies and a decrease in bone mineral density (BMD). Bone ...

  19. The effect of three hemostatic agents on early bone healing in an animal model

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    B, Sjogren S: Effects of bone wax on rabbit cranial boneRR: The effect of bone wax on the healing of experimentaland healing using bone wax and a soluble polymer material.

  20. Bisphosphonates and Bone diseases: past, present and future Bisphosphonates are stable analogues of the naturally-occuring inorganic

    E-Print Network [OSTI]

    Paris-Sud XI, Universitť de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget's disease of bone

  1. Engineered nanomedicine for myeloma and bone microenvironment targeting

    E-Print Network [OSTI]

    Swami, Archana

    Bone is a favorable microenvironment for tumor growth and a frequent destination for metastatic cancer cells. Targeting cancers within the bone marrow remains a crucial oncologic challenge due to issues of drug availability ...

  2. Cellular and molecular immunotherapeutics derived from the bone marrow stroma

    E-Print Network [OSTI]

    Parekkadan, Biju

    2008-01-01T23:59:59.000Z

    The bone marrow contains a multipotent stromal cell, commonly referred to as a mesenchymal stem cell (MSC). There has been recent interest in the clinical use of MSCs for cell-based therapy because: (1) bone marrow aspiration ...

  3. Original article Analysis of muscle and bone weight variation

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . The commonalities ranged from 0.76 (drumstick muscle) to 0.92 (neck bone) and the uniqueness (special size factors and drumstick bone factors. The correlation coefficient between the first factor score and carcass muscle was 0

  4. Two-dimensional ultrasonic computed tomography of growing bones.

    E-Print Network [OSTI]

    Paris-Sud XI, Universitť de

    Two-dimensional ultrasonic computed tomography of growing bones. P. Lasaygues, E. Franceschini, R: Ultrasonic Computed Tomography, Bone imaging, Born approximation, iterative distorted method I. INTRODUCTION imaging process, using ultrasonic computed tomography. Although this method is known to provide

  5. Mechanistic fracture criteria for the failure of human cortical bone

    SciTech Connect (OSTI)

    Nalla, Ravi K.; Kinney, John H.; Ritchie, Robert O.

    2002-12-13T23:59:59.000Z

    A mechanistic understanding of fracture in human bone is critical to predicting fracture risk associated with age and disease. Despite extensive work, a mechanistic framework for describing how the underlying microstructure affects the failure mode in bone is lacking.

  6. Three-dimensional terahertz computed tomography of human bones

    E-Print Network [OSTI]

    Paris-Sud XI, Universitť de

    spectroscopy cannot rival with dual energy x-ray absorptiometry (DEXA) to identify the bone mineral density

  7. Dynamic Behavior and Microstructural Properties of Cancellous Bone.

    E-Print Network [OSTI]

    Boyer, Edmond

    A total of 15 distal parts of bovine femoral bones were used for this study (72 hours post mortemDynamic Behavior and Microstructural Properties of Cancellous Bone. S. Laporte1 , F. David1 , V of the cancellous bone and to identify the link between this mechanical behavior and the microstructural properties

  8. Bone loss during energy restriction: mechanistic role of leptin†

    E-Print Network [OSTI]

    Baek, Kyunghwa

    2009-05-15T23:59:59.000Z

    ), dual energy X-ray absorptiometry (DEXA) and mechanical testing. As a whole body measure, biochemical markers of bone turnover can be used to quantify changes in bone formation (e.g., osteocalcin, OC) and bone resorption (e.g., deoxypyridonoline...

  9. Prediction and Informative Risk Factor Selection of Bone Diseases

    E-Print Network [OSTI]

    Zhang, Aidong

    data and use these integrated features to effectively predict osteoporosis and bone fractures. We; disease memory; osteoporosis; bone fracture. ! 1 INTRODUCTION Risk factor (RF) analysis based on patients on the study of osteoporosis and bone fracture prediction. Over the past few decades, osteoporosis has been

  10. Spring 2012 Mobile Learning Scholars Assessment Report

    E-Print Network [OSTI]

    Barrash, Warren

    is an immersive semester of exploration focused on leveraging mobile learning strategies to achieve course goals and on student learning. During the Spring 2012 semester, two cohorts of faculty were supported. Each faculty of the experience was assessed in the following ways: a) students enrolled in these mLearning courses were surveyed

  11. Denman Forestry Issues Series presents: Spring 2009

    E-Print Network [OSTI]

    Borenstein, Elhanan

    Denman Forestry Issues Series presents: Spring 2009 Future of Forestry in the Pacific Northwest May, College of Forest Resources Session 1: The Future of Forestry in the Pacific Northwest "The Future of Forestry in the Pacific Northwest" Bruce Bare "Markets Happen: The value of diversifying markets" Ivan

  12. DEAN'S LIST HONORABLE MENTION Spring Semester 2010

    E-Print Network [OSTI]

    Wong, Pak Kin

    DEAN'S LIST HONORABLE MENTION Spring Semester 2010 Brown, Skyler Joseph Budinoff, Hannah D. Buzimkic, Ena Campbell, Jesse Alexander Campbell, Jonathan A. Carlotto, Colleen R. Carvallo, Francisco Cureton, David Wayne Davis, Trent Wilford Davis, Wyatt Joseph DeRosa, Sean Edward Dettmer, Lance D. Dixit

  13. Revised Spring 2008 NIH Public Access Policy

    E-Print Network [OSTI]

    Revised Spring 2008 NIH Public Access Policy Notice Number: NOT-OD-08-033 - (See Notice NOT-OD-08-161 (Consolidated Appropriations Act, 2008), the NIH voluntary Public Access Policy (NOT-OD-05-022) is now mandatory shall implement the public access policy in a manner consistent with copyright law. Specifics 1. The NIH

  14. ECE 6050 ADVANCED MICROPROCESSOR APPLICATIONS SPRING 2012

    E-Print Network [OSTI]

    Grantner, Janos L.

    ECE 6050 ADVANCED MICROPROCESSOR APPLICATIONS SPRING 2012 Instructor: Dr. Janos Grantner Office The objective of this course is to survey current microprocessors and to discuss various aspects of memory and in microprocessor/microcontroller systems design. Though some software topics will also be covered, the primary

  15. Internship Administration (Policy effective Spring 2013)

    E-Print Network [OSTI]

    Internship Administration (Policy effective Spring 2013) The purpose of this policy is to provide or repository for both non-credit and credit bearing internships. Employers and organizations wishing to post an internship opportunity have the option to contact the Career Center and indicate their interest in a Siena

  16. GIS Analysis GIS 6116 -Spring 2015

    E-Print Network [OSTI]

    Watson, Craig A.

    ). Geospatial Analysis (4th ed.). Leicester: Matador. Available online at httpGIS Analysis GIS 6116 - Spring 2015 School of Forest Resources and Conservation Geomatics Program _______________________________________________________________________________________ 1 GIS 6116 (GIS Analysis) INSTRUCTORS: Dr. Hartwig Henry Hochmair (FLREC Fort Lauderdale) Dr. Amr

  17. Quantitative Methods of Policy Analysis Spring 2013

    E-Print Network [OSTI]

    Colorado at Boulder, University of

    ENVS 5120 Quantitative Methods of Policy Analysis Spring 2013 Lecture: M/W 5:00-6:15pm Class. Some of these practical skill sets include: basic research design, cost-benefit analysis, risk and skill sets that are commonly used in the professional world of policymaking and policy analysis. Some

  18. Power Systems Analysis ELEN4511 Spring 2013

    E-Print Network [OSTI]

    Lavaei, Javad

    Power Systems Analysis ELEN4511 Spring 2013 Project Paper: Communication Systems and Standards along the power grid. The grid comprised solely of electro- mechanical systems that could of communication systems on the power grid enables devices to communicate more efficiently, and also allows

  19. EEL 6591: Wireless Networks Spring 2014

    E-Print Network [OSTI]

    Latchman, Haniph A.

    EEL 6591: Wireless Networks Spring 2014 Instructor: Professor Yuguang "Michael" Fang Contact: 435-Hall, 2002. References: 1. Broadband Wireless Multimedia Networks by Benny Bing, John Wiley, 2013. 2. Wireless and Mobile Network Architecture by Yi-Bing Lin and Imrich Chlamtac, John Wiley & Sons, 2000. 3

  20. Soil and Water Conservation Spring 2014

    E-Print Network [OSTI]

    Ma, Lena

    of agricultural soil drainage on them. Define water harvesting and give examples. #12;2 Basic Course1 SWS 4233 Soil and Water Conservation 3 Credits Spring 2014 Instructor Susan Curry scurry resources: soil and water. Topics discussed include: Soil/water resources, historical erosions and sediment

  1. Soil and Water Conservation Spring 2014

    E-Print Network [OSTI]

    Ma, Lena

    on them. Define water harvesting and give examples. #12;Basic Course Requirements: 1. Exams consistSWS 4233 Soil and Water Conservation Spring 2014 Instructor Susan Curry scurry@ufl.edu 352 most valuable and most mistreated resources: soil and water. Topics discussed include: Soil/water

  2. Computer Science Graduation Requirements Checklist Spring 2006

    E-Print Network [OSTI]

    Zadok, Erez

    Computer Science Graduation Requirements Checklist ­ Spring 2006 Computer Science Courses Course Gr. Sem. Comments CSE 113 Foundations of Computer Science I CSE 114 Computer Science I [prerequisite: CSE 110] CSE 213 Foundations of Computer Science II CSE 214 Computer Science II CSE 219 Computer Science

  3. 2012 WOMEN'S SOCCER Spring/Summer Clinics

    E-Print Network [OSTI]

    Aalberts, Daniel P.

    2012 WOMEN'S SOCCER Spring/Summer Clinics This clinic is designed for high school student. At the end of the clinic, our hope is that you will have gained technical and tactical awareness that is essential to play college soccer. The ultimate goal of the clinic is that you will gain a better

  4. OkanoganRiver SpringChinookSalmon

    E-Print Network [OSTI]

    : Species or Hatchery Stock: Agency/Operator: Watershed and Region: Date Submitted: Date Last Updated: NOTE Chinook Above Wells Dam Table 3. Tribal Incidental Take Thresholds for ESA-Listed 44 Upper Columbia River Steelhead Table 4. Tribal & Recreational Incidental Take Thresholds 45 for Unmarked Spring Chinook Table 5

  5. SPRING 2013 OU/SPC CAREER EXPERIENCE

    E-Print Network [OSTI]

    SPRING 2013 OU/SPC CAREER EXPERIENCE PROGRAM The Storm Prediction Center (SPC) and the OU School will spend between 8-10 hrs per week at the SPC working on a research project related to U.S. severe weather through this program. The student will also have the opportunity to spend time in the SPC operations area

  6. SPRING 2012 OU/SPC CAREER EXPERIENCE

    E-Print Network [OSTI]

    SPRING 2012 OU/SPC CAREER EXPERIENCE PROGRAM The Storm Prediction Center (SPC) and the OU School will spend between 8-10 hrs per week at the SPC working on a research project related to U.S. severe weather through this program. The student will also will have the opportunity to spend several days in the SPC

  7. Neutrinoless Double Phys 135c Spring 2007

    E-Print Network [OSTI]

    Golwala, Sunil

    Neutrinoless Double Beta Decay Phys 135c Spring 2007 Michael Mendenhall #12;Theory Overview #12 beta decays #12;neutrinoless double beta decays n e- p beta decay e #12;neutrinoless double beta decays n e- p beta decay e n e- p n e- p double beta decay e e #12;neutrinoless double beta decays n e- p

  8. Falconer Natural History 2010* Spring Lecture Series

    E-Print Network [OSTI]

    Linsley, Braddock K.

    is in the process of evaluating potential environmental impacts of horizontal drilling and high-volume hydraulic of the potential adverse impacts identified in a draft supplemental generic environmental impact statementFalconer Natural History 2010* Spring Lecture Series Sponsored by the Atmospheric Sciences Research

  9. Chemistry and Biochemistry Graduate Student Spring 2012

    E-Print Network [OSTI]

    Chemistry and Biochemistry Graduate Student Tutors Spring 2012 (All arrangements are solely between.axelrod@mail.utexas.edu Organic Chemistry Chris Bates chrismbates@gmail.com General Chemistry Lecture/Lab Organic Chemistry Amy Bonaparte abonaparte@mail.utexas.edu General and Organic Chemistry Shelly Casciato slcasciato

  10. Chemistry 106X -Spring 2011 General Chemistry

    E-Print Network [OSTI]

    Wagner, Diane

    Chemistry 106X - Spring 2011 General Chemistry Instructor: Christopher Iceman Class: MWF 1 and can be purchased in the UAF bookstore or elsewhere: ∑ Chemistry and Chemical Reactivity 7th Ed for Chemistry and Chemical Reactivity 7th Ed. (1 or 2 semester) ∑ TurningPoint Technologies ResponseCard RF

  11. DEAN'S LIST HONORABLE MENTION Spring Semester 2014

    E-Print Network [OSTI]

    Wong, Pak Kin

    DEAN'S LIST HONORABLE MENTION Spring Semester 2014 Congratulations to these students for earning Joseph Ding, Yawei Dow, Luz M. Dzul Karnain, Ahmad Ariff Eddy, Steven Kyle Edwards, Corey Taylor Ellis Emelien Hailwood, Michael Dean Hall, Peter W. Hatch, Brent Lane Haubert, Ian A. Hernandez, Luis Leonardo

  12. OKLAHOMA CITY UNIVERSITY VOLUME 32 SPRING 2007

    E-Print Network [OSTI]

    Sharp, Kim

    OKLAHOMA CITY UNIVERSITY LAW REVIEW VOLUME 32 SPRING 2007 SPEECH NUMBER 1 UNPOPULAR PRIVACY numbers for their clients;2 (3) decisional intrusions, * This speech was given at Oklahoma City University as the Quinlain Lecture at the Oklahoma City University School of Law. 1. See, e.g., Plaxico v. Michael, 735 So. 2

  13. CNR GRADUATION SURVEY RESULTS Spring, 2000

    E-Print Network [OSTI]

    Management (19 graduates): 5 are looking for work 1 is taking time off 1 is planning to attend grad schoolCNR GRADUATION SURVEY RESULTS Spring, 2000 Received 131 completed surveys at graduation in May are looking for work 0 are taking time off 0 are planning to attend grad school 4 have found employment

  14. Introduction to Statistical Linear Models Spring 2005

    E-Print Network [OSTI]

    of multivariate data and in the language of matrices and vectors. Broad introduction to MATLAB/Octave, R (SSyllabus Introduction to Statistical Linear Models 960:577:01 Spring 2005 Instructor: Farid Statistical Analysis" Fifth edition, Prentice Hall, 2002. Other sources may be required and will be posted

  15. PY313: Modern Physics Spring 2012

    E-Print Network [OSTI]

    Goldberg, Bennett

    PY313: Modern Physics Spring 2012 Instructor and Class Information Instructor: Prof. Peter A. Zink: Physics 313 will examine the development of modern physics leading up to and including quantum mechanics for producing well-organized and clearly written engineering reports. Required Textbooks ∑ Modern Physics

  16. METR 4433, Mesoscale Meteorology Spring 2011

    E-Print Network [OSTI]

    Droegemeier, Kelvin K.

    METR 4433, Mesoscale Meteorology Spring 2011 Instructor Dr. Kelvin K. Droegemeier Office: Three, 1:00 ≠ 2:30 pm Required Text Markowski, P. and Y. Richardson: Mesoscale Meteorology in Midlatitudes and physical analysis techniques to mesoscale phenomena. Topics include definition of the term "mesoscale

  17. ATS 641: Mesoscale Meteorology Spring 2014

    E-Print Network [OSTI]

    ATS 641: Mesoscale Meteorology Spring 2014 TR, 1:00-2:50 PM, ATS Room 101 Course Description and Prerequisites This course will cover the theory and application of mesoscale meteorology, and how mesoscale, students will be able to: ∑ Describe the basic theories describing mesoscale weather phenomena ∑ Understand

  18. METR 4433, Mesoscale Meteorology Spring 2013

    E-Print Network [OSTI]

    Droegemeier, Kelvin K.

    METR 4433, Mesoscale Meteorology Spring 2013 Instructor Dr. Kelvin K. Droegemeier (kkd Text Markowski, P. and Y. Richardson: Mesoscale Meteorology in Midlatitudes. Wiley-Blackwell, 430pp to mesoscale phenomena. Topics include definition of the term "mesoscale," radar principles and interpretation

  19. ECE 2100 Circuit Analysis Spring 2011

    E-Print Network [OSTI]

    Miller, Damon A.

    ECE 2100 Circuit Analysis Spring 2011 Exam #1 NAME analysis. #12;© 2011 Damon A. Miller Schematics drawn using LTspice IV (linear.com). Some problems might Schematics drawn using LTspice IV (linear.com). Some problems might be adapted from the course text

  20. Math 566: Axiomatic Set Theory Spring 2009

    E-Print Network [OSTI]

    Basic Set Theory Definition (Axiom of Choice (AC)). If F is a family of non-empty sets, then thereMath 566: Axiomatic Set Theory Spring 2009 Professor: Simon Thomas Note-taker: Jay Williams #12;Contents 1 Basic Set Theory 3 1.1 The ordinals

  1. Response of Red-Tailed Hawks and Golden Eagles to Topographical Features, Weather, and Abundance of a Dominant Prey Species at the Altamont Pass Wind Resource Area, California: April 1999-December 2000

    SciTech Connect (OSTI)

    Hoover, S.

    2002-06-01T23:59:59.000Z

    Studies have shown that raptors flying within the Altamont Pass WRA are vulnerable to fatal turbine collisions, possibly because of their specific foraging and flight behavior. Between June 1999 and June 2000, I conducted 346.5 hours of raptor observations within the Atlamont Pass WRA. Behavior was recorded in relation to characteristics of the topography (slope aspect, elevation, and inclination), the weather, and ground squirrel abundance, as determined by active burrow entrances. The most significant finding of this study revealed that red-tailed hawks and golden eagles flew more in strong winds than in weak winds, particularly along hillsides facing into prevailing winds (as opposed to hillsides shielded from the wind). This is likely a result of the birds' use of declivity currents for lift during flights. These results suggest that certain combinations of topography and weather produce wind currents that are sought out by foraging red-tailed hawks and golden eagles within the Altamont Pass WRA. To decrease raptor mortality, mitigation measures can be targeted to specific areas likely to attract foraging raptors because of their capacity to create particularly favorable wind currents.

  2. INVEST IN YOUR BONES Daily Activities

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Daily Activities Leaflet 3 Another osteoporosis prevention step to decrease lifestyle. Let's see how you can do that. If you have osteoporosis, follow carefully the activity program. Remember the following about osteoporosis: is largely preventable and treatable is a serious

  3. Nanoscale Surface Topography to Guide Bone Growth

    E-Print Network [OSTI]

    Nanoscale Surface Topography to Guide Bone Growth P R O J E C T L E A D E R : Jirun Sun (American T S Designed and fabricated devices with nanoscale surface topography. Controlled cell alignment by varying the height and aspect ratio of the surface features. R E F E R E N C E Exploring cellular contact guidance

  4. Rotational hysteresis of exchange-spring magnets.

    SciTech Connect (OSTI)

    Jiang, J.S.; Bader, S.D.; Kaper, H.; Leaf, G.K.; Shull, R.D.; Shapiro, A.J.; Gornakov, V.S.; Nikitenko, V.I.; Platt, C.L.; Berkowitz, A.E.; David, S.; Fullerton, E.E.

    2002-03-27T23:59:59.000Z

    We highlight our experimental studies and micromagnetic simulations of the rotational hysteresis in exchange-spring magnets. Magneto-optical imaging and torque magnetometry measurements for SmCo/Fe exchange-spring films with uniaxial in-plane anisotropy show that the magnetization rotation created in the magnetically soft Fe layer by a rotating magnetic field is hysteretic. The rotational hysteresis is due to the reversal of the chirality of the spin spiral structure. Micromagnetic simulations reveal two reversal modes of the chirality, one at low fields due to an in-plane untwisting of the spiral, and the other, at high fields, due to an out-of-plane fanning of the spiral.

  5. Spring structure for a thermionic converter emitter support arrangement

    SciTech Connect (OSTI)

    Allen, Daniel T. (La Jolla, CA)

    1992-01-01T23:59:59.000Z

    A support is provided for use in a thermionic converter to support an end of an emitter to keep it out of contact with a surrounding collector while allowing the emitter end to move axially as its temperature changes. The emitter end (34) is supported by a spring structure (44) that includes a pair of Belleville springs, and the spring structure is supported by a support structure (42) fixed to the housing that includes the collector. The support structure is in the form of a sandwich with a small metal spring-engaging element (74) at the front end, a larger metal main support (76) at the rear end that is attached to the housing, and with a ceramic layer (80) between them that is bonded by hot isostatic pressing to the metal element and metal main support. The spring structure can include a loose wafer (120) captured between the Belleville springs.

  6. Spring structure for a thermionic converter emitter support arrangement

    DOE Patents [OSTI]

    Allen, D.T.

    1992-03-17T23:59:59.000Z

    A support is provided for use in a thermionic converter to support an end of an emitter to keep it out of contact with a surrounding collector while allowing the emitter end to move axially as its temperature changes. The emitter end is supported by a spring structure that includes a pair of Belleville springs, and the spring structure is supported by a support structure fixed to the housing that includes the collector. The support structure is in the form of a sandwich with a small metal spring-engaging element at the front end, a larger metal main support at the rear end that is attached to the housing, and with a ceramic layer between them that is bonded by hot isostatic pressing to the metal element and metal main support. The spring structure can include a loose wafer captured between the Belleville springs. 7 figs.

  7. Wrap spring clutch syringe ram and frit mixer

    DOE Patents [OSTI]

    Simpson, Frank B.

    2006-07-25T23:59:59.000Z

    A wrap spring clutch syringe ram pushes at least one syringe with virtually instantaneous starting and stopping, and with constant motion at a defined velocity during the intervening push. The wrap spring clutch syringe ram includes an electric motor, a computer, a flywheel, a wrap spring clutch, a precision lead screw, a slide platform, and syringe reservoirs, a mixing chamber, and a reaction incubation tube. The electric motor drives a flywheel and the wrap spring clutch couples the precision lead screw to the flywheel when a computer enables a solenoid of the wrap spring clutch. The precision lead screw drives a precision slide which causes syringes to supply a portion of solution into the mixing chamber and the incubation tube. The wrap spring clutch syringe ram is designed to enable the quantitative study of solution phase chemical and biochemical reactions, particularly those reactions that occur on the subsecond time scale.

  8. Spring 07 for web.qxp

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    SPRING NEWS ROCKY MOUNTAIN OILFIELD TESTING CENTER O f f i c e o f F o s s i l E n e r g y T N M T R A P E D O F E N E R G Y E T A T S D E T I N U S O F A M E R I C A E GEOLOGIC...

  9. Journal of Undergraduate Research, Spring 2014

    E-Print Network [OSTI]

    2014-04-01T23:59:59.000Z

    .................................................................................................................................. 20 Eric Rivera An analysis of electromyography as an input method for resilient and affordable systems: human-computer interfacing using the bodyís electrical activity ............................................ 30 Seth Polsley Man of Tomorrow: a...Summer 2013 Ė Spring 2014 The University of Kansas prohibits discrimination on the basis of race, color, ethnicity, religion, sex, national origin, age, ancestry, disability, status as a veteran, sexual orientation, marital status, parental status...

  10. N Springs expedited response action proposal

    SciTech Connect (OSTI)

    Not Available

    1994-01-01T23:59:59.000Z

    Since signing the Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) in 1989, the parties to the agreement have recognized the need to modify the approach to conducting investigations, studies, and cleanup actions at Hanford. To implement this approach, the parties have jointly developed the Hanford Past-Practice Strategy. The strategy defines a non-time-critical expedited response action (ERA) as a response action ``needed to abate a threat to human health or welfare or the environment where sufficient time exists for formal planning prior to initiation of response. In accordance with the past-practice strategy, DOE proposes to conduct an ERA at the N Springs, located in the Hanford 100 N Area, to substantially reduce the strontium-90 transport into the river through the groundwater pathway. The purpose of this ERA proposal is to provide sufficient information to select a preferred alternative at N Springs. The nature of an ERA requires that alternatives developed for the ERA be field ready; therefore, all the technologies proposed for the ERA should be capable of addressing the circumstances at N Springs. A comparison of these alternatives is made based on protectiveness, cost, technical feasibility, and institutional considerations to arrive at a preferred alternative. Following the selection of an alternative, a design phase will be conducted; the design phase will include a detailed look at design parameters, performance specifications, and costs of the selected alternative. Testing will be conducted as required to generate design data.

  11. Prof. Alexandru Suciu MTH 1230 LINEAR ALGEBRA Spring 2001

    E-Print Network [OSTI]

    Prof. Alexandru Suciu MTH 1230 LINEAR ALGEBRA Spring 2001 EXAM 4 1. 12 pts (a) Compute the area 4 Spring 2001 2. 7 points Let A and B be two 5 √? 5 matrices, with det A = 0 and det B = -3. (a, with eigenvalues -7 and 3, respectively. #12;MTH 1230 Exam 4 Spring 2001 4. 12 points A 4 √? 4 matrix A has

  12. FUPWG Spring 2010 Meeting South Dakota: Washington Update

    Broader source: Energy.gov [DOE]

    Presentation covers an update on Washington given at the Spring 2010 Federal Utility Partnership Working Group (FUPWG) meeting in Rapid City, South Dakota.

  13. Thermal Gradient Holes At Waunita Hot Springs Geothermal Area...

    Open Energy Info (EERE)

    Zacharakis, 1981) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Thermal Gradient Holes At Waunita Hot Springs Geothermal Area (Zacharakis,...

  14. Spring 2001 Vol. 2, No. 2 ii Colorado Climate

    E-Print Network [OSTI]

    Colorado Climate Spring 2001 Vol. 2, No. 2 #12;ii Colorado Climate Table of Contents Frost: Nature ...................................................................................................................................... 9 January 2001 .......................................................................................................................................................... 9 February 2001

  15. Fuel Cell Vehicle Learning Demonstration: Spring 2008 Results; Preprint

    SciTech Connect (OSTI)

    Wipke, K.; Sprik, S.; Kurtz, J.; Garbak, J.

    2008-04-01T23:59:59.000Z

    Conference paper presented at the 2008 National Hydrogen Association Meeting that describes the spring, 2008 results of the Controlled Hydrogen Fleet and Infrastructure Demonstration and Validation Project.

  16. Sulphur Springs Valley EC- Residential Energy Efficiency Loan Program

    Broader source: Energy.gov [DOE]

    Sulphur Springs Valley Electric Cooperative (SSVEC) is a Touchstone Energy Cooperative. SSVEC offers the Member Loan Program to residential customers to improve the energy efficiency of eligible...

  17. Sulphur Springs Valley EC- Residential Energy Efficiency Rebate

    Broader source: Energy.gov [DOE]

    Sulphur Springs Valley Electric Cooperative (SSVEC) is a Touchstone Energy Cooperative. SSVEC's residential rebate program offers a $500 rebate for the installation of 15 SEER or higher electric...

  18. Modeling-Computer Simulations At Valles Caldera - Sulphur Springs...

    Open Energy Info (EERE)

    Sulphur Springs Geothermal Area Exploration Technique Modeling-Computer Simulations Activity Date 1987 - 1995 Usefulness useful DOE-funding Unknown Notes A modification of the...

  19. Modeling-Computer Simulations At Valles Caldera - Sulphur Springs...

    Open Energy Info (EERE)

    navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Modeling-Computer Simulations At Valles Caldera - Sulphur Springs Geothermal Area (Wilt & Haar, 1986)...

  20. Trace Element Geochemical Zoning in the Roosevelt Hot Springs...

    Open Energy Info (EERE)

    Capuano. 1980. Trace Element Geochemical Zoning in the Roosevelt Hot Springs Thermal Area, Utah. In: Transactions. GRC Annual Meeting; 09091980; Salt Lake City, UT. Salt...

  1. Static Temperature Survey At Lake City Hot Springs Area (Benoit...

    Open Energy Info (EERE)

    Benoit Et Al., 2005) Exploration Activity Details Location Lake City Hot Springs Area Exploration Technique Static Temperature Survey Activity Date Usefulness useful DOE-funding...

  2. Geothermal Literature Review At Lake City Hot Springs Area (Benoit...

    Open Energy Info (EERE)

    Et Al., 2004) Exploration Activity Details Location Lake City Hot Springs Area Exploration Technique Geothermal Literature Review Activity Date Usefulness not indicated DOE-funding...

  3. Blue Mountain Hot Spring Guest Ranch Pool & Spa Low Temperature...

    Open Energy Info (EERE)

    Ranch Pool & Spa Low Temperature Geothermal Facility Jump to: navigation, search Name Blue Mountain Hot Spring Guest Ranch Pool & Spa Low Temperature Geothermal Facility Facility...

  4. Geologic map of the Sulphur Springs Area, Valles Caldera Geothermal...

    Open Energy Info (EERE)

    Goff,J. N. Gardner. Geologic map of the Sulphur Springs Area, Valles Caldera Geothermal System, New Mexico. Map. Place of publication not provided. Los Alamos National...

  5. Surface Gas Sampling At Valles Caldera - Sulphur Springs Area...

    Open Energy Info (EERE)

    Details Location Valles Caldera - Sulphur Springs Area Exploration Technique Surface Gas Sampling Activity Date Usefulness not indicated DOE-funding Unknown Notes Gas samples...

  6. ORISE: Applications being accepted for 2015 spring term of DOE...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    being accepted for 2015 spring term of DOE's Science Undergraduate Laboratory Internship Program at ORNL Students have the opportunity to perform research alongside...

  7. Colorado Springs Utilities- Commercial Energy Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    The Colorado Springs Utilities (CSU) Business Energy and Water Efficiency Rebate Program offers a variety of incentives to business customers who upgrade evaporative cooling, HVAC, irrigation,...

  8. Agricultural Business Curriculum (BS) (effective Spring Quarter 2011)

    E-Print Network [OSTI]

    Selmic, Sandra

    Agricultural Business Curriculum (BS) (effective Spring Quarter 2011) Freshman year Animal Science 111............................................3 Agricultural Business 230 Sophomore Year Accounting 201...................................................3 Agricultural Business 220

  9. Time-Domain Electromagnetics At Neal Hot Springs Geothermal Area...

    Open Energy Info (EERE)

    Activity: Time-Domain Electromagnetics At Neal Hot Springs Geothermal Area (Colorado School of Mines and Imperial College London, 2011) Exploration Activity Details Location Neal...

  10. arctic spring site: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Siciliano 2010-01-01 116 UC EAP Application Deadlines Remaining Programs for Spring 15 Engineering Websites Summary: -SITE: ITALYSPAIN (MadridRome, European Transformations)...

  11. Math 13700 Mathematics for Elementary Education I Spring 2010 ...

    E-Print Network [OSTI]

    rroames

    2010-01-04T23:59:59.000Z

    Mar 22, 2010 ... Mathematics for Elementary Education I. Spring 2010. Coordinator: Renee Roames MATH 808 ph: 494-1929 email: rroames@purdue.edu.

  12. Math 13700 Mathematics for Elementary Education I Spring 2015

    E-Print Network [OSTI]

    User

    2015-01-05T23:59:59.000Z

    Mathematics for Elementary Education I. Spring 2015. Coordinator: Renee Figueroa. MATH 808 ph: 494-1929 email: rfigueroa@purdue.edu. Course web page:†...

  13. aatb spring meeting: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    distributions. Ch 11, 13Math 130 Elementary Statistics with Computers Spring 2009 Syllabus CLASS MEETS MWF 2:10-3:00 in MDH. Sampling Distributions Binomial distribution....

  14. Core Analysis At Valles Caldera - Sulphur Springs Geothermal...

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Core Analysis At Valles Caldera - Sulphur Springs Geothermal Area (Ito & Tanaka, 1995) Exploration...

  15. Isotopic Analysis- Fluid At Roosevelt Hot Springs Geothermal...

    Open Energy Info (EERE)

    Details Location Roosevelt Hot Springs Geothermal Area Exploration Technique Isotopic Analysis- Fluid Activity Date 1981 - 1981 Usefulness useful DOE-funding Unknown Exploration...

  16. Compound and Elemental Analysis At Breitenbush Hot Springs Area...

    Open Energy Info (EERE)

    Wood, 2002) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Compound and Elemental Analysis At Breitenbush Hot Springs Area (Wood, 2002)...

  17. Fluid Inclusion Analysis At Valles Caldera - Sulphur Springs...

    Open Energy Info (EERE)

    Sasada & Goff, 1995) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Fluid Inclusion Analysis At Valles Caldera - Sulphur Springs Geothermal Area...

  18. Walley's Hot Springs Resort Space Heating Low Temperature Geothermal...

    Open Energy Info (EERE)

    Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Walley's Hot Springs Resort Space Heating Low Temperature Geothermal Facility Facility Walley's...

  19. Warner Springs Ranch Resort Space Heating Low Temperature Geothermal...

    Open Energy Info (EERE)

    Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Warner Springs Ranch Resort Space Heating Low Temperature Geothermal Facility Facility Warner...

  20. Warm Springs Water District District Heating Low Temperature...

    Open Energy Info (EERE)

    Water District District Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Warm Springs Water District District Heating Low Temperature Geothermal...

  1. Hot Springs National Park Space Heating Low Temperature Geothermal...

    Open Energy Info (EERE)

    National Park Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Hot Springs National Park Space Heating Low Temperature Geothermal Facility...

  2. Fairmont Hot Springs Resort Space Heating Low Temperature Geothermal...

    Open Energy Info (EERE)

    Institute of Technology's Geo-Heat Center1 Fairmont Hot Springs Resort is a Space Heating low temperature direct use geothermal facility in Fairmont, Montana. This article is...

  3. Glenwood Hot Springs Lodge Space Heating Low Temperature Geothermal...

    Open Energy Info (EERE)

    Lodge Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Glenwood Hot Springs Lodge Space Heating Low Temperature Geothermal Facility Facility...

  4. Pagosa Springs Private Wells Space Heating Low Temperature Geothermal...

    Open Energy Info (EERE)

    Private Wells Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Pagosa Springs Private Wells Space Heating Low Temperature Geothermal Facility...

  5. Warm Springs State Hospital Space Heating Low Temperature Geothermal...

    Open Energy Info (EERE)

    State Hospital Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Warm Springs State Hospital Space Heating Low Temperature Geothermal Facility...

  6. Chena Hot Springs GRED III Project: Final Report Geology, Petrology...

    Open Energy Info (EERE)

    Alteration, and Fluid Analyses Jump to: navigation, search OpenEI Reference LibraryAdd to library Report: Chena Hot Springs GRED III Project: Final Report Geology, Petrology,...

  7. Geologic Setting of the Central Alaskan Hot Springs Belt: Implications...

    Open Energy Info (EERE)

    Sustainable Energy Production Jump to: navigation, search OpenEI Reference LibraryAdd to library Thesis: Geologic Setting of the Central Alaskan Hot Springs Belt: Implications for...

  8. analysis indian springs: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the most commonENGINEERING 12 SPRING 2008 PHYSICAL SYSTEMS ANALYSIS LABORATORY 1: TRANSFORMERS Objectives or counterclockwise). In the following discussion the subscript 1 will...

  9. alkaline spring system: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the most commonENGINEERING 12 SPRING 2008 PHYSICAL SYSTEMS ANALYSIS LABORATORY 1: TRANSFORMERS Objectives or counterclockwise). In the following discussion the subscript 1 will...

  10. Flow Test At Valles Caldera - Sulphur Springs Geothermal Area...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Flow Test At Valles Caldera - Sulphur Springs Geothermal Area (Musgrave, Et Al., 1989)...

  11. ,"Highgate Springs, VT Natural Gas Pipeline Imports From Canada...

    U.S. Energy Information Administration (EIA) Indexed Site

    Highgate Springs, VT Natural Gas Pipeline Imports From Canada (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","L...

  12. Soil Sampling At Waunita Hot Springs Geothermal Area (Ringrose...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Soil Sampling At Waunita Hot Springs Geothermal Area (Ringrose & Pearl, 1981) Exploration...

  13. Idaho Public Utilities Commission Approves Neal Hot Springs Power...

    Open Energy Info (EERE)

    Commission Approves Neal Hot Springs Power Purchase Agreement Jump to: navigation, search OpenEI Reference LibraryAdd to library Report: Idaho Public Utilities Commission Approves...

  14. Hydrogeologic investigation of Coso Hot Springs, Inyo County...

    Open Energy Info (EERE)

    for chemical analysis; determination of the local Coso Hot Springs and regional groundwater hydrology, including consideration of recharge, discharge, movement, and water...

  15. Interpretation of Water Sample Analysis, Waunita Hot Spring Project...

    Open Energy Info (EERE)

    R. H. Carpenter (Colorado Geological Survey in Cooperation with the U.S. Department of Energy). 1981. Interpretation of Water Sample Analysis, Waunita Hot Spring Project,...

  16. Colorado Springs Utilities- Residential Energy Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    Colorado Springs Utilities offers a variety of energy and water efficiency incentives to its residential customers through the Residential Rebate Program. Rebates are offered for single and multi...

  17. Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson & Dellechaie, 1976)...

  18. Water Sampling At Valles Caldera - Sulphur Springs Area (Rao...

    Open Energy Info (EERE)

    Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Valles Caldera - Sulphur Springs Area (Rao, Et Al., 1996) Exploration...

  19. Teleseismic-Seismic Monitoring At Valles Caldera - Sulphur Springs...

    Open Energy Info (EERE)

    Valles Caldera - Sulphur Springs Geothermal Area Exploration Technique Teleseismic-Seismic Monitoring Activity Date 1993 - 1994 Usefulness useful DOE-funding Unknown...

  20. Seismic baseline and induction studies- Roosevelt Hot Springs...

    Open Energy Info (EERE)

    Idaho Jump to: navigation, search OpenEI Reference LibraryAdd to library Report: Seismic baseline and induction studies- Roosevelt Hot Springs, Utah and Raft River, Idaho...

  1. Paleomagnetic Measurements At Neal Hot Springs Geothermal Area...

    Open Energy Info (EERE)

    London, 2011) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Paleomagnetic Measurements At Neal Hot Springs Geothermal Area (London, 2011)...

  2. annual spring water: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    living in vehicle Escher, Christine 9 CE475 WATER QUALITY ANALYSIS SPRING 2009 Environmental Management and Restoration Websites Summary: 1 CE475 - WATER QUALITY...

  3. WSSRAP chemical plant geotechnical investigations for the Weldon Spring Site Remedial Action Project, Weldon Spring, Missouri

    SciTech Connect (OSTI)

    Not Available

    1990-12-01T23:59:59.000Z

    This document has been prepared for the United states Department of Energy (DOE) Weldon Spring Site Remedial Action Project (WSSRAP) by the Project Management Contractor (PMC), which consists of MK-Ferguson Company (MKF) and Morrison Knudsen Corporation Environmental Services Group (MKES) with Jacobs Engineering Group (JEG) as MKF's predesignated subcontractor. This report presents the results of site geotechnical investigations conducted by the PMC in the vicinity of the Weldon Spring chemical plant and raffinate pits (WSCP/RP) and in potential on-site and off-site clayey material borrow sources. The WSCP/RP is the proposed disposal cell (DC) site. 39 refs., 24 figs., 12 tabs.

  4. Interactions between microenvironment and cancer cells in two animal models of bone metastasis

    E-Print Network [OSTI]

    Boyer, Edmond

    1 Interactions between microenvironment and cancer cells in two animal models of bone metastasis of characteristics leading to osteoclastogenesis only in the bone microenvironment. Key words: Bone metastasis;3 INTRODUCTION Bone is a preferential site for metastasis in different types of cancer. Bone metastases induce

  5. BONE LOSS IN RELATION TO HYPOTHALAMIC ATROPHY IN ALZHEIMER'S DISEASE

    E-Print Network [OSTI]

    Loskutova, Natalia Y.

    2011-05-12T23:59:59.000Z

    considerable burden on the health system, patients, and caregivers. 1.2 Alzheimerís Disease and Bone Loss Bone health is an important issue in aging and AD. OsteoporosisĖrelated fractures are among the major health and socioeconomic concerns in aging... of bone fractures, and a determining factor in clinical diagnosis of osteoporosis (Ammann and Rizzoli 2003). Several studies in women suggest that low BMD is associated with poorer cognitive function and subsequent cognitive decline (Yaffe, Browner et al...

  6. Bone Cancer Rates in Dinosaurs Compared with Modern Vertebrates

    E-Print Network [OSTI]

    L. C. Natarajan; A. L. Melott; B. M. Rothschild; L. D. Martin

    2007-10-16T23:59:59.000Z

    Data on the prevalence of bone cancer in dinosaurs is available from past radiological examination of preserved bones. We statistically test this data for consistency with rates extrapolated from information on bone cancer in modern vertebrates, and find that there is no evidence of a different rate. Thus, this test provides no support for a possible role of ionizing radiation in the K-T extinction event.

  7. allowing normal bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    assays. Correlations of fluoride levels between normal bone near the Nancy Medina; Chester W. Douglass; Gary M. Whitford; Robert N. Hoover; Thomas R. Fears 6 Differential...

  8. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    their results, the researchers recommended that vitamin D levels be checked and kept on well--balanced levels to maintain the structural integrity of bones and avoid...

  9. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on different size scales within bone, as well as the role of sustained irradiation damage. Combining in situ mechanical testing with synchrotron x-ray diffraction imaging and...

  10. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    Skeleton. In Bone Loss and Osteoporosis: An AnthropologicalThe radiological diagnosis of osteoporosis: A new approach.170. Birnbaum, E. 1992. Osteoporosis: A Summary of Recent

  11. ancient human bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reich, David 159 OsteoConduct: Wireless Body-Area Communication based on Bone Conduction Energy Storage, Conversion and Utilization Websites Summary: , Measurement, Human Factors....

  12. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    present and that diagenesis (chemical exchange between therisk assessment. Diagenesis, or the chemical exchangeto assess the level of diagenesis in a bone without chemical

  13. attenuates bone cancer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    human bone were studied via the small scale mechanical loading test. Failure analysis was conducted... Jang, Eunhwa 2012-10-19 19 ORIGINAL ARTICLE JBMR Cancer Treatment...

  14. arm bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TO ENSURE HUMAN SAFETY Lingqi Zeng and Gary M. Bone Engineering Websites Summary: , and robot and human velocities. The impact experiments are performed with an apparatus...

  15. Survey of Selected Seeps and Springs within the

    E-Print Network [OSTI]

    Committee of the Colorado Division of Wildlife Wetlands Program was helpful in recommending high quality with a Survey of Critical Wetlands and Riparian Areas in Gunnison County (Rocchio et al. 2003). A total of 74. Factors affecting the quality of the seeps and springs in the Gunnison Basin include spring development

  16. SPRING SEMESTER GENERAL FACULTY MEETING March 5, 2001

    E-Print Network [OSTI]

    Hutcheon, James M.

    MINUTES SPRING SEMESTER GENERAL FACULTY MEETING March 5, 2001 The Spring General Faculty meeting was convened by President Grube on March 5, 2001, at 4:00 p.m., in the Russell Union Ballroom. The agenda was approved as distributed. The minutes of the November 9, 2001, meeting which were distributed on January 3

  17. BREAK HOUSING HALLS NOTICE FOR SPRING SEMESTER HOUSING

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    BREAK HOUSING HALLS NOTICE FOR SPRING SEMESTER HOUSING BRETT | LEWIS | PRINCE | CASHIN NORTH AREA APARTMENTS #12;If you are cancelling your Break Housing assignment for the spring semester, you have two will receive a $100 refund of the Break Housing fee to your fall Bursar account. 2. If you remain beyond 6:00pm

  18. Preliminary geothermal investigations at Manley Hot Springs, Alaska

    SciTech Connect (OSTI)

    East, J.

    1982-04-01T23:59:59.000Z

    Manley Hot Springs is one of several hot springs which form a belt extending from the Seward Peninsula to east-central Alaska. All of the hot springs are low-temperature, water-dominated geothermal systems, having formed as the result of circulation of meteoric water along deepseated fractures near or within granitic intrusives. Shallow, thermally disturbed ground at Manley Hot Springs constitutes an area of 1.2 km by 0.6 km along the lower slopes of Bean Ridge on the north side of the Tanana Valley. This area includes 32 springs and seeps and one warm (29.1/sup 0/C) well. The hottest springs range in temperature from 61/sup 0/ to 47/sup 0/C and are presently utilized for space heating and irrigation. This study was designed to characterize the geothermal system present at Manley Hot Springs and delineate likely sites for geothermal drilling. Several surveys were conducted over a grid system which included shallow ground temperature, helium soil gas, mercury soil and resistivity surveys. In addition, a reconnaissance ground temperature survey and water chemistry sampling program was undertaken. The preliminary results, including some preliminary water chemistry, show that shallow hydrothermal activity can be delineated by many of the surveys. Three localities are targeted as likely geothermal well sites, and a model is proposed for the geothermal system at Manley Hot Springs.

  19. RMI 357e spring 2012 Introduction to Risk Management & Insurance

    E-Print Network [OSTI]

    Ghosh, Joydeep

    RMI 357e ≠ spring 2012 1 Introduction to Risk Management & Insurance R M 357e Professor: Olga Trofimova Olga.trofimova@utexas.edu Syllabus ≠ spring 2012 Textbook Principles of Risk Management Management: 357E. Introduction to Risk Management - Upper-Division Course Principles of risk management

  20. ABET Course Syllabus Spring 2011 EC402 Control Systems Elective

    E-Print Network [OSTI]

    Goldberg, Bennett

    Schedule: LEC: 4 hrs/week (MW 4-6), LAB: (TBA) Textbooks: "Modern Control Systems", 12 th edition, by DorfABET Course Syllabus ≠ Spring 2011 EC402 Control Systems Elective Spring 2011 Catalog Data-Hurwitz, root-locus, Bode, and Nyquist techniques. Design and compensation of feedback control systems. Course

  1. Chemistry climate model simulations of1 spring Antarctic ozone

    E-Print Network [OSTI]

    Wirosoetisno, Djoko

    Chemistry climate model simulations of1 spring Antarctic ozone 1234567 89A64BC7DEF72B4 19B34EE3293C climate model simulations of spring Antarctic ozone John Austin,1,2 H. Struthers,3 J. Scinocca,4 D. A) and Intergovernmental Panel on Climate Change A1b Scenario. The simulations of the Antarctic ozone hole are compared

  2. Course Enrollment by College -Census West Lafayette -Spring 2009

    E-Print Network [OSTI]

    Pittendrigh, Barry

    Course Enrollment by College - Census West Lafayette - Spring 2009 Freeze Date: Jan 28, 2009 Enrollment by College - Census West Lafayette - Spring 2009 Freeze Date: Jan 28, 2009 College Enrollment 01 & Meat Mrkt 6 2 15 4 8 35 AGEC42200 Technical Price Anly 6 2 15 3 8 34 AGEC42600 Mkt Mgt Agr Bus 3 7 23 4

  3. Course Enrollment by College -Census West Lafayette -Spring 2011

    E-Print Network [OSTI]

    Ginzel, Matthew

    Course Enrollment by College - Census West Lafayette - Spring 2011 Freeze Date: Jan 25, 2011 Enrollment by College - Census West Lafayette - Spring 2011 Freeze Date: Jan 25, 2011 College Enrollment 01 & Meat Mrkt 1 4 13 6 17 41 AGEC42200 Technical Price Anly 1 3 10 4 16 34 AGEC42400 Finan Mgt Agr Bus 9 27

  4. Course Enrollment by College -Census West Lafayette -Spring 2010

    E-Print Network [OSTI]

    Pittendrigh, Barry

    Course Enrollment by College - Census West Lafayette - Spring 2010 Freeze Date: Jan 26, 2010 by College - Census West Lafayette - Spring 2010 Freeze Date: Jan 26, 2010 College Enrollment 01 02 03 04 05 7 3 16 13 21 63 AGEC41200 Farm Business Mgmt 3 8 11 AGEC42100 Livestock & Meat Mrkt 1 1 3 15 7 15 42

  5. CSCI 480 Computer Graphics, Spring 2011 Administrative Matters

    E-Print Network [OSTI]

    Southern California, University of

    CSCI 480 Computer Graphics, Spring 2011 Administrative Matters Spring 2011, Mon and Wed, 10 24 Transformations Ch 4 Wed Jan 26 Viewing and Projection Ch 5 Mon Jan 31 Hierarchical Modeling Ch 10, Publisher: Addison Wesley, ISBN: 9780321535863 Dave Shreiner: OpenGL Programming Guide: The Official Guide

  6. FOR341 Timber Harvesting and Forest Roads Spring 2009

    E-Print Network [OSTI]

    Vonessen, Nikolaus

    FOR341 Timber Harvesting and Forest Roads Spring 2009 Instructor: Beth Dodson Office: FOR 201A Text: Water Quality BMPs (Best Management Practices) for Montana Forests Other readings as assigned (available in class folder: R:\\Classes\\Spring2009\\FOR341) Course Description: An overview of harvesting

  7. IN A CUREUF HEALTH CANCER CENTER NEWS SPRING 2014

    E-Print Network [OSTI]

    Roy, Subrata

    care and research for the Southeast's most comprehensive academic health center. In each issue, weIN A CUREUF HEALTH CANCER CENTER NEWS Believe SPRING 2014 PAGE6 #12;www.cancer.ufl.eduBelieve in a Cure//Spring 20142 Believe in a Cure is the newsletter for the UF Health Cancer Center, home to cancer

  8. 1. Williams Shop 15 Spring St., 413-458-3605

    E-Print Network [OSTI]

    Aalberts, Daniel P.

    Spring St., 413-458-8321 8. Nature's Closet 61 Spring St., 413-458-7909 9. Sweets and Beans Confieserie & Vines Beer Garden & Brasserie 16 Water St., 413-884-1372 31. Amy's Cottage 24 Water St., 413-458-4305 32. Water Street Books 26 Water St., 413-458-8072 33. In Touch Massage & Day Spa 84 Water St., 413

  9. ENVS 340: Topics in Pollution: Gulf Oil Spill Spring 2011

    E-Print Network [OSTI]

    ENVS 340: Topics in Pollution: Gulf Oil Spill Spring 2011 ENVS 340 Topics in Pollution: Gulf Oil Oil Spill based on scientific research. Our report is due ~May 8. Our first goal is to determine with their instructors as soon as possible to discuss their needs. #12;ENVS 340/BIOL 378: Topics in Pollution Spring 2011

  10. Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Bala Krishnamoorthy, Department of Mathematics, Washington State University

    E-Print Network [OSTI]

    Krishnamoorthy, Bala

    1 Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Strength Bala to failure in axial compression. Predictive variables included age, gender, bone mineral density (BMD mineral density, spine surgery. #12;3 Introduction The allograft bone industry is guided by practices

  11. Osteopontin deficiency increases bone fragility but preserves bone mass Philipp J. Thurner a,b

    E-Print Network [OSTI]

    Ritchie, Robert

    density (BMD) is the most common diagnostic used to assess fracture risk [1,2], yet less than half of non to osteopontin in bone, many of which have the potential to impact material properties. To elucidate the role role for OPN in preventing crack propagation. This significant decline in fracture toughness

  12. ARM - Field Campaign - Spring 1994 UAV IOP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa- Polarization DiversityPolarizationgovCampaignsSmall Particles ingovCampaignsSpring

  13. ARM - Field Campaign - Spring Cloud IOP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa- Polarization DiversityPolarizationgovCampaignsSmall ParticlesSCM IOPgovCampaignsSpring

  14. Summary of the Spring 2004 ASA Meeting

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocks Nov-14 Dec-14TableConference |6:Welcome to the of the Spring

  15. Wilbur Springs Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-fTri GlobalJumpGoogleAreaMapUtilityRateEntryHelperVideoVimeoWilbur Springs

  16. Okpilak Springs Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRoseConcernsCompany Oil and Gas CompanyOklahoma/WindOkpilak Springs

  17. Granite Springs Geothermal Project | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdfGetec AG Contracting JumpGove County,Texas: EnergyOhio:GeothermalSprings

  18. Spring, Texas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro Industries Pvt LtdShawangunk,Southeast ColoradoOhio: EnergyIndiana:New York: EnergySpring,

  19. SpringWorks | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro Industries Pvt LtdShawangunk,Southeast ColoradoOhio: EnergyIndiana:New York:SpringWorks Jump

  20. Spring Canyon Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-f < RAPID‚ÄéSolarCity Corp JumpsourceSouthlake,AeHJump to:Spring Canyon

  1. Silver Spring Networks | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty Edit with form HistoryRistma AGShandongShirkeSichuanSilicon RecyclingSilver Spring

  2. Quantity and Quality of Trabecular Bone in the Femur Are Enhanced by a Strongly Anabolic, Noninvasive

    E-Print Network [OSTI]

    serve as the basis for a biomechanically based intervention for osteoporosis. To evaluate intervention for osteoporosis. (J Bone Miner Res 2002;17:349≠357) Key words: osteoporosis, osteogenic, anabolic, bone formation, bone quality, osteogenic INTRODUCTION OSTEOPOROSIS, A disease characterized

  3. Structural Analysis of Human and Bovine Bone for Development of Synthetic Materials†

    E-Print Network [OSTI]

    Jang, Eunhwa

    2012-10-19T23:59:59.000Z

    With increasing demands in bone repair and replacement, this research investigates the microstructure, properties and performance of bovine bone, human bone, and synthetic materials. Doing so, experimental approaches were used to exam and compare...

  4. Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells

    E-Print Network [OSTI]

    Aliotta, Jason M.

    2008-01-01T23:59:59.000Z

    Bone marrow production of lung cells: the impact of G-CSF,bone marrow to reconstitute lung epithelium. Am. J. Respirof Bone Marrow Cells into Lung Cells Mark S. Dooner 1 *,

  5. Role of middle-ear inertial component of bone conduction in chinchilla

    E-Print Network [OSTI]

    Chhan, David

    2013-01-01T23:59:59.000Z

    Bone conduction describes the mechanisms that produce a hearing sensation when the skull bones are subjected to vibration. Multiple components and pathways have been suggested to contribute to total bone-conducted sound. ...

  6. Geothermal resource assessment of Idaho Springs, Colorado. Resource series 16

    SciTech Connect (OSTI)

    Repplier, F.N.; Zacharakis, T.G.; Ringrose, C.D.

    1982-01-01T23:59:59.000Z

    Located in the Front Range of the Rocky Mountains approximately 30 miles west of Denver, in the community of Idaho Springs, are a series of thermal springs and wells. The temperature of these waters ranges from a low of 68/sup 0/F (20/sup 0/C) to a high of 127/sup 0/F (53/sup 0/C). To define the hydrothermal conditions of the Idaho Springs region in 1980, an investigation consisting of electrical geophysical surveys, soil mercury geochemical surveys, and reconnaissance geological and hydrogeological investigations was made. Due to topographic and cultural restrictions, the investigation was limited to the immediate area surrounding the thermal springs at the Indian Springs Resort. The bedrock of the region is faulted and fractured metamorphosed Precambrian gneisses and schists, locally intruded by Tertiary age plutons and dikes. The investigation showed that the thermal waters most likely are fault controlled and the thermal area does not have a large areal extent.

  7. Mechanical bone strength in the proximal tibia†

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    KNEE REPLACEMENT 3 2. 1 Mechanics of the Knee 2. 1. 1 knee Structure. 2. 1. 2 Bone Strength of Proximal Tibia. 2. 2 Total Knee Replacement. '2. 3 Research Prospective III MECHANICS OF MATERIALS. . 3 3 5 7 8 10 3. 1 Normal Stress and Strain... Specimens. 4. 1. 2 Mechanical Test. . 4. 2 Statistical Analysis. . . . . . . . . . . . . 18 18 18 19 V RESULTS AND CONCLUSIONS. 20 5. 1 Results. . 20 5. 2 Discussion and Conclusions. Page 24 REFERENCES. 27 VITA. 29 LIST OF FIGURES FIGURE 2. 1...

  8. Sol Duc Hot Springs feasibility study

    SciTech Connect (OSTI)

    Not Available

    1981-12-01T23:59:59.000Z

    Sol Duc Springs is located in the Olympic National Park in western Washington state. Since the turn of the century, the area has served as a resort, offering hot mineral baths, lodge and overnight cabin accommodations. The Park Service, in conjunction with the concessionaire, is in the process of renovating the existing facilities, most of which are approximately 50 years old. The present renovation work consists of removing all of the existing cabins and replacing them with 36 new units. In addition, a new hot pool is planned to replace the existing one. This report explores the possibility of a more efficient use of the geothermal resource to accompany other planned improvements. It is important to note that the system outlined is based upon the resource development as it exists currently. That is, the geothermal source is considered to be: the two existing wells and the hot springs currently in use. In addition, every effort has been made to accommodate the priorities for utilization as set forth by the Park Service.

  9. WOMEN'S GLOBAL HEALTH INSTITUTE NUTR59000/BMS59800: WOMEN'SHEALTH:BONE

    E-Print Network [OSTI]

    /remodeling, mechanics;Tools of assessment Epidemiology of osteoporosis Development of peak bone mass ≠ nutrition/exercise Adult Bone: Women's reproductive choices ≠ oral contraceptives, pregnancy, lactation Menopause: Biology

  10. Novel Techniques for High-Resolution Functional Imaging of Trabecular Bone

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    associated with osteoporosis (1, 2). Osteoporosis results in bone loss and deterioration in trabecular a primary endpoint in osteoporosis diagnosis and monitoring. Where strong correlations between bone density

  11. Bone Growth, Maintenance and Loss in the Neolithic Community of «atalhŲyŁk, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Interpreting Bone Loss and Osteoporosis in Past Populations.2005. How many women have osteoporosis? Journal of Bone and1987. Postmenopausal osteoporosis: single screening method

  12. In Vivo Evaluation of the Presence of Bone Marrow in Cortical Porosity in Postmenopausal Osteopenic Women

    E-Print Network [OSTI]

    Goldenstein, Janet; Kazakia, Galateia; Majumdar, Sharmila

    2010-01-01T23:59:59.000Z

    bone resorption in osteoporosis. Calcif. Tissue Int. Augat,Porosity in Women with Osteoporosis. Vienna, Austria:porosity in women with osteoporosis. J. Bone Miner. Res.

  13. Verrucous carcinoma of the foot affecting the bone: Utility of the computed tomography scanner

    E-Print Network [OSTI]

    GarcŪa-GavŪn, J; GonzŠlez-Vilas, D; RodrŪguez-Pazos, L; SŠnchez-Aguilar, D; Toribio, J

    2010-01-01T23:59:59.000Z

    Frassica FJ, Fishman EK. Computed tomography of the bones ofbone: Utility of the computed tomography scanner J GarcŪa-of bone invasion. Computed tomography (CT) showed a lytic

  14. Controlling the Bone Marrow Dynamics in Cancer Chemotherapy

    E-Print Network [OSTI]

    Ledzewicz, Urszula

    Professor Award 1 #12;find optimal strategies for chemotherapy treatments of the cancer, where Controlling the Bone Marrow Dynamics in Cancer Chemotherapy Urszula Ledzewicz1 and Heinz Sch In the paper a mathematical model for the growth of the bone marrow under cell-cycle specific cancer

  15. Microcapsule-Induced Toughening of Bone Cement Gina M. Miller

    E-Print Network [OSTI]

    Sottos, Nancy R.

    27 Microcapsule-Induced Toughening of Bone Cement Gina M. Miller Senior in Aerospace Engineering R. White, and TAM Prof. Nancy R. Sottos Acrylic bone cement is the primary material used cement, it may be possible to extend the lifetime of the implant, thus reducing the occurrence

  16. Therapeutic Agents for the Prevention and Restoration of Bone Mass

    E-Print Network [OSTI]

    Slatton, Clint

    osteoporosis-related bone loss. According to the National Osteoporosis Foundation, osteoporosis is a major osteoporosis Advantages ∑ Selectively blocks osteoclastic bone resorption by a novel mechanism, providing in post-menopausal women. This ultimately leads to fractures resulting from minimal falls and accidents

  17. Bone motion analysis from dynamic MRI: acquisition and tracking

    E-Print Network [OSTI]

    Gilles, Benjamin

    overload, impingement or femoral head instability. For both the diagnosis and the surgical planningBone motion analysis from dynamic MRI: acquisition and tracking Benjamin Gilles1 , Rosalind Perrin2 methods in order to auto- matically extract active bone kinematics from multi-slice real-time dy- namic

  18. Biomechanics in bone tissue engineering Dominique P. Pioletti*

    E-Print Network [OSTI]

    Guerraoui, Rachid

    such a procedure truly is, we report, in Figure 1(a), the particular case of a posterior surgical approachBiomechanics in bone tissue engineering Dominique P. Pioletti* Laboratory of Biomechanical 18 January 2010) Biomechanics may be considered as central in the development of bone tissue

  19. Protocadherin-7 induces bone metastasis of breast cancer

    SciTech Connect (OSTI)

    Li, Ai-Min [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China)] [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China); Tian, Ai-Xian [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Zhang, Rui-Xue [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China)] [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China); Ge, Jie [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Sun, Xuan [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Cao, Xu-Chen, E-mail: caoxuch@126.com [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)

    2013-07-05T23:59:59.000Z

    Highlights: ēPCDH7 is overexpression in high bone metastatic MDA-MB-231 cells. ēPCDH7 is up-regulation in bone metastatic breast cancer tissues. ēSuppression of PCDH7 inhibits cell proliferation, migration, and invasion in vitro. ēPCDH7 induces breast cancer bone metastasis in vivo. -- Abstract: Breast cancer had a propensity to metastasize to bone, resulting in serious skeletal complications associated with poor outcome. Previous study showed that Protocadherin-7 (PCDH7) play an important role in brain metastatic breast cancer, however, the role of PCDH7 in bone metastatic breast cancer has never been explored. In the present study, we found that PCDH7 expression was up-regulation in bone metastatic breast cancer tissues by real-time PCR and immunohistochemistry assays. Furthermore, suppression of PCDH7 inhibits breast cancer cell proliferation, migration, and invasion in vitro by MTT, scratch, and transwell assays. Most importantly, overexpression of PCDH7 promotes breast cancer cell proliferation and invasion in vitro, and formation of bone metastasis in vivo. These data provide an important insight into the role of PCDH7 in bone metastasis of breast cancer.

  20. On the Estimation of Bone Status Rasmus Paulsen

    E-Print Network [OSTI]

    Osteoporosis Diagnostics. The subject of this thesis is medical image analysis with special attention to X Reinhold Paulsen Keywords Osteoporosis, bone status, radius, contact radiographs, cortical geometry, en algorithm developed by Torsana Osteoporosis Diagnostics. A simulated bone is made by simulated x

  1. A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone Marrow Mesenchymal Stem Cell Transplantation

    E-Print Network [OSTI]

    Miga, Michael I.

    A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone generation, and an iterative optimization (using finite element analysis) of the fracture callus material approach includes acquisition of microCT image volumes, biomechanical testing, finite element mesh

  2. Exchange-Spring Magnets: Nanocomposite Exchange-Spring Magnets for Motor and Generator Applications

    SciTech Connect (OSTI)

    None

    2012-01-01T23:59:59.000Z

    REACT Project: ANL will develop a cost-effective exchange-spring magnet to use in the electric motors of wind generators and EVs that uses no rare earth materials. This ANL exchange-spring magnet combines a hard magnetic outer shell with a soft magnetic inner coreócoupling these together increases the performance (energy density and operating temperature). The hard and soft magnet composite particles would be created at the molecular level, followed by consolidation in a magnetic field. This process allows the particles to be oriented to maximize the magnetic properties of low-cost and abundant metals, eliminating the need for expensive imported rare earths. The ultimate goal of this project is to demonstrate this new type of magnet in a prototype electric motor.

  3. Analysis of geothermal electric-power generation at Big Creek Hot Springs, Lemhi County, Idaho

    SciTech Connect (OSTI)

    Struhsacker, D.W. (ed.)

    1981-01-01T23:59:59.000Z

    Big Creek Hot Springs was evaluated as a source of electrical power for the Blackbird Cobalt Mine, approximately 13 miles south of the hot spring. An evaluaton of the geothermal potential of Big Creek Hot Springs, a suggested exploration program and budget, an engineering feasibility study of power generation at Big Creek Hot Springs, an economic analysis of the modeled power generating system, and an appraisal of the institutional factors influencing development at Big Creek Hot Springs are included.

  4. Macroarthropod communities of Sandy Springs of East Texas

    E-Print Network [OSTI]

    Gibson, James Randall

    2000-01-01T23:59:59.000Z

    Pag&e C27 Invertcb& ate 1'auna of Boykin Springs. Jasper CO, TX, May 21, 1995, 140 C28 Irn&ertebrate fauna of Red Hills Lake Spring, Sabine CO, TX, May 18. 1995. . 14 I C29 Physiochemical characteristics of temporary and stand&nh& v..., fast flowin? riffles The richness was high v ith both spring and second-order launa . 'jv?rueffu hlfur &to and ( ra&fufcgrrst& r nur& ufrrtu wet e both common at this site Three stoneflies genera, two mayfly genera, furceus sp and ('hevmalopEychc sp...

  5. A Tidal Hydrology Assessment for Reconnecting Spring Branch Creek to Suisun Marsh, Solano County CA: Predicting the Impact to the Federally Listed Plant Soft Bird's Beak

    E-Print Network [OSTI]

    Olson, Jessica J.

    2011-01-01T23:59:59.000Z

    population in Spring Branch Creek has experienced decline inand up the Spring Branch Creek gradient on its own. Withor up the Spring Branch Creek gradient is necessary. 12

  6. Relation between hydrogen isotopic ratios of bone collagen and rain

    SciTech Connect (OSTI)

    Cormie, A.B.; Schwarcz, H.P. (McMaster Univ., Hamilton, Ontario (Canada)); Gray, J. (Univ. of Alberta, Edmonton (Canada))

    1994-01-01T23:59:59.000Z

    The hydrogen isotopic value ([delta]D) of deer bone collagen is related to both [delta]D of rain during the growing season and growing season relative humidity (RH). With correction for the effects of RH, bone [delta]D is related to growing season rain [delta]D in a simple manner with a slope of 1.0. This indicates that, with RH correction, there are no additional sources of bias in the [delta]D of bone due to unaccounted for biologic or climatic effects. Due to a low sensitivity of bone [delta]D to RH effects, both yearly and growing season rain [delta]D can be estimated with considerable accuracy (R = 0.97 and R = 0.96) from bone collagen [delta]D and [delta][sup 15]N. Here, [delta][sup 15]N is used to correct bone [delta]D for the effects of RH. From these estimates of rain [delta]D, it may then be possible to evaluate temperature since the [delta]D of rain primarily reflects local temperature. Therefore, the measurement of bone collagen [delta]D has good potential for evaluating paleoclimates.

  7. The effects of low environmental cadmium exposure on bone density

    SciTech Connect (OSTI)

    Trzcinka-Ochocka, M., E-mail: ochocka@imp.lodz.pl [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Jakubowski, M. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Szymczak, W. [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland) [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland); Insitute of Psychology, University of Lodz (Poland); Janasik, B.; Brodzka, R. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)

    2010-04-15T23:59:59.000Z

    Recent epidemiological data indicate that low environmental exposure to cadmium, as shown by cadmium body burden (Cd-U), is associated with renal dysfunction as well as an increased risk of cadmium-induced bone disorders. The present study was designed to assess the effects of low environmental cadmium exposure, at the level sufficient to induce kidney damage, on bone metabolism and mineral density (BMD). The project was conducted in the area contaminated with cadmium, nearby a zinc smelter located in the region of Poland where heavy industry prevails. The study population comprised 170 women (mean age=39.7; 18-70 years) and 100 men (mean age=31.9; 18-76 years). Urinary and blood cadmium and the markers of renal tubular dysfunction ({beta}{sub 2}M-U RBP, NAG), glomerular dysfunction (Alb-U and {beta}{sub 2}M-S) and bone metabolism markers (BAP-S, CTX-S) as well as forearm BMD, were measured. The results of this study based on simple dose-effect analysis showed the relationship between increasing cadmium concentrations and an increased excretion of renal dysfunction markers and decreasing bone density. However, the results of the multivariate analysis did not indicate the association between exposure to cadmium and decrease in bone density. They showed that the most important factors that have impact on bone density are body weight and age in the female subjects and body weight and calcium excretion in males. Our investigation revealed that the excretion of low molecular weight proteins occurred at a lower level of cadmium exposure than the possible loss of bone mass. It seems that renal tubular markers are the most sensitive and significant indicators of early health effects of cadmium intoxication in the general population. The correlation of urinary cadmium concentration with markers of kidney dysfunction was observed in the absence of significant correlations with bone effects. Our findings did not indicate any effects of environmental cadmium exposure on bone density.

  8. Processing of hydroxylapatite coatings on titanium alloy bone prostheses

    DOE Patents [OSTI]

    Nastasi, Michael A. (Espanola, NM); Levine, Timothy E. (Santa Clara, CA); Mayer, James W. (Phoenix, AZ); Pizziconi, Vincent B. (Phoenix, AZ)

    1998-01-01T23:59:59.000Z

    Processing of hydroxylapatite sol-gel films on titanium alloy bone prostheses. A method utilizing non-line-of-sight ion beam implantation and/or rapid thermal processing to provide improved bonding of layers of hydroxylapatite to titanium alloy substrates while encouraging bone ingrowth into the hydroxylapatite layers located away from the substrate, is described for the fabrication of prostheses. The first layer of hydroxylapatite is mixed into the substrate by the ions or rapidly thermally annealed, while subsequent layers are heat treated or densified using ion implantation to form layers of decreasing density and larger crystallization, with the outermost layers being suitable for bone ingrowth.

  9. Term: Fall 2012 Spring 2013 University of Pittsburgh

    E-Print Network [OSTI]

    Sibille, Etienne

    Term: Fall 2012 ­ Spring 2013 1 University of Pittsburgh HOUSING/DINING SERVICES CONTRACT This Housing/Dining Services Contract (this "Contract") is made by and between the University of Pittsburgh

  10. Term: Fall 2011 Spring 2012 University of Pittsburgh

    E-Print Network [OSTI]

    Sibille, Etienne

    Term: Fall 2011 ­ Spring 2012 1 University of Pittsburgh HOUSING/DINING SERVICES CONTRACT This Housing/Dining Services Contract (this "Contract") is made by and between the University of Pittsburgh

  11. Department of Mechanical Engineering Spring 2011 Nanoparticle Reactor Automation

    E-Print Network [OSTI]

    Demirel, Melik C.

    PENNSTATE Department of Mechanical Engineering Spring 2011 Nanoparticle Reactor Automation Overview would be fully automated and able to run overnight. The team was also asked to keep the solutions from

  12. BEE 200. The BEE Experience Spring Semester 2007

    E-Print Network [OSTI]

    Walter, M.Todd

    BEE 200. The BEE Experience Spring Semester 2007 J A Bartsch, PE, 06/28/2007 Credit: 1 hour and date: James A. Bartsch, 6/28/07 Ethical behavior statement: The expectation for ethical behavior

  13. Sulphur Springs Valley EC- SunWatts Loan Program

    Broader source: Energy.gov [DOE]

    Sulphur Springs Valley Electric Cooperative (SSVEC) has a loan program that allows its members to finance a portion of a photovoltaic (PV) or small wind system. Loans are available in an amount of...

  14. A Preliminary Study Of Older Hot Spring Alteration In Sevenmile...

    Open Energy Info (EERE)

    hydrothermal activity has been ongoing since at least that time. A northwest-trending linear array of extinct and active hot spring centers in the Sevenmile Hole area implies a...

  15. Detecting environmental impacts on metapopulations of mound spring invertebrates

    E-Print Network [OSTI]

    Queensland, University of

    Detecting environmental impacts on metapopulations of mound spring invertebrates Assessing environmental impacts on metapopulations. We assume that the probability of colonisation decreases to detect environmental impacts on metapopulations with small numbers of patches. D 2001 Elsevier Science

  16. Ground Gravity Survey At Neal Hot Springs Geothermal Area (U...

    Open Energy Info (EERE)

    Hot Springs. Data from these surveys will be integrated with older data from Chevron Minerals 1979 drill hole. Notes The gravity survey covered an area of approximately 34 km2...

  17. Scientific Drilling at Sulphur Springs, Valles Caldera, New Mexico...

    Open Energy Info (EERE)

    navigation, search OpenEI Reference LibraryAdd to library Journal Article: Scientific Drilling at Sulphur Springs, Valles Caldera, New Mexico- Core Hole VC-2A Abstract A scientific...

  18. Spring Forward and Start Saving Money | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    has begun, and as millions around the world prepare to "spring forward" one hour for Daylight Saving Time on March 10th, you might consider this as an opportunity to also save...

  19. Syllabus for Spring 2014! Environmental Values, Movements, and Policy!

    E-Print Network [OSTI]

    Delaware, University of

    Syllabus for Spring 2014! ! Environmental Values, Movements, and Policy! MAST 692-010 and UAPP 692, Viewing the World Ecologically. Boulder, CO: Westview Press. (On reserve) ! SYLLABUS ! Most weeks

  20. air springs: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6430 EXPERIMENTAL METHODS IN AIR QUALITY Spring 2012 Prof. Mike Bergin, Prof. Rodney Weber Scattering and Absorption by 2) Calibration of an Optical Particle Counter Aerosol 6-7...

  1. JLab announces two Spring Science Series events - topics include...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Lab's 2006 Spring Science Series kicks off at 7 p.m. on Tuesday, Feb. 21, in the CEBAF Center auditorium with astronomer, teacher and author Jeffrey Bennett from the...

  2. Jefferson Lab's Spring Science Series kicks off with Feb. 13...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Feb. 13 event February 9, 2001 Jefferson Lab's Spring Science Series kicks off in the CEBAF Center auditorium at 7 p.m., Tuesday, Feb. 13. Dog trainer Marilyn Sanders will...

  3. SPRING 2012 STUDY ABROAD in CAPE TOWN, SOUTH AFRICA

    E-Print Network [OSTI]

    Alpay, S. Pamir

    SPRING 2012 STUDY ABROAD in CAPE TOWN, SOUTH AFRICA Want to find out studying the multiple concerns facing South Africa as it strives to become one. Take three academically engaging courses: The History & Politics of South Africa

  4. Fast Simulation of Mass-Spring Systems Tiantian Liu

    E-Print Network [OSTI]

    Plotkin, Joshua B.

    ) springs. We express the widely used implicit Euler method as an energy minimization problem and introduce for subsequent Newton's iteration. CR Categories: I.3.7 [Computer Graphics]: Three-Dimensional Graphics

  5. Design of repeating projectile toy based on bistable spring propulsion

    E-Print Network [OSTI]

    Blanco, Matthew C. (Matthew Corwin)

    2007-01-01T23:59:59.000Z

    Recently, bistable springs have been proven as a viable propulsion method for the standard 1.75" foam balls used in Nerfģ projectile toys. This technology was developed at M.I.T. by William Fienup and Barry Kudrowitz, who ...

  6. Geology and Geothermal Potential of the Roosevelt Hot Springs...

    Open Energy Info (EERE)

    Area, Beaver County, Utah Jump to: navigation, search OpenEI Reference LibraryAdd to library Thesis: Geology and Geothermal Potential of the Roosevelt Hot Springs Area, Beaver...

  7. Abraham Hot Springs Geothermal Area Northern Basin and Range...

    Open Energy Info (EERE)

    Brophy br Model br Moeck br Beardsmore br Type br Volume br Geothermal br Region Mean br Reservoir br Temp br Mean br Capacity Abraham Hot Springs Geothermal Area Northern Basin...

  8. Department of Bioengineering Spring 2013 Next Generation Hygiene System

    E-Print Network [OSTI]

    Demirel, Melik C.

    PENNSTATE Department of Bioengineering Spring 2013 Next Generation Hygiene System Overview the composition of the solution. The next generation hygiene system, similar to existing industrial systems, uses. However, the next generation hygiene system overcomes several drawbacks found in existing systems

  9. Chemistry Of Thermal And Nonthermal Springs In The Vicinity Of...

    Open Energy Info (EERE)

    Hot Springs, and in the south-central part of LVNP in the Walker "O" No. 1 well at Terminal Geyser are rich in chloride and yield calculated geothermometer temperatures between...

  10. Thermal Gradient Holes At Neal Hot Springs Geothermal Area (U...

    Open Energy Info (EERE)

    U.S. Geothermal Inc. (2010) Idaho Public Utilities Commission Approves Neal Hot Springs Power Purchase Agreement U.S. Geothermal Inc. (2009) U.S. Geothermal Starts New Drilling...

  11. Ecology, Evolution and Behavior Seminar Series Spring Semester 2013

    E-Print Network [OSTI]

    Virginia Tech

    Ecology, Evolution and Behavior Seminar Series Spring Semester 2013 All Hilu February 28 Robert Cox University of Virginia The ecology and physiology Christine May James Madison Unv. Disturbance ecology: linking stream communities

  12. Microsoft Word - JockoSpringCreek_Scott_Acquisition_CX_Final...

    Broader source: Energy.gov (indexed) [DOE]

    purchase of Jocko Spring Creek Property. Fish and Wildlife Project No.: 2002-003-00, Contract BPA-44646 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021):...

  13. PHY 3003 SPRING 2014 Week of April 14

    E-Print Network [OSTI]

    Millis, Andrew

    . (Numbers refer to problems in Classical Mechanics, J. R. Taylor, 2005 Edition). (1) 11.2 (2) 11.4 (3) 11PHY 3003 SPRING 2014 Week of April 14 Reading: Taylor, Chapter 11 Homework: Due in class April 21

  14. Dean's List Spring 2011 Harpur College of Arts and Sciences

    E-Print Network [OSTI]

    Suzuki, Masatsugu

    Dean's List Spring 2011 Harpur College of Arts and Sciences Abbate, Jennifer A. Abdel-Jawad, Nadeem. Auwarter, John J. Avery, Corey P. Avila, Moraina M. Axelson, Aaron P. Ba, Oulimata J. Bac, Hay Rang

  15. Adjustable Nonlinear Springs to Improve Efficiency of Vibration Energy Harvesters

    E-Print Network [OSTI]

    S. Boisseau; G. Despesse; B. Ahmed Seddik

    2015-06-01T23:59:59.000Z

    Vibration Energy Harvesting is an emerging technology aimed at turning mechanical energy from vibrations into electricity to power microsystems of the future. Most of present vibration energy harvesters are based on a mass spring structure introducing a resonance phenomenon that allows to increase the output power compared to non-resonant systems, but limits the working frequency bandwidth. Therefore, they are not able to harvest energy when ambient vibrations' frequencies shift. To follow shifts of ambient vibration frequencies and to increase the frequency band where energy can be harvested, one solution consists in using nonlinear springs. We present in this paper a model of adjustable nonlinear springs (H-shaped springs) and their benefits to improve velocity-damped vibration energy harvesters' (VEH) output powers. A simulation on a real vibration source proves that the output power can be higher in nonlinear devices compared to linear systems (up to +48%).

  16. Microsoft Word - PR 12 13 Hooper Springs DEIS Public Meeting

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 13 BONNEVILLE POWER ADMINISTRATION FOR IMMEDIATE RELEASE Wednesday, March 20, 2013 CONTACT: Teresa Waugh, 503-230-7536 or 503-230-5131 BPA releases Hooper Springs Transmission...

  17. BYU Merit Badge PowWow Spring 2014

    E-Print Network [OSTI]

    Olsen Jr., Dan R.

    BYU Merit Badge PowWow Spring 2014 Saturday, March 15 and Saturday, March 29 Join us for our PowWow in the World Coin Collecting Communications Crime Prevention Disabilities Awareness Energy & Engineering

  18. Design and analysis of large deformation spiral springs

    E-Print Network [OSTI]

    Pisor, Robert Donald

    1996-01-01T23:59:59.000Z

    This thesis presents the analysis, design and construction of spiral springs for use in the Microgravity Simulator at Phillips Laboratory at Kirkland AFB in New Mexico. A finite element analysis to determine the behavior of three different length...

  19. Chemical and Isotopic Composition of Casa Diablo Hot Spring:...

    Open Energy Info (EERE)

    Composition of Casa Diablo Hot Spring: Magmatic CO2 near Mammoth Lakes, CA Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Paper: Chemical and...

  20. SPRING 2003 C I R AC I R A

    E-Print Network [OSTI]

    Collett Jr., Jeffrey L.

    of Defense ģ 11 8 #12;3 A Cloud Hangs Over Iraq In the Spring 2002 issue of the CIRA magazine, Ken Eis is negotiable based on experience, qualifications, and funding support. The program is open to scientists of all

  1. Department of Mechanical and Aerospace Engineering Updated: Spring 2012

    E-Print Network [OSTI]

    Krstic, Miroslav

    Department of Mechanical and Aerospace Engineering Updated: Spring 2012 MECHANICAL ENGINEERING TECHNICAL ELECTIVES Mechanical Engineering Majors are required to complete four (4) Technical Electives Century Energy Technologies II MAE 135 Computational Mechanics MAE 180A Spacecraft Guidance MAE 181 Space

  2. Math 204 Elementary Linear Algebra Spring 2012 Instructor Amites Sarkar

    E-Print Network [OSTI]

    Sarkar, Amites

    Math 204 Elementary Linear Algebra Spring 2012 Instructor Amites Sarkar Text Linear Algebra and its and Fridays, in 216 Bond Hall. My phone number is 650 7569 and my e-mail is amites.sarkar@wwu.edu Course

  3. Math 209 Discrete Mathematics Spring 2008 Instructor Amites Sarkar

    E-Print Network [OSTI]

    Sarkar, Amites

    Math 209 Discrete Mathematics Spring 2008 Instructor Amites Sarkar Text Discrete Mathematics, Tuesdays, Thursdays and Fridays, in 216 Bond Hall. My phone number is 650 7569 and my e-mail is amites.sarkar

  4. Math 209 Discrete Mathematics Spring 2011 Instructor Dr. Amites Sarkar

    E-Print Network [OSTI]

    Sarkar, Amites

    Math 209 Discrete Mathematics Spring 2011 Instructor Dr. Amites Sarkar Text Discrete Mathematics, in 216 Bond Hall. My phone number is 650 7569 and my e-mail is amites.sarkar@wwu.edu #12;

  5. Math 304 Linear Algebra Spring 2013 Instructor Amites Sarkar

    E-Print Network [OSTI]

    Sarkar, Amites

    Math 304 Linear Algebra Spring 2013 Instructor Amites Sarkar Text Linear Algebra and its, Tuesdays, Thursdays and Fridays, in 216 Bond Hall. My phone number is 650 7569 and my e-mail is amites.sarkar

  6. Chemistry of spring and well waters on Kilauea Volcano, Hawaii...

    Open Energy Info (EERE)

    the chemistry of dilute meteoric water, mixtures with sea water,and thermal water. Data for well and spring samples of non-thermal water indicate that mixing with sea water...

  7. Syllabus for MATH 362 Spring 2015: Topics in Vector Calculus

    E-Print Network [OSTI]

    2014-12-23T23:59:59.000Z

    Page 1. Syllabus for MATH 362 Spring 2015: Topics in Vector Calculus. Alex Misiats omisiats@purdue.edu. December 23, 2014. Lectures: MWF, 12:30 - 1:20

  8. ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone

    E-Print Network [OSTI]

    Price, Paul A.

    ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone Po-Yu Chen ∑ Damon the hierarchical structure of mineral in mature bone. A method to completely deproteinize bone without altering of mineral and protein constituents. SEM revealed that bone minerals are fused together and form a sheet

  9. Interactive Separation of Segmented Bones in CT Volumes Using Graph Cut

    E-Print Network [OSTI]

    Ju, Tao

    mask customized to the shape of the bone, such as the femoral head. However, creat- ing masks for bones of different methodology have been reported for bone segmen- tation (see a recent survey in [1]). DueInteractive Separation of Segmented Bones in CT Volumes Using Graph Cut Lu Liu, David Raber, David

  10. Bone density and geometry in juvenile racehorses fed differing amounts of minerals

    E-Print Network [OSTI]

    Nolan, Meghan Muire

    2002-01-01T23:59:59.000Z

    designed as low, moderate, moderately high and high. Radiographs of the third metacarpal (MCIII) were taken on day 0, 28, 60, 92 and 124 to evaluate change in bone density and bone geometry. Bone density was expressed as radiographic bone aluminum...

  11. Computer modeling approach for microsphere-packed bone scaffold Pallavi Lal, Wei Sun*

    E-Print Network [OSTI]

    Sun, Wei

    bone graft [5,6], for structural and human cellular assessment of scaffolds for bone repair [7 modeling approach for constructing a three-dimensional microsphere-packed bone graft structure is presented packing model to determine the number of microspheres packed in a synthesized bone graft. The pore size

  12. Prediction of the elastic modulus of the trabecular bone based on X-ray computed tomography

    E-Print Network [OSTI]

    Paris-Sud XI, Universitť de

    . INTRODUCTION The investigation of the mechanical properties of trabe- cular bone presents a major challenge

  13. Fossil fish studies

    E-Print Network [OSTI]

    Chorn, John; Reavis, E. A.; Stewart, J. D.; Whetstone, K. N.

    1978-02-17T23:59:59.000Z

    MEMBER EAGLE SANDSTONE SHARON SPRINGS MEMBER MOOREVILLE FORMATION GAMMON FERRUGINOUS MEMBER * AUSTIN GROUP * TOMBIGBEE SAND ----\\ 7-- MEMBER NIOBRARA FORMATION TELEGRAPH CREEK FORMATION SANTONIAN EUTAW FORMATION COLORADO SHALE FIG. 7. Generalized corr... MEMBER EAGLE SANDSTONE SHARON SPRINGS MEMBER MOOREVILLE FORMATION GAMMON FERRUGINOUS MEMBER * AUSTIN GROUP * TOMBIGBEE SAND ----\\ 7-- MEMBER NIOBRARA FORMATION TELEGRAPH CREEK FORMATION SANTONIAN EUTAW FORMATION COLORADO SHALE FIG. 7. Generalized corr...

  14. Prof. Alexandru Suciu MTH 1230 LINEAR ALGEBRA Spring 2001

    E-Print Network [OSTI]

    Prof. Alexandru Suciu MTH 1230 LINEAR ALGEBRA Spring 2001 EXAM 3 1. 10 pts Consider the independent 2001 2. 12 points Let A = -3 4 9 -12 . (a) Find a basis for ker A. (b) Find a basis for (ker A) . (c) Find a basis for ker A . (d) Find a basis for (ker A ) . #12;MTH 1230 Exam 3 Spring 2001 3. 8 points

  15. EINSTEINSpring 2007 spring 2007 I EinstEin

    E-Print Network [OSTI]

    Yates, Andrew

    ;spring 2007 I EinstEin eInSTeInCONTENTs 3 A meSSAge from the deAn 4 Children with AidS: the remarkableSiCiAn Ben Brody, Class of 2007 32 newS from the lAbS 35 Around the CAmpuS 26 22 14 4 3 Spring 2007 eInSTeIn: A publication for faculty, students, alumni, friends and supporters of the Albert einstein College of Medicine

  16. Hot Springs Metropolitan Planning Organization 2030 Long Range Transportation Plan

    E-Print Network [OSTI]

    Hot Springs Metropolitan Planning Organization

    2005-11-03T23:59:59.000Z

    Federal Highway Administration Federal Transit Administration 2030 Long Range Transportation Plan for the Hot Springs Area Metropolitan Planning Organization This LRTP has been funded with federal Metropolitan Planning (PL) funds through... the Federal Highway Administration, Section 5303 funds through the Federal Transit Administration, the State of Arkansas, and participating agency local match funds. HSA-MPO 100 Broadway Terrace Hot Springs, AR 71901 501-321-4804 HSA...

  17. Recovery of Carboxylic Acids from Fermentation Broth via Acid Springing

    E-Print Network [OSTI]

    Dong, Jipeng

    2010-01-14T23:59:59.000Z

    RECOVERY OF CARBOXYLIC ACIDS FROM FERMENTATION BROTH VIA ACID SPRINGING A Thesis by JIPENG DONG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE December 2008 Major Subject: Chemical Engineering RECOVERY OF CARBOXYLIC ACIDS FROM FERMENTATION BROTH VIA ACID SPRINGING A Thesis by JIPENG DONG Submitted to the Office of Graduate Studies of Texas A...

  18. DEPOSITIONAL FACIES AND AQUEOUS-SOLID GEOCHEMISTRY OF TRAVERTINE-DEPOSITING HOT SPRINGS (ANGEL TERRACE, MAMMOTH HOT SPRINGS, YELLOWSTONE NATIONAL PARK, U.S.A.)

    E-Print Network [OSTI]

    Farmer, Jack D.

    include hot spring travertine (precipitates from high-temperature springs, also called carbonate sinters spring water in the higher-temperature (-50-73¬įC) depositional facies. Conversely, travertine from waters in low- to high- * Present Address: Department of Geology, Arizona State University, Box

  19. Evaluation of radionuclide bone-imaging for the early detection of sepsis in a model of equine neonatal osteomyelitis

    E-Print Network [OSTI]

    Taylor, James Rutledge

    1986-01-01T23:59:59.000Z

    method of detecting bone abnormalities. The two main factors determining the degree of radiopharmaceutical uptake in bones, and thereby assessing the functional integrity of bone, have been identified as bone blood flow and bone turnover rates.... The resultant infection and induced metabolic changes should produce a positive Technetium-99m MDP ( Tc-MDP) 99m bone scan, a positive scan using Indium-111-oxine labeled leukocytes and radiographic changes characterized by decreased bone density . Seven...

  20. autotaxin controls bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Bykowski; Johnny Huard, Ph.D.; Lee E. Weiss, Ph.D.; Joseph E. Losee; Phil G. Campbell, Ph.D. 3 Akt1 in Osteoblasts and Osteoclasts Controls Bone Remodeling University of Kansas -...

  1. On the Mechanistic Origins of Toughness in Bone

    E-Print Network [OSTI]

    Launey, Maximilien E.

    One of the most intriguing protein materials found in nature is bone, a material composed of assemblies of tropocollagen molecules and tiny hydroxyapatite mineral crystals that form an extremely tough, yet lightweight, ...

  2. Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics

    E-Print Network [OSTI]

    Vuik, Kees

    Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics E.M.van Aken 1107895 of the joint and to relieve the pain, a prosthesis to replace the glenoid of the shoulder joint is an option

  3. affects bone tissue: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  4. acute bone marrow: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  5. abnormal bone growth: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  6. abnormally high bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  7. acute bone crises: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  8. anorganic bone clinical: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  9. abnormal bone development: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  10. absorptiometry bone densitometer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  11. alveolar bone cells: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  12. acute bone infarcts: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  13. acellular bone explants: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  14. adverse events bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    marrow disease Daldrup-Link, H E; Henning, T; Link, T M 2007-01-01 316 Bone loss during energy restriction: mechanistic role of leptin Texas A&M University - TxSpace Summary:...

  15. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, James W. (108 Independent Blvd., Aiken, SC 29801)

    1993-01-01T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  16. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-06-08T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  17. ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone

    E-Print Network [OSTI]

    Ritchie, Robert

    ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone in adult rats /Accepted: 3 September 2013 /Published online: 11 April 2014 # International Osteoporosis Foundation and National Osteoporosis Foundation 2014 Abstract Summary We used an osteopenic adult ovariectomized (OVX) rat

  18. areal bone mineral: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2.2.4 Risk factors 22 2.2.5 Morbidity and mortality 23 2.3 Units Laughlin, Robert B. 103 Rare earth element systematics of fossil bone revealed by LA-ICPMS analysis Environmental...

  19. Modular ĎClick-in-Emulsioní Bone-Targeted Nanogels

    E-Print Network [OSTI]

    Heller, Daniel A.

    A new class of nanogel demonstrates modular biodistribution and affinity for bone. Nanogels, ~70 nm in diameter and synthesized via an astoichiometric click-chemistry in-emulsion method, controllably display residual, free ...

  20. Children cortical bone characterisation: the ultrasonic J.-P. Berteaua

    E-Print Network [OSTI]

    Boyer, Edmond

    infantile osteo-pathologies. That is why there is a strong interest in the characterisation of the growing specific location (close to cancerous cells) or cadaveric bone. They indicate a lower Young's modulus

  1. Trabecular bone dosimetry using a Monte Carlo code

    E-Print Network [OSTI]

    Zuzarte de Mendonca, Anne

    1993-01-01T23:59:59.000Z

    The nuclear medicine community needs radiation ~ dose estimates to patients who are administered radiopharmaceuticals for therapy or diagnosis. These estimates should be as accurate as possible for any organ, and especially for the bone since the bone... of Nuclear Medicine formed a committee to fulfill the needs of the nuclear medicine community to determine the radiation absorbed dose to patients who are athninistered radiopharmaceuticals. The objectives of the Medical Internal Radiation Dose Committee...

  2. A Conceptual Restoration Plan and Tidal Hydrology Assessment for Reconnecting Spring Branch Creek to Suisun Marsh, Solano County, California

    E-Print Network [OSTI]

    Olson, Jessica J.

    2012-01-01T23:59:59.000Z

    for Reconnecting Spring Branch Creek to Suisun Marsh, SolanoFramework CHAPTER 2. SPRING BRANCH CREEK SITE ASSESSMENT 2.1Model for Spring Branch Creek Following Reconnection CHAPTER

  3. Yakima River Spring Chinook Enhancement Study, 1987 Annual Report.

    SciTech Connect (OSTI)

    Fast, David E.

    1988-01-01T23:59:59.000Z

    The smelt outmigration was monitored at wapatox on the Naches River and Prosser on the lower Yakima. The spring outmigration at Wapatox was estimated to be 16,141 smolts. The 1987 spring outmigration of wild spring chinook from the Yakima Basin was estimated to be 251,975 smolts at Prosser. The survival from egg to smelt was calculated using the 1985 redd counts and the 1987 smolt outmigration at Prosser. The estimated survival was 4.16%, which gives a mean egg to smolt survival over four years of 6.32%. In 1987 a total of 3,683 adult and 335 jack spring chinook salmon returning to the Yakima River were counted at Prosser fish ladder. This gives a total of 4,018 salmon returning to Prosser Dam. The median dates of passage were May 12 and May 16 for adults and jacks respectively. An additional 372 fish were estimated to have been caught in the Yakima River subsistence dipnet fishery below Horn Rapids and Prosser Dams. Therefore, total return to the Yakima system was 4,390 spring chinook salmon. Spring chinook were counted at Roza Dam from May 1 to September 30, 1987. Passage at Roza Dam was 1,610 adult and 67 jack spring chinook for a total of 1,677 wild fish. The median dates of passage at Roza Dam were May 29 and May 26 for spring chinook adults and jacks respectively. The smolt to adult (S{sub sa}) survival was calculated based on the 1983 smelt outmigration estimated at Prosser and the 1984 return of jacks (3 year old fish) the 1985 return of four year old adults, and the 1986 return of five year old fish to the Yakima River. It was estimated that 6,012 wild three, four, and five year old fish returned from an estimated smolt outmigration of 135,548 fish in 1983. This gives an estimated survival from smolt to adult of 4.4%. The smolt to adult survival for the 1984 smolt outmigration was 5.3% with 423 jacks returning in 1985, 5,163 four year old adults returning in 1986, and 983 five year old fish returning in 1987 fran an estimated 123,732 smolts in 1984. Spring chinook adults from fourteen different hatchery release groups were recovered in 1987. A total of 211 coded wire tags were recovered and these were expanded to an estimated 253 returning hatchery fish in 1987. Nine of these fish were jacks.

  4. Structure and mechanics of the spasmoneme, a biological spring within the protozoan Vorticella convallaria

    E-Print Network [OSTI]

    France, Danielle Cook

    2007-01-01T23:59:59.000Z

    Molecular springs have recently emerged as the basis for the fastest and most powerful movements at the cellular level in biology. The spasmoneme of the protozoan, Vorticella convallaria, is a model molecular spring, relying ...

  5. Office of Graduate Studies Dissertation Fellowship Nomination and Selection Process, Spring 2014 Awards Conditions

    E-Print Network [OSTI]

    Texas at Arlington, University of

    Office of Graduate Studies Dissertation Fellowship Nomination and Selection Process, Spring 2014 Awards Conditions: 1) Dissertation Fellowships will be awarded for and paid in Spring 2014 must have completed all formal course requirements. 4) Nominees must have an approved dissertation

  6. EA-1676: U.S. Geothermal's Neal Hot Springs Geothermal Facility...

    Office of Environmental Management (EM)

    6: U.S. Geothermal's Neal Hot Springs Geothermal Facility in Vale, OR EA-1676: U.S. Geothermal's Neal Hot Springs Geothermal Facility in Vale, OR December 1, 2009 EA-1676: Final...

  7. Math 550 (Section 1) University of South Carolina D. Meade Spring 1997

    E-Print Network [OSTI]

    Meade, Douglas B.

    Math 550 (Section 1) University of South Carolina D. Meade Spring 1997 Day One Questionnaire -- Math 550 (Spring 1997) ffl Personal Information Name Phone Number E­mail Address Major Year ffl

  8. Federal Technical Assistance Aims to Accelerate Tribal Energy Project Deployment, Spring 2013 (Newsletter)

    SciTech Connect (OSTI)

    Not Available

    2013-03-01T23:59:59.000Z

    This newsletter describes key activities of the DOE Office of Indian Energy Policy and Programs for Spring 2013.

  9. Arizona Apache Tribe Set to Break Ground on New Solar Project, Spring / Summer 2014 (Newsletter)

    SciTech Connect (OSTI)

    Not Available

    2014-03-01T23:59:59.000Z

    This newsletter describes key activities of the DOE Office of Indian Energy Policy and Programs for Spring / Summer 2014.

  10. An Index to LATR 16/1 (Fall 1982) to 20/2 (Spring 1987)

    E-Print Network [OSTI]

    Bruflat, Alan; Cohen, Deb

    1987-04-01T23:59:59.000Z

    ): 17. AR Betancourt, Helia. "El protocolo de JuliŠn Bravo (1599): primero contrato de una agrupaciůn teatral en Amťrica." 19/2 (Spring 1986): 17-22. MEX Beverido Duhalt, Francisco. "Teatro universitario en Mťxico." 18/2 (Spring 1985): 39-44. ME... Bissett, Judith I. "Constructing the Alternative Version: Vicente LeŮero's Documentary and Historical Drama." 18/2 (Spring 1985): 71-78. MEX Bissett, Judith Ishmael. "Delivering the Message: Gestus and Aguirre's Los papeleros." 17/2 (Spring 1984): 31...

  11. Geothermal Exploration in Hot Springs, Montana

    SciTech Connect (OSTI)

    Toby McIntosh, Jackola Engineering

    2012-09-26T23:59:59.000Z

    The project involves drilling deeper in the Camp Aqua well dri lled in June 1982 as part of an effort to develop an ethanol plant. The purpose of the current drill ing effort is to determine if water at or above 165√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬įF exists for the use in low temperature resource power generation. Previous geothermal resource study efforts in and around Hot Springs , MT and the Camp Aqua area (NE of Hot Springs) have been conducted through the years. A confined gravel aquifer exists in deep alluvium overlain by approximately 250√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬Ę√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬? of si lt and c lay deposits from Glacial Lake Missoula. This gravel aquifer overlies a deeper bedrock aquifer. In the Camp Aqua area several wel l s exist in the gravel aquifer which receives hot water f rom bedrock fractures beneath the area. Prior to this exploration, one known well in the Camp Aqua area penetrated into the bedrock without success in intersecting fractures transporting hot geothermal water. The exploration associated with this project adds to the physical knowledge database of the Camp Aqua area. The dri l l ing effort provides additional subsurface information that can be used to gain a better understanding of the bedrock formation that i s leaking hot geothermal water into an otherwise cold water aquifer. The exi s t ing well used for the explorat ion is located within the √?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬Ę√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?center√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬Ę√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬Ě of the hottest water within the gravel aquifer. This lent i t sel f as a logical and economical location to continue the exploration within the existing well. Faced with budget constraints due to unanticipated costs, changing dril l ing techniques stretched the limited project resources to maximize the overa l l well depth which f e l l short of original project goals. The project goal of finding 165√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬?√?¬įF or hotter water was not achieved; however the project provides additional information and understanding of the Camp Aqua area that could prove valuable in future exploration efforts

  12. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    and the epiphysis are wider than the diaphysis. Cortical bone is denser than trabecular bone as shown in Fig. 2.1b. In the overall adult human skeleton, the skeletal mass is 80% cortical bone and 20% trabecular bone (4). However, the distribution of cortical... surfaces. Moreover, they did not use the volume 6 Table 2.1. Summary of experimental results on trabecular bone from previous research Source Type of bone Size of specimen Carter & Hayes (3) Bovine, Human ?20.6x5mm Cylinder E =3790? 0.06 ? 3 , ? c...

  13. Yakima River Spring Chinook Enhancement Study, 1985 Annual Report.

    SciTech Connect (OSTI)

    Fast, David E.

    1986-02-01T23:59:59.000Z

    The purpose was to evaluate enhancement methodologies that can be used to rebuild runs of spring chinook salmon in the Yakima River basin. The objectives were to: (1) determine the abundance, distribution and survival of naturally produced fry and smolts in the Yakima River; (2) evaluate different methods of fry and smolt supplementation into the natural rearing environment while maintaining as much as possible the gentic integrity of naturally produced stocks; (3) locate and define areas in the watershed which may be used for the rearing of spring chinook; (4) define strategies for enhancing natural production of spring chinook in the Yakima River; and (5) determine physical and biological limitations for production within the system.

  14. Geologic report for the Weldon Spring Raffinate Pits Site

    SciTech Connect (OSTI)

    none,

    1984-10-01T23:59:59.000Z

    A preliminary geologic site characterization study was conducted at the Weldon Spring Raffinate Pits Site, which is part of the Weldon Spring Site, in St. Charles County, Missouri. The Raffinate Pits Site is under the custody of the Department of Energy (DOE). Surrounding properties, including the Weldon Spring chemical plant, are under the control of the Department of the Army. The study determined the following parameters: site stratigraphy, lithology and general conditions of each stratigraphic unit, and groundwater characteristics and their relation to the geology. These parameters were used to evaluate the potential of the site to adequately store low-level radioactive wastes. The site investigation included trenching, geophysical surveying, borehole drilling and sampling, and installing observation wells and piezometers to monitor groundwater and pore pressures.

  15. Paper ID #9719 Machine Design Experiments Using Mechanical Springs to Foster Discover

    E-Print Network [OSTI]

    Nagurka, Mark L.

    to manufacturer's supplied data). (4) Experimentally determining shear moduli and stiffnesses of wire and 3D printed springs. Investigating overextension limits of springs. Introduction For the typical undergraduate exposure may be in a physics course, where springs are modeled as idealized mechanical energy storage

  16. FW402 Syllabus Spring 2011 FW402 FISH CULTURE (4 CREDITS)

    E-Print Network [OSTI]

    FW402 Syllabus Spring 2011 1 FW402 ­ FISH CULTURE (4 CREDITS) SYLLABUS ­ SPRING 2011 I. Lecture) · Assigned readings (see end of syllabus) · Calculator III. Recommended Materials · Old clothes for lab Syllabus Spring 2011 2 for the first 5 weekdays--after that point, they will be worth a maximum of 50

  17. Weldon Spring Site Environmental Report for Calendar Year 1995

    SciTech Connect (OSTI)

    NONE

    1996-06-01T23:59:59.000Z

    This Weldon Spring Site Environmental Report for Calendar Year 1995 has been prepared to provide information about the public safety and environmental protection programs conducted by the Weldon Spring Site Remedial Action Project (WSSRAP). The Weldon Spring site is located in southern St. Charles County, Missouri, approximately 48 km (30 mi) west of St. Louis. The site consists of two main areas, the Weldon Spring Chemical Plant and raffinate pits and the Weldon Spring Quarry. The chemical plant, raffinate pits, and quarry are located on Missouri State Route 94, southwest of U.S. Route 40/61. The objectives of the Site Environmental Report are to present a summary of data from the environmental monitoring program, to characterize trends and environmental conditions at the site, and to confirm compliance with environmental and health protection standards and requirements. The report also presents the status of remedial activities and the results of monitoring these activities to assess their impacts on the public and environment. This report includes monitoring data from routine radiological and nonradiological sampling activities. These data include estimates of dose to the public from the Weldon Spring site, estimates of effluent releases, and trends in groundwater contaminant levels. Additionally, applicable compliance requirements, quality assurance programs, and special studies conducted in 1995 to support environmental protection programs are discussed. Dose estimates presented in this report are based on hypothetical exposure scenarios for public use of areas near the site. In addition, release estimates have been calculated on the basis of 1995 National Pollutant Discharge Elimination System (NPDES) and air monitoring data. Effluent discharges from the site under routine NPDES and National Emission Standards for Hazardous Air Pollutants (NESHAPs) monitoring were below permitted levels.

  18. Common variants in the region around Osterix are associated with bone mineral density and growth in childhood

    E-Print Network [OSTI]

    Peltonen, Leena

    Peak bone mass achieved in adolescence is a determinant of bone mass in later life. In order to identify genetic variants affecting bone mineral density (BMD), we performed a genome-wide association study of BMD and related ...

  19. Spectral analysis for semi-infinite mass-spring systems

    E-Print Network [OSTI]

    Rafael del Rio; Luis O. Silva

    2014-07-29T23:59:59.000Z

    We study how the spectrum of a Jacobi operator changes when this operator is modified by a certain finite rank perturbation. The operator corresponds to an infinite mass-spring system and the perturbation is obtained by modifying one interior mass and one spring of this system. In particular, there are detailed results of what happens in the spectral gaps and which eigenvalues do not move under the modifications considered. These results were obtained by a new tecnique of comparative spectral analysis and they generalize and include previous results for finite and infinite Jacobi matrices.

  20. Weldon Spring Site environmental report for calendar year 1993. Weldon Springs Site Remedial Action Project

    SciTech Connect (OSTI)

    Not Available

    1994-05-01T23:59:59.000Z

    This Site Environmental Report for Calendar Year 1993 describes the environmental monitoring programs at the Weldon Spring Site Remedial Action Project (WSSRAP). The objectives of these programs are to assess actual or potential exposure to contaminant effluents from the project area by providing public use scenarios and dose estimates, to demonstrate compliance with Federal and State permitted levels, and to summarize trends and/or changes in contaminant concentrations from environmental monitoring program. In 1993, the maximum committed dose to a hypothetical individual at the chemical plant site perimeter was 0.03 mrem (0.0003 mSv). The maximum committed dose to a hypothetical individual at the boundary of the Weldon Spring Quarry was 1.9 mrem (0.019 mSv). These scenarios assume an individual walking along the perimeter of the site-once a day at the chemical plant/raffinate pits and twice a day at the quarry-250 days per year. This hypothetical individual also consumes fish, sediment, and water from lakes and other bodies of water in the area. The collective dose, based on an effected population of 112,000 was 0.12 person-rem (0.0012 person-Sv). This calculation is based on recreational use of the August A. Busch Memorial Conservation Area and the Missouri Department of Conservation recreational trail (the Katy Trail) near the quarry. These estimates are below the U.S. Department of Energy requirement of 100 mrem (I mSv) annual committed effective dose equivalent for all exposure pathways. Results from air monitoring for the National Emission Standards for Hazardous Air Pollutants (NESHAPs) program indicated that the estimated dose was 0.38 mrem, which is below the U.S. Environmental Protection Agency (EPA) standard of 10 mrem per year.

  1. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model†

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    In this study, trabecular architecture is considered as a cellular solid structure, including both intact and damaged bone models. ??Intact?? bone models were constructed based on ideal versions of 25, 60 and 80-year-old ...

  2. Methods for identifying cancellous bone specimen location and size for the Reduced Platen Compression Test†

    E-Print Network [OSTI]

    Cowen, Kyle Ray

    2013-02-22T23:59:59.000Z

    , and stimuli on the skeleton and its ability to perform these everyday functions. The current state of bone testing is focused on understanding the mechanical properties of bone through use of traditional mechanical testing procedures such as three point...

  3. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    properties of proximal tibia were measured using in vivo peripheral quantitative CT. Bone formation rate was quantified on the periosteal the surface by standard bone histomorphometry after intraperitoneal injections of calcein. There was a significant main...

  4. Metabolic modeling for the deposition of transuranic nuclides on bone surfaces†

    E-Print Network [OSTI]

    Halter, Donald Anthony

    1997-01-01T23:59:59.000Z

    to bone surfaces. Although only plutonium was used in the evaluation of this model, any bone surface-seeking, alpha-emitting nuclide, and any class compound, can be used with this model....

  5. Apatite-polymer composites for the controlled delivery of bone morphogenetic proteins

    E-Print Network [OSTI]

    Yong, Tseh-Hwan

    2005-01-01T23:59:59.000Z

    Current treatment of bone defects due to trauma, cancer, or degenerative spine diseases involves the implantation of a bone graft. Autografts, which are harvested from the patient's own body, are associated with problems ...

  6. Bone Canonical WNT/B-Catenin Signaling in Models of Reduced Microgravity

    E-Print Network [OSTI]

    Macias, Brandon 1979-

    2012-10-25T23:59:59.000Z

    translates into molecular osteogenic signals in bone cells is unknown. Radiation exposure is another potent inducer of bone loss, namely observed on Earth in the clinical setting following radiotherapy procedures. It is expected that long duration space...

  7. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training†

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    Young and ovariectomized animals eating diets rich in omega-3 polyunsaturated fatty acids (n-3 PUFAs) exhibit enhanced bone formation and decrease bone loss, respectively. Eicosapentaenoic acid, an n-3 PUFA found in fish ...

  8. Detection of bone disease in dogs by radioisotope scanning

    E-Print Network [OSTI]

    Morris, Earl Louis

    1971-01-01T23:59:59.000Z

    f = fractional abundance 6 = cross section thermal neutron f1~ &t (1-e ) = decay factor The usual method of administration of radio- isotopes is intravenously but some have been given orally. 4 high bone to tissue ratio must be achieved... is limited by their availability because they must be produced close to where they will be used. MATERIALS AND METHODS The use of 2 radioactive isotopes for bone scanning in dogs was studied. Sr and Sr were 85 87m selected as the isotopes to be studied...

  9. Measurement of bone mineral content in caged and active cats†

    E-Print Network [OSTI]

    Tveter, Diane Ellen

    1988-01-01T23:59:59.000Z

    errors but these can be reduced by using two different x-ray energies. Dual energy CT operates on a basis similar to dual photon absorptiometry (explained below). The difference in attenuation between tissue and bone is greater for a lower energy... to act as a soft tissue equivalent (35). Effects of fat and soft tissue are decreased when dual energy CT is used (33). Data from each of the two different photon energies are combined and result in images of soft tissue and bone mineral regions. Beam...

  10. The effects of eccentric training on muscle-bone function

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE... December 1999 Major Subject: Kinesiology THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Subinitted to the Office of Graduate Studies of Texas A8iM University in partial fulfillment of the requirements...

  11. Patients with Patellofemoral Pain Exhibit Elevated Bone Metabolic Activity at the Patellofemoral Joint

    E-Print Network [OSTI]

    Delp, Scott

    . While we cannot measure bone stress in vivo, we can visualize bone metabolic activity using 18 F NaF PET/CT, which may be related to bone stress. Our goals were to use 18 F NaF PET/CT to evaluate whether subjects. Published by Wiley Periodicals, Inc. J Orthop Res Keywords: patellofemoral pain; 18 F NaF PET/CT; bone

  12. Is decreased bone mineral density associated with development of scoliosis? A bipedal osteopenic rat model

    E-Print Network [OSTI]

    Dede, Ozgur; Akel, Ibrahim; Demirkiran, Gokhan; Yalcin, Nadir; Marcucio, Ralph; Acaroglu, Emre

    2011-01-01T23:59:59.000Z

    more time standing erect. Dual energy X-ray absorbtiometry (acid; DEXA: Dual energy X-ray absorptiometry; BMD: Bone

  13. 3D Bone Microarchitecture Modeling and Fracture Risk Department of Computer

    E-Print Network [OSTI]

    Buffalo, State University of New York

    technique for the diagnosis of osteoporosis is Bone Mineral Density (BMD) measurement based on dual energy X

  14. Geothermal-resource assessment of the Steamboat-Routt Hot Springs area, Colorado. Resources Series 22

    SciTech Connect (OSTI)

    Pearl, R.H.; Zacharakis, T.G.; Ringrose, C.D.

    1983-01-01T23:59:59.000Z

    An assessment of the Steamboat Springs region in northwest Colorado was initiated and carried out in 1980 and 1981. The goal of this program was to delineate the geological features controlling the occurrence of the thermal waters (temperatures in excess of 68/sup 0/F (20/sup 0/C)) in this area at Steamboat Springs and 8 miles (12.8 km) north at Routt Hot Springs. Thermal waters from Heart Spring, the only developed thermal water source in the study area, are used in the municipal swimming pool in Steamboat Springs. The assessment program was a fully integrated program consisting of: dipole-dipole, Audio-magnetotelluric, telluric, self potential and gravity geophysical surveys, soil mercury and soil helium geochemical surveys; shallow temperature measurements; and prepartion of geological maps. The investigation showed that all the thermal springs appear to be fault controlled. Based on the chemical composition of the thermal waters it appears that Heart Spring in Steamboat Springs is hydrologically related to the Routt Hot Springs. This relationship was further confirmed when it was reported that thermal waters were encountered during the construction of the new high school in Strawberry Park on the north side of Steamboat Springs. In addition, residents stated that Strawberry Park appears to be warmer than the surrounding country side. Geological mapping has determined that a major fault extends from the Routt Hot Springs area into Strawberry Park.

  15. Term: Fall 2013 Spring 2014 University of Pittsburgh

    E-Print Network [OSTI]

    Sibille, Etienne

    Term: Fall 2013 ­ Spring 2014 University of Pittsburgh HOUSING/DINING SERVICES CONTRACT/Dining Services Contract (this "Contract") is made by and between the University of Pittsburgh's Housing/Dining Services Contract does not guarantee admission to the University. Applicants

  16. Spring 2014 Anesthesia Research Retreat Wednesday May 7th, 2014

    E-Print Network [OSTI]

    Thompson, Michael

    Spring 2014 Anesthesia Research Retreat Wednesday May 7th, 2014 Ancaster Mill ≠ 1812 Room 548 Old. James Paul ≠ Anesthesia Research: Looking back at the past year ii. Dr. Yannick Le Manach: Opportunities in the Anesthesia Department v. Dr. Summer Syed - Improving transfusion rates and clinical

  17. AME40463: Senior Design Project Spring 2010 ENGINEERING TRADE STUDY

    E-Print Network [OSTI]

    Batill, Stephen M.

    AME40463: Senior Design Project ≠ Spring 2010 ENGINEERING TRADE STUDY The engineering trade study indicate how that information influenced design decisions for the platform. Trade Study Proposal (due Feb prior to the beginning of the all-class meeting at 9:30 a.m. Trade Study Report (due Feb. 23): The trade

  18. Spring 2010 (Rev.) Washington and Lee University Library

    E-Print Network [OSTI]

    Marsh, David

    1 Spring 2010 (Rev.) Washington and Lee University Library Collection Development Policy I. Purpose of the University Library II. Relationship with other libraries III. Purpose of a collection policy IV. Collection. Retrospective purchases D. Duplicates E. Gifts F. Weeding VIII. Types of materials A. Books / E-books B. Serial

  19. Department of Mechanical Engineering Spring 2013 Active Vehicle Grille

    E-Print Network [OSTI]

    Demirel, Melik C.

    was tasked by General Motors (GM) to design and build active shutters that are mounted directly to the main Motors engineers and developed five possible concepts ∑ Reviewed existing patents and current activePENNSTATE Department of Mechanical Engineering Spring 2013 Active Vehicle Grille Overview Active

  20. Math 5654 4cr Spring 2010 Prediction and Filtering

    E-Print Network [OSTI]

    Krylov, Nicolai

    Math 5654 4cr Spring 2010 Syllabus Prediction and Filtering Lectures: 10:10am-12:05pm TTh, VinH 364: Saturday, May 15, 4 pm-6 pm. A few homeworks wil be assigned and the grades for them will enter as 2-dimensional case 133 2:2. Multidimensional case 137 3. Linear filtering 147 Chapter 6. Wiener process