Sample records for bone marrow cells

  1. Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells

    E-Print Network [OSTI]

    Aliotta, Jason M.

    2008-01-01T23:59:59.000Z

    Bone marrow production of lung cells: the impact of G-CSF,bone marrow to reconstitute lung epithelium. Am. J. Respirof Bone Marrow Cells into Lung Cells Mark S. Dooner 1 *,

  2. Identification of a hypoxic population of bone marrow cells

    SciTech Connect (OSTI)

    Allalunis, M.J.; Chapman, J.D.; Turner, A.R.

    1983-02-01T23:59:59.000Z

    A technique using collagenase has been devised to release and separate, with reproducibility, hematopoietic cells (HC) from various microenvironments of mouse femurs. HC were assayed by an in vitro gel culture technique used traditionally to score granulocyte-macrophage precursor cells (CFU-C). CFU-C which resided in the medullary cavity and endosteal regions were sensitive to ionizing radiation and resistant to misonidazole (MISO) cytotoxicity. CFU-C which resided within the compact bone were resistant to ionizing radiation and sensitive to the cytotoxic action of MISO. These results suggest that HC which reside in the bone are hypoxic and retain clonogenic potential. When animals were exposed to various treatments with MISO followed by myelotoxic doses of cyclophosphamide (CTX) or total body irradiation (TBI), the LD/sub 50/ of both agents was significantly reduced. This result suggests that a hypoxic component of HC could be important in the regenerative process within the marrow after such myelotoxic trauma.

  3. Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells

    SciTech Connect (OSTI)

    Dooner, Mark; Aliotta, Jason M.; Pimental, Jeffrey; Dooner, Gerri J.; Abedi, Mehrdad; Colvin, Gerald; Liu, Qin; Weier, Heinz-Ulli; Dooner, Mark S.; Quesenberry, Peter J.

    2007-12-31T23:59:59.000Z

    Green-fluorescent protein (GFP) labeled marrow cells transplanted into lethally irradiated mice can be detected in the lungs of transplanted mice and have been shown to express lung specific proteins while lacking the expression of hematopoietic markers. We have studied marrow cells induced to transit cell cycle by exposure to IL-3, IL-6, IL-11 and steel factor at different times of culture corresponding to different phases of cell cycle. We have found that marrow cells at the G1/S interface have a 3-fold increase in cells which assume a lung phenotype and that this increase is no longer seen in late S/G2. These cells have been characterized as GFP{sup +} CD45{sup -} and GFP{sup +} cytokeratin{sup +}. Thus marrow cells with the capacity to convert into cells with a lung phenotype after transplantation show a reversible increase with cytokine induced cell cycle transit. Previous studies have shown the phenotype of bone marrow stem cells fluctuates reversibly as these cells traverse cell cycle, leading to a continuum model of stem cell regulation. The present studies indicate that marrow stem cell production of nonhematopoietic cells also fluctuates on a continuum.

  4. Discovery of novel anti-inflammatory proteins inspired by bone marrow mesenchymal stem cell secretions

    E-Print Network [OSTI]

    Milwid, Jack Miles

    2011-01-01T23:59:59.000Z

    Bone marrow mesenchymal stem cells (MSCs) may soon become the first FDA-approved stem cell therapy for autoimmune and inflammatory disease. Our lab originally hypothesized that much of the therapeutic activity of MSCs may ...

  5. Self-assembling peptide hydrogels modulate in vitro chondrogenesis of bovine bone marrow stromal cells

    E-Print Network [OSTI]

    Kopesky, Paul Wayne

    Our objective was to test the hypothesis that self-assembling peptide hydrogel scaffolds provide cues that enhance the chondrogenic differentiation of bone marrow stromal cells (BMSCs). BMSCs were encapsulated within two ...

  6. Suppressor cells in transplantation tolerance. II. maturation of suppressor cells in the bone marrow chimera

    SciTech Connect (OSTI)

    Tutschka, P.J.; Ki, P.F.; Beschorner, W.E.; Hess, A.D.; Santos, G.W.

    1981-10-01T23:59:59.000Z

    Histoincompatible bone marrow allografts were established in lethally irradiated rats. At various times after transplantation, the spleen cells were harvested, subjected to mixed lymphocyte cultures, and assayed for suppressor cells in vitro and in vivo by adoptive transfer studies. Alloantigen-nonspecific suppressor cells appeared in the chimera at 40 days after grafting, coinciding with the resolution of graft-versus-host disease (GVHD). At 250 days the nonspecific suppressor cells were replaced by suppressor cells specifically suppressing donor-versus-host alloantigen responses. At 720 days suppressor cells could no longer be identified by in vitro methods but were identified by in vivo adoptive transfer of transplantation tolerance. After injection of host-type antigen into chimeras, the suppressor cells could be again demonstrated by in vitro methods.

  7. Suppressor cells in transplantation tolerance II. Maturation of suppressor cells in the bone marrow chimera

    SciTech Connect (OSTI)

    Tutschka, P.J.; Ki, P.F.; Beschorner, W.E.; Hess, A.D.; Santos, G.W.

    1981-10-01T23:59:59.000Z

    Histoincompatible bone marrow allografts were established in lethally irradiated rats. At various times after transplantation, the spleen cells were harvested, subjected to mixed lymphocyte cultures, and assayed for suppressor cells in vitro and in vivo by adoptive transfer studies. Alloantigen-nonspecific suppressor cells appeared in the chimera at 40 days after grafting, coinciding with the resolution of graft-versus-host disease (GVHD). At 250 days the nonspecific suppressor cells were replaced by suppressor cells specifically suppressing donor-versus-host alloantigen responses. At 720 days suppressor cells could no longer be identified by in vitro methods but were identified by in vivo adoptive transfer of transplantation tolerance. After injection of host-type antigen into chimeras, the suppressor cells could be again demonstrated by in vitro methods.

  8. Cellular and molecular immunotherapeutics derived from the bone marrow stroma

    E-Print Network [OSTI]

    Parekkadan, Biju

    2008-01-01T23:59:59.000Z

    The bone marrow contains a multipotent stromal cell, commonly referred to as a mesenchymal stem cell (MSC). There has been recent interest in the clinical use of MSCs for cell-based therapy because: (1) bone marrow aspiration ...

  9. Characterization of host lymphoid cells in antibody-facilitated bone marrow chimeras

    SciTech Connect (OSTI)

    McCarthy, S.A.; Griffith, I.J.; Gambel, P.; Francescutti, L.H.; Wegmann, T.G.

    1985-07-01T23:59:59.000Z

    The authors have produced stable murine antibody-facilitated (AF) chimeras by the simultaneous injection of P1 bone marrow cells and anti-P2 monoclonal antibody into normal (unirradiated) adult (P1 X P2)F1 recipients. These AF chimeras are healthy, long-lived, and exhibit no overt signs of graft-versus-host disease. They are immunocompetent and tolerant of host, P2-encoded alloantigens. Donor cell engraftment and takeover, monitored by glucosephosphate isomerase isozyme patterns, is usually complete (greater than 95%) in the peripheral blood, bone marrow, and hemopoietic stem cell compartments of long-term (greater than 3 months posttransplantation) AF chimeras. The authors report here, however, that splenic, lymph node, and thymic leukocytes of AF chimeras represent donor/host chimeric populations. Spleen cell populations of AF chimeras exhibit substantial chimera-to-chimera variation in the preponderant residual host cell type(s) present. Interpretations of the implications of these findings are discussed.

  10. Intra-arterial Autologous Bone Marrow Cell Transplantation in a Patient with Upper-extremity Critical Limb Ischemia

    SciTech Connect (OSTI)

    Madaric, Juraj, E-mail: jurmad@hotmail.com [National Institute of Cardiovascular Diseases (NUSCH) and Slovak Medical University, Department of Cardiology and Angiology (Slovakia)] [National Institute of Cardiovascular Diseases (NUSCH) and Slovak Medical University, Department of Cardiology and Angiology (Slovakia); Klepanec, Andrej [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)] [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia); Mistrik, Martin [Clinic of Hematology and Transfusiology, Faculty Hospital (Slovakia)] [Clinic of Hematology and Transfusiology, Faculty Hospital (Slovakia); Altaner, Cestmir [Slovak Academy of Science, Institute of Experimental Oncology (Slovakia)] [Slovak Academy of Science, Institute of Experimental Oncology (Slovakia); Vulev, Ivan [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)] [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)

    2013-04-15T23:59:59.000Z

    Induction of therapeutic angiogenesis by autologous bone marrow mononuclear cell transplantation has been identified as a potential new option in patients with advanced lower-limb ischemia. There is little evidence of the benefit of intra-arterial cell application in upper-limb critical ischemia. We describe a patient with upper-extremity critical limb ischemia with digital gangrene resulting from hypothenar hammer syndrome successfully treated by intra-arterial autologous bone marrow mononuclear cell transplantation.

  11. Adult equine bone-marrow stromal cells produce a cartilage-like ECM superior to animal-matched adult chondrocytes

    E-Print Network [OSTI]

    Kisiday, John D.

    Our objective was to evaluate the age-dependent mechanical phenotype of bone marrow stromal cell- (BMSC-) and chondrocyte-produced cartilage-like neo-tissue and to elucidate the matrix-associated mechanisms which generate ...

  12. Expression of T cell antigen receptor genes in the thymus of irradiated mice after bone marrow transplantation

    SciTech Connect (OSTI)

    Matsuzaki, G.; Yoshikai, Y.; Kishihara, K.; Nomoto, K.

    1988-01-15T23:59:59.000Z

    Sequential appearance of the expression of T cell antigen receptor genes was investigated in the thymus of irradiated mice at the early stage after transplantation of Thy-1 congeneic H-2 compatible allogeneic bone marrow cells. The first cells to repopulate the thymus on day 7 after bone marrow transplantation were intrathymic radioresistant T cell precursors, which expanded mainly to CD4+CD8+ host-type thymocytes by day 14. A high level of gamma gene expression but a much reduced level of alpha and beta gene expression were detected in the host-type thymocytes on day 7. During regeneration of these cells, gamma-chain messages fell to low level and alpha and beta mRNA levels increased. The thymus of the recipients began to be repopulated by donor-derived T cells about 2 wk after bone marrow transplantation and was almost completely replaced by the third week. An ordered expression of gamma then beta and alpha-chain gene transcript was also observed in the donor-type thymocytes at the early stage after bone marrow transplantation. The use of thymocytes at early stage in whole-body irradiated bone marrow chimera provides a pertinent source for investigating the molecular mechanism of T cell differentiation in adult thymus.

  13. Essential requirement of I-A region-identical host bone marrow or bone marrow-derived cells for tumor neutralization by primed L3T4+ T cells

    SciTech Connect (OSTI)

    Ozawa, H.; Iwaguchi, T.; Kataoka, T.

    1987-12-01T23:59:59.000Z

    The antitumor activity of Meth A-hyperimmunized BALB/c mouse spleen cells (Meth A-Im-SPL) was assayed by the Winn test in H-2 incompatible bone marrow chimeras in closed colony CD-1 (nu/nu), inbred DDD/1(nu/nu) (H-2s), or inbred BALB/c(nu/nu) (H-2d) mice as recipients. We found that Meth A-Im-SPL suppressed Meth A growth in the chimera nude mice which were reconstituted with bone marrow cells of the H-2d haplotype (i.e., BALB/c, DBA/2 and B10.D2), but not in the chimeras which were reconstituted with bone marrow cells of the H-2a, H-2b, or H-2k haplotype (i.e., B10.A, B10, and B10.BR). These results suggested that H-2 restriction occurred between Meth A-Im-SPL and bone marrow or bone marrow-derived cells in tumor neutralization. Furthermore, Meth A-Im-SPL did not suppress Meth 1 tumors (antigenically distinct from Meth A tumors) in the presence or absence of mitomycin C-treated Meth A in a Winn assay. These results suggested that there is tumor specificity in the effector phase as well as in the induction phase. The phenotype of the effectors in the Meth A-Im-SPL was Thy-1.2+ and L3T4+, because Meth A-Im-SPL lost their antitumor activity with pretreatment with anti-Thy-1.2 monoclonal antibody (mAb) and complement or anti-L3T4 mAb and complement, but not with anti-Lyt-2.2 mAb and complement or complement alone. Positively purified L3T4+ T cells from Meth A-Im-SPL (Meth A-Im-L3T4), obtained by the panning method, suppressed the tumor growth in the chimera nude mice which were reconstituted with bone marrow cells of B10.KEA2 mice (that were I-A region-identical with Meth A-Im-L3T4 cells but not others in H-2) as well as B10.D2 cells (that were fully identical with Meth A-Im-L3T4 cells in H-2). We conclude that Meth A-Im-SPL (L3T4+) neutralized the tumors in collaboration with I-A region-identical host bone marrow or bone marrow-derived cells, and the neutralization was not accompanied by the bystander effect.

  14. Bone marrow-derived mesenchymal stem cells enhance angiogenesis via their ?6?1 integrin receptor

    SciTech Connect (OSTI)

    Carrion, Bita; Kong, Yen P. [Department of Biomedical Engineering, University of Michigan, Ann Arbor, MI 48109 (United States); Kaigler, Darnell [Department of Biomedical Engineering, University of Michigan, Ann Arbor, MI 48109 (United States); Department of Periodontics and Oral Medicine, University of Michigan, Ann Arbor, MI 48109 (United States); Putnam, Andrew J., E-mail: putnam@umich.edu [Department of Biomedical Engineering, University of Michigan, Ann Arbor, MI 48109 (United States)

    2013-11-15T23:59:59.000Z

    Bone marrow-derived mesenchymal stem cells (BMSCs) facilitate the angiogenic response of endothelial cells (ECs) within three-dimensional (3D) matrices in vivo and in engineered tissues in vitro in part through paracrine mediators and by acting as stabilizing pericytes. However, the molecular interactions between BMSCs and nascent tubules during the process of angiogenesis are not fully understood. In this study, we have used a tractable 3D co-culture model to explore the functional role of the ?6?1 integrin adhesion receptor on BMSCs in sprouting angiogenesis. We report that knockdown of the ?6 integrin subunit in BMSCs significantly reduces capillary sprouting, and causes their failure to associate with the nascent vessels. Furthermore, we demonstrate that the BMSCs with attenuated ?6 integrin proliferate at a significantly lower rate relative to either control cells expressing non-targeting shRNA or wild type BMSCs; however, despite adding more cells to compensate for this deficit in proliferation, deficient sprouting persists. Collectively, our findings demonstrate that the ?6 integrin subunit in BMSCs is important for their ability to stimulate vessel morphogenesis. This conclusion may have important implications in the optimization of cell-based strategies to promote angiogenesis. Highlights: • BMSCs stimulate angiogenesis, but the mechanisms remain unclear. • We silenced the expression of the ?6 integrin subunit in BMSCs. • Silencing this receptor subunit significantly inhibited angiogenic sprouting. • Knocking down ?6 integrin affected laminin and ?SMA expression. • Silencing ?6 integrin expression also reduced BMSC proliferation.

  15. Efficient natural defense mechanisms against Listeria monocytogenes in T and B cell-deficient allogeneic bone marrow radiation chimeras. Preactivated macrophages are the main effector cells in an early phase after bone marrow transfer

    SciTech Connect (OSTI)

    Roesler, J.; Groettrup, E.B.; Baccarini, M.; Lohmann-Mattes, M.L. (Fraunhofer-Institut ITA, Hannover (Germany, F.R.))

    1989-09-01T23:59:59.000Z

    Radiation chimeras in the early phase after bone marrow transplantation are a good model to study the efficiency of the body's nonspecific defense system represented by macrophages (M phi), polymorphonuclear cells (PMN), and NK cells. These cell types are present in large numbers in spleen and liver at that time, whereas the specific immune system represented by T and B cells is functionally deficient. We previously reported enhanced activities in vitro of M phi (and PMN) from recipient animals in an early phase after allogeneic bone marrow transfer. We here demonstrate that these activities result in enhanced spontaneous resistance against Listeria monocytogenes in vivo: CFU of L. monocytogenes in spleen and liver 48 h after infection were about 1 or 2 to 4 log steps less than in untreated control mice of donor or host haplotype. This enhanced resistance decreased over the 4-mo period after marrow transfer. Preactivated M phi were identified as the most important effector cells. Isolated from spleen and peritoneal cavity, they performed enhanced killing of phagocytosed Listeria. Such preactivated M phi occurred in recipient animals after transfer of allogeneic but not of syngeneic bone marrow. The precise mechanism of M phi activation in the allogeneic radiation chimera in the complete absence of any detectable T cell function is not clear at present. However, these preactivated M phi display an important protective effect against L. monocytogenes: chimeras could eliminate Listeria without acquisition of positive delayed-type sensitivity when infected with 10(3) bacteria. An inoculum of 5 . 10(3) L. monocytogenes resulted either in prolonged survival compared with normal mice of the recipient haplotype or in definitive survival accompanied by a positive delayed-type sensitivity.

  16. Controlling the Bone Marrow Dynamics in Cancer Chemotherapy

    E-Print Network [OSTI]

    Ledzewicz, Urszula

    Professor Award 1 #12;find optimal strategies for chemotherapy treatments of the cancer, where Controlling the Bone Marrow Dynamics in Cancer Chemotherapy Urszula Ledzewicz1 and Heinz Sch In the paper a mathematical model for the growth of the bone marrow under cell-cycle specific cancer

  17. Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells

    E-Print Network [OSTI]

    Aliotta, Jason M.

    2008-01-01T23:59:59.000Z

    mice can be detected in the lungs of transplanted mice andto 5.43% of cells within the lung are GFP CD45 , which weIn nonirradiated mice, homing to the lung was significantly

  18. Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells

    E-Print Network [OSTI]

    Aliotta, Jason M.

    2008-01-01T23:59:59.000Z

    that from 6 to 9 % of infused stem cells end up residing inbody irradiation and then infused with either 5X10 green-Lin - Sca-1 + groups were infused after 24 hours culture in

  19. Effects of bone marrow-derived cells on monocrotaline-and hypoxia-induced pulmonary hypertension in mice

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    hypertension in mice William Raoul,1 Orianne Wagner-Ballon,6 Guitanouch Saber,1 Anne Hulin,5 Elisabeth Marcos the difference in their effects depends on the mechanism of pulmonary hypertension (PH) remains unknown of monocrotaline (MCT)- induced pulmonary hypertension, Zhao et al. [9] showed that bone marrow-derived endothelial

  20. A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone Marrow Mesenchymal Stem Cell Transplantation

    E-Print Network [OSTI]

    Miga, Michael I.

    A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone generation, and an iterative optimization (using finite element analysis) of the fracture callus material approach includes acquisition of microCT image volumes, biomechanical testing, finite element mesh

  1. Clonal deletion of self-reactive T cells in irradiation bone marrow chimeras and neonatally tolerant mice. Evidence for intercellular transfer of Mlsa

    SciTech Connect (OSTI)

    Speiser, D.E.; Schneider, R.; Hengartner, H.; MacDonald, H.R.; Zinkernagel, R.M. (Univ. Hospital, Zuerich (Switzerland))

    1989-08-01T23:59:59.000Z

    Tolerance to Mlsa has been shown to be associated with clonal deletion of cells carrying TCR beta chain variable regions V beta 6 or V beta 8.1 in mice possessing I-E antigens. To evaluate the rules of tolerance induction to Mlsa we prepared irradiation bone marrow chimeras expressing Mlsa or Mlsb and I-E by different cell types. Deletion of V beta 6+, Mlsa-reactive T cells required the presence of Mlsa and I-E products either on bone marrow-derived cells or on irradiated recipient cells. Tolerance was induced when Mlsa and I-E were expressed by distinct cells of the chimera. Also neonatally tolerized mice exhibited depletion of V beta 6+ cells after injection of I-E- Mlsa spleen cells (DBA/1) into newborn I-E+ Mlsb mice (BALB/c x B10.G)F1. These results suggest that the product of the Mlsa locus is soluble and/or may be transferred from cell to cell and bound to I-E antigens. The chimera experiments also showed that tolerance to Mlsa is H-2 allele independent, i.e., is apparently unrestricted. Differentiation of chimeric (H-2d/Mlsa x H-2q/Mlsb)F1 stem cells in either an H-2d or an H-2q thymus revealed that tolerance assessed by absence of V beta 6+ T cells is not dependent on the thymically determined restriction specificity of T cells.

  2. Lead effects on development and function of bone marrow-derived dendritic cells promote Th2 immune responses

    SciTech Connect (OSTI)

    Gao Donghong [Biggs Laboratory, Wadsworth Center, New York State Department of Health, Empire State Plaza, Albany, NY 12201-0509 (United States); Mondal, Tapan K. [Biggs Laboratory, Wadsworth Center, New York State Department of Health, Empire State Plaza, Albany, NY 12201-0509 (United States); Lawrence, David A. [Biggs Laboratory, Wadsworth Center, New York State Department of Health, Empire State Plaza, Albany, NY 12201-0509 (United States)]. E-mail: lawrencd@wadsworth.org

    2007-07-01T23:59:59.000Z

    Although lead (Pb) has significant effects on the development and function of macrophages, B cells, and T cells and has been suggested to promote allergic asthma in mice and humans, Pb modulation of bone marrow (BM)-derived dendritic cells (DCs) and the resultant DC effects on Th1 and Th2 development have not been examined. Accordingly, we cultured BM cells with murine granulocyte macrophage-colony stimulating factor (mGM-CSF) {+-} PbCl{sub 2}. At day 10, culture supernatant (SN) and non-adherent cells were harvested for analysis. Additionally, day 10 non-adherent BM-DCs were harvested and recultured with mGM-CSF + LPS {+-} Pb for 2 days. The day 10 Pb exposure significantly inhibited BM-DC generation, based on CD11c expression. Although fewer DCs were generated with Pb, the existing Pb-exposed DCs had significantly greater MHC-II expression than did the non-Pb-exposed DCs. However, these differences diminished upon LPS stimulation. After LPS stimulation, CD80, CD86, CD40, CD54, and MHC-II were all up-regulated on both Pb-DCs and DCs, but Pb-DCs expressed significantly less CD80 than did DCs. The CD86:CD80 ratio suggests a Pb-DC potential for Th2 cell development. After LPS stimulation, IL-6, IL-10, IL-12 (p70), and TNF-{alpha} levels significantly increased with both Pb-DCs and DCs, but Pb-DCs produced significantly less cytokines than did DCs, except for IL-10, which further supports Pb-DC preferential skewing toward type-2 immunity. In vitro studies confirm that Pb-DCs have the ability to polarize antigen-specific T cells to Th2 cells. Pb-DCs also enhanced allogeneic and autologous T cell proliferation in vitro, and in vivo studies suggested that Pb-DCs inhibited Th1 effects on humoral and cell-mediated immunity. The Pb effect was mainly on DCs, rather than on T cells, and Pb's modification of DC function appears to be the main cause of Pb's promotion of type-2-related immunity, which may relate to Pb's enhanced activation of the Erk/MAP kinase pathway.

  3. Oxygen tension regulates the osteogenic, chondrogenic and endochondral phenotype of bone marrow derived mesenchymal stem cells

    SciTech Connect (OSTI)

    Sheehy, Eamon J.; Buckley, Conor T. [Trinity Centre for Bioengineering, School of Engineering, Trinity College Dublin, Dublin 2 (Ireland)] [Trinity Centre for Bioengineering, School of Engineering, Trinity College Dublin, Dublin 2 (Ireland); Kelly, Daniel J., E-mail: kellyd9@tcd.ie [Trinity Centre for Bioengineering, School of Engineering, Trinity College Dublin, Dublin 2 (Ireland)

    2012-01-06T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer Expansion in low oxygen enhances MSC proliferation and osteogenesis. Black-Right-Pointing-Pointer Differentiation in low oxygen enhances chondrogenesis and suppresses hypertrophy. Black-Right-Pointing-Pointer Oxygen can regulate the MSC phenotype for use in tissue engineering applications. -- Abstract: The local oxygen tension is a key regulator of the fate of mesenchymal stem cells (MSCs). The objective of this study was to investigate the effect of a low oxygen tension during expansion and differentiation on the proliferation kinetics as well as the subsequent osteogenic and chondrogenic potential of MSCs. We first hypothesised that expansion in a low oxygen tension (5% pO{sub 2}) would improve both the subsequent osteogenic and chondrogenic potential of MSCs compared to expansion in a normoxic environment (20% pO{sub 2}). Furthermore, we hypothesised that chondrogenic differentiation in a low oxygen environment would suppress hypertrophy of MSCs cultured in both pellets and hydrogels used in tissue engineering strategies. MSCs expanded at 5% pO{sub 2} proliferated faster forming larger colonies, resulting in higher cell yields. Expansion at 5% pO{sub 2} also enhanced subsequent osteogenesis of MSCs, whereas differentiation at 5% pO{sub 2} was found to be a more potent promoter of chondrogenesis than expansion at 5% pO{sub 2}. Greater collagen accumulation, and more intense staining for collagen types I and X, was observed in pellets maintained at 20% pO{sub 2} compared to 5% pO{sub 2}. Both pellets and hydrogels stained more intensely for type II collagen when undergoing chondrogenesis in a low oxygen environment. Differentiation at 5% pO{sub 2} also appeared to inhibit hypertrophy in both pellets and hydrogels, as demonstrated by reduced collagen type X and Alizarin Red staining and alkaline phosphatase activity. This study demonstrates that the local oxygen environment can be manipulated in vitro to either stabilise a chondrogenic phenotype for use in cartilage repair therapies or to promote hypertrophy of cartilaginous grafts for endochondral bone repair strategies.

  4. The effects of physiological age on bone marrow-derived mesenchymal stem cells

    E-Print Network [OSTI]

    Buckspan, Caitlin

    2010-01-01T23:59:59.000Z

    Jaenisch. Treatment of sickle cell anemia mouse model withcan be used to treat sickle cell anemia in a mouse model 5 ,

  5. Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair Compared to the Trochlea in a

    E-Print Network [OSTI]

    Buschmann, Michael

    Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair femoral condylar (MFC) versus femoral trochlear (TR) defects 3 months after bone marrow stimulation: cartilage repair; medial femoral condyle; trochlea; bone marrow stimulation; meniscus degeneration Articular

  6. Epitopes associated with the MHC restriction site of T cells. II. Somatic generation of Iat epitopes on T cells in radiation bone marrow chimeras

    SciTech Connect (OSTI)

    Asano, Y.; Tada, T.

    1987-01-01T23:59:59.000Z

    We described in this paper systematic alterations in the expression of unique I region controlled epitopes on helper T cells (Th) in chimeras according to the changes in their H-2 restriction specificity. Taking advantage of the reactivity of monoclonal antibodies (anti-Iat) putatively specific for the epitopes indirectly controlled by I region and expressed in association with the Iak restriction site of Th, we examined the alterations of these epitopes on Th cells from various bone marrow chimeras. Iatk epitopes were physiologically expressed on Iak-restricted but not on Iab-restricted Th cells in (H-2k X H-2b)F1 mice. In the chimeric condition, the H-2k-restricted Th of B6----F1 chimera acquired the expression of Iatk even though B6 Th is unable to express Iatk when developed under the physiologic condition. Iatk are also found on Th of fully allogeneic chimera of B6----C3H, whereas Th cells of C3H----B6 completely lost the Iatk expression. These results indicate that Iat epitopes originally defined as unique I region-controlled determinants selectively expressed on T cells are not encoded by the I region genes but are associated with the T cell receptor that sees the self Ia. The epitopes undergo the adaptive alterations according to the acquisition of a new MHC restriction. This is the first example to demonstrate the epitope associated with T cell receptor which undergo the systematic adaptive differentiation.

  7. Differentiation and functional maturation of bone marrow-derived intestinal epithelial T cells expressing membrane T cell receptor in athymic radiation chimeras

    SciTech Connect (OSTI)

    Mosley, R.L.; Styre, D.; Klein, J.R. (Univ. of Tulsa, OK (USA))

    1990-09-01T23:59:59.000Z

    The thymus dependency of murine intestinal intraepithelial lymphocytes (IEL) was studied in an athymic F1----parent radiation chimera model. IEL, although not splenic or lymph node lymphocytes, from athymic chimeras displayed normal levels of cells bearing the class-specific T cell Ag, CD4 and CD8; the TCR-associated molecule, CD3; and the Thy-1 Ag. Moreover, two-color flow cytometric analyses of IEL from athymic mice demonstrated regulated expression of T cell Ag characteristic of IEL subset populations from thymus-bearing mice. In immunoprecipitation experiments, surface TCR-alpha beta or TCR-gamma delta were expressed on IEL, although not on splenic lymphocytes, from athymic chimeras. That IEL from athymic chimeras constituted a population of functionally mature effector cells activated in situ, similar to IEL from thymus-bearing mice, was demonstrated by the presence of CD3-mediated lytic activity of athymic lethally irradiated bone marrow reconstituted IEL. These data provide compelling evidence that intestinal T cells do not require thymic influence for maturation and development, and demonstrate that the microenvironment of the intestinal epithelium is uniquely adapted to regulate IEL differentiation.

  8. Bone marrow transplantation after the Chernobyl nuclear accident

    SciTech Connect (OSTI)

    Baranov, A.; Gale, R.P.; Guskova, A.; Piatkin, E.; Selidovkin, G.; Muravyova, L.; Champlin, R.E.; Danilova, N.; Yevseeva, L.; Petrosyan, L. (Institute of Biophysics of the Ministry of Health and Clinical Hospital, Moscow (USSR))

    1989-07-27T23:59:59.000Z

    On April 26, 1986, an accident at the Chernobyl nuclear power station in the Soviet Union exposed about 200 people to large doses of total-body radiation. Thirteen persons exposed to estimated total-body doses of 5.6 to 13.4 Gy received bone marrow transplants. Two transplant recipients, who received estimated doses of radiation of 5.6 and 8.7 Gy, are alive more than three years after the accident. The others died of various causes, including burns (the cause of death in five), interstitial pneumonitis (three), graft-versus-host disease (two), and acute renal failure and adult respiratory distress syndrome (one). There was hematopoietic (granulocytic) recovery in nine transplant recipients who could be evaluated, six of whom had transient partial engraftment before the recovery of their own marrow. Graft-versus-host disease was diagnosed clinically in four persons and suspected in two others. Although the recovery of endogenous hematopoiesis may occur after exposure to radiation doses of 5.6 to 13.4 Gy, we do not know whether it is more likely after the transient engraftment of transplanted stem cells. Because large doses of radiation affect multiple systems, bone marrow recovery does not necessarily ensure survival. Furthermore, the risk of graft-versus-host disease must be considered when the benefits of this treatment are being weighed.

  9. Continuous high expression of XBP1 and GRP78 is important for the survival of bone marrow cells in CCl{sub 4}-treated cirrhotic liver

    SciTech Connect (OSTI)

    Marumoto, Yoshio [Department of Gastroenterology and Hepatology, Yamaguchi University Graduate School of Medicine, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan); Terai, Shuji [Department of Gastroenterology and Hepatology, Yamaguchi University Graduate School of Medicine, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan)], E-mail: terais@yamaguchi-u.ac.jp; Urata, Yohei; Matsumoto, Toshihiko; Mizunaga, Yuko; Yamamoto, Naoki; Jin, Haiyan; Fujisawa, Koichi [Department of Gastroenterology and Hepatology, Yamaguchi University Graduate School of Medicine, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan); Murata, Tomoaki [Science Research Center, Yamaguchi University, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan); Shinoda, Koh [Department of Neuroanatomy and Neuroscience, Yamaguchi University School of Medicine, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan); Nishina, Hiroshi [Department of Developmental and Regenerative Biology, Medical Research Institute, Tokyo Medical and Dental University, 1-5-45, Yushima, Bunkyo-ku, Tokyo 113-8510 (Japan); Sakaida, Isao [Department of Gastroenterology and Hepatology, Yamaguchi University Graduate School of Medicine, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan)

    2008-03-14T23:59:59.000Z

    We have previously shown that infusion of bone marrow cells (BMC) improves CCl{sub 4}-induced cirrhosis. However, it is unclear why the injected BMC are resistant to CCl{sub 4} damage and subsequently improve the local microenvironment in damaged liver. To analyze the cellular phenomena involved in this process, we studied the damaged liver using electron microscopy. We found that CCl{sub 4} caused rough endoplasmic reticula to swell in hepatocytes. To analyze the gene expression patterns associated with this process, we conducted PCR-selected suppressive subtractive hybridization. We found that expression levels of HSP84, HSP40, and XBP1 differed markedly between control liver and liver infused with BMC. Immunohistochemical staining revealed that expression levels of HSP84 and HSP40 were markedly higher in the early phase of differentiation immediately after BMC infusion, but decreased over time. XBP1 expression remained high during the late phase, and GRP78 expression increased with XBP1 activation. We also found that GFP-positive BMC expressed XBP1 and GRP78. XBP1 and GRP78 are associated with ER stress. Thus, continuous high XBP1 and GRP78 expression might be essential for the survival and proliferation of BMC in a CCl{sub 4}-induced persistent liver damage environment.

  10. Regulation of thrombopoietin in bone marrow

    E-Print Network [OSTI]

    McIntosh, Bryan James

    2007-01-01T23:59:59.000Z

    R: gacagagttagtcttgccactgcaa Prb: actgatttgctcctggcggccatMutant prb: tggagctgactgatttactactagcagcaatgc Cyclophilin (L: tggcacatgaatcctggaata Prb: ttcgagctctgagcactggagaga Bone

  11. Study on proliferative responses to host Ia antigens in allogeneic bone marrow chimera in mice: sequential analysis of the reactivity and characterization of the cells involved in the responses

    SciTech Connect (OSTI)

    Iwabuchi, K.; Ogasawara, K.; Ogasawara, M.; Yasumizu, R.; Noguchi, M.; Geng, L.; Fujita, M.; Good, R.A.; Onoe, K.

    1987-01-01T23:59:59.000Z

    Irradiation bone marrow chimeras were established by reconstitution of lethally irradiated AKR mice with C57BL/10 marrow cells to permit serial analysis of the developing reactivities of lymphocytes from such chimeras, (B10----AKR), against donor, host, or third party antigens. We found that substantial proliferative responses to Ia antigens of the recipient strain and also to third party antigens were generated by the thymocytes obtained from the irradiation chimeras at an early stage after bone marrow reconstitution. The majority of the responding thymocytes had surfaces lacking demonstrable peanut agglutinin receptors and were donor type Thy-1+, Ly-2-, and L3T4+ in both anti-recipient and anti-third party MLR. In anti-host responses, however, Ly-2+ thymocytes seemed to be at least partially involved. This capacity of thymus cells to mount a response to antigens of the recipient strain declined shortly thereafter, whereas the capacity to mount MLR against third party antigens persisted. The spleen cells of (B10----AKR) chimeras at the same time developed a more durable capability to exhibit anti-host reactivities and a permanent capability of reacting to third party allo-antigens. The stimulator antigens were Ia molecules on the stimulator cells in both anti-recipient and anti-third party MLR. The responding splenocytes were of donor origin and most of them had Thy-1+, Ly-1+2-, and L3T4+ phenotype.

  12. Measuring the whole bone marrow asset in humans by a computational approach to integrated PET/CT imaging.

    E-Print Network [OSTI]

    Piana, Michele

    ; 7 CNR-SPIN. Genova. Italy Running Head: PET/CT measurement of bone marrow volume AddressMeasuring the whole bone marrow asset in humans by a computational approach to integrated PET/CT to chemotherapy. Keywords: PET/CT; bone marrow imaging; image processing. #12;2 Introduction Bone marrow (BM

  13. CX3CR1 Is Expressed by Prostate Epithelial Cells and Androgens Regulate the Levels of CX3CL1/Fractalkine in the Bone Marrow

    E-Print Network [OSTI]

    Fatatis, Alessandro

    CX3CR1 Is Expressed by Prostate Epithelial Cells and Androgens Regulate the Levels of CX3CL1 human osteoblasts in vitro. Thus, the interaction of fractalkine with its receptor CX3CR1 could play a crucial role in vivo by directing circulating prostate cancer cells to the bone. We found that although CX

  14. Anti-bacterial immunity to Listeria monocytogenes in allogeneic bone marrow chimera in mice

    SciTech Connect (OSTI)

    Onoe, K.; Good, R.A.; Yamamoto, K.

    1986-06-01T23:59:59.000Z

    Protection and delayed-type hypersensitivity (DTH) to the facultative intracellular bacterium Listeria monocytogenes (L.m.) were studied in allogeneic and syngeneic bone marrow chimeras. Lethally irradiated AKR (H-2k) mice were successfully reconstituted with marrow cells from C57BL/10 (B10) (H-2b), B10 H-2-recombinant strains or syngeneic mice. Irradiated AKR mice reconstituted with marrow cells from H-2-compatible B10.BR mice, (BR----AKR), as well as syngeneic marrow cells, (AKR----AKR), showed a normal level of responsiveness to the challenge stimulation with the listeria antigens when DTH was evaluated by footpad reactions. These mice also showed vigorous activities in acquired resistance to the L.m. By contrast, chimeric mice that had total or partial histoincompatibility at the H-2 determinants between donor and recipient, (B10----AKR), (B10.AQR----AKR), (B10.A(4R)----AKR), or (B10.A(5R)----AKR), were almost completely unresponsive in DTH and antibacterial immunity. However, when (B10----AKR) H-2-incompatible chimeras had been immunized with killed L.m. before challenge with live L.m., these mice manifested considerable DTH and resistance to L.m. These observations suggest that compatibility at the entire MHC between donor and recipient is required for bone marrow chimeras to be able to manifest DTH and protection against L.m. after a short-term immunization schedule. However, this requirement is overcome by a preceding or more prolonged period of immunization with L.m. antigens. These antigens, together with marrow-derived antigen-presenting cells, can then stimulate and expand cell populations that are restricted to the MHC (H-2) products of the donor type.

  15. PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism

    E-Print Network [OSTI]

    Toledo, University of

    PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism Beata regulating systemic energy homeostasis. In this article, we review current knowledge on the role of PPARs of bone marrow microenvironment and its possible contribution to the systemic regulation of energy

  16. Mechanisms of tolerance in murine radiation bone marrow chimeras. I. Nonspecific suppression of alloreactivity by spleen cells from early, but not late, chimeras

    SciTech Connect (OSTI)

    Auchincloss, H. Jr.; Sachs, D.H.

    1983-10-01T23:59:59.000Z

    Allogeneic chimeras were prepared using lethally irradiated B6 hosts and untreated marrow from exsanguinated BALB/c donors. For about two months after reconstitution, chimeras had very weak antihost cell-mediated lymphocytotoxicity (CML) reactivity and little third-party alloreactivity. During this time a cell population capable of suppressing CML reactivity against both host and third-party alloantigens (i.e., antigen-nonspecific) was demonstrated in chimera spleens by in vitro mixing experiments. The putative suppressor cells were Thy-1-negative and radiation-sensitive. Subsequently, mature chimeras showed host tolerance and strong third-party alloreactivity. At this point suppressor mechanisms could no longer be demonstrated. These data are consistent with a clonal elimination hypothesis in that they do not provide evidence to indicate that maintenance of specific immune tolerance is mediated by an active suppressor mechanism.

  17. Anti-CD45 radioimmunotherapy using 211At with bone marrow transplantation prolongs survival in a disseminated murine leukemia model

    SciTech Connect (OSTI)

    Orozco, Johnnie J.; Back, Tom; Kenoyer, Aimee L.; Balkin, Ethan R.; Hamlin, Donald K.; Wilbur, D. Scott; Fisher, Darrell R.; Frayo, Shani; Hylarides, Mark; Green, Damian J.; Gopal, Ajay K.; Press, Oliver W.; Pagel, John M.

    2013-05-15T23:59:59.000Z

    Anti-CD45 Radioimmunotherapy using an Alpha-Emitting Radionuclide 211At Combined with Bone Marrow Transplantation Prolongs Survival in a Disseminated Murine Leukemia Model ABSTRACT Despite aggressive chemotherapy combined with hematopoietic cell transplant (HCT), many patients with acute myeloid leukemia (AML) relapse. Radioimmunotherapy (RIT) using antibodies (Ab) labeled primarily with beta-emitting radionuclides has been explored to reduce relapse.

  18. Adaptive differentiation of H-2- and Igh-restricted B lymphocyte in tetraparental bone marrow chimera

    SciTech Connect (OSTI)

    Yamamoto, H.; Bitoh, S.; Fujimoto, S.

    1987-01-15T23:59:59.000Z

    Immunization of BALB/c mice with MOPC-104E myeloma protein induced idiotype-specific enhancing B cells that acted on anti-dextran antibody producing B cells. The enhancing cells have the surface phenotype of B cells. With the use of several H-2 or Igh congenic mice, it was found that the cooperation among B cells was controlled by both the major histocompatibility complex (MHC) and Igh. The capability to generate enhancing B cell activity was analyzed by using tetraparental bone marrow chimeras. (C57BL/6 X BALB/c)F1 mice, for example, were lethally irradiated and were reconstituted with C57BL/6 and BALB/c bone marrow cells. Nine to 12 wk after the reconstitution, the chimeras were immunized with the myeloma protein and were tested for their enhancing B cell activity. After the removal of C57BL/6 origin cells by treatment with anti-H-2b + complement, residual cells exhibited enhancing B cell activity on BALB.B, as well as BALB/c antidextran antibody response. This indicates that the generation of H-2-restricted, idiotype-specific enhancing B cell activity differentiated adaptively so as to recognize foreign MHC as self under chimeric conditions. On the other hand, splenic B cells treated with anti-H-2d + complement did not enhance the responses of BALB/c or BALB.B. Even in a chimeric environment, the B cells of C57BL/6 origin could not obtain the ability to generate enhancing B cell activity upon immunization of the idiotype. The results described here, taken in conjunction with our previous studies, suggest that the Ig heavy chain gene(s) predominantly control the Igh restriction properties of enhancing B cells, and the capability of MHC recognition by B cells is selected under chimeric conditions.

  19. Hyperemic peripheral red marrow in a patient with sickle cell anemia demonstrated on Tc-99m labeled red blood cell venography

    SciTech Connect (OSTI)

    Heiden, R.A.; Locko, R.C.; Stent, T.R. (Columbia Univ. College of Physicians and Surgeons, New York, NY (USA))

    1991-03-01T23:59:59.000Z

    A 25-year-old gravid woman, homozygous for sickle cell anemia, with a history of recent deep venous thrombosis, was examined using Tc-99m labeled red blood cell venography for recurrent thrombosis. Although negative for thrombus, the study presented an unusual incidental finding: the patient's peripheral bone marrow was hyperemic in a distribution consistent with peripheral red bone marrow expansion. Such a pattern has not been documented before using this technique. This report supports other literature that has demonstrated hyperemia of peripheral red bone marrow in other hemolytic anemias. This finding may ultimately define an additional role of scintigraphy in assessing the pathophysiologic status of the sickle cell patient.

  20. Booster irradiation to the spleen following total body irradiation. A new immunosuppressive approach for allogeneic bone marrow transplantation

    SciTech Connect (OSTI)

    Lapidot, T.; Singer, T.S.; Salomon, O.; Terenzi, A.; Schwartz, E.; Reisner, Y.

    1988-10-15T23:59:59.000Z

    Graft rejection presents a major obstacle for transplantation of T cell-depleted bone marrow in HLA-mismatched patients. In a primate model, after conditioning exactly as for leukemia patients, it was shown that over 99% of the residual host clonable T cells are concentrated in the spleen on day 5 after completion of cytoreduction. We have now corroborated these findings in a mouse model. After 9-Gy total body irradiation (TBI), the total number of Thy-1.2+ cells in the spleen reaches a peak between days 3 and 4 after TBI. The T cell population is composed of both L3T4 (helper) and Lyt-2 (suppressor) T cells, the former being the major subpopulation. Specific booster irradiation to the spleen (5 Gy twice) on days 2 and 4 after TBI greatly enhances production of donor-type chimera after transplantation of T cell-depleted allogeneic bone marrow. Similar enhancement can be achieved by splenectomy on day 3 or 4 after TBI but not if splenectomy is performed 1 day before TBI or 1 day after TBI, strengthening the hypothesis that, after lethal TBI in mice, the remaining host T cells migrate from the periphery to the spleen. These results suggest that a delayed booster irradiation to the spleen may be beneficial as an additional immunosuppressive agent in the conditioning of leukemia patients, in order to reduce the incidence of bone marrow allograft rejection.

  1. Jefferson Lab Man Donates Bone Marrow to Save 12-Year-Old Boy...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to MCV where he was admitted for the overnight procedure. He received a general anesthesia; then the doctors extracted two liters of bone marrow from his body. The life-saving...

  2. Microfluidic purification and analysis of hematopoietic stem cells from bone Romana Schirhagl,a

    E-Print Network [OSTI]

    Zare, Richard N.

    Microfluidic purification and analysis of hematopoietic stem cells from bone marrow Romana to separate them from a whole-marrow sample. A microfluidic device was fabricated using an integrated membrane are restricted by the limited availability of stem cell sources.2,3 We believe that microfluidics can be used

  3. Mandible versus Long Bone Marrow Cells

    E-Print Network [OSTI]

    Chaichanasakul, Thawinee

    2012-01-01T23:59:59.000Z

    diseases, such as osteoporosis, hyperparathyroidism, orbone density and osteoporosis (Jeffcoat et al. 2000; Kribbsglucocorticoid-induced osteoporosis. Endocrinology, 140(10),

  4. acute bone marrow: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  5. Rational design to control multipotent stromal cell migration for applications in bone tissue engineering and injury repair

    E-Print Network [OSTI]

    Wu, Shan, Ph. D. Massachusetts Institute of Technology

    2011-01-01T23:59:59.000Z

    Multipotent stromal cells derived from bone marrow hold great potential for tissue engineering applications because of their ability to home to injury sites and to differentiate along mesodermal lineages to become osteocytes, ...

  6. Dynamic T{sub 2}-mapping during magnetic resonance guided high intensity focused ultrasound ablation of bone marrow

    SciTech Connect (OSTI)

    Waspe, Adam C.; Looi, Thomas; Mougenot, Charles; Amaral, Joao; Temple, Michael; Sivaloganathan, Siv; Drake, James M. [Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada); Philips Healthcare Canada, Markham, ON, L6C 2S3 (Canada); Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada); Department of Applied Mathematics, University of Waterloo, Waterloo, ON, N2L 3G1 (Canada); Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada)

    2012-11-28T23:59:59.000Z

    Focal bone tumor treatments include amputation, limb-sparing surgical excision with bone reconstruction, and high-dose external-beam radiation therapy. Magnetic resonance guided high intensity focused ultrasound (MR-HIFU) is an effective non-invasive thermotherapy for palliative management of bone metastases pain. MR thermometry (MRT) measures the proton resonance frequency shift (PRFS) of water molecules and produces accurate (<1 Degree-Sign C) and dynamic (<5s) thermal maps in soft tissues. PRFS-MRT is ineffective in fatty tissues such as yellow bone marrow and, since accurate temperature measurements are required in the bone to ensure adequate thermal dose, MR-HIFU is not indicated for primary bone tumor treatments. Magnetic relaxation times are sensitive to lipid temperature and we hypothesize that bone marrow temperature can be determined accurately by measuring changes in T{sub 2}, since T{sub 2} increases linearly in fat during heating. T{sub 2}-mapping using dual echo times during a dynamic turbo spin-echo pulse sequence enabled rapid measurement of T{sub 2}. Calibration of T{sub 2}-based thermal maps involved heating the marrow in a bovine femur and simultaneously measuring T{sub 2} and temperature with a thermocouple. A positive T{sub 2} temperature dependence in bone marrow of 20 ms/ Degree-Sign C was observed. Dynamic T{sub 2}-mapping should enable accurate temperature monitoring during MR-HIFU treatment of bone marrow and shows promise for improving the safety and reducing the invasiveness of pediatric bone tumor treatments.

  7. Immobilized sonic hedgehog N-terminal signaling domain enhances differentiation of bone marrow-derived

    E-Print Network [OSTI]

    Schaffer, David V.

    , and immobilized onto interpenetrating polymer network (IPN) surfaces also grafted with a bone sialoprotein presented to cells using an intrinsically nonfouling interpenetrating polymer network (IPN).12,13 In spite

  8. Towards functional regeneration of the central nervous system : glial calcium signaling in reactive gliosis and the therapeutic potential of bone marrow-derived mesenchymal stem cells for retinal degenerative diseases

    E-Print Network [OSTI]

    Yu, Diana Xuan

    2008-01-01T23:59:59.000Z

    Petri dishes (MatTek Corp. , Ashland MA) at ~200,000 cells/Petri dishes (MatTek Corp. , Ashland MA) at ~200,000 cells/bottom dishes (MakTek, Ashland, MA). Cells were allowed to

  9. In Vivo Evaluation of the Presence of Bone Marrow in Cortical Porosity in Postmenopausal Osteopenic Women

    E-Print Network [OSTI]

    Goldenstein, Janet; Kazakia, Galateia; Majumdar, Sharmila

    2010-01-01T23:59:59.000Z

    bone resorption in osteoporosis. Calcif. Tissue Int. Augat,Porosity in Women with Osteoporosis. Vienna, Austria:porosity in women with osteoporosis. J. Bone Miner. Res.

  10. Engineered nanomedicine for myeloma and bone microenvironment targeting

    E-Print Network [OSTI]

    Swami, Archana

    Bone is a favorable microenvironment for tumor growth and a frequent destination for metastatic cancer cells. Targeting cancers within the bone marrow remains a crucial oncologic challenge due to issues of drug availability ...

  11. A comparison of the concentrations of certain chlorinated hydrocarbons and polychlorinated biphenyls in bone marrow and fat tissue of children and their concentrations in breast milk

    SciTech Connect (OSTI)

    Scheele, J.; Teufel, M.; Niessen, K.H. [Univ. of Heidelberg, Mannheim (Germany)

    1995-12-31T23:59:59.000Z

    Chlorinated hydrocarbon (CHC) and polychlorinated biphenyl (PCB) concentrations in the bone marrow of 57 children were compared with the concentrations in adipose tissue of 50 children and the concentrations in breast milk in the Federal Republic of Germany from 1984 to 1991. The concentrations of hexachlorobenzene (HCB), the dichlorodiphenyl-trichlorethane (DDT)-metabolites, and polychlorinated biphenyl (PCB) congeners no. 138 and no. 153 were increased threefold, while the concentrations of several hexachloro-cyclohexane (HCH)-isomers and PCB congener no. 180 were only increased two fold. Because breast feeding is the primary source of CHC and PCB in toddlers and infants we also compared the concentrations in bone marrow of children with the concentrations in breast milk and found approximately fourfold higher concentrations for the most highly chlorinated PCB congener no. 180, but only threefold higher concentrations for PCB 138 and 153 and the DDT-metabolites. The concentrations of {beta}-HCH and HCB were only slightly higher in bone marrow. 15 refs., 2 figs.

  12. Evaluation of dual energy quantitative CT for determining the spatial distributions of red marrow and bone for dosimetry in internal emitter radiation therapy

    SciTech Connect (OSTI)

    Goodsitt, Mitchell M., E-mail: goodsitt@umich.edu; Shenoy, Apeksha; Howard, David; Christodoulou, Emmanuel; Dewaraja, Yuni K. [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Shen, Jincheng [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States)] [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States); Schipper, Matthew J. [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Wilderman, Scott [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Chun, Se Young [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)] [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)

    2014-05-15T23:59:59.000Z

    Purpose: To evaluate a three-equation three-unknown dual-energy quantitative CT (DEQCT) technique for determining region specific variations in bone spongiosa composition for improved red marrow dose estimation in radionuclide therapy. Methods: The DEQCT method was applied to 80/140 kVp images of patient-simulating lumbar sectional body phantoms of three sizes (small, medium, and large). External calibration rods of bone, red marrow, and fat-simulating materials were placed beneath the body phantoms. Similar internal calibration inserts were placed at vertebral locations within the body phantoms. Six test inserts of known volume fractions of bone, fat, and red marrow were also scanned. External-to-internal calibration correction factors were derived. The effects of body phantom size, radiation dose, spongiosa region segmentation granularity [single (?17 × 17 mm) region of interest (ROI), 2 × 2, and 3 × 3 segmentation of that single ROI], and calibration method on the accuracy of the calculated volume fractions of red marrow (cellularity) and trabecular bone were evaluated. Results: For standard low dose DEQCT x-ray technique factors and the internal calibration method, the RMS errors of the estimated volume fractions of red marrow of the test inserts were 1.2–1.3 times greater in the medium body than in the small body phantom and 1.3–1.5 times greater in the large body than in the small body phantom. RMS errors of the calculated volume fractions of red marrow within 2 × 2 segmented subregions of the ROIs were 1.6–1.9 times greater than for no segmentation, and RMS errors for 3 × 3 segmented subregions were 2.3–2.7 times greater than those for no segmentation. Increasing the dose by a factor of 2 reduced the RMS errors of all constituent volume fractions by an average factor of 1.40 ± 0.29 for all segmentation schemes and body phantom sizes; increasing the dose by a factor of 4 reduced those RMS errors by an average factor of 1.71 ± 0.25. Results for external calibrations exhibited much larger RMS errors than size matched internal calibration. Use of an average body size external-to-internal calibration correction factor reduced the errors to closer to those for internal calibration. RMS errors of less than 30% or about 0.01 for the bone and 0.1 for the red marrow volume fractions would likely be satisfactory for human studies. Such accuracies were achieved for 3 × 3 segmentation of 5 mm slice images for: (a) internal calibration with 4 times dose for all size body phantoms, (b) internal calibration with 2 times dose for the small and medium size body phantoms, and (c) corrected external calibration with 4 times dose and all size body phantoms. Conclusions: Phantom studies are promising and demonstrate the potential to use dual energy quantitative CT to estimate the spatial distributions of red marrow and bone within the vertebral spongiosa.

  13. Cellular response of the primate (M. mulatta) spleen to bone marrow transplantation in gamma irradiated recipients

    E-Print Network [OSTI]

    Fraunfelter, Frank Clare

    1966-01-01T23:59:59.000Z

    . This monkey reminded the author of an animal that was sensitized to a foreign protein. E. Histo atholo of the S leen. Many of the follicles were hyperplastic. The capsule was small and distended. The reticulo- endothelial cells lining the sinusoids were... higher than the radiation con- trols. E. Histo atholo of the S leen. Both spleens had a reduced number of lyrnphocytes and poorly defined follicles. The reticulo- endothelial-like cells were more prominent in the follicles than normal donors...

  14. Interactions between microenvironment and cancer cells in two animal models of bone metastasis

    E-Print Network [OSTI]

    Boyer, Edmond

    1 Interactions between microenvironment and cancer cells in two animal models of bone metastasis of characteristics leading to osteoclastogenesis only in the bone microenvironment. Key words: Bone metastasis;3 INTRODUCTION Bone is a preferential site for metastasis in different types of cancer. Bone metastases induce

  15. Mineralization of Decalcified Bone Occurs Under Cell Culture Conditions and Requires Bovine Serum But Not Cells

    E-Print Network [OSTI]

    Price, Paul A.

    Mineralization of Decalcified Bone Occurs Under Cell Culture Conditions and Requires Bovine Serum mineralization in the absence of cells. For this model, we utilized EDTA- decalcified new-born rat tibias with the cartilaginous ends intact, allowing us to visually determine the spec- ificity of mineralization within the bone

  16. Immune transfer studies in canine allogeneic marrow graft donor-recipient pairs

    SciTech Connect (OSTI)

    Grosse-Wilde, H.; Krumbacher, K.; Schuening, F.D.; Doxiadis, I.; Mahmoud, H.K.; Emde, C.; Schmidt-Weinmar, A.; Schaefer, U.W.

    1986-07-01T23:59:59.000Z

    Transfer of immunity occurring with bone marrow grafting was studied using the dog as a preclinical model. Allogeneic bone marrow transplantation (BMT) was performed between DLA-identical beagle litter-mates. The donors were immunized with tetanus toxoid (TT) or sheep red blood cells (SRBC), and their humoral response was monitored by hemagglutination. The recipients of bone marrow from TT-immunized donors showed a marked increase of antibody titer one week posttransplantation, while in the recipients of marrow from SRBC immunized donors the antibody titers were considerably lower. Within the following 60 days the antibody titers in both groups diminished gradually to pregrafting levels. Control experiments in which cell-free plasma from donors immunized with TT and SRBC respectively was transfused indicated that the initial rise of specific antibody titers after marrow grafting is likely to be due to a passive transfer of humoral immunity. A single challenge of these marrow graft recipients with the respective antigen 15-18 weeks posttransplantation led to a secondary type of humoral immune response. It could be demonstrated that transfer of memory against TT or SRBC was independent from the actual antibody titer and the time of vaccination of the donor. One dog was immunized with TT after serving as marrow donor. When the donor had shown an antibody response, a peripheral blood leukocytes (PBL) transfusion was given to his chimera. Subsequent challenge of the latter resulted in a secondary type of specific antibody response. This indicates that specific cellular-bound immunological memory can be transferred after BMT from the donor to his allogeneic bone marrow chimera by transfusion of peripheral blood leukocytes. The data may be of importance in clinical BMT to protect patients during the phase of reduced immune reactivity by transfer of memory cells.

  17. Notch signalling pathway in murine embryonic stem cell derived haematopoiesis 

    E-Print Network [OSTI]

    Huang, Caoxin

    2013-07-06T23:59:59.000Z

    Haematopoiesis is the process to produce haematopoietic stem cells (HSCs), haematopoietic progenitors (HPCs) and terminally differentiated cell types. In the adult, HSCs resided in bone marrow while in the embryo, ...

  18. Bone Marrow Transplantation Alters the Tremor Phenotype in the Murine Model of Globoid-Cell Leukodystrophy

    E-Print Network [OSTI]

    Reddy, Adarsh S.; Wozniak, David F.; Farber, Nuri B.; Dearborn, Joshua T.; Fowler, Stephen C.; Sands, Mark S.

    2012-01-19T23:59:59.000Z

    the damaging effects of conditioning radiation and BMT in the neonatal period. The behavioral methodology used herein provides a quantitative approach for assessing the efficacy of potential therapeutic interventions for Krabbe’s disease....

  19. Molecular mechanisms mediating retinal reactive gliosis following bone marrow mesenchymal stem cell (BM-MSC) transplantation

    E-Print Network [OSTI]

    Tassoni, Alessia; Gutteridge, Alex; Barber, Amanda C.; Osborne, Andrew; Martin, Keith R.

    2015-01-01T23:59:59.000Z

    found in vivo that intravitreal BM-MSC transplantation is associated with gliosis-mediated retinal folding, up-regulation of intermediate filaments and recruitment of macrophages. These responses were accompanied by significant JAK/STAT3 and MAPK (ERK1...

  20. Secreted Factors from Bone Marrow Stromal Cells Upregulate IL-10 and Reverse Acute Kidney Injury

    E-Print Network [OSTI]

    Milwid, John Miles

    2012-01-01T23:59:59.000Z

    Acute kidney injury is a devastating syndrome that afflicts over 2,000,000 people in the US per year, with an associated mortality of greater than 70% in severe cases. Unfortunately, standard-of-care treatments are not ...

  1. The effects of physiological age on bone marrow-derived mesenchymal stem cells

    E-Print Network [OSTI]

    Buckspan, Caitlin

    2010-01-01T23:59:59.000Z

    1548. 41. Marcus, R. Osteoporosis: Volume 1. Elsevier, 2008.and D.P. Kiel (Eds. ) Osteoporosis in Older Persons (p. 19-and in patients with osteoporosis. Biogerontology, 2001. 2:

  2. Frontal and orbital bone infarctions causing periorbital swelling in patients with sickle cell anemia

    SciTech Connect (OSTI)

    Garty, I.; Koren, A.; Garzozi, H.

    1984-10-01T23:59:59.000Z

    Two cases of unilateral and bilateral periorbital hematomas occurred in patients with sickle cell anemia. The cause of periorbital swelling in these cases was found to be orbital and frontal bone infarctions, respectively, diagnosed by technetium Tc 99m medronate bone scintigraphy. To our knowledge, periorbital bone infarction, as a part of the differential diagnosis of periorbital hematoma and as part of the possible ocular manifestations in patients with sickle cell anemia, has not previously been described.

  3. Targeting bone-microenvironment-tumour cell interactions : IGF-1 receptor kinase inhibitors. 

    E-Print Network [OSTI]

    Logan, John Gordon

    2012-11-30T23:59:59.000Z

    Bone metastases are a frequent clinical complication associated with cancer. The aim of this PhD thesis was to set up a model system for the study of tumour cellbone cell interactions in vitro, ex vivo and in vivo and ...

  4. Bilateral diffuse pulmonary ectopic ossification after marrow allograft in a dog. Evidence for allotransplantation of hemopoietic and mesenchymal stem cells

    SciTech Connect (OSTI)

    Sale, G.E.; Storb, R.

    1983-11-01T23:59:59.000Z

    In light of recent studies showing successful transplantation of both bony and stromal elements by marrow transplantation, we report an unexpected phenomenon occurring in a canine radiation chimera. Nine hundred fifty-six days after a successful and uneventful DLA-matched marrow allograft, a dog suddenly died of respiratory failure. Autopsy revealed extensive ossification of the lungs with multiple sites of trilineage marrow engraftment. The entire complement of bony elements can apparently be allografted using marrow grafting techniques.

  5. Quantitative correlations among human mesenchymal stem cell mechanical properties and biological function

    E-Print Network [OSTI]

    Jolibois-Quinot, Remi

    2013-01-01T23:59:59.000Z

    Mesenchymal stem cells (MSCs) are derived from bone marrow, and are capable of proliferating and differentiating along multiple pathways such as osteoblasts, chondrocytes and adipocytes. MSCs offer the means for regenerative ...

  6. Osteogenic precursor cells in reparative osteogenesis

    SciTech Connect (OSTI)

    Mikhailova, L.N.; Pal'tsyn, A.A.

    1986-11-01T23:59:59.000Z

    The authors aim to discover osteogenic precursor cells in chinchilla rabbits appearing in the medullary cavity after removal of bone marrow. For this purpose the authors modified a model of medullary curettage. Pieces of tissue for electron-microscope autoradiography were incubated in medium with /sup 3/H-thymidine. To discover the proliferative properties of cells of the regenerating bone marrow tissue, an electron-microscopic autoradiographic investigation was carried out. It was found that DNA synthesis took place mainly in undifferentiated cells, endothelial cells, and differentiated cells.

  7. From a Dry Bone to a Genetic Portrait: A Case Study of Sickle Cell Anemia

    E-Print Network [OSTI]

    From a Dry Bone to a Genetic Portrait: A Case Study of Sickle Cell Anemia MARINA FAERMAN,1* ALMUT identification; Y chromosome polymorphic markers; sickle cell anemia ABSTRACT The potential and reliability sample, which represented a documented case of sickle cell anemia. -globin gene sequences obtained from

  8. alveolar bone cells: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  9. Origin of hemopoietic stromal progenitor cells in chimeras

    SciTech Connect (OSTI)

    Chertkov, J.L.; Drize, N.J.; Gurevitch, O.A.; Samoylova, R.S.

    1985-12-01T23:59:59.000Z

    Intravenously injected bone marrow cells do not participate in the regeneration of hemopoietic stromal progenitors in irradiated mice, nor in the curetted parts of the recipient's marrow. The hemopoietic stromal progenitors in allogeneic chimeras are of recipient origin. The adherent cell layer (ACL) of long-term cultures of allogeneic chimera bone marrow contains only recipient hemopoietic stromal progenitors. However, in ectopic hemopoietic foci produced by marrow implantation under the renal capsule and repopulated by the recipient hemopoietic cells after irradiation and reconstitution by syngeneic hemopoietic cells, the stromal progenitors were of implant donor origin, as were stromal progenitors of the ACL in long-term cultures of hemopoietic cells from ectopic foci. Our results confirm that the stromal and hemopoietic progenitors differ in origin and that hemopoietic stromal progenitors are not transplantable by the intravenous route in mice.

  10. The Application of Flow Cytometry to Examine Damage Clearance in Stem Cells From Whole-Body Irradiated Mice

    SciTech Connect (OSTI)

    Marples, Brian; Kovalchuk, Olga; McGonagle, Michele; Martinez, Alvaro; Wilson, George, D.

    2010-02-26T23:59:59.000Z

    The bone marrow contains many types of cells. Approximately 1-2% of these cells are critical for life, these are the so-called ‘bone marrow stem cells’ which divide indefinitely to produce platelets, red blood cells and white blood cells. Death of the bone marrow stem cells results in a diminished ability of the organism to make new blood cell components and can be fatal without medical intervention, such as a bone marrow transplant. Bone marrow stem cells are considered to be particularly sensitive to radiation injury. Therefore, it is important to understand how these cells response to total body radiation exposure and how these cells can be protected from radiation damage. The aim of this project was to determine if these critical cells in the bone marrow are susceptible to short-term and long-term injury after a whole-body exposure to a sub-lethal low dose of ionizing radiation. The overall aims were to determine if the extent of injury produced by the sub-lethal radiation exposure would be cleared from the stem cells and therefore present no long- term genetic risk to the organism, or if the radiation injury persisted and had an adverse long-term consequences for the cell genome. This research question is of interest in order to define the risks to exposed persons after occupational, accidental or terrorism-related sub-lethal low-dose radiation exposures. The novel aspect of this project was the methodology used to obtain the bone marrow stem cell-like cells and examining the outcomes of sub-lethal low-dose radiation in a mammalian animal model. Four radiation treatments were used: single treatments of 0.01Gy, 0.1 Gy, 1 Gy and ten treatments of 0.1 Gy given over 10 days. Bone marrow stem cell-like cells were then harvested 6 hours, 24 hours and 24 days later. The levels of radiation-induced cell death, damage to DNA and permanent changes to cellular DNA were measured in the isolated stem cell-like cells after each radiation treatment and time point and then the results were compared. As expected, the largest radiation dose produced the greatest level of damage but a linear relationship did not exist between cellular effects and radiation dose. The low dose exposures appeared to be more efficient at producing damage than the highest dose when normalized for the initial extent of damage. Additionally, immune stimulation given prior to radiation exposure appeared to protect the critical bone marrow stem cell population from radiation injury. The data suggest that the response of bone marrow stem-cell like cells to radiation injury is dependent on the extent of the initial levels of damage and the effects of total-body low-dose exposures can not be predicted by extrapolating from high dose exposures. This research has provided new information about the radiation sensitivity of bone marrow stem cell-like cells following total-body exposures, and suggests that these critical cells might be more sensitive to radiation than more mature cells in the bone marrow. Further work is need with intermediate radiation doses to confirm this conclusion.

  11. Effect of arthroscopic cartilage defect repair with bone marrow derived cells on the lubricant properties of synovial fluid :

    E-Print Network [OSTI]

    Grissom, Murray J.

    2011-01-01T23:59:59.000Z

    1995. 59(3): p. 205-12. Saari, H. , Y.T. Konttinen, R.M.Res, 1999. 17: p. 475-87. Saari, H. , Y.T. Konttinen, R.M.

  12. Effect of arthroscopic cartilage defect repair with bone marrow derived cells on the lubricant properties of synovial fluid :

    E-Print Network [OSTI]

    Grissom, Murray J.

    2011-01-01T23:59:59.000Z

    0.25 MDa ranges. NL equine SF (eSF), between 2-3 MDa, but the method of high-upper detection limit of 3 MDa [96]. Studies on human SF (

  13. Human adipose tissue-derived mesenchymal stem cells differentiate into insulin, somatostatin, and glucagon expressing cells

    SciTech Connect (OSTI)

    Timper, Katharina [Department of Research, University Hospital, Basel (Switzerland); Seboek, Dalma [Department of Research, University Hospital, Basel (Switzerland); Eberhardt, Michael [Department of Research, University Hospital, Basel (Switzerland); Linscheid, Philippe [Department of Research, University Hospital, Basel (Switzerland); Christ-Crain, Mirjam [Division of Endocrinology, Diabetes and Clinical Nutrition, University Hospital, Basel (Switzerland); Keller, Ulrich [Department of Research, University Hospital, Basel (Switzerland); Division of Endocrinology, Diabetes and Clinical Nutrition, University Hospital, Basel (Switzerland); Mueller, Beat [Department of Research, University Hospital, Basel (Switzerland); Division of Endocrinology, Diabetes and Clinical Nutrition, University Hospital, Basel (Switzerland); Zulewski, Henryk [Department of Research, University Hospital, Basel (Switzerland) and Division of Endocrinology, Diabetes and Clinical Nutrition, University Hospital, Basel (Switzerland)]. E-mail: henryk.zulewski@unibas.ch

    2006-03-24T23:59:59.000Z

    Mesenchymal stem cells (MSC) from mouse bone marrow were shown to adopt a pancreatic endocrine phenotype in vitro and to reverse diabetes in an animal model. MSC from human bone marrow and adipose tissue represent very similar cell populations with comparable phenotypes. Adipose tissue is abundant and easily accessible and could thus also harbor cells with the potential to differentiate in insulin producing cells. We isolated human adipose tissue-derived MSC from four healthy donors. During the proliferation period, the cells expressed the stem cell markers nestin, ABCG2, SCF, Thy-1 as well as the pancreatic endocrine transcription factor Isl-1. The cells were induced to differentiate into a pancreatic endocrine phenotype by defined culture conditions within 3 days. Using quantitative PCR a down-regulation of ABCG2 and up-regulation of pancreatic developmental transcription factors Isl-1, Ipf-1, and Ngn3 were observed together with induction of the islet hormones insulin, glucagon, and somatostatin.

  14. DU145 human prostate cancer cells express functional Receptor Activator of NF-B: New insights in the prostate cancer bone metastasis process.

    E-Print Network [OSTI]

    Boyer, Edmond

    in the prostate cancer bone metastasis process. Mori K.1, 2, * , Le Goff B. 1, 2 , Charrier C. 1, 2 , Battaglia S cells, thus facilitating prostate cancer metastasis development in bone. We confirm that RANKL is a factor that facilitates metastasis to bone by acting as an activator of both osteoclasts and RANK

  15. Post-bone-marrow-transplant leukemia cutis

    E-Print Network [OSTI]

    2013-01-01T23:59:59.000Z

    of myeloid neoplasms and acute leukemia: rationale andextramedullary acute myeloid leukemia. Blood . 2011 Oct 6;transplantation for acute myelogenous leukemia with leukemia

  16. Contrasting Effects of Vasculogenic Induction Upon Biaxial Bioreactor Stimulation of Mesenchymal Stem Cells and Endothelial Progenitor Cells Cocultures in Three-Dimensional Scaffolds under in Vitro and in Vivo Paradigms for Vascularized Bone Tissue Engineering

    E-Print Network [OSTI]

    Liu, Yuchun

    Clinical translation of bone tissue engineering approaches for fracture repair has been hampered by inadequate vascularization required for maintaining cell survival, skeletal regeneration, and remodeling. The potential ...

  17. Contrasting Effects of Vasculogenic Induction Upon Biaxial Bioreactor Stimulation of Mesenchymal Stem Cells and Endothelial Progenitor Cells Cocultures in Three-Dimensional Scaffolds Under In Vitro and In Vivo Paradigms for Vascularized Bone Tissue Engineering

    E-Print Network [OSTI]

    Teoh, Swee-Hin

    Clinical translation of bone tissue engineering approaches for fracture repair has been hampered by inadequate vascularization required for maintaining cell survival, skeletal regeneration, and remodeling. The potential ...

  18. Gene Expression Profile of Mesenchymal Stem Cells from Paired Umbilical Cord Units: Cord is Different from Blood

    E-Print Network [OSTI]

    2009-01-01T23:59:59.000Z

    2002). Gene expression profile of human bone marrow stromal2003). Gene expression profile of mouse bone marrow stromalRNA (ncRNA) expression profiles of MSC from match-paired UC

  19. adverse events bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    marrow disease Daldrup-Link, H E; Henning, T; Link, T M 2007-01-01 316 Bone loss during energy restriction: mechanistic role of leptin Texas A&M University - TxSpace Summary:...

  20. Immunosuppression prior to marrow transplantation for sensitized aplastic anemia patients: comparison of TLI with TBI

    SciTech Connect (OSTI)

    Shank, B.; Brochstein, J.A.; Castro-Malaspina, H.; Yahalom, J.; Bonfiglio, P.; O'Reilly, R.J.

    1988-06-01T23:59:59.000Z

    From May 1980 through July 1986, 26 patients with severe aplastic anemia, sensitized with multiple transfusions of blood products, were treated on either of two immunosuppressive regimens in preparation for bone marrow transplantation from a matched donor. There were 10 patients treated with total body irradiation (TBI), 200 cGy/fraction X 4 daily fractions (800 cGy total dose), followed by cyclophosphamide, 60 mg/kg/d X 2 d. An additional 16 patients were treated with total lymphoid irradiation (TLI) (or, if they were infants, a modified TLI or thoracoabdominal irradiation (TAI)), 100 cGy/fraction, 3 fractions/d X 2 d (600 cGy total dose), followed by cyclophosphamide, 40 mg/kg/d X 4 d. The extent of immunosuppression was similar in both groups as measured by peripheral blood lymphocyte depression at the completion of the course of irradiation (5% of initial concentration for TBI and 24% for TLI), neutrophil engraftment (10/10 for TBI and 15/16 for TLI), and time to neutrophil engraftment (median of 22 d for TBI and 17 d for TLI). Marrow and peripheral blood cytogenetic analysis for assessment of percent donor cells was also compared in those patients in whom it was available. 2/2 patients studied with TBI had 100% donor cells, whereas 6/11 with TLI had 100% donor cells. Of the five who did not, three were stable mixed chimeras with greater than or equal to 70% donor cells, one became a mixed chimera with about 50% donor cells, but became aplastic again after Cyclosporine A cessation 5 mo post-transplant, and the fifth reverted to all host cells by d. 18 post-transplant. Overall actuarial survival at 2 years was 56% in the TLI group compared with 30% in the TBI group although this was not statistically significant. No survival decrement has been seen after 2 years in either group.

  1. Revised estimates of electron absorbed fractions and radionuclide S-values in trabecular bone

    E-Print Network [OSTI]

    Parry, Robert Alan

    1995-01-01T23:59:59.000Z

    of trabecular bone in the skeleton. (Adapted from ICRP 1975). 45 Table 5. 3. Relative weights of dry bones as percentages of total skeleton. (Adapted from ICRP 1975), 45 Table 5. 4. Fractional distribution of red marrow in the skeleton. (Adapted from ICRP... Table 6. 3. Average and maximum beta-particle energy for selected radionuclides. 69 Table 6. 4. S-values for sources in the marrow (in mGy'A4Bq 's '). Target: Marrow 7l Table 6. 5. S-values for sources in the marrow (in mGyMBq 's ') Target...

  2. Time-dependent mechanical behavior of newly developing matrix of bovine primary chondrocytes and bone marrow stromal cells using Atomic Force Microscopy

    E-Print Network [OSTI]

    Lee, BoBae

    2009-01-01T23:59:59.000Z

    Introduction: Articular cartilage chondrocytes are solely responsible for the synthesis, assembly, and maintenance of the extracellular matrix (ECM) and yet occupy <10% of the cartilage tissue volume. Chondrocytes (equilibrium ...

  3. In vitro and in vivo growth factor delivery to chondrocytes and bone-marrow-derived stromal cells in cartilage and in self-assembling peptide scaffolds

    E-Print Network [OSTI]

    Miller, Rachel E. (Rachel Elizabeth)

    2010-01-01T23:59:59.000Z

    The inability of articular cartilage to repair itself after acute injury has been implicated in the development of osteoarthritis. The objective of this work was to develop methods for delivering growth factors to cartilage ...

  4. Protrusio acetabuli in sickle-cell anemia

    SciTech Connect (OSTI)

    Martinez, S.; Apple, J.S.; Baber, C.; Putman, C.E.; Rosse, W.F.

    1984-04-01T23:59:59.000Z

    Of 155 adults with sickle-cell anemia (SS, SC), radiographs of the pelvis or hip demonstrated protrusio acetabuli on at least one side in 14 (3 men and 11 women), as indicated by projection of the acetabular line medial to the ilio-ischial line. All 14 patients had bone changes attributable to sickle-cell anemia, including marrow hyperplasia and osteonecrosis; however, the severity of femoral or acetabular osteonecrosis did not appear directly related to the protrusion. The authors conclude that sickle-cell anemia can predispose to development of protrusio acetabuli.

  5. marrow with beans and corn

    E-Print Network [OSTI]

    When the marrow is *almost* cooked, add the beans and the sweetcorn and cook until the ... If you do need to add water during cooking, keep it to a minimum.

  6. Radiobiological modelling with MarCell software

    SciTech Connect (OSTI)

    Hasan, J.S.; Jones, T.D.

    1996-10-01T23:59:59.000Z

    Jones introduced a bone marrow radiation cell kinetics model with great potential for application in the fields of health physics, radiation research, and medicine. However, until recently, only the model developers have been able to apply it because of the complex array of biological and physical assignments needed for evaluation of a particular radiation exposure protocol. The purpose of this article is to illustrate the use of MarCell (MARrow CELL Kinetics) software for MS-DOS, a user-friendly computer implementation of that mathematical model that allows almost anyone with an elementary knowledge of radiation physics and/or medical procedures to apply the model. A hands-on demonstration of the software will be given by guiding the user through evaluation of a medical total body irradiation protocol and a nuclear fallout scenario. A brief overview of the software is given in the Appendix.

  7. attenuates bone cancer-induced: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2007-01-01 300 MR imaging of therapy-induced changes of bone marrow University of California eScholarship Repository Summary: Treatment effects due to irradiation, chemotherapy...

  8. Computational analysis of whole body CT documents a bone structure alteration in adult advanced chronic lymphocytic leukemia

    E-Print Network [OSTI]

    Piana, Michele

    progression. PET/CT images were analyzed using dedicated software, able to recognize an external 2-pixel bone ring whose Hounsfield coefficient served as cut off to recognize trabecular and compact bone. PET/CT of the disease. Keywords: Image Analysis, Bone Marrow, Skeletal Structure, ACLL, PET/CT #12;3 Introduction

  9. acquired bone marrow: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    S. , Oklahoma State University; D. V. M. , Oklahoma State University Directed by: Dr. Chester A. Gleiser The study was designed to determine... the effects of nutritional...

  10. MR imaging of therapy-induced changes of bone marrow

    E-Print Network [OSTI]

    Daldrup-Link, H E; Henning, T; Link, T M

    2007-01-01T23:59:59.000Z

    applications, compared to PET-CT because of the improvedimaging methods, such as PET-CT and PET- MR in the treatment

  11. Self-assembling peptide hydrogels promote in vitro chondrogenesis of bone marrow-derived stromal cells : effects of peptide sequence, cell donor age, and method of growth factor delivery

    E-Print Network [OSTI]

    Kopesky, Paul Wayne

    2009-01-01T23:59:59.000Z

    The inability of articular cartilage to heal after damage or disease has motivated investigation of novel cartilage tissue engineering technologies. The objective of this thesis was to advance the use of self-assembling ...

  12. Fibroblast growth factor 2 inhibits up-regulation of bone morphogenic proteins and their receptors during osteoblastic differentiation of human mesenchymal stem cells

    SciTech Connect (OSTI)

    Biver, Emmanuel, E-mail: ebiver@yahoo.fr [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France) [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Department of Rheumatology, Lille University Hospital, Roger Salengro Hospital, 59037 Lille cedex (France); Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland); Soubrier, Anne-Sophie [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France) [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Department of Rheumatology, Lille University Hospital, Roger Salengro Hospital, 59037 Lille cedex (France); Thouverey, Cyril [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland)] [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland); Cortet, Bernard [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France) [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Department of Rheumatology, Lille University Hospital, Roger Salengro Hospital, 59037 Lille cedex (France); Broux, Odile [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France)] [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Caverzasio, Joseph [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland)] [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland); Hardouin, Pierre [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France)] [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France)

    2012-11-02T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer FGF modulates BMPs pathway in HMSCs by down-regulating BMP/BMPR expression. Black-Right-Pointing-Pointer This effect is mediated by ERK and JNK MAPKs pathways. Black-Right-Pointing-Pointer Crosstalk between FGF and BMPs must be taken into account in skeletal bioengineering. Black-Right-Pointing-Pointer It must also be considered in the use of recombinant BMPs in orthopedic and spine surgeries. -- Abstract: Understanding the interactions between growth factors and bone morphogenic proteins (BMPs) signaling remains a crucial issue to optimize the use of human mesenchymal stem cells (HMSCs) and BMPs in therapeutic perspectives and bone tissue engineering. BMPs are potent inducers of osteoblastic differentiation. They exert their actions via BMP receptors (BMPR), including BMPR1A, BMPR1B and BMPR2. Fibroblast growth factor 2 (FGF2) is expressed by cells of the osteoblastic lineage, increases their proliferation and is secreted during the healing process of fractures or in surgery bone sites. We hypothesized that FGF2 might influence HMSC osteoblastic differentiation by modulating expressions of BMPs and their receptors. BMP2, BMP4, BMPR1A and mainly BMPR1B expressions were up-regulated during this differentiation. FGF2 inhibited HMSCs osteoblastic differentiation and the up-regulation of BMPs and BMPR. This effect was prevented by inhibiting the ERK or JNK mitogen-activated protein kinases which are known to be activated by FGF2. These data provide a mechanism explaining the inhibitory effect of FGF2 on osteoblastic differentiation of HMSCs. These crosstalks between growth and osteogenic factors should be considered in the use of recombinant BMPs in therapeutic purpose of fracture repair or skeletal bioengineering.

  13. VEGF improves survival of mesenchymal stem cells in infarcted hearts

    SciTech Connect (OSTI)

    Pons, Jennifer [Cardiovascular Research Institute, University of California, San Francisco, San Francisco, CA (United States); Huang Yu; Arakawa-Hoyt, Janice; Washko, Daniel [Department of Medicine, University of California, San Francisco, San Francisco, CA (United States); Takagawa, Junya; Ye, Jianqin [Division of Cardiology, University of California, San Francisco, San Francisco, CA (United States); Grossman, William [Department of Medicine, University of California, San Francisco, San Francisco, CA (United States); Division of Cardiology, University of California, San Francisco, San Francisco, CA (United States); Su Hua [Cardiovascular Research Institute, University of California, San Francisco, San Francisco, CA (United States); Department of Anesthesia and Perioperative, University of California, San Francisco, 1001 Potrero Avenue, Room 3C-38, San Francisco, CA 94110 (United States)], E-mail: hua.su@ucsf.edu

    2008-11-14T23:59:59.000Z

    Bone marrow-derived mesenchymal stem cells (MSC) are a promising source for cell-based treatment of myocardial infarction (MI), but existing strategies are restricted by low cell survival and engraftment. We examined whether vascular endothelial growth factor (VEGF) improve MSC viability in infracted hearts. We found long-term culture increased MSC-cellular stress: expressing more cell cycle inhibitors, p16{sup INK}, p21 and p19{sup ARF}. VEGF treatment reduced cellular stress, increased pro-survival factors, phosphorylated-Akt and Bcl-xL expression and cell proliferation. Co-injection of MSCs with VEGF to MI hearts increased cell engraftment and resulted in better improvement of cardiac function than that injected with MSCs or VEGF alone. In conclusion, VEGF protects MSCs from culture-induce cellular stress and improves their viability in ischemic myocardium, which results in improvements of their therapeutic effect for the treatment of MI.

  14. Elevated extracellular calcium increases expression of bone morphogenetic protein-2 gene via a calcium channel and ERK pathway in human dental pulp cells

    SciTech Connect (OSTI)

    Tada, Hiroyuki [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)] [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Nemoto, Eiji, E-mail: e-nemoto@umin.ac.jp [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)] [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Kanaya, Sousuke; Hamaji, Nozomu; Sato, Hisae; Shimauchi, Hidetoshi [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)] [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)

    2010-04-16T23:59:59.000Z

    Dental pulp cells, which have been shown to share phenotypical features with osteoblasts, are capable of differentiating into odontoblast-like cells and generating a dentin-like mineral structure. Elevated extracellular Ca{sup 2+}Ca{sub o}{sup 2+} has been implicated in osteogenesis by stimulating the proliferation and differentiation of osteoblasts; however, the role of Ca{sub o}{sup 2+} signaling in odontogenesis remains unclear. We found that elevated Ca{sub o}{sup 2+} increases bone morphogenetic protein (BMP)-2 gene expression in human dental pulp cells. The increase was modulated not only at a transcriptional level but also at a post-transcriptional level, because treatment with Ca{sup 2+} increased the stability of BMP-2 mRNA in the presence of actinomycin D, an inhibitor of transcription. A similar increase in BMP-2 mRNA level was observed in other human mesenchymal cells from oral tissue; periodontal ligament cells and gingival fibroblasts. However, the latter cells exhibited considerably lower expression of BMP-2 mRNA compared with dental pulp cells and periodontal ligament cells. The BMP-2 increase was markedly inhibited by pretreatment with an extracellular signal-regulated kinase (ERK) inhibitor, PD98059, and partially inhibited by the L-type Ca{sup 2+} channels inhibitor, nifedipine. However, pretreatment with nifedipine had no effect on ERK1/2 phosphorylation triggered by Ca{sup 2+}, suggesting that the Ca{sup 2+} influx from Ca{sup 2+} channels may operate independently of ERK signaling. Dental pulp cells do not express the transcript of Ca{sup 2+}-sensing receptors (CaSR) and only respond slightly to other cations such as Sr{sup 2+} and spermine, suggesting that dental pulp cells respond to Ca{sub o}{sup 2+} to increase BMP-2 mRNA expression in a manner different from CaSR and rather specific for Ca{sub o}{sup 2+} among cations.

  15. Bone-derived mesenchymal stromal cells from HIV transgenic mice exhibit altered proliferation, differentiation capacity and paracrine functions along with impaired therapeutic potential in kidney injury

    SciTech Connect (OSTI)

    Cheng, Kang; Rai, Partab; Lan, Xiqian; Plagov, Andrei; Malhotra, Ashwani [Feinstein Institute for Medical Research, North Shore-Long Island Jewish Health System, Manhassett, NY (United States); Gupta, Sanjeev [Departments of Medicine and Pathology, Marion Bessin Liver Research Center, Diabetes Center, Cancer Center, Ruth L. and David S. Gottesman Institute for Stem Cell and Regenerative Medicine Research, Institute for Clinical and Translational Research, Albert Einstein College of Medicine, Bronx, NY (United States); Singhal, Pravin C., E-mail: psinghal@nshs.edu [Feinstein Institute for Medical Research, North Shore-Long Island Jewish Health System, Manhassett, NY (United States)

    2013-08-15T23:59:59.000Z

    Mesenchymal stem cells (MSCs) secrete paracrine factors that could be cytoprotective and serve roles in immunoregulation during tissue injury. Although MSCs express HIV receptors, and co-receptors, and are susceptible to HIV infection, whether HIV-1 may affect biological properties of MSCs needs more study. We evaluated cellular proliferation, differentiation and paracrine functions of MSCs isolated from compact bones of healthy control mice and Tg26 HIV-1 transgenic mice. The ability of MSCs to protect against cisplatin toxicity was studied in cultured renal tubular cells as well as in intact mice. We successfully isolated MSCs from healthy mice and Tg26 HIV-1 transgenic mice and found the latter expressed viral Nef, Vpu, NL4-3 and Vif genes. The proliferation and differentiation of Tg26 HIV-1 MSCs was inferior to MSCs from healthy mice. Moreover, transplantation of Tg26 HIV-1 MSCs less effectively improved outcomes compared with healthy MSCs in mice with acute kidney injury. Also, Tg26 HIV-1 MSCs secreted multiple cytokines, but at significantly lower levels than healthy MSCs, which resulted in failure of conditioned medium from these MSCs to protect cultured renal tubular cells from cisplatin toxicity. Therefore, HIV-1 had adverse biological effects on MSCs extending to their proliferation, differentiation, function, and therapeutic potential. These findings will help in advancing mechanistical insight in renal injury and repair in the setting of HIV-1 infection. -- Highlights: •MSCs isolated from HIV mice displayed HIV genes. •MSCs isolated from HIV mice exhibited attenuated growth and paracrine functions. •AKI mice with transplanted HIV-MSC displayed poor outcome. •HIV-1 MSC secreted multiple cytokines but at a lower level.

  16. Long-lived IgE- and IgG-secreting cells in rodents manifesting persistent antibody responses

    SciTech Connect (OSTI)

    Holt, P.G.; Sedgwick, J.D.; O'Leary, C.; Krska, K.; Leivers, S.

    1984-12-01T23:59:59.000Z

    BALB/c mice and BN rats manifesting persistent IgE and IgG responses were examined up to 1 year after immunization. A significant proportion of the ongoing antibody response in these animals survived lethal X-irradiation employing dosages sufficient to deplete B memory cells. The persistent IgE responses in both species were refractory to exogenous isotype-specific suppressor cells taken from tolerant syngeneic animals, which were shown to abrogate primary IgE responses in parallel tests. Employing a novel ELISA-based assay for plaque forming cells, long-lived radioresistant IgE- and IgG-secreting cells were identified in differing ratios in lymph nodes, spleen, and bone marrow of both species. These long-lived cells were shown to arise following maximum antigenic challenge with antigen plus adjuvant, and after repeated low-grade stimulation by antigen alone, including passive inhalation of dilute antigen aerosols.

  17. INVEST IN YOUR BONES Bone Basics

    E-Print Network [OSTI]

    replace- ment at menopause may prevent bone loss and/or osteoporosis. Also find out if there is a need in your bones? Osteoporosis, a major health problem in America, affects over 10 million persons, with 34 million at a high risk of developing the disease (National Osteoporosis Foundation, 2010). Dubbed

  18. Bone Canonical WNT/B-Catenin Signaling in Models of Reduced Microgravity

    E-Print Network [OSTI]

    Macias, Brandon 1979-

    2012-10-25T23:59:59.000Z

    translates into molecular osteogenic signals in bone cells is unknown. Radiation exposure is another potent inducer of bone loss, namely observed on Earth in the clinical setting following radiotherapy procedures. It is expected that long duration space...

  19. Non-invasive shock wave stimulated periosteum for bone tissue engineering

    E-Print Network [OSTI]

    Kearney, Cathal (Cathal John)

    2011-01-01T23:59:59.000Z

    The cambium cells of the periosteum, which are known osteoprogenitor cells, have limited suitability for clinical applications of bone tissue engineering due to their low cell number (2-5 cells thick). Extracorporeal shock ...

  20. Protocadherin-7 induces bone metastasis of breast cancer

    SciTech Connect (OSTI)

    Li, Ai-Min [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China)] [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China); Tian, Ai-Xian [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Zhang, Rui-Xue [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China)] [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China); Ge, Jie [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Sun, Xuan [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Cao, Xu-Chen, E-mail: caoxuch@126.com [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)

    2013-07-05T23:59:59.000Z

    Highlights: •PCDH7 is overexpression in high bone metastatic MDA-MB-231 cells. •PCDH7 is up-regulation in bone metastatic breast cancer tissues. •Suppression of PCDH7 inhibits cell proliferation, migration, and invasion in vitro. •PCDH7 induces breast cancer bone metastasis in vivo. -- Abstract: Breast cancer had a propensity to metastasize to bone, resulting in serious skeletal complications associated with poor outcome. Previous study showed that Protocadherin-7 (PCDH7) play an important role in brain metastatic breast cancer, however, the role of PCDH7 in bone metastatic breast cancer has never been explored. In the present study, we found that PCDH7 expression was up-regulation in bone metastatic breast cancer tissues by real-time PCR and immunohistochemistry assays. Furthermore, suppression of PCDH7 inhibits breast cancer cell proliferation, migration, and invasion in vitro by MTT, scratch, and transwell assays. Most importantly, overexpression of PCDH7 promotes breast cancer cell proliferation and invasion in vitro, and formation of bone metastasis in vivo. These data provide an important insight into the role of PCDH7 in bone metastasis of breast cancer.

  1. Soluble epoxide hydrolase regulates hematopoietic progenitor cell function via generation of fatty

    E-Print Network [OSTI]

    Hammock, Bruce D.

    formation), but the sEH products 12,13-dihydroxyoctadecenoic acid (12,13-DiHOME) and 11,12- dihydroxyeicosatrienoic acid stimulated canonical Wnt signaling and rescued the effects of sEH inhibition. In murine bone either the restoration of bone marrow sEH activity or treatment with 12,13-DiHOME. Thus, sEH activity

  2. Identification and enrichment of colony-forming cells from the adult murine pituitary

    SciTech Connect (OSTI)

    Lepore, D.A. [Pituitary Research Unit, Murdoch Childrens Research Institute, Royal Children's Hospital, Parkville, Victoria 3052 (Australia); Roeszler, K. [Pituitary Research Unit, Murdoch Childrens Research Institute, Royal Children's Hospital, Parkville, Victoria 3052 (Australia); Wagner, J. [Pituitary Research Unit, Murdoch Childrens Research Institute, Royal Children's Hospital, Parkville, Victoria 3052 (Australia); Department of Paediatrics, University of Melbourne, Melbourne, Victoria (Australia); Ross, S.A. [Pituitary Research Unit, Murdoch Childrens Research Institute, Royal Children's Hospital, Parkville, Victoria 3052 (Australia); Bauer, K. [Max-Planck-Institut fuer Experimentelle Endokrinologie, Hannover (Germany); Thomas, P.Q. [Pituitary Research Unit, Murdoch Childrens Research Institute, Royal Children's Hospital, Parkville, Victoria 3052 (Australia)], E-Mail: paul.thomas@mcri.edu.au

    2005-08-01T23:59:59.000Z

    Stem and progenitor cells have been identified in many adult tissues including bone marrow, the central nervous system, and skin. While there is direct evidence to indicate the activity of a progenitor cell population in the pituitary gland, this putative subpopulation has not yet been identified. Herein we describe the isolation and characterization of a novel clonogenic cell type in the adult murine pituitary, which we have termed Pituitary Colony-Forming Cells (PCFCs). PCFCs constitute 0.2% of pituitary cells, and generate heterogeneous colonies from single cells. PCFCs exhibit variable proliferative potential, and may exceed 11 population doublings in 14 days. Enrichment of PCFCs to 61.5-fold with 100% recovery can be obtained through the active uptake of the fluorescent dipeptide, {beta}-Ala-Lys-N{epsilon}-AMCA. PCFCs are mostly contained within the large, agranular subpopulation of AMCA{sup +} cells, and constitute 28% of this fraction, corresponding to 140.5-fold enrichment. Interestingly, the AMCA{sup +} population contains rare cells that are GH{sup +} or PRL{sup +}. GH{sup +} cells were also identified in PCFC single cell colonies, suggesting that PCFCs have the potential to differentiate into GH{sup +} cells. Together, these data show that the pituitary contains a rare clonogenic population which may correspond to the somatotrope/lactotrope progenitors suggested by previous experiments.

  3. SPECT Imaging for in vivo tracking of NIS containing stem cells

    SciTech Connect (OSTI)

    Lee, Zhenghong

    2013-04-02T23:59:59.000Z

    The proposed study contains two groups of imaging experiments: 1) human mesenchymal stem cells supporting in vivo survival of unrelated donor hematopoietic stem cells; 2) gene transduction and selection of mutant MGMT genes on human hematopoietic stem cells conferring resistance to BC+BCNU. There is increasing evidence that adult human tissues harbor stem and progenitor cells that can be used for therapeutic purposes. We had focused on the Mesenchymal Stem Cells (MSCs) found in human bone marrow and investigated these cells in the context of autologous and allogeneic hematopoietic stem cell transplantation to a) facilitate rapid hematopoietic engraftment in cancer patients receiving high dose chemotherapy and b) to modulate the graft-versus-host disease (GVHD). We have demonstrated that culture-expanded autologous and allogeneic MSCs can be safely infused into humans and the preliminary results showed that MSCs facilitate hematopoietic engraftment and reduce GVHD. On the other hand, studies of gene transfer with drug resistant selection suggest major perturbations to the process of hematopoietic reconstitution and the confounding issue of organ toxicity and recovery that takes place in the host. We have found that limiting numbers of hematopoietic stem cells transduced with MGMT repopulate the bone marrow of primary and secondary recipient mice. We are also particularly interested in the dynamics of engraftment and selection in regions of bones, liver, spleen and lung, where we have previously seen marked evidence of engraftment. All the measurements have required animal sacrifice and single point determinations of engraftment in individual and cohorts of mice. Heretofore it has not been possible to study the dynamics of engraftment and enrichment. In the upcoming application, we propose to develop an imaging method to track intravenously infused stem cells in vivo at preset time points to understand their homing and proliferation. Specifically, we propose to use Na+/I- symporter (NIS) gene as a reporter gene (imagene) for non-invasive imaging of infused stem cells� distribution and persistence in vivo on small animal models. NIS is an intrinsic membrane glycoprotein that mediates active iodide (I-) uptake into normal thyroid follicular cells and other cells. The advantages of using NIS for non-invasive and repeated scintigraphic imaging in this application are: a) NIS is not a foreign gene and thus eliminate the immunoresponse problem; b) radiotracer or substrate for NIS is simply radioiodide (I-125, I- 123, I-124, and I-124) or [Tc-99m]-pertechnetate, no radiosynthesis is needed. It has been shown that NIS gene transfer can induce radioactive iodide uptake in a variety of cells and that xenografts expressing exogenous NIS could be imaged by non-invasive scintigraphic imaging. The specific aims are: 1.Determine the feasibility, stability and physiological effects of human NIS gene expression on human HSCs and MSCs in vitro. 2.Determine the engraftment of human HSC and MSC co-infused in NOD-SCID mice. 3.Transduce both a drug resistance gene and an imagene into bone marrow stem cells, and follow the dynamics of engraftment after selection in real time.

  4. Biodegradable synthetic bone composites

    DOE Patents [OSTI]

    Liu, Gao; Zhao, Dacheng; Saiz, Eduardo; Tomsia, Antoni P.

    2013-01-01T23:59:59.000Z

    The invention provides for a biodegradable synthetic bone composition comprising a biodegradable hydrogel polymer scaffold comprising a plurality of hydrolytically unstable linkages, and an inorganic component; such as a biodegradable poly(hydroxyethylmethacrylate)/hydroxyapatite (pHEMA/HA) hydrogel composite possessing mineral content approximately that of human bone.

  5. Nanoscale Surface Topography to Guide Bone Growth

    E-Print Network [OSTI]

    Nanoscale Surface Topography to Guide Bone Growth P R O J E C T L E A D E R : Jirun Sun (American T S Designed and fabricated devices with nanoscale surface topography. Controlled cell alignment by varying the height and aspect ratio of the surface features. R E F E R E N C E Exploring cellular contact guidance

  6. Children cortical bone characterisation: the ultrasonic J.-P. Berteaua

    E-Print Network [OSTI]

    Boyer, Edmond

    infantile osteo-pathologies. That is why there is a strong interest in the characterisation of the growing specific location (close to cancerous cells) or cadaveric bone. They indicate a lower Young's modulus

  7. Application of in vitro erythropoiesis from bone marrow derived progenitors to detect and study genotoxicity

    E-Print Network [OSTI]

    Shuga, Joseph F. (Joseph Francis)

    2007-01-01T23:59:59.000Z

    Assays that predict toxicity are an essential part of drug development and there is a demand for efficient models to better predict human responses. The in vivo micronucleus (MN) assay is a robust toxicity test that assesses ...

  8. Research report Axon growth and recovery of function supported by human bone marrow

    E-Print Network [OSTI]

    Fischer, Itzhak

    may be donor-dependent. Similarly, a battery of behavioral tests showed partial recovery in some highlight the need for establishing adequate characterization, including the development of relevant, and characterization. As a 0006-8993/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j

  9. One Chance in a Million: Altruism and the Bone Marrow Registry

    E-Print Network [OSTI]

    Bergstrom, Ted C; Garratt, Rod; Sheehan-Connor, Damien

    2008-01-01T23:59:59.000Z

    For patients with acute leukemia, long- term survival is 50-chemotherapy in acute myelogenous leukemia. New EnglandLong-term survival in acute myeloid leukemia. Cancer, [6

  10. Multiple poromas in a bone marrow transplant recipient: A case report

    E-Print Network [OSTI]

    Nguyen, Bichchau T; Lortscher, David N; Lee, Robert A

    2012-01-01T23:59:59.000Z

    a history of acute myelogenous leukemia and had undergonewith a history of acute myelogenous leukemia, who developedaged man with acute lymphoid leukemia treated with total

  11. One Chance in a Million: Altruism and the Bone Marrow Registry

    E-Print Network [OSTI]

    Bergstrom, Ted C; Garratt, Rod; Sheehan-Connor, Damien

    2008-01-01T23:59:59.000Z

    108 patients with acute lymphoblastic leukemia: favorablein adult acute lymphoblastic leukemia in ?rst completeadults with acute lymphoblastic leukemia in ?rst remission

  12. HEMATOPOIESIS Soluble factor cross-talk between human bone marrow-derived hematopoietic and

    E-Print Network [OSTI]

    Zandstra, Peter W.

    for studying the regulation of mesengenesis by HCs. Accordingly, an in vitro model capable of maintaining system was developed that allows manipulation of the growth of both mesenchymal and hematopoietic human compo- nents.1-6 Although self-regulation within the hematopoietic niche is undoubtedly critical, it has

  13. Dysregulated Toll-like receptor expression and signaling in bone marrow-derived macrophages at

    E-Print Network [OSTI]

    Toledo, University of

    . McInerney1 1 Department of Medicinal and Biological Chemistry, College of Pharmacy, and 2 Department Center, Walther Cancer Institute, Indianapolis, IN, USA 5 Present address: College of Pharmacy in the diabetic state correlated with increased nuclear factor kappa B (NF-jB) activation in response to the TLR4

  14. Functional clonal deletion versus suppressor cell-induced transplantation tolerance in chimeras prepared with a short course of total-lymphoid irradiation

    SciTech Connect (OSTI)

    Slavin, S.; Morecki, S.; Weigensberg, M.; Bar, S.; Weiss, L.

    1986-06-01T23:59:59.000Z

    Allogeneic bone marrow (BM) chimeras induced by infusion of BM cells into recipients conditioned with total lymphoid irradiation (TLI) were shown to develop humoral and cell-mediated tolerance to host and donor-type alloantigens by a number of in vitro and in vivo assays. Spleen cells of tolerant chimeras exhibited suppressive activity of mixed lymphocyte reaction (MLR). MLR suppression was not abrogated by depletion of Lyt-2 cells, and neither could Lyt-2-positive cells sorted from the spleens of tolerant chimeras suppress MLR or attenuate graft-versus-host reactivity in vivo. Likewise, specifically unresponsive spleen cells obtained from chimeras could not be induced to respond in MLR against tolerizing host-type cells following depletion of Lyt-2 or passage through a nylon-wool column. Tolerance of chimera spleen cells to host alloantigens, best documented by permanent survival of donor-type skin allografts, could be adoptively transferred into syngeneic recipients treated by heavy irradiation but not into untreated or mildly irradiated recipients. Adoptive transfer of tolerance seemed to be associated with experimental conditions favoring engraftment of tolerant cells rather than suppression of host reactivity. We speculate that although host and/or donor-derived suppressor cells may be operating in reducing the pool of specific alloreactive clones by blocking cell proliferation in response to allogeneic challenge, the final outcome in tolerant chimeras is actual or functional deletion of alloreactive clones.

  15. Invest in Your Bones Bone Mineral Calcium and Vitamin D

    E-Print Network [OSTI]

    beans, eggs, and nuts. Sardines and salmon with bones, oysters, kidney beans, and tofu made with calcium

  16. Insulin-like growth factor 1 enhances the migratory capacity of mesenchymal stem cells

    SciTech Connect (OSTI)

    Li, Yangxin [Laboratory of Heart Failure and Stem Cell, Texas Heart Institute, Houston, TX 77030 (United States)]. E-mail: Yangxin_li@yahoo.com; Yu, XiYong [Research Center of Medical Sciences, Guangdong Provincial People's Hospital, Guangdong Provincial Cardiovascular Institute, Guanzhou, Guandong 510080 (China)]. E-mail: yuxycn@hotmail.com; Lin, ShuGuang [Research Center of Medical Sciences, Guangdong Provincial People's Hospital, Guangdong Provincial Cardiovascular Institute, Guanzhou, Guandong 510080 (China); Li, XiaoHong [Research Center of Medical Sciences, Guangdong Provincial People's Hospital, Guangdong Provincial Cardiovascular Institute, Guanzhou, Guandong 510080 (China); Zhang, Saidan [Section of Cardiology, Xiangya Hospital of Central-South University, Changsha, Hunan 410008 (China); Song, Yao-Hua [Department of Molecular Pathology, University of Texas M.D. Anderson Cancer Center, Houston, TX 77030 (United States)

    2007-05-11T23:59:59.000Z

    Mesenchymal stem cells (MSCs) are attractive candidates for cell based therapies. However, the mechanisms responsible for stem cell migration and homing after transplantation remain unknown. It has been shown that insulin-like growth factor-1 (IGF-1) induces proliferation and migration of some cell types, but its effects on stem cells have not been investigated. We isolated and cultured MSC from rat bone marrow, and found that IGF-1 increased the expression levels of the chemokine receptor CXCR4 (receptor for stromal cell-derived factor-1, SDF-1). Moreover, IGF-1 markedly increased the migratory response of MSC to SDF-1. The IGF-1-induced increase in MSC migration in response to SDF-1 was attenuated by PI3 kinase inhibitor (LY294002 and wortmannin) but not by mitogen-activated protein/ERK kinase inhibitor PD98059. Our data indicate that IGF-1 increases MSC migratory responses via CXCR4 chemokine receptor signaling which is PI3/Akt dependent. These findings provide a new paradigm for biological effects of IGF-1 on MSC and have implications for the development of novel stem cell therapeutic strategies.

  17. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1995-05-09T23:59:59.000Z

    A device is described for stimulating bone tissue by applying a low level alternating current signal directly to the patient`s skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures. 5 figs.

  18. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, James W. (Aiken, SC)

    1995-01-01T23:59:59.000Z

    A device for stimulating bone tissue by applying a low level alternating current signal directly to the patient's skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures.

  19. A multiscale mechanobiological model of bone remodelling predicts site-specific bone loss in the femur during osteoporosis and mechanical disuse

    E-Print Network [OSTI]

    Lerebours, C; Scheiner, S; Pivonka, P

    2015-01-01T23:59:59.000Z

    We propose a multiscale mechanobiological model of bone remodelling to investigate the site-specific evolution of bone volume fraction across the midshaft of a femur. The model includes hormonal regulation and biochemical coupling of bone cell populations, the influence of the microstructure on bone turnover rate, and mechanical adaptation of the tissue. Both microscopic and tissue-scale stress/strain states of the tissue are calculated from macroscopic loads by a combination of beam theory and micromechanical homogenisation. This model is applied to simulate the spatio-temporal evolution of a human midshaft femur scan subjected to two deregulating circumstances: (i) osteoporosis and (ii) mechanical disuse. Both simulated deregulations led to endocortical bone loss, cortical wall thinning and expansion of the medullary cavity, in accordance with experimental findings. Our model suggests that these observations are attributable to a large extent to the influence of the microstructure on bone turnover rate. Mec...

  20. asialoglycoprotein receptor imaging: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 62 Glycosylation of b1-adrenergic receptors regulates receptor...

  1. adenosine a2a receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 102 Glycosylation of b1-adrenergic receptors regulates receptor...

  2. anti-il-2 receptor tac: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 90 Glycosylation of b1-adrenergic receptors regulates receptor...

  3. adenosine a2a receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 102 Glycosylation of b1-adrenergic receptors regulates receptor...

  4. acth receptor mc2r: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 31 Glycosylation of b1-adrenergic receptors regulates receptor...

  5. a2a adenosine receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 102 Glycosylation of b1-adrenergic receptors regulates receptor...

  6. adenosine diphosphate receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 94 Glycosylation of b1-adrenergic receptors regulates receptor...

  7. anti-n-methyl-d-aspartate receptor encephalitis: Topics by E...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 44 Glycosylation of b1-adrenergic receptors regulates receptor...

  8. alpha-1 adrenergic receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 108 PERSPECTIVE Orphan nuclear receptors--new ligands Biology...

  9. adenosine receptors newer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 88 Glycosylation of b1-adrenergic receptors regulates receptor...

  10. a2 receptors measurement: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 84 Glycosylation of b1-adrenergic receptors regulates receptor...

  11. angiopoietin receptors tie-1: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 36 Glycosylation of b1-adrenergic receptors regulates receptor...

  12. antagonista dos receptores: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 47 Glycosylation of b1-adrenergic receptors regulates receptor...

  13. antagonista del receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 50 Glycosylation of b1-adrenergic receptors regulates receptor...

  14. aloe glycoprotein ny945: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 68 Electron tomography analysis of envelope glycoprotein trimers...

  15. angiopoietin receptor stie-2: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 28 Glycosylation of b1-adrenergic receptors regulates receptor...

  16. angiotensin at1 receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 96 Glycosylation of b1-adrenergic receptors regulates receptor...

  17. at1 receptor blocker: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 65 Glycosylation of b1-adrenergic receptors regulates receptor...

  18. age receptor rage: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 90 Glycosylation of b1-adrenergic receptors regulates receptor...

  19. a2b adenosine receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 93 Glycosylation of b1-adrenergic receptors regulates receptor...

  20. axila negativa receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 24 Glycosylation of b1-adrenergic receptors regulates receptor...

  1. acoustic dispensing technology: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 82 Motivation Atmospheric Contamination Rejuvenation of a...

  2. amastin surface glycoproteins: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 69 Electron tomography analysis of envelope glycoprotein trimers...

  3. at1 receptor supports: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 102 Glycosylation of b1-adrenergic receptors regulates receptor...

  4. adenosine a2 receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 102 Glycosylation of b1-adrenergic receptors regulates receptor...

  5. adenosine receptor dampens: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 95 Glycosylation of b1-adrenergic receptors regulates receptor...

  6. anti-nmda receptor encephalitis: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 46 Glycosylation of b1-adrenergic receptors regulates receptor...

  7. anaphylatoxin c5a receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 36 Glycosylation of b1-adrenergic receptors regulates receptor...

  8. activin receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 37 Glycosylation of b1-adrenergic receptors regulates receptor...

  9. a3 adenosine receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 94 Glycosylation of b1-adrenergic receptors regulates receptor...

  10. adenosine a3 receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 94 Glycosylation of b1-adrenergic receptors regulates receptor...

  11. a2a adenosine receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 102 Glycosylation of b1-adrenergic receptors regulates receptor...

  12. a3 adenosine receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 94 Glycosylation of b1-adrenergic receptors regulates receptor...

  13. arylhydrocarbon receptor ahr: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 53 Glycosylation of b1-adrenergic receptors regulates receptor...

  14. amine-associated receptors taar3: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 19 Glycosylation of b1-adrenergic receptors regulates receptor...

  15. adenosine a2b receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 93 Glycosylation of b1-adrenergic receptors regulates receptor...

  16. a2 adenosine receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 102 Glycosylation of b1-adrenergic receptors regulates receptor...

  17. adenovirus receptor car: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 24 ORIGINAL ARTICLE Occurrence of adenovirus and other enteric...

  18. aldosterone receptor antagonism: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 63 Glycosylation of b1-adrenergic receptors regulates receptor...

  19. a1 adenosine receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 103 Glycosylation of b1-adrenergic receptors regulates receptor...

  20. anti-platelet glycoprotein iiia: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 65 Electron tomography analysis of envelope glycoprotein trimers...

  1. alpha-1 adrenergic receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 108 PERSPECTIVE Orphan nuclear receptors--new ligands Biology...

  2. adenosine a1 receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 103 Glycosylation of b1-adrenergic receptors regulates receptor...

  3. atp-sensitive receptor p2x7: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 54 Glycosylation of b1-adrenergic receptors regulates receptor...

  4. a-1-acid glycoprotein concentration: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 55 Electron tomography analysis of envelope glycoprotein trimers...

  5. ampa receptor glur1: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 111 Glycosylation of b1-adrenergic receptors regulates receptor...

  6. adenosine a2b receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 93 Glycosylation of b1-adrenergic receptors regulates receptor...

  7. adenovirus receptor acts: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 13 ORIGINAL ARTICLE Occurrence of adenovirus and other enteric...

  8. a2 adenosine receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 102 Glycosylation of b1-adrenergic receptors regulates receptor...

  9. acetylcholine receptor number: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 93 Formation and Stability of Synaptic Receptor Domains...

  10. arcuate y4 receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 38 Glycosylation of b1-adrenergic receptors regulates receptor...

  11. adenosine a2 receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 102 Glycosylation of b1-adrenergic receptors regulates receptor...

  12. adp p2y receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 102 Glycosylation of b1-adrenergic receptors regulates receptor...

  13. adenosine a1 receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 103 Glycosylation of b1-adrenergic receptors regulates receptor...

  14. a2b receptor based: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 71 Glycosylation of b1-adrenergic receptors regulates receptor...

  15. a1 adenosine receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 103 Glycosylation of b1-adrenergic receptors regulates receptor...

  16. activin receptor type: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 78 How AMPA Receptor Desensitization Depends on Receptor...

  17. autocrine egf receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 98 Glycosylation of b1-adrenergic receptors regulates receptor...

  18. a2a receptor antagonism: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 65 Glycosylation of b1-adrenergic receptors regulates receptor...

  19. anti-apoptotic erbb receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 60 Glycosylation of b1-adrenergic receptors regulates receptor...

  20. anti-myelin-associated glycoprotein peripheral: Topics by E-print...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 103 Electron tomography analysis of envelope glycoprotein...

  1. angiotensin at1 receptors: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 96 Glycosylation of b1-adrenergic receptors regulates receptor...

  2. anaphylatoxin receptor cd88: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 22 Glycosylation of b1-adrenergic receptors regulates receptor...

  3. at1b angiotensin receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 77 Glycosylation of b1-adrenergic receptors regulates receptor...

  4. acetyl group-binding receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 78 Glycosylation of b1-adrenergic receptors regulates receptor...

  5. atp-activated p2x7 receptor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 39 Glycosylation of b1-adrenergic receptors regulates receptor...

  6. arterial esophageal hemorrhage: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MnSOD Gene Therapy. Radiat the potential of mitochondrial SOD (MnSOD) gene therapy to protect esophageal, pancreatic and bone marrow cells Engelward, Bevin 27 Massive...

  7. INVEST IN YOUR BONES Living with Osteoporosis

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Living with Osteoporosis Leaflet 5 Living with osteoporosis can be done environment safe to avoid falls. Early detection of bone loss or osteoporosis is now possible with bone to be most effective in reducing bone loss during the five to ten years following menopause, when bone loss

  8. Evolution of B-cell malignancy; Pre-B-cell leukemia resulting from MYC activation in a B-cell neoplasm with a rearranged BCL2 gene

    SciTech Connect (OSTI)

    Gauwerky, C.E.; Haluska, F.G.; Tsujimoto, Y.; Nowell, P.C.; Croce, C.M. (Wistar Institute of Anatomy and Biology, Philadelphia, PA (USA))

    1988-11-01T23:59:59.000Z

    The authors have analyzed the molecular genetics of the breakpoints involved in the t(8;14) and t(14;18) translocations of an acute pre-B-cell leukemia from a patient with a history of follicular lymphoma. In this patient's leukemic cells, the breakpoint of the t(14;18) translocation occurred in the major breakpoint-cluster region of the BCL2 gene and became linked to the J{sub H}4 joining-region gene segment of the immunoglobulin heavy-chain locus on the 14q+ chromosome as previously observed in follicular lymphoma. An N region and heptamer and nonamer signal sequences indicated that this translocation occurred as a mistake in V{sub H}-D{sub H}-J{sub H} joining (where V{sub H} and D{sub H} are the variable and diversity segments). In the t(8;14) translocation, the breakpoint was located immediately 5' of the first exon of the MYC protooncogene, which was juxtaposed with the C{gamma}2 constant gene segment of the second 14q+ chromosome. The finding of repeated sequences typical of switch regions suggested that this translocation occurred during heavy-chain isotype switching, resulting in progression to pre-B-cell leukemia with both the 5(8;14) and the t(14;18) translocations. The terminal deoxynucleotidyltransferase-positive phenotype of the patient's leukemic cells further suggests that the pre-B-cell leukemia was derived from a pre-B cell carrying a t(14;18) translocation in the original follicular lymphoma. The polymerase chain reaction method was then used to identify cancer cells in the bone marrow of the patient.

  9. Endocortical bone loss in osteoporosis: the role of bone surface availability

    E-Print Network [OSTI]

    Buenzli, Pascal R; Clement, John G; Pivonka, Peter

    2012-01-01T23:59:59.000Z

    Age-related bone loss and postmenopausal osteoporosis are disorders of bone remodelling, in which less bone is reformed than resorbed. Yet, this dysregulation of bone remodelling does not occur equally in all bone regions. Loss of bone is more pronounced near the endocortex, leading to cortical wall thinning and medullary cavity expansion, a process sometimes referred to as "trabecularisation" or "cancellisation". Cortical wall thinning is of primary concern in osteoporosis due to the strong reduction in bone mechanical properties that it is associated with. In this paper, we examine the possibility that the nonuniformity of microscopic bone surface availability could explain the nonuniformity of bone loss in osteoporosis. We use a simple computational model of bone remodelling, in which microscopic bone surface availability influences bone turnover rate, to simulate the evolution of the bone volume fraction profile across the midshaft of a long bone. We find that bone loss is accelerated near the endocortica...

  10. IBMS BoneKEy. 2009 April;6(4):132-149 http://www.bonekey-ibms.org/cgi/content/full/ibmske;6/4/132

    E-Print Network [OSTI]

    and osteoporosis, yet uniquely ­ without targeting the resident fat or bone cell. IBMS BoneKEy. 2009 April;6(4):132-149. ©2009 International Bone & Mineral Society Introduction Osteoporosis and obesity, two of the most billion dollars in annual health service costs. (1) Osteoporosis, a disease characterized by diminished

  11. Splenic concentration of bone imaging agents in functional asplenia

    SciTech Connect (OSTI)

    Dhekne, R.D.

    1981-07-01T23:59:59.000Z

    Three cases of sickle cell disease associated with functional asplenia are described. The spleen was not visualized on routine Tc-99m-sulfur colloid scan. The bone scan performed with Tc-99m-phosphate compounds revealed abnormal splenic activity in all three cases. The previous case reports and the literature on this subject are reviewed.

  12. Metastatic calcification of the stomach imaged on a bone scan

    SciTech Connect (OSTI)

    Goldstein, R.; Ryo, U.Y.; Pinsky, S.M.

    1984-10-01T23:59:59.000Z

    A whole body bone scan obtained on a 21-year-old woman with sickle cell disease and chronic renal failure showed localization of the radionuclide diffusely in the stomach. The localization of the radionuclide represented metastatic calcification of the stomach caused by secondary hyperparathyroidism.

  13. Understanding the Interactions of Collagen with Mineral in Bone: Working Towards Developing a Realistic Composite

    E-Print Network [OSTI]

    Greenaway, Alan

    . · Mini-project on bone nodule formation. · Neutron scattering on whole bone. · Analysis of bone explants

  14. Hepatocyte growth factor regulated tyrosine kinase substrate in the peripheral development and function of B-cells

    SciTech Connect (OSTI)

    Nagata, Takayuki [Department of Pharmacy, Iwaki Meisei University, 5-5-1 Chuodai Iino, Iwaki, Fukushima 970-8551 (Japan) [Department of Pharmacy, Iwaki Meisei University, 5-5-1 Chuodai Iino, Iwaki, Fukushima 970-8551 (Japan); Department of Microbiology and Immunology, Tohoku University Graduate School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan); Murata, Kazuko, E-mail: murata-k@iwakimu.ac.jp [Department of Pharmacy, Iwaki Meisei University, 5-5-1 Chuodai Iino, Iwaki, Fukushima 970-8551 (Japan)] [Department of Pharmacy, Iwaki Meisei University, 5-5-1 Chuodai Iino, Iwaki, Fukushima 970-8551 (Japan); Murata, Ryo [Department of Pharmacy, Iwaki Meisei University, 5-5-1 Chuodai Iino, Iwaki, Fukushima 970-8551 (Japan)] [Department of Pharmacy, Iwaki Meisei University, 5-5-1 Chuodai Iino, Iwaki, Fukushima 970-8551 (Japan); Sun, Shu-lan [Department of Microbiology and Immunology, Tohoku University Graduate School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan)] [Department of Microbiology and Immunology, Tohoku University Graduate School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan); Saito, Yutaro; Yamaga, Shuhei [Department of Pharmacy, Iwaki Meisei University, 5-5-1 Chuodai Iino, Iwaki, Fukushima 970-8551 (Japan)] [Department of Pharmacy, Iwaki Meisei University, 5-5-1 Chuodai Iino, Iwaki, Fukushima 970-8551 (Japan); Tanaka, Nobuyuki; Tamai, Keiichi [Division of Immunology, Miyagi Cancer Research Institute, 47-1 Nodayama, Medeshima-Shiode, Natori 981-1293 (Japan)] [Division of Immunology, Miyagi Cancer Research Institute, 47-1 Nodayama, Medeshima-Shiode, Natori 981-1293 (Japan); Moriya, Kunihiko [Department of Pediatrics, Tohoku University School of Medicine, 1-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan)] [Department of Pediatrics, Tohoku University School of Medicine, 1-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan); Kasai, Noriyuki [Institute for Animal Experimentation, Tohoku University Graduate School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan)] [Institute for Animal Experimentation, Tohoku University Graduate School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan); Sugamura, Kazuo [Division of Immunology, Miyagi Cancer Research Institute, 47-1 Nodayama, Medeshima-Shiode, Natori 981-1293 (Japan)] [Division of Immunology, Miyagi Cancer Research Institute, 47-1 Nodayama, Medeshima-Shiode, Natori 981-1293 (Japan); Ishii, Naoto [Department of Microbiology and Immunology, Tohoku University Graduate School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan)] [Department of Microbiology and Immunology, Tohoku University Graduate School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan)

    2014-01-10T23:59:59.000Z

    Highlights: •ESCRT-0 protein regulates the development of peripheral B-cells. •BCR expression on cell surface should be controlled by the endosomal-sorting system. •Hrs plays important roles in responsiveness to Ag stimulation in B lymphocytes. -- Abstract: Hepatocyte growth factor (HGF)-regulated tyrosine kinase substrate (Hrs) is a vesicular sorting protein that functions as one of the endosomal-sorting proteins required for transport (ESCRT). Hrs, which binds to ubiquitinated proteins through its ubiquitin-interacting motif (UIM), contributes to the lysosomal transport and degradation of ubiquitinated membrane proteins. However, little is known about the relationship between B-cell functions and ESCRT proteins in vivo. Here we examined the immunological roles of Hrs in B-cell development and functions using B-cell-specific Hrs-deficient (Hrs{sup flox/flox};mb1{sup cre/+}:Hrs-cKO) mice, which were generated using a cre-LoxP recombination system. Hrs deficiency in B-cells significantly reduced T-cell-dependent antibody production in vivo and impaired the proliferation of B-cells treated in vitro with an anti-IgM monoclonal antibody but not with LPS. Although early development of B-cells in the bone marrow was normal in Hrs-cKO mice, there was a significant decrease in the number of the peripheral transitional B-cells and marginal zone B-cells in the spleen of Hrs-cKO mice. These results indicate that Hrs plays important roles during peripheral development and physiological functions of B lymphocytes.

  15. Bone Mineral Density, Bone Turnover, and Systemic Inflammation in Non-cirrhotics with Chronic Hepatitis C

    E-Print Network [OSTI]

    Lai, J; Shoback, DMA; Zipperstein, J; Lizaola, B; Tseng, S; Terrault, NA

    2015-01-01T23:59:59.000Z

    Mun˜oz-Torres M, et al. Bone mineral density, serum insulin-et al. Osteoporosis and bone mineral metabolism disorders in1069-9. 11. George J. Bone mineral density and disorders of

  16. Biomimetic hydroxyapatite as a new consolidating agent for archaeological bone

    E-Print Network [OSTI]

    North, Alexis

    2014-01-01T23:59:59.000Z

    R.E.M.  2002.  “Bone  Diagenesis:  An  Overview  of  2000.  “Patterns  of  Diagenesis  in  Bone  I:  The  element  Studies  of  Diagenesis  in  Prehistoric  Bone. ”  

  17. Development of high strength hydroxyapatite for bone tissue regeneration using nanobioactive glass composites

    SciTech Connect (OSTI)

    Shrivastava, Pragya; Dalai, Sridhar; Vijayalakshmi, S. [Centre for Research in Nanotechnology and Science, IIT Bombay (India); Sudera, Prerna; Sivam, Santosh Param [Amity Institute of Nanotechnology, Amity University, Noida, Uttar Pradesh-201303 (India); Sharma, Pratibha [Dept of Energy Science and Engineering, IIT Bombay (India)

    2013-02-05T23:59:59.000Z

    With an increasing demand of biocompatible bone substitutes for the treatment of bone diseases and bone tissue regeneration, bioactive glass composites are being tested to improvise the osteoconductive as well as osteoinductive properties. Nanobioactive glass (nBG) composites, having composition of SiO{sub 2} 70 mol%, CaO 26 mol % and P{sub 2}O{sub 5} 4 mol% were prepared by Freeze drying method using PEG-PPG-PEG co-polymer. Polymer addition improves the mechanical strength and porosity of the scaffold of nBG. Nano Bioactive glass composites upon implantation undergo specific reactions leading to the formation of crystalline hydroxyapatite (HA). This is tested in vitro using Simulated Body Fluid (SBF). This high strength hydroxyapatite (HA) layer acts as osteoconductive in cellular environment, by acting as mineral base of bones, onto which new bone cells proliferate leading to new bone formation. Strength of the nBG composites as well as HA is in the range of cortical and cancellous bone, thus proving significant for bone tissue regeneration substitutes.

  18. Lung cancer-derived Dickkopf1 is associated with bone metastasis and the mechanism involves the inhibition of osteoblast differentiation

    SciTech Connect (OSTI)

    Chu, Tianqing; Teng, Jiajun; Jiang, Liyan; Zhong, Hua; Han, Baohui, E-mail: baohuihan1@163.com

    2014-01-17T23:59:59.000Z

    Highlights: •DKK1 level was associated with NSCLC bone metastases. •Lung tumor cells derived DKK1 inhibited osteoblast differentiation. •Lung tumor cells derived DKK1 modulates ?-catenin and RUNX2. -- Abstract: Wnt/?-catenin signaling and Dickkopf1 (DKK1) play important roles in the progression of lung cancer, which preferably metastasizes to skeleton. But the role of them in bone dissemination is poorly understood. This study aims to define the role of DKK1 in lung cancer bone metastases and investigate the underlying mechanism. Our results demonstrated that DKK1 over-expression was a frequent event in non-small-cell lung cancer (NSCLC) blood samples, and serous DKK1 level was much higher in bone metastatic NSCLC compared to non-bone metastatic NSCLC. We also found that conditioned medium from DKK1 over-expressing lung cancer cells inhibited the differentiation of osteoblast, determined by alkaline phosphatase activity and osteocalcin secretion, whereas the conditioned medium from DKK1 silencing lung cancer cells exhibited the opposite effects. Mechanistically, DKK1 reduced the level of ?-catenin and RUNX2, as well as inhibiting the nuclear translocation of ?-catenin. Taken together, these results suggested that lung cancer-produced DKK1 may be an important mechanistic link between NSCLC and bone metastases, and targeting DKK1 may be an effective method to treat bone metastase of NSCLC.

  19. Near-infrared emitting quantum dots for cellular and vascular fluorescent labeling in in vivo multiplexed imaging studies

    E-Print Network [OSTI]

    Wu, Juwell Wendy

    2011-01-01T23:59:59.000Z

    In vivo multimodal, multiplexed microscopy allows real-time observation of hematopoietic cells, their stem and progenitor cells and metastatic cancer cells in their native bone marrow (BM) environment. Multiplexing has ...

  20. Positive modulator of bone morphogenic protein-2

    DOE Patents [OSTI]

    Zamora, Paul O. (Gaithersburg, MD); Pena, Louis A. (Poquott, NY); Lin, Xinhua (Plainview, NY); Takahashi, Kazuyuki (Germantown, MD)

    2009-01-27T23:59:59.000Z

    Compounds of the present invention of formula I and formula II are disclosed in the specification and wherein the compounds are modulators of Bone Morphogenic Protein activity. Compounds are synthetic peptides having a non-growth factor heparin binding region, a linker, and sequences that bind specifically to a receptor for Bone Morphogenic Protein. Uses of compounds of the present invention in the treatment of bone lesions, degenerative joint disease and to enhance bone formation are disclosed.

  1. BONE CARE FOR THE POSTMENOPAUSAL WOMAN

    E-Print Network [OSTI]

    Shihadeh, Alan

    Osteoporosis is a disease characterized by low bone mass and deterioration in the microarchitecture of bone tissue, leading to an increased risk of fracture. Osteoporosis occurs when the bone mass decreases more fracture). Osteoporosis has no signs or symptoms until a fracture occurs ­ this is why it is often called

  2. autologous marrow aspirate: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    scrape the well to remove the cells and matrigel. For this step, we use a sterile plunger from a 1 mlTM , and cells several times using a P1000 to break up the MatrigelTM ....

  3. Human Cementum Protein 1 induces expression of bone and cementum proteins by human gingival fibroblasts

    SciTech Connect (OSTI)

    Carmona-Rodriguez, Bruno [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Alvarez-Perez, Marco Antonio [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Narayanan, A. Sampath [Department of Pathology, School of Medicine, UW, Seattle (United States); Zeichner-David, Margarita [Center for Craniofacial Molecular Biology, School of Dentistry, USC, Los Angeles (United States); Reyes-Gasga, Jose [Instituto de Fisica, UNAM (Mexico); Molina-Guarneros, Juan [Facultad de Medicina, UNAM (Mexico); Garcia-Hernandez, Ana Lilia [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Suarez-Franco, Jose Luis [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Chavarria, Ivet Gil [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Villarreal-Ramirez, Eduardo [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Arzate, Higinio [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico)]. E-mail: harzate@servidor.unam.mx

    2007-07-06T23:59:59.000Z

    We recently presented evidence showing that a human cementoblastoma-derived protein, named Cementum Protein 1 (CEMP1) may play a role as a local regulator of cementoblast differentiation and cementum-matrix mineralization. This protein was shown to be expressed by cementoblasts and progenitor cells localized in the periodontal ligament. In this study we demonstrate that transfection of CEMP1 into human gingival fibroblasts (HGF) induces mineralization and expression of bone and cementum-matrix proteins. The transfected HGF cells had higher alkaline phosphatase activity and proliferation rate and they expressed genes for alkaline phosphatase, bone sialoprotein, osteocalcin, osteopontin, the transcription factor Runx2/Cbfa1, and cementum attachment protein (CAP). They also produced biological-type hydroxyapatite. These findings indicate that the CEMP1 might participate in differentiation and mineralization of nonosteogenic cells, and that it might have a potential function in cementum and bone formation.

  4. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    x ORIGINAL ARTICLE Bone mineral density and fractures inwas associated with lower bone mineral density (BMD) at theKeywords Bone loss . Bone mineral density . Elderly .

  5. Use of growth factors and adhesive ligands to promote connective tissue progenitor colony formation from fresh marrow

    E-Print Network [OSTI]

    Marcantonio, Nicholas A. (Nicholas Alexander)

    2008-01-01T23:59:59.000Z

    The current gold standard for bone graft material is autologous bone, which provides mechanical support, possesses factors that promote bone formation, and contains connective tissue progenitors (CTPs), a heterogeneous ...

  6. Acquisition of repertoires of suppressor T cells under the influence of macrophages

    SciTech Connect (OSTI)

    Soejima, T.; Nagayama, A.; Sado, T.; Taniguchi, M. (Chiba Univ. (Japan))

    1988-01-01T23:59:59.000Z

    Acquisition of repertoires and genetic restriction specificities of suppressor T cells (Ts) and their factors were studied by using full allogeneic radiation bone marrow chimera and H-2 congenic pairs, B10.A(3R) and B10.A(5R), which received conventional or cloned macrophages by cell transfer. Suppressor T-cell factor (TsF) from C3H----C57BL/6 or C57BL/6----C3H chimera suppressed only donor but not host-type responses of either C3H or C57BL/6, in an antigen-specific fashion. However, if chimera mice were given conventional or cloned macrophages of the host type, the chimera TsF in turn suppressed both the responses of C3H and C57BL/6 mice but not those of the third party, BALB/c, indicating that macrophages are responsible for the acquisition of host restriction specificity. Similarly, B10.A(5R) mice developed I-Jb restricted Ts or TsF when the B10.A(3R) macrophage cell line was injected at the time of antigen priming. The reverse was also true. B10.A(3R) mice did generate I-Jk restricted Ts when they received the B10.A(5R) macrophage cell line. Thus, the results clearly demonstrated that B10.A(3R) or B10.A(5R) mice potentially possessed their ability to express both I-Jk and I-Jb determinants and that repertoires and genetic restriction specificity of Ts and their TsF were acquired at a macrophage level at the time of antigen-priming.

  7. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-01-01T23:59:59.000Z

    The present invention relates to the electrical treatment of biological tissue. In particular, the present invention discloses a device that produces discrete electrical pulse trains for treating osteoporosis and accelerating bone growth. According to its major aspects and broadly stated, the present invention consists of an electrical circuit configuration capable of generating Bassett-type waveforms shown with alternative signals provide for the treatment of either fractured bones or osteoporosis. The signal generator comprises a quartz clock, an oscillator circuit, a binary divider chain, and a plurality of simple, digital logic gates. Signals are delivered efficiently, with little or no distortion, and uniformly distributed throughout the area of injury. Perferably, power is furnished by widely available and inexpensive radio batteries, needing replacement only once in several days. The present invention can be affixed to a medical cast without a great increase in either weight or bulk. Also, the disclosed stimulator can be used to treat osteoporosis or to strengthen a healing bone after the cast has been removed by attaching the device to the patient`s skin or clothing.

  8. WRITTEN IN BONE: Bone Biographer's Casebook Douglas Owsley and Karin Bruwelheide

    E-Print Network [OSTI]

    Mathis, Wayne N.

    afflictions that would have made daily life miserable. In addition to dental disease and gout, his bones were

  9. J Bone Miner Metab . Author manuscript Mineral maturity and crystallinity index are distinct characteristics of bone

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    J Bone Miner Metab . Author manuscript Page /1 13 Mineral maturity and crystallinity index are distinct characteristics of bone mineral Delphine Farlay 1 * , G rard Panczeré 2 , Christian Rey 3 , Pierre the hypothesis that mineral maturity and crystallinity index are two different characteristics of bone mineral

  10. A quantification strategy for missing bone mass in case of osteolytic bone lesions

    SciTech Connect (OSTI)

    Fränzle, Andrea, E-mail: a.fraenzle@dkfz.de; Giske, Kristina [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Bretschi, Maren; Bäuerle, Tobias [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Hillengass, Jens [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany)] [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany); Bendl, Rolf [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)

    2013-12-15T23:59:59.000Z

    Purpose: Most of the patients who died of breast cancer have developed bone metastases. To understand the pathogenesis of bone metastases and to analyze treatment response of different bone remodeling therapies, preclinical animal models are examined. In breast cancer, bone metastases are often bone destructive. To assess treatment response of bone remodeling therapies, the volumes of these lesions have to be determined during the therapy process. The manual delineation of missing structures, especially if large parts are missing, is very time-consuming and not reproducible. Reproducibility is highly important to have comparable results during the therapy process. Therefore, a computerized approach is needed. Also for the preclinical research, a reproducible measurement of the lesions is essential. Here, the authors present an automated segmentation method for the measurement of missing bone mass in a preclinical rat model with bone metastases in the hind leg bones based on 3D CT scans. Methods: The affected bone structure is compared to a healthy model. Since in this preclinical rat trial the metastasis only occurs on the right hind legs, which is assured by using vessel clips, the authors use the left body side as a healthy model. The left femur is segmented with a statistical shape model which is initialised using the automatically segmented medullary cavity. The left tibia and fibula are segmented using volume growing starting at the tibia medullary cavity and stopping at the femur boundary. Masked images of both segmentations are mirrored along the median plane and transferred manually to the position of the affected bone by rigid registration. Affected bone and healthy model are compared based on their gray values. If the gray value of a voxel indicates bone mass in the healthy model and no bone in the affected bone, this voxel is considered to be osteolytic. Results: The lesion segmentations complete the missing bone structures in a reasonable way. The mean ratiov{sub r}/v{sub m} of the reconstructed bone volume v{sub r} and the healthy model bone volume v{sub m} is 1.07, which indicates a good reconstruction of the modified bone. Conclusions: The qualitative and quantitative comparison of manual and semi-automated segmentation results have shown that comparing a modified bone structure with a healthy model can be used to identify and measure missing bone mass in a reproducible way.

  11. The role of SDF-1-CXCR4/CXCR7 axis in biological behaviors of adipose tissue-derived mesenchymal stem cells in vitro

    SciTech Connect (OSTI)

    Li, Qiang; Zhang, Aijun; Tao, Changbo; Li, Xueyang; Jin, Peisheng, E-mail: jinps2006@163.com

    2013-11-22T23:59:59.000Z

    Highlights: •SDF-1 pretreating increased the levels of CXCR4, CXCR7 in ADSCs. •SDF-1 improved cells paracrine migration and proliferation abilities. •CXCR4 and CXCR7 could function in ADSCs paracrine, migration and proliferation. -- Abstract: Numerous studies have reported that CXCR4 and CXCR7 play an essential, but differential role in stromal cell-derived factor-1 (SDF-1)-inducing cell chemotaxis, viability and paracrine actions of BMSCs. Adipose tissue-derived mesenchymal stem cells (ADSCs) have been suggested to be potential seed cells for clinical application instead of bone marrow derived stroma cell (BMSCs). However, the function of SDF-1/CXCR4 and SDF-1/CXCR7 in ADSCs is not well understood. This study was designed to analyze the effect of SDF-1/CXCR4 and SDF-1/CXCR7 axis on ADSCs biological behaviors in vitro. Using Flow cytometry and Western blot methods, we found for the first time that CXCR4/CXCR7 expression was increased after treatment with SDF-1 in ADSCs. SDF-1 promoted ADSCs paracrine, proliferation and migration abilities. CXCR4 or CXCR7 antibody suppressed ADSCs paracrine action induced by SDF-1. The migration of ADSCs can be abolished by CXCR4 antibody, while the proliferation of ADSCs was only downregulated by CXCR7 antibody. Our study indicated that the angiogenesis of ADSCs is, at least partly, mediated by SDF-1/CXCR4 and SDF-1/CXCR7 axis. However, only binding of SDF-1/CXCR7 was required for proliferation of ADSCs, and CXCR7 was required for migration of ADSCs induced by SDF-1. Our studies provide evidence that the activation of either axis may be helpful to improve the effectiveness of ADSCs-based stem cell therapy.

  12. Radiation Increases Invasion of Gene-Modified Mesenchymal Stem Cells into Tumors

    SciTech Connect (OSTI)

    Zielske, Steven P., E-mail: szielske@med.umich.ed [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Livant, Donna L.; Lawrence, Theodore S. [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States)

    2009-11-01T23:59:59.000Z

    Purpose: Mesenchymal stem cells (MSCs) are multipotent cells in the bone marrow that have been found to migrate to tumors, suggesting a potential use for cancer gene therapy. MSCs migrate to sites of tissue damage, including normal tissues damaged by radiation. In this study, we investigated the effect of tumor radiotherapy on the localization of lentivirus-transduced MSCs to tumors. Methods and Materials: MSCs were labeled with a lipophilic dye to investigate their migration to colon cancer xenografts. Subsequently, the MSCs were transduced with a lentiviral vector to model gene therapy and mark the infused MSCs. LoVo tumor xenografts were treated with increasing radiation doses to assess the effect on MSC localization, which was measured by quantitative polymerase chain reaction. MSC invasion efficiency was determined in an invasion assay. Results: MSCs migrated to tumor xenografts of various origins, with few cells found in normal tissues. A lentiviral vector efficiently transduced MSCs in the presence, but not the absence, of hexadimethrine bromide (Polybrene). When LoVo tumors were treated with increasing radiation doses, more MSCs were found to migrate to them than to untreated tumors. Irradiation increased MSC localization in HT-29 and MDA-MB-231, but not UMSCC1, xenografts. Monocyte chemotactic protein-1 expression in tumors did not correlate with the basal levels of MSC infiltration; however, monocyte chemotactic protein-1 was modestly elevated in irradiated tumors. Media from irradiated LoVo cells stimulated MSC invasion into basement membranes. Conclusion: These findings suggest that radiation-induced injury can be used to target MSCs to tumors, which might increase the effectiveness of MSC cancer gene therapy. The production of tumor-derived factors in response to radiation stimulates MSC invasion.

  13. Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor is enhanced by compressive

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor la Santé et de la Recherche Médicale Running title Cancellous bone culture in a dynamic 3D bioreactor

  14. Curr Pharm Des . Author manuscript Bisphosphonates and bone diseases: past, present and future

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget s disease of bone

  15. Shell Formation and Bone Strength Laying Hens

    E-Print Network [OSTI]

    Shell Formation and Bone Strength in Laying Hens Effects of Age, Daidzein and Exogenous Estrogen Cover aquarelle: E. Spörndly-Nees #12;Shell Formation and Bone Strength in Laying Hens Effects of Age eggshells as shell quality declines with age during the laying period. This is a concern for food safety

  16. Mechanical bone strength in the proximal tibia

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    . These findings were a pilot study of the technique, which will subsequently be used for human tibial bone. Such data is relevant in the human with respect to the ability of the bone at various distances from the condyle to support the "flat-plate" loading...

  17. Ibuprofen Administered Pre- or Post- Simulated Resistance Exercise Training Does Not Diminsh Gains in Bone Formation or Bone Mass

    E-Print Network [OSTI]

    Cunningham, David

    2012-02-14T23:59:59.000Z

    IBUPROFEN ADMINSTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINISH GAINS IN BONE FORMATION OR BONE MASS A Thesis by DAVID ARTHUR CUNNINGHAM Submitted to the Office of Graduate Studies of Texas A... Training Does Not Diminish Gains in Bone Formation or Bone Mass Copyright 2011 David Arthur Cunningham IBUPROFEN ADMINISTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINSH GAINS IN BONE FORMATION OR BONE MASS A Thesis...

  18. Comparative analysis of 11 different radioisotopes for palliative treatment of bone metastases by computational methods

    SciTech Connect (OSTI)

    Guerra Liberal, Francisco D. C., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, Adriana Alexandre S., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, João Manuel R. S., E-mail: tavares@fe.up.pt [Instituto de Engenharia Mecânica e Gestão Industrial, Faculdade de Engenharia, Universidade do Porto, Rua Dr. Roberto Frias s/n, Porto 4200-465 (Portugal)

    2014-11-01T23:59:59.000Z

    Purpose: Throughout the years, the palliative treatment of bone metastases using bone seeking radiotracers has been part of the therapeutic resources used in oncology, but the choice of which bone seeking agent to use is not consensual across sites and limited data are available comparing the characteristics of each radioisotope. Computational simulation is a simple and practical method to study and to compare a variety of radioisotopes for different medical applications, including the palliative treatment of bone metastases. This study aims to evaluate and compare 11 different radioisotopes currently in use or under research for the palliative treatment of bone metastases using computational methods. Methods: Computational models were used to estimate the percentage of deoxyribonucleic acid (DNA) damage (fast Monte Carlo damage algorithm), the probability of correct DNA repair (Monte Carlo excision repair algorithm), and the radiation-induced cellular effects (virtual cell radiobiology algorithm) post-irradiation with selected particles emitted by phosphorus-32 ({sup 32}P), strontium-89 ({sup 89}Sr), yttrium-90 ({sup 90}Y ), tin-117 ({sup 117m}Sn), samarium-153 ({sup 153}Sm), holmium-166 ({sup 166}Ho), thulium-170 ({sup 170}Tm), lutetium-177 ({sup 177}Lu), rhenium-186 ({sup 186}Re), rhenium-188 ({sup 188}Re), and radium-223 ({sup 223}Ra). Results: {sup 223}Ra alpha particles, {sup 177}Lu beta minus particles, and {sup 170}Tm beta minus particles induced the highest cell death of all investigated particles and radioisotopes. The cell survival fraction measured post-irradiation with beta minus particles emitted by {sup 89}Sr and {sup 153}Sm, two of the most frequently used radionuclides in the palliative treatment of bone metastases in clinical routine practice, was higher than {sup 177}Lu beta minus particles and {sup 223}Ra alpha particles. Conclusions: {sup 223}Ra and {sup 177}Lu hold the highest potential for palliative treatment of bone metastases of all radioisotopes compared in this study. Data reported here may prompt future in vitro and in vivo experiments comparing different radionuclides for palliative treatment of bone metastases, raise the need for the careful rethinking of the current widespread clinical use of {sup 89}Sr and {sup 153}Sm, and perhaps strengthen the use of {sup 223}Ra and {sup 177}Lu in the palliative treatment of bone metastases.

  19. E-Print Network 3.0 - autologous cell therapy Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2009 447 The new england Summary: of nonmyeloablative chemo- therapy followed by an infusion of autologous hematopoietic stem cells that had been trans... autologous CD34+ bone...

  20. Think of your bones as a "bank" where

    E-Print Network [OSTI]

    Baker, Chris I.

    can get osteoporosis (ah-stee-oh-puh- ROH-sis) when you get older. Osteoporosis is a disease in which the bones become weak and more likely to break (fracture). People with osteoporosis most often break bones in the hip, spine, and wrist. 1 #12;Normal bone Bone with osteoporosis Reprinted from The Surgeon General

  1. Application of synchrotron radiation computed microtomography for quantification of bone microstructure in human and rat bones

    SciTech Connect (OSTI)

    Parreiras Nogueira, Liebert; Barroso, Regina Cely; Pereira de Almeida, Andre; Braz, Delson; Almeida, Carlos Eduardo de; Borba de Andrade, Cherley; Tromba, Giuliana [Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Physics Institute / State University of Rio de Janeiro, 20550-900, Rio de Janeiro (Brazil); Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Laboratory of Radiological Sciences / State University of Rio de Janeiro, Rio de Janeiro (Brazil); Sincrotrone Trieste SCpA, Strada Statale S.S. 14 km 163.5, 34012 Basovizza, Trieste (Italy)

    2012-05-17T23:59:59.000Z

    This work aims to evaluate histomorphometric quantification by synchrotron radiation computed microto-mography in bones of human and rat specimens. Bones specimens are classified as normal and pathological (for human samples) and irradiated and non-irradiated samples (for rat ones). Human bones are specimens which were affected by some injury, or not. Rat bones are specimens which were irradiated, simulating radiotherapy procedures, or not. Images were obtained on SYRMEP beamline at the Elettra Synchrotron Laboratory in Trieste, Italy. The system generated 14 {mu}m tomographic images. The quantification of bone structures were performed directly by the 3D rendered images using a home-made software. Resolution yielded was excellent what facilitate quantification of bone microstructures.

  2. Microdamage accumulation in bovine trabecular bone

    E-Print Network [OSTI]

    Moore, Tara L. Arthur (Tara Lee Arthur), 1972-

    2001-01-01T23:59:59.000Z

    When bone is loaded beyond its failure point, it develops damage in the form of microcracks. Normally, microcracks are repaired by the remodeling process, limiting the number of in vivo microcracks. However, if the rate ...

  3. CORTICAL BONE FRACTURE R. O. RITCHIE

    E-Print Network [OSTI]

    Ritchie, Robert

    with menopause in aging women, can lead to osteoporosis, a condition of low bone mass associated the therapeutic benefits of antiresorptive agents in treating osteoporosis (6,7) has re-emphasized the ne- cessity

  4. Composite gelatin delivery system for bone regeneration

    E-Print Network [OSTI]

    Hager, Elizabeth A. (Elizabeth Ann)

    2005-01-01T23:59:59.000Z

    In this thesis, the chemical/mechanical properties and biocompatibility of gelatin were investigated to produce a gelatin scaffold for the release of bone morphogenetic proteins (BMPs) from composite particles. This delivery ...

  5. The roll of integrins in hematopoiesis

    E-Print Network [OSTI]

    Eshghi, Shawdee

    2007-01-01T23:59:59.000Z

    Hematopoietic stem cells (HSCs) hold great promise for the treatment of disease. The rare frequency at which HSCs occur in the bone marrow under homeostatic conditions is a limiting factor in both their study and clinical ...

  6. antiradical scavenging activity: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 43 An Ultra-Low-Power Power Management IC for Energy-Scavenged...

  7. alpha4beta2 receptor imaging: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris First Page Previous Page 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16...

  8. adenovirus expressing glycoproteins: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 12 CXCR4 Mediated Chemotaxis Is Regulated by 5T4 Oncofetal...

  9. analogs scavenge lipid-derived: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 59 An Ultra-Low-Power Power Management IC for Energy-Scavenged...

  10. angiotensin receptor type: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    receptor A Abbreviations: Ad, adenovirus; BMDCs, bone marrow-derived dendritic cells; CFDA-SE, 5 Nicchitta, Chris 97 Subtype Receptor of Angiotensin II From Large Arteries to the...

  11. adult adipose derived: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    clades that lack larvae or that have specialized larval feeding James C. O& apos; reilly; Stephen M. Deban; Kiisa C. Nishikawa 16 Bone Marrow-Derived Cells that Populate the...

  12. Bone Growth, Maintenance and Loss in the Neolithic Community of Çatalhöyük, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Bone Growth, Maintenance and Loss in the Neolithic CommunityThe examination of bone maintenance and loss is another wellchanging patterns of bone maintenance typically observed in

  13. OSTEOBLAST ADHESION OF BREAST CANCER CELLS WITH SCANNING ACOUSTIC MICROSCOPY

    SciTech Connect (OSTI)

    Chiaki Miyasaka; Robyn R. Mercer; Andrea M. Mastro; Ken L. Telschow

    2005-03-01T23:59:59.000Z

    Breast cancer frequently metastasizes to the bone. Upon colonizing bone tissue, the cancer cells stimulate osteoclasts (cells that break bone down), resulting in large lesions in the bone. The breast cancer cells also affect osteoblasts (cells that build new bone). Conditioned medium was collected from a bone-metastatic breast cancer cell line, MDA-MB-231, and cultured with an immature osteoblast cell line, MC3T3-E1. Under these conditions the osteoblasts acquired a changed morphology and appeared to adherer in a different way to the substrate and to each other. To characterize cell adhesion, MC3T3-E1 osteoblasts were cultured with or without MDA-MB-231 conditioned medium for two days, and then assayed with a mechanical scanning acoustic reflection microscope (SAM). The SAM indicated that in normal medium the MC3T3-E1 osteoblasts were firmly attached to their plastic substrate. However, MC3T3-E1 cells cultured with MDA-MB-231 conditioned medium displayed both an abnormal shape and poor adhesion at the substrate interface. The cells were fixed and stained to visualize cytoskeletal components using optical microscopic techniques. We were not able to observe these differences until the cells were quite confluent after 7 days of culture. However, using the SAM, we were able to detect these changes within 2 days of culture with MDA-MB-231 conditioned medium

  14. H-2 restriction of the T cell response to chemically induced tumors: evidence from F/sub 1/. -->. parent chimeras

    SciTech Connect (OSTI)

    Lannin, D.R.; Yu, S.; McKhann, C.F.

    1982-01-01T23:59:59.000Z

    It has been well established that T cells that react to tumor antigen on virus-induced tumors must share H-2D or H-2K specificities with the tumor. It has been impossible to perform similar studies with chemically induced tumors because each chemically induced tumor expresses a unique tumor antigen that cannot be studied in association with other H-2 types. This study provies evidence that H-2 recognition is also necessary for recognition of chemically induced tumors. We have found that F/sub 1/ ..-->.. parent chimeras preferentially recognize chemically induced tumors of parental H-2 type. C3H/HeJ and C57BL/6 mice were lethally irradiated and restored with (C3H x C57BL/6) F/sub 1/ hybrid bone marrow. The F/sub 1/ ..-->.. C3H chimera but not the F/sub 1/ ..-->.. C57BL/6 chimera was able to respond to a C3H fibrosarcoma in mixed lymphocyte-tumor cell culture and also to neutralize the tumor in an in vivo tumor neutralization assay. On the other hand, the F/sub 1/ ..-->.. C57BL/6 chimera but not the F/sub 1/ ..-->.. C3H chimera was able to kill the C57BL/6 lymphoma EL4 in an in vitro cytotoxicity assay. Both chimeras were tolerant to C3H and C57BL/6 alloantigens but could respond normally to Con A and to BALB/c spleen cells in mixed lymphocyte cultures and cytotoxicity assay.

  15. Photoplethysmography for non-invasive measurement of bone hemodynamic responses to changes in external pressure

    E-Print Network [OSTI]

    Mateus, Jaime (Pereira de Mateus Silva)

    2011-01-01T23:59:59.000Z

    Adequate blood supply and circulation in bones is required to maintain a healthy skeleton, and inadequate blood perfusion is associated with numerous bone pathologies and a decrease in bone mineral density (BMD). Bone ...

  16. The effect of three hemostatic agents on early bone healing in an animal model

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    B, Sjogren S: Effects of bone wax on rabbit cranial boneRR: The effect of bone wax on the healing of experimentaland healing using bone wax and a soluble polymer material.

  17. Bisphosphonates and Bone diseases: past, present and future Bisphosphonates are stable analogues of the naturally-occuring inorganic

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget's disease of bone

  18. Original article Analysis of muscle and bone weight variation

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . The commonalities ranged from 0.76 (drumstick muscle) to 0.92 (neck bone) and the uniqueness (special size factors and drumstick bone factors. The correlation coefficient between the first factor score and carcass muscle was 0

  19. Two-dimensional ultrasonic computed tomography of growing bones.

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Two-dimensional ultrasonic computed tomography of growing bones. P. Lasaygues, E. Franceschini, R: Ultrasonic Computed Tomography, Bone imaging, Born approximation, iterative distorted method I. INTRODUCTION imaging process, using ultrasonic computed tomography. Although this method is known to provide

  20. Mechanistic fracture criteria for the failure of human cortical bone

    SciTech Connect (OSTI)

    Nalla, Ravi K.; Kinney, John H.; Ritchie, Robert O.

    2002-12-13T23:59:59.000Z

    A mechanistic understanding of fracture in human bone is critical to predicting fracture risk associated with age and disease. Despite extensive work, a mechanistic framework for describing how the underlying microstructure affects the failure mode in bone is lacking.

  1. An experimental study of diffusional properties of small ions and nonelectrolytes in compact bone 

    E-Print Network [OSTI]

    Bilge, Huseyin Fertac

    1978-01-01T23:59:59.000Z

    in mineralized tissue is lacking, and no direct measurement of the diffusion coefficient in bone has been reported. RESEARCH OBJECTIVES The overall objective of this investigation was to experimentally determine selected passive mass transport properties... The objective of the research reported was tn determine the diffu- sion coefficients of Na , urea, and glucose and permeability of water through compact hone. The methodology used involved construction of diffusion cells for controlled diffusion...

  2. Three-dimensional terahertz computed tomography of human bones

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    spectroscopy cannot rival with dual energy x-ray absorptiometry (DEXA) to identify the bone mineral density

  3. Dynamic Behavior and Microstructural Properties of Cancellous Bone.

    E-Print Network [OSTI]

    Boyer, Edmond

    A total of 15 distal parts of bovine femoral bones were used for this study (72 hours post mortemDynamic Behavior and Microstructural Properties of Cancellous Bone. S. Laporte1 , F. David1 , V of the cancellous bone and to identify the link between this mechanical behavior and the microstructural properties

  4. Bone loss during energy restriction: mechanistic role of leptin 

    E-Print Network [OSTI]

    Baek, Kyunghwa

    2009-05-15T23:59:59.000Z

    ), dual energy X-ray absorptiometry (DEXA) and mechanical testing. As a whole body measure, biochemical markers of bone turnover can be used to quantify changes in bone formation (e.g., osteocalcin, OC) and bone resorption (e.g., deoxypyridonoline...

  5. Prediction and Informative Risk Factor Selection of Bone Diseases

    E-Print Network [OSTI]

    Zhang, Aidong

    data and use these integrated features to effectively predict osteoporosis and bone fractures. We; disease memory; osteoporosis; bone fracture. ! 1 INTRODUCTION Risk factor (RF) analysis based on patients on the study of osteoporosis and bone fracture prediction. Over the past few decades, osteoporosis has been

  6. Hemoglobin TranscripT abundance in a cdna library from bone marrow of cresTed ducks (Lophonetta specuLarioides)

    E-Print Network [OSTI]

    McCracken, Kevin G.

    taxones de regiones de alta montaña para determinar si hay expresión diferencial de las subunidades A y D ósea de individuos que habitan regiones de alta montaña y coinciden con la función hematopoyética e high-altitude regions and are in agreement with the known hemopoietic and immune function

  7. INVEST IN YOUR BONES Daily Activities

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Daily Activities Leaflet 3 Another osteoporosis prevention step to decrease lifestyle. Let's see how you can do that. If you have osteoporosis, follow carefully the activity program. Remember the following about osteoporosis: is largely preventable and treatable is a serious

  8. Validation of a simple and fast method to quantify in vitro mineralization with fluorescent probes used in molecular imaging of bone

    SciTech Connect (OSTI)

    Moester, Martiene J.C. [Department of Radiology, Leiden University Medical Center (Netherlands)] [Department of Radiology, Leiden University Medical Center (Netherlands); Schoeman, Monique A.E. [Department of Orthopedic Surgery, Leiden University Medical Center (Netherlands)] [Department of Orthopedic Surgery, Leiden University Medical Center (Netherlands); Oudshoorn, Ineke B. [Department of Radiology, Leiden University Medical Center (Netherlands) [Department of Radiology, Leiden University Medical Center (Netherlands); Percuros BV, Leiden (Netherlands)] [Netherlands; Beusekom, Mara M. van [Department of Radiology, Leiden University Medical Center (Netherlands)] [Department of Radiology, Leiden University Medical Center (Netherlands); Mol, Isabel M. [Department of Radiology, Leiden University Medical Center (Netherlands) [Department of Radiology, Leiden University Medical Center (Netherlands); Percuros BV, Leiden (Netherlands)] [Netherlands; Kaijzel, Eric L.; Löwik, Clemens W.G.M. [Department of Radiology, Leiden University Medical Center (Netherlands); Rooij, Karien E. de, E-mail: k.e.de_rooij@lumc.nl [Department of Radiology, Leiden University Medical Center (Netherlands) [Department of Radiology, Leiden University Medical Center (Netherlands); Percuros BV, Leiden (Netherlands)] [Netherlands

    2014-01-03T23:59:59.000Z

    Highlights: •We validate a simple and fast method of quantification of in vitro mineralization. •Fluorescently labeled agents can detect calcium deposits in the mineralized matrix of cell cultures. •Fluorescent signals of the probes correlated with Alizarin Red S staining. -- Abstract: Alizarin Red S staining is the standard method to indicate and quantify matrix mineralization during differentiation of osteoblast cultures. KS483 cells are multipotent mouse mesenchymal progenitor cells that can differentiate into chondrocytes, adipocytes and osteoblasts and are a well-characterized model for the study of bone formation. Matrix mineralization is the last step of differentiation of bone cells and is therefore a very important outcome measure in bone research. Fluorescently labelled calcium chelating agents, e.g. BoneTag and OsteoSense, are currently used for in vivo imaging of bone. The aim of the present study was to validate these probes for fast and simple detection and quantification of in vitro matrix mineralization by KS483 cells and thus enabling high-throughput screening experiments. KS483 cells were cultured under osteogenic conditions in the presence of compounds that either stimulate or inhibit osteoblast differentiation and thereby matrix mineralization. After 21 days of differentiation, fluorescence of stained cultures was quantified with a near-infrared imager and compared to Alizarin Red S quantification. Fluorescence of both probes closely correlated to Alizarin Red S staining in both inhibiting and stimulating conditions. In addition, both compounds displayed specificity for mineralized nodules. We therefore conclude that this method of quantification of bone mineralization using fluorescent compounds is a good alternative for the Alizarin Red S staining.

  9. BONE LOSS IN RELATION TO HYPOTHALAMIC ATROPHY IN ALZHEIMER'S DISEASE

    E-Print Network [OSTI]

    Loskutova, Natalia Y.

    2011-05-12T23:59:59.000Z

    considerable burden on the health system, patients, and caregivers. 1.2 Alzheimer’s Disease and Bone Loss Bone health is an important issue in aging and AD. Osteoporosis–related fractures are among the major health and socioeconomic concerns in aging... of bone fractures, and a determining factor in clinical diagnosis of osteoporosis (Ammann and Rizzoli 2003). Several studies in women suggest that low BMD is associated with poorer cognitive function and subsequent cognitive decline (Yaffe, Browner et al...

  10. Bone Cancer Rates in Dinosaurs Compared with Modern Vertebrates

    E-Print Network [OSTI]

    L. C. Natarajan; A. L. Melott; B. M. Rothschild; L. D. Martin

    2007-10-16T23:59:59.000Z

    Data on the prevalence of bone cancer in dinosaurs is available from past radiological examination of preserved bones. We statistically test this data for consistency with rates extrapolated from information on bone cancer in modern vertebrates, and find that there is no evidence of a different rate. Thus, this test provides no support for a possible role of ionizing radiation in the K-T extinction event.

  11. allowing normal bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    assays. Correlations of fluoride levels between normal bone near the Nancy Medina; Chester W. Douglass; Gary M. Whitford; Robert N. Hoover; Thomas R. Fears 6 Differential...

  12. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    their results, the researchers recommended that vitamin D levels be checked and kept on well--balanced levels to maintain the structural integrity of bones and avoid...

  13. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on different size scales within bone, as well as the role of sustained irradiation damage. Combining in situ mechanical testing with synchrotron x-ray diffraction imaging and...

  14. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    Skeleton. In Bone Loss and Osteoporosis: An AnthropologicalThe radiological diagnosis of osteoporosis: A new approach.170. Birnbaum, E. 1992. Osteoporosis: A Summary of Recent

  15. ancient human bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reich, David 159 OsteoConduct: Wireless Body-Area Communication based on Bone Conduction Energy Storage, Conversion and Utilization Websites Summary: , Measurement, Human Factors....

  16. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    present and that diagenesis (chemical exchange between therisk assessment. Diagenesis, or the chemical exchangeto assess the level of diagenesis in a bone without chemical

  17. attenuates bone cancer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    human bone were studied via the small scale mechanical loading test. Failure analysis was conducted... Jang, Eunhwa 2012-10-19 19 ORIGINAL ARTICLE JBMR Cancer Treatment...

  18. arm bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TO ENSURE HUMAN SAFETY Lingqi Zeng and Gary M. Bone Engineering Websites Summary: , and robot and human velocities. The impact experiments are performed with an apparatus...

  19. Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Bala Krishnamoorthy, Department of Mathematics, Washington State University

    E-Print Network [OSTI]

    Krishnamoorthy, Bala

    1 Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Strength Bala to failure in axial compression. Predictive variables included age, gender, bone mineral density (BMD mineral density, spine surgery. #12;3 Introduction The allograft bone industry is guided by practices

  20. Osteopontin deficiency increases bone fragility but preserves bone mass Philipp J. Thurner a,b

    E-Print Network [OSTI]

    Ritchie, Robert

    density (BMD) is the most common diagnostic used to assess fracture risk [1,2], yet less than half of non to osteopontin in bone, many of which have the potential to impact material properties. To elucidate the role role for OPN in preventing crack propagation. This significant decline in fracture toughness

  1. Quantity and Quality of Trabecular Bone in the Femur Are Enhanced by a Strongly Anabolic, Noninvasive

    E-Print Network [OSTI]

    serve as the basis for a biomechanically based intervention for osteoporosis. To evaluate intervention for osteoporosis. (J Bone Miner Res 2002;17:349­357) Key words: osteoporosis, osteogenic, anabolic, bone formation, bone quality, osteogenic INTRODUCTION OSTEOPOROSIS, A disease characterized

  2. Structural Analysis of Human and Bovine Bone for Development of Synthetic Materials 

    E-Print Network [OSTI]

    Jang, Eunhwa

    2012-10-19T23:59:59.000Z

    With increasing demands in bone repair and replacement, this research investigates the microstructure, properties and performance of bovine bone, human bone, and synthetic materials. Doing so, experimental approaches were used to exam and compare...

  3. Role of middle-ear inertial component of bone conduction in chinchilla

    E-Print Network [OSTI]

    Chhan, David

    2013-01-01T23:59:59.000Z

    Bone conduction describes the mechanisms that produce a hearing sensation when the skull bones are subjected to vibration. Multiple components and pathways have been suggested to contribute to total bone-conducted sound. ...

  4. Mechanical bone strength in the proximal tibia 

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    KNEE REPLACEMENT 3 2. 1 Mechanics of the Knee 2. 1. 1 knee Structure. 2. 1. 2 Bone Strength of Proximal Tibia. 2. 2 Total Knee Replacement. '2. 3 Research Prospective III MECHANICS OF MATERIALS. . 3 3 5 7 8 10 3. 1 Normal Stress and Strain... Specimens. 4. 1. 2 Mechanical Test. . 4. 2 Statistical Analysis. . . . . . . . . . . . . 18 18 18 19 V RESULTS AND CONCLUSIONS. 20 5. 1 Results. . 20 5. 2 Discussion and Conclusions. Page 24 REFERENCES. 27 VITA. 29 LIST OF FIGURES FIGURE 2. 1...

  5. DOI: 10.1002/cmdc.201100381 Runaway ROS as a Selective Anticancer Strategy

    E-Print Network [OSTI]

    Hergenrother, Paul J.

    rapidly dividing normal cells, such as the intestinal lining and bone marrow, resulting in dose limiting) protein found in some non-small-cell lung cancers,[1,2] and trastuzumab (Her- ceptin), a monoclonal selectively induces death in cancer cell lines compared with normal cells--Raj et al. reported

  6. WOMEN'S GLOBAL HEALTH INSTITUTE NUTR59000/BMS59800: WOMEN'SHEALTH:BONE

    E-Print Network [OSTI]

    /remodeling, mechanics;Tools of assessment Epidemiology of osteoporosis Development of peak bone mass ­ nutrition/exercise Adult Bone: Women's reproductive choices ­ oral contraceptives, pregnancy, lactation Menopause: Biology

  7. Novel Techniques for High-Resolution Functional Imaging of Trabecular Bone

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    associated with osteoporosis (1, 2). Osteoporosis results in bone loss and deterioration in trabecular a primary endpoint in osteoporosis diagnosis and monitoring. Where strong correlations between bone density

  8. Bone Growth, Maintenance and Loss in the Neolithic Community of Çatalhöyük, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Interpreting Bone Loss and Osteoporosis in Past Populations.2005. How many women have osteoporosis? Journal of Bone and1987. Postmenopausal osteoporosis: single screening method

  9. Verrucous carcinoma of the foot affecting the bone: Utility of the computed tomography scanner

    E-Print Network [OSTI]

    García-Gavín, J; González-Vilas, D; Rodríguez-Pazos, L; Sánchez-Aguilar, D; Toribio, J

    2010-01-01T23:59:59.000Z

    Frassica FJ, Fishman EK. Computed tomography of the bones ofbone: Utility of the computed tomography scanner J García-of bone invasion. Computed tomography (CT) showed a lytic

  10. Microcapsule-Induced Toughening of Bone Cement Gina M. Miller

    E-Print Network [OSTI]

    Sottos, Nancy R.

    27 Microcapsule-Induced Toughening of Bone Cement Gina M. Miller Senior in Aerospace Engineering R. White, and TAM Prof. Nancy R. Sottos Acrylic bone cement is the primary material used cement, it may be possible to extend the lifetime of the implant, thus reducing the occurrence

  11. Therapeutic Agents for the Prevention and Restoration of Bone Mass

    E-Print Network [OSTI]

    Slatton, Clint

    osteoporosis-related bone loss. According to the National Osteoporosis Foundation, osteoporosis is a major osteoporosis Advantages · Selectively blocks osteoclastic bone resorption by a novel mechanism, providing in post-menopausal women. This ultimately leads to fractures resulting from minimal falls and accidents

  12. Bone motion analysis from dynamic MRI: acquisition and tracking

    E-Print Network [OSTI]

    Gilles, Benjamin

    overload, impingement or femoral head instability. For both the diagnosis and the surgical planningBone motion analysis from dynamic MRI: acquisition and tracking Benjamin Gilles1 , Rosalind Perrin2 methods in order to auto- matically extract active bone kinematics from multi-slice real-time dy- namic

  13. Biomechanics in bone tissue engineering Dominique P. Pioletti*

    E-Print Network [OSTI]

    Guerraoui, Rachid

    such a procedure truly is, we report, in Figure 1(a), the particular case of a posterior surgical approachBiomechanics in bone tissue engineering Dominique P. Pioletti* Laboratory of Biomechanical 18 January 2010) Biomechanics may be considered as central in the development of bone tissue

  14. On the Estimation of Bone Status Rasmus Paulsen

    E-Print Network [OSTI]

    Osteoporosis Diagnostics. The subject of this thesis is medical image analysis with special attention to X Reinhold Paulsen Keywords Osteoporosis, bone status, radius, contact radiographs, cortical geometry, en algorithm developed by Torsana Osteoporosis Diagnostics. A simulated bone is made by simulated x

  15. Interaction of osteoblast-like cells with serum and fibronectin: effects on cell motility and proliferation in vitro

    SciTech Connect (OSTI)

    Zuk, A.

    1986-01-01T23:59:59.000Z

    Osteoblast migration and proliferation are believed to occur during bone remodelling, in particular after osteoclastic bone resorption and prior to osteoblastic bone formation. In order to study migration and proliferation in vitro, the model of Alessandri et al. (1983) was modified. The model entailed seeding osteoblast-like cells into wells cut in agar and quantifying migration and proliferation peripheral to the well. Cell morphology also was described. The data indicated that on growth surfaces enriched with varying concentrations of fetal calf serum (FSC), the quantification of migration and proliferation was related both to percent cell attachment and to FCS-concentration. Because few osteoblast-like cells incorporated (/sup 3/H-TdR), it was concluded that the appearance of cells peripheral to the well was due to migration, and not to proliferation. Cell morphology and myosin distribution and organization indicated that osteoblast-like cells at the periphery of the cell culture (i.e. leading edge) may have been directionally migrating whereas cells behind the leading edge may have been engaged in non-directional migration. The migration, proliferation, and morphology of osteoblast-like cells cultured on fibronectin (FN) enriched growth surfaces also was examined. The quantification of migration and proliferation was related to the FN-concentration applied to the growth surface. Because few osteoblast-like cells incorporated /sup 3/H-TdR and cell morphology indicated migration, it was concluded that osteoblast-like cells on FN-enriched growth surfaces are specialized, in part, for migration.

  16. Relation between hydrogen isotopic ratios of bone collagen and rain

    SciTech Connect (OSTI)

    Cormie, A.B.; Schwarcz, H.P. (McMaster Univ., Hamilton, Ontario (Canada)); Gray, J. (Univ. of Alberta, Edmonton (Canada))

    1994-01-01T23:59:59.000Z

    The hydrogen isotopic value ([delta]D) of deer bone collagen is related to both [delta]D of rain during the growing season and growing season relative humidity (RH). With correction for the effects of RH, bone [delta]D is related to growing season rain [delta]D in a simple manner with a slope of 1.0. This indicates that, with RH correction, there are no additional sources of bias in the [delta]D of bone due to unaccounted for biologic or climatic effects. Due to a low sensitivity of bone [delta]D to RH effects, both yearly and growing season rain [delta]D can be estimated with considerable accuracy (R = 0.97 and R = 0.96) from bone collagen [delta]D and [delta][sup 15]N. Here, [delta][sup 15]N is used to correct bone [delta]D for the effects of RH. From these estimates of rain [delta]D, it may then be possible to evaluate temperature since the [delta]D of rain primarily reflects local temperature. Therefore, the measurement of bone collagen [delta]D has good potential for evaluating paleoclimates.

  17. The effects of low environmental cadmium exposure on bone density

    SciTech Connect (OSTI)

    Trzcinka-Ochocka, M., E-mail: ochocka@imp.lodz.pl [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Jakubowski, M. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Szymczak, W. [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland) [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland); Insitute of Psychology, University of Lodz (Poland); Janasik, B.; Brodzka, R. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)

    2010-04-15T23:59:59.000Z

    Recent epidemiological data indicate that low environmental exposure to cadmium, as shown by cadmium body burden (Cd-U), is associated with renal dysfunction as well as an increased risk of cadmium-induced bone disorders. The present study was designed to assess the effects of low environmental cadmium exposure, at the level sufficient to induce kidney damage, on bone metabolism and mineral density (BMD). The project was conducted in the area contaminated with cadmium, nearby a zinc smelter located in the region of Poland where heavy industry prevails. The study population comprised 170 women (mean age=39.7; 18-70 years) and 100 men (mean age=31.9; 18-76 years). Urinary and blood cadmium and the markers of renal tubular dysfunction ({beta}{sub 2}M-U RBP, NAG), glomerular dysfunction (Alb-U and {beta}{sub 2}M-S) and bone metabolism markers (BAP-S, CTX-S) as well as forearm BMD, were measured. The results of this study based on simple dose-effect analysis showed the relationship between increasing cadmium concentrations and an increased excretion of renal dysfunction markers and decreasing bone density. However, the results of the multivariate analysis did not indicate the association between exposure to cadmium and decrease in bone density. They showed that the most important factors that have impact on bone density are body weight and age in the female subjects and body weight and calcium excretion in males. Our investigation revealed that the excretion of low molecular weight proteins occurred at a lower level of cadmium exposure than the possible loss of bone mass. It seems that renal tubular markers are the most sensitive and significant indicators of early health effects of cadmium intoxication in the general population. The correlation of urinary cadmium concentration with markers of kidney dysfunction was observed in the absence of significant correlations with bone effects. Our findings did not indicate any effects of environmental cadmium exposure on bone density.

  18. Processing of hydroxylapatite coatings on titanium alloy bone prostheses

    DOE Patents [OSTI]

    Nastasi, Michael A. (Espanola, NM); Levine, Timothy E. (Santa Clara, CA); Mayer, James W. (Phoenix, AZ); Pizziconi, Vincent B. (Phoenix, AZ)

    1998-01-01T23:59:59.000Z

    Processing of hydroxylapatite sol-gel films on titanium alloy bone prostheses. A method utilizing non-line-of-sight ion beam implantation and/or rapid thermal processing to provide improved bonding of layers of hydroxylapatite to titanium alloy substrates while encouraging bone ingrowth into the hydroxylapatite layers located away from the substrate, is described for the fabrication of prostheses. The first layer of hydroxylapatite is mixed into the substrate by the ions or rapidly thermally annealed, while subsequent layers are heat treated or densified using ion implantation to form layers of decreasing density and larger crystallization, with the outermost layers being suitable for bone ingrowth.

  19. ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone

    E-Print Network [OSTI]

    Price, Paul A.

    ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone Po-Yu Chen · Damon the hierarchical structure of mineral in mature bone. A method to completely deproteinize bone without altering of mineral and protein constituents. SEM revealed that bone minerals are fused together and form a sheet

  20. Interactive Separation of Segmented Bones in CT Volumes Using Graph Cut

    E-Print Network [OSTI]

    Ju, Tao

    mask customized to the shape of the bone, such as the femoral head. However, creat- ing masks for bones of different methodology have been reported for bone segmen- tation (see a recent survey in [1]). DueInteractive Separation of Segmented Bones in CT Volumes Using Graph Cut Lu Liu, David Raber, David

  1. Bone density and geometry in juvenile racehorses fed differing amounts of minerals

    E-Print Network [OSTI]

    Nolan, Meghan Muire

    2002-01-01T23:59:59.000Z

    designed as low, moderate, moderately high and high. Radiographs of the third metacarpal (MCIII) were taken on day 0, 28, 60, 92 and 124 to evaluate change in bone density and bone geometry. Bone density was expressed as radiographic bone aluminum...

  2. Computer modeling approach for microsphere-packed bone scaffold Pallavi Lal, Wei Sun*

    E-Print Network [OSTI]

    Sun, Wei

    bone graft [5,6], for structural and human cellular assessment of scaffolds for bone repair [7 modeling approach for constructing a three-dimensional microsphere-packed bone graft structure is presented packing model to determine the number of microspheres packed in a synthesized bone graft. The pore size

  3. Prediction of the elastic modulus of the trabecular bone based on X-ray computed tomography

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . INTRODUCTION The investigation of the mechanical properties of trabe- cular bone presents a major challenge

  4. Technetium-99m white blood cell imaging: False-negative result in salmonella osteomyelitis associated with sickle cell disease

    SciTech Connect (OSTI)

    Guze, B.H.; Hawkins, R.A.; Marcus, C.S.

    1989-02-01T23:59:59.000Z

    The authors report a case of sickle cell anemia associated osteomyelitis where the Tc-99m white blood cell imaging was negative, and bone imaging showed increased uptake in the region in question. The reasons for the possible false-negative image are discussed.

  5. Evaluation of radionuclide bone-imaging for the early detection of sepsis in a model of equine neonatal osteomyelitis

    E-Print Network [OSTI]

    Taylor, James Rutledge

    1986-01-01T23:59:59.000Z

    method of detecting bone abnormalities. The two main factors determining the degree of radiopharmaceutical uptake in bones, and thereby assessing the functional integrity of bone, have been identified as bone blood flow and bone turnover rates.... The resultant infection and induced metabolic changes should produce a positive Technetium-99m MDP ( Tc-MDP) 99m bone scan, a positive scan using Indium-111-oxine labeled leukocytes and radiographic changes characterized by decreased bone density . Seven...

  6. autotaxin controls bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Bykowski; Johnny Huard, Ph.D.; Lee E. Weiss, Ph.D.; Joseph E. Losee; Phil G. Campbell, Ph.D. 3 Akt1 in Osteoblasts and Osteoclasts Controls Bone Remodeling University of Kansas -...

  7. On the Mechanistic Origins of Toughness in Bone

    E-Print Network [OSTI]

    Launey, Maximilien E.

    One of the most intriguing protein materials found in nature is bone, a material composed of assemblies of tropocollagen molecules and tiny hydroxyapatite mineral crystals that form an extremely tough, yet lightweight, ...

  8. Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics

    E-Print Network [OSTI]

    Vuik, Kees

    Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics E.M.van Aken 1107895 of the joint and to relieve the pain, a prosthesis to replace the glenoid of the shoulder joint is an option

  9. affects bone tissue: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  10. abnormal bone growth: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  11. abnormally high bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  12. acute bone crises: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  13. anorganic bone clinical: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  14. abnormal bone development: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  15. absorptiometry bone densitometer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  16. acute bone infarcts: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  17. acellular bone explants: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  18. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, James W. (108 Independent Blvd., Aiken, SC 29801)

    1993-01-01T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  19. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-06-08T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  20. ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone

    E-Print Network [OSTI]

    Ritchie, Robert

    ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone in adult rats /Accepted: 3 September 2013 /Published online: 11 April 2014 # International Osteoporosis Foundation and National Osteoporosis Foundation 2014 Abstract Summary We used an osteopenic adult ovariectomized (OVX) rat

  1. areal bone mineral: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2.2.4 Risk factors 22 2.2.5 Morbidity and mortality 23 2.3 Units Laughlin, Robert B. 103 Rare earth element systematics of fossil bone revealed by LA-ICPMS analysis Environmental...

  2. Modular ‘Click-in-Emulsion’ Bone-Targeted Nanogels

    E-Print Network [OSTI]

    Heller, Daniel A.

    A new class of nanogel demonstrates modular biodistribution and affinity for bone. Nanogels, ~70 nm in diameter and synthesized via an astoichiometric click-chemistry in-emulsion method, controllably display residual, free ...

  3. Trabecular bone dosimetry using a Monte Carlo code

    E-Print Network [OSTI]

    Zuzarte de Mendonca, Anne

    1993-01-01T23:59:59.000Z

    The nuclear medicine community needs radiation ~ dose estimates to patients who are administered radiopharmaceuticals for therapy or diagnosis. These estimates should be as accurate as possible for any organ, and especially for the bone since the bone... of Nuclear Medicine formed a committee to fulfill the needs of the nuclear medicine community to determine the radiation absorbed dose to patients who are athninistered radiopharmaceuticals. The objectives of the Medical Internal Radiation Dose Committee...

  4. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    and the epiphysis are wider than the diaphysis. Cortical bone is denser than trabecular bone as shown in Fig. 2.1b. In the overall adult human skeleton, the skeletal mass is 80% cortical bone and 20% trabecular bone (4). However, the distribution of cortical... surfaces. Moreover, they did not use the volume 6 Table 2.1. Summary of experimental results on trabecular bone from previous research Source Type of bone Size of specimen Carter & Hayes (3) Bovine, Human ?20.6x5mm Cylinder E =3790? 0.06 ? 3 , ? c...

  5. Targeting of Osseous Sites with Alpha-emitting Ra-223: Comparison with the Beta-emitter Sr-89 in Mice

    SciTech Connect (OSTI)

    Henriksen, Gjermund; Fisher, Darrell R.; Roeske, John C.; Bruland, Oyvind S.; Larsen, Roy H.

    2003-05-16T23:59:59.000Z

    The bone-seeking property of and the potential to irradiate red marrow by the alpha-particle emitter Ra-223 (t1/2 = 11.43 d) were compared to those of the beta-emitter Sr-89 (t1/2 = 50.53 d). Methods: The biodistributions of Ra-223 and Sr-89 were studied in mice. Tissue uptakes were determined at 1 h, 6 h, 1 d, 3 d, and 14 d after intravenous administration. The potential redistribution of progeny from Ra-223 located in bone was investigated. Radiation absorbed doses were calculated for soft tissues and bone. Doses were also estimated for marrow-containing cavities assuming spheric geometries. Results: We found that both Sr-89 and Ra-223 selectively concentrated on bone surfaces relative to soft tissues. The measured bone uptake of Ra-223 was slightly higher than that of Sr-89. At the 24 h time-point, the femur uptake of Ra-223 was 40.1% of the administered activity per gram tissue. The uptake in spleen and most other soft tissues was higher for Ra-223 than for Sr-89. We observed rapid clearance of Ra-223 from soft tissues within the first 24 hours, but the bone surface uptake of Ra-223 increased with time up to 24 h. Among the soft tissues, the spleen had the greatest accumulation and retention of Ra-223. The femur-to-spleen ratio increased with time, from 6.4 at 6 h to 23.7 at 3 days after injections. We found little redistribution of Ra-223 daughter products away from bone (about 2% at 6 h and less than 1% detectable at 3 d). Estimates of dose to marrow-containing cavities showed that the Ra-223 alpha-emitter might have a marrow-sparing advantage compared to beta-emitters due to high linear-energy-transfer and short alpha range targeting osteoid surfaces. The alpha-emitters irradiate a smaller fraction of the marrow-containing volumes--sparing marrow and enhancing survival of marrow cells. At the same time, the bone surfaces receives a therapeutically effective radiation dose. Conclusion: The results of this study indicate that Ra-223 is a promising candidate for high linear-energy-transfer alpha-particle irradiation of cancer cells on bone surfaces. Radium-223 can, together with its daughter radionuclides, deliver an intense and highly localized field of radiation to bone surfaces with substantially less irradiation of healthy bone marrow dose compared to standard, bone-seeking beta-emitters such as Sr-89.

  6. Common variants in the region around Osterix are associated with bone mineral density and growth in childhood

    E-Print Network [OSTI]

    Peltonen, Leena

    Peak bone mass achieved in adolescence is a determinant of bone mass in later life. In order to identify genetic variants affecting bone mineral density (BMD), we performed a genome-wide association study of BMD and related ...

  7. Questions and Answers About LeukemiaCENTERS FOR DISEASE CONTROL AND PREVENTION

    E-Print Network [OSTI]

    the disease develops (acute vs. chronic leukemia) and by the type of blood cell involved (lymphocytic and myeloid leukemia being the most common). In acute leukemia, bone marrow cells are immature and are unable slowly. The most common types of leukemia are acute lymphocytic leukemia, acute myeloid leukemia, chronic

  8. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model 

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    In this study, trabecular architecture is considered as a cellular solid structure, including both intact and damaged bone models. ??Intact?? bone models were constructed based on ideal versions of 25, 60 and 80-year-old ...

  9. Methods for identifying cancellous bone specimen location and size for the Reduced Platen Compression Test 

    E-Print Network [OSTI]

    Cowen, Kyle Ray

    2013-02-22T23:59:59.000Z

    , and stimuli on the skeleton and its ability to perform these everyday functions. The current state of bone testing is focused on understanding the mechanical properties of bone through use of traditional mechanical testing procedures such as three point...

  10. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    properties of proximal tibia were measured using in vivo peripheral quantitative CT. Bone formation rate was quantified on the periosteal the surface by standard bone histomorphometry after intraperitoneal injections of calcein. There was a significant main...

  11. Metabolic modeling for the deposition of transuranic nuclides on bone surfaces 

    E-Print Network [OSTI]

    Halter, Donald Anthony

    1997-01-01T23:59:59.000Z

    to bone surfaces. Although only plutonium was used in the evaluation of this model, any bone surface-seeking, alpha-emitting nuclide, and any class compound, can be used with this model....

  12. Apatite-polymer composites for the controlled delivery of bone morphogenetic proteins

    E-Print Network [OSTI]

    Yong, Tseh-Hwan

    2005-01-01T23:59:59.000Z

    Current treatment of bone defects due to trauma, cancer, or degenerative spine diseases involves the implantation of a bone graft. Autografts, which are harvested from the patient's own body, are associated with problems ...

  13. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training 

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    Young and ovariectomized animals eating diets rich in omega-3 polyunsaturated fatty acids (n-3 PUFAs) exhibit enhanced bone formation and decrease bone loss, respectively. Eicosapentaenoic acid, an n-3 PUFA found in fish ...

  14. Detection of bone disease in dogs by radioisotope scanning

    E-Print Network [OSTI]

    Morris, Earl Louis

    1971-01-01T23:59:59.000Z

    f = fractional abundance 6 = cross section thermal neutron f1~ &t (1-e ) = decay factor The usual method of administration of radio- isotopes is intravenously but some have been given orally. 4 high bone to tissue ratio must be achieved... is limited by their availability because they must be produced close to where they will be used. MATERIALS AND METHODS The use of 2 radioactive isotopes for bone scanning in dogs was studied. Sr and Sr were 85 87m selected as the isotopes to be studied...

  15. Measurement of bone mineral content in caged and active cats 

    E-Print Network [OSTI]

    Tveter, Diane Ellen

    1988-01-01T23:59:59.000Z

    errors but these can be reduced by using two different x-ray energies. Dual energy CT operates on a basis similar to dual photon absorptiometry (explained below). The difference in attenuation between tissue and bone is greater for a lower energy... to act as a soft tissue equivalent (35). Effects of fat and soft tissue are decreased when dual energy CT is used (33). Data from each of the two different photon energies are combined and result in images of soft tissue and bone mineral regions. Beam...

  16. The effects of eccentric training on muscle-bone function

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE... December 1999 Major Subject: Kinesiology THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Subinitted to the Office of Graduate Studies of Texas A8iM University in partial fulfillment of the requirements...

  17. Patients with Patellofemoral Pain Exhibit Elevated Bone Metabolic Activity at the Patellofemoral Joint

    E-Print Network [OSTI]

    Delp, Scott

    . While we cannot measure bone stress in vivo, we can visualize bone metabolic activity using 18 F NaF PET/CT, which may be related to bone stress. Our goals were to use 18 F NaF PET/CT to evaluate whether subjects. Published by Wiley Periodicals, Inc. J Orthop Res Keywords: patellofemoral pain; 18 F NaF PET/CT; bone

  18. Is decreased bone mineral density associated with development of scoliosis? A bipedal osteopenic rat model

    E-Print Network [OSTI]

    Dede, Ozgur; Akel, Ibrahim; Demirkiran, Gokhan; Yalcin, Nadir; Marcucio, Ralph; Acaroglu, Emre

    2011-01-01T23:59:59.000Z

    more time standing erect. Dual energy X-ray absorbtiometry (acid; DEXA: Dual energy X-ray absorptiometry; BMD: Bone

  19. 3D Bone Microarchitecture Modeling and Fracture Risk Department of Computer

    E-Print Network [OSTI]

    Buffalo, State University of New York

    technique for the diagnosis of osteoporosis is Bone Mineral Density (BMD) measurement based on dual energy X

  20. Calcium phosphate cement augmentation of cancellous bone screws can compensate for the absence of cortical fixation

    E-Print Network [OSTI]

    Guerraoui, Rachid

    Calcium phosphate cement augmentation of cancellous bone screws can compensate for the absence Keywords: Screw fixation Pullout force Calcium phosphate cement Osteoporotic bone a b s t r a c with cement. Previous studies have shown that bone augmentation with Calcium Phosphate (CaP) cement

  1. Augmentation of bone defect healing using a new biocomposite scaffold: An in vivo study in sheep

    E-Print Network [OSTI]

    Guerraoui, Rachid

    replacement, where significant bone loss can be found either under the tibial tray or in the femoral partAugmentation of bone defect healing using a new biocomposite scaffold: An in vivo study in sheep U March 2010 Keywords: Biocomposite Bone substitute In vivo Poly(L-lactic acid) b-Tricalcium phosphate a b

  2. Design and validation of automated femoral bone morphology measurements in cerebral palsy

    E-Print Network [OSTI]

    Lee, Jehee

    Design and validation of automated femoral bone morphology measurements in cerebral palsy Noyeol, Seoul, South Korea #12;Abstract Accurate quantification of bone morphology is important for monitoring an automatic bone morphology measurement method using one or two radiographs. The study focused on 4

  3. A method for calibration of bone driver transducers to measure the mastoid impedance Reggie Weecea

    E-Print Network [OSTI]

    Allen, Jont

    bone vibrator transducers for clinical measurements, the transfer of energy from the bone driver by known masses. This absolute calibration is based upon a circuit model of the driver, describing specialized equipment not available in the clinic, and a refined bone driver circuit model is proposed

  4. A Graph-based Approach for Computational Model of Bone Microstructure

    E-Print Network [OSTI]

    Buffalo, State University of New York

    azhang@buffalo.edu ABSTRACT Osteoporosis, a condition in which bones become fragile and more likely bone due to osteoporosis. The diagnosis of osteoporosis is commonly done by tests that measure for the diagnosis of osteoporosis are limited due to the lack of good measurements of bone quality. In this paper

  5. Modelling by percolation theory of the behaviour of natural coral used as bone substitute.

    E-Print Network [OSTI]

    Boyer, Edmond

    Modelling by percolation theory of the behaviour of natural coral used as bone substitute. Y the resorption and ossification of natural coral implanted in bones. The first step of the process.barbotteau@qse.tohoku.ac.jp) #12;Modelling by percolation theory of the behaviour of natural coral used as bone substitute.2 1

  6. Histologic Comparison of Regenerate Bone Produced from Dentate Versus Edentulous Transport Discs in Bone Transport Distraction Osteogenesis

    E-Print Network [OSTI]

    Sevilla Gaitan, Carlos

    2013-12-10T23:59:59.000Z

    and the recipient bone segment (Nagashima, Rondon-Newby et al. 2012). Histologic examination of the midline tissues was performed in the present study to establish whether or not bony union has occurred. Main Goal The main goal of this study was to analyze... emphasis on characteristics related to the quality and quantity of the new regenerate bone formed (Zapata, Halvachs et al. 2011; Zapata, Opperman et al. 2011; Nagashima, Rondon-Newby et al. 2012). Nagashima et al. concluded that after four weeks...

  7. Evolution of Matrix and Bone -Carboxyglutamic Acid Proteins in Vertebrates*

    E-Print Network [OSTI]

    Price, Paul A.

    or reconstructed through the use of comparative genomics and data mining. These sequences were compared with available annotated sequences (a total of 48 complete or nearly complete sequences, 28 BGPs and 20 MGPs of biological functions such as skeletogenesis and bone maintenance (BGP and MGP), hemostasis (prothrombin, clot

  8. FSH Directly Regulates Bone Mass Yuanzhen Peng,1

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    .01.051 SUMMARY Postmenopausal osteoporosis, a global public health problem, has for decades been attributed and function. We suggest that high circulating FSH causes hypogonadal bone loss. INTRODUCTION Osteoporosis., 1993; Manolagas and Jilka, 1995). After menopause, resorption significantly exceeds formation

  9. Invest in Your Bones Osteoporosis--The Silent Disease

    E-Print Network [OSTI]

    Invest in Your Bones Osteoporosis--The Silent Disease Leaflet 2 Osteoporosis, a painful of State Health Services, 2008). Osteoporosis is preventable and/or treatable. Accordingly, osteoporosis of height, and chronic back pain. Hip fracture, the most serious consequence of osteoporosis, threatens one

  10. The effects of eccentric training on muscle-bone function 

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    , mechanical testing at this site showed greater tibiae stiffness in the exercised bone than that of the OVX group (+28.5%). No significant differences were found in tibial ultimate load to fracture, ultimate strength or modulus of elasticity. In summary...

  11. Spectral Analysis and Connectivity of Porous Microstructures in Bone

    E-Print Network [OSTI]

    Golden, Kenneth M.

    that quantifies brine connectivity and its thermal evolution can also help assess the impact of osteoporosis on trabecular structure. Central to our approach is the spectral measure of a composite material, which contains, in dense cortical bone the pores can be sparse and disconnected, yet exhibit increasing volume fraction

  12. Random lasing in bone tissue Qinghai Song,1

    E-Print Network [OSTI]

    Kim, Young L.

    of Biomedical Engineering, Purdue University, West Lafayette, Indiana 47907, USA 2 School of Electrical, 2010; posted March 26, 2010 (Doc. ID 122271); published April 28, 2010 Owing to the low-loss and high and deformation mecha- nisms in bone still remain relatively unexplored, in part, due to current technical

  13. Methods for testing the strength of cancellous bone and tested method effects on cortical bone in the ovariectomized rat 

    E-Print Network [OSTI]

    Ruhmann, Sean Phillip

    1998-01-01T23:59:59.000Z

    In this study, two mechanical testing procedures were developed to test the strength of cancellous bone from the proximal tibia of the rat, the "punch method" and the "whole slice method". These were used to quantify the effect of ovariectomy on rat...

  14. Methods for testing the strength of cancellous bone and tested method effects on cortical bone in the ovariectomized rat

    E-Print Network [OSTI]

    Ruhmann, Sean Phillip

    1998-01-01T23:59:59.000Z

    of the effect of two testing methods, torsion and three-point bending, on the mechanical strength of the rat femur and the changes in strength due to ovariectomy. From these tests, little change in cortical bone properties for the OVX rats compared to the Sham...

  15. Mechanical loading attenuates loss of bone mass and bone strength induced by immobilization and calcium-deficiency 

    E-Print Network [OSTI]

    Inman, Cynthia Lynn

    1996-01-01T23:59:59.000Z

    mechanically loaded by a unique four-point loading machine three times per week. After six weeks of treatment, all animals were sacrificed, both tibia removed and tested for bone mineral density (BMD) by dual energy X-ray absorptiometry, stiffness and ultimate...

  16. Nukbone® promotes proliferation and osteoblastic differentiation of mesenchymal stem cells from human amniotic membrane

    SciTech Connect (OSTI)

    Rodríguez-Fuentes, Nayeli; Rodríguez-Hernández, Ana G. [Depto. Microbiología y Parasitología, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Mexico City 04510 (Mexico)] [Depto. Microbiología y Parasitología, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Mexico City 04510 (Mexico); Enríquez-Jiménez, Juana [Depto. Biología de la Reproducción, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (INCMNSZ), México City 14000 (Mexico)] [Depto. Biología de la Reproducción, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (INCMNSZ), México City 14000 (Mexico); Alcántara-Quintana, Luz E. [Subd. de Investigación, Centro Nacional de la Transfusión Sanguínea, Secretaria de Salud, Mexico City 07370 (Mexico)] [Subd. de Investigación, Centro Nacional de la Transfusión Sanguínea, Secretaria de Salud, Mexico City 07370 (Mexico); Fuentes-Mera, Lizeth [Depto. Biología Molecular e Histocompatibilidad, Hospital General “Dr. Manuel Gea González”, México City 4800 (Mexico)] [Depto. Biología Molecular e Histocompatibilidad, Hospital General “Dr. Manuel Gea González”, México City 4800 (Mexico); Piña-Barba, María C. [Depto. Materiales Metálicos y Cerámicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autónoma de México (UNAM), México City 04510 (Mexico)] [Depto. Materiales Metálicos y Cerámicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autónoma de México (UNAM), México City 04510 (Mexico); Zepeda-Rodríguez, Armando [Depto. Biología Celular y Tisular, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), México City 04510 (Mexico)] [Depto. Biología Celular y Tisular, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), México City 04510 (Mexico); and others

    2013-05-10T23:59:59.000Z

    Highlights: •Nukbone showed to be a good scaffold for adhesion, proliferation and differentiation of stem cells. •Nukbone induced osteoblastic differentiation of human mesenchymal stem cells. •Results showed that Nukbone offer an excellent option for bone tissue regeneration due to properties. -- Abstract: Bovine bone matrix Nukbone® (NKB) is an osseous tissue-engineering biomaterial that retains its mineral and organic phases and its natural bone topography and has been used as a xenoimplant for bone regeneration in clinics. There are not studies regarding its influence of the NKB in the behavior of cells during the repairing processes. The aim of this research is to demonstrate that NKB has an osteoinductive effect in human mesenchymal stem cells from amniotic membrane (AM-hMSCs). Results indicated that NKB favors the AM-hMSCs adhesion and proliferation up to 7 days in culture as shown by the scanning electron microscopy and proliferation measures using an alamarBlue assay. Furthermore, as demonstrated by reverse transcriptase polymerase chain reaction, it was detected that two gene expression markers of osteoblastic differentiation: the core binding factor and osteocalcin were higher for AM-hMSCs co-cultured with NKB in comparison with cultivated cells in absence of the biomaterial. As the results indicate, NKB possess the capability for inducing successfully the osteoblastic differentiation of AM-hMSC, so that, NKB is an excellent xenoimplant option for repairing bone tissue defects.

  17. Exposure to cadmium and persistent organochlorine pollutants and its association with bone mineral density and markers of bone metabolism on postmenopausal women

    SciTech Connect (OSTI)

    Rignell-Hydbom, A., E-mail: anna.rignell-hydbom@med.lu.se [Department of Occupational and Environmental Medicine, Lund University (Sweden); Skerfving, S.; Lundh, T.; Lindh, C.H. [Department of Occupational and Environmental Medicine, Lund University (Sweden)] [Department of Occupational and Environmental Medicine, Lund University (Sweden); Elmstahl, S. [Division of Geriatric Medicine, Department of Health Sciences, Lund University, Malmue University Hospital (Sweden)] [Division of Geriatric Medicine, Department of Health Sciences, Lund University, Malmue University Hospital (Sweden); Bjellerup, P. [Center for Clinical Research, Uppsala University, Department of Clinical Chemistry, Vaesteras (Sweden)] [Center for Clinical Research, Uppsala University, Department of Clinical Chemistry, Vaesteras (Sweden); Juensson, B.A.G.; Struemberg, U. [Department of Occupational and Environmental Medicine, Lund University (Sweden)] [Department of Occupational and Environmental Medicine, Lund University (Sweden); Akesson, A. [Institute of Environmental Medicine, Karolinska Institutet, Stockholm (Sweden)] [Institute of Environmental Medicine, Karolinska Institutet, Stockholm (Sweden)

    2009-11-15T23:59:59.000Z

    Environmental contaminants such as cadmium and persistent organochlorine pollutants have been proposed as risk factors of osteoporosis, and women may be at an increased risk. To assess associations between exposure to cadmium and two different POPs (2,2',4,4',5,5'-hexachlorobiphenyl CB-153, 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene p,p'-DDE), on one hand, and bone effects, on the other, in a population-based study among postmenopausal (60-70 years) Swedish women with biobanked blood samples. The study included 908 women and was designed to have a large contrast of bone mineral densities, measured with a single photon absorptiometry technique in the non-dominant forearm. Biochemical markers related to bone metabolism were analyzed in serum. Exposure assessment was based on cadmium concentrations in erythrocytes and serum concentrations of CB-153 and p,p'-DDE. Cadmium was negatively associated with bone mineral density and parathyroid hormone, positively with the marker of bone resorption. However, this association disappeared after adjustment for smoking. The major DDT metabolite (p,p'-DDE) was positively associated with bone mineral density, an association which remained after adjustment for confounders, but the effect was weak. There was no evidence that the estrogenic congener (CB-153) was associated with any of the bone markers. In conclusion, no convincing associations were observed between cadmium and POPs, on one hand, and bone metabolism markers and BMD, on the other.

  18. Primary cutaneous follicle-center lymphoma

    E-Print Network [OSTI]

    Ahearn, Ian M; Hu, Stephanie W; Meehan, Shane A; Latkowski, Jo-Ann

    2015-01-01T23:59:59.000Z

    has a poor prognosis, PET/CT and bone marrow biopsy,only in cases where PET/CT is positive, is indicated tosystemic evaluation with PET/CT and a bone marrow biopsy

  19. A comparative histological study of fossil and recent bone tissues

    E-Print Network [OSTI]

    Enlow, Donald H.

    1955-01-01T23:59:59.000Z

    ? scopic inspection. A wet section, as viewed during trial grinding examinations, will appear more transparent than the dried, finished mount. Any of the standard laboratory abrasives, such as finely powdered carborundum, polishing alumina, or powdered... by hand with the bone section in direct contact with the revolving surface of a power-driven lap wheel. Finely powdered abrasive, such as carborundum or cleansing pov/der, is applied in the form of water paste to the wheel. Periodic inspection under a...

  20. Effects of hyperparathyroidism and calcium on bone healing

    E-Print Network [OSTI]

    Hubbard, Gene Borden

    1975-01-01T23:59:59.000Z

    lesions, blood chemistry data and microscopic examination of bone, The citations on the following pages follow the style of the Sutrnaf. 0$ She. Amuck'. can Vetenanacq Medx. caf. Ass acL aX&0n. CHAPTER II LITERATURE REVIEW Trauma has traditionally...- parathyroidism; however, lameness disappeared in horses fed a standard ration containing 0. 52; calcium and 0. 45+ phosphorus. The case history of a man with hyperparathyroidism in which the main clinical feature was multiple nonuniting 7 fractures has been...

  1. Porous coatings from wire mesh for bone implants

    DOE Patents [OSTI]

    Sump, Kenneth R. (Richland, WA)

    1986-01-01T23:59:59.000Z

    A method of coating areas of bone implant elements and the resulting implant having a porous coating are described. Preselected surface areas are covered by a preform made from continuous woven lengths of wire. The preform is compressed and heated to assure that diffusion bonding occurs between the wire surfaces and between the surface boundaries of the implant element and the wire surfaces in contact with it. Porosity is achieved by control of the resulting voids between the bonded wire portions.

  2. Aging and Fracture of Human Cortical Bone and Tooth Dentin

    SciTech Connect (OSTI)

    Ager, Joel; Koester, Kurt J.; Ager III, Joel W.; Ritchie, Robert O.

    2008-05-07T23:59:59.000Z

    Mineralized tissues, such as bone and tooth dentin, serve as structural materials in the human body and, as such, have evolved to resist fracture. In assessing their quantitative fracture resistance or toughness, it is important to distinguish between intrinsic toughening mechanisms which function ahead of the crack tip, such as plasticity in metals, and extrinsic mechanisms which function primarily behind the tip, such as crack bridging in ceramics. Bone and dentin derive their resistance to fracture principally from extrinsic toughening mechanisms which have their origins in the hierarchical microstructure of these mineralized tissues. Experimentally, quantification of these toughening mechanisms requires a crack-growth resistance approach, which can be achieved by measuring the crack-driving force, e.g., the stress intensity, as a function of crack extension ("R-curve approach"). Here this methodology is used to study of the effect of aging on the fracture properties of human cortical bone and human dentin in order to discern the microstructural origins of toughness in these materials.

  3. We would like to thank all those listed below for taking the time to review for Bone Marrow Transplantation in 2012 -your generosity is much appreciated and we hope your association with the journal continues in

    E-Print Network [OSTI]

    Cai, Long

    , Hideki Al-Ali, Haifa-Kathrin Albert, Michael Alegre, Adrian Alexanian, Raymond Aljurf, Mahmoud D Allan, Francis Bacigalupo, Andrea Bader, Peter Bain, Barbara Bajwa, Rajinder Ballen, Karen Barba, Pere Barker

  4. We would like to thank all those listed below for taking the time to review for Bone Marrow Transplantation in 2013 -your generosity is much appreciated and we hope your association with the journal continues in

    E-Print Network [OSTI]

    Cai, Long

    , Karen Barba, Pere Barber, Linda D Barfield, Raymond Barker, Juliet Barkholt, Lisbeth Baron, Frederic Battiwalla, Minoo Baxter-Lowe, Lee-Ann Bazarbachi, Ali Bearman, Scott I Bekassy, Albert Benedetti, Edoardo

  5. arthrospira platensistumor necrosis: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    identified in Drosophila. DTRAF1 contains 7 zinc finger 17 Drilling and Microfracture Lead to Different Bone Structure and Necrosis during Bone-Marrow Stimulation for Cartilage...

  6. Patients with Patellofemoral Pain Exhibit Elevated Bone Metabolic Activity at the Patellofemoral Joint

    E-Print Network [OSTI]

    Delp, Scott

    NaF PET/CT, which may be related to bone stress. Our goals were to use 18 F NaF PET/CT to evaluate: patellofemoral pain; 18 F NaF PET/CT; bone metabolic activity Patellofemoral pain syndrome is often characterized the specific regions of tracer uptake. 18 F NaF PET/CT is an alter- native to Tc-99m MDP bone scintigraphy

  7. Mitigating Disuse Bone Loss: Role of Resistance Exercise and Beta-Adrenergic Signaling

    E-Print Network [OSTI]

    Swift, Joshua Michael

    2011-08-08T23:59:59.000Z

    on Bone During Extended Bed Rest (Human) Only a few long-term bed rest investigations have successfully mitigated bone loss with exercise paradigms. Combined supine flywheel resistive and treadmill exercise during 90-day bed rest in young men... novel rodent resistance exercise device using flywheel technology was used by Fluckey et al (57) to demonstrate the effects of maximal voluntary squats, performed during suspension, on changes in metaphyseal bone mass. The flywheel exercise protocol...

  8. Journal of Biomechanics 41 (2008) 10621068 Nonlinear ultrasound can detect accumulated damage in human bone

    E-Print Network [OSTI]

    2008-01-01T23:59:59.000Z

    due to the fact that osteoporosis and bone fragility are increasingly widespread diseases. Fracture increases exponentially with age, with a significant increase corresponding to the beginning of menopause

  9. Preparation and characterization of calcium phosphate ceramics and Composites as bone substitutes

    E-Print Network [OSTI]

    Zhang, Xing

    2007-01-01T23:59:59.000Z

    bone. Natural porous calcium carbonate skeletons, coral andconversion of calcium carbonate marine skeletons in (NH 4 )conversions of calcium carbonate skeletons (e.g. coral,

  10. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    risk of vertebral osteoporosis compared to men with noto identify patients with osteoporosis. Keywords Bone loss .associated with COPD, osteoporosis is believed to affect 36%

  11. Bone mineral density and blood metals in premenopausal women

    SciTech Connect (OSTI)

    Pollack, A.Z., E-mail: pollacka@mail.nih.gov [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States); Mumford, S.L. [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)] [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States); Wactawski-Wende, J. [Department of Social and Preventive Medicine, University at Buffalo, State University of New York, Buffalo, NY (United States)] [Department of Social and Preventive Medicine, University at Buffalo, State University of New York, Buffalo, NY (United States); Yeung, E.; Mendola, P.; Mattison, D.R.; Schisterman, E.F. [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)] [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)

    2013-01-15T23:59:59.000Z

    Exposure to metals, specifically cadmium, lead, and mercury, is widespread and is associated with reduced bone mineral density (BMD) in older populations, but the associations among premenopausal women are unclear. Therefore, we evaluated the relationship between these metals in blood and BMD (whole body, total hip, lumbar spine, and non-dominant wrist) quantified by dual energy X-ray absorptiometry in 248 premenopausal women, aged 18-44. Participants were of normal body mass index (mean BMI 24.1), young (mean age 27.4), 60% were white, 20% non-Hispanic black, 15% Asian, and 6% other race group, and were from the Buffalo, New York region. The median (interquartile range) level of cadmium was 0.30 {mu}g/l (0.19-0.43), of lead was 0.86 {mu}g/dl (0.68-1.20), and of mercury was 1.10 {mu}g/l (0.58-2.00). BMD was treated both as a continuous variable in linear regression and dichotomized at the 10th percentile for logistic regression analyses. Mercury was associated with reduced odds of decreased lumbar spine BMD (0.66, 95% confidence interval: 0.44, 0.99), but overall, metals at environmentally relevant levels of exposure were not associated with reduced BMD in this population of healthy, reproductive-aged women. Further research is needed to determine if the blood levels of cadmium, lead, and mercury in this population are sufficiently low that there is no substantive impact on bone, or if effects on bone can be expected only at older ages.

  12. Hydroxyapatite-binding peptides for bone growth and inhibition

    DOE Patents [OSTI]

    Bertozzi, Carolyn R. (Berkeley, CA); Song, Jie (Shrewsbury, MA); Lee, Seung-Wuk (Walnut Creek, CA)

    2011-09-20T23:59:59.000Z

    Hydroxyapatite (HA)-binding peptides are selected using combinatorial phage library display. Pseudo-repetitive consensus amino acid sequences possessing periodic hydroxyl side chains in every two or three amino acid sequences are obtained. These sequences resemble the (Gly-Pro-Hyp).sub.x repeat of human type I collagen, a major component of extracellular matrices of natural bone. A consistent presence of basic amino acid residues is also observed. The peptides are synthesized by the solid-phase synthetic method and then used for template-driven HA-mineralization. Microscopy reveal that the peptides template the growth of polycrystalline HA crystals .about.40 nm in size.

  13. Zhejiang Bone New Material Technology Co Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty Edit withTianlinPapers HomeXuanenYongzhouYunnanZhangye LonghuiZhejiang Bone New

  14. Bone status in high levels cyclists J Clin Densitom. 2012 Jan-Mar;15(1):103-7. Evaluation of the Bone Status in High-Level Cyclists

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    health Organization has defined osteoporosis in post-menopausal women as a T-score value less than -2) defines a "low bone density". In post-menopausal women as well as in elderly in general, results are more

  15. Analyzing the effects of alcohol on IGF-I in bone and plasma and on IGF-I mRNA in the liver and bone

    E-Print Network [OSTI]

    Stine, Christina Nicole

    2001-01-01T23:59:59.000Z

    Alcohol consumption is occurring in the younger generation. It has been found that the sooner people started drinking the shorter they are. Alcohol has also been shown to reduce peak bone mass. Alcohol inhibits osteoblastic proliferation which...

  16. The bending and dynamic mechanical properties of cortical bone: the effects of sodium fluoride and the relationship to physical properties 

    E-Print Network [OSTI]

    McCurdy-Rahn, Megan Calista

    1998-01-01T23:59:59.000Z

    Bone is a complex organic composite material. The graphics. interface between the mineral and organic phases of bone is significant both to medicine and to the biokinetics, a field which seeks to create advanced synthetic materials by copying...

  17. The effect of alcohol on the bone growth spurt of rats at a time equivalent to adolescent females

    E-Print Network [OSTI]

    Chaffin, Catherine Lee

    1997-01-01T23:59:59.000Z

    . The trabecular bone that remained was widely separated and reduced in thickness. These changes are similar to those observed in osteoporosis. The cause and mechanism of the reduced bone volume after alcohol abuse remains unclear. Alcohol consumption at an early...

  18. High-speed photography of compressed human trabecular bone correlates whitening to microscopic damage

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    of trabecular bone is mainly motivated by the huge impact of osteoporosis in post-menopausal women and the aged is mainly motivated by the reduction of bone strength due to osteoporosis, a systemic skeletal disease [10.elsevier.com/locate/engfracmech #12;comes with a concomitant increase of fracture risk. Post-menopausal women and the elderly

  19. High-Speed Photography of Human Trabecular Bone during Compression Philipp J. Thurner1

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    of this research is motivated by the immense costs of health care and social impacts due to osteoporosis in post-menopausal women and the aged. Osteoporosis results in bone loss and change of trabecular architecture, causing of osteoporosis, a systemic, skeletal disease2 , which comes with a reduction of bone strength and a concomitant

  20. Estrogen protects bone by inducing Fas ligand in osteoblasts to regulate osteoclast survival

    E-Print Network [OSTI]

    Brown, Myles

    for post-menopausal osteoporosis (Sambrook and Cooper, 2006). Estrogen and ERs are important for bone and Musculoskeletal Biology, Wyeth Research, Collegeville, PA, USA Estrogen deficiency in menopause is a major cause of osteoporosis in women. Estrogen acts to maintain the appropriate ratio between bone-forming osteoblasts

  1. Correlating mechanical properties of cancellous bone in the rat with various density measures 

    E-Print Network [OSTI]

    Ramaswamy, Ramya

    2004-09-30T23:59:59.000Z

    , and to correlate the mechanical properties of the rodent cancellous bone with the various density measures. Analytical studies were made to assess the effect of the size and shape of the platen based on the values from mechanical testing of the cancellous bone...

  2. Calcium balance and bone density in immature horses fed a high protein diet

    E-Print Network [OSTI]

    Spooner, Holly Sue

    2006-10-30T23:59:59.000Z

    . Blood samples, feces, and urine were collected during the 116-day study to determine any diet effect on pH and mineral balance. Radiographs were made of the left third metacarpal (MCIII) to determine bone density via radiographic bone aluminum...

  3. Bone Motion Analysis From Dynamic MRI: Ac-quisition and Tracking

    E-Print Network [OSTI]

    Gilles, Benjamin

    of mechanical overload, impingement or femoral head instability. For both diagnosis and surgical planning, an acBone Motion Analysis From Dynamic MRI: Ac- quisition and Tracking INTRODUCTION Periacetabular- curate estimate of hip joint bone motion is required. Orthopedists can use animated 3D models, prior

  4. Bone Surface Reconstruction From CT/MR Images Using Fast Marching and Level Set Methods1)

    E-Print Network [OSTI]

    Chetverikov, Dmitry

    Bone Surface Reconstruction From CT/MR Images Using Fast Marching and Level Set Methods1) Istv surfaces reconstructed from MR volumes are shown. 1 Outline of the project One of our current projects steps of bone surface reconstruction from CT/MR slice images. 2 Main steps of reconstruction 2.1

  5. Research Paper A method for calibration of bone driver transducers to measure the mastoid

    E-Print Network [OSTI]

    Allen, Jont

    vibrator transducers for clinical measurements, the transfer of energy from the bone driver depends. This absolute calibration is based upon a circuit model of the driver, describing it with three frequency in the clinic, and a refined bone driver circuit model is proposed to better capture the observed behaviors. Ã?

  6. Development/Plasticity/Repair The Bone Morphogenetic Protein Roof Plate Chemorepellent

    E-Print Network [OSTI]

    Butler, Samantha

    Development/Plasticity/Repair The Bone Morphogenetic Protein Roof Plate Chemorepellent Regulates, Toronto, Ontario, Canada M5G 1X8 Commissural spinal axons extend away from the roof plate (RP) in response to the dorsal midline and are generated by the bone morphogenetic proteins (BMPs) in the roof plate (RP) (Liem

  7. Bone Loss in Diabetes: Use of Antidiabetic Thiazolidinediones and Secondary Osteoporosis

    E-Print Network [OSTI]

    Toledo, University of

    Bone Loss in Diabetes: Use of Antidiabetic Thiazolidinediones and Secondary Osteoporosis Beata secondary osteoporosis. Risk factors for development of TZD-induced secondary osteoporosis are gender (women healing in T2DM patients on TZD therapy. Keywords Diabetes . Thiazolidinediones . Bone . Osteoporosis

  8. A multi-scale bone study to estimate the risk of fracture related to osteoporosis

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    A multi-scale bone study to estimate the risk of fracture related to osteoporosis Abdelwahed' Orléans, 8, Rue Léonard de Vinci 45072 Orléans, France Objective: Osteoporosis is a disease marked. Bone fractures caused by the osteoporosis become increasingly important goal for both clinicians

  9. Classification and volumetric analysis of temporal bone pneumatization using cone beam computed tomography

    E-Print Network [OSTI]

    Terasaki, Mark

    bone pneumatization in adults using cone beam computed tomography (CBCT) scans. Study Design. A total Oral Pathol Oral Radiol 2014;117:376-384) The advances in cone beam computed tomography (CBCT) overClassification and volumetric analysis of temporal bone pneumatization using cone beam computed

  10. Finite-Element Analysis of Biting Behavior and Bone Stress in the

    E-Print Network [OSTI]

    Dumont, Elizabeth R.

    Finite-Element Analysis of Biting Behavior and Bone Stress in the Facial Skeletons of Bats biting behavior and bite force data gathered in the field with finite-element (FE) analysis. Our FE words: biting behavior; bone stress; adaptation; finite-ele- ment analysis; Chiroptera Mammal evolution

  11. Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a

    E-Print Network [OSTI]

    Ariza Moreno, Pilar

    Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a , H descubrimientos s/n 41092 Seville (Spain) a jsanz@us.es, b helgaem@gmail.com, c mpariza@us.es Keywords: Bone-cement of the last XX century. Normally, implant is fixed to bone by means of a polymer material known as bone cement

  12. Estimation of the 3D self-similarity parameter of trabecular bone from its 2D projection

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    of osteoporosis is mainly based on dual energy X-ray absorptiometry which amounts to measuring bone mass

  13. Fuel Cells

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Fuel Cells Converting chemical energy of hydrogenated fuels into electricity Project Description Invented in 1839, fuels cells powered the Gemini and Apollo space missions, as well...

  14. EARLY PREVENTIVE EFFECTS OF RISEDRONATE IN A RAT MODEL WITH MASSIVE BONE LOSS DUE TO ORCHIDECTOMY AND

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    and disuse induced osteoporosis. ORX and BTX models were combined to see if their effects were cumulative on trabecular bone mass and bone architecture. KEY WORDS: Osteoporosis Orchidectomy Disuse Risedronate Bone-remodeling rate is observed in women after menopause or surgica

  15. Cell Stem Cell Clinical Progress

    E-Print Network [OSTI]

    Zandstra, Peter W.

    Cell Stem Cell Clinical Progress Rapid Expansion of Human Hematopoietic Stem Cells by Automated of Toronto, Toronto, ON M5G 1L7, Canada 6McEwen Centre for Regenerative Medicine, University Health Network

  16. Splenic uptake of both technetium-99m diphosphonate and technetium-99m sulfur colloid in sickle cell beta degrees thalassemia

    SciTech Connect (OSTI)

    Heck, L.L.; Brittin, G.M. (Methodist Hospital of Indiana, IN (USA))

    1989-08-01T23:59:59.000Z

    A 19-year-old black woman with sickle cell beta degrees thalassemia had experienced more than 100 hospital admissions for sickle cell crisis and aseptic necrosis of both femoral heads. Her spleen was enlarged threefold and accumulated both radiocolloid and bone-seeking agent on two occasions, demonstrating an exception to the rule in sickle cell anemia that spleens that take up bone-seeking agents demonstrate functional asplenia. In the context of fever, left upper quadrant pain, and splenomegaly, the pattern of calcification in the patient's spleen as revealed in ultrasound and CT studies suggested possible abscess and led to unnecessary splenectomy. The nuclear medicine studies did not support this diagnosis. Nuclear medicine physicians should not be misled by splenic findings of sickle cell thalassemia (and possibly of other heterozygous sickle cell disorders) that differ from those of the more familiar homozygous sickle cell anemia.

  17. The role of E2f4 in cell cycle exit and bone development

    E-Print Network [OSTI]

    Miller, Emily S. (Emily Sun Young)

    2009-01-01T23:59:59.000Z

    Members of the E2F family of transcription factors are critical downstream effectors of the pocket protein family and mediate the regulation of genes required for cellular proliferation. The repressive E2Fs act in association ...

  18. Cell-Sheet Technology: A Novel Method To Enhance Bone-Implant Integration

    E-Print Network [OSTI]

    Kanuru, Rajita Kodali

    2012-01-01T23:59:59.000Z

    the titanium surfaces was examined by an energy dispersivethe titanium surfaces was examined by an energy dispersivethe titanium surfaces was examined by an energy dispersive

  19. The role of cGMP-dependent protein kinases in bone cell growth and survival

    E-Print Network [OSTI]

    Marathe, Nisha Madhav

    2011-01-01T23:59:59.000Z

    ablation of osteocytes induces osteoporosis with defectiveand the risk of osteoporosis. Expert Opin Drug Saf 2009, 8:formation in check. Osteoporosis: an overview Osteoporosis

  20. Effect of cryo-induced microcracks on microindentation of hydrated cortical bone tissue

    SciTech Connect (OSTI)

    Yin Ling, E-mail: ling.yin@jcu.edu.au [School of Engineering, James Cook University, Townsville, QLD 4811 (Australia); Venkatesan, Sudharshan [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia); Webb, Daryl [Electron Microscopy Unit, Australian National University, Canberra, ACT 0200 (Australia); Kalyanasundaram, Shankar; Qin Qinghua [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia)

    2009-08-15T23:59:59.000Z

    Microcracks accumulate in cortical bone tissue as a consequence of everyday cyclic loading. However, it remains unclear to what extent microdamage accumulation contributes to an increase in fracture risk. A cryo-preparation technique was applied to induce microcracks in cortical bone tissue. Microcracks with lengths up to approximately 20 {mu}m, which were initiated mainly on the boundaries of haversian canals, were observed with cryo-scanning electron microscopy. A microindentation technique was applied to study the mechanical loading effect on the microcracked hydrated bone tissue. The microindentation patterns were section-scanned using confocal laser scanning microscopy to understand the deformation and bone damage mechanisms made by mechanical loading. The results show that there was no significant difference with respect to microhardness between the original and microcracked hydrated cortical bone tissues (ANOVA, p > 0.05). The cryo-induced microcracks in the bone tissue were not propagated further under the mechanical loads applied. The deformation mechanism of the microcracked cortical bone tissue was plastic deformation, not brittle fracture.

  1. Peripheral blood derived mononuclear cells enhance osteoarthritic human chondrocyte migration

    E-Print Network [OSTI]

    Hopper, Niina; Henson, Frances; Brooks, Roger; Ali, Erden; Rushton, Neil; Wardale, John

    2015-01-01T23:59:59.000Z

    gradients [44, 45]. Experiments in young animals have shown that chondrocyte migration affects tissue-engineered cartilage integration by activating the signal transduction pathways involving Src, PLC?1, and ERK1/2 [46]. In order to begin to investigate... from the National Institute for Health Research. Abbreviations ACTB, actin beta; B2M, beta-2 microglobulin; BMP, bone morphogenic protein; CAPN, calpain; CI, cell index; ECM, extracellular matrix; ERK, extracellular signal regulated kinases; FBS...

  2. Investigation of bone response to implant materials by electron microscopy and computer simulation

    E-Print Network [OSTI]

    Wang, Hao, 1974-

    2004-01-01T23:59:59.000Z

    (cont.) implementation of this scintigraphic method for quantitative studies of osteoblast-mediated mineralization in vitro. A 2-D truss finite element model is used to study the remodeling of trabecular bone. Using strain ...

  3. Bone Canonical WNT/B-Catenin Signaling in Models of Reduced Microgravity 

    E-Print Network [OSTI]

    Macias, Brandon 1979-

    2012-10-25T23:59:59.000Z

    of the series was conducted at Brookhaven National Laboratory. To quantify the impact of the abovementioned countermeasures and space radiation on bone, mechanical testing, peripheral quantitative computed tomography, micro-computed tomography, histomorphometry...

  4. Longitudinal ultrasound measurement of the equine third metacarpal bone as a predictor of mechanical testing properties 

    E-Print Network [OSTI]

    Dyer, Stephanie Ann

    1999-01-01T23:59:59.000Z

    diagnostic technique to identify the onset of bucked shins. The purpose of this study was to determine if the longitudinal speed of sound as measured by Soundscan 2000[] was an appropriate predictor of bone strength characterized by mechanical testing...

  5. Methods and modeling for the reduced platen compression of cancellous bone in the rodent proximal tibia 

    E-Print Network [OSTI]

    Rogers, William Elliott

    2002-01-01T23:59:59.000Z

    This study focused on the reduced platen compression (RPC) test of cancellous bone in the rodent proximal tibia. The objective was to improve methods for this mechanical test, specifically in the areas of specimen location, specimen preparation...

  6. The effects of alcohol consumption after menopause on bone regulating hormones

    E-Print Network [OSTI]

    Blaschke, Dawn Lewis

    1999-01-01T23:59:59.000Z

    The goal of this project was to determine if the alcohol-associated increase in osteopenia as observed in ovariectomized rats, which simulated human females after menopause, was due to the elect of alcohol on hormones that regulate bone metabolism...

  7. Method for palliation of pain in human bone cancer using therapeutic tin-117m compositions

    DOE Patents [OSTI]

    Srivastava, S.C.; Meinken, G.E.; Mausner, L.F.; Atkins, H.L.

    1998-12-29T23:59:59.000Z

    The invention provides a method for the palliation of bone pain due to cancer by the administration of a unique dosage of a tin-117m (Sn-117m) stannic chelate complex in a pharmaceutically acceptable composition. In addition, the invention provides a method for simultaneous palliation of bone pain and radiotherapy in cancer patients using compositions containing Sn-117m chelates. The invention also provides a method for palliating bone pain in cancer patients using Sn-117m-containing compositions and monitoring patient status by imaging the distribution of the Sn-117m in the patients. Also provided are pharmaceutically acceptable compositions containing Sn-117m chelate complexes for the palliation of bone pain in cancer patients. 5 figs.

  8. Method for palliation of pain in human bone cancer using therapeutic tin-117m compositions

    DOE Patents [OSTI]

    Srivastava, Suresh C. (Setauket, NY); Meinken, George E. (Middle Island, NY); Mausner, Leonard F. (Stony Brook, NY); Atkins, Harold L. (Setauket, NY)

    1998-12-29T23:59:59.000Z

    The invention provides a method for the palliation of bone pain due to cancer by the administration of a unique dosage of a tin-117m (Sn-117m) stannic chelate complex in a pharmaceutically acceptable composition. In addition, the invention provides a method for simultaneous palliation of bone pain and radiotherapy in cancer patients using compositions containing Sn-117m chelates. The invention also provides a method for palliating bone pain in cancer patients using Sn-117m-containing compositions and monitoring patient status by imaging the distribution of the Sn-117m in the patients. Also provided are pharmaceutically acceptable compositions containing Sn-117m chelate complexes for the palliation of bone pain in cancer patients.

  9. Effects of High Dietary Iron and Gamma Radiation on Oxidative Stress and Bone

    E-Print Network [OSTI]

    Yuen, Evelyn P

    2013-04-19T23:59:59.000Z

    (induced by feeding a high iron diet) and gamma radiation exposure would independently increase markers of oxidative stress and markers of oxidative damage and result in loss of bone mass, with the combined treatment having additive or synergistic effects...

  10. Pretreatment levels of bone turnover and the antifracture efficacy of alendronate: The fracture intervention trial

    E-Print Network [OSTI]

    2006-01-01T23:59:59.000Z

    in postmenopausal osteoporosis. Cal- cif Tissue Int 65:359–in postmeno- pausal osteoporosis. J Bone Miner Res 12:624–among women without osteoporosis at baseline. Although they

  11. Race/ethnic differences in bone mineral densities in older men

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    the Baltimore men’s osteoporosis study. J Bone Miner Res 13.center genetic study of osteoporosis. Osteoporos Int 17:125–Leung Jockey Club Centre for Osteoporosis Care and Control,

  12. The harmful effects of late-onset alcohol consumption on cortical bone in aged rats 

    E-Print Network [OSTI]

    Bowlin, Julie Lee

    2001-01-01T23:59:59.000Z

    to determine bone chemistry and morphological parameters. The effects of alcohol consumption, the aging process and caloric restriction were examined after obtaining results from this experiment. From the results found, it is evident that alcohol does have a...

  13. Factors Affecting the Mechanical Behavior of Bone Subrata Saha, Ph.D.

    E-Print Network [OSTI]

    Gilbert, Robert P.

    Factors Affecting the Mechanical Behavior of Bone by Subrata Saha, Ph.D. Research Professor-mail: subrata.saha@downstate.edu ABSTRACT The load carrying capacity of our skeletal system depends

  14. Analysis of a Fossil Bone from the Archaeological Settlement Malu Rosu, Romania by Accelerator Mass Spectrometry

    E-Print Network [OSTI]

    Agata Olariu; Ion V. Popescu; Ragnar Hellborg; Kristina Stenström; Mikko Faarinen; Per Persson; Bengt Erlandsson; Göran Skog; Emilian Alexandrescu

    2001-03-13T23:59:59.000Z

    A fossil bone from the archaeological site Malu Rosu Giurgiu, in Romania has been analyzed by accelerator mass spectrometry to estimate its age by determining its $^{14}$C content. The radiocarbon age of the bone is in agreement with the date obtained by the method for age determination, based on fluorine content. This is the first radiocarbon dating for the final Neolithic period, for this archaeological settlement in the Romanian region.

  15. Estimating cancellous bone properties of the rat from mechanical testing of the femoral neck 

    E-Print Network [OSTI]

    Groves, Jennifer Ann

    1998-01-01T23:59:59.000Z

    ESTIMATING CANCELLOIJS BONE PROPERTIES OF THE RAT FROM MECHANICAL TESTING OF THE FEMORAL NECK A Thesis by JENNIFER ANN GROVES Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 1998 Major Subject: Mechanical Engineering ESTIMATING CANCELLOUS BONE PROPERTIES OF THE RAT FROM MECHANICAL TESTING OF THE FEMORAL NECK A Thesis by JENNIFER ANN GROVES Submitted to Texas Ai8:M University...

  16. Analyzing the effects of alcohol on IGF-I in bone and plasma and on IGF-I mRNA in the liver and bone 

    E-Print Network [OSTI]

    Stine, Christina Nicole

    2001-01-01T23:59:59.000Z

    (Member) John E. Bauer (Chair of Nutrition) Bryan H. Johnson (Department Head) August 2001 Major: Nutrition ABSTRACT Analyzing the Effects of Alcohol on IGF-I in Bone and Plasma and on IGF-I mRNA in the Liver and Bone. (August 2001) Christina... different effector pathways to increase proliferation at the growth plate (Klaus et al. , 1998). Therefore Vitamin D may not have an effect on IGF-I. Alcoholics have decreased plasma 25-hydroxyvitamin D which is an indicator of Vitamin D status (Peris et...

  17. Generation of insulin-producing cells from gnotobiotic porcine skin-derived stem cells

    SciTech Connect (OSTI)

    Yang, Ji Hoon; Lee, Sung Ho; Heo, Young Tae [Department of Bioscience and Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of)] [Department of Bioscience and Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Uhm, Sang Jun [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of)] [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Lee, Hoon Taek, E-mail: htl3675@konkuk.ac.kr [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of)

    2010-07-09T23:59:59.000Z

    A major problem in the treatment of type 1 diabetes mellitus is the limited availability of alternative sources of insulin-producing cells for islet transplantation. In this study, we investigated the effect of bone morphogenetic protein 4 (BMP-4) treatments of gnotobiotic porcine skin-derived stem cells (gSDSCs) on their reprogramming and subsequent differentiation into insulin-producing cells (IPCs). We isolated SDSCs from the ear skin of a gnotobiotic pig. During the proliferation period, the cells expressed stem-cell markers Oct-4, Sox-2, and CD90; nestin expression also increased significantly. The cells could differentiate into IPCs after treatments with activin-A, glucagon-like peptide-1 (GLP-1), and nicotinamide. After 15 days in the differentiation medium, controlled gSDSCs began expressing endocrine progenitor genes and proteins (Ngn3, Neuro-D, PDX-1, NKX2.2, NKX6.1, and insulin). The IPCs showed increased insulin synthesis after glucose stimulation. The results indicate that stem cells derived from the skin of gnotobiotic pigs can differentiate into IPCs under the appropriate conditions in vitro. Our three-stage induction protocol could be applied without genetic modification to source IPCs from stem cells in the skin of patients with diabetes for autologous transplantation.

  18. 2008LANDESBIOSCIENCE.DONOTDISTRIBUTE. [Cell Cycle 7:10, 1348-1352; 15 May 2008]; 2008 Landes Bioscience

    E-Print Network [OSTI]

    Brown, Myles

    Bioscience 1348 Cell Cycle 2008; Vol. 7 Issue 10 A decrease in estrogen levels at menopause leads to a rapid on these differing models of the mechanism of estrogen-mediated osteoclast apoptosis. Introduction During menopause of full bone maturation with a failure of epiphyseal closure and osteoporosis at age 28.10 Several men

  19. Trichodermin induces cell apoptosis through mitochondrial dysfunction and endoplasmic reticulum stress in human chondrosarcoma cells

    SciTech Connect (OSTI)

    Su, Chen-Ming [Graduate Institute of Basic Medical Science, China Medical University, Taichung, Taiwan (China); Wang, Shih-Wei [Department of Medicine, Mackay Medical College, New Taipei City, Taiwan (China); Lee, Tzong-Huei [Graduate Institute of Pharmacognosy, Taipei Medical University, Taipei, Taiwan (China); Tzeng, Wen-Pei [Graduate Institute of Sports and Health, National Changhua University of Education, Changhua, Taiwan (China); Hsiao, Che-Jen [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Liu, Shih-Chia [Department of Orthopaedics, Mackay Memorial Hospital, Taipei, Taiwan (China); Tang, Chih-Hsin, E-mail: chtang@mail.cmu.edu.tw [Graduate Institute of Basic Medical Science, China Medical University, Taichung, Taiwan (China); Department of Pharmacology, School of Medicine, China Medical University, Taichung, Taiwan (China); Department of Biotechnology, College of Health Science, Asia University, Taichung, Taiwan (China)

    2013-10-15T23:59:59.000Z

    Chondrosarcoma is the second most common primary bone tumor, and it responds poorly to both chemotherapy and radiation treatment. Nalanthamala psidii was described originally as Myxosporium in 1926. This is the first study to investigate the anti-tumor activity of trichodermin (trichothec-9-en-4-ol, 12,13-epoxy-, acetate), an endophytic fungal metabolite from N. psidii against human chondrosarcoma cells. We demonstrated that trichodermin induced cell apoptosis in human chondrosarcoma cell lines (JJ012 and SW1353 cells) instead of primary chondrocytes. In addition, trichodermin triggered endoplasmic reticulum (ER) stress protein levels of IRE1, p-PERK, GRP78, and GRP94, which were characterized by changes in cytosolic calcium levels. Furthermore, trichodermin induced the upregulation of Bax and Bid, the downregulation of Bcl-2, and the dysfunction of mitochondria, which released cytochrome c and activated caspase-3 in human chondrosarcoma. In addition, animal experiments illustrated reduced tumor volume, which led to an increased number of terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells and an increased level of cleaved PARP protein following trichodermin treatment. Together, this study demonstrates that trichodermin is a novel anti-tumor agent against human chondrosarcoma cells both in vitro and in vivo via mitochondrial dysfunction and ER stress. - Highlights: • Trichodermin induces chondrosarcoma apoptosis. • ER stress is involved in trichodermin-induced cell death. • Trichodermin induces chondrosarcoma death in vivo.

  20. Automated simulation of areal bone mineral density assessment in the distal radius from high-resolution peripheral quantitative computed tomography

    E-Print Network [OSTI]

    Burghardt, A. J.; Kazakia, G. J.; Link, T. M.; Majumdar, S.

    2009-01-01T23:59:59.000Z

    Bone mineral density . DXA . HR-pQCT . Osteoporosis .Simulation Introduction Osteoporosis is a conditionclinical assessment of osteoporosis status were identified

  1. Characterization of the effects of x-ray irradiation on the hierarchical structure and mechanical properties of human cortical bone

    E-Print Network [OSTI]

    Barth, Holly

    2012-01-01T23:59:59.000Z

    in   bone   strength.   Osteoporosis  Int    2006;17:319-­??fragility   in   aging,   osteoporosis,   and   diabetes  mellitus.  Osteoporosis  Int    2010;21:195-­??214.  

  2. Electron Microscopy and Analytical X-ray Characterization of Compositional and Nanoscale Structural Changes in Fossil Bone

    E-Print Network [OSTI]

    Boatman, Elizabeth

    2012-01-01T23:59:59.000Z

    of questions surrounding the diagenesis and fossilization ofthe consequences of diagenesis for that particular feature (on the concept of bone diagenesis and how it relates to

  3. Fuel Cells

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the major national security imperatives of this century. Get Expertise Rod Borup MPA-11, Fuel Cell Program Manager Email Andrew Dattelbaum MPA-11 Group Leader Email Melissa Fox...

  4. Synchrotron imaging reveals bone healing and remodelling strategies in extinct and extant vertebrates

    SciTech Connect (OSTI)

    Anne, Jennifer [Univ. of Manchester (United Kingdom); Edwards, Nicholas P. [Univ. of Manchester (United Kingdom); Wogelius, Roy A. [Univ. of Manchester (United Kingdom); Tumarkin-Deratzian, Allison R. [Temple Univ., Philadelphia, PA (United States); Sellers, William I. [Univ. of Manchester (United Kingdom); van Veelen, Arjen [Univ. of Manchester (United Kingdom); Bergmann, Uwe [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Sokaras, Dimosthenis [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Alonso-Mori, Roberto [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Ignatyev, Konstantin [Diamond Light Source (United Kingdom); Egerton, Victoria M. [Univ. of Manchester (United Kingdom); Manning, Phillip L. [Univ. of Manchester (United Kingdom)

    2014-04-23T23:59:59.000Z

    Current understanding of bone healing and remodelling strategies in vertebrates has traditionally relied on morphological observations through the histological analysis of thin sections. However, chemical analysis may also be used in such interpretations, as different elements are known to be absorbed and used by bone for different physiological purposes such as growth and healing. These chemical signatures are beyond the detection limit of most laboratory-based analytical techniques (e.g. scanning electron microscopy). However, synchrotron rapid scanning–X-ray fluorescence (SRS–XRF) is an elemental mapping technique that uniquely combines high sensitivity (ppm), excellent sample resolution (20–100 ?m) and the ability to scan large specimens (decimetre scale) approximately 3000 times faster than other mapping techniques. Here, we use SRS–XRF combined with microfocus elemental mapping (2–20 ?m) to determine the distribution and concentration of trace elements within pathological and normal bone of both extant and extinct archosaurs (Cathartes aura and Allosaurus fragilis). Results reveal discrete chemical inventories within different bone tissue types and preservation modes. Chemical inventories also revealed detail of histological features not observable in thin section, including fine structures within the interface between pathological and normal bone as well as woven texture within pathological tissue.

  5. Synchrotron imaging reveals bone healing and remodelling strategies in extinct and extant vertebrates

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Anne, Jennifer; Edwards, Nicholas P.; Wogelius, Roy A.; Tumarkin-Deratzian, Allison R.; Sellers, William I.; van Veelen, Arjen; Bergmann, Uwe; Sokaras, Dimosthenis; Alonso-Mori, Roberto; Ignatyev, Konstantin; et al

    2014-04-23T23:59:59.000Z

    Current understanding of bone healing and remodelling strategies in vertebrates has traditionally relied on morphological observations through the histological analysis of thin sections. However, chemical analysis may also be used in such interpretations, as different elements are known to be absorbed and used by bone for different physiological purposes such as growth and healing. These chemical signatures are beyond the detection limit of most laboratory-based analytical techniques (e.g. scanning electron microscopy). However, synchrotron rapid scanning–X-ray fluorescence (SRS–XRF) is an elemental mapping technique that uniquely combines high sensitivity (ppm), excellent sample resolution (20–100 ?m) and the ability to scan large specimensmore »(decimetre scale) approximately 3000 times faster than other mapping techniques. Here, we use SRS–XRF combined with microfocus elemental mapping (2–20 ?m) to determine the distribution and concentration of trace elements within pathological and normal bone of both extant and extinct archosaurs (Cathartes aura and Allosaurus fragilis). Results reveal discrete chemical inventories within different bone tissue types and preservation modes. Chemical inventories also revealed detail of histological features not observable in thin section, including fine structures within the interface between pathological and normal bone as well as woven texture within pathological tissue.« less

  6. Dickkopf-1 in Craniofacial Bone and Tooth Development

    E-Print Network [OSTI]

    Rodgers, Anika Sarah

    2014-08-20T23:59:59.000Z

    receptor-related protein MM Multiple Myeloma MMP Matrix metalloproteinase OB Osteoblast OC Osteoclast vii OCN Osteocalcin OPG Osteoprotegerin OSX Osterix PDL Periodontal Ligament RANK Receptor activator of nuclear factor kappa RANKL Receptor activator... ................................................................................................. 71 x LIST OF FIGURES Page Figure 1-1 Generation of a transgenic mouse .................................................................. 71 Figure 1-2 Generation of gene targeted mice using embryonic stem (ES) cells...

  7. Clinical Assessment of Percutaneous Radiofrequency Ablation for Painful Metastatic Bone Tumors

    SciTech Connect (OSTI)

    Kojima, Hiroyuki, E-mail: kojimah@takii.kmu.ac.jp; Tanigawa, Noboru; Kariya, Shuji; Komemushi, Atsushi; Shomura, Yuzo; Sawada, Satoshi [Kansai Medical University Takii Hospital, Department of Radiology (Japan)

    2006-12-15T23:59:59.000Z

    Purpose. To investigate the pain-alleviating effects of radiofrequency ablation (RFA) on metastatic bone tumors in relation to tumor size, combined therapy, and percent tumor necrosis rate following RFA. Methods. Subjects comprised 24 patients with 28 painful metastatic bone tumors. A 17G internally cooled electrode was inserted into the tumor for CT guidance and ablation was performed. Bone cement was injected following RFA for 4 tumors involving a weight-bearing bone, while 5 tumors were treated using combined RFA and external irradiation. Percent necrosis rate of the tumor was measured using contrast-enhanced computed tomography 1 week after RFA. Results. Improvement in the visual analog scale (VAS) score was 4.6 {+-} 2.2 for large tumors (>5 cm, n = 12), 3.7 {+-} 1.8 for medium-sized tumors (3.1-5.0 cm, n = 11), and 3.5 {+-} 1.7 for small tumors ({<=}3 cm, n = 4), with no significant differences noted among tumor sizes. Improvement in the VAS score was 3.5 {+-} 1.3 for the 4 tumors in the RFA + bone cement group, 3.2 {+-} 1.9 for the 5 tumors in the RFA + radiation therapy group, and 4.8 {+-} 2.2 for the 18 tumors in the RFA group. No significant differences were identified between groups. The improvement in the VAS score was 3.8 {+-} 2.3, 4.0 {+-} 1.9, and 4.7 {+-} 2.6 in patients with tumor necrosis rates of 0-49%, 50-74%, and 75-100%, respectively. No significant association was observed among these three groups. Conclusion. Percutaneous RFA therapy was effective in relieving pain due to metastatic bone tumors. No relationships appear to exist between initial response and tumor size, combined therapy, and percent tumor necrosis.

  8. Development of a three-dimensional in vitro model to study the effect of vitamin D on bone metastatic breast cancer

    E-Print Network [OSTI]

    Li, Danda

    2011-08-31T23:59:59.000Z

    Breast cancer has a high prevalence among women and most patients suffer from metastasis to bone. The mechanisms involved in breast cancer bone metastasis are poorly understood. Three-dimensional (3D) tissue culture systems are becoming a focus...

  9. J Bone Miner Res . Author manuscript Fracture risk prediction using BMD and clinical risk factors in early

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ,651 peri- and early post-menopausal women (mean age (± SD): 54 4 yr) with a mean follow-up period of 13 Density ; Female ; Fractures, Bone ; etiology ; Humans ; Middle Aged ; Osteoporosis, Postmenopausal definition of osteoporosis ( ), i.e. a bone mineral density (BMD) value less than 2.5 standard deviations

  10. Mineral Maturity and Crystallinity Index Are Distinct Characteristics of Bone D. Farlay, G. Panczer, C. Rey, P. D. Delmas

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Mineral Maturity and Crystallinity Index Are Distinct Characteristics of Bone Mineral D. Farlay, G in "Journal of Bone and Mineral Metabolism 2010;28(4):433-45" DOI : 10.1007/s00774-009-0146-7 #12;Abstract The purpose of this study was to test the hypothesis that mineral maturity and crystallinity index are two

  11. Wavelet based characterization of ex vivo vertebral trabecular bone structure with 3T MRI compared to microCT

    SciTech Connect (OSTI)

    Krug, R; Carballido-Gamio, J; Burghardt, A; Haase, S; Sedat, J W; Moss, W C; Majumdar, S

    2005-04-11T23:59:59.000Z

    Trabecular bone structure and bone density contribute to the strength of bone and are important in the study of osteoporosis. Wavelets are a powerful tool to characterize and quantify texture in an image. In this study the thickness of trabecular bone was analyzed in 8 cylindrical cores of the vertebral spine. Images were obtained from 3 Tesla (T) magnetic resonance imaging (MRI) and micro-computed tomography ({micro}CT). Results from the wavelet based analysis of trabecular bone were compared with standard two-dimensional structural parameters (analogous to bone histomorphometry) obtained using mean intercept length (MR images) and direct 3D distance transformation methods ({micro}CT images). Additionally, the bone volume fraction was determined from MR images. We conclude that the wavelet based analyses delivers comparable results to the established MR histomorphometric measurements. The average deviation in trabecular thickness was less than one pixel size between the wavelet and the standard approach for both MR and {micro}CT analysis. Since the wavelet based method is less sensitive to image noise, we see an advantage of wavelet analysis of trabecular bone for MR imaging when going to higher resolution.

  12. Electrochemical cell

    DOE Patents [OSTI]

    Redey, Laszlo I. (Downers Grove, IL); Vissers, Donald R. (Naperville, IL); Prakash, Jai (Downers Grove, IL)

    1994-01-01T23:59:59.000Z

    An electrochemical cell having a bimodal positive electrode, a negative electrode of an alkali metal, and a compatible electrolyte including an alkali metal salt molten at the cell operating temperature. The positive electrode has an electrochemically active layer of at least one transition metal chloride at least partially present as a charging product, and additives of bromide and/or iodide and sulfur in the positive electrode or the electrolyte. Electrode volumetric capacity is in excess of 400 Ah/cm.sup.3 ; the cell can be 90% recharged in three hours and can operate at temperatures below 160.degree. C. There is also disclosed a method of reducing the operating temperature and improving the overall volumetric capacity of an electrochemical cell and for producing a positive electrode having a BET area greater than 6.times.10.sup.4 cm.sup.2 /g of Ni.

  13. Electrochemical cell

    DOE Patents [OSTI]

    Redey, Laszlo I. (6851 Carpenter St., Downers Grove, IL 60516); Vissers, Donald R. (611 Clover Ct., Naperville, IL 60540); Prakash, Jai (2205 Arbor Cir. 8, Downers Grove, IL 60515)

    1996-01-01T23:59:59.000Z

    An electrochemical cell having a bimodal positive electrode, a negative electrode of an alkali metal, and a compatible electrolyte including an alkali metal salt molten at the cell operating temperature. The positive electrode has an electrochemically active layer of at least one transition metal chloride at least partially present as a charging product, and additives of bromide and/or iodide and sulfur in the positive electrode or the electrolyte. Electrode volumetric capacity is in excess of 400 Ah/cm.sup.3 ; the cell can be 90% recharged in three hours and can operate at temperatures below 160.degree. C. There is also disclosed a method of reducing the operating temperature and improving the overall volumetric capacity of an electrochemical cell and for producing a positive electrode having a BET area greater than 6.times.10.sup.4 cm.sup.2 /g of Ni.

  14. Electrochemical cell

    DOE Patents [OSTI]

    Redey, L.I.; Vissers, D.R.; Prakash, J.

    1996-07-16T23:59:59.000Z

    An electrochemical cell is described having a bimodal positive electrode, a negative electrode of an alkali metal, and a compatible electrolyte including an alkali metal salt molten at the cell operating temperature. The positive electrode has an electrochemically active layer of at least one transition metal chloride at least partially present as a charging product, and additives of bromide and/or iodide and sulfur in the positive electrode or the electrolyte. Electrode volumetric capacity is in excess of 400 Ah/cm{sup 3}; the cell can be 90% recharged in three hours and can operate at temperatures below 160 C. There is also disclosed a method of reducing the operating temperature and improving the overall volumetric capacity of an electrochemical cell and for producing a positive electrode having a BET area greater than 6{times}10{sup 4}cm{sup 2}/g of Ni. 6 figs.

  15. Electrochemical cell

    DOE Patents [OSTI]

    Redey, L.I.; Vissers, D.R.; Prakash, J.

    1994-02-01T23:59:59.000Z

    An electrochemical cell is described having a bimodal positive electrode, a negative electrode of an alkali metal, and a compatible electrolyte including an alkali metal salt molten at the cell operating temperature. The positive electrode has an electrochemically active layer of at least one transition metal chloride at least partially present as a charging product, and additives of bromide and/or iodide and sulfur in the positive electrode or the electrolyte. Electrode volumetric capacity is in excess of 400 Ah/cm[sup 3]; the cell can be 90% recharged in three hours and can operate at temperatures below 160 C. There is also disclosed a method of reducing the operating temperature and improving the overall volumetric capacity of an electrochemical cell and for producing a positive electrode having a BET area greater than 6[times]10[sup 4] cm[sup 2]/g of Ni. 8 figures.

  16. APPLICATIONS OF ALGEBRAIC MULTIGRID TO LARGE-SCALE FINITE ELEMENT ANALYSIS OF WHOLE BONE MICRO-MECHANICS ON THE IBM SP

    E-Print Network [OSTI]

    California at Berkeley, University of

    APPLICATIONS OF ALGEBRAIC MULTIGRID TO LARGE-SCALE FINITE ELEMENT ANALYSIS OF WHOLE BONE MICRO,5 Abstract. Accurate micro-finite element analyses of whole bones require the solution of large sets architectures. Key words. multigrid, trabecular bone, human vertebral body, finite element method, massively

  17. Cell Stem Cell The Systematic Production

    E-Print Network [OSTI]

    Zandstra, Peter W.

    Cell Stem Cell Review The Systematic Production of Cells for Cell Therapies Daniel C. Kirouac1 to guide the development of next-generation technologies capable of producing cell-based products in a safe will enhance cell therapy product quality and safety, expediting clinical development. Breakthroughs

  18. Micro Fuel Cells Direct Methanol Fuel Cells

    E-Print Network [OSTI]

    Micro Fuel Cells TM Direct Methanol Fuel Cells for Portable Power A Fuel Cell System Developer-17, 2002 Phoenix, Arizona #12;Micro Fuel Cells Direct Methanol Fuel Cells for Portable Power Outline (1 Energy Content (Wh) Volume(cm^3) Li-Ion Battery DMFC #12;Direct Methanol Fuel Cell Technology

  19. The Role of Bone Morphogenetic Protein 10 (BMP10) and Crossveinless 2 (CV2) in Cardiomyogenesis

    E-Print Network [OSTI]

    Cubberly, Mark Raymond

    2013-01-01T23:59:59.000Z

    After filtration through a mesh strainer, the cells werewell dishes, 70 µm cell strainers are placed into each well.

  20. School of Architecture, Design and the Built Environment Project Title: Artificial bone for prosthetic hip joints

    E-Print Network [OSTI]

    Evans, Paul

    formation by the Additive Manufacturing (AM) direct printing process. The artificial bone must and the development of new additive manufacturing techniques for medical devices. The group has active links and structural gradients into the prosthesis. It is envisioned this could involve the use of additively

  1. Nonlinear resonant ultrasound spectroscopy (NRUS) applied to damage assessment in bone

    E-Print Network [OSTI]

    Alamos National Laboratory of the University of California, Los Alamos, New Mexico 87545 Received 25 May NRUS is a resonance-based technique exploiting the significant nonlinear behavior of damaged materials obtained through the measurement of bone mineral density BMD obtained from x-ray densitometric techniques.1

  2. In vitro analysis of biodegradable polymer blend/hydroxyapatite composites for bone

    E-Print Network [OSTI]

    Weiss, Lee E.

    In vitro analysis of biodegradable polymer blend/hydroxyapatite composites for bone tissue engineering Kacey G. Marra,1 Jeffrey W. Szem,2 Prashant N. Kumta,3 Paul A. DiMilla,4 Lee E. Weiss5 1 14 April 1999 Abstract: Blends of biodegradable polymers, poly(capro- lactone) and poly

  3. Estimated number of women likely to benefit from bone mineral density measurement in France

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ; Menopause Introduction The prevalence of osteoporosis is rising, most notably in postmenopausal women years of age with risk factors for osteoporosis likely to lead to bone mineral density measurement, an investigation reimbursed by the French national health insurance system in patients at risk for osteoporosis

  4. Differential Maintenance of Cortical and Cancellous Bone Strength Following Discontinuation of

    E-Print Network [OSTI]

    Ritchie, Robert

    and with combination of osteoporosis medications are needed to improve our treatment of osteoporosis. ß 2011 American; RALOXIFENE Introduction A number of drugs offer some protection against post- menopausal bone loss and nonvertebral fractures in postmenopausal osteoporosis.(3) While bisphosphonates such as ALN may accumulate

  5. Feeding Bone Meal to Range Cattle on the Coastal Plains of Texas : Preliminary Report.

    E-Print Network [OSTI]

    Schmidt, H.

    1926-01-01T23:59:59.000Z

    TO RANGE CATTLE 15 Ullllt deca espc T : (Figure 4), or a piece of old hide that has not yet completely yed. Occasionally an animal may be seen licking on the partially ~sed bones of a foul-smelling carcass. he facts related above have probably been...

  6. 1174 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 53, NO. 6, JUNE 2006 Microwave Drilling of Bones

    E-Print Network [OSTI]

    Gefen, Amit

    1174 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 53, NO. 6, JUNE 2006 Microwave Drilling*, Member, IEEE Abstract--This paper presents a feasibility study of drilling in fresh wet bone tissue in vitro using the microwave drill method [Jerby et al., 2002], toward testing its applicability

  7. 3D Reconstruction of the Femoral Bone using two X-ray Images from Orthogonal Views

    E-Print Network [OSTI]

    3D Reconstruction of the Femoral Bone using two X-ray Images from Orthogonal Views B. Nikkhahe of the femur and 97 % of the model femur shaft less than 2 mm from the CT scan. Also the femoral head visualization of the femur including the femoral collumn and condyles is important for the clinician in a number

  8. Changes in bone morphology and composition following long-term alcohol consumption

    E-Print Network [OSTI]

    Hebert, Valerie Anne

    1998-01-01T23:59:59.000Z

    The objective of this study is to determine the effect ics. of long-term alcohol consumption on bone morphology and composition. Female Sprague-Dawley rats were fed one of three diets (alcohol, pair-fed, or chow) for 18 months. The rats were...

  9. Bone ingrowth in a shoulder prosthesis E.M.van Aken

    E-Print Network [OSTI]

    Vuik, Kees

    Bone ingrowth in a shoulder prosthesis E.M.van Aken 1107895 emvanaken@hotmail.com Delft, 2006 and to relief the pain, a prosthesis to replace the glenoid of the shoulder joint is an option. The shoulder. The prosthesis, often made of stainless steal combined with polyethylene, re- #12;4 places this glenoid cavity

  10. A method for calibration of bone driver transducers to measure the mastoid Reggie Weece a

    E-Print Network [OSTI]

    Allen, Jont

    2010 Available online xxxx a b s t r a c t When using bone vibrator transducers for clinical a circuit model of the driver, describing it with three frequency-dependent parameters. Once these three circuit model is proposed to better capture the observed behaviors. Ã? 2010 Published by Elsevier B.V. 1

  11. The consequence of late-onset alcohol abuse in aged bone: a histomorhometric analysis

    E-Print Network [OSTI]

    Barker, Lisa Setchfield

    2000-01-01T23:59:59.000Z

    The objective of this experiment was to examine the effect of late-onset alcohol abuse on aged bone using the rat model. Thirty female Fischer 344 rats were separated by weights into one of four groups: baseline, alcohol-fed, pair-fed, and pellet...

  12. Calcium balance and bone density in immature horses fed a high protein diet 

    E-Print Network [OSTI]

    Spooner, Holly Sue

    2006-10-30T23:59:59.000Z

    is easy and non-invasive, the variability among horses is quite high, and thus it is best used for observations of changes in bone density over time for a specific animal. Computer assisted tomography (CAT scan) and dual energy x-ray 7...

  13. Correlation of mechanical viscoelastic properties to microstructure of equine cortical bone tissue

    E-Print Network [OSTI]

    Ayers, Andrew Kerr

    1995-01-01T23:59:59.000Z

    , there is a fair amount of subjectivity that is involved when deciding borderline grid points The current investigation used a diff'erent method in which an image analysis program, Optimas 4 2, is used to threshold the image of the bone In this procedure...

  14. BONE DENSITOMETRY IN PEDIATRIC POPULATIONS: DISCREPANCIES IN THE DIAGNOSIS OF OSTEOPOROSIS BY DXA AND CT

    E-Print Network [OSTI]

    Valero-Cuevas, Francisco

    BONE DENSITOMETRY IN PEDIATRIC POPULATIONS: DISCREPANCIES IN THE DIAGNOSIS OF OSTEOPOROSIS BY DXA, osteoporosis is frequently overdiagnosed in children when using dual-energy x-ray absorptiometry (DXA osteoporosis in pediatric populations. (J Pediatr 2005;146:776-9) D ual-energy x-ray absorptiometry (DXA

  15. On Smoothing Surfaces in Voxel Based Finite Element Analysis of Trabecular Bone

    E-Print Network [OSTI]

    Frey, Pascal

    On Smoothing Surfaces in Voxel Based Finite Element Analysis of Trabecular Bone Peter Arbenz on complicated domains composed of often hundreds of millions of voxel elements. The finite element analysis finite element (FE) analysis. The approach based on the FE analysis leads to linear systems of equations

  16. Sex Differences in Long Bone Fatigue Using a Rat Model Luisa D. Moreno,1

    E-Print Network [OSTI]

    Waldman, Stephen D.

    response to fatigue, we also determined the creep that occurred during the fatigue test. From the creep progress (Fig. 1). Caler and Carter32 studied cortical bone creep behavior during fatigue testing. When adaptation. From these results, we hypothesized that creep was the underlying mechanism that accounted

  17. Metabolic modeling for the deposition of transuranic nuclides on bone surfaces

    E-Print Network [OSTI]

    Halter, Donald Anthony

    1997-01-01T23:59:59.000Z

    to recalculate integrated activity over fifty years, U, values, as a function of intake for use in dose calculations for plutonium deposit on bone surfaces. These values were compared with those in ICRP-30 and showed a substantial decrease in the estimated dose...

  18. Mitigating Disuse Bone Loss: Role of Resistance Exercise and Beta-Adrenergic Signaling 

    E-Print Network [OSTI]

    Swift, Joshua Michael

    2011-08-08T23:59:59.000Z

    . Recent data gathered from crew members on the International Space Station (ISS) illustrates the significant losses of bone mineral density (BMD) and geometry of the femoral neck (15). Dual-energy x-ray absorptiometry (DXA) and QCT scans were taken...

  19. Changes in bone morphology and composition following long-term alcohol consumption 

    E-Print Network [OSTI]

    Hebert, Valerie Anne

    1998-01-01T23:59:59.000Z

    The objective of this study is to determine the effect ics. of long-term alcohol consumption on bone morphology and composition. Female Sprague-Dawley rats were fed one of three diets (alcohol, pair-fed, or chow) for 18 ...

  20. A 3D Statistical Shape Model Of The Pelvic Bone For Segmentation

    E-Print Network [OSTI]

    Andrzejak, Artur

    patient models from 3D image data. Within the setting of a hybrid system (applicator plus MR tomograph. Left: hybrid system (MRT plus applicator), Right: MRT slice image from the abdomen with pelvic bone. 1 on heating up affected tissue compartments to temperatures above 42 degree Celsius without damaging

  1. SENSITIZATION OF HUMAN OSTEOSARCOMA CELL LINE 143B WITH CALCITRIOL FOR CISPLATIN THERAPY

    E-Print Network [OSTI]

    Bhamidi Lakshmi, Surya Kameshwari Priyanka

    2012-08-31T23:59:59.000Z

    associated with OS are environmental such as exposure to radiation and beryllium oxide (2); epidemiological including associations with diseases such as retinoblastoma, Bloom syndrome and genetic impairments such as defects in cell cycle regulation with Rb... in the figure 2 (13). In addition to the role in bone mineral homeostasis, vitamin D has other non- calcemic actions such as thyroid function (17), insulin secretion (18), modulation of lymphocyte function and immune function (19), cellular differentiation...

  2. Electrochemical cell

    DOE Patents [OSTI]

    Redey, Laszlo I. (Downers Grove, IL); Myles, Kevin M. (Downers Grove, IL); Vissers, Donald R. (Naperville, IL); Prakash, Jai (Downers Grove, IL)

    1996-01-01T23:59:59.000Z

    An electrochemical cell with a positive electrode having an electrochemically active layer of at least one transition metal chloride. A negative electrode of an alkali metal and a compatible electrolyte including an alkali metal salt molten at cell operating temperature is included in the cell. The electrolyte is present at least partially as a corrugated .beta." alumina tube surrounding the negative electrode interior to the positive electrode. The ratio of the volume of liquid electrolyte to the volume of the positive electrode is in the range of from about 0.1 to about 3. A plurality of stacked electrochemical cells is disclosed each having a positive electrode, a negative electrode of an alkali metal molten at cell operating temperature, and a compatible electrolyte. The electrolyte is at least partially present as a corrugated .beta." alumina sheet separating the negative electrode and interior to the positive electrodes. The alkali metal is retained in a porous electrically conductive ceramic, and seals for sealing the junctures of the electrolyte and the adjacent electrodes at the peripheries thereof.

  3. Mechanical loading attenuates loss of bone mass and bone strength induced by immobilization and calcium-deficiency

    E-Print Network [OSTI]

    Inman, Cynthia Lynn

    1996-01-01T23:59:59.000Z

    of mechanical regulation of the skeleton by examining the mechanisms of cell stimulation in a controlled in vivo loading environment (Raab- Cullen et al. 1994). I~obl to It is well established that the skeleton adapts to the level of stress which is placed... University, Omaha, Nebraska. 26 The loading device is designed to accommodate the anatomy of an adult rat's right tibia (Figure 1) (Raab-Cullen et al. 1994). The pads (Figure 2) are constructed of balsa wood and sheathed with surgical tubing to minimize...

  4. Electrochemical cell

    DOE Patents [OSTI]

    Redey, L.I.; Vissers, D.R.; Prakash, J.

    1994-08-23T23:59:59.000Z

    An electrochemical cell is described having an alkali metal negative electrode such as sodium and a positive electrode including Ni or transition metals, separated by a [beta] alumina electrolyte and NaAlCl[sub 4] or other compatible material. Various concentrations of a bromine, iodine and/or sulfur containing additive and pore formers are disclosed, which enhance cell capacity and power. The pore formers may be the ammonium salts of carbonic acid or a weak organic acid or oxamide or methylcellulose. 6 figs.

  5. Photovoltaic cell

    DOE Patents [OSTI]

    Gordon, Roy G. (Cambridge, MA); Kurtz, Sarah (Somerville, MA)

    1984-11-27T23:59:59.000Z

    In a photovoltaic cell structure containing a visibly transparent, electrically conductive first layer of metal oxide, and a light-absorbing semiconductive photovoltaic second layer, the improvement comprising a thin layer of transition metal nitride, carbide or boride interposed between said first and second layers.

  6. Antibody responses in allogeneic radiation chimeras

    SciTech Connect (OSTI)

    Coico, R.F.

    1982-01-01T23:59:59.000Z

    The construction of long-lived allogeneic radiation chimeras, free of graft-versus-host disease, has been achieved using serologic elimination of Thy 1/sup +/ cells from donor bone marrow. Humoral immune function was not restored in these animals as evidenced by lack of primary antibody responses to a T cell-dependent antigen, namely, sheep erythrocytes (SRBC) both in vivo and in vitro. No evidence for a suppressor cell-mediated mechanism was found. Using separated chimera spleen cell populations and specific helper cell soluble mediators, the functional capabilities of chimera B cells, T cells, and macrophages were assessed. These findings suggested that the failure of chimeras to produce antibody is not the result of impaired B cell, T cell, or macrophage function, but rather, that it is due to ineffective cellular interactions. Physiologic cellular interactions depend upon the sharing of major histocompatibility complex (MHC) determinants between interacting cells. However, the self-recognition repertoire of developing T cells may be influenced by the environment which these cells differentiate such that they learn to recognize host MHC determinants as self. These findings support the interpretation that the immunologic hyporeactivity of allogeneic bone marrow chimeras reflects the role of the host environment in restricting the interactive capabilities of donor-derived cells.

  7. Nanocrystal Solar Cells

    E-Print Network [OSTI]

    Gur, Ilan

    2006-01-01T23:59:59.000Z

    research on organic photovoltaic cells since small molecule10 years prior (4). Photovoltaic cells with an active layerof the associated photovoltaic cells. 2.4 Charge transport

  8. Nanocrystal Solar Cells

    E-Print Network [OSTI]

    Gur, Ilan

    2006-01-01T23:59:59.000Z

    Nov, 2005). Chapter 4 Hybrid solar cells with 3-dimensionalinorganic nanocrystal solar cells 5.1 Introduction In recentoperation of organic based solar cells and distinguish them

  9. Hydrogen Fuel Cell Vehicles

    E-Print Network [OSTI]

    Delucchi, Mark

    1992-01-01T23:59:59.000Z

    Research Institute 1990 Fuel Cell Status," Proceedings ofMiller, "Introduction: Fuel-Cell-Powered Vehicle DevelopmentPrograms," presented at Fuel Cells for Transportation,

  10. Fuel Cell Technologies Overview: 2011 Fuel Cell Seminar | Department...

    Broader source: Energy.gov (indexed) [DOE]

    Fuel Cell Technologies Overview: 2011 Fuel Cell Seminar Fuel Cell Technologies Overview: 2011 Fuel Cell Seminar Presentation by Sunita Satyapal at the Fuel Cell Seminar on November...

  11. Diagnostic Studies on Lithium Battery Cells and Cell Components...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Studies on Lithium Battery Cells and Cell Components Diagnostic Studies on Lithium Battery Cells and Cell Components 2012 DOE Hydrogen and Fuel Cells Program and Vehicle...

  12. Hydrogen and Fuel Cell Technologies Program: Fuel Cells Fact...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Hydrogen and Fuel Cell Technologies Program: Fuel Cells Fact Sheet Hydrogen and Fuel Cell Technologies Program: Fuel Cells Fact Sheet Fact sheet produced by the Fuel Cell...

  13. Stationary Fuel Cells: Overview of Hydrogen and Fuel Cell Activities...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Stationary Fuel Cells: Overview of Hydrogen and Fuel Cell Activities Stationary Fuel Cells: Overview of Hydrogen and Fuel Cell Activities Presentation covers stationary fuel cells...

  14. Regional geologic characterization of the Second Bone Spring Sandstone, Delaware basin, Lea and Eddy Counties, New Mexico

    E-Print Network [OSTI]

    Downing, Amanda Beth

    2001-01-01T23:59:59.000Z

    The Bone Spring Formation is a series of interbedded siliciclastics and carbonates that were deposited in the Delaware basin during the Leonardian (Early Permian). It consists of the First, Second and Third Carbonate and the First, Second and Third...

  15. Adaptations of Trabecular Bone to Low Magnitude Vibrations Result in More Uniform Stress and Strain Under Load

    E-Print Network [OSTI]

    magnitude mechanical stimuli 10 microstrain induced at high frequencies are anabolic to trabe- cular bone strain or stress , the resultant stresses and strains within trabe- culae were more uniformly distributed

  16. Gary M. Bone, Andrew Lambert and Mark Edwards Abstract This paper describes the development of a novel

    E-Print Network [OSTI]

    Bone, Gary

    Gary M. Bone, Andrew Lambert and Mark Edwards Abstract ­ This paper describes the development from the top of a pile was described by Taylor, Blake and Cox [3]. They used a wrist-mounted camera

  17. Effect of dietary calcium and phosphorus levels on performance and bone development of large-framed developing boars

    E-Print Network [OSTI]

    Robinson, Robert Glen

    1975-01-01T23:59:59.000Z

    in determining bone strength. His expertise and willingness to help on short notice many times under adverse conditions will always be remembered. Special recognition is also due and gratefully given to personal friends Darrell Knabe and Edward Gregg...

  18. Potential commercial application of a bi-layer bone-ligament regeneration scaffold to anterior cruciate ligament replacement

    E-Print Network [OSTI]

    Li, Jessica C. (Jessica Ching-Yi)

    2006-01-01T23:59:59.000Z

    A business model was created in order to explore the commercial application of a bi-layer bone-ligament scaffold to the treatment of torn anterior cruciate ligaments (ACL) requiring replacement. The two main keys in producing ...

  19. Evaluation of Radiation Dose Effects on Rat Bones Using Synchrotron Radiation Computed Microtomography

    SciTech Connect (OSTI)

    Nogueira, Liebert Parreiras; Braz, Delson [Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Barroso, Regina Cely [Physics Institute / State University of Rio de Janeiro, 20550-900, Rio de Janeiro (Brazil); Almeida, Carlos Eduardo de; Andrade, Cherley Borba [Laboratory of Radiological Sciences / State University of Rio de Janeiro, Rio de Janeiro (Brazil); Tromba, Giuliana [Sincrotrone Trieste SCpA, Strada Statale S.S. 14 km 163.5, 34012 Basovizza, Trieste (Italy)

    2011-12-13T23:59:59.000Z

    In this work, we investigated the consequences of irradiation in the femora and ribs of rats submitted to radiation doses of 5 Gy. Three different sites in femur specimens (head, distal metaphysis and distal epiphysis) and one in ribs (ventral) were imaged using synchrotron radiation microcomputed tomography to assess trabecular bone microarchitecture. Histomorphometric quantification was calculated directly from the 3D microtomographic images using synchrotron radiation. The 3D microtomographic images were obtained at the SYRMEP (SYnchrotron Radiation for MEdical Physics) beamline at the Elettra Synchrotron Laboratory in Trieste, Italy. A better understanding of the biological interactions that occur after exposure to photon radiation is needed in order to optimize therapeutic regimens and facilitate development and strategies that decrease radiation-induced side effects in humans. Results showed significant differences between irradiated and non-irradiated specimens, mostly in head and distal metaphysis bone sites.

  20. Treatment of Extraspinal Painful Bone Metastases with Percutaneous Cementoplasty: A Prospective Study of 50 Patients

    SciTech Connect (OSTI)

    Anselmetti, Giovanni Carlo, E-mail: giovanni.anselmetti@ircc.it; Manca, Antonio [Institute for Cancer Research and Treatment, Interventional Radiology Unit (Italy); Ortega, Cinzia; Grignani, Giovanni [Institute for Cancer Research and Treatment, Oncology Unit (Italy); DeBernardi, Felicino [Institute for Cancer Research and Treatment, Anesthesiology Unit (Italy); Regge, Daniele [Institute for Cancer Research and Treatment, Radiology Unit (Italy)

    2008-11-15T23:59:59.000Z

    The aim of this study was to assess the efficacy of percutaneous cementoplasty (PC) with polymethylmethacrylate (PMMA) in painful extravertebral lytic bone metastases not responding to conventional therapy. Fifty patients (25 females), mean age 64.7 {+-} 11.2 years, underwent PC after giving informed consent. Procedures were performed under fluoroscopy (1/50) or combined fluoroscopy-CT (49/50) guidance in local anesthesia or under deep sedation in 7 patients with large metastases who underwent radiofrequency thermoablation (RFA) in the same session. Seventy lesions were treated (1-6 per patient; average, 1.4 {+-} 0.9), arranging in size from 1 to 10 cm (average, 3.6 {+-} 2.1 cm). Mean volume of PMMA per lesion was 5.9 {+-} 3.2 ml (range, 1.5-15.0 ml). Pain was prospectively evaluated on an 11-point visual analog scale (VAS) before and after the procedure (follow-up, 15 to 36 months). Mean VAS score dropped from 9.1 {+-} 1.2 (range: 6-10) to 2.1 {+-} 2.5 (range: 0-9). Mean VAS difference was 7.0 {+-} 2.3 (range, 1-10; p < 0.0001, Wilcoxon signed rank test). Forty-seven of the 50 patients (94%) suspended narcotic drugs, in 22 (44%) pain was controlled with a nonsteroidal anti-inflammatory drug, in 25 (50%) analgesic therapy was suspended, and 13 of 50 (26%) had complete pain regression. In 3 of the 50 patients (6%) pain was not improved. No statistical difference between osteoplasty and osteoplasty plus RFA was found (p = 0.8338, Mann-Whitney test). No complications arose during the procedure. Two patients with metastases in the femoral diaphysis reported a fracture 1 month after treatment. PC is effective to obtain pain regression in painful bone metastases not responding to conventional analgesic therapy; bone consolidation cannot be obtained in the diaphysis of long weight-bearing bones.

  1. Bone Implant Interface Investigation by Synchrotron Radiation X-Ray Microfluorescence

    SciTech Connect (OSTI)

    Calasans-Maia, M. [Odondology Department, Fluminense Federal Univeristy, Niteroi 24030-900, RJ (Brazil); Sales, E.; Lopes, R. T. [Nuclear Instrumentation Laboratory-PEN/COPPE, Federal Univeristy of Rio de Janeiro, Rio de Janeiro 21941-914, RJ (Brazil); Granjeiro, J. M. [Department of Cell and Molecular Biology, Fluminense Federal University, Niteroi 24030-900, RJ (Brazil); Lima, I. [Odondology Department, Fluminense Federal Univeristy, Niteroi 24030-900, RJ (Brazil); Department of Mechanical Engineering and Energy, Rio de Janeiro State University, Regional Campus-Polytechnic Institute-Alberto Rangel, s/n, Vila Nova, room 308, 28630-050, Nova Friburgo, RJ (Brazil)

    2010-04-06T23:59:59.000Z

    Zinc is known to play a relevant role in growth and development; it has stimulatory effects on in vitro and in vivo bone formation and an inhibitory effect on in vitro osteoclastic bone resorption. The inorganic component of the bone tissue is nonstoichiometric apatite; changes in the composition of hidroxyapatite are subject of studies in order to improve the tissue response after implantation. The objective of this study was to investigate the effect of 0.5% zinc-containing hydroxyapatite in comparison to hydroxyapatite on osseous repair of rabbit's tibia. Cylinders (2x6 mm) of both materials were produced according to the specification of the International Organization for Standardization. Ethics Commission on Teaching and Research in Animals approved this project (HUAP-195/06). Fifteen White New Zealand rabbits were submitted to general anesthesia and two perforations (2 mm) were made in each tibia for implantation of zinc-containing hydroxyapatite cylinders (left tibia) and hydroxyapatite cylinders (right tibia). After 1, 2 and 4 weeks, the animals were killed and one fragment of each tibia with the cylinder was collected and embedded in a methacrylate-based resin and cut into slices (approx200 {mu}m thickness), parallel to the implant's long axis with a precision diamond saw for Synchrotron Radiation X-ray Microfluorescence investigation. The accomplishment of the standard procedures helped the planning, execution and the comparative analysis of the results. The chemical and physical properties of the biomaterials were modified after its implantation and the incorporation of zinc. Both materials are biocompatible and promote osteoconduction and favored bone repair.

  2. The Relation of Lime and Phosphoric Acid to the Growth and Bone Development of White Rats.

    E-Print Network [OSTI]

    Blum, J. K. (Joseph Kelly)

    1931-01-01T23:59:59.000Z

    LIBRARY, A & M COLLEGE. CAMPUS. TEXAS AGRICULTURAL EXPERIMENT STATION A. B. CONNER, DIRECTOR College Station, Brazos County, Texas BULLETIN NO. 441 DECEMBER, 1931 DIVISION OF CHEMISTRY The Relation of Lime and Phosphoric Acid to the Growth... and Bone Development of White Rats 2 ., .t .I* .-. /.' AGRICULTURAL AND MECHANICAL COLLEGE OF TEXAS--. .. T. 0. WALTON, President ..- STATION STAFF+ ADMINISTRATION: VETERINARY SCIENCE: A B. CONNER M S. Director *M. FRANCIS, D. V. M., Chief. R: E...

  3. Automatic detection of bone fragments in poultry using multi-energy x-rays

    DOE Patents [OSTI]

    Gleason, Shaun S. (Knoxville, TN); Paulus, Michael J. (Knoxville, TN); Mullens, James A. (Knoxville, TN)

    2002-04-09T23:59:59.000Z

    At least two linear arrays of x-ray detectors are placed below a conveyor belt in a poultry processing plant. Multiple-energy x-ray sources illuminate the poultry and are detected by the detectors. Laser profilometry is used to measure the poultry thickness as the x-ray data is acquired. The detector readout is processed in real time to detect the presence of small highly attenuating fragments in the poultry, i.e., bone, metal, and cartilage.

  4. Functional Interference Clusters in Cancer Patients With Bone Metastases: A Secondary Analysis of RTOG 9714

    SciTech Connect (OSTI)

    Chow, Edward, E-mail: Edward.Chow@sunnybrook.c [Odette Cancer Centre, Toronto, ON (Canada); James, Jennifer [RTOG Statistical Center, Philadelphia, PA (United States); Barsevick, Andrea [Fox Chase Cancer Center, Cheltenham, PA (United States); Hartsell, William [Good Samaritan Cancer Center, Downers Grove, IL (United States); Ratcliffe, Sarah [University of Pennsylvania School of Medicine, Philadelphia, PA (United States); Scarantino, Charles [Rex Healthcare Cancer Center, Raleigh, NC (United States); Ivker, Robert [Newark Beth Israel Medical Center, Newark, NJ (Israel); Roach, Mack [UCSF Comprehensive Cancer Center, San Francisco, CA (United States); Suh, John [Cleveland Clinic Foundation, Cleveland, OH (United States); Petersen, Ivy [Mayo Clinic, Rochester, MN (United States); Konski, Andre [Fox Chase Cancer Center, Cheltenham, PA (United States); Demas, William [Akron City Hospital Cancer Care Center, Inc., Akron, OH (United States); Bruner, Deborah [Abramson Cancer Center, Philadelphia, PA (United States)

    2010-04-15T23:59:59.000Z

    Purpose: To explore the relationships (clusters) among the functional interference items in the Brief Pain Inventory (BPI) in patients with bone metastases. Methods: Patients enrolled in the Radiation Therapy Oncology Group (RTOG) 9714 bone metastases study were eligible. Patients were assessed at baseline and 4, 8, and 12 weeks after randomization for the palliative radiotherapy with the BPI, which consists of seven functional items: general activity, mood, walking ability, normal work, relations with others, sleep, and enjoyment of life. Principal component analysis with varimax rotation was used to determine the clusters between the functional items at baseline and the follow-up. Cronbach's alpha was used to determine the consistency and reliability of each cluster at baseline and follow-up. Results: There were 448 male and 461 female patients, with a median age of 67 years. There were two functional interference clusters at baseline, which accounted for 71% of the total variance. The first cluster (physical interference) included normal work and walking ability, which accounted for 58% of the total variance. The second cluster (psychosocial interference) included relations with others and sleep, which accounted for 13% of the total variance. The Cronbach's alpha statistics were 0.83 and 0.80, respectively. The functional clusters changed at week 12 in responders but persisted through week 12 in nonresponders. Conclusion: Palliative radiotherapy is effective in reducing bone pain. Functional interference component clusters exist in patients treated for bone metastases. These clusters changed over time in this study, possibly attributable to treatment. Further research is needed to examine these effects.

  5. Growth and bone development in weanling quarter horses fed diets supplemented with sodium zeolite-A

    E-Print Network [OSTI]

    Frey, Kimberly Suzanne

    1991-01-01T23:59:59.000Z

    ) possibly due to SZA's high ion-exchange capabilities (Roland, 1985; Miles, 1986); however, natural zeolites have not been shown to improve egg shell quality especially in diets low in calcium (Nakaue and Koelliker, 1981). This could be due...GROWTH AND BONE DEVELOPMENT IN WEANLING QUARTER HORSES FED DIETS SUPPLEMENTED WITH SODIUM ZEOLITE-A A Thesis by KIMBERLY SUZANNE FREY Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment...

  6. Immunization with FSH? fusion protein antigen prevents bone loss in a rat ovariectomy-induced osteoporosis model

    SciTech Connect (OSTI)

    Geng, Wenxin; Yan, Xingrong; Du, Huicong; Cui, Jihong; Li, Liwen, E-mail: liven@nwu.edu.cn; Chen, Fulin, E-mail: chenfl@nwu.edu.cn

    2013-05-03T23:59:59.000Z

    Highlights: •A GST-FSH fusion protein was successfully expressed in E. coli. •Immunization with GST-FSH antigen can raise high-titer anti-FSH polyclonal sera. •Anti-FSH polyclonal sera can neutralize osteoclastogenic effect of FSH in vitro. •FSH immunization can prevent bone loss in a rat osteoporosis model. -- Abstract: Osteoporosis, a metabolic bone disease, threatens postmenopausal women globally. Hormone replacement therapy (HTR), especially estrogen replacement therapy (ERT), is used widely in the clinic because it has been generally accepted that postmenopausal osteoporosis is caused by estrogen deficiency. However, hypogonadal ? and ? estrogen receptor null mice were only mildly osteopenic, and mice with either receptor deleted had normal bone mass, indicating that estrogen may not be the only mediator that induces osteoporosis. Recently, follicle-stimulating hormone (FSH), the serum concentration of which increases from the very beginning of menopause, has been found to play a key role in postmenopausal osteoporosis by promoting osteoclastogenesis. In this article, we confirmed that exogenous FSH can enhance osteoclast differentiation in vitro and that this effect can be neutralized by either an anti-FSH monoclonal antibody or anti-FSH polyclonal sera raised by immunizing animals with a recombinant GST-FSH? fusion protein antigen. Moreover, immunizing ovariectomized rats with the GST-FSH? antigen does significantly prevent trabecular bone loss and thereby enhance the bone strength, indicating that a FSH-based vaccine may be a promising therapeutic strategy to slow down bone loss in postmenopausal women.

  7. Cell Stem Cell Induction of Multipotential Hematopoietic

    E-Print Network [OSTI]

    Collins, James J.

    patients with hematologic diseases, including Fanconi anemia (Mu¨ ller et al., 2012), sickle cell anemia

  8. Fuel Cells

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8,Dist.Newof Energy ForrestalPrinceton PlasmaEnergyFuel Cell

  9. Induction and Patterning of Neural Crest Cells in the Developing Mouse Embryo: Roles for Gcnf and Hhat

    E-Print Network [OSTI]

    Dennis, Jennifer Frances

    2008-12-17T23:59:59.000Z

    . 31 crest cells results in cardio- and non-cardiovascular defects, including persistent truncus arteriosus, an incomplete septation of the aortic and pulmonary outflow tracts; non-cardiovascular phenotypes include defects in thymic, parathyroid...). Normal craniofacial development requires the orchestrated differentiation of these germ layers for functional integration of the facial and skull bones, muscle, connective tissue, skin, and the central and peripheral nervous systems (Trainor 2005...

  10. Age-related changes in the plasticity and toughness of human cortical bone at multiple length-scales

    SciTech Connect (OSTI)

    Zimmermann, Elizabeth A.; Schaible, Eric; Bale, Hrishikesh; Barth, Holly D.; Tang, Simon Y.; Reichert, Peter; Busse, Bjoern; Alliston, Tamara; Ager III, Joel W.; Ritchie, Robert O.

    2011-08-10T23:59:59.000Z

    The structure of human cortical bone evolves over multiple length-scales from its basic constituents of collagen and hydroxyapatite at the nanoscale to osteonal structures at nearmillimeter dimensions, which all provide the basis for its mechanical properties. To resist fracture, bone’s toughness is derived intrinsically through plasticity (e.g., fibrillar sliding) at structural-scales typically below a micron and extrinsically (i.e., during crack growth) through mechanisms (e.g., crack deflection/bridging) generated at larger structural-scales. Biological factors such as aging lead to a markedly increased fracture risk, which is often associated with an age-related loss in bone mass (bone quantity). However, we find that age-related structural changes can significantly degrade the fracture resistance (bone quality) over multiple lengthscales. Using in situ small-/wide-angle x-ray scattering/diffraction to characterize sub-micron structural changes and synchrotron x-ray computed tomography and in situ fracture-toughness measurements in the scanning electron microscope to characterize effects at micron-scales, we show how these age-related structural changes at differing size-scales degrade both the intrinsic and extrinsic toughness of bone. Specifically, we attribute the loss in toughness to increased non-enzymatic collagen cross-linking which suppresses plasticity at nanoscale dimensions and to an increased osteonal density which limits the potency of crack-bridging mechanisms at micron-scales. The link between these processes is that the increased stiffness of the cross-linked collagen requires energy to be absorbed by “plastic” deformation at higher structural levels, which occurs by the process of microcracking.

  11. Assessment of trabecular bone structure using MDCT: comparison of 64- and 320-slice CT using HR-pQCT as the reference standard

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    slice MDCT . HR-pQCT . Osteoporosis . Structure analysis .bone Introduction Osteoporosis is defined as a systemicmethod in current osteoporosis diagnosis is the assessment

  12. Efficacy of the investigational mTOR kinase inhibitor MLN0128 / INK128 in models of B-cell acute lymphoblastic leukemia

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    and xenograft experiments with human leukemia samples NIH-PAculture experiments, hTERT-immortalized human marrow stromal

  13. Photoelectrochemical cell

    DOE Patents [OSTI]

    Rauh, R. David (Newton, MA); Boudreau, Robert A. (Norton, MA)

    1983-06-14T23:59:59.000Z

    A photoelectrochemical cell comprising a sealed container having a light-transmitting window for admitting light into the container across a light-admitting plane, an electrolyte in the container, a photoelectrode in the container having a light-absorbing surface arranged to receive light from the window and in contact with the electrolyte, the surface having a plurality of spaced portions oblique to the plane, each portion having dimensions at least an order of magnitude larger than the maximum wavelength of incident sunlight, the total surface area of the surface being larger than the area of the plane bounded by the container, and a counter electrode in the container in contact with the electrolyte.

  14. Fuel cell arrangement

    DOE Patents [OSTI]

    Isenberg, A.O.

    1987-05-12T23:59:59.000Z

    A fuel cell arrangement is provided wherein cylindrical cells of the solid oxide electrolyte type are arranged in planar arrays where the cells within a plane are parallel. Planes of cells are stacked with cells of adjacent planes perpendicular to one another. Air is provided to the interior of the cells through feed tubes which pass through a preheat chamber. Fuel is provided to the fuel cells through a channel in the center of the cell stack; the fuel then passes the exterior of the cells and combines with the oxygen-depleted air in the preheat chamber. 3 figs.

  15. DOE Fuel Cell Technologies Office: 2013 Fuel Cell Seminar and...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    DOE Fuel Cell Technologies Office: 2013 Fuel Cell Seminar and Energy Exposition DOE Fuel Cell Technologies Office: 2013 Fuel Cell Seminar and Energy Exposition Overview of DOE's...

  16. DOE Fuel Cell Technologies Office Record 13012: Fuel Cell System...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Fuel Cell Technologies Office Record 13012: Fuel Cell System Cost - 2013 DOE Fuel Cell Technologies Office Record 13012: Fuel Cell System Cost - 2013 This program record from the...

  17. Hydrogen and Fuel Cell Technologies Update: 2010 Fuel Cell Seminar...

    Broader source: Energy.gov (indexed) [DOE]

    Hydrogen and Fuel Cell Technologies Update: 2010 Fuel Cell Seminar and Exposition Hydrogen and Fuel Cell Technologies Update: 2010 Fuel Cell Seminar and Exposition Presentation by...

  18. X-band EPR imaging as a tool for gradient dose reconstruction in irradiated bones

    SciTech Connect (OSTI)

    Leveque, Philippe; Godechal, Quentin; Bol, Anne; Trompier, Francois; Gallez, Bernard [Biomedical Magnetic Resonance Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium); Molecular Imaging and Experimental Radiotherapy Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium); Institut de Surete Nucleaire et de Radioprotection, F-92262 Fontenay-aux-Roses (France); Biomedical Magnetic Resonance Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium)

    2009-09-15T23:59:59.000Z

    Purpose: Various tools are currently available for dose reconstruction in individuals after accidental exposure to ionizing radiation. Among the available biological analyses, Monte Carlo simulations, and biophysical methods, such as electron paramagnetic resonance (EPR), the latter has proved its usefulness for retrospective dosimetry. Although EPR spectroscopy is probably the most sensitive technique, it does not provide spatial dosimetric data. This information is, however, highly desirable when steep dose gradient irradiations are involved. The purpose of this work was to explore the possibilities of EPR imaging (EPRI) for spatial dose reconstruction in irradiated biological material. Methods: X-band EPRI was used to reconstruct ex vivo the relative dose distribution in human bone samples and hydroxyapatite phantoms after irradiation with brachytherapy seeds or x rays. Three situations were investigated: Homogeneous, stepwise gradient, and continuous gradient irradiation. Results: EPRI gave a faithful relative spin density distribution in bone samples and in hydroxyapatite phantoms. Measured dose ratios were in close agreement with the actual delivered dose ratios. EPRI was able to distinguish the dose gradients induced by two different sources ({sup 125}I and {sup 192}Ir). However, the measured spatial resolution of the system was 1.9 mm and this appeared to be a limiting factor. The method could be improved by using new signal postprocessing strategies. Conclusions: This study demonstrates that EPRI can be used to assess the regional relative dose distribution in irradiated bone samples. The method is currently applicable to ex vivo measurements of small size samples with low variation in tissue density but is likely to be adapted for in vivo application using L-band EPRI.

  19. The consequence of late-onset alcohol abuse in aged bone: a histomorhometric analysis 

    E-Print Network [OSTI]

    Barker, Lisa Setchfield

    2000-01-01T23:59:59.000Z

    of the requirements for the degree of MASTER OF SCIENCE Approved as to style and content by: . Wayn ampson (Co-Chair of Committee) Joanne R. Lupton (Co-Chair of Committee) kfa A. Hog (Member) John E. Bauer ( air of Faculty of Nutrition) Brya . hn (Head... dehydrated within a vacuum by an ethanol gradient of 70 10 to 100'/o over four days, followed by two-24-hour acetone steps, and then embedded in methyl methacrylate. " Using a Jung Polycut E microtome (Leica, Germany), the plastic-embedded bones were...

  20. A parametric analysis of bone fixation plates on fractured equine third metacarpal

    E-Print Network [OSTI]

    Ray, Donald Reagan

    1970-01-01T23:59:59.000Z

    of metallic materials, were also being investigated and tried clinically. The earliesr types of metal plates to be used were made of nickel-steel, iron, or silver (1). These early plates were generally attached to the fractured Numbers in parentheses...A P~TRIC ANALYSIS OI' BONE FIXATION PLATES ON FRACTURED EQUINE THIRD lKTACARPAL A Thesis by Donald Reagan Ray Submitted to tnk Graduate College of Texas A&N University in partial fulfillment of the requirement for the degree of MASTER...

  1. Biochemical markers of bone modeling and remodeling in juvenile racehorses at varying mineral intakes

    E-Print Network [OSTI]

    Eller, Elena Maria

    2007-09-17T23:59:59.000Z

    . Resorption begins with recruitment of preosteoclasts, followed by differentiation into mature osteoclasts that then attach to the skeletal surface (Kleerekoper, 1996). During resorption (or demineralization) mineral is removed from the skeleton creating a... levels in the diet not be allowed to exceed Ca levels as ratios of Ca:P less than 1:1 appear to inhibit Ca absorption (NRC, 1989). Although Mg does not comprise as great a percentage of bone as do both Ca and P, 60% of the Mg in the body 8...

  2. Thermal Management of Solar Cells

    E-Print Network [OSTI]

    Saadah, Mohammed Ahmed

    2013-01-01T23:59:59.000Z

    D. Mills, "Cooling of photovoltaic cells under concentratedelectric performance of a photovoltaic cells by cooling andSolar Cell A photovoltaic cell is a semiconductor that

  3. Fuel cell-fuel cell hybrid system

    DOE Patents [OSTI]

    Geisbrecht, Rodney A.; Williams, Mark C.

    2003-09-23T23:59:59.000Z

    A device for converting chemical energy to electricity is provided, the device comprising a high temperature fuel cell with the ability for partially oxidizing and completely reforming fuel, and a low temperature fuel cell juxtaposed to said high temperature fuel cell so as to utilize remaining reformed fuel from the high temperature fuel cell. Also provided is a method for producing electricity comprising directing fuel to a first fuel cell, completely oxidizing a first portion of the fuel and partially oxidizing a second portion of the fuel, directing the second fuel portion to a second fuel cell, allowing the first fuel cell to utilize the first portion of the fuel to produce electricity; and allowing the second fuel cell to utilize the second portion of the fuel to produce electricity.

  4. Hydrogen Fuel Cell Vehicles

    E-Print Network [OSTI]

    Delucchi, Mark

    1992-01-01T23:59:59.000Z

    Hydrogen Fuel Cell Vehicles UCD-ITS-RR-92-14 September bycost than both. Solar-hydrogen fuel- cell vehicles would becost than both. Solar-hydrogen fuel- cell vehicles would be

  5. Nanocrystal Solar Cells

    E-Print Network [OSTI]

    Gur, Ilan

    2006-01-01T23:59:59.000Z

    of organic based solar cells and distinguish them from theirof nanocrystal-based solar cells. No one approach orNov, 2005). Chapter 4 Hybrid solar cells with 3-dimensional

  6. Nanocrystal Solar Cells

    E-Print Network [OSTI]

    Gur, Ilan

    2006-01-01T23:59:59.000Z

    Nov, 2005). Chapter 4 Hybrid solar cells with 3-dimensional5 All-inorganic nanocrystal solar cells 5.1 Introduction Inoperation of organic based solar cells and distinguish them

  7. Hydrogen Fuel Cell Vehicles

    E-Print Network [OSTI]

    Delucchi, Mark

    1992-01-01T23:59:59.000Z

    vehicles except the methanol/fuel cell vehicle and the BPEVe estimates for the methanol/fuel cell vehicle are based onbiomass-derived methanol used in fuel cell vehicles. Several

  8. The development of binary MgeCa alloys for use as biodegradable materials within bone

    E-Print Network [OSTI]

    Zheng, Yufeng

    the biocorrosion process and the associated hydroxyapatite mineralization. Ó 2007 Elsevier Ltd. All rights reserved to cells, and the viability of cells for Mge1Ca alloy extraction medium was better than that of control

  9. Characterization of the effects of x-ray irradiation on the hierarchical structure and mechanical properties of human cortical bone

    SciTech Connect (OSTI)

    Barth, Holly; Zimmermann, Elizabeth; Schaible, Eric; Tang, Simon; Alliston, Tamara; Ritchie, Robert

    2011-08-19T23:59:59.000Z

    Bone comprises a complex structure of primarily collagen, hydroxyapatite and water, where each hierarchical structural level contributes to its strength, ductility and toughness. These properties, however, are degraded by irradiation, arising from medical therapy or bone-allograft sterilization. We provide here a mechanistic framework for how irradiation affects the nature and properties of human cortical bone over a range of characteristic (nano to macro) length-scales, following x-­ray exposures up to 630 kGy. Macroscopically, bone strength, ductility and fracture resistance are seen to be progressively degraded with increasing irradiation levels. At the micron-­scale, fracture properties, evaluated using in-situ scanning electron microscopy and synchrotron x-ray computed micro-tomography, provide mechanistic information on how cracks interact with the bone-matrix structure. At sub-micron scales, strength properties are evaluated with in-situ tensile tests in the synchrotron using small-/wide-angle x-ray scattering/diffraction, where strains are simultaneously measured in the macroscopic tissue, collagen fibrils and mineral. Compared to healthy bone, results show that the fibrillar strain is decreased by ~40% following 70 kGy exposures, consistent with significant stiffening and degradation of the collagen. We attribute the irradiation-­induced deterioration in mechanical properties to mechanisms at multiple length-scales, including changes in crack paths at micron-­scales, loss of plasticity from suppressed fibrillar sliding at sub-­micron scales, and the loss and damage of collagen at the nano-­scales, the latter being assessed using Raman and Fourier-Transform-Infrared spectroscopy and a fluorometric assay.

  10. Chemopreventive activity of compounds extracted from Casearia sylvestris (Salicaceae) Sw against DNA damage induced by particulate matter emitted by sugarcane burning near Araraquara, Brazil

    SciTech Connect (OSTI)

    Prieto, A.M. [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Clinical Analysis, Rua Expedicionários do Brasil, 1621, Araraquara (Brazil)] [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Clinical Analysis, Rua Expedicionários do Brasil, 1621, Araraquara (Brazil); Santos, A.G. [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Natural Principles and Toxicology, Rodovia Araraquara-Jau, km 01, Araraquara (Brazil)] [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Natural Principles and Toxicology, Rodovia Araraquara-Jau, km 01, Araraquara (Brazil); Csipak, A.R.; Caliri, C.M.; Silva, I.C. [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Clinical Analysis, Rua Expedicionários do Brasil, 1621, Araraquara (Brazil)] [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Clinical Analysis, Rua Expedicionários do Brasil, 1621, Araraquara (Brazil); Arbex, M.A. [UNIFESP — Federal University of São Paulo, Paulista College of Medicine, Department of Internal Medicine, Rua Pedro de Toledo, 720, São Paulo (Brazil)] [UNIFESP — Federal University of São Paulo, Paulista College of Medicine, Department of Internal Medicine, Rua Pedro de Toledo, 720, São Paulo (Brazil); Silva, F.S.; Marchi, M.R.R. [UNESP — Univ. Estadual Paulista, Chemistry Institute, Department of Analytical Chemistry, Rua Francisco Degni, S/N, Araraquara (Brazil)] [UNESP — Univ. Estadual Paulista, Chemistry Institute, Department of Analytical Chemistry, Rua Francisco Degni, S/N, Araraquara (Brazil); Cavalheiro, A.J.; Silva, D.H.S.; Bolzani, V.S. [UNESP — Univ. Estadual Paulista, Chemistry Institute, Department of Organic Chemistry, Rua Francisco Degni, S/N, Araraquara (Brazil)] [UNESP — Univ. Estadual Paulista, Chemistry Institute, Department of Organic Chemistry, Rua Francisco Degni, S/N, Araraquara (Brazil); Soares, C.P., E-mail: soarescp@hotmail.com [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Clinical Analysis, Rua Expedicionários do Brasil, 1621, Araraquara (Brazil)

    2012-12-15T23:59:59.000Z

    Ethanolic extract of Casearia sylvestris is thought to be antimutagenic. In this study, we attempted to determine whether this extract and casearin X (a clerodane diterpene from C. sylvestris) are protective against the harmful effects of airborne pollutants from sugarcane burning. To that end, we used the Tradescantia micronucleus test in meiotic pollen cells of Tradescantia pallida, the micronucleus test in mouse bone marrow cells, and the comet assay in mouse blood cells. The mutagenic compound was total suspended particulate (TSP) from air. For the Tradescantia micronucleus test, T. pallida cuttings were treated with the extract at 0.13, 0.25, or 0.50 mg/ml. Subsequently, TSP was added at 0.3 mg/ml, and tetrads from the inflorescences were examined for micronuclei. For the micronucleus test in mouse bone marrow cells and the comet assay in mouse blood cells, Balb/c mice were treated for 15 days with the extract—3.9, 7.5, or 15.0 mg/kg body weight (BW)—or with casearin X—0.3, 0.25, or 1.2 mg/kg BW—after which they received TSP (3.75 mg/kg BW). In T. pallida and mouse bone marrow cells, the extract was antimutagenic at all concentrations tested. In mouse blood cells, the extract was antigenotoxic at all concentrations, whereas casearin X was not antimutagenic but was antigenotoxic at all concentrations. We conclude that C. sylvestris ethanolic extract and casearin X protect DNA from damage induced by airborne pollutants from sugarcane burning. -- Highlights: ? We assessed DNA protection of C. sylvestris ethanolic extract. ? We assessed DNA protection of casearin X. ? We used Tradescantia pallida micronucleus test as screening. ? We used comet assay and micronucleus test in mice. ? The compounds protected DNA against sugar cane burning pollutants.

  11. Effect of the {delta}-aminolevulinate dehydratase polymorphism on the accumulation of lead in bone and blood in lead smelter workers

    SciTech Connect (OSTI)

    Fleming, D.E.B.; Chettle, D.R. [McMaster Univ., Hamilton, Ontario (Canada). Dept. of Physics and Astronomy] [McMaster Univ., Hamilton, Ontario (Canada). Dept. of Physics and Astronomy; Wetmur, J.G.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)] [Mount Sinai School of Medicine, New York, NY (United States); Robin, J.P. [Noranda Inc., Montreal, Quebec (Canada)] [Noranda Inc., Montreal, Quebec (Canada); Boulay, D.; Richard, N.S. [Brunswick Mining and Smelting Corp. Ltd., Belledune, New Brunswick (Canada). Occupational Health Services] [Brunswick Mining and Smelting Corp. Ltd., Belledune, New Brunswick (Canada). Occupational Health Services; Gordon, C.L.; Webber, C.E. [Hamilton Health Sciences Corp., Hamilton, Ontario (Canada). Dept. of Nuclear Medicine] [Hamilton Health Sciences Corp., Hamilton, Ontario (Canada). Dept. of Nuclear Medicine

    1998-04-01T23:59:59.000Z

    Lead inhibition of the zinc metalloenzyme {delta}-aminolevulinate dehydratase (ALAD) is one of the most sensitive indicators of blood lead levels. Whole blood lead, serum lead, and ALAD genotype were determined for 381 lead smelter workers, including 70 workers expressing the ALAD allele, whose blood lead elevations were observed for more than 20 years of employment. The same employees demonstrated higher serum lead levels. Using a cumulative blood lead index (CBLI) for each worker, based on individual blood lead histories, and in vivo X-ray fluorescence measurements of bone lead to estimate total lead body burden, the slopes of linear relations of bone lead to CBLI were greater for workers homoallelic for ALAD, indicating more efficient uptake of lead from blood into bone. This effect was most significant in calcaneus bone and for workers hired since 1977. Decreased transfer of blood lead into bone in individuals expressing the ALAD allele contrasted with increased blood lead.

  12. Thermal Management of Solar Cells

    E-Print Network [OSTI]

    Saadah, Mohammed Ahmed

    2013-01-01T23:59:59.000Z

    cells by cooling and concentration techniques," inheat. Different techniques of cooling solar cells have been

  13. POLYMER ELECTROLYTE FUEL CELLS

    E-Print Network [OSTI]

    Petta, Jason

    POLYMER ELECTROLYTE FUEL CELLS: The Gas Diffusion Layer Johannah Itescu Princeton University PRISM REU #12;PEM FUEL CELLS: A little background information I. What do fuel cells do? Generate electricity through chemical reaction #12;PEM FUEL CELLS: A little background information -+ + eHH 442 2 0244 22 He

  14. Molten carbonate fuel cell

    DOE Patents [OSTI]

    Kaun, T.D.; Smith, J.L.

    1986-07-08T23:59:59.000Z

    A molten electrolyte fuel cell is disclosed with an array of stacked cells and cell enclosures isolating each cell except for access to gas manifolds for the supply of fuel or oxidant gas or the removal of waste gas. The cell enclosures collectively provide an enclosure for the array and effectively avoid the problems of electrolyte migration and the previous need for compression of stack components. The fuel cell further includes an inner housing about and in cooperation with the array enclosure to provide a manifold system with isolated chambers for the supply and removal of gases. An external insulated housing about the inner housing provides thermal isolation to the cell components.

  15. The safety and efficacy of an injectable bone substitute in dental sockets demonstrated in a human clinical trial

    E-Print Network [OSTI]

    Boyer, Edmond

    in a water-soluble cellulose polymer carrier phase. It was used for filling bone defects after tooth extractions in eleven patients. The first objective of the study was to investigate the safety of the filler of the implanted areas were harvested and analyzed by using micro-computed tomography, non-decalcified histology

  16. Prevention of Postmenopausal Bone Loss by a Low-Magnitude, High-Frequency Mechanical Stimuli: A Clinical Trial Assessing Compliance,

    E-Print Network [OSTI]

    , skeleton, aging, menopause, bone, antiresorptive INTRODUCTION OSTEOPOROSIS, A DISEASE CHARACTERIZED, double-blind, and placebo-controlled clinical trial in 70 women, 3­8 years past the menopause, examined the potential for a noninvasive, mechanically mediated intervention for osteoporosis. This non

  17. Bone quality measurements Osteoporos Int. 2011 Aug;22(8):2225-40. New laboratory tools in the assessment

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ,version1-1Jul2013 Author manuscript, published in "Osteoporosis International 22, 8 (2011) 2225-2240" DOI Force Microscopy FEA Finite Element Analysis Introduction Fragility fractures due to osteoporosis and affect ~30 % of women after the menopause and ~10 % of men. Dual Energy bone densitometry (DXA) has

  18. A Novel Method for the Evaluation of Mechanical Properties of Cancellous Bone in the Rat Distal Femur 

    E-Print Network [OSTI]

    Lucas, Matthew W.

    2010-01-14T23:59:59.000Z

    .................................................................................................................. 35 3.7.1 Analysis of Mechanical Testing Data .............................................................. 35 3.7.2 Material Properties ........................................................................................... 37 3.7.3 Core....2 Osteoporosis and the Ovariectomized Rat Model .................................................... 5 2.3 Mechanical Testing of Cancellous Bone in Rats ..................................................... 5 2.3.1 Femoral Neck Testing...

  19. Genetic Inactivation of ERK1 and ERK2 in Chondrocytes Promotes Bone Growth and Enlarges the Spinal Canal

    E-Print Network [OSTI]

    Genetic Inactivation of ERK1 and ERK2 in Chondrocytes Promotes Bone Growth and Enlarges the Spinal dysplasia. In mouse models of achondroplasia, recent studies have implicated the ERK MAPK pathway, a pathway and ERK MAPK signaling in chondrocytes also causes premature synchondrosis closure in the cranial base

  20. Spectral analysis and connectivity of porous microstructures in bone Kenneth M. Golden , N. Benjamin Murphy, Elena Cherkaev

    E-Print Network [OSTI]

    Cherkaev, Elena

    also help assess the impact of osteoporosis on trabecular structure. Central to our approach- structures, ranging from a solid network of connected trabeculae containing numerous connected pores, in dense cortical bone the pores can be sparse and disconnected, yet exhibit increasing volume fraction