Sample records for bone fracture behavior

  1. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on different size scales within bone, as well as the role of sustained irradiation damage. Combining in situ mechanical testing with synchrotron x-ray diffraction imaging and...

  2. On the effect of x-ray irradiation on the deformation and fracture behavior of human cortical bone

    SciTech Connect (OSTI)

    Barth, Holly D.; Launey, Maximilien E.; McDowell, Alastair A.; Ager III, Joel W.; Ritchie, Robert O.

    2010-01-10T23:59:59.000Z

    In situ mechanical testing coupled with imaging using high-energy synchrotron x-ray diffraction or tomography imaging is gaining in popularity as a technique to investigate micrometer and even sub-micrometer deformation and fracture mechanisms in mineralized tissues, such as bone and teeth. However, the role of the irradiation in affecting the nature and properties of the tissue is not always taken into account. Accordingly, we examine here the effect of x-ray synchrotron-source irradiation on the mechanistic aspects of deformation and fracture in human cortical bone. Specifically, the strength, ductility and fracture resistance (both work-of-fracture and resistance-curve fracture toughness) of human femoral bone in the transverse (breaking) orientation were evaluated following exposures to 0.05, 70, 210 and 630 kGy irradiation. Our results show that the radiation typically used in tomography imaging can have a major and deleterious impact on the strength, post-yield behavior and fracture toughness of cortical bone, with the severity of the effect progressively increasing with higher doses of radiation. Plasticity was essentially suppressed after as little as 70 kGy of radiation; the fracture toughness was decreased by a factor of five after 210 kGy of radiation. Mechanistically, the irradiation was found to alter the salient toughening mechanisms, manifest by the progressive elimination of the bone's capacity for plastic deformation which restricts the intrinsic toughening from the formation 'plastic zones' around crack-like defects. Deep-ultraviolet Raman spectroscopy indicated that this behavior could be related to degradation in the collagen integrity.

  3. Mechanistic fracture criteria for the failure of human cortical bone

    SciTech Connect (OSTI)

    Nalla, Ravi K.; Kinney, John H.; Ritchie, Robert O.

    2002-12-13T23:59:59.000Z

    A mechanistic understanding of fracture in human bone is critical to predicting fracture risk associated with age and disease. Despite extensive work, a mechanistic framework for describing how the underlying microstructure affects the failure mode in bone is lacking.

  4. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    x ORIGINAL ARTICLE Bone mineral density and fractures inwas associated with lower bone mineral density (BMD) at theKeywords Bone loss . Bone mineral density . Elderly .

  5. CORTICAL BONE FRACTURE R. O. RITCHIE

    E-Print Network [OSTI]

    Ritchie, Robert

    with menopause in aging women, can lead to osteoporosis, a condition of low bone mass associated the therapeutic benefits of antiresorptive agents in treating osteoporosis (6,7) has re-emphasized the ne- cessity

  6. Aging and Fracture of Human Cortical Bone and Tooth Dentin

    SciTech Connect (OSTI)

    Ager, Joel; Koester, Kurt J.; Ager III, Joel W.; Ritchie, Robert O.

    2008-05-07T23:59:59.000Z

    Mineralized tissues, such as bone and tooth dentin, serve as structural materials in the human body and, as such, have evolved to resist fracture. In assessing their quantitative fracture resistance or toughness, it is important to distinguish between intrinsic toughening mechanisms which function ahead of the crack tip, such as plasticity in metals, and extrinsic mechanisms which function primarily behind the tip, such as crack bridging in ceramics. Bone and dentin derive their resistance to fracture principally from extrinsic toughening mechanisms which have their origins in the hierarchical microstructure of these mineralized tissues. Experimentally, quantification of these toughening mechanisms requires a crack-growth resistance approach, which can be achieved by measuring the crack-driving force, e.g., the stress intensity, as a function of crack extension ("R-curve approach"). Here this methodology is used to study of the effect of aging on the fracture properties of human cortical bone and human dentin in order to discern the microstructural origins of toughness in these materials.

  7. A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone Marrow Mesenchymal Stem Cell Transplantation

    E-Print Network [OSTI]

    Miga, Michael I.

    A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone generation, and an iterative optimization (using finite element analysis) of the fracture callus material approach includes acquisition of microCT image volumes, biomechanical testing, finite element mesh

  8. A multi-scale bone study to estimate the risk of fracture related to osteoporosis

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    A multi-scale bone study to estimate the risk of fracture related to osteoporosis Abdelwahed' Orléans, 8, Rue Léonard de Vinci 45072 Orléans, France Objective: Osteoporosis is a disease marked. Bone fractures caused by the osteoporosis become increasingly important goal for both clinicians

  9. Dynamic Behavior and Microstructural Properties of Cancellous Bone.

    E-Print Network [OSTI]

    Boyer, Edmond

    A total of 15 distal parts of bovine femoral bones were used for this study (72 hours post mortemDynamic Behavior and Microstructural Properties of Cancellous Bone. S. Laporte1 , F. David1 , V of the cancellous bone and to identify the link between this mechanical behavior and the microstructural properties

  10. Impact fracture behavior of HT9 duct

    SciTech Connect (OSTI)

    Huang, F.H. [Westinghouse Hanford Co., Richland, WA (United States); Gelles, D.S. [Pacific Northwest Lab., Richland, WA (United States)

    1994-07-01T23:59:59.000Z

    Ferritic alloys are known to undergo a ductile-brittle transition as the test temperature is decreased. This inherent problem has limited their applications to reactor component materials subjected to low neutron exposures. However, the excellent resistance to void swelling exhibited by these alloys has led to choosing the materials as candidate materials for fast and fusion reactor applications. Despite the ductile-brittle transition problem, results show that the materials exhibit superior resistance to fracture under very high neutron fluences at irradiation temperatures above 380{degrees}C. Impact testing on FFTF duct sections of HT9 indicates that HT9 ducts have adequate fracture toughness at much higher temperatures for handling operations at room temperature and refueling operations.

  11. Identification and quantification of fracture behavior through reservoir simulation

    SciTech Connect (OSTI)

    Cline, S. [Univ. of Oklahoma, Oklahoma City, OK (United States)]|[Hefner Corporation, Oklahoma City, OK (United States)

    1995-08-01T23:59:59.000Z

    This study demonstrated the use of reservoir simulation as a tool for quantifying and describing the relative significance of fracture and matrix flow units to overall reservoir storage capacity and transmissibility in a field development example. A high matrix porosity Pennsylvanian age sandstone oil reservoir, that is currently undergoing the early stages of secondary recovery by waterflood, was studied. Unexpected early water breakthrough indicated the presence of a high directional permeability fracture system superimposed on the high porosity matrix system. To further understand the reservoir behavior, improve field performance and to quantify the relative contributions of fracture and matrix units to permeability and storage capacity, a reservoir simulation and characterization project was initiated. Well test, well log, tracer and geologic data were integrated into the simulation project. The integrated study indicated that the fractures exhibited high directional permeability but low storage capacity relative to the matrix portion of the reservoir. Although fractures heavily influenced overall fluid flow behavior, they did not contain large storage capacity. The system had a low calculated fracture intensity index. Reservoir simulation enabled the quantification of the relative importance of the two flow systems which in turn had a large impact on total reserves estimates and production forecasting. Simulation results indicated a need to realign injector and producer patterns which improved production rates and ultimate recovery.

  12. Transient pressure behavior of multiple-fractured gas wells

    E-Print Network [OSTI]

    Choo, Yew Kai

    1985-01-01T23:59:59.000Z

    -theta" coordinates will be developed. This simulator will then be employed to study the tr ansient pressure behavior of low-permeability gas wells with multiple finite-conductivity fractures. This thesis follows the form and style of the Journal of Petr oleum...

  13. A parametric analysis of bone fixation plates on fractured equine third metacarpal

    E-Print Network [OSTI]

    Ray, Donald Reagan

    1970-01-01T23:59:59.000Z

    of metallic materials, were also being investigated and tried clinically. The earliesr types of metal plates to be used were made of nickel-steel, iron, or silver (1). These early plates were generally attached to the fractured Numbers in parentheses...A P~TRIC ANALYSIS OI' BONE FIXATION PLATES ON FRACTURED EQUINE THIRD lKTACARPAL A Thesis by Donald Reagan Ray Submitted to tnk Graduate College of Texas A&N University in partial fulfillment of the requirement for the degree of MASTER...

  14. Analysis of flow behavior in fractured lithophysal reservoirs

    E-Print Network [OSTI]

    Liu, Jianchun; Bodvarsson, G.S.; Wu, Yu-Shu

    2002-01-01T23:59:59.000Z

    R. , 1980. Naturally Fractured Reservoirs, Petroleum, Tulsa,bounded naturally fractured reservoirs. Soc. Pet. Eng. J.test in a naturally fractured reservoir. J. Pet. Tech. 1295–

  15. J Bone Miner Res . Author manuscript Fracture risk prediction using BMD and clinical risk factors in early

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ,651 peri- and early post-menopausal women (mean age (± SD): 54 4 yr) with a mean follow-up period of 13 Density ; Female ; Fractures, Bone ; etiology ; Humans ; Middle Aged ; Osteoporosis, Postmenopausal definition of osteoporosis ( ), i.e. a bone mineral density (BMD) value less than 2.5 standard deviations

  16. Fracture Modeling and Flow Behavior in Shale Gas Reservoirs Using Discrete Fracture Networks

    E-Print Network [OSTI]

    Ogbechie, Joachim Nwabunwanne

    2012-02-14T23:59:59.000Z

    Gen and NFflow) for fracture modeling of a shale gas reservoir and also studies the interaction of the different fracture properties on reservoir response. The most important results of the study are that a uniform fracture network distribution and fracture...

  17. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes | NationalCurriculum IntroductionInvestor14,566Irradiation

  18. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes | NationalCurriculum

  19. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the Key

  20. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the KeyIrradiation Effects

  1. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the KeyIrradiation

  2. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the

  3. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is theIrradiation Effects on

  4. Predicting hip fracture type with cortical bone mapping (CBM) in the Osteoporotic Fractures in Men (MrOS) study

    E-Print Network [OSTI]

    Treece, Graham M.; Gee, Andrew H.; Tonkin, Carol; Ewing, Susan K.; Cawthon, Peggy M.; Black, Dennis M.; Poole, Kenneth E. S.; Osteoporotic Fractures in Men Study

    2015-03-18T23:59:59.000Z

    Hip fracture risk is known to be related to material properties of the proximal femur, but fracture prediction studies adding richer quantitative computed tomography (QCT) measures to dual energy X-ray (DXA)-based methods have shown limited...

  5. Finite-Element Analysis of Biting Behavior and Bone Stress in the

    E-Print Network [OSTI]

    Dumont, Elizabeth R.

    Finite-Element Analysis of Biting Behavior and Bone Stress in the Facial Skeletons of Bats biting behavior and bite force data gathered in the field with finite-element (FE) analysis. Our FE words: biting behavior; bone stress; adaptation; finite-ele- ment analysis; Chiroptera Mammal evolution

  6. The effect of graphite nodules on fracture behavior of ductile iron 

    E-Print Network [OSTI]

    Tanner, Glenn Mark

    1986-01-01T23:59:59.000Z

    THE EFFECT OF GRAPHITE NODULES ON FRACTURE BEHAVIOR OF DUCTILE IRON A Thesis By GLENN NARK TANNER Suhmitted to the Graduate College of Texas A&K University in partial fulfillment of the requirements for the degree of RASTER OF SCIENCE Nay... 1986 Kajor Subject: Nechanical Engineering THE EFFECT OF GRAPHITE NODULES ON FRACTURE BEHAVIOR OF DUCTILE IRON A Thesis by GLENN MARK TANNER Approved as to style and content by: Halter L. Bradley (Chairman of Committee) pl...

  7. Effect of resin toughness on fracture behavior of graphite/epoxy composites 

    E-Print Network [OSTI]

    Cohen, Ronald Nelson

    1982-01-01T23:59:59.000Z

    EFFECT OF RESIN TOUGHNESS ON FRACTURE BEHAVIOR OF GRAPHITE/EPOXY COMPOSITES A Thesis Dy RONALD NELSON COHEN Submitted to the Graduate College of Texas ASM University in partial fulfillment of the requirement for the degree of MASTER... OF SCIENCE December 1982 Mlajor Subject: Interdisciplinary Enqi neeri ng EFFECT OF RESIN TOUGHNESS ON FRACTURE BEHAVIOR OF GRAPHITE/EPOXY COMPOSITES A Thesis by RONALD NELSON COHEN Approved as to style and content by: (N. L. Bradley, Cha man) (R. A...

  8. The effect of vertical fractures on the behavior of a stratified reservoir under waterflood

    E-Print Network [OSTI]

    Pettitt, Bobby Eugene

    1963-01-01T23:59:59.000Z

    THE EFFECT OF VERTICAL FRACTURES ON THE BEHAVIOR OF A STRATIFIED RESERVOIR UNDER WATERFLOOD A Thesis Bobby E Pettitt Submitted to the Graduate School of the Agricultural and Mechanical College of Texas in Partial i...'ulfillment of the requirements for the degree of MASTER OF SCIENCE August~ 1963 Major Sub]ect: Petroleum Engineering THE EFFECT GF VERTICAL FRACTURES ON THE BEHAVIOR OF A STRATIFIED RESERVOIR UNDER WATERFLOOD A Thesis by Bobby E. Pettitt Approved as to style...

  9. Impact fracture behavior of model system modified polypropylene

    E-Print Network [OSTI]

    Estrada, Albert Jesse

    2000-01-01T23:59:59.000Z

    -edge-notched three-point-bend tests were performed to obtain the values of fracture toughness. A correlation exists between the Izod impact values and the size of the damage zone after fracture. Damage analysis using the double-notch four-point-bend Charpy impact...

  10. Fiber coatings and the fracture behavior of a continuous fiber ceramic composite

    SciTech Connect (OSTI)

    Miller, J.H.; Lowden, R.A. [Oak Ridge National Lab., TN (United States); Liaw, P.K. [Univ. of Knoxville, TN (United States)

    1995-12-31T23:59:59.000Z

    Continuous fiber reinforced ceramic composites (CFCC) are being recognized as necessary for high-temperature structural applications. For instance, the applications of SiC/SiC composites in elevated-temperature structures, such as first wall, and high heat flux surfaces in fusion reactors, as well as in combustors and boiler components in power generation systems, have drawn considerable attention. In the present study, Nicalon{sup {reg_sign}} plane-weave fiber reinforced SiC matrix composites have been fabricated by forced chemical vapor infiltration (FCVI) methods. The influence of fiber/matrix interface coating thickness on the fracture behavior of the continuous fiber reinforced SiC composites has been investigated. Experimental results indicate that fiber coating thickness significantly alters the fracture behavior of SiC composites. The fracture strength exhibits a maximum as the coating thickness increases. A mechanistic understanding of the fracture behavior is provided. Furthermore, a theoretical model is formulated to provide a better understanding of the effects of coating thickness on fracture behavior. The predicted fracture behavior was found to be in good agreement with the experimental results.

  11. In Situ Characterization of a Single Fracture Hydromechanical Behavior from Hydraulic Pulse Tests coupled to Simultaneous Pressure Normal

    E-Print Network [OSTI]

    Vallée, Martin

    In Situ Characterization of a Single Fracture Hydromechanical Behavior from Hydraulic Pulse Tests of the other surrounding fractures of the network. 1 INTRODUCTION Hydraulic pulse injection testing in single borehole has previously been applied to determine hydraulic properties of rock fractures, including

  12. Role of fluids in the hydromechanical behavior of heterogeneous fractured rocks: in situ characterization and numerical modelling

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    points and on different fracture types within a carbonate reservoir. Two kinds of experiments wereRole of fluids in the hydromechanical behavior of heterogeneous fractured rocks: in situ-Antipolis, France Abstract Hydromechanical coupled processes in a shallow fractured rock mass were investigated

  13. 3D Bone Microarchitecture Modeling and Fracture Risk Department of Computer

    E-Print Network [OSTI]

    Buffalo, State University of New York

    technique for the diagnosis of osteoporosis is Bone Mineral Density (BMD) measurement based on dual energy X

  14. Factors Affecting the Mechanical Behavior of Bone Subrata Saha, Ph.D.

    E-Print Network [OSTI]

    Gilbert, Robert P.

    Factors Affecting the Mechanical Behavior of Bone by Subrata Saha, Ph.D. Research Professor-mail: subrata.saha@downstate.edu ABSTRACT The load carrying capacity of our skeletal system depends

  15. Fracture behavior of short circumferentially surface-cracked pipe

    SciTech Connect (OSTI)

    Krishnaswamy, P.; Scott, P.; Mohan, R. [Battelle, Columbus, OH (United States)] [and others

    1995-11-01T23:59:59.000Z

    This topical report summarizes the work performed for the Nuclear Regulatory Comniission`s (NRC) research program entitled ``Short Cracks in Piping and Piping Welds`` that specifically focuses on pipes with short, circumferential surface cracks. The following details are provided in this report: (i) material property deteminations, (ii) pipe fracture experiments, (iii) development, modification and validation of fracture analysis methods, and (iv) impact of this work on the ASME Section XI Flaw Evaluation Procedures. The material properties developed and used in the analysis of the experiments are included in this report and have been implemented into the NRC`s PIFRAC database. Six full-scale pipe experiments were conducted during this program. The analyses methods reported here fall into three categories (i) limit-load approaches, (ii) design criteria, and (iii) elastic-plastic fracture methods. These methods were evaluated by comparing the analytical predictions with experimental data. The results, using 44 pipe experiments from this and other programs, showed that the SC.TNP1 and DPZP analyses were the most accurate in predicting maximum load. New Z-factors were developed using these methods. These are being considered for updating the ASME Section XI criteria.

  16. Strength of Materials, Vol. 46, No. 2, March, 2014 ANALYSIS OF FRACTURE BEHAVIOR OF THIN POLYCRYSTALLINE DIAMOND FILMS

    E-Print Network [OSTI]

    Qin, Qinghua

    POLYCRYSTALLINE DIAMOND FILMS D. S. Li,a,c,1 D. W. Zuo,a,b UDC 539.4 and Q. H. Qinc The effect of the substrate temperature and CH4 concentrations on the fracture behavior of thin polycrystalline diamond films that the fracture behavior of thin polycrystalline diamond films synthesized by direct current plasma jet chemical

  17. Fracture Behavior and Properties of Functionally Graded Fiber-Reinforced Concrete

    E-Print Network [OSTI]

    Paulino, Glaucio H.

    the structural benefits of functionally graded concrete materials (FGCM) for rigid pavements by testing (testing and modeling) demonstrates the viability of FGCM for designing layered concrete pavements systemFracture Behavior and Properties of Functionally Graded Fiber-Reinforced Concrete Jeffery Roesler

  18. Effect of Phase Transformation on the Fracture Behavior of Shape Memory Alloys

    E-Print Network [OSTI]

    Parrinello, Antonino

    2013-07-24T23:59:59.000Z

    . In order to achieve an effective design of SMA-based devices a thorough investigation of their behavior in the presence of cracks is needed. In particular, it is important to understand the effect of phase transformation on their fracture response...

  19. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    risk of vertebral osteoporosis compared to men with noto identify patients with osteoporosis. Keywords Bone loss .associated with COPD, osteoporosis is believed to affect 36%

  20. Effects of flaws on fracture behavior of structural ceramics

    SciTech Connect (OSTI)

    Singh, J.P.; Singh, D.; Sutaria, M.

    1996-05-01T23:59:59.000Z

    We evaluated the effects of fiber coating thickness, fiber orientation, and elevated temperature on flaw morphology and mechanical properties of Nicalon-fiber-reinforced SiC matrix composites with fiber cloth lay-up sequences of 0{degree}/45{degrees}, 0{degree}/20{degrees}/60{degrees}, and 0{degree}/40{degrees}/60{degrees} and fiber coating thicknesses of 0. 2 and 0.4{mu}m. For the three fiber cloth lay-up sequences (0{degree}/45{degrees}, 0{degree}/20{degrees}/60{degrees}, and 0{degree}/40{degrees}/60{degrees}), mechanical property (first matrix cracking stress, ultimate stress, and work of fracture) initially increase with coating thickness and reach peak values at a coating thickness of 0.2{mu}m. A further increase in coating thickness does not result in further improvements in mechanical properties; this is related to the role of coatings in protecting fibers from damage during composite processing. Measured values of strength and work-of- fracture of the above composites at elevated temperatures increased with temperature up to 1200{degrees}C, but decreased at higher temperatures. This decrease is correlated to in-situ fiber strength and fiber/matrix interface degradation. Correlations between model prediction and measured room-temperature ultimate strength of composites with 0{degree}45{degrees} and 0{degree}/40{degrees}/60{degrees} lay-up sequences were established by using in-situ fiber strength characteristics. The failure modes and degradation mechanisms in hot-gas filters and ceramic composite joints are being characterized by the mechanical and fractographic evaluation techniques established thus far. Correlations of these results with those of nondestructive evaluation can provide critical information for improved quality control.

  1. DIGITAL PREOPERATIVE PLANNING FOR LONG-BONE FRACTURES Esmitt Ramirez J.

    E-Print Network [OSTI]

    Coto, Ernesto

    .ramirez@ciens.ucv.ve ernesto.coto@ciens.ucv.ve Centro de Computaci´on Gr´afica, Universidad Central de Venezuela. Los Chaguaramos, Caracas-Venezuela Abstract. Nowadays, fracture management is an essential part of everyday

  2. Pretreatment levels of bone turnover and the antifracture efficacy of alendronate: The fracture intervention trial

    E-Print Network [OSTI]

    2006-01-01T23:59:59.000Z

    in postmenopausal osteoporosis. Cal- cif Tissue Int 65:359–in postmeno- pausal osteoporosis. J Bone Miner Res 12:624–among women without osteoporosis at baseline. Although they

  3. Fracture behavior of circumferentially surface-cracked elbows. Technical report, October 1993--March 1996

    SciTech Connect (OSTI)

    Kilinski, T.; Mohan, R.; Rudland, D.; Fleming, M. [and others

    1996-12-01T23:59:59.000Z

    This report presents the results from Task 2 of the Second International Piping Integrity Research Group (IPIRG-2) program. The focus of the Task 2 work was directed towards furthering the understanding of the fracture behavior of long-radius elbows. This was accomplished through a combined analytical and experimental program. J-estimation schemes were developed for both axial and circumferential surface cracks in elbows. Large-scale, quasi-static and dynamic, pipe-system, elbow fracture experiments under combined pressure and bending loads were performed on elbows containing an internal surface crack at the extrados. In conjunction with the elbow experiments, material property data were developed for the A106-90 carbon steel and WP304L stainless steel elbow materials investigated. A comparison of the experimental data with the maximum stress predictions using existing straight pipe fracture prediction analysis methods, and elbow fracture prediction methods developed in this program was performed. This analysis was directed at addressing the concerns regarding the validity of using analysis predictions developed for straight pipe to predict the fracture stresses of cracked elbows. Finally, a simplified fitting flaw acceptance criteria incorporating ASME B2 stress indices and straight pipe, circumferential-crack analysis was developed.

  4. The effect of processing upon the fracture behavior of cast and forged low alloy steel wellhead components

    E-Print Network [OSTI]

    Desadier, Christopher Earl

    1987-01-01T23:59:59.000Z

    THE EFFECT OF PROCESS1NG UPON THE FRACTURE BEHAVIOR OF CAST AND FORGED LOW ALLOY STEEL WELLHEAD COMPONENTS A Thesis by CHRISTOPHER EARL DESADIER Submitted to the Graduate College of Texas AAM University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE May 1987 Major Subject: Mechanical Engineering EFFECT OF PROCESSING UPON THE FRACTURE BEHAVIOR OF CAST AND FORGED LOW ALLOY STEEL WELLHEAD COMPONENTS A Thesis by CHRISTOPHER EARL DESADIER Approved...

  5. Cladding metallurgy and fracture behavior during reactivity-initiated accidents at high burnup

    SciTech Connect (OSTI)

    Chung, H.M.; Kassner, T.F.

    1996-12-01T23:59:59.000Z

    High-burnup fuel failure during a reactivity-initiated accident has been the subject of safety-related concern. Because of wide variations in metallurgical and simulation test conditions, it has been difficult to understand the complex failure behavior from major tests in NSRR and CABRI reactors. In this paper, a failure model based on fracture toughness and microstructural characteristics is proposed in which fracture toughness of high-burnup cladding is assumed to be sensitive to temperature and exhibit ductile-brittle transition phenomena similar to those of irradiated bcc alloys. Significant effects of temperature and shape of the pulse are predicted when a simulated test is conducted near the material`s transition temperature. Temperature dependence of fracture toughness is, in turn, sensitive to cladding microstructure such as density, distribution, and orientation of hydrides, oxygen distribution in the metallic phase, and irradiation-induced damage. Because all these factors are strongly influenced by corrosion, the key parameters that influence susceptibility to failure are oxide layer thickness and hydriding behavior. Therefore, fuel failure is predicted to be strongly dependent on cladding axial location as well as on burnup. 10 figs, 21 refs.

  6. Mechanical Behavior of Small-Scale Channels in Acid-etched Fractures

    E-Print Network [OSTI]

    Deng, Jiayao

    2011-02-22T23:59:59.000Z

    .) ............................................................................................................. 30 Fig. 2.4 Width profile of a fracture?s cross-section. ..................................................... 34 Fig. 2.5 Fracture?s cross-section approximated by an ellipse. ..................................... 35 Fig. 2.6 Fracture... profile scanned in the lab. .................................................................... 57 Fig. 3.5 Width profiles of fracture surfaces under closure stress 1,000 psi. ................ 58 Fig. 3.6 Width profiles of fracture surfaces...

  7. The Role of Geochemistry and Stress on Fracture Development and Proppant Behavior in EGS Reservoirs

    Broader source: Energy.gov [DOE]

    Project objective: Develop Improved Methods For Maintaining Permeable Fracture Volumes In EGS Reservoirs.

  8. Fracture and Fatigue Behavior at Ambient and Elevated Temperatures of Alumina Bonded with Copper/Niobium/Copper Interlayers

    E-Print Network [OSTI]

    Ritchie, Robert

    Fracture and Fatigue Behavior at Ambient and Elevated Temperatures of Alumina Bonded with Copper/Niobium-phase bonded using copper/niobium/copper interlayers have been investigated at both room and elevated, with failure primarily at the alumina/niobium interfaces. At room temperature, cyclic fatigue-crack propagation

  9. Prediction and Monitoring Systems of Creep-Fracture Behavior of 9Cr-1Mo Steels for Teactor Pressure Vessels

    SciTech Connect (OSTI)

    Potirniche, Gabriel; Barlow, Fred D.; Charit, Indrajit; Rink, Karl

    2013-11-26T23:59:59.000Z

    A recent workshop on next-generation nuclear plant (NGNP) topics underscored the need for research studies on the creep fracture behavior of two materials under consideration for reactor pressure vessel (RPV) applications: 9Cr-1Mo and SA-5XX steels. This research project will provide a fundamental understanding of creep fracture behavior of modified 9Cr-1Mo steel welds for through modeling and experimentation and will recommend a design for an RPV structural health monitoring system. Following are the specific objectives of this research project: • Characterize metallurgical degradation in welded modified 9Cr-1Mo steel resulting from aging processes and creep service conditions. • Perform creep tests and characterize the mechanisms of creep fracture process. • Quantify how the microstructure degradation controls the creep strength of welded steel specimens. • Perform finite element (FE) simulations using polycrystal plasticity to understand how grain texture affects the creep fracture properties of welds. • Develop a microstructure-based creep fracture model to estimate RPVs service life . • Manufacture small, prototypic, cylindrical pressure vessels, subject them to degradation by aging, and measure their leak rates. • Simulate damage evolution in creep specimens by FE analyses. • Develop a model that correlates gas leak rates from welded pressure vessels with the amount of microstructural damage. • Perform large-scale FE simulations with a realistic microstructure to evaluate RPV performance at elevated temperatures and creep strength. • Develop a fracture model for the structural integrity of RPVs subjected to creep loads. • Develop a plan for a non-destructive structural health monitoring technique and damage detection device for RPVs.

  10. Effect of dynamic monotonic and cyclic loading on fracture behavior for Japanese carbon steel pipe STS410

    SciTech Connect (OSTI)

    Kinoshita, Kanji; Murayama, Kouichi; Ogata, Hiroyuki [and others

    1997-04-01T23:59:59.000Z

    The fracture behavior for Japanese carbon steel pipe STS410 was examined under dynamic monotonic and cyclic loading through a research program of International Piping Integrity Research Group (EPIRG-2), in order to evaluate the strength of pipe during the seismic event The tensile test and the fracture toughness test were conducted for base metal and TIG weld metal. Three base metal pipe specimens, 1,500mm in length and 6-inch diameter sch.120, were employed for a quasi-static monotonic, a dynamic monotonic and a dynamic cyclic loading pipe fracture tests. One weld joint pipe specimen was also employed for a dynamic cyclic loading test In the dynamic cyclic loading test, the displacement was controlled as applying the fully reversed load (R=-1). The pipe specimens with a circumferential through-wall crack were subjected four point bending load at 300C in air. Japanese STS410 carbon steel pipe material was found to have high toughness under dynamic loading condition through the CT fracture toughness test. As the results of pipe fracture tests, the maximum moment to pipe fracture under dynamic monotonic and cyclic loading condition, could be estimated by plastic collapse criterion and the effect of dynamic monotonic loading and cyclic loading was a little on the maximum moment to pipe fracture of the STS410 carbon steel pipe. The STS410 carbon steel pipe seemed to be less sensitive to dynamic and cyclic loading effects than the A106Gr.B carbon steel pipe evaluated in IPIRG-1 program.

  11. Recent advances in hydraulic fracturing

    SciTech Connect (OSTI)

    Gidley, J.L.

    1989-01-01T23:59:59.000Z

    This book is a reference to the application of significant technological advances in hydraulic fracturing. It features illustrative problems to demonstrate specific applications of advanced technologies. Chapters examine pretreatment formation evaluation, rock mechanics and fracture geometry, 2D and 3D fracture-propagation models, propping agents and fracture conductivity, fracturing fluids and additives, fluid leakoff, flow behavior, proppant transport, treatment design, well completions, field implementation, fracturing-pressure analysis, postfracture formation evaluation, fracture azimuth and geometry determination, and economics of fracturing.

  12. Mesoscale Characterization of Coupled Hydromechanical Behavior of a Fractured Porous Slope in Response to Free Water-Surface Movement

    E-Print Network [OSTI]

    Guglielmi, Y.

    2008-01-01T23:59:59.000Z

    of these effects in fractured reservoirs, at an intermediateinteractions in a fractured carbonate reservoir inferredis a mesoscale fractured carbonate reservoir (30 m × 30 m ×

  13. BONE CARE FOR THE POSTMENOPAUSAL WOMAN

    E-Print Network [OSTI]

    Shihadeh, Alan

    Osteoporosis is a disease characterized by low bone mass and deterioration in the microarchitecture of bone tissue, leading to an increased risk of fracture. Osteoporosis occurs when the bone mass decreases more fracture). Osteoporosis has no signs or symptoms until a fracture occurs ­ this is why it is often called

  14. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    and the epiphysis are wider than the diaphysis. Cortical bone is denser than trabecular bone as shown in Fig. 2.1b. In the overall adult human skeleton, the skeletal mass is 80% cortical bone and 20% trabecular bone (4). However, the distribution of cortical... surfaces. Moreover, they did not use the volume 6 Table 2.1. Summary of experimental results on trabecular bone from previous research Source Type of bone Size of specimen Carter & Hayes (3) Bovine, Human ?20.6x5mm Cylinder E =3790? 0.06 ? 3 , ? c...

  15. Effect of resin toughness on fracture behavior of graphite/epoxy composites

    E-Print Network [OSTI]

    Cohen, Ronald Nelson

    1982-01-01T23:59:59.000Z

    to the Hexcel Corp. for donating all of the T6T145/F185 and T6C190/F155 mater1al used in this investiga- tion and for its assistance 1n contributing helpful information through- out the research, Also appreciated 1s the f1nancial support of the U. S. Air... AND DISCUSSION. Delamination Fracture Toughness Results ? Mode I Delamination Fracture Toughness Results - Mixed Mode I/Mode I I Delamination-Microscopic Investigation T6T145/F185 AS4/3502. T60190/ F155 Transverse Fracture Toughness Results. Transverse...

  16. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model 

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    In this study, trabecular architecture is considered as a cellular solid structure, including both intact and damaged bone models. ??Intact?? bone models were constructed based on ideal versions of 25, 60 and 80-year-old ...

  17. Fracture behaviors of nanowire-coated metal/polymer systems under mode-I loading condition

    SciTech Connect (OSTI)

    Lee, Ho-Young [School of Mechanical and Aerospace Engineering, College of Engineering, Seoul National University, San 56-1, Shillim-dong, Kwanak-gu, Seoul 151-744 (Korea, Republic of)]. E-mail: hlee@snu.ac.kr; Kim, Yong-Hyup [School of Mechanical and Aerospace Engineering, College of Engineering, Seoul National University, San 56-1, Shillim-dong, Kwanak-gu, Seoul 151-744 (Korea, Republic of); Chang, Young-Keun [School of Aerospace and Mechanical Engineering, Hankuk Aviation University, Hwajeon-dong, Duckyang-gu, Goyang-City 412-791 (Korea, Republic of)

    2004-12-01T23:59:59.000Z

    In previous works, two kinds of nanowires were formed on the surface of a copper-based leadframe by immersing them in two kinds of hot alkaline solutions. The nanowire-coated copper-based leadframe sheets were molded with epoxy molding compound (EMC), and the molded bodies were machined to form sandwiched double-cantilever beam specimens to measure the fracture toughness of the nanowire-coated leadframe (metal)/EMC (polymer) interfaces under quasi-mode-I loading condition. After the adhesion test, the fracture surfaces were analyzed to clarify the failure path by using various equipments. The present work attempted to correlate the failure path to adhesion strength by using a simple adhesion model.

  18. Prediction and Informative Risk Factor Selection of Bone Diseases

    E-Print Network [OSTI]

    Zhang, Aidong

    data and use these integrated features to effectively predict osteoporosis and bone fractures. We; disease memory; osteoporosis; bone fracture. ! 1 INTRODUCTION Risk factor (RF) analysis based on patients on the study of osteoporosis and bone fracture prediction. Over the past few decades, osteoporosis has been

  19. Effects of high-temperature environments on flaw generation and fracture behavior of SiC/SiC composites

    SciTech Connect (OSTI)

    Singh, J.P.; Singh, D. [Argonne National Lab., IL (United States). Energy Technology Div.

    1995-02-01T23:59:59.000Z

    Flaw generation and fracture behavior of Nicalon-fiber-reinforced SiC matrix composites are influenced by high temperatures. Therefore, the authors evaluated the effects of temperature by measuring the strength of these composites at several temperatures ranging from 800 to 1,300 C, and by characterizing their microstructure. While composite strength increased from {approx}400 MPa at room temperature to {approx}532 MPa at 800 C, it decreased to {approx}270 MPa at 1,300 C. Such degradation of composite strength at high temperature is believed to be partly due to fiber degradation. In-situ fiber strength of composites tested at room and elevated temperatures was estimated by fractographic techniques. The in-situ strength of fibers in composites was significantly lower than that of as-received fibers. This decrease is believed to be related to flaws that develop during processing and to exposure to elevated-temperature service environments.

  20. Mesoscale Characterization of Coupled Hydromechanical Behavior of a Fractured Porous Slope in Response to Free Water-Surface Movement

    E-Print Network [OSTI]

    Guglielmi, Y.

    2008-01-01T23:59:59.000Z

    Mesoscale Characterization of Coupled Hydromechanicalinstrumented for mesoscale hydraulic and mechanicalwords: Fracture; Rock slope; Mesoscale; In situ poroelastic

  1. Development of nondestructive evaluation methods and prediction of effects of flaws on the fracture behavior of structural ceramics

    SciTech Connect (OSTI)

    Ellingson, W.A.; Singh, J.P.; Holloway, D.L.; Dieckman, S.L.; Singh, D.; Sivers, E.A.; Sheen, S.H.; Wheeler, M.J.

    1992-05-01T23:59:59.000Z

    Characterization of ceramic matrix composites (continuous and whisker-type) by nondestructive evaluation (NDE) methods and an understanding of fracture behavior, together with correlation of fracture and NDE data, may provide insight into the prediction of component performance and the development of process technology. Knowledge of the degradation extent of fiber tows or monofilament degradation after processing, extent of open porosity before densification, and filament/fiber alignments before and after processing are also examples of important variables to be measured. Work in this program has emphasized continuous fiber ceramic matrix composites (CFCCs) that use chemical vapor infiltration (CVI)-infiltrated SiC/SiC materials, primarily those made of Nicalon satin or plain weave with 16 {times} 16 tows/in. in 2-D layups. All studied samples were provided by Oak Ridge National Laboratory and were made using 100 layers per inch. CVI specimens with 0/30/60, 0/90, and 0/45 were examined by 3-D X-ray microtomography to characterize in-plane fiber orientations. Current information suggests that for Nicalon-type fiber architecture, a {plus minus}2--1/2{degrees} misalignment may not affect mechanical properties. Thus the near-term goal has been to establish a detection capability for angular orientation. By using 512 {times} 512 images from 3-D X-ray CT data with pixel sizes of < 140 {mu}m and a special 2-D fast-Fourier transform image processing analysis, we have shown that fiber orientations to {plus minus}2--1/2{degrees} with SiC/SiC CVI type 2-D weave architecture can be measured.

  2. Development of nondestructive evaluation methods and prediction of effects of flaws on the fracture behavior of structural ceramics

    SciTech Connect (OSTI)

    Ellingson, W.A.; Singh, J.P.; Holloway, D.L.; Dieckman, S.L.; Singh, D.; Sivers, E.A.; Sheen, S.H.; Wheeler, M.J.

    1992-05-01T23:59:59.000Z

    Characterization of ceramic matrix composites (continuous and whisker-type) by nondestructive evaluation (NDE) methods and an understanding of fracture behavior, together with correlation of fracture and NDE data, may provide insight into the prediction of component performance and the development of process technology. Knowledge of the degradation extent of fiber tows or monofilament degradation after processing, extent of open porosity before densification, and filament/fiber alignments before and after processing are also examples of important variables to be measured. Work in this program has emphasized continuous fiber ceramic matrix composites (CFCCs) that use chemical vapor infiltration (CVI)-infiltrated SiC/SiC materials, primarily those made of Nicalon satin or plain weave with 16 {times} 16 tows/in. in 2-D layups. All studied samples were provided by Oak Ridge National Laboratory and were made using 100 layers per inch. CVI specimens with 0/30/60, 0/90, and 0/45 were examined by 3-D X-ray microtomography to characterize in-plane fiber orientations. Current information suggests that for Nicalon-type fiber architecture, a {plus_minus}2--1/2{degrees} misalignment may not affect mechanical properties. Thus the near-term goal has been to establish a detection capability for angular orientation. By using 512 {times} 512 images from 3-D X-ray CT data with pixel sizes of < 140 {mu}m and a special 2-D fast-Fourier transform image processing analysis, we have shown that fiber orientations to {plus_minus}2--1/2{degrees} with SiC/SiC CVI type 2-D weave architecture can be measured.

  3. A triple-continuum pressure-transient model for a naturally fractured vuggy reservoir

    E-Print Network [OSTI]

    2007-01-01T23:59:59.000Z

    simulation of naturally fractured reservoirs, Water Resour.model for fissured fractured reservoir, Soc. Pet. Eng. J. ,behavior of naturally fractured reservoirs, Soc. Pet. Eng.

  4. Upscaling solute transport in naturally fractured porous media with the continuous time random walk method

    E-Print Network [OSTI]

    Geiger, S.

    2012-01-01T23:59:59.000Z

    behavior of naturally fractured reservoirs. SPE Journal, R.the Bristol Channel fractured reservoir analogue (a), ?uidfor naturally fractured reservoirs. These simulations are

  5. Failure by fracture and fatigue in 'NANO' and 'BIO'materials

    SciTech Connect (OSTI)

    Ritchie, R.O.; Muhlstein, C.L.; Nalla, R.K.

    2003-12-19T23:59:59.000Z

    The behavior of nanostructured materials/small-volumestructures and biologi-cal/bio-implantable materials, so-called "nano"and "bio" materials, is currently much in vogue in materials science. Oneaspect of this field, which to date has received only limited attention,is their fracture and fatigue properties. In this paper, we examine twotopics in this area, namely the premature fatigue failure ofsilicon-based micron-scale structures for microelectromechanical systems(MEMS), and the fracture properties of mineralized tissue, specificallyhuman bone.

  6. Suspensions in hydraulic fracturing

    SciTech Connect (OSTI)

    Shah, S.N. [Univ. of Oklahoma, Norman, OK (United States)

    1996-12-31T23:59:59.000Z

    Suspensions or slurries are widely used in well stimulation and hydraulic fracturing processes to enhance the production of oil and gas from the underground hydrocarbon-bearing formation. The success of these processes depends significantly upon having a thorough understanding of the behavior of suspensions used. Therefore, the characterization of suspensions under realistic conditions, for their rheological and hydraulic properties, is very important. This chapter deals with the state-of-the-art hydraulic fracturing suspension technology. Specifically it deals with various types of suspensions used in well stimulation and fracturing processes, their rheological characterization and hydraulic properties, behavior of suspensions in horizontal wells, review of proppant settling velocity and proppant transport in the fracture, and presently available measurement techniques for suspensions and their merits. Future industry needs for better understanding of the complex behavior of suspensions are also addressed. 74 refs., 21 figs., 1 tab.

  7. Numerical simulation of single-phase and multiphase non-Darcy flow in porous and fractured reservoirs

    E-Print Network [OSTI]

    Wu, Yu-Shu

    2000-01-01T23:59:59.000Z

    flow simulations in fractured reservoirs, Report LBL-15227,behavior of naturally fractured reservoirs, Soc. Pet. Eng.Flow in Porous and Fractured Reservoirs Yu-Shu Wu Earth

  8. The Influence of Fold and Fracture Development on Reservoir Behavior of the Lisburne Group of Northern Alaska

    SciTech Connect (OSTI)

    Wallace, Wesley K.; Hanks, Catherine L.; Whalen, Michael T.; Jensen1, Jerry; Shackleton, J. Ryan; Jadamec, Margarete A.; McGee, Michelle M.; Karpov1, Alexandre V.

    2001-07-23T23:59:59.000Z

    The Carboniferous Lisburne Group is a major carbonate reservoir unit in northern Alaska. The lisburne is detachment folded where it is exposed throughout the northeastern Brooks Range, but is relatively underformed in areas of current production in the subsurface of the North Slope. The objectives of this study are to develop a better understanding of four major aspects of the Lisburne: (1) The geometry and kinematics of detachment folds and their truncation by thrust faults, (2) The influence of folding on fracture patterns, (3) The influence of deformation on fluid flow, and (4) Lithostratigraphy and its influence on folding, faulting, fracturing, and reservoir characteristics.

  9. Experimental analysis of the extension to shear fracture transition in Berea Sandstone

    E-Print Network [OSTI]

    Bobich, Jennifer Kay

    2005-11-01T23:59:59.000Z

    and follows Coulomb behavior; however, the angle between the fracture surface and ??1 increases continuously with Pc. Fracture surfaces characteristic of the extension to shear fracture transition appear as linked, stepped extension fractures; the length...

  10. Think of your bones as a "bank" where

    E-Print Network [OSTI]

    Baker, Chris I.

    can get osteoporosis (ah-stee-oh-puh- ROH-sis) when you get older. Osteoporosis is a disease in which the bones become weak and more likely to break (fracture). People with osteoporosis most often break bones in the hip, spine, and wrist. 1 #12;Normal bone Bone with osteoporosis Reprinted from The Surgeon General

  11. THE INFLUENCE OF FOLD AND FRACTURE DEVELOPMENT ON RESERVOIR BEHAVIOR OF THE LISBURNE GROUP OF NORTHERN ALASKA

    SciTech Connect (OSTI)

    Wesley K. Wallace; Catherine L. Hanks; Jerry Jensen; Michael T. Whalen

    2002-01-01T23:59:59.000Z

    The Carboniferous Lisburne Group is a major carbonate reservoir unit in northern Alaska. The Lisburne is detachment folded where it is exposed throughout the northeastern Brooks Range, but is relatively undeformed in areas of current production in the subsurface of the North Slope. The objectives of this study are to develop a better understanding of four major aspects of the Lisburne: (1) The geometry and kinematics of detachment folds and their truncation by thrust faults. (2) The influence of folding on fracture patterns. (3) The influence of deformation on fluid flow. (4) Lithostratigraphy and its influence on folding, faulting, fracturing, and reservoir characteristics. The Lisburne in the main axis of the Brooks Range is characteristically deformed into imbricate thrust sheets with asymmetrical hanging wall anticlines and footwall synclines. In contrast, the Lisburne in the northeastern Brooks Range is characterized by symmetrical detachment folds. The focus of our 2000 field studies was at the boundary between these structural styles in the vicinity of Porcupine Lake, in the Arctic National Wildlife Refuge. The northern edge of thrust-truncated folds in Lisburne is marked by a local range front that likely represents an eastward continuation of the central Brooks Range front. This is bounded to the north by a gently dipping panel of Lisburne with local asymmetrical folds. The leading edge of the flat panel is thrust over Permian to Cretaceous rocks in a synclinal depression. These younger rocks overlie symmetrically detachment-folded Lisburne, as is extensively exposed to the north. Six partial sections were measured in the Lisburne of the flat panel and local range front. The Lisburne here is about 700 m thick and is interpreted to consist primarily of the Wachsmuth and Alapah Limestones, with only a thin veneer of Wahoo Limestone. The Wachsmuth (200 m) is gradational between the underlying Missippian Kayak Shale and the overlying Mississippian Alapah, and increases in resistance upward. The Alapah consists of a lower resistant member (100 m) of alternating limestone and chert, a middle recessive member (100 m), and an upper resistant member (260 m) that is similar to Wahoo in the northeastern Brooks Range. The Wahoo is recessive and is thin (30 m) due either to non-deposition or erosion beneath the sub-Permian unconformity. The Lisburne of the area records two major episodes of transgression and shallowing-upward on a carbonate ramp. Thicknesses and facies vary along depositional strike. Asymmetrical folds, mostly truncated by thrust faults, were studied in and south of the local range front. Fold geometry was documented by surveys of four thrust-truncated folds and two folds not visibly cut by thrusts. A portion of the local range front was mapped to document changes in fold geometry along strike in three dimensions. The folds typically display a long, non-folded gently to moderately dipping backlimbs and steep to overturned forelimbs, commonly including parasitic anticline-syncline pairs. Thrusts commonly cut through the anticlinal forelimb or the forward synclinal hinge. These folds probably originated as detachment folds based on their mechanical stratigraphy and the transition to detachment folds to the north. Their geometry indicates that they were asymmetrical prior to thrust truncation. This asymmetry may have favored accommodation of increasing shortening by thrust breakthrough rather than continued folding. Fracture patterns were documented in the gently dipping panel of Lisburne and the asymmetrical folds within it. Four sets of steeply dipping extension fractures were identified, with strikes to the (1) N, (2) E, (3) N to NW, and (4) NE. The relative timing of these fracture sets is complex and unclear. En echelon sets of fractures are common, and display normal or strike-slip sense. Mesoscopic and penetrative structures are locally well developed, and indicate bed-parallel shear within the flat panel and strain within folds. Three sets of normal faults are well developed in the area, and are unusual

  12. Development of nondestructive evaluation methods and prediction of effects of flaws on the fracture behavior of structural ceramics

    SciTech Connect (OSTI)

    Ellingson, W.A.; Singh, J.P.; Holloway, D.L.; Dieckman, S.L.; Singh, D.; Sivers, E.A.

    1993-03-01T23:59:59.000Z

    Work emphasized continuous-fiber ceramic matrix composites (CFCCs) with 2-D lay-ups composed of chemical-vapor-infiltrated (CVI) SiC/SiC materials, mostly made of Nicalon plain weave with 16 [times] 16 tows/in. One sample examined comprised a 3-D SiC/SiC braid made by Techniweave. Using a new 1024[times]1024[times]14 bit detector, images from 3-D X-ray CT data with pixel sizes of <140 [mu]m and 2-D fast-Fourier transform (FFT) image processing, we have shown that fiber orientations can be measured to [plus minus]2-1/2[degree]. 3-D FFT analysis was used to determine 3-D braid/weave fiber spacing. Multinuclear ([sup l]H, [sup 13]C, and [sup 29]Si) NMR spectroscopy, is being studied. Surface chemistry of fibers and chemistry of interfacial regions in composites are being studied. We are also conducting initial studies to investigate the bulk composition of matrix materials ([alpha], [beta], amorphous phase, silica, and oxynitride concentration) and surface chemistry of Si[sub 3]N[sub 4] and SiC fibers. Fracture mechanics work to correlate with NDE data focused on strength distribution of as-fabricated Nicalon fibers obtained from bundle tests. Strength distribution of fractured Nicalon fibers in composites was assessed from fracture mirror radii. SEM was used to determine distribution of fiber pullout length distribution for fibers in composites, for their strength distribution. From the strength distribution plots, scale parameters were determined to be 3.45 GPa for as-fabricated fibers and 1.31 GPa for fibers in processed composites. However, the Weibull moduli for the two distributions were similar. Reduction in strength of the fibers in processed composites is believed to be due to surface flaws and defects. Effects of fiber misorientation on mechanical properties of NDE-tested CVI continuous-fiber composites are currently being investigated. 8 figs, 11 refs.

  13. FRACTURING FLUID CHARACTERIZATION FACILITY

    SciTech Connect (OSTI)

    Subhash Shah

    2000-08-01T23:59:59.000Z

    Hydraulic fracturing technology has been successfully applied for well stimulation of low and high permeability reservoirs for numerous years. Treatment optimization and improved economics have always been the key to the success and it is more so when the reservoirs under consideration are marginal. Fluids are widely used for the stimulation of wells. The Fracturing Fluid Characterization Facility (FFCF) has been established to provide the accurate prediction of the behavior of complex fracturing fluids under downhole conditions. The primary focus of the facility is to provide valuable insight into the various mechanisms that govern the flow of fracturing fluids and slurries through hydraulically created fractures. During the time between September 30, 1992, and March 31, 2000, the research efforts were devoted to the areas of fluid rheology, proppant transport, proppant flowback, dynamic fluid loss, perforation pressure losses, and frictional pressure losses. In this regard, a unique above-the-ground fracture simulator was designed and constructed at the FFCF, labeled ''The High Pressure Simulator'' (HPS). The FFCF is now available to industry for characterizing and understanding the behavior of complex fluid systems. To better reflect and encompass the broad spectrum of the petroleum industry, the FFCF now operates under a new name of ''The Well Construction Technology Center'' (WCTC). This report documents the summary of the activities performed during 1992-2000 at the FFCF.

  14. The Influence of fold and fracture development on reservoir behavior of the Lisburne Group of northern Alaska

    SciTech Connect (OSTI)

    Wesley K. Wallace; Catherine L. Hanks; Jerry Jensen: Michael T. Whalen; Paul Atkinson; Joseph Brinton; Thang Bui; Margarete Jadamec; Alexandre Karpov; John Lorenz; Michelle M. McGee; T.M. Parris; Ryan Shackleton

    2004-07-01T23:59:59.000Z

    The Carboniferous Lisburne Group is a major carbonate reservoir unit in northern Alaska. The Lisburne is folded and thrust faulted where it is exposed throughout the Brooks Range, but is relatively undeformed in areas of current production in the subsurface of the North Slope. The objectives of this study were to develop a better understanding of four major aspects of the Lisburne: (1) The geometry and kinematics of folds and their truncation by thrust faults. (2) The influence of folding on fracture patterns. (3) The influence of deformation on fluid flow. (4) Lithostratigraphy and its influence on folding, faulting, fracturing, and reservoir characteristics. Symmetrical detachment folds characterize the Lisburne in the northeastern Brooks Range. In contrast, Lisburne in the main axis of the Brooks Range is deformed into imbricate thrust sheets with asymmetrical hangingwall anticlines and footwall synclines. The Continental Divide thrust front separates these different structural styles in the Lisburne and also marks the southern boundary of the northeastern Brooks Range. Field studies were conducted for this project during 1999 to 2001 in various locations in the northeastern Brooks Range and in the vicinity of Porcupine Lake, immediately south of the Continental Divide thrust front. Results are summarized below for the four main subject areas of the study.

  15. Automatic Fracture Reduction Thomas Albrecht and Thomas Vetter

    E-Print Network [OSTI]

    Vetter, Thomas

    present a method to automatically reposition the frag- ments of a broken bone based on surface meshes nailing, the correct repositioning of bone fragments is not always apparent or visible without an operation plan. We propose to achieve automatic fracture reduction by fitting the bone fragments

  16. Development of nondestructive evaluation methods and prediction of effects of flaws on the fracture behavior of structural ceramics

    SciTech Connect (OSTI)

    Ellingson, W.A.; Singh, J.P.; Holloway, D.L.; Dieckman, S.L.; Singh, D.; Sivers, E.A.

    1993-03-01T23:59:59.000Z

    Work emphasized continuous-fiber ceramic matrix composites (CFCCs) with 2-D lay-ups composed of chemical-vapor-infiltrated (CVI) SiC/SiC materials, mostly made of Nicalon plain weave with 16 {times} 16 tows/in. One sample examined comprised a 3-D SiC/SiC braid made by Techniweave. Using a new 1024{times}1024{times}14 bit detector, images from 3-D X-ray CT data with pixel sizes of <140 {mu}m and 2-D fast-Fourier transform (FFT) image processing, we have shown that fiber orientations can be measured to {plus_minus}2-1/2{degree}. 3-D FFT analysis was used to determine 3-D braid/weave fiber spacing. Multinuclear ({sup l}H, {sup 13}C, and {sup 29}Si) NMR spectroscopy, is being studied. Surface chemistry of fibers and chemistry of interfacial regions in composites are being studied. We are also conducting initial studies to investigate the bulk composition of matrix materials ({alpha}, {beta}, amorphous phase, silica, and oxynitride concentration) and surface chemistry of Si{sub 3}N{sub 4} and SiC fibers. Fracture mechanics work to correlate with NDE data focused on strength distribution of as-fabricated Nicalon fibers obtained from bundle tests. Strength distribution of fractured Nicalon fibers in composites was assessed from fracture mirror radii. SEM was used to determine distribution of fiber pullout length distribution for fibers in composites, for their strength distribution. From the strength distribution plots, scale parameters were determined to be 3.45 GPa for as-fabricated fibers and 1.31 GPa for fibers in processed composites. However, the Weibull moduli for the two distributions were similar. Reduction in strength of the fibers in processed composites is believed to be due to surface flaws and defects. Effects of fiber misorientation on mechanical properties of NDE-tested CVI continuous-fiber composites are currently being investigated. 8 figs, 11 refs.

  17. Discrete Element Model for Simulations of Early-Life Thermal Fracturing Behaviors in Ceramic Nuclear Fuel Pellets

    SciTech Connect (OSTI)

    Hai Huang; Ben Spencer; Jason Hales

    2014-10-01T23:59:59.000Z

    A discrete element Model (DEM) representation of coupled solid mechanics/fracturing and heat conduction processes has been developed and applied to explicitly simulate the random initiations and subsequent propagations of interacting thermal cracks in a ceramic nuclear fuel pellet during initial rise to power and during power cycles. The DEM model clearly predicts realistic early-life crack patterns including both radial cracks and circumferential cracks. Simulation results clearly demonstrate the formation of radial cracks during the initial power rise, and formation of circumferential cracks as the power is ramped down. In these simulations, additional early-life power cycles do not lead to the formation of new thermal cracks. They do, however clearly indicate changes in the apertures of thermal cracks during later power cycles due to thermal expansion and shrinkage. The number of radial cracks increases with increasing power, which is consistent with the experimental observations.

  18. Association of Osteocalcin and Abdominal Aortic Calcification in Older Women: The Study of Osteoporotic Fractures

    E-Print Network [OSTI]

    Parker, Benjamin D.; Bauer, Douglas C.; Ensrud, Kristine E.; Ix, Joachim H.

    2010-01-01T23:59:59.000Z

    History of stroke, No. Osteoporosis or vertebral fracture,aortic calci?cation in osteoporosis patients. J Bone Minercation of the aorta and osteoporosis. A roentgenographic

  19. Trabecular Microarchitecture, Endplate Failure, and the Biomechanics of Human Vertebral Fractures

    E-Print Network [OSTI]

    Fields, Aaron Joseph

    2010-01-01T23:59:59.000Z

    The Worldwide Problem of Osteoporosis - Insights Afforded byN. The diagnosis of osteoporosis. J Bone Miner Res 1994;9:of fracture in women with osteoporosis? Bone 2000;27: 1-3.

  20. Percutaneous Vertebroplasty for Osteoporotic Compression Fracture: Multivariate Study of Predictors of New Vertebral Body Fracture

    SciTech Connect (OSTI)

    Komemushi, Atsushi, E-mail: kome64@yo.rim.or.jp; Tanigawa, Noboru; Kariya, Shuji; Kojima, Hiroyuki; Shomura, Yuzo [Kansai Medical University, Department of Radiology (Japan); Komemushi, Sadao [Kinki University, Schoool of Agriculture (Japan); Sawada, Satoshi [Kansai Medical University, Department of Radiology (Japan)

    2006-08-15T23:59:59.000Z

    Purpose. To investigate the risk factors and relative risk of new compression fractures following vertebroplasty. Methods. Initially, we enrolled 104 consecutive patients with vertebral compression fractures caused by osteoporosis. A total of 83 of the 104 patients visited our hospital for follow-up examinations for more than 4 weeks after vertebroplasty. Logistic regression analysis of the data obtained from these 83 patients was used to determine relative risks of recurrent compression fractures, using 13 different factors. Results. We identified 59 new fractures in 30 of the 83 patients: 41 new fractures in vertebrae adjacent to treated vertebrae; and 18 new fractures in vertebrae not adjacent to treated vertebrae. New fractures occurred in vertebrae adjacent to treated vertebrae significantly more frequently than in vertebrae not adjacent to treated vertebrae. Only cement leakage into the disk was a significant predictor of new vertebral body fracture after vertebroplasty (odds ratio = 4.633). None of the following covariates were associated with increased risk of new fracture: age, gender, bone mineral density, the number of vertebroplasty procedures, the number of vertebrae treated per procedure, the cumulative number of vertebrae treated, the presence of a single untreated vertebra between treated vertebrae, the presence of multiple untreated vertebrae between treated vertebrae, the amount of bone cement injected per procedure, the cumulative amount of bone cement injected, cement leakage into the soft tissue around the vertebra, and cement leakage into the vein.

  1. BONE LOSS IN RELATION TO HYPOTHALAMIC ATROPHY IN ALZHEIMER'S DISEASE

    E-Print Network [OSTI]

    Loskutova, Natalia Y.

    2011-05-12T23:59:59.000Z

    considerable burden on the health system, patients, and caregivers. 1.2 Alzheimer’s Disease and Bone Loss Bone health is an important issue in aging and AD. Osteoporosis–related fractures are among the major health and socioeconomic concerns in aging... of bone fractures, and a determining factor in clinical diagnosis of osteoporosis (Ammann and Rizzoli 2003). Several studies in women suggest that low BMD is associated with poorer cognitive function and subsequent cognitive decline (Yaffe, Browner et al...

  2. Effects of toughness anisotropy and combined tension, torsion, and bending loads on fracture behavior of ferritic nuclear pipe

    SciTech Connect (OSTI)

    Mohan, R.; Marshall, C.; Ghadiali, N.; Wilkowski, G. [Battelle, Columbus, OH (United States)

    1997-04-01T23:59:59.000Z

    This paper summarizes work on angled through-wall-crack initiation and combined loading effects on ferritic nuclear pipe performed as part of the Nuclear Regulatory Commission`s research program entitled {open_quotes}Short Cracks In Piping an Piping Welds{close_quotes}. The reader is referred to Reference 1 for details of the experiments and analyses conducted as part of this program. The major impetus for this work stemmed from the observation that initially circumferentially oriented cracks in carbon steel pipes exhibited a high tendency to grow at a different angle when the cracked pipes were subjected to bending or bending plus pressure loads. This failure mode was little understood, and the effect of angled crack grown from an initially circumferential crack raised questions about how cracks in a piping system subjected to combined loading with torsional stresses would behave. There were three major efforts undertaken in this study. The first involved a literature review to assess the causes of toughness anisotropy in ferritic pipes and to develop strength and toughness data as a function of angle from the circumferential plane. The second effort was an attempt to develop a screening criterion based on toughness anisotropy and to compare this screening criterion with experimental pipe fracture data. The third and more significant effort involved finite element analyses to examine why cracks grow at an angle and what is the effect of combined loads with torsional stresses on a circumferentially cracked pipe. These three efforts are summarized.

  3. Development of nondestructive evaluation methods and prediction of effects of flaws on the fracture behavior of structural ceramics

    SciTech Connect (OSTI)

    Ellingson, W.A.; Singh, J.P.; Sivers, E.A. [and others

    1995-04-01T23:59:59.000Z

    Continuous fiber ceramic matrix composites are being developed for turbine engine components, heat exchangers, and hot-gas filters in fossil energy systems. Reliable application requires nondestructive evaluation (NDE) methods that provide data for quality assurance and inputs to life time prediction models and that aid in process development. NDE developments at Argonne have focused on methods to assess density distribution, fiber orientation (for mechanical properties), and defect detection in both SiC/SiC and A1{sub 2}O{sub 3}/A1{sub 2}O{sub 3} materials. and that also assess the chemical state at fiber/matrix interfaces. 2-D cloth lay-up and 3-D weave CVI-infiltrated SiC/SiC specimens were studied by X-ray imaging methods now under development. Microfocus X-ray computerized tomography (MXCT) methods are being developed to provide these data. Multinuclear Nuclear Magnetic Resonance spectroscopy (13C, 29Si, and 11B) is under development for quantizing B content at fiber/matrix interfaces. Magic angle spinning techniques on SiC/SiC specimens with different coating thicknesses showed that quantification of B at the Interface is achievable. NDE data are being coupled to room- and elevated-temperature fracture studies to evaluate effects of fiber orientation and fiber coating thickness on resulting flaw morphology and mechanical properties of Nicalon-fiber-reinforced SiC matrix composites. Specifically, composites with fiber cloth lay-up sequences of varying coating thicknesses were evaluated. For room-temperature mechanical evaluation, composites with carbon-fiber coating thicknesses of 0 and 0.2 {mu}m were used, while elevated-temperature studies used composites with a coating thickness of 0.4 {mu}m. Composites with uncoated fibers failed in a brittle mode, while composites with 0.2 {mu}m fiber coating showed noncatastrophic failure.

  4. Hydraulic Fracturing (Vermont)

    Broader source: Energy.gov [DOE]

    Vermont prohibits hydraulic fracturing or the collection, storage, or treatment of wastewater from hydraulic fracturing

  5. A microstructural study of the extension-to-shear fracture transition in Carrara Marble 

    E-Print Network [OSTI]

    Rodriguez, Erika

    2005-11-01T23:59:59.000Z

    Triaxial extension experiments on Carrara Marble demonstrate that there is a continuous transition from extension to shear fracture on the basis of mechanical behavior, macroscopic fracture orientation and fracture morphology ...

  6. Journal of Biomechanics 41 (2008) 10621068 Nonlinear ultrasound can detect accumulated damage in human bone

    E-Print Network [OSTI]

    2008-01-01T23:59:59.000Z

    due to the fact that osteoporosis and bone fragility are increasingly widespread diseases. Fracture increases exponentially with age, with a significant increase corresponding to the beginning of menopause

  7. Fractured shale reservoirs: Towards a realistic model

    SciTech Connect (OSTI)

    Hamilton-Smith, T. [Applied Earth Science, Lexington, KY (United States)

    1996-09-01T23:59:59.000Z

    Fractured shale reservoirs are fundamentally unconventional, which is to say that their behavior is qualitatively different from reservoirs characterized by intergranular pore space. Attempts to analyze fractured shale reservoirs are essentially misleading. Reliance on such models can have only negative results for fractured shale oil and gas exploration and development. A realistic model of fractured shale reservoirs begins with the history of the shale as a hydrocarbon source rock. Minimum levels of both kerogen concentration and thermal maturity are required for effective hydrocarbon generation. Hydrocarbon generation results in overpressuring of the shale. At some critical level of repressuring, the shale fractures in the ambient stress field. This primary natural fracture system is fundamental to the future behavior of the fractured shale gas reservoir. The fractures facilitate primary migration of oil and gas out of the shale and into the basin. In this process, all connate water is expelled, leaving the fractured shale oil-wet and saturated with oil and gas. What fluids are eventually produced from the fractured shale depends on the consequent structural and geochemical history. As long as the shale remains hot, oil production may be obtained. (e.g. Bakken Shale, Green River Shale). If the shale is significantly cooled, mainly gas will be produced (e.g. Antrim Shale, Ohio Shale, New Albany Shale). Where secondary natural fracture systems are developed and connect the shale to aquifers or to surface recharge, the fractured shale will also produce water (e.g. Antrim Shale, Indiana New Albany Shale).

  8. Osteopontin deficiency increases bone fragility but preserves bone mass Philipp J. Thurner a,b

    E-Print Network [OSTI]

    Ritchie, Robert

    density (BMD) is the most common diagnostic used to assess fracture risk [1,2], yet less than half of non to osteopontin in bone, many of which have the potential to impact material properties. To elucidate the role role for OPN in preventing crack propagation. This significant decline in fracture toughness

  9. I N F I N I T E CONDUCTIVITY FRACTURE NATURALLY FRACTURED RESERVOIR

    E-Print Network [OSTI]

    Stanford University

    I N F I N I T E CONDUCTIVITY FRACTURE I N A NATURALLY FRACTURED RESERVOIR A REPORT SUBMITTED How& #12;ABSTRACT This r e p o r t describes t h e behavior of a n a t u r a l l y fractured r e s e r v o i r when a well is producing a t constant rate through an i n f i n i t e conductivity fracture

  10. Structural Integrity and Fracture, Melbourne, 11-12 July 2013 Assessment of the effect of heterogeneity on failure mechanisms in trabecular

    E-Print Network [OSTI]

    Qin, Qinghua

    , ACT 2601, Australia * Corresponding Author: Yi Xiao (Yi.Xiao@anu.edu.au) Keywords: Osteoporosis, Micro-architecture, Trabecular bone, Heterogeneity, Symmetry axis transfer Abstract Osteoporosis or `porous bones' is the major cause of bone fracture in elderly post-menopausal women. As such, predicting fracture occurrence can

  11. An investigation into the effects of changes in temperature and shear rate upon the viscous behavior of a crosslinked fracture fluid

    E-Print Network [OSTI]

    Nichols, John Edward

    1986-01-01T23:59:59.000Z

    representing typical field situations. One case simulates a high shear rate-low temperature fracture system typical of many shallow reservoirs. The second case models deep reservoir fracture treatment conditions of low shear rates and high tempera- tures... OF RESULTS 33 44 48 Temperature History Effects. High Shear Rate (HSR) and Low Shear Rate (LSR) Fluid Testing Methods and Their Results. 51 CONCLUSIONS RECOMMENDATIONS FOR FUTURE WORK 56 APPENDICES 57 APPENDIX A ? COMPOSITION OF DELAYED...

  12. Relative Permeability of Fractured Rock

    SciTech Connect (OSTI)

    Mark D. Habana

    2002-06-30T23:59:59.000Z

    Contemporary understanding of multiphase flow through fractures is limited. Different studies using synthetic fractures and various fluids have yielded different relative permeability-saturation relations. This study aimed to extend the understanding of multiphase flow by conducting nitrogen-water relative permeability experiments on a naturally-fractured rock from The Geysers geothermal field. The steady-state approach was used. However, steady state was achieved only at the endpoint saturations. Several difficulties were encountered that are attributed to phase interference and changes in fracture aperture and surface roughness, along with fracture propagation/initiation. Absolute permeabilities were determined using nitrogen and water. The permeability values obtained change with the number of load cycles. Determining the absolute permeability of a core is especially important in a fractured rock. The rock may change as asperities are destroyed and fractures propagate or st rain harden as the net stresses vary. Pressure spikes occurred in water a solute permeability experiments. Conceptual models of an elastic fracture network can explain the pressure spike behavior. At the endpoint saturations the water relative permeabilities obtained are much less than the nitrogen gas relative permeabilities. Saturations were determined by weighing and by resistivity calculations. The resistivity-saturation relationship developed for the core gave saturation values that differ by 5% from the value determined by weighing. Further work is required to complete the relative permeability curve. The steady-state experimental approach encountered difficulties due to phase interference and fracture change. Steady state may not be reached until an impractical length of time. Thus, unsteady-state methods should be pursued. In unsteady-state experiments the challenge will be in quantifying rock fracture change in addition to fluid flow changes.

  13. Hydraulic fracturing-1

    SciTech Connect (OSTI)

    Not Available

    1990-01-01T23:59:59.000Z

    This book contains papers on hydraulic fracturing. Topics covered include: An overview of recent advances in hydraulic fracturing technology; Containment of massive hydraulic fracture; and Fracturing with a high-strength proppant.

  14. Fracture, aging and disease in bone

    E-Print Network [OSTI]

    Ager, J.W.; Balooch, G.; Ritchie, R.O.

    2006-01-01T23:59:59.000Z

    on glucocorticoid-induced osteoporosis. Rheumatic DiseaseGlucocorticoid-induced osteoporosis. Endocrinol Metab. Clin.of cortico-steroid osteoporosis. A meta-analysis. Osteoporos

  15. Three dimensional geologic modeling of a fractured reservoir, Saudi Arabia

    SciTech Connect (OSTI)

    Luthy, S.T.; Grover, G.A. [Saudi Aramco, Dhahran (Saudi Arabia)

    1995-11-01T23:59:59.000Z

    A geological assessment of a large carbonate reservoir in Saudi Arabia shows that it is a Type 2 fractured reservoir in which fractures provide the essential permeability. Intercrystalline microporosity, found within the basinally deposited mudstones and wackestones, is the dominant porosity type. Near-vertical, east-west-oriented extension fractures are preferentially localized in low-to-moderate porosities associated with stylolites. Porosity/fracture density relationships, combined with the results of structural curvature mapping, yielded a 3-dimensional model of fracture density. Fracture permeability and fracture porosity distributions were generated by integrating fracture density modeling results with average fracture aperture information derived from well test data. Dramatic differences exist between matrix- and fracture-related porosity, permeability models that help explain observed production behavior within the field. These models are being used by reservoir and simulation engineers for daily reservoir management, history matching, and long-term development drilling planning.

  16. TOUGH+Hydrate v1.0 User's Manual: A Code for the Simulation of System Behavior in Hydrate-Bearing Geologic Media

    E-Print Network [OSTI]

    Moridis, George

    2008-01-01T23:59:59.000Z

    Behavior of Naturally Fractured Reservoirs, Soc. Pet. Eng.Flow Simulations in Fractured Reservoirs, Lawrence BerkeleyFor any given fractured reservoir flow problem, selection of

  17. Numerical Investigation of Interaction Between Hydraulic Fractures and Natural Fractures

    E-Print Network [OSTI]

    Xue, Wenxu

    2011-02-22T23:59:59.000Z

    Hydraulic fracturing of a naturally-fractured reservoir is a challenge for industry, as fractures can have complex growth patterns when propagating in systems of natural fractures in the reservoir. Fracture propagation near a natural fracture (NF...

  18. On equivalence of thinning fluids used for hydraulic fracturing

    E-Print Network [OSTI]

    Linkov, Alexander

    2012-01-01T23:59:59.000Z

    The paper aims to answer the question: if and how non-Newtonian fluids may be compared in their mechanical action when used for hydraulic fracturing? By employing the modified formulation of the PKN problem we obtain its simple analytical solutions in the cases of perfectly plastic and Newtonian fluids. Since the results for shear thinning fluids are intermediate between those for these cases, the obtained equation for the fracture length suggests a criterion of the equivalence of various shear thinning fluids for the problem of hydraulic fractures. We assume fluids equivalent in their hydrofracturing action, when at a reference time they produce fractures of the same length. The equation for the fracture length translates the equivalence in terms of the hydraulic fracture length and treatment time into the equivalence in terms of the properties of a fracturing fluid (behavior and consistency indices). Analysis shows that the influence of the consistency and behavior indices on the fracture length, particle v...

  19. FRACTURE TOUGHNESS VARIABILITY IN F82H

    SciTech Connect (OSTI)

    Gelles, David S.; Sokolov, M.

    2003-09-03T23:59:59.000Z

    The fracture toughness database for F82H displays some anomalous behavior. Metallographic examination reveals banding in the center of 25 mm thick F82H plate, which is more evident in transverse section. The banding is shown to arise because some grains are etched on a very fine scale whereas the remainder is etched more strongly and better delineates the martensite lath structure. However, the banding found does not provide explanation for the anomalous fracture toughness behavior.

  20. Therapeutic Agents for the Prevention and Restoration of Bone Mass

    E-Print Network [OSTI]

    Slatton, Clint

    osteoporosis-related bone loss. According to the National Osteoporosis Foundation, osteoporosis is a major osteoporosis Advantages · Selectively blocks osteoclastic bone resorption by a novel mechanism, providing in post-menopausal women. This ultimately leads to fractures resulting from minimal falls and accidents

  1. Fracture Properties From Seismic Scattering

    E-Print Network [OSTI]

    Burns, Daniel R.

    2007-01-01T23:59:59.000Z

    Fractures scatter seismic energy and this energy can be analyzed to provide information about fracture

  2. Seismic characterization of fractures

    E-Print Network [OSTI]

    JM Carcione

    2014-06-07T23:59:59.000Z

    Seismic characterization of fractures. José M. Carcione, OGS, Italy. Fractured geological formations are generally represented with a stress-strain relation.

  3. OVERBURDEN PRESSURE AFFECTS FRACTURE APERTURE

    E-Print Network [OSTI]

    Schechter, David S.

    OVERBURDEN PRESSURE AFFECTS FRACTURE APERTURE AND FRACTURE PERMEABILITY IN A FRACTURED RESERVOIR are in integrated reservoir study, reservoir charac- terization, naturally fractured reservoirs, waterflooding in Hydraulically and Naturally Fractured Reservoirs." His research areas include experimental analysis

  4. Investigation of the effect of gel residue on hydraulic fracture conductivity using dynamic fracture conductivity test

    E-Print Network [OSTI]

    Marpaung, Fivman

    2009-05-15T23:59:59.000Z

    ) ............................................................................ 51 Figure B.9: Fracture Conductivity Behavior (Polymer Concentration = 50 lb/Mgal and Gas Rate = 0.5 slm) ............................................................................ 52 Figure B.10: Fracture Conductivity Behavior (Polymer... documented in API RP-61 (1989). The recommended conditions and procedure for the test includes loading a known proppant concentration (generally 2 lb/ft2) uniformly between two steel pistons at ambient temperature, maintaining closure stress for 15 minutes...

  5. Thermo-Poroelastic Fracture Propagation Modeling with Displacement Discontinuity Boundary Element Method

    E-Print Network [OSTI]

    Chun, Kwang Hee

    2013-08-01T23:59:59.000Z

    The effect of coupled thermo-poroelastic behavior on hydraulic fracture propagation is of much interest in geothermal- and petroleum-related geomechanics problems such as wellbore stability and hydraulic fracturing as pore pressure and temperature...

  6. Fracture characterization of clays and clay-like materials using flattened Brazilian Test

    E-Print Network [OSTI]

    Agaiby, Shehab Sherif Wissa

    2013-01-01T23:59:59.000Z

    Fracture mechanics has been used for many years to study the mechanical behavior of brittle and quasi-brittle materials like concrete, rock, wood, and ceramics. To date, the application of fracture mechanics to soils has ...

  7. "Taking a break" from bisphosphonates: Is it appropriate? http://ryortho.com/largeJoints.php?news=741_Bisphosphonates-and-Unusual-Femur-Fractures

    E-Print Network [OSTI]

    Pillow, Jonathan

    INFORMATION I. Epidemiology1-2 a. 10 million Americans have osteoporosis b. 33.6 million have low bone density of the hip c. 1 out of 2 Caucasian women and 1 out of 5 Caucasian men will experience an osteoporosis-related fracture d. Majority of fractures occur in low bone mass rather than osteoporosis e. More than 4 million

  8. Multiwell experiment: Fracturing experiments

    SciTech Connect (OSTI)

    Warpinski, N.R.; Sattler, A.R.; Branagan, P.T.; Cipolla, C.

    1987-01-01T23:59:59.000Z

    Because of the complexity of the stimulation, no conventional analyses were useful, so we decided to concentrate on the minifrac to provide important fracture parameters. The minifrac was conducted in an identical manner to the pressure-up and pad stages of the stimulation. Figure 1 shows two initial pressure-history match calculations that were performed to model the minifrac. We found that the pressure behavior could not be matched with any normal behavior. Examining the field pressure data, we see that the interesting feature is the sudden flattening in the pressure at a level 1050 psi above the closure stress during pumping and the rapid drop to this same level at shut-in, after which the pressure decreases much more slowly. We first tried to match this behavior using enhanced height growth. While height growth can flatten the pressure during pumping, it also causes a very slow pressure decline at shut-in. We also tried additional leakoff height as height grew, but this could not flatten the pressure as much as needed. Finally, we tried an accelerated leakoff condition above 1050 psi. We did this by increasing the leakoff coefficient by a constant factor above some threshold value. To keep the results smooth and code convergent, we actually linearly phased in the increased leakoff between 1000 and 1100 psi. The final result of these calculations is shown in Figure 2; a factor of 50 increase in the leakoff coefficient was required to match the data for pressures above 1050 psi.

  9. Fracture-Flow-Enhanced Solute Diffusion into Fractured Rock

    E-Print Network [OSTI]

    Wu, Yu-Shu; Ye, Ming; Sudicky, E.A.

    2008-01-01T23:59:59.000Z

    of Naturally Fractured Reservoirs, Society of Petroleumresources from fractured reservoirs (e.g. , Warren and Root,Reservoir Engineering Stanford University, Stanford, California, January 28-30, 2008 SGP-TR-185 FRACTURE-FLOW-ENHANCED SOLUTE DIFFUSION INTO FRACTURED

  10. Contrasting Effects of Vasculogenic Induction Upon Biaxial Bioreactor Stimulation of Mesenchymal Stem Cells and Endothelial Progenitor Cells Cocultures in Three-Dimensional Scaffolds under in Vitro and in Vivo Paradigms for Vascularized Bone Tissue Engineering

    E-Print Network [OSTI]

    Liu, Yuchun

    Clinical translation of bone tissue engineering approaches for fracture repair has been hampered by inadequate vascularization required for maintaining cell survival, skeletal regeneration, and remodeling. The potential ...

  11. Contrasting Effects of Vasculogenic Induction Upon Biaxial Bioreactor Stimulation of Mesenchymal Stem Cells and Endothelial Progenitor Cells Cocultures in Three-Dimensional Scaffolds Under In Vitro and In Vivo Paradigms for Vascularized Bone Tissue Engineering

    E-Print Network [OSTI]

    Teoh, Swee-Hin

    Clinical translation of bone tissue engineering approaches for fracture repair has been hampered by inadequate vascularization required for maintaining cell survival, skeletal regeneration, and remodeling. The potential ...

  12. Characterization of fracture networks for fluid flow analysis

    SciTech Connect (OSTI)

    Long, J.C.S.; Billaux, D.; Hestir, K.; Majer, E.L.; Peterson, J.; Karasaki, K.; Nihei, K.; Gentier, S.; Cox, L.

    1989-06-01T23:59:59.000Z

    The analysis of fluid flow through fractured rocks is difficult because the only way to assign hydraulic parameters to fractures is to perform hydraulic tests. However, the interpretation of such tests, or ''inversion'' of the data, requires at least that we know the geometric pattern formed by the fractures. Combining a statistical approach with geophysical data may be extremely helpful in defining the fracture geometry. Cross-hole geophysics, either seismic or radar, can provide tomograms which are pixel maps of the velocity or attenuation anomalies in the rock. These anomalies are often due to fracture zones. Therefore, tomograms can be used to identify fracture zones and provide information about the structure within the fracture zones. This structural information can be used as the basis for simulating the degree of fracturing within the zones. Well tests can then be used to further refine the model. Because the fracture network is only partially connected, the resulting geometry of the flow paths may have fractal properties. We are studying the behavior of well tests under such geometry. Through understanding of this behavior, it may be possible to use inverse techniques to refine the a priori assignment of fractures and their conductances such that we obtain the best fit to a series of well test results simultaneously. The methodology described here is under development and currently being applied to several field sites. 4 refs., 14 figs.

  13. High velocity impact fracture

    E-Print Network [OSTI]

    Teng, Xiaoqing

    2005-01-01T23:59:59.000Z

    An in-depth understanding of dynamic ductile fracture is one of the most important steps to improve the survivability of critical structures such as the lost Twin Towers. In the present thesis, the macroscopic fracture ...

  14. The Political History of Hydraulic Fracturing’s Expansion Across the West

    E-Print Network [OSTI]

    Forbis, Robert E.

    2014-01-01T23:59:59.000Z

    Political History of Hydraulic Fracturing’s Expansion AcrossPolitical History of Hydraulic Fracturing’s Expansion Acrosss use of the hydraulic fracturing development process.

  15. 3.3 NUMERICAL MODELING OF SOLID DEFORMATION AND STRESS-DEPENDENT PERMEABILITY IN NATURALLY FRACTURED

    E-Print Network [OSTI]

    Schechter, David S.

    permeability. When the pore pressure depletes due to oil/gas production rates in highly stress FRACTURED RESERVOIRS During the first year of this project, we analyzed the productivity behavior was demonstrated. 3.3.1 Introduction Fractures are the main fluid flow paths in naturally fractured reservoirs

  16. IPIRG programs - advances in pipe fracture technology

    SciTech Connect (OSTI)

    Wilkowski, G.; Olson, R.; Scott, P. [Batelle, Columbus, OH (United States)

    1997-04-01T23:59:59.000Z

    This paper presents an overview of the advances made in fracture control technology as a result of the research performed in the International Piping Integrity Research Group (IPIRG) program. The findings from numerous experiments and supporting analyses conducted to investigate the behavior of circumferentially flawed piping and pipe systems subjected to high-rate loading typical of seismic events are summarized. Topics to be discussed include; (1) Seismic loading effects on material properties, (2) Piping system behavior under seismic loads, (3) Advances in elbow fracture evaluations, and (4) {open_quotes}Real{close_quotes} piping system response. The presentation for each topic will be illustrated with data and analytical results. In each case, the state-of-the-art in fracture mechanics prior to the first IPIRG program will be contrasted with the state-of-the-art at the completion of the IPIRG-2 program.

  17. High-speed photography of compressed human trabecular bone correlates whitening to microscopic damage

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    of trabecular bone is mainly motivated by the huge impact of osteoporosis in post-menopausal women and the aged is mainly motivated by the reduction of bone strength due to osteoporosis, a systemic skeletal disease [10.elsevier.com/locate/engfracmech #12;comes with a concomitant increase of fracture risk. Post-menopausal women and the elderly

  18. Self-potential observations during hydraulic fracturing

    E-Print Network [OSTI]

    Moore, Jeffrey R.; Glaser, Steven D.

    2008-01-01T23:59:59.000Z

    potential measurements during hydraulic fracturing of BunterMonitoring during hydraulic fracturing using the TG-2 well,fracture processes in hydraulic fracturing, Quarterly Report

  19. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-01-01T23:59:59.000Z

    The present invention relates to the electrical treatment of biological tissue. In particular, the present invention discloses a device that produces discrete electrical pulse trains for treating osteoporosis and accelerating bone growth. According to its major aspects and broadly stated, the present invention consists of an electrical circuit configuration capable of generating Bassett-type waveforms shown with alternative signals provide for the treatment of either fractured bones or osteoporosis. The signal generator comprises a quartz clock, an oscillator circuit, a binary divider chain, and a plurality of simple, digital logic gates. Signals are delivered efficiently, with little or no distortion, and uniformly distributed throughout the area of injury. Perferably, power is furnished by widely available and inexpensive radio batteries, needing replacement only once in several days. The present invention can be affixed to a medical cast without a great increase in either weight or bulk. Also, the disclosed stimulator can be used to treat osteoporosis or to strengthen a healing bone after the cast has been removed by attaching the device to the patient`s skin or clothing.

  20. Invest in Your Bones Osteoporosis--The Silent Disease

    E-Print Network [OSTI]

    Invest in Your Bones Osteoporosis--The Silent Disease Leaflet 2 Osteoporosis, a painful of State Health Services, 2008). Osteoporosis is preventable and/or treatable. Accordingly, osteoporosis of height, and chronic back pain. Hip fracture, the most serious consequence of osteoporosis, threatens one

  1. The effects of eccentric training on muscle-bone function 

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    , mechanical testing at this site showed greater tibiae stiffness in the exercised bone than that of the OVX group (+28.5%). No significant differences were found in tibial ultimate load to fracture, ultimate strength or modulus of elasticity. In summary...

  2. Poroelastic response of orthotropic fractured porous media

    SciTech Connect (OSTI)

    Berryman, J.G.

    2010-12-01T23:59:59.000Z

    An algorithm is presented for inverting either laboratory or field poroelastic data for all the drained constants of an anisotropic (specifically orthotropic) fractured poroelastic system. While fractures normally weaken the system by increasing the mechanical compliance, any liquids present in these fractures are expected to increase the stiffness somewhat, thus negating to some extent the mechanical weakening influence of the fractures themselves. The analysis presented quantifies these effects and shows that the key physical variable needed to account for the pore-fluid effects is a factor of (1 - B), where B is Skempton's second coe#14;fficient and satisfies 0 {<=} #20; B < 1. This scalar factor uniformly reduces the increase in compliance due to the presence of communicating fractures, thereby stiffening the fractured composite medium by a predictable amount. One further goal of the discussion is to determine how many of the poroelastic constants need to be known by other means in order to determine the rest from remote measurements, such as seismic wave propagation data in the field. Quantitative examples arising in the analysis show that, if the fracture aspect ratio a{sub f} ~ 0.1 and the pore fluid is liquid water, then for several cases considered Skempton's B ~ 0:9, so the stiffening effect of the pore-liquid reduces the change in compliance due to the fractures by a factor 1-B ~ 0.1, in these examples. The results do however depend on the actual moduli of the unfractured elastic material, as well as on the pore-liquid bulk modulus, so these quantitative predictions are just examples, and should not be treated as universal results. Attention is also given to two previously unremarked poroelastic identities, both being useful variants of Gassmann's equations for homogeneous -- but anisotropic -- poroelasticity. Relationships to Skempton's analysis of saturated soils are also noted. The paper concludes with a discussion of alternative methods of analyzing and quantifying fluid-substitution behavior in poroelastic systems, especially for those systems having heterogeneous constitution.

  3. Simulation of Hydraulic Fractures and their Interactions with Natural Fractures

    E-Print Network [OSTI]

    Sesetty, Varahanaresh

    2012-10-19T23:59:59.000Z

    Modeling the stimulated reservoir volume during hydraulic fracturing is important to geothermal and petroleum reservoir stimulation. The interaction between a hydraulic fracture and pre-existing natural fractures exerts significant control...

  4. Simulating the Effect of Water on the Fracture System of Shale Gas Wells 

    E-Print Network [OSTI]

    Hamam, Hassan Hasan H.

    2011-10-21T23:59:59.000Z

    It was observed that many hydraulically fractured horizontal shale gas wells exhibit transient linear flow behavior. A half-slope on a type curve represents this transient linear flow behavior. Shale gas wells show a significant skin effect which...

  5. Fracture Toughness Prediction for MWCNT Reinforced Ceramics

    SciTech Connect (OSTI)

    Henager, Charles H.; Nguyen, Ba Nghiep

    2013-09-01T23:59:59.000Z

    This report describes the development of a micromechanics model to predict fracture toughness of multiwall carbon nanotube (MWCNT) reinforced ceramic composites to guide future experimental work for this project. The modeling work described in this report includes (i) prediction of elastic properties, (ii) development of a mechanistic damage model accounting for matrix cracking to predict the composite nonlinear stress/strain response to tensile loading to failure, and (iii) application of this damage model in a modified boundary layer (MBL) analysis using ABAQUS to predict fracture toughness and crack resistance behavior (R-curves) for ceramic materials containing MWCNTs at various volume fractions.

  6. TEMPORAL VARIATIONS OF FRACTURE DIRECTIONS AND FRACTURE DENSITIES...

    Open Energy Info (EERE)

    OF SHEAR-WAVE SPLITTING Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Proceedings: TEMPORAL VARIATIONS OF FRACTURE DIRECTIONS AND FRACTURE...

  7. Evaluation of the relationship between fracture conductivity, fracture fluid production, and effective fracture length

    E-Print Network [OSTI]

    Lolon, Elyezer P.

    2006-04-12T23:59:59.000Z

    Low-permeability gas wells often produce less than predicted after a fracture treatment. One of the reasons for this is that fracture lengths calculated after stimulation are often less than designed lengths. While actual fracture lengths may...

  8. Evaluation of the relationship between fracture conductivity, fracture fluid production, and effective fracture length 

    E-Print Network [OSTI]

    Lolon, Elyezer P.

    2006-04-12T23:59:59.000Z

    Low-permeability gas wells often produce less than predicted after a fracture treatment. One of the reasons for this is that fracture lengths calculated after stimulation are often less than designed lengths. While actual fracture lengths may...

  9. Peri-prosthetic fracture vibration testing

    SciTech Connect (OSTI)

    Cruce, Jesse R [Los Alamos National Laboratory; Erwin, Jenny R [Los Alamos National Laboratory; Remick, Kevin R [Los Alamos National Laboratory; Cornwell, Phillip J [Los Alamos National Laboratory; Menegini, R. Michael [INDIANA UNIV.; Racanelli, Joe [STRYKER ORTHOPAEDICS

    2011-01-28T23:59:59.000Z

    The purpose of this study is to establish a test setup and vibration analysis method to predict femoral stem seating and prevent bone fracture using accelerometer or force response data from an instrument stem and impactor. This study builds upon earlier studies to identify a means to supplement a surgeon's tactile and auditory senses by using damage identification techniques normally used for civil and mechanical structures. Testing will be conducted using foam cortical shell sawbones prepared for stems of different geometries. Each stem will be instrumented with an accelerometer. Two impactor designs will be compared: a monolithic impactor with an integrated load cell and accelerometer and a two piece impactor. Acceleration and force measurements will be taken in the direction of impaction. Signal processing techniques will be applied to the acceleration time histories to determine features that can be used to assess device seating and potential fracture. A consistent energy input will be applied using a drop tower. The effect of introducing compliance under the bone support vise will also be investigated. The ultimate goal of this study is to design an integrated portable data acquisition system capable of being used in future cadaveric testing. This paper will discuss the experimental set-up, the signal processing techniques used and the subsequent results.

  10. INVEST IN YOUR BONES Bone Basics

    E-Print Network [OSTI]

    replace- ment at menopause may prevent bone loss and/or osteoporosis. Also find out if there is a need in your bones? Osteoporosis, a major health problem in America, affects over 10 million persons, with 34 million at a high risk of developing the disease (National Osteoporosis Foundation, 2010). Dubbed

  11. Self-potential observations during hydraulic fracturing

    E-Print Network [OSTI]

    Moore, J R; Glaser, Steven D

    2007-01-01T23:59:59.000Z

    potential measurements during hydraulic fracturing of BunterSP response during hydraulic fracturing. Citation: Moore, J.observations during hydraulic fracturing, J. Geophys. Res. ,

  12. Can a fractured caprock self-heal?

    E-Print Network [OSTI]

    Elkhoury, JE; Elkhoury, JE; Detwiler, RL; Ameli, P

    2015-01-01T23:59:59.000Z

    characterization of fractured reservoirs. J. Geophys. Eng.fractured carbonates caused by flow of CO 2 -rich brine under reservoirreservoirs. We present results from two experiments in fractured

  13. Development of a clinically relevant strategy to promote fracture healing in an atrophic non-union model using mesenchymal stem cells 

    E-Print Network [OSTI]

    Tawonsawatruk, Tulyapruek

    2014-07-05T23:59:59.000Z

    Atrophic non-union is a major complication following fracture of a bone. It represents a biological failure of the fracture healing process and occurs in 5-10% of cases. A number of factors predispose to atrophic non-union ...

  14. On the fracture toughness of advanced materials

    SciTech Connect (OSTI)

    Launey, Maximilien E.; Ritchie, Robert O.

    2008-11-24T23:59:59.000Z

    Few engineering materials are limited by their strength; rather they are limited by their resistance to fracture or fracture toughness. It is not by accident that most critical structures, such as bridges, ships, nuclear pressure vessels and so forth, are manufactured from materials that are comparatively low in strength but high in toughness. Indeed, in many classes of materials, strength and toughness are almost mutually exclusive. In the first instance, such resistance to fracture is a function of bonding and crystal structure (or lack thereof), but can be developed through the design of appropriate nano/microstructures. However, the creation of tough microstructures in structural materials, i.e., metals, polymers, ceramics and their composites, is invariably a compromise between resistance to intrinsic damage mechanisms ahead of the tip of a crack (intrinsic toughening) and the formation of crack-tip shielding mechanisms which principally act behind the tip to reduce the effective 'crack-driving force' (extrinsic toughening). Intrinsic toughening is essentially an inherent property of a specific microstructure; it is the dominant form of toughening in ductile (e.g., metallic) materials. However, for most brittle (e.g., ceramic) solids, and this includes many biological materials, it is largely ineffective and toughening conversely must be developed extrinsically, by such shielding mechanisms as crack bridging. From a fracture mechanics perspective, this results in toughening in the form of rising resistance-curve behavior where the fracture resistance actually increases with crack extension. The implication of this is that in many biological and high-strength advanced materials, toughness is developed primarily during crack growth and not for crack initiation. This is an important realization yet is still rarely reflected in the way that toughness is measured, which is invariably involves the use of single-value (crack-initiation) parameters such as the fracture toughness K{sub Ic}.

  15. Dual-porosity reservoir modeling of the fractured Hanifa reservoir, Abqaiq Field, Saudi Arabia

    SciTech Connect (OSTI)

    Luthy, S.T. [Saudi Aramco, Dhahran (Saudi Arabia)

    1996-12-31T23:59:59.000Z

    Fractures play a significant role in the transmissibility of the Hanifa reservoir at Abqaiq Field. The Hanifa is a Type 2 fractured reservoir characterized by a finely-crystalline carbonate matrix which contains most of the reservoir storage porosity, and a stylolitic fracture system which provides essential permeability. Comparisons of over 5000 fractures identified from core and borehole image data with open-hole log data showed that porosity is negatively correlated with fracture density and mechanical rock strength. From these relationships, it was possible to utilize additional wells where porosity log data was available to calculate fracture densities. These wells were used to generate matrix porosity and permeability as well as fracture density attributes in a 12-sequence, 29-layer geocellular model. The effect of structural curvature on fracture intensity in the reservoir was estimated by mapping the derivative of structural dip. Incorporation of structural curvature explained variations in well test behavior not predicted by initial estimates of fracture density from porosity alone. Resultant fracture permeabilities compared favorably with well-test derived productivity indices. Three-dimensional visualization of model attributes showed that a monotonous and low (<10 md) distribution of matrix-related permeability contrasts sharply with highly variable and relatively high (>50 md) permeabilities of the fracture system. Reliability of the geocellular model to predict fracture densities and associated permeabilities has been confirmed by subsequent drilling of high cost horizontal wells, and is being used in reservoir engineering and development drilling planning efforts.

  16. Dual-porosity reservoir modeling of the fractured Hanifa reservoir, Abqaiq Field, Saudi Arabia

    SciTech Connect (OSTI)

    Luthy, S.T. (Saudi Aramco, Dhahran (Saudi Arabia))

    1996-01-01T23:59:59.000Z

    Fractures play a significant role in the transmissibility of the Hanifa reservoir at Abqaiq Field. The Hanifa is a Type 2 fractured reservoir characterized by a finely-crystalline carbonate matrix which contains most of the reservoir storage porosity, and a stylolitic fracture system which provides essential permeability. Comparisons of over 5000 fractures identified from core and borehole image data with open-hole log data showed that porosity is negatively correlated with fracture density and mechanical rock strength. From these relationships, it was possible to utilize additional wells where porosity log data was available to calculate fracture densities. These wells were used to generate matrix porosity and permeability as well as fracture density attributes in a 12-sequence, 29-layer geocellular model. The effect of structural curvature on fracture intensity in the reservoir was estimated by mapping the derivative of structural dip. Incorporation of structural curvature explained variations in well test behavior not predicted by initial estimates of fracture density from porosity alone. Resultant fracture permeabilities compared favorably with well-test derived productivity indices. Three-dimensional visualization of model attributes showed that a monotonous and low (<10 md) distribution of matrix-related permeability contrasts sharply with highly variable and relatively high (>50 md) permeabilities of the fracture system. Reliability of the geocellular model to predict fracture densities and associated permeabilities has been confirmed by subsequent drilling of high cost horizontal wells, and is being used in reservoir engineering and development drilling planning efforts.

  17. Development of Reservoir Characterization Techniques and Production Models for Exploiting Naturally Fractured Reservoirs

    SciTech Connect (OSTI)

    Wiggins, Michael L; Brown, Raymon L.; Civan, Faruk; Hughes, Richard G.

    2002-10-08T23:59:59.000Z

    During this reporting period, research was continued on characterizing and modeling the behavior of naturally fractured reservoir systems. This report proposed a model to relate the seismic response to production data to determine crack spacing and aperture, provided details of tests of proposed models to obtain fracture properties from conventional well logs with actual field data, and verification of the naturally fractured reservoir simulator developed in this project.

  18. Investigation of Created Fracture Geometry through Hydraulic Fracture Treatment Analysis

    E-Print Network [OSTI]

    Ahmed, Ibraheem 1987-

    2012-11-30T23:59:59.000Z

    Successful development of shale gas reservoirs is highly dependent on hydraulic fracture treatments. Many questions remain in regards to the geometry of the created fractures. Production data analysis from some shale gas wells quantifies a much...

  19. Multiple-point statistical prediction on fracture networks at Yucca Mountain

    SciTech Connect (OSTI)

    Liu, X.Y; Zhang, C.Y.; Liu, Q.S.; Birkholzer, J.T.

    2009-05-01T23:59:59.000Z

    In many underground nuclear waste repository systems, such as at Yucca Mountain, water flow rate and amount of water seepage into the waste emplacement drifts are mainly determined by hydrological properties of fracture network in the surrounding rock mass. Natural fracture network system is not easy to describe, especially with respect to its connectivity which is critically important for simulating the water flow field. In this paper, we introduced a new method for fracture network description and prediction, termed multi-point-statistics (MPS). The process of the MPS method is to record multiple-point statistics concerning the connectivity patterns of a fracture network from a known fracture map, and to reproduce multiple-scale training fracture patterns in a stochastic manner, implicitly and directly. It is applied to fracture data to study flow field behavior at the Yucca Mountain waste repository system. First, the MPS method is used to create a fracture network with an original fracture training image from Yucca Mountain dataset. After we adopt a harmonic and arithmetic average method to upscale the permeability to a coarse grid, THM simulation is carried out to study near-field water flow in the surrounding waste emplacement drifts. Our study shows that connectivity or patterns of fracture networks can be grasped and reconstructed by MPS methods. In theory, it will lead to better prediction of fracture system characteristics and flow behavior. Meanwhile, we can obtain variance from flow field, which gives us a way to quantify model uncertainty even in complicated coupled THM simulations. It indicates that MPS can potentially characterize and reconstruct natural fracture networks in a fractured rock mass with advantages of quantifying connectivity of fracture system and its simulation uncertainty simultaneously.

  20. Reservoir fracture characterizations from seismic scattered waves

    E-Print Network [OSTI]

    Fang, Xinding

    2012-01-01T23:59:59.000Z

    The measurements of fracture parameters, such as fracture orientation, fracture density and fracture compliance, in a reservoir is very important for field development and exploration. Traditional seismic methods for ...

  1. Fracture induced anisotropy in viscoelastic media

    E-Print Network [OSTI]

    santos,,,

    ... seismology and mining. Fractures constitute the sources of earthquakes, and hydrocarbon and geothermal reservoirs are mainly composed of fractured rocks.

  2. Seismic Fracture Characterization Methods for Enhanced Geothermal...

    Broader source: Energy.gov (indexed) [DOE]

    Seismic Fracture Characterization Methods for Enhanced Geothermal Systems Seismic Fracture Characterization Methods for Enhanced Geothermal Systems Project objective: Make Seismic...

  3. Seismic Fracture Characterization Methods for Enhanced Geothermal...

    Broader source: Energy.gov (indexed) [DOE]

    Seismic Fracture Characterization Methods for Enhanced Geothermal Systems; 2010 Geothermal Technology Program Peer Review Report Seismic Fracture Characterization Methods for...

  4. Fracture prediction in metal sheets

    E-Print Network [OSTI]

    Lee, Young-Woong

    2005-01-01T23:59:59.000Z

    One of the most important failure modes of thin-walled structures is fracture. Fracture is predominantly tensile in nature and, in most part, is operated by the physical mechanisms of void nucleation, growth, and linkage. ...

  5. Seismic waves in rocks with fluids and fractures

    SciTech Connect (OSTI)

    Berryman, J.G.

    2007-05-14T23:59:59.000Z

    Seismic wave propagation through the earth is often stronglyaffected by the presence of fractures. When these fractures are filledwith fluids (oil, gas, water, CO2, etc.), the type and state of the fluid(liquid or gas) can make a large difference in the response of theseismic waves. This paper summarizes recent work on methods ofdeconstructing the effects of fractures, and any fluids within thesefractures, on seismic wave propagation as observed in reflection seismicdata. One method explored here is Thomsen's weak anisotropy approximationfor wave moveout (since fractures often induce elastic anisotropy due tononuniform crack-orientation statistics). Another method makes use ofsome very convenient fracture parameters introduced previously thatpermit a relatively simple deconstruction of the elastic and wavepropagation behavior in terms of a small number of fracture parameters(whenever this is appropriate, as is certainly the case for small crackdensities). Then, the quantitative effects of fluids on thesecrack-influence parameters are shown to be directly related to Skempton scoefficient B of undrained poroelasticity (where B typically ranges from0 to 1). In particular, the rigorous result obtained for the low crackdensity limit is that the crack-influence parameters are multiplied by afactor (1 ? B) for undrained systems. It is also shown how fractureanisotropy affects Rayleigh wave speed, and how measured Rayleigh wavespeeds can be used to infer shear wave speed of the fractured medium.Higher crack density results are also presented by incorporating recentsimulation data on such cracked systems.

  6. Effects of hyperparathyroidism and calcium on bone healing

    E-Print Network [OSTI]

    Hubbard, Gene Borden

    1975-01-01T23:59:59.000Z

    lesions, blood chemistry data and microscopic examination of bone, The citations on the following pages follow the style of the Sutrnaf. 0$ She. Amuck'. can Vetenanacq Medx. caf. Ass acL aX&0n. CHAPTER II LITERATURE REVIEW Trauma has traditionally...- parathyroidism; however, lameness disappeared in horses fed a standard ration containing 0. 52; calcium and 0. 45+ phosphorus. The case history of a man with hyperparathyroidism in which the main clinical feature was multiple nonuniting 7 fractures has been...

  7. Multiporosity Flow in Fractured Low-Permeability Rocks

    E-Print Network [OSTI]

    Kuhlman, Kristopher L; Heath, Jason E

    2015-01-01T23:59:59.000Z

    A multiporosity extension of classical double and triple porosity fractured rock flow models for slightly compressible fluids is presented. The multiporosity model is an adaptation of the multirate solute transport model of Haggerty and Gorelick (1995) to viscous flow in fractured rock reservoirs. It is a generalization of both pseudo-steady-state and transient interporosity flow double porosity models. The model includes a fracture continuum and an overlapping distribution of multiple rock matrix continua, whose fracture-matrix exchange coefficients are specified through a discrete probability mass function. Semi-analytical cylindrically symmetric solutions to the multiporosity mathematical model are developed using the Laplace transform to illustrate its behavior. The multiporosity model presented here is conceptually simple, yet flexible enough to simulate common conceptualizations of double and triple porosity flow. This combination of generality and simplicity makes the multiporosity model a good choice ...

  8. Hydromechanical modeling of pulse tests that measure both fluid pressure and fracture-normal displacement of the Coaraze Laboratory site, France

    E-Print Network [OSTI]

    Cappa, F.; Guglielmi, Y.; Rutqvist, J.; Tsang, C-F.; Thoraval, A.

    2006-01-01T23:59:59.000Z

    Coupled stress-flow properties of rock joints from hydraulicthe fractures and rock matrix properties, as well as the 3DRock: Mechanical, Hydraulic and Seismic Behavior and Properties

  9. A physically based numerical approach for modeling fracture-matrix interaction in fractured reservoirs

    E-Print Network [OSTI]

    Wu, Yu-Shu; Pruess, Karsten

    2004-01-01T23:59:59.000Z

    of naturally fractured reservoirs with uniform fracturefor naturally fractured reservoirs, SPE-11688, Presented atflow simulations in fractured reservoirs, Report LBL- 15227,

  10. A Semi-Analytic Solution for Flow in Finite-Conductivity Vertical Fractures Using Fractal Theory

    E-Print Network [OSTI]

    Cossio Santizo, Manuel

    2012-10-19T23:59:59.000Z

    in ultra-tight reservoirs, answers are presently being sought. Fractal theory has been successfully applied to pressure transient testing, albeit with an emphasis on the effects of natural fractures in pressure-rate behavior. In this work, we begin...

  11. Numerical Modeling of Fractured Shale-Gas and Tight-Gas Reservoirs Using Unstructured Grids

    E-Print Network [OSTI]

    Olorode, Olufemi Morounfopefoluwa

    2012-02-14T23:59:59.000Z

    Various models featuring horizontal wells with multiple induced fractures have been proposed to characterize flow behavior over time in tight gas and shale gas systems. Currently, there is little consensus regarding the effects of non...

  12. Joint flow-seismic inversion for characterizing fractured reservoirs: theoretical approach and numerical modeling

    E-Print Network [OSTI]

    Kang, Peter K.

    2013-01-01T23:59:59.000Z

    Traditionally, seismic interpretation is performed without any account of the flow behavior. Here, we present a methodology to characterize fractured geologic media by integrating flow and seismic data. The key element of ...

  13. Fracture mechanics analysis on the resistance of welded details under variable amplitude long life loading 

    E-Print Network [OSTI]

    Zhou, Minjian

    1993-01-01T23:59:59.000Z

    Fracture mechanics approach has been used to analyze the behavior of fatigue resistance of welded details existing in highway steel bridges under variable amplitude long life loading which means most of the stress ranges will be below constant...

  14. Evaluation and Effect of Fracturing Fluids on Fracture Conductivity in Tight Gas Reservoirs Using Dynamic Fracture Conductivity Test 

    E-Print Network [OSTI]

    Correa Castro, Juan

    2011-08-08T23:59:59.000Z

    EVALUATION AND EFFECT OF FRACTURING FLUIDS ON FRACTURE CONDUCTIVITY IN TIGHT GAS RESERVOIRS USING DYNAMIC FRACTURE CONDUCTIVITY TEST A Thesis by JUAN CARLOS CORREA CASTRO Submitted to the Office of Graduate Studies of Texas A... in Tight Gas Reservoirs Using Dynamic Fracture Conductivity Test Copyright 2011 Juan Carlos Correa Castro EVALUATION AND EFFECT OF FRACTURING FLUIDS ON FRACTURE CONDUCTIVITY IN TIGHT GAS RESERVOIRS USING DYNAMIC FRACTURE CONDUCTIVITY TEST A...

  15. Crack Propagation in Bone on the Scale of Mineralized Collagen Fibrils : Role of Polymers with Sacrificial Bonds and Hidden Length

    E-Print Network [OSTI]

    Wenyi Wang; Ahmed Elbanna

    2014-08-04T23:59:59.000Z

    Sacrificial bonds and hidden length (SBHL) in structural molecules provide a mechanism for energy dissipation at the nanoscale. It is hypothesized that their presence leads to greater fracture toughness than what is observed in materials without such features. Here, we investigate this hypothesis using a simplified model of a mineralized collagen fibril sliding on a polymeric interface with SBHL systems. A 1D coarse-grained nonlinear spring-mass system is used to model the fibril. Rate-and-displacement constitutive equations are used to describe the mechanical properties of the polymeric system. The model quantifies how the interface toughness increases as a function of polymer density and number of sacrificial bonds. Other characteristics of the SBHL system, such as the length of hidden loops and the strength of the bonds, are found to influence the results. The model also gives insight into the variations in the mechanical behavior in response to physiological changes, such as the degree of mineralization of the collagen fibril and polymer density in the interfibrillar matrix. The model results provide constraints relevant for bio-mimetic material design and multiscale modeling of fracture in human bone.

  16. Fracture and Healing of Rock Salt Related to Salt Caverns

    SciTech Connect (OSTI)

    Chan, K.S.; Fossum, A.F.; Munson, D.E.

    1999-03-01T23:59:59.000Z

    In recent years, serious investigations of potential extension of the useful life of older caverns or of the use of abandoned caverns for waste disposal have been of interest to the technical community. All of the potential applications depend upon understanding the reamer in which older caverns and sealing systems can fail. Such an understanding will require a more detailed knowledge of the fracture of salt than has been necessary to date. Fortunately, the knowledge of the fracture and healing of salt has made significant advances in the last decade, and is in a position to yield meaningful insights to older cavern behavior. In particular, micromechanical mechanisms of fracture and the concept of a fracture mechanism map have been essential guides, as has the utilization of continuum damage mechanics. The Multimechanism Deformation Coupled Fracture (MDCF) model, which is summarized extensively in this work was developed specifically to treat both the creep and fracture of salt, and was later extended to incorporate the fracture healing process known to occur in rock salt. Fracture in salt is based on the formation and evolution of microfractures, which may take the form of wing tip cracks, either in the body or the boundary of the grain. This type of crack deforms under shear to produce a strain, and furthermore, the opening of the wing cracks produce volume strain or dilatancy. In the presence of a confining pressure, microcrack formation may be suppressed, as is often the case for triaxial compression tests or natural underground stress situations. However, if the confining pressure is insufficient to suppress fracture, then the fractures will evolve with time to give the characteristic tertiary creep response. Two first order kinetics processes, closure of cracks and healing of cracks, control the healing process. Significantly, volume strain produced by microfractures may lead to changes in the permeability of the salt, which can become a major concern in cavern sealing and operation. The MDCF model is used in three simulations of field experiments in which indirect measures were obtained of the generation of damage. The results of the simulations help to verify the model and suggest that the model captures the correct fracture behavior of rock salt. The model is used in this work to estimate the generation and location of damage around a cylindrical storage cavern. The results are interesting because stress conditions around the cylindrical cavern do not lead to large amounts of damage. Moreover, the damage is such that general failure can not readily occur, nor does the extent of the damage suggest possible increased permeation when the surrounding salt is impermeable.

  17. Biodegradable synthetic bone composites

    DOE Patents [OSTI]

    Liu, Gao; Zhao, Dacheng; Saiz, Eduardo; Tomsia, Antoni P.

    2013-01-01T23:59:59.000Z

    The invention provides for a biodegradable synthetic bone composition comprising a biodegradable hydrogel polymer scaffold comprising a plurality of hydrolytically unstable linkages, and an inorganic component; such as a biodegradable poly(hydroxyethylmethacrylate)/hydroxyapatite (pHEMA/HA) hydrogel composite possessing mineral content approximately that of human bone.

  18. Design and Implementation of Energized Fracture Treatment in Tight Gas Sands

    SciTech Connect (OSTI)

    Mukul Sharma; Kyle Friehauf

    2009-12-31T23:59:59.000Z

    Hydraulic fracturing is essential for producing gas and oil at an economic rate from low permeability sands. Most fracturing treatments use water and polymers with a gelling agent as a fracturing fluid. The water is held in the small pore spaces by capillary pressure and is not recovered when drawdown pressures are low. The un-recovered water leaves a water saturated zone around the fracture face that stops the flow of gas into the fracture. This is a particularly acute problem in low permeability formations where capillary pressures are high. Depletion (lower reservoir pressures) causes a limitation on the drawdown pressure that can be applied. A hydraulic fracturing process can be energized by the addition of a compressible, sometimes soluble, gas phase into the treatment fluid. When the well is produced, the energized fluid expands and gas comes out of solution. Energizing the fluid creates high gas saturation in the invaded zone, thereby facilitating gas flowback. A new compositional hydraulic fracturing model has been created (EFRAC). This is the first model to include changes in composition, temperature, and phase behavior of the fluid inside the fracture. An equation of state is used to evaluate the phase behavior of the fluid. These compositional effects are coupled with the fluid rheology, proppant transport, and mechanics of fracture growth to create a general model for fracture creation when energized fluids are used. In addition to the fracture propagation model, we have also introduced another new model for hydraulically fractured well productivity. This is the first and only model that takes into account both finite fracture conductivity and damage in the invaded zone in a simple analytical way. EFRAC was successfully used to simulate several fracture treatments in a gas field in South Texas. Based on production estimates, energized fluids may be required when drawdown pressures are smaller than the capillary forces in the formation. For this field, the minimum CO{sub 2} gas quality (volume % of gas) recommended is 30% for moderate differences between fracture and reservoir pressures (2900 psi reservoir, 5300 psi fracture). The minimum quality is reduced to 20% when the difference between pressures is larger, resulting in additional gas expansion in the invaded zone. Inlet fluid temperature, flow rate, and base viscosity did not have a large impact on fracture production. Finally, every stage of the fracturing treatment should be energized with a gas component to ensure high gas saturation in the invaded zone. A second, more general, sensitivity study was conducted. Simulations show that CO{sub 2} outperforms N{sub 2} as a fluid component because it has higher solubility in water at fracturing temperatures and pressures. In fact, all gas components with higher solubility in water will increase the fluid's ability to reduce damage in the invaded zone. Adding methanol to the fracturing solution can increase the solubility of CO{sub 2}. N{sub 2} should only be used if the gas leaks-off either during the creation of the fracture or during closure, resulting in gas going into the invaded zone. Experimental data is needed to determine if the gas phase leaks-off during the creation of the fracture. Simulations show that the bubbles in a fluid traveling across the face of a porous medium are not likely to attach to the surface of the rock, the filter cake, or penetrate far into the porous medium. In summary, this research has created the first compositional fracturing simulator, a useful tool to aid in energized fracture design. We have made several important and original conclusions about the best practices when using energized fluids in tight gas sands. The models and tools presented here may be used in the future to predict behavior of any multi-phase or multi-component fracturing fluid system.

  19. Effect of cryo-induced microcracks on microindentation of hydrated cortical bone tissue

    SciTech Connect (OSTI)

    Yin Ling, E-mail: ling.yin@jcu.edu.au [School of Engineering, James Cook University, Townsville, QLD 4811 (Australia); Venkatesan, Sudharshan [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia); Webb, Daryl [Electron Microscopy Unit, Australian National University, Canberra, ACT 0200 (Australia); Kalyanasundaram, Shankar; Qin Qinghua [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia)

    2009-08-15T23:59:59.000Z

    Microcracks accumulate in cortical bone tissue as a consequence of everyday cyclic loading. However, it remains unclear to what extent microdamage accumulation contributes to an increase in fracture risk. A cryo-preparation technique was applied to induce microcracks in cortical bone tissue. Microcracks with lengths up to approximately 20 {mu}m, which were initiated mainly on the boundaries of haversian canals, were observed with cryo-scanning electron microscopy. A microindentation technique was applied to study the mechanical loading effect on the microcracked hydrated bone tissue. The microindentation patterns were section-scanned using confocal laser scanning microscopy to understand the deformation and bone damage mechanisms made by mechanical loading. The results show that there was no significant difference with respect to microhardness between the original and microcracked hydrated cortical bone tissues (ANOVA, p > 0.05). The cryo-induced microcracks in the bone tissue were not propagated further under the mechanical loads applied. The deformation mechanism of the microcracked cortical bone tissue was plastic deformation, not brittle fracture.

  20. Differential Maintenance of Cortical and Cancellous Bone Strength Following Discontinuation of

    E-Print Network [OSTI]

    Ritchie, Robert

    and with combination of osteoporosis medications are needed to improve our treatment of osteoporosis. ß 2011 American; RALOXIFENE Introduction A number of drugs offer some protection against post- menopausal bone loss and nonvertebral fractures in postmenopausal osteoporosis.(3) While bisphosphonates such as ALN may accumulate

  1. Procedure for estimating fracture energy from fracture surface roughness

    DOE Patents [OSTI]

    Williford, Ralph E. (Kennewick, WA)

    1989-01-01T23:59:59.000Z

    The fracture energy of a material is determined by first measuring the length of a profile of a section through a fractured surface of the material taken on a plane perpendicular to the mean plane of that surface, then determining the fractal dimensionality of the surface. From this, the yield strength of the material, and the Young's Modulus of that material, the fracture energy is calculated.

  2. Flow dynamics and solute transport in unsaturated rock fractures

    SciTech Connect (OSTI)

    Su, G. W.

    1999-10-01T23:59:59.000Z

    Rock fractures play an important role in flow and contaminant transport in fractured aquifers, production of oil from petroleum reservoirs, and steam generation from geothermal reservoirs. In this dissertation, phenomenological aspects of flow in unsaturated fractures were studied in visualization experiments conducted on a transparent replica of a natural, rough-walled rock fracture for inlet conditions of constant pressure and flow rate over a range of angles of inclination. The experiments demonstrated that infiltrating liquid proceeds through unsaturated rock fractures along non-uniform, localized preferential flow paths. Even in the presence of constant boundary conditions, intermittent flow was a persistent flow feature observed, where portions of the flow channel underwent cycles of snapping and reforming. Two modes of intermittent flow were observed, the pulsating blob mode and the rivulet snapping mode. A conceptual model for the rivulet snapping mode was proposed and examined using idealized, variable-aperture fractures. The frequency of intermittent flow events was measured in several experiments and related to the capillary and Bond numbers to characterize this flow behavior.

  3. Fracture of Thermosetting Polymers: Experiments and Modeling

    E-Print Network [OSTI]

    Benzerga, Amine; Burgess, Brad

    2011-08-04T23:59:59.000Z

    , have come under scrutiny. The cases consist of a carbon fiber resin matrix. The resin can be any one of a number of epoxies, most germane of which is E862. This resin has the effect of strengthening the overall casing structure, but the full nature... of a resin known as epoxy E862, which is a polymer resin currently explored by NASA researchers, and then model this behavior using FEM. In the early 1990's, successful computational methodologies for modeling fracture of metal-matrix composites...

  4. Aquifer behavior with reinjection 

    E-Print Network [OSTI]

    Bonet, Euclides Jose

    1967-01-01T23:59:59.000Z

    AQUIFER BEHAVIOR WITH REINJECTION A Thesis By EUCLIDES JOSE BONET Submitted to the Graduate College of the Texas ARUM University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May, f967 Major Subject... Petroleum Engineering AQUIFER BEHAVIOR WITH REINJECTION A Thesis By E UC LI DES JOSE BONE T Approved as to style and content by: (Chairman of Committee) (Member) (Member) May, 1967 ACKNOWLEDGMENT Thanks are due to Petroleo Brasilerio S...

  5. Numerical simulation of hydraulic fracturing

    E-Print Network [OSTI]

    Warner, Joseph Barnes

    1987-01-01T23:59:59.000Z

    ~ared that the results of such treatments were not always adequately described by the two-dimensional models. With recent advances in hydraulic fracturing and computing technology, attempts have been made to formulate more realistic fracture models. These three...NUMERICAL SIMULATION OF HYDRAULIC FRACTURING A Thesis by JOSEPH BARNES WARNER Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May 1987 Maj or Subj ect...

  6. Design and construction of an experiment for two-phase flow in fractured porous media

    SciTech Connect (OSTI)

    Ayala, R.E.G.; Aziz, K.

    1993-08-01T23:59:59.000Z

    In numerical reservoir simulation naturally fractured reservoirs are commonly divided into matrix and fracture systems. The high permeability fractures are usually entirely responsible for flow between blocks and flow to the wells. The flow in these fractures is modeled using Darcy`s law and its extension to multiphase flow by means of relative permeabilities. The influence and measurement of fracture relative permeability for two-phase flow in fractured porous media have not been studied extensively, and the few works presented in the literature are contradictory. Experimental and numerical work on two-phase flow in fractured porous media has been initiated. An apparatus for monitoring this type of flow was designed and constructed. It consists of an artificially fractured core inside an epoxy core holder, detailed pressure and effluent monitoring, saturation measurements by means of a CT-scanner and a computerized data acquisition system. The complete apparatus was assembled and tested at conditions similar to the conditions expected for the two-phase flow experiments. Fine grid simulations of the experimental setup-were performed in order to establish experimental conditions and to study the effects of several key variables. These variables include fracture relative permeability and fracture capillary pressure. The numerical computations show that the flow is dominated by capillary imbibition, and that fracture relative permeabilities have only a minor influence. High oil recoveries without water production are achieved due to effective water imbibition from the fracture to the matrix. When imbibition is absent, fracture relative permeabilities affect the flow behavior at early production times.

  7. BTEX biodegradation in fractured shale

    SciTech Connect (OSTI)

    O`Cleirigh, D.; Coryea, H. [Roy F. Weston, Inc., Austin, TX (United States); Christopher, M.; Vaughn, C. [Roy F. Weston, Inc., Houston, TX (United States)

    1997-12-31T23:59:59.000Z

    A petroleum hydrocarbon groundwater plume was identified at a Federal Aviation Administration (FAA) facility in Oklahoma. The affected area had an average BTEX concentration of 3.8 mg/L. Previous aquifer tests indicated preferential groundwater flow paths resulting from natural fractures present in the aquifer formation (primarily shale). A pneumatic fracturing pilot study was performed to evaluate the technology`s effectiveness in creating a more isotropic aquifer. As part of the study, pre-fracture/post-fracture pump tests were performed. Pre-fracture and post-fracture graphs confirmed the study`s hypothesis that pneumatic fracturing would eliminate preferential flow paths and increase groundwater yield. Based on the successful pneumatic fracturing test, an area within the petroleum hydrocarbon plume was fractured and a pilot-scale biodegradation system was operated for four months. The remediation system provided groundwater circulation amended with nutrients and oxygen. Results of the study indicated a significant decrease in BTEX concentrations between the injection well and the observation wells. By Day 113, the benzene concentration (0.044 mg/L) at one of the observation wells was less than the desired state cleanup goal of 0.05 mg/L.

  8. Fracture model for cemented aggregates

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zubelewicz, Aleksander; Thompson, Darla G.; Ostoja-Starzewski, Martin; Ionita, Axinte; Shunk, Devin; Lewis, Matthew W.; Lawson, Joe C.; Kale, Sohan; Koric, Seid

    2013-01-01T23:59:59.000Z

    A mechanisms-based fracture model applicable to a broad class of cemented aggregates and, among them, plastic-bonded explosive (PBX) composites, is presented. The model is calibrated for PBX 9502 using the available experimental data under uniaxial compression and tension gathered at various strain rates and temperatures. We show that the model correctly captures inelastic stress-strain responses prior to the load peak and it predicts the post-critical macro-fracture processes, which result from the growth and coalescence of micro-cracks. In our approach, the fracture zone is embedded into elastic matrix and effectively weakens the material's strength along the plane of the dominant fracture.

  9. Mechanical properties of two canine iliac fracture fixation systems 

    E-Print Network [OSTI]

    VanGundy, Thomas Eugene

    1988-01-01T23:59:59.000Z

    Group-Un- paired specimens tested as intact bones Intact T-Torsion E, -Axial E, -Axial and moderate bending E~-Axial and maximum bending 3 In all implant specimens a standardized oblique iliac fracture was simulated by osteotomy with a... the neutral longitudinal axis of the specimen at the rate of 15 degrees per minute. Axial loading was performed along the neutral longitudinal axis (E, position in Fig. 5). Axial loading with a concurrent bending moment (modes E~ and E~ in Fig. 5...

  10. Mechanical properties of two canine iliac fracture fixation systems

    E-Print Network [OSTI]

    VanGundy, Thomas Eugene

    1988-01-01T23:59:59.000Z

    and mediolateral dimensions of the iliac shaft of each specimen were measured with calipers and the cross-sectional area approximated as the height times the width. Group mean cross sectional area was compared using the nonpaired t-test for control versus... Group-Un- paired specimens tested as intact bones Intact T-Torsion E, -Axial E, -Axial and moderate bending E~-Axial and maximum bending 3 In all implant specimens a standardized oblique iliac fracture was simulated by osteotomy with a...

  11. Interferometric hydrofracture microseism localization using neighboring fracture

    E-Print Network [OSTI]

    Poliannikov, Oleg V.

    2011-05-19T23:59:59.000Z

    Hydraulic fracturing is the process of injecting high-pressure fluids into a reservoir to induce fractures and thus improve reservoir productivity. Microseismic event localization is used to locate created fractures. ...

  12. Interferometric hydrofracture microseism localization using neighboring fracture

    E-Print Network [OSTI]

    Poliannikov, Oleg V.

    Hydraulic fracturing is the process of injecting high-pressure fluids into a reservoir to induce fractures and thus improve reservoir productivity. Microseismic event localization is used to locate created fractures. ...

  13. Fracture compliance estimation using borehole tube waves

    E-Print Network [OSTI]

    Bakku, Sudhish Kumar

    We tested two models, one for tube-wave generation and the other for tube-wave attenuation at a fracture intersecting a borehole that can be used to estimate fracture compliance, fracture aperture, and lateral extent. In ...

  14. Exploring the physicochemical processes that govern hydraulic fracture through laboratory

    E-Print Network [OSTI]

    Belmonte A; Connelly P

    ) containing model boreholes as an analog to hydraulic fracturing with various fracture-driving fluids. The

  15. Seismic Fracture Characterization Methods for Enhanced Geothermal...

    Broader source: Energy.gov (indexed) [DOE]

    Seismic Fracture Characterization Methods for Enhanced Geothermal Systems Principal Investigator: John H. Queen Hi-Q Geophysical Inc. Track Name: Seismicity and Reservoir Fracture...

  16. Estimation of fracture flow parameters through numerical analysis of hydromechanical pressure pulses

    E-Print Network [OSTI]

    Cappa, F.

    2009-01-01T23:59:59.000Z

    an Engineered Fractured Geothermal Reservoir. Example of theinteractions in a fractured carbonate reservoir inferredwithin a shallow fractured carbonate reservoir. Fracture

  17. Gradient effects on the fracture of inhomogeneous materials

    SciTech Connect (OSTI)

    Becker, T.L.

    2000-05-01T23:59:59.000Z

    Functionally Graded Materials (FGMs) have a spatial variation in physical properties that can be tailored to meet the needs of a specific application and/or to minimize internal stresses arising from thermal and elastic mismatch. Modeling these materials as inhomogeneous continua allows assessment of the role of the gradient without requiring detailed knowledge of the microstructure. Motivated by the relative difficulty of obtaining analytical solutions to boundary value problems for FGMs, an accurate finite-element code is developed for obtaining numerical planar and axisymmetric linear thermoelastic solutions. In addition an approximate analytical technique for mapping homogeneous-modulus solutions to those for FGMs is assessed and classes of problems to which it applies accurately are identified. The fracture mechanics analysis of FGMs can be characterized by the classic stress intensities, KI and KII, but there has been scarce progress in understanding the role of the modulus gradient in determining fracture initiation and propagation. To address this question, a statistical fracture model is used to correlate near-tip stresses with brittle fracture initiation behavior. This describes the behavior of a material experiencing fracture initiation away from the crack tip. Widely dispersed zones of fracture initiation sites are expected. Finite-length kinks are analyzed to describe the crack path for continuous crack growth. For kink lengths much shorter than the gradient dimension, a parallel stress term describes the deviation of the kinking angle from that for homogeneous materials. For longer kinks there is a divergence of the kink angle predicted by the maximum energy release rate and the pure opening mode criteria.

  18. Intergranular fracture in UO2: derivation of traction-separation law from atomistic simulations

    SciTech Connect (OSTI)

    Yongfeng Zhang; Paul C Millett; Michael R Tonks; Xian-Ming Bai; S Bulent Biner

    2013-10-01T23:59:59.000Z

    In this study, the intergranular fracture behavior of UO2 was studied by molecular dynamics simulations using the Basak potential. In addition, the constitutive traction-separation law was derived from atomistic data using the cohesive-zone model. In the simulations a bicrystal model with the (100) symmetric tilt E5 grain boundaries was utilized. Uniaxial tension along the grain boundary normal was applied to simulate Mode-I fracture. The fracture was observed to propagate along the grain boundary by micro-pore nucleation and coalescence, giving an overall intergranular fracture behavior. Phase transformations from the Fluorite to the Rutile and Scrutinyite phases were identified at the propagating crack tips. These new phases are metastable and they transformed back to the Fluorite phase at the wake of crack tips as the local stress concentration was relieved by complete cracking. Such transient behavior observed at atomistic scale was found to substantially increase the energy release rate for fracture. Insertion of Xe gas into the initial notch showed minor effect on the overall fracture behavior.

  19. Modeling the Fracture of Ice Sheets on Parallel Computers

    SciTech Connect (OSTI)

    Waisman, Haim [Columbia University] [Columbia University; Tuminaro, Ray [Sandia National Labs] [Sandia National Labs

    2013-10-10T23:59:59.000Z

    The objective of this project was to investigate the complex fracture of ice and understand its role within larger ice sheet simulations and global climate change. This objective was achieved by developing novel physics based models for ice, novel numerical tools to enable the modeling of the physics and by collaboration with the ice community experts. At the present time, ice fracture is not explicitly considered within ice sheet models due in part to large computational costs associated with the accurate modeling of this complex phenomena. However, fracture not only plays an extremely important role in regional behavior but also influences ice dynamics over much larger zones in ways that are currently not well understood. To this end, our research findings through this project offers significant advancement to the field and closes a large gap of knowledge in understanding and modeling the fracture of ice sheets in the polar regions. Thus, we believe that our objective has been achieved and our research accomplishments are significant. This is corroborated through a set of published papers, posters and presentations at technical conferences in the field. In particular significant progress has been made in the mechanics of ice, fracture of ice sheets and ice shelves in polar regions and sophisticated numerical methods that enable the solution of the physics in an efficient way.

  20. Invest in Your Bones Bone Mineral Calcium and Vitamin D

    E-Print Network [OSTI]

    beans, eggs, and nuts. Sardines and salmon with bones, oysters, kidney beans, and tofu made with calcium

  1. Research Paper A method for calibration of bone driver transducers to measure the mastoid

    E-Print Network [OSTI]

    Allen, Jont

    vibrator transducers for clinical measurements, the transfer of energy from the bone driver depends. This absolute calibration is based upon a circuit model of the driver, describing it with three frequency in the clinic, and a refined bone driver circuit model is proposed to better capture the observed behaviors. Ã?

  2. Slator Ranch fracture optimization study

    SciTech Connect (OSTI)

    Ventura, J.L.

    1985-07-01T23:59:59.000Z

    The Las Ovejas (Lobo) field in Zapata County, TX, is being developed actively. The field was discovered on Tenneco Oil EandP's Slator Ranch lease with the successful completion of the Sanchez-O'Brien Vaquillas Ranch Well 1. Tenneco operates all of the 17,712-acre (71 678 X 10/sup 3/-m/sup 2/) lease (with the exception of a 320-acre (1295 X 10/sup 3/-m/sup 2/) tract assigned to the Vaquillas Ranch Well 1) and has successfully completed five wells in the Lobo field subsequent to the discovery well. The Lobo interval in the Slator Ranch area is a tight gas sand, and all these wells require fracture stimulation. Because a successful fracture is essential for a good Lobo completion and because hydraulic fracturing represents a significant portion of the completed well cost, it is important to optimize this phase of the completion. The purpose of this study was to determine the following for Slator Ranch Lobo completions: an optimum fracture length as a function of permeability; whether wells should be tailed-in with bauxite, or fractured with all bauxite or sand (if an optimum tail-in does exist, to determine the optimum tail-in for a fixed fracture length as a function of permeability); the drainage area and abandonment pressure for Slator Ranch Well 2; the effect of compression on reserves; and closure pressure as a function of time and distance along the fracture for Slator Ranch Well 2.

  3. Numerical Modeling of Hydraulic Fracture Propagation Using Thermo-hydro-mechanical Analysis with Brittle Damage Model by Finite Element Method 

    E-Print Network [OSTI]

    Min, Kyoung

    2013-07-16T23:59:59.000Z

    are studied using a coupled thermo-hydro-mechanical (THM) analysis. The models are used to simulate microscopic and macroscopic fracture behaviors of laboratory-scale uniaxial and triaxial experiments on rock using an elastic/brittle damage model considering...

  4. Study of Flow Regimes in Multiply-Fractured Horizontal Wells in Tight Gas and Shale Gas Reservoir Systems 

    E-Print Network [OSTI]

    Freeman, Craig M.

    2010-07-14T23:59:59.000Z

    Various analytical, semi-analytical, and empirical models have been proposed to characterize rate and pressure behavior as a function of time in tight/shale gas systems featuring a horizontal well with multiple hydraulic fractures. Despite a small...

  5. Study of Flow Regimes in Multiply-Fractured Horizontal Wells in Tight Gas and Shale Gas Reservoir Systems

    E-Print Network [OSTI]

    Freeman, Craig M.

    2010-07-14T23:59:59.000Z

    Various analytical, semi-analytical, and empirical models have been proposed to characterize rate and pressure behavior as a function of time in tight/shale gas systems featuring a horizontal well with multiple hydraulic fractures. Despite a small...

  6. Acid Fracture and Fracture Conductivity Study of Field Rock Samples 

    E-Print Network [OSTI]

    Underwood, Jarrod

    2013-11-15T23:59:59.000Z

    carbonate reservoir were labeled A through F to protect proprietary information included in this research. A 2% potassium chloride solution was used for the acid system and fracture conductivity measurements to prevent clay swelling. Injection temperature...

  7. Optimization of fracture treatment designs

    E-Print Network [OSTI]

    Rueda, Jose Ignacio

    1992-01-01T23:59:59.000Z

    using the type curves published by Holditch et al2O. n f H r lic Fracture Pro a ation imula or In 1955, the first model to simulate the propagation of a vertical hydraulic fracture was developed by Khristianovitch and Zheltov O (K-Z model). This two... . . . . 93 97 LIST OF TABLES Table Page 5. I Reservoir and well data for base case example 54 5. 2 Fracture design data for base case example . 54 5. 3 Economic data for base case example . . 54 5. 4 Comparison of the methods used in STIMOP and LPOP...

  8. DEVELOPMENT OF RESERVOIR CHARACTERIZATION TECHNIQUES AND PRODUCTION MODELS FOR EXPLOITING NATURALLY FRACTURED RESERVOIRS

    SciTech Connect (OSTI)

    Michael L. Wiggins; Raymon L. Brown; Faruk Civan; Richard G. Hughes

    2002-12-31T23:59:59.000Z

    For many years, geoscientists and engineers have undertaken research to characterize naturally fractured reservoirs. Geoscientists have focused on understanding the process of fracturing and the subsequent measurement and description of fracture characteristics. Engineers have concentrated on the fluid flow behavior in the fracture-porous media system and the development of models to predict the hydrocarbon production from these complex systems. This research attempts to integrate these two complementary views to develop a quantitative reservoir characterization methodology and flow performance model for naturally fractured reservoirs. The research has focused on estimating naturally fractured reservoir properties from seismic data, predicting fracture characteristics from well logs, and developing a naturally fractured reservoir simulator. It is important to develop techniques that can be applied to estimate the important parameters in predicting the performance of naturally fractured reservoirs. This project proposes a method to relate seismic properties to the elastic compliance and permeability of the reservoir based upon a sugar cube model. In addition, methods are presented to use conventional well logs to estimate localized fracture information for reservoir characterization purposes. The ability to estimate fracture information from conventional well logs is very important in older wells where data are often limited. Finally, a desktop naturally fractured reservoir simulator has been developed for the purpose of predicting the performance of these complex reservoirs. The simulator incorporates vertical and horizontal wellbore models, methods to handle matrix to fracture fluid transfer, and fracture permeability tensors. This research project has developed methods to characterize and study the performance of naturally fractured reservoirs that integrate geoscience and engineering data. This is an important step in developing exploitation strategies for optimizing the recovery from naturally fractured reservoir systems. The next logical extension of this work is to apply the proposed methods to an actual field case study to provide information for verification and modification of the techniques and simulator. This report provides the details of the proposed techniques and summarizes the activities undertaken during the course of this project. Technology transfer activities were highlighted by a two-day technical conference held in Oklahoma City in June 2002. This conference attracted over 90 participants and included the presentation of seventeen technical papers from researchers throughout the United States.

  9. Age-related changes in the plasticity and toughness of human cortical bone at multiple length-scales

    SciTech Connect (OSTI)

    Zimmermann, Elizabeth A.; Schaible, Eric; Bale, Hrishikesh; Barth, Holly D.; Tang, Simon Y.; Reichert, Peter; Busse, Bjoern; Alliston, Tamara; Ager III, Joel W.; Ritchie, Robert O.

    2011-08-10T23:59:59.000Z

    The structure of human cortical bone evolves over multiple length-scales from its basic constituents of collagen and hydroxyapatite at the nanoscale to osteonal structures at nearmillimeter dimensions, which all provide the basis for its mechanical properties. To resist fracture, bone’s toughness is derived intrinsically through plasticity (e.g., fibrillar sliding) at structural-scales typically below a micron and extrinsically (i.e., during crack growth) through mechanisms (e.g., crack deflection/bridging) generated at larger structural-scales. Biological factors such as aging lead to a markedly increased fracture risk, which is often associated with an age-related loss in bone mass (bone quantity). However, we find that age-related structural changes can significantly degrade the fracture resistance (bone quality) over multiple lengthscales. Using in situ small-/wide-angle x-ray scattering/diffraction to characterize sub-micron structural changes and synchrotron x-ray computed tomography and in situ fracture-toughness measurements in the scanning electron microscope to characterize effects at micron-scales, we show how these age-related structural changes at differing size-scales degrade both the intrinsic and extrinsic toughness of bone. Specifically, we attribute the loss in toughness to increased non-enzymatic collagen cross-linking which suppresses plasticity at nanoscale dimensions and to an increased osteonal density which limits the potency of crack-bridging mechanisms at micron-scales. The link between these processes is that the increased stiffness of the cross-linked collagen requires energy to be absorbed by “plastic” deformation at higher structural levels, which occurs by the process of microcracking.

  10. Stimuli-Responsive/Rheoreversible Hydraulic Fracturing Fluids as a Greener Alternative to Support Geothermal and Fossil Energy Production

    SciTech Connect (OSTI)

    Jung, Hun Bok; Carroll, KC; Kabilan, Senthil; Heldebrant, David J.; Hoyt, David W.; Zhong, Lirong; Varga, Tamas; Stephens, Sean A.; Adams, Lexor; Bonneville, Alain; Kuprat, Andrew P.; Fernandez, Carlos A.

    2015-01-01T23:59:59.000Z

    Cost-effective yet safe creation of high-permeability reservoirs within deep bedrock is the primary challenge for the viability of enhanced geothermal systems (EGS) and unconventional oil/gas recovery. Although fracturing fluids are commonly used for oil/gas, standard fracturing methods are not developed or proven for EGS temperatures and pressures. Furthermore, the environmental impacts of currently used fracturing methods are only recently being determined. Widespread concerns about the environmental contamination have resulted in a number of regulations for fracturing fluids advocating for greener fracturing processes. To enable EGS feasibility and lessen environmental impact of reservoir stimulation, an environmentally benign, CO2-activated, rheoreversible fracturing fluid that enhances permeability through fracturing (at significantly lower effective stress than standard fracturing fluids) due to in situ volume expansion and gel formation is investigated herein. The chemical mechanism, stability, phase-change behavior, and rheology for a novel polyallylamine (PAA)-CO2 fracturing fluid was characterized at EGS temperatures and pressures. Hydrogel is formed upon reaction with CO2 and this process is reversible (via CO2 depressurization or solubilizing with a mild acid) allowing removal from the formation and recycling, decreasing environmental impact. Rock obtained from the Coso geothermal field was fractured in laboratory experiments under various EGS temperatures and pressures with comparison to standard fracturing fluids, and the fractures were characterized with imaging, permeability measurement, and flow modeling. This novel fracturing fluid and process may vastly reduce water usage and the environmental impact of fracturing practices and effectively make EGS production and unconventional oil/gas exploitation cost-effective and cleaner.

  11. Modeling the Ductile Brittle Fracture Transition in Reactor Pressure Vessel Steels using a Cohesive Zone Model based approach

    SciTech Connect (OSTI)

    Pritam Chakraborty; S. Bulent Biner

    2013-10-01T23:59:59.000Z

    Fracture properties of Reactor Pressure Vessel (RPV) steels show large variations with changes in temperature and irradiation levels. Brittle behavior is observed at lower temperatures and/or higher irradiation levels whereas ductile mode of failure is predominant at higher temperatures and/or lower irradiation levels. In addition to such temperature and radiation dependent fracture behavior, significant scatter in fracture toughness has also been observed. As a consequence of such variability in fracture behavior, accurate estimates of fracture properties of RPV steels are of utmost importance for safe and reliable operation of reactor pressure vessels. A cohesive zone based approach is being pursued in the present study where an attempt is made to obtain a unified law capturing both stable crack growth (ductile fracture) and unstable failure (cleavage fracture). The parameters of the constitutive model are dependent on both temperature and failure probability. The effect of irradiation has not been considered in the present study. The use of such a cohesive zone based approach would allow the modeling of explicit crack growth at both stable and unstable regimes of fracture. Also it would provide the possibility to incorporate more physical lower length scale models to predict DBT. Such a multi-scale approach would significantly improve the predictive capabilities of the model, which is still largely empirical.

  12. Fracture of aluminum naval structures

    E-Print Network [OSTI]

    Galanis, Konstantinos, 1970-

    2007-01-01T23:59:59.000Z

    Structural catastrophic failure of naval vessels due to extreme loads such as underwater or air explosion, high velocity impact (torpedoes), or hydrodynamic loads (high speed vessels) is primarily caused by fracture. ...

  13. Sensitivity analysis of fracture scattering

    E-Print Network [OSTI]

    Fang, Xinding, S.M. Massachusetts Institute of Technology

    2010-01-01T23:59:59.000Z

    We use a 2-D finite difference method to numerically calculate the seismic response of a single finite fracture in a homogeneous media. In our experiments, we use a point explosive source and ignore the free surface effect, ...

  14. FRACTURE STIMULATION IN ENHANCED GEOTHERMAL

    E-Print Network [OSTI]

    Stanford University

    FRACTURE STIMULATION IN ENHANCED GEOTHERMAL SYSTEMS A REPORT SUBMITTED TO THE DEPARTMENT OF ENERGY (Principal Advisor) #12;#12;v Abstract Enhanced Geothermal Systems (EGS) are geothermal reservoirs formed

  15. Seismic anisotropy of fractured rock

    E-Print Network [OSTI]

    M. Schoenberg, C. M. Sayers

    2000-02-18T23:59:59.000Z

    of seismic anisotropy to determine the orientation of fracture sets is of ... this assumption of noninteraction does not imply that the ... conventional (2-subscript) condensed 6 x 6 matrix notation,. 11. 6, while ... have simple physical interpretations.

  16. Bone quality measurements Osteoporos Int. 2011 Aug;22(8):2225-40. New laboratory tools in the assessment

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ,version1-1Jul2013 Author manuscript, published in "Osteoporosis International 22, 8 (2011) 2225-2240" DOI Force Microscopy FEA Finite Element Analysis Introduction Fragility fractures due to osteoporosis and affect ~30 % of women after the menopause and ~10 % of men. Dual Energy bone densitometry (DXA) has

  17. Application of elastic-plastic fracture mechanics to marine structures 

    E-Print Network [OSTI]

    Pathi, Amarkumar

    1991-01-01T23:59:59.000Z

    , be able to support the loads that are applied during its operating lifetime. The structural integrity of components can be assured by knowledge of the material used in their construction. The fracture behavior of a given structure or material depends... or fatigue cracks. Ship structures operate in or near the ductile-brittle transition region, where the failure mechanism is unstable cleavage. Consequently materials are characterized by a transition temperature region above which they may be safely used...

  18. Degradation behavior of hydroxyapatite/poly(lactic-co-glycolic) acid nanocomposite in simulated body fluid

    SciTech Connect (OSTI)

    Liuyun, Jiang, E-mail: jlytxg@163.com [Chengdu Institute of Organic Chemistry, Chinese Academy of Sciences, Chengdu 610041 (China); Chengdong, Xiong [Chengdu Institute of Organic Chemistry, Chinese Academy of Sciences, Chengdu 610041 (China); Lixin, Jiang; Lijuan, Xu [Chengdu Institute of Organic Chemistry, Chinese Academy of Sciences, Chengdu 610041 (China); Graduated School of Chinese Academy of Sciences, Beijing 100039 (China)

    2013-10-15T23:59:59.000Z

    Graphical abstract: In this manuscript, we initiated a systematic study to investigate the effect of HA on thermal properties, inner structure, reduction of mechanical strength, surface morphology and the surface deposit of n-HA/PLGA composite with respect to the soaking time. The results showed that n-HA played an important role in improving the degradation behavior of n-HA/PLGA composite, which can accelerate the degradation of n-HA/PLGA composite and endow it with bioactivity, after n-HA was detached from PLGA during the degradation, so that n-HA/PLGA composite may have a more promising prospect of the clinical application than pure PLGA as bone fracture internal fixation materials, and the results would be of reference significance to predict the in vivo degradation and biological properties. - Highlights: • Effect of n-HA on degradation behavior of n-HA/PLGA composite was investigated. • Degradation behaviors of n-HA/PLGA and PLGA were carried out in SBF for 6 months. • Viscosity, thermal properties, inner structure and bending strength were tested. • n-HA can accelerate the degradation and endows it with bioactivity. - Abstract: To investigate the effect of hydroxyapatite(HA) on the degradation behavior of hydroxyapatite/poly(lactic-co-glycolic) acid (HA/PLGA) nanocomposite, the degradation experiment of n-HA/PLGA composite and pure PLGA were carried out by soaking in simulated body fluid(SBF) at 37 °C for 1, 2, 4 and 6 months. The change of intrinsic viscosity, thermal properties, inner structure, bending strength reduction, surface morphology and the surface deposit of n-HA/PLGA composite and pure PLGA with respect to the soaking time were investigated by means of UbbeloHde Viscometer, differential scanning calorimeter (DSC), scanning electron microscope(SEM), electromechanical universal tester, a conventional camera and X-ray diffraction (XRD). The results showed that n-HA played an important role in improving the degradation behavior of n-HA/PLGA composite, which can accelerate the degradation PLGA and endow it with bioactivity, after n-HA was detached from PLGA during the degradation, so that n-HA/PLGA composite may have a more promising prospect of the clinical application than pure PLGA as bone fracture internal fixation materials.

  19. Estimation of fracture compliance from tubewaves generated at a fracture intersecting a borehole

    E-Print Network [OSTI]

    Bakku, Sudhish Kumar

    2011-01-01T23:59:59.000Z

    Understanding fracture compliance is important for characterizing fracture networks and for inferring fluid flow in the subsurface. In an attempt to estimate fracture compliance in the field, we developed a new model to ...

  20. Peri-prosthetic fracture vibration testing

    SciTech Connect (OSTI)

    Cruce, Jesse R [Los Alamos National Laboratory; Erwin, Jenny R [Los Alamos National Laboratory; Remick, Kevin R [Los Alamos National Laboratory; Cornwell, Phillip J [Los Alamos National Laboratory; Menegini, R. Michael [INDIANA UNIV.; Racanelli, Joe [STRYKER ORTHOPARDICS

    2010-11-08T23:59:59.000Z

    The purpose of this study was to establish a test setup and vibration analysis method to predict femoral stem seating and prevent bone fracture using accelerometer and force response data from an instrumented stem and impactor. This study builds upon earlier studies to identify a means to supplement a surgeon's tactile and auditory senses by using damage identification techniques normally used for civil and mechanical structures. Testing was conducted using foam cortical shell sawbones prepared for stems of different geometries. Each stem was instrumented with an accelerometer. Two impactor designs were compared: a monolithic impactor and a two-piece impactor, each with an integrated load cell and accelerometer. Acceleration and force measurements were taken in the direction of impaction. Comparisons between different methods of applying an impacting force were made, including a drop tower and a surgical hammer. The effect of varying compliance on the data was also investigated. The ultimate goal of this study was to assist in the design of an integrated portable data acquisition system capable of being used in future cadaveric testing. This paper will discuss the experimental setup and the subsequent results of the comparisons made between impactors, prosthetic geometries, compliances, and impact methods. The results of this study can be used for both future replicate testing as well as in a cadaveric environment.

  1. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1995-05-09T23:59:59.000Z

    A device is described for stimulating bone tissue by applying a low level alternating current signal directly to the patient`s skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures. 5 figs.

  2. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, James W. (Aiken, SC)

    1995-01-01T23:59:59.000Z

    A device for stimulating bone tissue by applying a low level alternating current signal directly to the patient's skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures.

  3. Stochastic Modeling of a Fracture Network in a Hydraulically Fractured Shale-Gas Reservoir

    E-Print Network [OSTI]

    Mhiri, Adnene

    2014-08-10T23:59:59.000Z

    : ? Uniform distribution of heterogeneities that cause a variation of geomechanical properties such as: — In-situ stress — Fracture initiation pressure — Elastic moduli (Shear modulus and Poisson’s ratio) ? No interaction with natural fractures: — Natural... that are dynamically created due to the change in the geomechanical properties in the vicinity of the primary fracture these are referred to as secondary fractures and are thought to be orthogonal to primary fractures. ? The fractures that originate due...

  4. INTERPRETATION OF A HYDRAULIC FRACTURING EXPERIMENT, MONTICELLO, SOUTH CAROLINA

    E-Print Network [OSTI]

    Narasimhan, T.N.

    2014-01-01T23:59:59.000Z

    Letters INTERPRETATION OF A HYDRAULIC FRACTURING EXPERIMENT,12091 INTERPRETATION OF A HYDRAULIC FRACTURING EXPERIMENT,transient data from a hydraulic fracturing experiment have

  5. Elastic properties of saturated porous rocks with aligned fractures

    E-Print Network [OSTI]

    2003-12-02T23:59:59.000Z

    This unexpected result is caused by the wave-induced flow of fluids between pores and fractures. ..... For non-fractured rock setting fracture weaknesses. DN and ...

  6. GMINC - A MESH GENERATOR FOR FLOW SIMULATIONS IN FRACTURED RESERVOIRS

    E-Print Network [OSTI]

    Pruess, K.

    2010-01-01T23:59:59.000Z

    Flow in Naturally Fractured Reservoirs, Society of Petroleumfor Naturally Fractured Reservoirs, paper SPE-11688,Determining Naturally Fractured Reservoir Properties by Well

  7. Tracer Testing for Estimating Heat Transfer Area in Fractured Reservoirs

    E-Print Network [OSTI]

    Pruess, Karsten; van Heel, Ton; Shan, Chao

    2004-01-01T23:59:59.000Z

    Heat Flow in Fractured Reservoirs, SPE Advanced TechnologyTransfer Area in Fractured Reservoirs Karsten Pruess 1 , Tonbehavior arises in fractured reservoirs. As cold injected

  8. asymmetric hydraulic fracture: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    from the fractured shale 17 RPSEA UNCONVENTIONAL GAS CONFERENCE 2012: Geology, the Environment, Hydraulic Fracturing Engineering Websites Summary: Fracturing Experiment Overview...

  9. advanced hydraulic fracturing: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    from the fractured shale 18 RPSEA UNCONVENTIONAL GAS CONFERENCE 2012: Geology, the Environment, Hydraulic Fracturing Engineering Websites Summary: Fracturing Experiment Overview...

  10. Uncertainty in the maximum principal stress estimated from hydraulic fracturing Measurements due to the presence of the induced fracture

    E-Print Network [OSTI]

    Rutqvist, Jonny; Tsang, Chin-fu; Stephansson, Ove

    2000-01-01T23:59:59.000Z

    reopening during hydraulic fracturing stress determinations.Laboratory study of hydraulic fracturing pressure data?Howevaluation of hydraulic fracturing stress measurement

  11. Fracture characterization and estimation of fracture porosity of naturally fractured reservoirs with no matrix porosity using stochastic fractal models

    E-Print Network [OSTI]

    Kim, Tae Hyung

    2009-05-15T23:59:59.000Z

    Determining fracture characteristics at the laboratory scale is a major challenge. It is known that fracture characteristics are scale dependent; as such, the minimum sample size should be deduced in order to scale to reservoir dimensions. The main...

  12. Three Models for Water ooding in a Naturally Fractured Petroleum ...

    E-Print Network [OSTI]

    THREE MODELS FOR WATERFLOODING IN A NATURALLY. FRACTURED ... 1. Introduction. For the purposes of this paper a naturally fractured reservoir.

  13. INVEST IN YOUR BONES Living with Osteoporosis

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Living with Osteoporosis Leaflet 5 Living with osteoporosis can be done environment safe to avoid falls. Early detection of bone loss or osteoporosis is now possible with bone to be most effective in reducing bone loss during the five to ten years following menopause, when bone loss

  14. Method for directional hydraulic fracturing

    DOE Patents [OSTI]

    Swanson, David E. (West St. Paul, MN); Daly, Daniel W. (Crystal, MN)

    1994-01-01T23:59:59.000Z

    A method for directional hydraulic fracturing using borehole seals to confine pressurized fluid in planar permeable regions, comprising: placing a sealant in the hole of a structure selected from geologic or cemented formations to fill the space between a permeable planar component and the geologic or cemented formation in the vicinity of the permeable planar component; making a hydraulic connection between the permeable planar component and a pump; permitting the sealant to cure and thereby provide both mechanical and hydraulic confinement to the permeable planar component; and pumping a fluid from the pump into the permeable planar component to internally pressurize the permeable planar component to initiate a fracture in the formation, the fracture being disposed in the same orientation as the permeable planar component.

  15. Molecular dynamics simulations of intergranular fracture in UO2 with nine empirical interatomic potentials

    SciTech Connect (OSTI)

    Yongfeng Zhang; Paul C Millett; Michael R Tonks; Xian-Ming Bai; S Bulent Biner

    2014-09-01T23:59:59.000Z

    The intergranular fracture behavior of UO2 was studied using molecular dynamics simulations with a bicrystal model. The anisotropic fracture behavior due to the different grain boundary characters was investigated with the View the MathML source symmetrical tilt S5 and the View the MathML source symmetrical tilt S3 ({1 1 1} twin) grain boundaries. Nine interatomic potentials, seven rigid-ion plus two core–shell ones, were utilized to elucidate possible potential dependence. Initiating from a notch, crack propagation along grain boundaries was observed for most potentials. The S3 boundary was found to be more prone to fracture than the S5 one, indicated by a lower energy release rate associated with the former. However, some potential dependence was identified on the existence of transient plastic deformation at crack tips, and the results were discussed regarding the relevant material properties including the excess energies of metastable phases and the critical energy release rate for intergranular fracture. In general, local plasticity at crack tips was observed in fracture simulations with potentials that predict low excess energies for metastable phases and high critical energy release rates for intergranular fracture.

  16. Continuous time random walk analysis of solute transport in fractured porous media

    SciTech Connect (OSTI)

    Cortis, Andrea; Cortis, Andrea; Birkholzer, Jens

    2008-06-01T23:59:59.000Z

    The objective of this work is to discuss solute transport phenomena in fractured porous media, where the macroscopic transport of contaminants in the highly permeable interconnected fractures can be strongly affected by solute exchange with the porous rock matrix. We are interested in a wide range of rock types, with matrix hydraulic conductivities varying from almost impermeable (e.g., granites) to somewhat permeable (e.g., porous sandstones). In the first case, molecular diffusion is the only transport process causing the transfer of contaminants between the fractures and the matrix blocks. In the second case, additional solute transfer occurs as a result of a combination of advective and dispersive transport mechanisms, with considerable impact on the macroscopic transport behavior. We start our study by conducting numerical tracer experiments employing a discrete (microscopic) representation of fractures and matrix. Using the discrete simulations as a surrogate for the 'correct' transport behavior, we then evaluate the accuracy of macroscopic (continuum) approaches in comparison with the discrete results. However, instead of using dual-continuum models, which are quite often used to account for this type of heterogeneity, we develop a macroscopic model based on the Continuous Time Random Walk (CTRW) framework, which characterizes the interaction between the fractured and porous rock domains by using a probability distribution function of residence times. A parametric study of how CTRW parameters evolve is presented, describing transport as a function of the hydraulic conductivity ratio between fractured and porous domains.

  17. Acoustic Character Of Hydraulic Fractures In Granite

    E-Print Network [OSTI]

    Paillet, Frederick I.

    1983-01-01T23:59:59.000Z

    Hydraulic fractures in homogeneous granitic rocks were logged with conventional acoustic-transit-time, acoustic-waveform, and acoustic-televiewer logging systems. Fractured intervals ranged in depth from 45 to 570m. and ...

  18. A Global Model for Fracture Falloff Analysis

    E-Print Network [OSTI]

    Marongiu-Porcu, Matteo

    2014-10-29T23:59:59.000Z

    The reservoir permeability is an essential input for the optimum design of modern hydraulic fracture treatments, which are undeniably the crucial technology involved in the development of tight and/or unconventional gas reservoirs. The fracture...

  19. Fluid Flow Simulation in Fractured Reservoirs

    E-Print Network [OSTI]

    Sarkar, Sudipta

    2002-01-01T23:59:59.000Z

    The purpose of this study is to analyze fluid flow in fractured reservoirs. In most petroleum reservoirs, particularly carbonate reservoirs and some tight sands, natural fractures play a critical role in controlling fluid ...

  20. Self-potential observations during hydraulic fracturing

    E-Print Network [OSTI]

    Moore, Jeffrey R.; Glaser, Steven D.

    2008-01-01T23:59:59.000Z

    during hydraulic fracturing Moore and Glaser, in press JGR,press JGR, B – 2006JB004373 where m is the average hydraulichydraulic fracturing with water. Moore and Glaser, in press

  1. Laboratory analysis of fluid flow and solute transport through a variably saturated fracture embedded in porous tuff

    SciTech Connect (OSTI)

    Chuang, Y.; Haldeman, W.R.; Rasmussen, T.C.; Evans, D.D. [Arizona Univ., Tucson, AZ (USA). Dept. of Hydrology and Water Resources

    1990-02-01T23:59:59.000Z

    Laboratory techniques are developed that allow concurrent measurement of unsaturated matrix hydraulic conductivity and fracture transmissivity of fractured rock blocks. Two Apache Leap tuff blocks with natural fractures were removed from near Superior, Arizona, shaped into rectangular prisms, and instrumented in the laboratory. Porous ceramic plates provided solution to block tops at regulated pressures. Infiltration tests were performed on both test blocks. Steady flow testing of the saturated first block provided estimates of matrix hydraulic conductivity and fracture transmissivity. Fifteen centimeters of suction applied to the second block top showed that fracture flow was minimal and matrix hydraulic conductivity was an order of magnitude less than the first block saturated matrix conductivity. Coated-wire ion-selective electrodes monitored aqueous chlorided breakthrough concentrations. Minute samples of tracer solution were collected with filter paper. The techniques worked well for studying transport behavior at near-saturated flow conditions and also appear to be promising for unsaturated conditions. Breakthrough curves in the fracture and matrix, and a concentration map of chloride concentrations within the fracture, suggest preferential flows paths in the fracture and substantial diffusion into the matrix. Average travel velocity, dispersion coefficient and longitudinal dispersivity in the fracture are obtained. 67 refs., 54 figs., 23 tabs.

  2. Surrogate-based optimization of hydraulic fracturing in pre-existing fracture networks

    E-Print Network [OSTI]

    Lu, Zhiming

    Surrogate-based optimization of hydraulic fracturing in pre-existing fracture networks Mingjie Chen Keywords: Hydraulic fracturing Fractal dimension Surrogate model Optimization Global sensitivity a b s t r a c t Hydraulic fracturing has been used widely to stimulate production of oil, natural gas

  3. Wave Propagation in Fractured Poroelastic Media

    E-Print Network [OSTI]

    Seismic wave propagation through fractures and cracks is an important subject in exploration and production geophysics, earthquake seismology and mining.

  4. Discrete fracture modeling for fractured reservoirs using Voronoi grid blocks

    E-Print Network [OSTI]

    Gross, Matthew Edward

    2007-09-17T23:59:59.000Z

    or pseudofracture groups modeled in their own grid blocks. Discrete Fracture Modeling (DFN) is still a relatively new field, and most research on it up to this point has been done with Delaunay tessellations. This research investigates an alternative approach using...

  5. Hydraulic Fracture: multiscale processes and moving

    E-Print Network [OSTI]

    Peirce, Anthony

    Hydraulic Fracture: multiscale processes and moving interfaces Anthony Peirce Department Mitchell (UBC) · Ed Siebrits (SLB, Houston) #12;2 Outline · What is a hydraulic fracture? · Scaling Fluid Proppant #12;6 An actual hydraulic fracture #12;7 HF experiment (Jeffrey et al CSIRO) #12;8 1D

  6. Hydraulic Fracture: multiscale processes and moving

    E-Print Network [OSTI]

    Peirce, Anthony

    Hydraulic Fracture: multiscale processes and moving interfaces Anthony Peirce Department Siebrits (SLB, Houston) #12;2 Outline · What is a hydraulic fracture? · Mathematical models of hydraulic fracture · Scaling and special solutions for 1-2D models · Numerical modeling for 2-3D problems

  7. RATE DECLINE ANALYSIS FOR NATURALLY FRACTURED RESERVOIRS

    E-Print Network [OSTI]

    Stanford University

    RATE DECLINE ANALYSIS FOR NATURALLY FRACTURED RESERVOIRS A REPORT SUBMITTED TO THE DEPARTMENT analylsiis for constant pressure production in a naturally fractured reservoir is presented. The solution, the Warren and Root model which assumes fracturing is perfectly unifom, provides an upper bound of reservoir

  8. Regulation of Hydraulic Fracturing in California

    E-Print Network [OSTI]

    Kammen, Daniel M.

    APRIL 2013 Regulation of Hydraulic Fracturing in California: A WAsteWAteR And WAteR QuAlity Pe | Regulation of Hydraulic Fracturing in California Wheeler Institute for Water Law & Policy Center for Law #12;Regulation of Hydraulic Fracturing in California | 3Berkeley law | wheeler InstItute for water law

  9. Endocortical bone loss in osteoporosis: the role of bone surface availability

    E-Print Network [OSTI]

    Buenzli, Pascal R; Clement, John G; Pivonka, Peter

    2012-01-01T23:59:59.000Z

    Age-related bone loss and postmenopausal osteoporosis are disorders of bone remodelling, in which less bone is reformed than resorbed. Yet, this dysregulation of bone remodelling does not occur equally in all bone regions. Loss of bone is more pronounced near the endocortex, leading to cortical wall thinning and medullary cavity expansion, a process sometimes referred to as "trabecularisation" or "cancellisation". Cortical wall thinning is of primary concern in osteoporosis due to the strong reduction in bone mechanical properties that it is associated with. In this paper, we examine the possibility that the nonuniformity of microscopic bone surface availability could explain the nonuniformity of bone loss in osteoporosis. We use a simple computational model of bone remodelling, in which microscopic bone surface availability influences bone turnover rate, to simulate the evolution of the bone volume fraction profile across the midshaft of a long bone. We find that bone loss is accelerated near the endocortica...

  10. Laboratory investigation of crushed salt consolidation and fracture healing

    SciTech Connect (OSTI)

    Not Available

    1987-01-01T23:59:59.000Z

    A laboratory test program was conducted to investigate the consolidation behavior of crushed salt and fracture healing in natural and artificial salt. Crushed salt is proposed for use as backfill in a nuclear waste repository in salt. Artificial block salt is proposed for use in sealing a repository. Four consolidation tests were conducted in a hydrostatic pressure vessel at a maximum pressure of 2500 psi (17.2 MPa) and at room temperature. Three 1-month tests were conducted on salt obtained from the Waste Isolation Pilot Plant and one 2-month test was conducted on salt from Avery Island. Permeability was obtained using argon and either a steady-state or transient method. Initial porosities ranged from 0.26 to 0.36 and initial permeabilities from 2000 to 50,000 md. Final porosities and permeabilities ranged from 0.05 to 0.19 and from <10/sup -5/ md to 110 md, respectively. The lowest final porosity (0.05) and permeability (<10/sup -5/ md) were obtained in a 1-month test in which 2.3% moisture was added to the salt at the beginning of the test. The consolidation rate was much more rapid than in any of the dry salt tests. The fracture healing program included 20 permeability tests conducted on fractured and unfractured samples. The tests were conducted in a Hoek cell at hydrostatic pressures up to 3000 psi (20.6 MPa) with durations up to 8 days. For the natural rock salt tested, permeability was strongly dependent on confining pressure and time. The effect of confining pressure was much weaker in the artificial salt. In most cases the combined effects of time and pressure were to reduce the permeability of fractured samples to the same order of magnitude (or less) as the permeability measured prior to fracturing.

  11. Geomechanical Simulation of Fluid-Driven Fractures

    SciTech Connect (OSTI)

    Makhnenko, R.; Nikolskiy, D.; Mogilevskaya, S.; Labuz, J.

    2012-11-30T23:59:59.000Z

    The project supported graduate students working on experimental and numerical modeling of rock fracture, with the following objectives: (a) perform laboratory testing of fluid-saturated rock; (b) develop predictive models for simulation of fracture; and (c) establish educational frameworks for geologic sequestration issues related to rock fracture. These objectives were achieved through (i) using a novel apparatus to produce faulting in a fluid-saturated rock; (ii) modeling fracture with a boundary element method; and (iii) developing curricula for training geoengineers in experimental mechanics, numerical modeling of fracture, and poroelasticity.

  12. RESEARCH PROGRAM ON FRACTURED PETROLEUM RESERVOIRS

    SciTech Connect (OSTI)

    Abbas Firoozabadi

    2002-04-12T23:59:59.000Z

    Numerical simulation of water injection in discrete fractured media with capillary pressure is a challenge. Dual-porosity models in view of their strength and simplicity can be mainly used for sugar-cube representation of fractured media. In such a representation, the transfer function between the fracture and the matrix block can be readily calculated for water-wet media. For a mixed-wet system, the evaluation of the transfer function becomes complicated due to the effect of gravity. In this work, they use a discrete-fracture model in which the fractures are discretized as one dimensional entities to account for fracture thickness by an integral form of the flow equations. This simple step greatly improves the numerical solution. Then the discrete-fracture model is implemented using a Galerkin finite element method. The robustness and the accuracy of the approach are shown through several examples. First they consider a single fracture in a rock matrix and compare the results of the discrete-fracture model with a single-porosity model. Then, they use the discrete-fracture model in more complex configurations. Numerical simulations are carried out in water-wet media as well as in mixed-wet media to study the effect of matrix and fracture capillary pressures.

  13. Interaction between Injection Points during Hydraulic Fracturing

    E-Print Network [OSTI]

    Hals, Kjetil M D

    2012-01-01T23:59:59.000Z

    We present a model of the hydraulic fracturing of heterogeneous poroelastic media. The formalism is an effective continuum model that captures the coupled dynamics of the fluid pressure and the fractured rock matrix and models both the tensile and shear failure of the rock. As an application of the formalism, we study the geomechanical stress interaction between two injection points during hydraulic fracturing (hydrofracking) and how this interaction influences the fracturing process. For injection points that are separated by less than a critical correlation length, we find that the fracturing process around each point is strongly correlated with the position of the neighboring point. The magnitude of the correlation length depends on the degree of heterogeneity of the rock and is on the order of 30-45 m for rocks with low permeabilities. In the strongly correlated regime, we predict a novel effective fracture-force that attracts the fractures toward the neighboring injection point.

  14. Fracture permeability and seismic wave scattering--Poroelastic linear-slip interface model for heterogeneous fractures

    SciTech Connect (OSTI)

    Nakagawa, S.; Myer, L.R.

    2009-06-15T23:59:59.000Z

    Schoenberg's Linear-slip Interface (LSI) model for single, compliant, viscoelastic fractures has been extended to poroelastic fractures for predicting seismic wave scattering. However, this extended model results in no impact of the in-plane fracture permeability on the scattering. Recently, we proposed a variant of the LSI model considering the heterogeneity in the in-plane fracture properties. This modified model considers wave-induced, fracture-parallel fluid flow induced by passing seismic waves. The research discussed in this paper applies this new LSI model to heterogeneous fractures to examine when and how the permeability of a fracture is reflected in the scattering of seismic waves. From numerical simulations, we conclude that the heterogeneity in the fracture properties is essential for the scattering of seismic waves to be sensitive to the permeability of a fracture.

  15. Multiphase Fluid Flow in Deformable Variable-Aperture Fractures - Final Report

    SciTech Connect (OSTI)

    Detwiler, Russell

    2014-04-30T23:59:59.000Z

    Fractures provide flow paths that can potentially lead to fast migration of fluids or contaminants. A number of energy-­?related applications involve fluid injections that significantly perturb both the pressures and chemical composition of subsurface fluids. These perturbations can cause both mechanical deformation and chemical alteration of host rocks with potential for significant changes in permeability. In fractured rock subjected to coupled chemical and mechanical stresses, it can be difficult to predict the sign of permeability changes, let alone the magnitude. This project integrated experimental and computational studies to improve mechanistic understanding of these coupled processes and develop and test predictive models and monitoring techniques. The project involved three major components: (1) study of two-­?phase flow processes involving mass transfer between phases and dissolution of minerals along fracture surfaces (Detwiler et al., 2009; Detwiler, 2010); (2) study of fracture dissolution in fractures subjected to normal stresses using experimental techniques (Ameli, et al., 2013; Elkhoury et al., 2013; Elkhoury et al., 2014) and newly developed computational models (Ameli, et al., 2014); (3) evaluation of electrical resistivity tomography (ERT) as a method to detect and quantify gas leakage through a fractured caprock (Breen et al., 2012; Lochbuhler et al., 2014). The project provided support for one PhD student (Dr. Pasha Ameli; 2009-­?2013) and partially supported a post-­?doctoral scholar (Dr. Jean Elkhoury; 2010-­?2013). In addition, the project provided supplemental funding to support collaboration with Dr. Charles Carrigan at Lawrence Livermore National Laboratory in connection with (3) and supported one MS student (Stephen Breen; 2011-­?2013). Major results from each component of the project include the following: (1) Mineral dissolution in fractures occupied by two fluid phases (e.g., oil-­?water or water-­?CO{sub 2}) causes changes in local capillary forces and redistribution of fluids. These coupled processes enhance channel formation and the potential for development of fast flow paths through fractures. (2) Dissolution in fractures subjected to normal stress can result in behaviors ranging from development of dissolution channels and rapid permeability increases to fracture healing and significant permeability decreases. The timescales associated with advective transport of dissolved ions in the fracture, mineral dissolution rates, and diffusion within the adjacent porous matrix dictate the sign and magnitude of the resulting permeability changes. Furthermore, a high-­? resolution mechanistic model that couples elastic deformation of contacts and aperture-­?dependent dissolution rates predicts the range of observed behaviors reasonably well. (3) ERT has potential as a tool for monitoring gas leakage in deep formations. Using probabilistic inversion methods further enhances the results by providing uncertainty estimates of inverted parameters.

  16. Acid Fracture and Fracture Conductivity Study of Field Rock Samples

    E-Print Network [OSTI]

    Underwood, Jarrod

    2013-11-15T23:59:59.000Z

    (Black and Hower 1965). Clays consist of negatively charged aluminosilicate layers kept together by cations. The most characteristic property is their ability to adsorb water between the layers, resulting in strong repulsive forces and clay expansion... chemicals used in water fracturing such as friction reducers, fluid-loss additives, and surfactants (Black and Hower 1965). The samples used in this study had significant clay-like content. To prevent swelling, a 2% KCl solution was used throughout...

  17. Acoustic Emission in a Fluid Saturated Hetergeneous Porous Layer with Application to Hydraulic Fracture

    E-Print Network [OSTI]

    Nelson, J.T.

    2009-01-01T23:59:59.000Z

    responses during hydraulic fracturing, and aid developmentFracture Monitoring Hydraulic fracturing is a method forfluids" used for hydraulic fracturing, the above frequencies

  18. Lacunarity analysis of fracture networks: Evidence for scale-dependent clustering Ankur Roy a

    E-Print Network [OSTI]

    Perfect, Ed

    Road, BARC-EAST, Beltsville, MD 20705, USA d Korea Atomic Energy Research Institute, Radioactive Waste and Planetary Sciences, University of Tennessee, Knoxville, TN 37996-1410, USA b School of Earth and Environment. Introduction Fractures control or influence important behaviors in geological systems such as fluid storage

  19. Theoretical and Numerical Simulation of Non-Newtonian Fluid Flow in Propped Fractures

    E-Print Network [OSTI]

    Ouyang, Liangchen

    2013-12-10T23:59:59.000Z

    the original gel. The residual gel exhibits a higher yield stress, and is difficult to remove after fracture closure. But non-Newtonian fluid has complicated rheological equation and its flow behavior in porous media is difficult to be described and modeled...

  20. Understanding the Interactions of Collagen with Mineral in Bone: Working Towards Developing a Realistic Composite

    E-Print Network [OSTI]

    Greenaway, Alan

    . · Mini-project on bone nodule formation. · Neutron scattering on whole bone. · Analysis of bone explants

  1. Using microstructure observations to quantify fracture properties and improve reservoir simulations. Final report, September 1998

    SciTech Connect (OSTI)

    Laubach, S.E.; Marrett, R.; Rossen, W.; Olson, J.; Lake, L.; Ortega, O.; Gu, Y.; Reed, R.

    1999-01-01T23:59:59.000Z

    The research for this project provides new technology to understand and successfully characterize, predict, and simulate reservoir-scale fractures. Such fractures have worldwide importance because of their influence on successful extraction of resources. The scope of this project includes creation and testing of new methods to measure, interpret, and simulate reservoir fractures that overcome the challenge of inadequate sampling. The key to these methods is the use of microstructures as guides to the attributes of the large fractures that control reservoir behavior. One accomplishment of the project research is a demonstration that these microstructures can be reliably and inexpensively sampled. Specific goals of this project were to: create and test new methods of measuring attributes of reservoir-scale fractures, particularly as fluid conduits, and test the methods on samples from reservoirs; extrapolate structural attributes to the reservoir scale through rigorous mathematical techniques and help build accurate and useful 3-D models of the interwell region; and design new ways to incorporate geological and geophysical information into reservoir simulation and verify the accuracy by comparison with production data. New analytical methods developed in the project are leading to a more realistic characterization of fractured reservoir rocks. Testing diagnostic and predictive approaches was an integral part of the research, and several tests were successfully completed.

  2. Regulation of thrombopoietin in bone marrow

    E-Print Network [OSTI]

    McIntosh, Bryan James

    2007-01-01T23:59:59.000Z

    R: gacagagttagtcttgccactgcaa Prb: actgatttgctcctggcggccatMutant prb: tggagctgactgatttactactagcagcaatgc Cyclophilin (L: tggcacatgaatcctggaata Prb: ttcgagctctgagcactggagaga Bone

  3. An analysis of a biodegradable intramedullary fracture fixation system

    E-Print Network [OSTI]

    Smith, William Keith

    1991-01-01T23:59:59.000Z

    by rotating some of the pins out of the main plane in which the crosspins lie. Separate axial, torsional, and bending loading cases have also been examined. Bending loads have been considered for bending in anterior-posterior (A-P) and medial-lateral (M... of the system is dominated by the behavior of the first crosspin closest to the fracture surface, particularly for axial and torsional loading. Staggering crosspins by rotating them out of a single plane offered surprisingly little change in stiffnesses...

  4. Solution of hydraulic fracture problem accounting for lag

    E-Print Network [OSTI]

    Linkov, Alexander M

    2014-01-01T23:59:59.000Z

    The paper presents a method for solving hydraulic fracture problems accounting for the lag. The method consists in matching the outer (basic) solution neglecting the lag, with the inner (auxiliary) solution of the derived 1D integral equation with conditions, accounting for the lag and asymptotic behavior of the opening and the net-pressure. The method refers to practically important cases, when the influence of the local perturbation, caused by the lag, becomes insignificant at a distance, where the leading plane-state asymptotics near the fracture front is still applicable. The universal asymptotics are used for finding the matching constants of the basic (outer) solution and for formulation of matching condition for the solution of inner (auxiliary) problem. The method is illustrated by the solution of the Spence and Sharp plane-strain problem for a fracture propagating symmetrically from the inlet, where a Newtonian fluid is pumped at a constant rate. It is stated that the method developed for deep fractu...

  5. Fracture behavior of advanced ceramic hot gas filters: Final report

    SciTech Connect (OSTI)

    Singh, J.P.; Majumdar, S.; Sutaria, M.; Bielke, W. [Argonne National Lab., IL (United States). Energy Technology Div.

    1997-03-01T23:59:59.000Z

    This report presents the results of mechanical/microstructural evaluation, thermal shock/fatigue testing, and stress analyses of advanced hot-gas filters obtained from different manufacturers. These filters were fabricated from both monolithic ceramics and composites. The composite filters, made of both oxide and nonoxide materials, were in both as-fabricated and exposed conditions, whereas the monolithic filters were made only of nonoxide materials. Mechanical property measurement of composite filters included diametral compression testing with O-ring specimens and burst-testing of short filter segments with rubber plugs. In-situ strength of fibers in the composite filters was evaluated by microscopic technique. Thermal shock/fatigue resistance was estimated by measuring the strengths of filter specimens before and after thermal cycling from an air environment at elevated temperatures to a room temperature oil bath. Filter performance during mechanical and thermal shock/fatigue loadings was correlated with microstructural observations. Micromechanical models were developed to derive properties of composite filter constituents on the basis of measured mechanical properties of the filters. Subsequently, these properties were used to analytically predict the performance of composite filters during thermal shock loading.

  6. FATIGUE AND FRACTURE BEHAVIOR OF HIGH TEMPERATURE MATERIALS

    E-Print Network [OSTI]

    Ritchie, Robert

    for essentially unchanged between -250 and 13oooc, involving a softening and creep cavitation, which typically in such properties (8); however, in situ crystallization can provide an applications as gas turbines, piston engines

  7. Apparatus and method for monitoring underground fracturing

    DOE Patents [OSTI]

    Warpinski, Norman R. (Albuquerque, NM); Steinfort, Terry D. (Tijeras, NM); Branagan, Paul T. (Las Vegas, NV); Wilmer, Roy H. (Las Vegas, NV)

    1999-08-10T23:59:59.000Z

    An apparatus and method for measuring deformation of a rock mass around the vicinity of a fracture, commonly induced by hydraulic fracturing is provided. To this end, a well is drilled offset from the proposed fracture region, if no existing well is present. Once the well is formed to a depth approximately equal or exceeding the depth of the proposed fracture, a plurality of inclinometers, for example tiltmeters, are inserted downhole in the well. The inclinometers are located both above and below the approximate depth of the proposed fracture. The plurality of inclinometers may be arranged on a wireline that may be retrieved from the downhole portion of the well and used again or, alternatively, the inclinometers may be cemented in place. In either event, the inclinometers are used to measure the deformation of the rock around the induced fracture.

  8. Apparatus and method for monitoring underground fracturing

    DOE Patents [OSTI]

    Warpinski, N.R.; Steinfort, T.D.; Branagan, P.T.; Wilmer, R.H.

    1999-08-10T23:59:59.000Z

    An apparatus and method for measuring deformation of a rock mass around the vicinity of a fracture, commonly induced by hydraulic fracturing is provided. To this end, a well is drilled offset from the proposed fracture region, if no existing well is present. Once the well is formed to a depth approximately equal or exceeding the depth of the proposed fracture, a plurality of inclinometers, for example tiltmeters, are inserted downhole in the well. The inclinometers are located both above and below the approximate depth of the proposed fracture. The plurality of inclinometers may be arranged on a wireline that may be retrieved from the downhole portion of the well and used again or, alternatively, the inclinometers may be cemented in place. In either event, the inclinometers are used to measure the deformation of the rock around the induced fracture. 13 figs.

  9. Wellbore cement fracture evolution at the cement–basalt caprock interface during geologic carbon sequestration

    SciTech Connect (OSTI)

    Jung, Hun Bok; Kabilan, Senthil; Carson, James P.; Kuprat, Andrew P.; Um, Wooyong; Martin, Paul F.; Dahl, Michael E.; Kafentzis, Tyler A.; Varga, Tamas; Stephens, Sean A.; Arey, Bruce W.; Carroll, KC; Bonneville, Alain; Fernandez, Carlos A.

    2014-08-01T23:59:59.000Z

    Composite Portland cement-basalt caprock cores with fractures, as well as neat Portland cement columns, were prepared to understand the geochemical and geomechanical effects on the integrity of wellbores with defects during geologic carbon sequestration. The samples were reacted with CO2-saturated groundwater at 50 ºC and 10 MPa for 3 months under static conditions, while one cement-basalt core was subjected to mechanical stress at 2.7 MPa before the CO2 reaction. Micro-XRD and SEM-EDS data collected along the cement-basalt interface after 3-month reaction with CO2-saturated groundwater indicate that carbonation of cement matrix was extensive with the precipitation of calcite, aragonite, and vaterite, whereas the alteration of basalt caprock was minor. X-ray microtomography (XMT) provided three-dimensional (3-D) visualization of the opening and interconnection of cement fractures due to mechanical stress. Computational fluid dynamics (CFD) modeling further revealed that this stress led to the increase in fluid flow and hence permeability. After the CO2-reaction, XMT images displayed that calcium carbonate precipitation occurred extensively within the fractures in the cement matrix, but only partially along the fracture located at the cement-basalt interface. The 3-D visualization and CFD modeling also showed that the precipitation of calcium carbonate within the cement fractures after the CO2-reaction resulted in the disconnection of cement fractures and permeability decrease. The permeability calculated based on CFD modeling was in agreement with the experimentally determined permeability. This study demonstrates that XMT imaging coupled with CFD modeling represent a powerful tool to visualize and quantify fracture evolution and permeability change in geologic materials and to predict their behavior during geologic carbon sequestration or hydraulic fracturing for shale gas production and enhanced geothermal systems.

  10. Investigation of the effect of gel residue on hydraulic fracture conductivity using dynamic fracture conductivity test

    E-Print Network [OSTI]

    Marpaung, Fivman

    2008-10-10T23:59:59.000Z

    conductivity is created when proppant slurry is pumped into a hydraulic fracture in low permeability rock. Unlike conventional fracture conductivity tests in which proppant is loaded into the fracture artificially, we pump proppant/ fracturing fluid slurries... different or special methods for completion, stimulation, and/or production techniques to retrieve the resource. Natural gas from coal or coal bed methane, tight gas sands, shale gas, and gas hydrates are all examples of unconventional gas reservoirs...

  11. Method of fracturing a geological formation

    DOE Patents [OSTI]

    Johnson, James O. (2679-B Walnut, Los Alamos, NM 87544)

    1990-01-01T23:59:59.000Z

    An improved method of fracturing a geological formation surrounding a well bore is disclosed. A relatively small explosive charge is emplaced in a well bore and the bore is subsequently hydraulically pressurized to a pressure less than the formation breakdown pressure and preferably greater than the fracture propagation pressure of the formation. The charge is denoted while the bore is so pressurized, resulting in the formation of multiple fractures in the surrounding formation with little or no accompanying formation damage. Subsequent hydraulic pressurization can be used to propagate and extend the fractures in a conventional manner. The method is useful for stimulating production of oil, gas and possibly water from suitable geologic formations.

  12. Regional Analysis And Characterization Of Fractured Aquifers...

    Open Energy Info (EERE)

    Regional Analysis And Characterization Of Fractured Aquifers In The Virginia Blue Ridge And Piedmont Provinces Jump to: navigation, search OpenEI Reference LibraryAdd to library...

  13. Wave Propagation in Fractured Poroelastic Media

    E-Print Network [OSTI]

    2014-06-22T23:59:59.000Z

    Wave Propagation in Fractured. Poroelastic Media. WCCM, Barcelona, Spain, July 2014. Juan E. Santos,. 1. 1. Instituto del Gas y del Petr´oleo (IGPUBA), UBA,

  14. Fracturing technology poised for rapid advancement

    SciTech Connect (OSTI)

    Von Flatern, R.

    1993-10-01T23:59:59.000Z

    This paper summarizes the advances and current status of hydraulic fracturing and the industry's ability to design and predict the results. Although modeling techniques have improved over the years, there still is no model which can be considered very reliable. The paper considers alternatives to help improve the reliability of these models such as on-site quality control. This quality control aspect entails the site-specific tailoring of a fracturing fluid to be better suited for the target fracturing zone environment and adjusting the fluid properties accordingly. It also entails various methods for fluid injection and placement of propping agents. Some future trends in hydraulic fracturing are also discussed.

  15. Fracture permeability and seismic wave scattering ŒPoroelastic ...

    E-Print Network [OSTI]

    Seiji Nakagawa

    2010-02-03T23:59:59.000Z

    Jun 18, 2010 ... The new model contains fracture permeability in the plan-parallel direction. ... Division of Chemical Sciences of the U.S. Department of Energy ...

  16. Geothermal: Sponsored by OSTI -- Fracture Characterization in...

    Office of Scientific and Technical Information (OSTI)

    Fracture Characterization in Enhanced Geothermal Systems by Wellbore and Reservoir Analysis Geothermal Technologies Legacy Collection HelpFAQ | Site Map | Contact Us | Admin Log...

  17. Seismic Fracture Characterization Methods for Enhanced Geothermal...

    Broader source: Energy.gov (indexed) [DOE]

    5 4.5.2 Seismic Fracture Characterization Methods for Enhanced Geothermal Systems Presentation Number: 022 Investigator: Queen, John (Hi-Q Geophysical Inc.) Objectives: To develop...

  18. Microseismic Tracer Particles for Hydraulic Fracturing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    The trend toward production of hydrocarbons from unconventional reservoirs (tight gas, shale oilgas) has caused a large increase in the use of hydraulic fracture stimulation of...

  19. Fracture testing and performance of beryllium copper alloy C17510

    SciTech Connect (OSTI)

    Murray, H.A.; Zatz, I.J.

    1994-05-01T23:59:59.000Z

    When a literature search and discussion with manufacturers revealed that there was virtually no existing data related to the fracture properties and behavior of copper beryllium alloy C17510, a series of test programs was undertaken to ascertain this information for several variations in material processing and chemistry. These variations in C17510 were primarily optimized for combinations of strength and conductivity. While originally intended for use as cyclically loaded high-field, high-strength conductors in fusion energy research, material testing of C17510 has indicated that it is an attractive and economical alternative for a host of other structural, mechanical and electrical applications. ASTM tests performed on three variations of C17510 alloys included both J-integral and plane strain fracture toughness testing and fatigue crack growth rate tests, as well as verifying tensile, hardness, Charpy, and other well defined mechanical properties. Fracture testing was performed at both room and liquid nitrogen temperatures, which bound the thermal environment anticipated for the fusion components being designed. Fatigue crack propagation stress ratios ranged from nominal zero to minus one at each temperature. In order to confirm the test results, duplicate and independent test programs were awarded to separate facilities with appropriate test experience, whenever possible. The primary goal of the test program, to determine and bound the fracture toughness and Paris constants for C17510,was accomplished. In addition, a wealth of information was accumulated pertaining to crack growth characteristics, effects of directionality and potential testing pitfalls. The paper discusses the test program and its findings in detail.

  20. Bone Mineral Density, Bone Turnover, and Systemic Inflammation in Non-cirrhotics with Chronic Hepatitis C

    E-Print Network [OSTI]

    Lai, J; Shoback, DMA; Zipperstein, J; Lizaola, B; Tseng, S; Terrault, NA

    2015-01-01T23:59:59.000Z

    Mun˜oz-Torres M, et al. Bone mineral density, serum insulin-et al. Osteoporosis and bone mineral metabolism disorders in1069-9. 11. George J. Bone mineral density and disorders of

  1. Double torsion testing and finite element analysis for determining the electric fracture properties of piezoelectric ceramics

    SciTech Connect (OSTI)

    Shindo, Yasuhide; Narita, Fumio; Mikami, Masaru [Department of Materials Processing, Graduate School of Engineering, Tohoku University, Aoba-yama 6-6-02, Sendai 980-8579 (Japan)

    2005-06-01T23:59:59.000Z

    This paper presents the results of an experimental and numerical investigation in electric fracture behavior of composite [Pb(Zr,Ti)O{sub 3}] double torsion (DT) specimens. DT tests were conducted on a commercial piezoelectric ceramic bonded between two metals. Fracture loads under different electric fields were obtained from the experiment. Nonlinear three-dimensional finite element analysis was also employed to calculate the energy release rate for DT specimens based on the exact (permeable) and approximate (impermeable) crack models. The effects of applied electric field and domain switching on the energy release rate are discussed, and the model predictions are compared with the results of the experiments.

  2. Stress- and Chemistry-Mediated Permeability Enhancement/Degradation in Stimulated Critically-Stressed Fractures

    SciTech Connect (OSTI)

    Derek Elsworth; Abraham S. Grader; Chris Marone; Phillip Halleck; Peter Rose; Igor Faoro; Joshua Taron; André Niemeijer; Hideaki Yasuhara

    2009-03-30T23:59:59.000Z

    This work has investigated the interactions between stress and chemistry in controlling the evolution of permeability in stimulated fractured reservoirs through an integrated program of experimentation and modeling. Flow-through experiments on natural and artificial fractures in Coso diorite have examined the evolution of permeability under paths of mean and deviatoric stresses, including the role of dissolution and precipitation. Models accommodating these behaviors have examined the importance of incorporating the complex couplings between stress and chemistry in examining the evolution of permeability in EGS reservoirs. This document reports the findings of experiment [1,2] and analysis [3,4], in four sequential chapters.

  3. The Role of Acidizing in Proppant Fracturing in Carbonate Reservoirs

    E-Print Network [OSTI]

    Densirimongkol, Jurairat

    2010-10-12T23:59:59.000Z

    in fracture conductivity and unsuccessful stimulation treatment. In early years, because of the increase in the success of proppant fracturing, proppant partial monolayer has been put forward as a method that helps generate the maximum fracture conductivity...

  4. Seismic characterization of fractured reservoirs using 3D double beams

    E-Print Network [OSTI]

    Zheng, Yingcai

    2012-01-01T23:59:59.000Z

    We propose an efficient target-oriented method to characterize seismic properties of fractured reservoirs: the spacing between fractures and the fracture orientation. We use both singly scattered and multiply scattered ...

  5. Efficient Double-Beam Characterization for Fractured Reservoir

    E-Print Network [OSTI]

    Zheng, Yingcai

    We proposed an efficient target-oriented method to characterize seismic properties of fractured reservoirs: the spacing between fractures and the fracture orientation. Based on the diffraction theory, the scattered wave ...

  6. Incorporating Rigorous Height Determination into Unified Fracture Design

    E-Print Network [OSTI]

    Pitakbunkate, Termpan

    2010-10-12T23:59:59.000Z

    to find the maximum productivity index for a given proppant amount. Then, the dimensionless fracture conductivity index corresponding to the maximum productivity index can be computed. The penetration ration, the fracture length, and the propped fracture...

  7. Studying Hydraulic Fracturing through Time-variant Seismic Anisotropy

    E-Print Network [OSTI]

    Liu, Qifan

    2013-10-01T23:59:59.000Z

    . Studying seismic anisotropy by shear wave splitting can help us better understand the relationship between hydraulic fracturing and fracture systems. Shear wave splitting can be caused by fracturing and also can naturally take place in most sedimentary...

  8. Ductile fracture modeling : theory, experimental investigation and numerical verification

    E-Print Network [OSTI]

    Xue, Liang, 1973-

    2007-01-01T23:59:59.000Z

    The fracture initiation in ductile materials is governed by the damaging process along the plastic loading path. A new damage plasticity model for ductile fracture is proposed. Experimental results show that fracture ...

  9. INJECTION AND THERMAL BREAKTHROUGH IN FRACTURED GEOTHERMAL RESERVOIRS

    E-Print Network [OSTI]

    Bodvarsson, Gudmundur S.

    2012-01-01T23:59:59.000Z

    injection into a fractured reservoir system. A reservoirIn the case of fractured reservoirs, Equations (25) and (26)c ww q a >> For fractured reservoirs, the former expression

  10. Laboratory-scale fracture conductivity created by acid etching 

    E-Print Network [OSTI]

    Pournik, Maysam

    2009-05-15T23:59:59.000Z

    Success of acid fracturing treatment depends greatly on the created conductivity under closure stress. In order to have sufficient conductivity, the fracture face must be non-uniformly etched while the fracture strength maintained to withstand...

  11. Biomimetic hydroxyapatite as a new consolidating agent for archaeological bone

    E-Print Network [OSTI]

    North, Alexis

    2014-01-01T23:59:59.000Z

    R.E.M.  2002.  “Bone  Diagenesis:  An  Overview  of  2000.  “Patterns  of  Diagenesis  in  Bone  I:  The  element  Studies  of  Diagenesis  in  Prehistoric  Bone. ”  

  12. Field-Scale Effective Matrix Diffusion Coefficient for Fractured Rock: Results From Literature Survey

    E-Print Network [OSTI]

    Zhou, Quanlin; Liu, Hui Hai; Molz, Fred J.; Zhang, Yingqi; Bodvarsson, Gudmundur S.

    2008-01-01T23:59:59.000Z

    Dispersed fluid flow in fractured reservoirs: An analysis ofa hydraulically fractured granite geothermal reservoir, Soc.

  13. Aligned vertical fractures, HTI reservoir symmetry, and Thomsen seismic anisotropy parameters

    E-Print Network [OSTI]

    Berryman, James G.

    2008-01-01T23:59:59.000Z

    seismic parameters for fractured reservoirs when the crackin a naturally fractured gas reservoir, The Leading Edge,

  14. Numerical Modeling of Fracture Permeability Change in Naturally Fractured Reservoirs Using a Fully Coupled Displacement Discontinuity Method.

    E-Print Network [OSTI]

    Tao, Qingfeng

    2010-07-14T23:59:59.000Z

    finite difference method to solve the fluid flow in fractures, a fully coupled displacement discontinuity method to build the global relation of fracture deformation, and the Barton-Bandis model of fracture deformation to build the local relation...

  15. active fracture model: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    porosity of naturally fractured reservoirs with no matrix porosity using stochastic fractal models Texas A&M University - TxSpace Summary: Determining fracture characteristics...

  16. Detecting Fractures Using Technology at High Temperatures and...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Detecting Fractures Using Technology at High Temperatures and Depths - Geothermal Ultrasonic Fracture Imager (GUFI); 2010 Geothermal Technology Program Peer Review Report Detecting...

  17. Images of Fracture Sustainability Test on Stripa Granite

    SciTech Connect (OSTI)

    Tim Kneafsey

    2014-05-11T23:59:59.000Z

    Images of the Stripa Granite core before and after the fracture sustainability test. Photos of fracture faces of Stripa Granite core.

  18. Detecting Fractures Using Technology at High Temperatures and...

    Broader source: Energy.gov (indexed) [DOE]

    7 4.4.1 Detecting Fractures Using Technology at High Temperatures and Depths - Geothermal Ultrasonic Fracture Imager (GUFI) Presentation Number: 015 Investigator: Patterson, Doug...

  19. Images of Fracture Sustainability Test on Stripa Granite

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Tim Kneafsey

    Images of the Stripa Granite core before and after the fracture sustainability test. Photos of fracture faces of Stripa Granite core.

  20. acetabular internal fracture: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    stiness and uid ow L Lafayette, IN 47907-1397, USA Accepted 7 October 1999 Abstract Fracture specic stiness and uid ow through a single fracture under...

  1. age fracture mechanics: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    stiness and uid ow L Lafayette, IN 47907-1397, USA Accepted 7 October 1999 Abstract Fracture specic stiness and uid ow through a single fracture under...

  2. alloys fracture mechanics: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    stiness and uid ow L Lafayette, IN 47907-1397, USA Accepted 7 October 1999 Abstract Fracture specic stiness and uid ow through a single fracture under...

  3. applying fracture mechanics: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    stiness and uid ow L Lafayette, IN 47907-1397, USA Accepted 7 October 1999 Abstract Fracture specic stiness and uid ow through a single fracture under...

  4. advanced fracture characterization: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    stiness and uid ow L Lafayette, IN 47907-1397, USA Accepted 7 October 1999 Abstract Fracture specic stiness and uid ow through a single fracture under...

  5. Identification of MHF Fracture Planes and Flow Paths- a Correlation...

    Open Energy Info (EERE)

    flow paths. We applied this technique to seismic data collected during a massive hydraulic fracturing (MHF) treatment and found that the fracture planes determined by the...

  6. Fracture Evolution Following a Hydraulic Stimulation within an...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Evolution Following a Hydraulic Stimulation within an EGS Reservoir Fracture Evolution Following a Hydraulic Stimulation within an EGS Reservoir Fracture Evolution Following a...

  7. Monitoring of Fracture Cri0cal Steel Bridges

    E-Print Network [OSTI]

    Minnesota, University of

    #12;Monitoring of Fracture Cri0cal Steel Bridges: Acous0c Emission Sensors system on other fracture cri0cal steel bridges #12;Project Impact #12;Thank

  8. Characterizing Fractures in the Geysers Geothermal Field by Micro...

    Broader source: Energy.gov (indexed) [DOE]

    Characterizing Fractures in the Geysers Geothermal Field by Micro-seismic Data, Using Soft Computing, Fractals, and Shear Wave Anisotropy Characterizing Fractures in the Geysers...

  9. Joint inversion of electrical and seismic data for Fracture char...

    Broader source: Energy.gov (indexed) [DOE]

    Joint inversion of electrical and seismic data for Fracture char. and Imaging of Fluid Flow in Geothermal Systems Joint inversion of electrical and seismic data for Fracture char....

  10. METHOD DEVELOPMENT FOR DETERMINING THE HYDRAULIC CONDUCTIVITY OF FRACTURED POROUS MEDIA

    SciTech Connect (OSTI)

    Dixon, K.

    2013-09-30T23:59:59.000Z

    Plausible, but unvalidated, theoretical model constructs for unsaturated hydraulic conductivity of fractured porous media are currently used in Performance Assessment (PA) modeling for cracked saltstone and concrete (Flach 2011). The Nuclear Regulatory Commission (NRC) has expressed concern about the lack of model support for these assumed Moisture Characteristic Curves (MCC) data, as noted in Requests for Additional Information (RAIs) PA-8 and SP-4 (Savannah River Remediation, LLC, 2011). The objective of this task was to advance PA model support by developing an experimental method for determining the hydraulic conductivity of fractured cementitious materials under unsaturated conditions, and to demonstrate the technique on fractured saltstone samples. The task was requested through Task Technical Request (TTR) HLW-SSF-TTR-2012-0016 and conducted in accordance with Task Technical & Quality Assurance Plan (TTQAP) SRNL-TR-2012-00090. Preliminary method development previously conducted by Kohn et al. (2012) identified transient outflow extraction as the most promising method for characterizing the unsaturated properties of fractured porous media. While the research conducted by Kohn et al. (2012) focused on fractured media analogs such as stacked glass slides, the current task focused directly on fractured saltstone. For this task, four sample types with differing fracture geometries were considered: 1) intact saltstone, 2) intact saltstone with a single saw cut, smooth surface fracture, 3) micro-fractured saltstone (induced by oven drying), and 4) micro-fractured saltstone with a single, fully-penetrating, rough-surface fracture. Each sample type was tested initially for saturated hydraulic conductivity following method ASTM D 5084 using a flexible wall permeameter. Samples were subsequently tested using the transient outflow extraction method to determine cumulative outflow as a function of time and applied pressure. Of the four sample types tested, two yielded datasets suitable for analysis (sample types 3 and 4). The intact saltstone sample (sample type 1) did not yield any measureable outflow over the pressure range of the outflow test (0-1000 cm H{sub 2}O). This was expected because the estimated air entry pressure for intact saltstone is on the order of 100,000 cm H{sub 2}O (Dixon et al., 2009). The intact saltstone sample with a single saw cut smooth surface fracture (sample type 2) did not produce useable data because the fracture completely drained at less than 10 cm H{sub 2}O applied pressure. The cumulative outflow data from sample types 3 and 4 were analyzed using an inverse solution of the Richard’s equation for water flow in variably saturated porous media. This technique was implemented using the computer code Hydrus-1D (Šim?nek et al., 2008) and the resulting output included the van Genuchten-Mualem water retention and relative permeability parameters and predicted saturated hydraulic conductivity (Van Genuchten, 1980; Van Genuchten et al., 1991). Estimations of relative permeability and saturated conductivity are possible because the transient response of the sample to pressure changes is recorded during the multi-step outflow extraction test. Characteristic curves were developed for sample types 3 and 4 based on the results of the transient outflow method and compared to that of intact saltstone previously reported by Dixon et al. (2009). The overall results of this study indicate that the outflow extraction method is suitable for measuring the hydraulic properties of micro-fractured porous media. The resulting cumulative outflow data can be analyzed using the computer code Hydrus-1D to generate the van Genuchten curve fitting parameters that adequately describe fracture drainage. The resulting characteristic curves are consistent with blended characteristic curves that combine the behaviors of low pressure drainage associated with fracture flow with high pressure drainage from the bulk saltstone matrix.

  11. Modeling of Acid Fracturing in Carbonate Reservoirs

    E-Print Network [OSTI]

    Al Jawad, Murtada s

    2014-06-05T23:59:59.000Z

    equations are used to draw 3D velocity and pressure profiles. Part of the fluid diffuses or leaks off into the fracture walls and dissolves part of the fracture face according to the chemical reaction below. 2H^(+)(aq) + CO((2-)/3) ? H_(2 )CO_(3)(aq) ? CO...

  12. Accounting for Remaining Injected Fracturing Fluid 

    E-Print Network [OSTI]

    Zhang, Yannan

    2013-12-06T23:59:59.000Z

    The technology of multi-stage fracturing of horizontal wells made the development of shale gas reservoirs become greatly successful during the past decades. A large amount of fracturing fluid, usually from 53,000 bbls to 81,400 bbls, is injected...

  13. Accounting for Remaining Injected Fracturing Fluid

    E-Print Network [OSTI]

    Zhang, Yannan

    2013-12-06T23:59:59.000Z

    The technology of multi-stage fracturing of horizontal wells made the development of shale gas reservoirs become greatly successful during the past decades. A large amount of fracturing fluid, usually from 53,000 bbls to 81,400 bbls, is injected...

  14. Fracture of synthetic diamond M. D. Droty

    E-Print Network [OSTI]

    Ritchie, Robert

    of synthetic polycrystalline diamond make it a promising material for many structural applications studies on the fracture toughness of polycrystalline diamond,29 primarily due to the difficultiesFracture of synthetic diamond M. D. Droty Ctystallume, 3506 Bassett Street, Santa Clara, California

  15. Finite Conductivity Fractures in Elliptical Coordinates

    E-Print Network [OSTI]

    Stanford University

    TO THE DEPARTMENT OF PETROLEUM ENGINEERING AND THE COMMITTEE ON GRADUATE STUDIES OF STANFORD UNIVERSITY IN PARTIAL well performance. Indeed, a large number of wells, which could not otherwise be operated economically, it is important that means be available to evaluate fracture effectiveness. The most widely used tool in fracture

  16. Hydraulic fracturing slurry transport in horizontal pipes

    SciTech Connect (OSTI)

    Shah, S.N.; Lord, D.L. (Halliburton Services (US))

    1990-09-01T23:59:59.000Z

    Horizontal-well activity has increased throughout the industry in the past few years. To design a successful hydraulic fracturing treatment for horizontal wells, accurate information on the transport properties of slurry in horizontal pipe is required. Limited information exists that can be used to estimate critical deposition and resuspension velocities when proppants are transported in horizontal wells with non-Newtonian fracturing gels. This paper presents a study of transport properties of various hydraulic fracturing slurries in horizontal pipes. Flow data are gathered in three transparent horizontal pipes with different diameters. Linear and crosslinked fracturing gels were studied, and the effects of variables--e.g., pipe size; polymer-gelling-agent concentration; fluid rheological properties; crosslinking effects; proppant size, density, and concentrations; fluid density; and slurry pump rate--on critical deposition and resuspension velocities were investigated. Also, equations to estimate the critical deposition and resuspension velocities of fracturing gels are provided.

  17. Methodologies and new user interfaces to optimize hydraulic fracturing design and evaluate fracturing performance for gas wells 

    E-Print Network [OSTI]

    Wang, Wenxin

    2006-04-12T23:59:59.000Z

    This thesis presents and develops efficient and effective methodologies for optimal hydraulic fracture design and fracture performance evaluation. These methods incorporate algorithms that simultaneously optimize all of ...

  18. Use of fracture surface features to improve core description and fracture interpretation in Niobrara and Gallup formations, Colorado and New Mexico

    SciTech Connect (OSTI)

    Ward, B.J.; Petrusak, R.L.; Kulander, B.R. (Amoco Production Co. Research, Tulsa, OK (USA))

    1989-09-01T23:59:59.000Z

    The Niobrara formation in the Denver basin and the Gallup formation in the eastern San Juan Basin are very fine-grained, low-permeability reservoirs. Natural fracturing provides essential reservoir permeability. When natural and induced fractures are correctly identified in core, understanding of key fractured reservoir characteristics such as fracture spacing, fracture intensity, and fracture size improves greatly. For example, the Gallup has a significant amount of non-mineralized natural fractures which are generally difficult to identify in core as natural. If these fractures are misidentified as induced, fracture intensity may be underestimated and fracture spacing may be overestimated. Diagnostic fracture surface features are very well developed in the Gallup and Niobrara. Proper identification of induced fractures and nonmineralized natural fractures is done by examining these fracture surface features under oblique illumination. The Niobrara cores that were examined provide excellent examples of induced fractures. These cores have predominately mineral-filled and slickened natural fractures. Fracture surface features on the non-mineralized fractures positively identify these fractures as induced and demonstrate that nonmineralized natural fractures are a minor component of the reservoir. The Gallup cores provide excellent examples of the diagnostic surface features of natural fractures. Fractured intervals up to 20 ft long have been recovered in Gallup core. Multiple individual fractures which comprise the larger fractured intervals are identified using fracture surface morphology. This type of detailed fracture description improves evaluations of fractured reservoir quality in the Gallup formation.

  19. antidepressant-like behavioral effects: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Jelenkovi& apos; c 1996-01-01 145 Effect of resin toughness on fracture behavior of graphiteepoxy composites Texas A&M University - TxSpace Summary: applications. A fiber...

  20. Development of experimental verification techniques for non-linear deformation and fracture.

    SciTech Connect (OSTI)

    Moody, Neville Reid; Bahr, David F. (Washington State University, Pullman, WA)

    2003-12-01T23:59:59.000Z

    This project covers three distinct features of thin film fracture and deformation in which the current experimental technique of nanoindentation demonstrates limitations. The first feature is film fracture, which can be generated either by nanoindentation or bulge testing thin films. Examples of both tests will be shown, in particular oxide films on metallic or semiconductor substrates. Nanoindentations were made into oxide films on aluminum and titanium substrates for two cases; one where the metal was a bulk (effectively single crystal) material and the other where the metal was a 1 pm thick film grown on a silica or silicon substrate. In both cases indentation was used to produce discontinuous loading curves, which indicate film fracture after plastic deformation of the metal. The oxides on bulk metals fractures occurred at reproducible loads, and the tensile stress in the films at fracture were approximately 10 and 15 GPa for the aluminum and titanium oxides respectively. Similarly, bulge tests of piezoelectric oxide films have been carried out and demonstrate film fracture at stresses of only 100's of MPa, suggesting the importance of defects and film thickness in evaluating film strength. The second feature of concern is film adhesion. Several qualitative and quantitative tests exist today that measure the adhesion properties of thin films. A relatively new technique that uses stressed overlayers to measure adhesion has been proposed and extensively studied. Delamination of thin films manifests itself in the form of either telephone cord or straight buckles. The buckles are used to calculate the interfacial fracture toughness of the film-substrate system. Nanoindentation can be utilized if more energy is needed to initiate buckling of the film system. Finally, deformation in metallic systems can lead to non-linear deformation due to 'bursts' of dislocation activity during nanoindentation. An experimental study to examine the structure of dislocations around indentations has been carried out to demonstrate the effectiveness in evaluating cross slip and dislocation behavior around nanoindentation impressions in bulk engineering alloys.

  1. Statistical analysis of liquid seepage in partially saturated heterogeneous fracture systems

    SciTech Connect (OSTI)

    Liou, T.S.

    1999-12-01T23:59:59.000Z

    Field evidence suggests that water flow in unsaturated fracture systems may occur along fast preferential flow paths. However, conventional macroscale continuum approaches generally predict the downward migration of water as a spatially uniform wetting front subjected to strong inhibition into the partially saturated rock matrix. One possible cause of this discrepancy may be the spatially random geometry of the fracture surfaces, and hence, the irregular fracture aperture. Therefore, a numerical model was developed in this study to investigate the effects of geometric features of natural rock fractures on liquid seepage and solute transport in 2-D planar fractures under isothermal, partially saturated conditions. The fractures were conceptualized as 2-D heterogeneous porous media that are characterized by their spatially correlated permeability fields. A statistical simulator, which uses a simulated annealing (SA) algorithm, was employed to generate synthetic permeability fields. Hypothesized geometric features that are expected to be relevant for seepage behavior, such as spatially correlated asperity contacts, were considered in the SA algorithm. Most importantly, a new perturbation mechanism for SA was developed in order to consider specifically the spatial correlation near conditioning asperity contacts. Numerical simulations of fluid flow and solute transport were then performed in these synthetic fractures by the flow simulator TOUGH2, assuming that the effects of matrix permeability, gas phase pressure, capillary/permeability hysteresis, and molecular diffusion can be neglected. Results of flow simulation showed that liquid seepage in partially saturated fractures is characterized by localized preferential flow, along with bypassing, funneling, and localized ponding. Seepage pattern is dominated by the fraction of asperity contracts, and their shape, size, and spatial correlation. However, the correlation structure of permeability field is less important than the spatial correlation of asperity contacts. A faster breakthrough was observed in fractures subjected to higher normal stress, accompanied with a nonlinearly decreasing trend of the effective permeability. Interestingly, seepage dispersion is generally higher in fractures with intermediate fraction of asperity contacts; but it is lower for small or large fractions of asperity contacts. However, it may become higher if the ponding becomes significant. Transport simulations indicate that tracers bypass dead-end pores and travel along flow paths that have less flow resistance. Accordingly, tracer breakthrough curves generally show more spreading than breakthrough curves for water. Further analyses suggest that the log-normal time model generally fails to fit the breakthrough curves for water, but it is a good approximation for breakthrough curves for the tracer.

  2. Final Report - Advanced Conceptual Models for Unsaturated and Two-Phase Flow in Fractured Rock

    SciTech Connect (OSTI)

    Nicholl, Michael J.

    2006-07-10T23:59:59.000Z

    The Department of Energy Environmental Management Program is faced with two major issues involving two-phase flow in fractured rock; specifically, transport of dissolved contaminants in the Vadose Zone, and the fate of Dense Nonaqueous Phase Liquids (DNAPLs) below the water table. Conceptual models currently used to address these problems do not correctly include the influence of the fractures, thus leading to erroneous predictions. Recent work has shown that it is crucial to understand the topology, or ''structure'' of the fluid phases (air/water or water/DNAPL) within the subsurface. It has also been shown that even under steady boundary conditions, the influence of fractures can lead to complex and dynamic phase structure that controls system behavior, with or without the presence of a porous rock matrix. Complicated phase structures within the fracture network can facilitate rapid transport, and lead to a sparsely populated and widespread distribution of concentrated contaminants; these qualities are highly difficult to describe with current conceptual models. The focus of our work is to improve predictive modeling through the development of advanced conceptual models for two-phase flow in fractured rock.

  3. Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair Compared to the Trochlea in a

    E-Print Network [OSTI]

    Buschmann, Michael

    Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair femoral condylar (MFC) versus femoral trochlear (TR) defects 3 months after bone marrow stimulation: cartilage repair; medial femoral condyle; trochlea; bone marrow stimulation; meniscus degeneration Articular

  4. Positive modulator of bone morphogenic protein-2

    DOE Patents [OSTI]

    Zamora, Paul O. (Gaithersburg, MD); Pena, Louis A. (Poquott, NY); Lin, Xinhua (Plainview, NY); Takahashi, Kazuyuki (Germantown, MD)

    2009-01-27T23:59:59.000Z

    Compounds of the present invention of formula I and formula II are disclosed in the specification and wherein the compounds are modulators of Bone Morphogenic Protein activity. Compounds are synthetic peptides having a non-growth factor heparin binding region, a linker, and sequences that bind specifically to a receptor for Bone Morphogenic Protein. Uses of compounds of the present invention in the treatment of bone lesions, degenerative joint disease and to enhance bone formation are disclosed.

  5. Fracture-resistant lanthanide scintillators

    DOE Patents [OSTI]

    Doty, F. Patrick (Livermore, CA)

    2011-01-04T23:59:59.000Z

    Lanthanide halide alloys have recently enabled scintillating gamma ray spectrometers comparable to room temperature semiconductors (<3% FWHM energy resolutions at 662 keV). However brittle fracture of these materials upon cooling hinders the growth of large volume crystals. Efforts to improve the strength through non-lanthanide alloy substitution, while preserving scintillation, have been demonstrated. Isovalent alloys having nominal compositions of comprising Al, Ga, Sc, Y, and In dopants as well as aliovalent alloys comprising Ca, Sr, Zr, Hf, Zn, and Pb dopants were prepared. All of these alloys exhibit bright fluorescence under UV excitation, with varying shifts in the spectral peaks and intensities relative to pure CeBr.sub.3. Further, these alloys scintillate when coupled to a photomultiplier tube (PMT) and exposed to .sup.137Cs gamma rays.

  6. High Energy Gas Fracturing Test

    SciTech Connect (OSTI)

    Schulte, R.

    2001-02-27T23:59:59.000Z

    The Rocky Mountain Oilfield Testing Center (RMOTC) has recently completed two tests of a high-energy gas fracturing system being developed by Western Technologies of Crossville, Tennessee. The tests involved the use of two active wells located at the Naval Petroleum Reserve No. 3 (NPR-3), thirty-five miles north of Casper, Wyoming (See Figure 1). During the testing process the delivery and operational system was enhanced by RMOTC, Western Technologies, and commercial wireline subcontractors. RMOTC has assisted an industrial client in developing their technology for high energy gas fracturing to a commercial level. The modifications and improvements implemented during the technology testing process are instrumental in all field testing efforts at RMOTC. The importance of well selection can also be critical in demonstrating the success of the technology. To date, significant increases in well productivity have been clearly proven in well 63-TPX-10. Gross fluid production was initially raised by a factor of three. Final production rates increased by a factor of six with the use of a larger submersible pump. Well productivity (bbls of fluid per foot of drawdown) increased by a factor of 15 to 20. The above results assume that no mechanical damage has occurred to the casing or cast iron bridge plug which could allow well production from the Tensleep ''B'' sand. In the case of well 61-A-3, a six-fold increase in total fluid production was seen. Unfortunately, the increase is clouded by the water injection into the well that was necessary to have a positive fluid head on the propellant tool. No significant increase in oil production was seen. The tools which were retrieved from both 63-TPX-10 and 61-A-3 indicated a large amount of energy, similar to high gram perforating, had been expended downhole upon the formation face.

  7. Characterization of the effects of x-ray irradiation on the hierarchical structure and mechanical properties of human cortical bone

    SciTech Connect (OSTI)

    Barth, Holly; Zimmermann, Elizabeth; Schaible, Eric; Tang, Simon; Alliston, Tamara; Ritchie, Robert

    2011-08-19T23:59:59.000Z

    Bone comprises a complex structure of primarily collagen, hydroxyapatite and water, where each hierarchical structural level contributes to its strength, ductility and toughness. These properties, however, are degraded by irradiation, arising from medical therapy or bone-allograft sterilization. We provide here a mechanistic framework for how irradiation affects the nature and properties of human cortical bone over a range of characteristic (nano to macro) length-scales, following x-­ray exposures up to 630 kGy. Macroscopically, bone strength, ductility and fracture resistance are seen to be progressively degraded with increasing irradiation levels. At the micron-­scale, fracture properties, evaluated using in-situ scanning electron microscopy and synchrotron x-ray computed micro-tomography, provide mechanistic information on how cracks interact with the bone-matrix structure. At sub-micron scales, strength properties are evaluated with in-situ tensile tests in the synchrotron using small-/wide-angle x-ray scattering/diffraction, where strains are simultaneously measured in the macroscopic tissue, collagen fibrils and mineral. Compared to healthy bone, results show that the fibrillar strain is decreased by ~40% following 70 kGy exposures, consistent with significant stiffening and degradation of the collagen. We attribute the irradiation-­induced deterioration in mechanical properties to mechanisms at multiple length-scales, including changes in crack paths at micron-­scales, loss of plasticity from suppressed fibrillar sliding at sub-­micron scales, and the loss and damage of collagen at the nano-­scales, the latter being assessed using Raman and Fourier-Transform-Infrared spectroscopy and a fluorometric assay.

  8. Coupling schemes for modeling hydraulic fracture propagation using the XFEM

    E-Print Network [OSTI]

    Peirce, Anthony

    Coupling schemes for modeling hydraulic fracture propagation using the XFEM Elizaveta Gordeliy of hydraulic fractures in an elastic medium. With appropriate enrichment, the XFEM resolves the Neumann(h) accuracy. For hydraulic fracture problems with a lag separating the uid front from the fracture front, we

  9. Calibration of hydraulic and tracer tests in fractured media

    E-Print Network [OSTI]

    Politècnica de Catalunya, Universitat

    Calibration of hydraulic and tracer tests in fractured media represented by a DFN Model L. D. Donado, X. Sanchez-Vila, E. Ruiz* & F. J. Elorza** * Enviros Spain S.L. ** UPM #12;Fractured Media Water flows through fractures (matrix basically impervious ­ though relevant to transport) Fractures at all

  10. Hydromechanical modeling of pulse tests that measure both fluidpressure and fracture-normal displacement of the Coaraze Laboratory site,France

    SciTech Connect (OSTI)

    Cappa, F.; Guglielmi, Y.; Rutqvist, J.; Tsang, C-F.; Thoraval, A.

    2006-04-22T23:59:59.000Z

    In situ fracture mechanical deformation and fluid flowinteractions are investigated through a series of hydraulic pulseinjection tests, using specialized borehole equipment that cansimultaneously measure fluid pressure and fracture displacements. Thetests were conducted in two horizontal boreholes spaced one meter apartvertically and intersecting a near-vertical highly permeable faultlocated within a shallow fractured carbonate rock. The field data wereevaluated by conducting a series of coupled hydromechanical numericalanalyses, using both distinct-element and finite-element modelingtechniques and both two- and three-dimensional model representations thatcan incorporate various complexities in fracture network geometry. Oneunique feature of these pulse injection experiments is that the entiretest cycle, both the initial pressure increase and subsequent pressurefall-off, is carefully monitored and used for the evaluation of the insitu hydromechanical behavior. Field test data are evaluated by plottingfracture normal displacement as a function of fluid pressure, measured atthe same borehole. The resulting normal displacement-versus-pressurecurves show a characteristic loop, in which the paths for loading(pressure increase) and unloading (pressure decrease) are different. Bymatching this characteristic loop behavior, the fracture normal stiffnessand an equivalent stiffness (Young's modulus) of the surrounding rockmass can be back-calculated. Evaluation of the field tests by couplednumerical hydromechanical modeling shows that initial fracture hydraulicaperture and normal stiffness vary by a factor of 2 to 3 for the twomonitoring points within the same fracture plane. Moreover, the analysesshow that hydraulic aperture and the normal stiffness of the pulse-testedfracture, the stiffness of surrounding rock matrix, and the propertiesand geometry of the surrounding fracture network significantly affectcoupled hydromechanical responses during the pulse injection test. Morespecifically, the pressure-increase path of the normaldisplacement-versus-pressure curve is highly dependent on thehydromechanical parameters of the tested fracture and the stiffness ofthe matrix near the injection point, whereas the pressure-decrease pathis highly influenced by mechanical processes within a larger portion ofthe surrounding fractured rock.

  11. Evaluation and Effect of Fracturing Fluids on Fracture Conductivity in Tight Gas Reservoirs Using Dynamic Fracture Conductivity Test

    E-Print Network [OSTI]

    Correa Castro, Juan

    2011-08-08T23:59:59.000Z

    make necessary continuous efforts to reduce costs and improve efficiency in all aspects of drilling, completion and production techniques. Many of the recent improvements have been in well completions and hydraulic fracturing. Thus, the main goal of a...

  12. Fracture toughness of the IEA heat of F82H ferritic/martensitic stainless steel as a function of loading mode

    SciTech Connect (OSTI)

    Li, Huaxin; Gelles, D.S. [Pacific Northwest Labs., Richland, WA (United States); Hirth, J.P. [Washington State Univ., Pullman, WA (United States)] [and others

    1997-04-01T23:59:59.000Z

    Mode I and mixed-mode I/III fracture toughness tests were performed for the IEA heat of the reduced activation ferritic/martensitic stainless steel F82H at ambient temperature in order to provide comparison with previous measurements on a small heat given a different heat treatment. The results showed that heat to heat variations and heat treatment had negligible consequences on Mode I fracture toughness, but behavior during mixed-mode testing showed unexpected instabilities.

  13. Simulation of fluid flow mechanisms in high permeability zones (Super-K) in a giant naturally fractured carbonate reservoir

    E-Print Network [OSTI]

    Abu-Hassoun, Amer H.

    2009-05-15T23:59:59.000Z

    and fractures were treated as two systems. Reservoir management practices and decisions should be very carefully reviewed and executed in this dual continuum reservoir based on the results of this work. Studying this dual media flow behavior is vital for better...

  14. Nonlinear resonant ultrasound spectroscopy (NRUS) applied to damage assessment in bone

    E-Print Network [OSTI]

    Alamos National Laboratory of the University of California, Los Alamos, New Mexico 87545 Received 25 May NRUS is a resonance-based technique exploiting the significant nonlinear behavior of damaged materials obtained through the measurement of bone mineral density BMD obtained from x-ray densitometric techniques.1

  15. A method for calibration of bone driver transducers to measure the mastoid Reggie Weece a

    E-Print Network [OSTI]

    Allen, Jont

    2010 Available online xxxx a b s t r a c t When using bone vibrator transducers for clinical a circuit model of the driver, describing it with three frequency-dependent parameters. Once these three circuit model is proposed to better capture the observed behaviors. Ã? 2010 Published by Elsevier B.V. 1

  16. Sex Differences in Long Bone Fatigue Using a Rat Model Luisa D. Moreno,1

    E-Print Network [OSTI]

    Waldman, Stephen D.

    response to fatigue, we also determined the creep that occurred during the fatigue test. From the creep progress (Fig. 1). Caler and Carter32 studied cortical bone creep behavior during fatigue testing. When adaptation. From these results, we hypothesized that creep was the underlying mechanism that accounted

  17. 3-D description of fracture surfaces and stress-sensitivity analysis for naturally fractured reservoirs

    SciTech Connect (OSTI)

    Zhang, S.Q.; Jioa, D.; Meng, Y.F.; Fan, Y.

    1997-08-01T23:59:59.000Z

    Three kinds of reservoir cores (limestone, sandstone, and shale with natural fractures) were used to study the effect of morphology of fracture surfaces on stress sensitivity. The cores, obtained from the reservoirs with depths of 2170 to 2300 m, have fractures which are mated on a large scale, but unmated on a fine scale. A specially designed photoelectric scanner with a computer was used to describe the topography of the fracture surfaces. Then, theoretical analysis of the fracture closure was carried out based on the fracture topography generated. The scanning results show that the asperity has almost normal distributions for all three types of samples. For the tested samples, the fracture closure predicted by the elastic-contact theory is different from the laboratory measurements because plastic deformation of the aspirates plays an important role under the testing range of normal stresses. In this work, the traditionally used elastic-contact theory has been modified to better predict the stress sensitivity of reservoir fractures. Analysis shows that the standard deviation of the probability density function of asperity distribution has a great effect on the fracture closure rate.

  18. The prevalence of radiographic vertebral fractures in Mexican men

    E-Print Network [OSTI]

    Clark, P.; Cons-Molina, F.; Deleze, M.; Talavera, J. O.; Palermo, L.; Cummings, S. O.

    2010-01-01T23:59:59.000Z

    for postmenopausal osteoporosis. Report of a WHO StudyChina: the Beijing Osteoporosis Project. J Bone Miner Resthe European Prospective Osteoporosis Study (EPOS). J Bone

  19. Universal asymptotic umbrella for hydraulic fracture modeling

    E-Print Network [OSTI]

    Linkov, Aleksandr M

    2014-01-01T23:59:59.000Z

    The paper presents universal asymptotic solution needed for efficient modeling of hydraulic fractures. We show that when neglecting the lag, there is universal asymptotic equation for the near-front opening. It appears that apart from the mechanical properties of fluid and rock, the asymptotic opening depends merely on the local speed of fracture propagation. This implies that, on one hand, the global problem is ill-posed, when trying to solve it as a boundary value problem under a fixed position of the front. On the other hand, when properly used, the universal asymptotics drastically facilitates solving hydraulic fracture problems (both analytically and numerically). We derive simple universal asymptotics and comment on their employment for efficient numerical simulation of hydraulic fractures, in particular, by well-established Level Set and Fast Marching Methods.

  20. Gas condensate damage in hydraulically fractured wells

    E-Print Network [OSTI]

    Adeyeye, Adedeji Ayoola

    2004-09-30T23:59:59.000Z

    Company. The well was producing a gas condensate reservoir and questions were raised about how much drop in flowing bottomhole pressure below dewpoint would be appropriate. Condensate damage in the hydraulic fracture was expected to be of significant...

  1. Geomechanical review of hydraulic fracturing technology

    E-Print Network [OSTI]

    Arop, Julius Bankong

    2013-01-01T23:59:59.000Z

    Hydraulic fracturing as a method for recovering unconventional shale gas has been around for several decades. Significant research and improvement in field methods have been documented in literature on the subject. The ...

  2. Fracture induced anisotropy in viscoelastic media

    E-Print Network [OSTI]

    santos,,,

    pp = 28 MPa, Z. ?1. N. = (14.4+3.6i) GPa, Z. ?1. T. = (21 + 2.6i) GPa,. We consider a set of equispaced fractures with L = 1 cm and 80 % binary fractal variations ...

  3. Multiphase flow in fractured porous media

    SciTech Connect (OSTI)

    Firoozabadi, A.

    1995-02-01T23:59:59.000Z

    The major goal of this research project was to improve the understanding of the gas-oil two-phase flow in fractured porous media. In addition, miscible displacement was studied to evaluate its promise for enhanced recovery.

  4. Dynamic Fracture Toughness of Polymer Composites

    E-Print Network [OSTI]

    Harmeet Kaur

    2012-02-14T23:59:59.000Z

    bar with required instrumentation to obtain load-history and initiation of crack propagation parameters followed by finite element analysis to determine desired dynamic properties. Single edge notch bend(SENB) type geometry is used for Mode-I fracture...

  5. Infiltration and Seepage Through Fractured Welded Tuff

    SciTech Connect (OSTI)

    T.A. Ghezzehei; P.F. Dobson; J.A. Rodriguez; P.J. Cook

    2006-06-20T23:59:59.000Z

    The Nopal I mine in Pena Blanca, Chihuahua, Mexico, contains a uranium ore deposit within fractured tuff. Previous mining activities exposed a level ground surface 8 m above an excavated mining adit. In this paper, we report results of ongoing research to understand and model percolation through the fractured tuff and seepage into a mined adit both of which are important processes for the performance of the proposed nuclear waste repository at Yucca Mountain. Travel of water plumes was modeled using one-dimensional numerical and analytical approaches. Most of the hydrologic properly estimates were calculated from mean fracture apertures and fracture density. Based on the modeling results, we presented constraints for the arrival time and temporal pattern of seepage at the adit.

  6. Anomalous transport through porous and fractured media

    E-Print Network [OSTI]

    Kang, Peter Kyungchul

    2014-01-01T23:59:59.000Z

    Anomalous transport, understood as the nonlinear scaling with time of the mean square displacement of transported particles, is observed in many physical processes, including contaminant transport through porous and fractured ...

  7. Fracture Conductivity of the Eagle Ford Shale

    E-Print Network [OSTI]

    Guzek, James J

    2014-07-25T23:59:59.000Z

    , and rock geomechanical properties. Therefore, optimizing conductivity by tailoring a well’s fracturing treatment to local reservoir characteristics is important to the oil and gas industry for economic reasons. The roots of hydraulic fracturing can... of the formation. Sahoo et al. (2013) identified that mineralogy, hydrocarbon filled porosity, and total organic content are most prominent parameters that control Eagle Ford well productivity. Mineral composition determines several geomechanical properties...

  8. TRITIUM EFFECTS ON WELDMENT FRACTURE TOUGHNESS

    SciTech Connect (OSTI)

    Morgan, M; Michael Tosten, M; Scott West, S

    2006-07-17T23:59:59.000Z

    The effects of tritium on the fracture toughness properties of Type 304L stainless steel and its weldments were measured. Fracture toughness data are needed for assessing tritium reservoir structural integrity. This report provides data from J-Integral fracture toughness tests on unexposed and tritium-exposed weldments. The effect of tritium on weldment toughness has not been measured until now. The data include tests on tritium-exposed weldments after aging for up to three years to measure the effect of increasing decay helium concentration on toughness. The results indicate that Type 304L stainless steel weldments have high fracture toughness and are resistant to tritium aging effects on toughness. For unexposed alloys, weldment fracture toughness was higher than base metal toughness. Tritium-exposed-and-aged base metals and weldments had lower toughness values than unexposed ones but still retained good toughness properties. In both base metals and weldments there was an initial reduction in fracture toughness after tritium exposure but little change in fracture toughness values with increasing helium content in the range tested. Fracture modes occurred by the dimpled rupture process in unexposed and tritium-exposed steels and welds. This corroborates further the resistance of Type 304L steel to tritium embrittlement. This report fulfills the requirements for the FY06 Level 3 milestone, TSR15.3 ''Issue summary report for tritium reservoir material aging studies'' for the Enhanced Surveillance Campaign (ESC). The milestone was in support of ESC L2-1866 Milestone-''Complete an annual Enhanced Surveillance stockpile aging assessment report to support the annual assessment process''.

  9. Pressure Responses of a Vertically Hydraulic Fractured Well in a Reservoir with Fractal Structure

    E-Print Network [OSTI]

    Razminia, Kambiz; Torres, Delfim F M

    2015-01-01T23:59:59.000Z

    We obtain an analytical solution for the pressure-transient behavior of a vertically hydraulic fractured well in a heterogeneous reservoir. The heterogeneity of the reservoir is modeled by using the concept of fractal geometry. Such reservoirs are called fractal reservoirs. According to the theory of fractional calculus, a temporal fractional derivative is applied to incorporate the memory properties of the fractal reservoir. The effect of different parameters on the computed wellbore pressure is fully investigated by various synthetic examples.

  10. Effects of osteoporosis therapies on bone biomechanics

    E-Print Network [OSTI]

    Easley, Sarah Kathleen

    2010-01-01T23:59:59.000Z

    study. R EFERENCES National Osteoporosis Foundation. http://in patients with osteoporosis: a paired biopsy study. J Bonein women with osteoporosis: the Fracture Intervention Trial.

  11. Failing softly: A fracture theory of highly-deformable materials

    E-Print Network [OSTI]

    Tamar Goldman Boué; Roi Harpaz; Jay Fineberg; Eran Bouchbinder

    2015-03-24T23:59:59.000Z

    Highly-deformable materials, from synthetic hydrogels to biological tissues, are becoming increasingly important from both fundamental and practical perspectives. Their mechanical behaviors, in particular the dynamics of crack propagation during failure, are not yet fully understood. Here we propose a theoretical framework for the dynamic fracture of highly-deformable materials, in which the effects of a dynamic crack are treated with respect to the nonlinearly deformed (pre-stressed/strained), non-cracked, state of the material. Within this framework, we derive analytic and semi-analytic solutions for the near-tip deformation fields and energy release rates of dynamic cracks propagating in incompressible neo-Hookean solids under biaxial and uniaxial loading. We show that moderately large pre-stressing has a marked effect on the stress fields surrounding a crack's tip. We verify these predictions by performing extensive experiments on the fracture of soft brittle elastomers over a range of loading levels and propagation velocities, showing that the newly developed framework offers significantly better approximations to the measurements than standard approaches at moderately large levels of external loadings and high propagation velocities. This framework should be relevant to the failure analysis of soft and tough, yet brittle, materials.

  12. HYDRAULIC FRACTURING AND OVERCORING STRESS MEASUREMENTS IN A DEEP BOREHOLE AT THE STRIPA TEST MINE, SWEDEN

    E-Print Network [OSTI]

    Doe, T.

    2010-01-01T23:59:59.000Z

    u l y 2 , 1 9 8 1 HYDRAULIC FRACTURING AND OVERCORING STRESSI nun LBL-12478 HYDRAULIC FRACTURING AND OVERCORING STRESSthe calculated stress. n HYDRAULIC FRACTURING EQUIPMENT AND

  13. THE STATE OF THE ART OF NUMERICAL MODELING OF THERMOHYDROLOGIC FLOW IN FRACTURED ROCK MASSES

    E-Print Network [OSTI]

    Wang, J.S.Y.

    2013-01-01T23:59:59.000Z

    flow in naturally fractured reservoirs: Proceedings, 2ndliquid-dominated, fractured reservoir over a twenty- yeardrawdown. (c) Fractured Reservoir: The double-porosity

  14. An Analytical Solution for Slug-Tracer Tests in Fractured Reservoirs

    E-Print Network [OSTI]

    Shan, Chao; Pruess, Karsten

    2005-01-01T23:59:59.000Z

    Tracer Tests in Fractured Reservoirs Chao Shan and Karstenof chemicals or heat in fractured reservoirs is stronglyin a water-saturated fractured reservoir. The solution shows

  15. Aligned vertical fractures, HTI reservoir symmetry, and Thomsen seismic anisotropy parameters for polar media

    E-Print Network [OSTI]

    Berryman, James G.

    2008-01-01T23:59:59.000Z

    waves in such fractured reservoirs (Hsu and Schoenberg,i.e. , for cracked/fractured reservoirs), the vertical phasemore closely. FRACTURED RESERVOIRS AND CRACK-INFLUENCE

  16. Brief Guide to the MINC-Method for Modeling Flow and Transport in Fractured Media

    E-Print Network [OSTI]

    Pruess editor, K.

    2010-01-01T23:59:59.000Z

    Simulating Naturally Fractured Reservoirs Using a SubdomainModels of Naturally Fractured Reservoirs, In Situ, 15, (2),for Naturally Fractured Reservoirs, papr,r SPE-11688,

  17. Effects of non-condensible gases on fluid recovery in fractured geothermal reservoirs

    E-Print Network [OSTI]

    Bodvarsson, Gudmundur S.; Gaulke, Scott

    1986-01-01T23:59:59.000Z

    Simu- lations in Fractured Reservoirs,” Lawrence Berkeleyfrom a twctphase fractured reservoir. T h e results obtainedRecovery in Fractured Geothermal Reservoirs Gudmundur S.

  18. On the multiscale origins of fracture resistance in human bone and its biological degradation

    E-Print Network [OSTI]

    Zimmermann, Elizabeth A.

    2012-01-01T23:59:59.000Z

    and   its  biological  degradation   DISCLAIMER   This  and   its  biological  degradation   E.  A.  Zimmermanntissue  fails  due  to  degradation  of  the  collagen  

  19. Modeling interfacial fracture in Sierra.

    SciTech Connect (OSTI)

    Brown, Arthur A.; Ohashi, Yuki; Lu, Wei-Yang; Nelson, Stacy A. C.; Foulk, James W.,; Reedy, Earl David,; Austin, Kevin N.; Margolis, Stephen B.

    2013-09-01T23:59:59.000Z

    This report summarizes computational efforts to model interfacial fracture using cohesive zone models in the SIERRA/SolidMechanics (SIERRA/SM) finite element code. Cohesive surface elements were used to model crack initiation and propagation along predefined paths. Mesh convergence was observed with SIERRA/SM for numerous geometries. As the funding for this project came from the Advanced Simulation and Computing Verification and Validation (ASC V&V) focus area, considerable effort was spent performing verification and validation. Code verification was performed to compare code predictions to analytical solutions for simple three-element simulations as well as a higher-fidelity simulation of a double-cantilever beam. Parameter identification was conducted with Dakota using experimental results on asymmetric double-cantilever beam (ADCB) and end-notched-flexure (ENF) experiments conducted under Campaign-6 funding. Discretization convergence studies were also performed with respect to mesh size and time step and an optimization study was completed for mode II delamination using the ENF geometry. Throughout this verification process, numerous SIERRA/SM bugs were found and reported, all of which have been fixed, leading to over a 10-fold increase in convergence rates. Finally, mixed-mode flexure experiments were performed for validation. One of the unexplained issues encountered was material property variability for ostensibly the same composite material. Since the variability is not fully understood, it is difficult to accurately assess uncertainty when performing predictions.

  20. Creep and Fracture of a Protein Gel under Stress

    E-Print Network [OSTI]

    Mathieu Leocmach; Christophe Perge; Thibaut Divoux; Sébastien Manneville

    2014-08-19T23:59:59.000Z

    Biomaterials such as protein or polysaccharide gels are known to behave qualitatively as soft solids and to rupture under an external load. Combining optical and ultrasonic imaging to shear rheology we show that the failure scenario of a protein gel is reminiscent of brittle solids: after a primary creep regime characterized by a power-law behavior which exponent is fully accounted for by linear viscoelasticity, fractures nucleate and grow logarithmically perpendicularly to shear, up to the sudden rupture of the gel. A single equation accounting for those two successive processes nicely captures the full rheological response. The failure time follows a decreasing power law with the applied shear stress, similar to the Basquin law of fatigue for solids. These results are in excellent agreement with recent fiber-bundle models that include damage accumulation on elastic fibers and exemplify protein gels as model, brittle-like soft solids.

  1. Evaluation of acid fracturing based on the "acid fracture number" concept

    E-Print Network [OSTI]

    Alghamdi, Abdulwahab

    2006-08-16T23:59:59.000Z

    ................................................................................................. 29 4.2.1 Initial Pad Volume ........................................................................... 29 4.2.2 Acid Strength and Volume...............................................................30 V... stages of pad fluids and acids.11 The reaction of HCl with carbonate formations is fast, especially at high temperatures. This means that the acid will not be able to penetrate deeply down the fracture, which may affect the outcome of acid fracturing...

  2. A Physically Based Approach for Modeling Multiphase Fracture-Matrix Interaction in Fractured Porous Media

    SciTech Connect (OSTI)

    Wu, Yu-Shu; Pan, Lehua; Pruess, Karsten

    2004-03-15T23:59:59.000Z

    Modeling fracture-matrix interaction within a complex multiple phase flow system is a key issue for fractured reservoir simulation. Commonly used mathematical models for dealing with such interactions employ a dual- or multiple-continuum concept, in which fractures and matrix are represented as overlapping, different, but interconnected continua, described by parallel sets of conservation equations. The conventional single-point upstream weighting scheme, in which the fracture relative permeability is used to represent the counterpart at the fracture-matrix interface, is the most common scheme by which to estimate flow mobility for fracture-matrix flow terms. However, such a scheme has a serious flaw, which may lead to unphysical solutions or significant numerical errors. To overcome the limitation of the conventional upstream weighting scheme, this paper presents a physically based modeling approach for estimating physically correct relative permeability in calculating multiphase flow between fractures and the matrix, using continuity of capillary pressure at the fracture-matrix interface. The proposed approach has been implemented into two multiphase reservoir simulators and verified using analytical solutions and laboratory experimental data. The new method is demonstrated to be accurate, numerically efficient, and easy to implement in dual- or multiple-continuum models.

  3. Fractured: Experts examine the contentious issue of hydraulic fracturing water use

    E-Print Network [OSTI]

    Wythe, Kathy

    2013-01-01T23:59:59.000Z

    of Fracture Fluid Performance in Oil Shale with Surfactant Additives by X-Ray Tomography Methods (Crisman Institute: Schechter) Re-Use of Produced Waters as Hydraulic Fracturing Fluids (Crisman Institute: Nasr-El-Din) In a joint House Commi#20;ee...

  4. CRYSTALLOGRAPHIC PROPERTIES AND MECHANICAL BEHAVIOR OF TITANIUM HYDRIDE LAYERS GROWN ON TITANIUM IMPLANTS

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    CRYSTALLOGRAPHIC PROPERTIES AND MECHANICAL BEHAVIOR OF TITANIUM HYDRIDE LAYERS GROWN ON TITANIUM, Switzerland Keywords: SLA treated titanium - bone-anchored dental implants - transmission and scanning electron microscopy - titanium hydride sub-surface layer - epitaxy Abstract Commercially pure titanium

  5. Limited Chemotherapy and Shrinking Field Radiotherapy for Osteolymphoma (Primary Bone Lymphoma): Results From the Trans-Tasman Radiation Oncology Group 99.04 and Australasian Leukaemia and Lymphoma Group LY02 Prospective Trial;Bone; Lymphoma; Radiotherapy; Chemotherapy; Clinical trial

    SciTech Connect (OSTI)

    Christie, David, E-mail: david.christie@premion.com.au [Premion and Bond University, Gold Coast, Queensland (Australia); Dear, Keith [Department of Epidemiology and Population Studies, Australian National University, Canberra, New South Wales (Australia); Le, Thai [BHB, Premion, Brisbane, Queensland (Australia); Barton, Michael [Collaboration for Cancer Outcomes and Research (CCORE) and University of NSW, Sydney, New South Wales (Australia); Wirth, Andrew [Peter MacCallum Cancer Institute, Melbourne, Victoria (Australia); Porter, David [Auckland Hospital, Auckland (New Zealand); Roos, Daniel [Royal Adelaide Hospital, Adelaide, South Australia (Australia); Pratt, Gary [Royal Brisbane Hospital, Brisbane, Queensland (Australia)

    2011-07-15T23:59:59.000Z

    Purpose: To establish benchmark outcomes for combined modality treatment to be used in future prospective studies of osteolymphoma (primary bone lymphoma). Methods and Materials: In 1999, the Trans-Tasman Radiation Oncology Group (TROG) invited the Australasian Leukemia and Lymphoma Group (ALLG) to collaborate on a prospective study of limited chemotherapy and radiotherapy for osteolymphoma. The treatment was designed to maintain efficacy but limit the risk of subsequent pathological fractures. Patient assessment included both functional imaging and isotope bone scanning. Treatment included three cycles of CHOP chemotherapy and radiation to a dose of 45 Gy in 25 fractions using a shrinking field technique. Results: The trial closed because of slow accrual after 33 patients had been entered. Accrual was noted to slow down after Rituximab became readily available in Australia. After a median follow-up of 4.3 years, the five-year overall survival and local control rates are estimated at 90% and 72% respectively. Three patients had fractures at presentation that persisted after treatment, one with recurrent lymphoma. Conclusions: Relatively high rates of survival were achieved but the number of local failures suggests that the dose of radiotherapy should remain higher than it is for other types of lymphoma. Disability after treatment due to pathological fracture was not seen.

  6. A robust method for fracture orientation and density detection from seismic scattered energy

    E-Print Network [OSTI]

    Fang, Xinding

    2011-01-01T23:59:59.000Z

    The measurements of fracture parameters, such as fracture orientation, fracture density and fracture compliance, in a reservoir is very important for field development and exploration. Traditional seismic methods for ...

  7. Reservoir Fracture Mapping using Microearthquakes: Austin Chalk, Giddings Field, TX and 76 Field, Clinton Co., KY.

    E-Print Network [OSTI]

    SPE 36651 Reservoir Fracture Mapping using Microearthquakes: Austin Chalk, Giddings Field, TX and enhanced recovery, production operations in fracture- dominated oil and gas reservoirs. Borehole geophones to study reservoir fracture systems. Methods currently applied to study fracture systems include tilt

  8. Extrapolation of Fracture Toughness Data for HT9 Irradiated at 360-390°C

    SciTech Connect (OSTI)

    Gelles, David S.; Kurtz, Richard J.

    2007-05-01T23:59:59.000Z

    Following irradiation in the FFTF-AC01 test at 360°C to 5.5 x 1022 n/cm2, two HT9 samples tested at 30°C were measured to have fracture toughness levels of 28.2 and 31.9 MPa m1/2, respectively, whereas a third identical specimen tested at 205°C gave 126 MPa m1/2. Based on testing of notched tensile specimens from the same irradiation test, the low toughness was a result of brittle fracture. A similar low level of toughness has also been demonstrated in HT9 following irradiation at 250°C and therefore such behavior is reproducible. Using ASTM Standard E1921-02, which characterizes the fracture toughness of ferritic steels that experience onset of cleavage cracking at instabilities, it is shown that these data can be analyzed by a Master Curve approach, and that the trend of the fracture toughness over a wider range of temperatures can be estimated. Master Curve analysis demonstrates that toughness will remain low over a wide range of temperatures near 30°C, but will degrade only slightly when temperatures drop to –10°C.

  9. Temperature-dependent void-sheet fracture in Al-Cu-Mg-Ag-Zr

    SciTech Connect (OSTI)

    Haynes, M.J. [Texas Instruments, Inc., Attleboro, MA (United States); Gangloff, R.P. [Univ. of Virginia, Charlottesville, VA (United States). Dept. of Materials Science and Engineering

    1998-06-01T23:59:59.000Z

    Temperature-dependent initiation fracture toughness and stable crack growth resistance are important attributes of next-generation aluminum alloys for airframe applications such as the high speed civil transport. Previous research showed that tensile fracture strain increases as temperature increases for AA2519 with Mg and Ag additions, because the void-sheet coalescence stage of microvoid fracture is retarded. The present work characterizes intravoid-strain localization (ISL) between primary voids at large constituents and secondary-void nucleation at small dispersoids, two mechanisms that may govern the temperature dependence of void sheeting. Most dispersoids nucleate secondary voids in an ISL band at 25 C, promoting further localization, while dispersoid-void nucleation at 150 C is greatly reduced. Increased strain-rate hardening with increasing temperature does not cause this behavior. Rather, a stress relaxation model predicts that flow stress and strain hardening decrease with increasing temperature or decreasing strain rate due to a transition from dislocation accumulation to diffusional relaxation around dispersoids. This transition to softening causes a sharp increase in the model-predicted applied plastic strain necessary for dispersoid/matrix interface decohesion. This reduced secondary-void nucleation and reduced ISL at elevated temperature explain retarded void sheeting and increased fracture strain.

  10. WRITTEN IN BONE: Bone Biographer's Casebook Douglas Owsley and Karin Bruwelheide

    E-Print Network [OSTI]

    Mathis, Wayne N.

    afflictions that would have made daily life miserable. In addition to dental disease and gout, his bones were

  11. Dose-Effect Relationships for Femoral Fractures After Multimodality Limb-Sparing Therapy of Soft-Tissue Sarcomas of the Proximal Lower Extremity

    SciTech Connect (OSTI)

    Pak, Daniel; Vineberg, Karen A. [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Griffith, Kent A. [Biostatistics Unit, Comprehensive Cancer Center, University of Michigan, Ann Arbor, MI (United States); Sabolch, Aaron [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Chugh, Rashmi [Department of Internal Medicine, Division of Hematology/Oncology, University of Michigan, Ann Arbor, MI (United States); Ben-Josef, Edgar [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Biermann, Janet Sybil [Department of Orthopedic Surgery, University of Michigan, Ann Arbor, MI (United States); Feng, Mary, E-mail: maryfeng@umich.edu [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States)

    2012-07-15T23:59:59.000Z

    Purpose: We investigated the clinical and dosimetric predictors for radiation-associated femoral fractures in patients with proximal lower extremity soft tissue sarcomas (STS). Methods and Materials: We examined 131 patients with proximal lower extremity STS who received limb-sparing surgery and external-beam radiation therapy between 1985 and 2006. Five (4%) patients sustained pathologic femoral fractures. Dosimetric analysis was limited to 4 fracture patients with full three-dimensional dose information, who were compared with 59 nonfracture patients. The mean doses and volumes of bone (V{sub d}) receiving specified doses ({>=}30 Gy, 45 Gy, 60 Gy) at the femoral body, femoral neck, intertrochanteric region, and subtrochanteric region were compared. Clinical predictive factors were also evaluated. Results: Of 4 fracture patients in our dosimetric series, there were three femoral neck fractures with a mean dose of 57.6 {+-} 8.9 Gy, V30 of 14.5 {+-} 2.3 cc, V45 of 11.8 {+-} 1.1 cc, and V60 of 7.2 {+-} 2.2 cc at the femoral neck compared with 22.9 {+-} 20.8 Gy, 4.8 {+-} 5.6 cc, 2.5 {+-} 3.9 cc, and 0.8 {+-} 2.7 cc, respectively, for nonfracture patients (p < 0.03 for all). The femoral neck fracture rate was higher than at the subtrochanteric region despite lower mean doses at these subregions. All fracture sites received mean doses greater than 40 Gy. Also, with our policy of prophylactic femoral intramedullary nailing for high-risk patients, there was no significant difference in fracture rates between patients with and without periosteal excision. There were no significant differences in age, sex, tumor size, timing of radiation therapy, and use of chemotherapy between fracture and nonfracture patients. Conclusions: These dose-volume toxicity relationships provide RT optimization goals to guide future efforts for reducing pathologic fracture rates. Prophylactic femoral intramedullary nailing may also reduce fracture risk for susceptible patients.

  12. J Bone Miner Metab . Author manuscript Mineral maturity and crystallinity index are distinct characteristics of bone

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    J Bone Miner Metab . Author manuscript Page /1 13 Mineral maturity and crystallinity index are distinct characteristics of bone mineral Delphine Farlay 1 * , G rard Panczeré 2 , Christian Rey 3 , Pierre the hypothesis that mineral maturity and crystallinity index are two different characteristics of bone mineral

  13. PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism

    E-Print Network [OSTI]

    Toledo, University of

    PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism Beata regulating systemic energy homeostasis. In this article, we review current knowledge on the role of PPARs of bone marrow microenvironment and its possible contribution to the systemic regulation of energy

  14. Pressure analysis of the hydromechanical fracture behaviour in stimulated tight sedimentary geothermal reservoirs

    E-Print Network [OSTI]

    Wessling, S.

    2009-01-01T23:59:59.000Z

    cooling of the fracture surfaces results in a significant opening of the fracture, which would influence the rate of geothermal

  15. A quantification strategy for missing bone mass in case of osteolytic bone lesions

    SciTech Connect (OSTI)

    Fränzle, Andrea, E-mail: a.fraenzle@dkfz.de; Giske, Kristina [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Bretschi, Maren; Bäuerle, Tobias [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Hillengass, Jens [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany)] [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany); Bendl, Rolf [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)

    2013-12-15T23:59:59.000Z

    Purpose: Most of the patients who died of breast cancer have developed bone metastases. To understand the pathogenesis of bone metastases and to analyze treatment response of different bone remodeling therapies, preclinical animal models are examined. In breast cancer, bone metastases are often bone destructive. To assess treatment response of bone remodeling therapies, the volumes of these lesions have to be determined during the therapy process. The manual delineation of missing structures, especially if large parts are missing, is very time-consuming and not reproducible. Reproducibility is highly important to have comparable results during the therapy process. Therefore, a computerized approach is needed. Also for the preclinical research, a reproducible measurement of the lesions is essential. Here, the authors present an automated segmentation method for the measurement of missing bone mass in a preclinical rat model with bone metastases in the hind leg bones based on 3D CT scans. Methods: The affected bone structure is compared to a healthy model. Since in this preclinical rat trial the metastasis only occurs on the right hind legs, which is assured by using vessel clips, the authors use the left body side as a healthy model. The left femur is segmented with a statistical shape model which is initialised using the automatically segmented medullary cavity. The left tibia and fibula are segmented using volume growing starting at the tibia medullary cavity and stopping at the femur boundary. Masked images of both segmentations are mirrored along the median plane and transferred manually to the position of the affected bone by rigid registration. Affected bone and healthy model are compared based on their gray values. If the gray value of a voxel indicates bone mass in the healthy model and no bone in the affected bone, this voxel is considered to be osteolytic. Results: The lesion segmentations complete the missing bone structures in a reasonable way. The mean ratiov{sub r}/v{sub m} of the reconstructed bone volume v{sub r} and the healthy model bone volume v{sub m} is 1.07, which indicates a good reconstruction of the modified bone. Conclusions: The qualitative and quantitative comparison of manual and semi-automated segmentation results have shown that comparing a modified bone structure with a healthy model can be used to identify and measure missing bone mass in a reproducible way.

  16. Simulated evolution of fractures and fracture networks subject to thermal cooling: A coupled discrete element and heat conduction model

    SciTech Connect (OSTI)

    Huang, Hai; Plummer, Mitchell; Podgorney, Robert

    2013-02-01T23:59:59.000Z

    Advancement of EGS requires improved prediction of fracture development and growth during reservoir stimulation and long-term operation. This, in turn, requires better understanding of the dynamics of the strongly coupled thermo-hydro-mechanical (THM) processes within fractured rocks. We have developed a physically based rock deformation and fracture propagation simulator by using a quasi-static discrete element model (DEM) to model mechanical rock deformation and fracture propagation induced by thermal stress and fluid pressure changes. We also developed a network model to simulate fluid flow and heat transport in both fractures and porous rock. In this paper, we describe results of simulations in which the DEM model and network flow & heat transport model are coupled together to provide realistic simulation of the changes of apertures and permeability of fractures and fracture networks induced by thermal cooling and fluid pressure changes within fractures. Various processes, such as Stokes flow in low velocity pores, convection-dominated heat transport in fractures, heat exchange between fluid-filled fractures and solid rock, heat conduction through low-permeability matrices and associated mechanical deformations are all incorporated into the coupled model. The effects of confining stresses, developing thermal stress and injection pressure on the permeability evolution of fracture and fracture networks are systematically investigated. Results are summarized in terms of implications for the development and evolution of fracture distribution during hydrofracturing and thermal stimulation for EGS.

  17. Hydraulic Fracture Monitoring: A Jonah Field Case Study

    E-Print Network [OSTI]

    Seher, T.

    2011-01-01T23:59:59.000Z

    Hydraulic fracturing involves the injection of a fluid to fracture oil and gas reservoirs, and thus increase their permeability. The process creates numerous microseismic events, which can be used to monitor subsurface ...

  18. Fractional Diffusion Modeling of Electromagnetic Induction in Fractured Rocks

    E-Print Network [OSTI]

    Ge, Jianchao

    2014-08-11T23:59:59.000Z

    -2 km, a zone where pores and fractures over various length scales are highly complicated. Spatial confinement of fluid or electric charge transport by the fractal geometry gives rise to interesting dynamic processes within the pore space and fractures...

  19. Gaseous Detonation-Driven Fracture of Tubes Tong Wa Chao

    E-Print Network [OSTI]

    never asked for anything back. First is Professor Wolfgang Knauss, who guided me in the solid to be consistent with fracture under mixed-mode loading. High-speed movies of the fracture events and blast wave

  20. Laboratory-scale fracture conductivity created by acid etching

    E-Print Network [OSTI]

    Pournik, Maysam

    2009-05-15T23:59:59.000Z

    the closure stress. While there have been several experimental studies conducted on acid fracturing, most of these have not scaled experiments to field conditions and did not account for the effect of rock weakening and etching pattern. Hence, acid fracture...

  1. Development and testing of an advanced acid fracture conductivity apparatus

    E-Print Network [OSTI]

    Zou, ChunLei

    2006-08-16T23:59:59.000Z

    wells. Acid fracturing is a standard practice to increase the production rate and to improve ultimate recovery in carbonate reservoirs. There have been successful cases in most carbonate reservoirs around the world. However acid fracture performance...

  2. Fracture characterization from seismic measurements in a borehole

    E-Print Network [OSTI]

    Bakku, Sudhish Kumar

    2015-01-01T23:59:59.000Z

    Fracture characterization is important for optimal recovery of hydrocarbons. In this thesis, we develop techniques to characterize natural and hydraulic fractures using seismic measurements in a borehole. We first develop ...

  3. Stochastic multiscale models for fracture analysis of functionally graded materials

    E-Print Network [OSTI]

    Rahman, Sharif

    Chakraborty, Sharif Rahman * Department of Mechanical and Industrial Engineering, College of Engineering three multiscale models, including sequential, invasive, and concurrent models, for fracture analysis-intensity factors or accurate probability of fracture initiation. The concurrent multiscale model is sufficiently

  4. FRACTURE AND HYDROLOGY DATA FROM FIELD STUDIES AT STRIPA, SWEDEN

    E-Print Network [OSTI]

    Gale, J.E.

    2010-01-01T23:59:59.000Z

    An Approach to the Fracture Hydrology at Stripa, PreliminaryRocks. On Recent Trends in Hydrology, Special PublicationsDE86 013586 W FRACTURE AND HYDROLOGY DATA FROM FIELD STUDIES

  5. Finite Difference Modeling of Seismic Responses to Intersecting Fracture Sets

    E-Print Network [OSTI]

    Chi, Shihong

    2006-01-01T23:59:59.000Z

    Fractured reservoir characterization is becoming increasingly important for the petroleum industry. Currentmethods for this task are developed based on effectivemedia theory, which assumes the cracks or fractures in a ...

  6. Effects of subsurface fracture interactions on surface deformation

    E-Print Network [OSTI]

    Jerry, Ruel (Ruel Valentine)

    2013-01-01T23:59:59.000Z

    Although the surface deformation resulting from the opening of a single fracture in a layered elastic half-space resembles the observed deformation at the InSalah site, it seems unlikely that only a single fracture is ...

  7. Analysis of Scattered Signal to Estimate Reservoir Fracture Parameters

    E-Print Network [OSTI]

    Grandi, Samantha K.

    We detect fracture corridors and determine their orientation and average spacing based on an analysis of seismic coda in the frequency-wave number (f-k ) domain. Fracture corridors have dimensions similar to seismic ...

  8. Seismic characterization of fractured reservoirs by focusing Gaussian beams

    E-Print Network [OSTI]

    Zheng, Yingcai

    Naturally fractured reservoirs occur worldwide, and they account for the bulk of global oil production. The most important impact of fractures is their influence on fluid flow. To maximize oil production, the characterization ...

  9. Fracture Evolution Following a Hydraulic Stimulation within an EGS Reservoir

    Broader source: Energy.gov [DOE]

    DOE Geothermal Peer Review 2010 - Presentation. This project will provide the first ever formal evaluation of fracture and fracture flow evolution in an EGS reservoir following a hydraulic stimulation.

  10. Experimental Study of Acid Fracture Conductivity of Austin Chalk Formation

    E-Print Network [OSTI]

    Nino Penaloza, Andrea

    2013-05-01T23:59:59.000Z

    to those in actual acid fracture treatments. After acid etching, fracture conductivity is measured at different closure stresses. This research work presents a systematic study to investigate the effect of temperature, rock-acid contact time and initial...

  11. Model for Fracturing Fluid Flowback and Characterization of Flowback Mechanisms

    E-Print Network [OSTI]

    Song, Bo

    2014-08-28T23:59:59.000Z

    A large volume of fracturing fluid that may include slick water and various sorts of additives is injected into shale formations along with proppant to create hydraulic fractures which define a stimulated shale volume a shale gas well will actually...

  12. Effectiveness of microseismic monitoring for optimizing hydraulic fracturing in California

    E-Print Network [OSTI]

    Alampi, Ann M

    2014-01-01T23:59:59.000Z

    Hydraulic fracturing has fundamentally changed the oil and gas industry in the past 10 years. Bakersfield, California provides a unique case study because steam injection, a type of hydraulic fracturing, has been used there ...

  13. Fracture Characterization from Scattered Energy: A Case Study

    E-Print Network [OSTI]

    Grandi, Samantha K.

    2006-01-01T23:59:59.000Z

    We use 3D surface seismic data to determine the presence and the preferred orientation of fracture corridors in a field. The Scattering Index method is proving to be a robust tool for detecting and mapping fracture corridors. ...

  14. How can we use one fracture to locate another?

    E-Print Network [OSTI]

    Poliannikov, Oleg V.

    2011-01-01T23:59:59.000Z

    Hydraulic fracturing is an important tool that helps extract fluids from the subsurface. It is critical in applications ranging from enhanced oil recovery to geothermal energy pro-duction. As the goal of fracturing is to ...

  15. Experimental Study of Acid Fracture Conductivity of Austin Chalk Formation 

    E-Print Network [OSTI]

    Nino Penaloza, Andrea

    2013-05-01T23:59:59.000Z

    Acid fracture conductivity and the effect of key variables in the etching process during acid fracturing can be assessed at the laboratory scale. This is accomplished by using an experimental apparatus that simulates acid injection fluxes comparable...

  16. A Bayesian framework for fracture characterization from surface seismic data

    E-Print Network [OSTI]

    Zamanian, S. Ahmad

    2012-01-01T23:59:59.000Z

    We describe a methodology for quantitatively characterizing the fractured nature of a hydrocarbon or geothermal reservoir from surface seismic data under a Bayesian inference framework. Fractures provide pathways for fluid ...

  17. A Thermoelastic Hydraulic Fracture Design Tool for Geothermal Reservoir Development

    SciTech Connect (OSTI)

    Ahmad Ghassemi

    2003-06-30T23:59:59.000Z

    Geothermal energy is recovered by circulating water through heat exchange areas within a hot rock mass. Geothermal reservoir rock masses generally consist of igneous and metamorphic rocks that have low matrix permeability. Therefore, cracks and fractures play a significant role in extraction of geothermal energy by providing the major pathways for fluid flow and heat exchange. Thus, knowledge of conditions leading to formation of fractures and fracture networks is of paramount importance. Furthermore, in the absence of natural fractures or adequate connectivity, artificial fracture are created in the reservoir using hydraulic fracturing. At times, the practice aims to create a number of parallel fractures connecting a pair of wells. Multiple fractures are preferred because of the large size necessary when using only a single fracture. Although the basic idea is rather simple, hydraulic fracturing is a complex process involving interactions of high pressure fluid injections with a stressed hot rock mass, mechanical interaction of induced fractures with existing natural fractures, and the spatial and temporal variations of in-situ stress. As a result it is necessary to develop tools that can be used to study these interactions as an integral part of a comprehensive approach to geothermal reservoir development, particularly enhanced geothermal systems. In response to this need we have set out to develop advanced thermo-mechanical models for design of artificial fractures and rock fracture research in geothermal reservoirs. These models consider the significant hydraulic and thermo-mechanical processes and their interaction with the in-situ stress state. Wellbore failure and fracture initiation is studied using a model that fully couples poro-mechanical and thermo-mechanical effects. The fracture propagation model is based on a complex variable and regular displacement discontinuity formulations. In the complex variable approach the displacement discontinuities are defined from the numerical solution of a complex hypersingular integral equation written for a given fracture configuration and loading. The fracture propagation studies include modeling interaction of induced fractures with existing discontinuities such as faults and joints. In addition to the fracture propagation studies, two- and three-dimensional heat extraction solution algorithms have been developed and used to estimate heat extraction and the variations of the reservoir stress with cooling. The numerical models have been developed in a user-friendly environment to create a tool for improving fracture design and investigating single or multiple fracture propagation in rock.

  18. Compartmentalization analysis using discrete fracture network models

    SciTech Connect (OSTI)

    La Pointe, P.R.; Eiben, T.; Dershowitz, W. [Golder Associates, Redmond, VA (United States); Wadleigh, E. [Marathon Oil Co., Midland, TX (United States)

    1997-08-01T23:59:59.000Z

    This paper illustrates how Discrete Fracture Network (DFN) technology can serve as a basis for the calculation of reservoir engineering parameters for the development of fractured reservoirs. It describes the development of quantitative techniques for defining the geometry and volume of structurally controlled compartments. These techniques are based on a combination of stochastic geometry, computational geometry, and graph the theory. The parameters addressed are compartment size, matrix block size and tributary drainage volume. The concept of DFN models is explained and methodologies to compute these parameters are demonstrated.

  19. Seismic velocity and Q anisotropy in fractured poroelastic media

    E-Print Network [OSTI]

    Introduction. Seismic wave propagation through fractures is an important subject in hydrocarbon exploration geophysics, mining and reservoir characterization ...

  20. Experimental and Analytical Research on Fracture Processes in ROck

    SciTech Connect (OSTI)

    Herbert H.. Einstein; Jay Miller; Bruno Silva

    2009-02-27T23:59:59.000Z

    Experimental studies on fracture propagation and coalescence were conducted which together with previous tests by this group on gypsum and marble, provide information on fracturing. Specifically, different fracture geometries wsere tested, which together with the different material properties will provide the basis for analytical/numerical modeling. INitial steps on the models were made as were initial investigations on the effect of pressurized water on fracture coalescence.

  1. Fracture toughness of Alloy 690 and EN52 weld in air and water

    SciTech Connect (OSTI)

    Brown, C.M.; Mills, W.J.

    1999-06-01T23:59:59.000Z

    The effect of low and high temperature water with high hydrogen on the fracture toughness of Alloy 690 and its weld, EN52, was characterized using elastic-plastic J{sub IC} methodology. While both materials display excellent fracture resistance in air and elevated temperature (>93 C) water, a dramatic degradation in toughness is observed in 54 C water. The loss of toughness is associated with a hydrogen-induced intergranular cracking mechanism where hydrogen is picked up from the water. Comparison of the cracking behavior in low temperature water with that for hydrogen-precharged specimens tested in air indicates that the critical local hydrogen content required to cause low temperature embrittlement is on the order of 120 to 160 ppm. Loading rate studies show that the cracking resistance is significantly improved at rates above ca. 1000 MPa{radical}m/h because there is insufficient time to produce grain boundary embrittlement. Electron fractographic examinations were performed to correlate cracking behavior with microstructural features and operative fracture mechanics.

  2. Chemically- and mechanically-mediated influences on the transport and mechanical characteristics of rock fractures

    SciTech Connect (OSTI)

    Min, K.-B.; Rutqvist, J.; Elsworth, D.

    2009-02-01T23:59:59.000Z

    A model is presented to represent changes in the mechanical and transport characteristics of fractured rock that result from coupled mechanical and chemical effects. The specific influence is the elevation of dissolution rates on contacting asperities, which results in a stress- and temperature-dependent permanent closure. A model representing this pressure-dissolution-like behavior is adapted to define the threshold and resulting response in terms of fundamental thermodynamic properties of a contacting fracture. These relations are incorporated in a stress-stiffening model of fracture closure to define the stress- and temperature-dependency of aperture loss and behavior during stress and temperature cycling. These models compare well with laboratory and field experiments, representing both decoupled isobaric and isothermal responses. The model was applied to explore the impact of these responses on heated structures in rock. The result showed a reduction in ultimate induced stresses over the case where chemical effects were not incorporated, with permanent reduction in final stresses after cooling to ambient conditions. Similarly, permeabilities may be lower than they were in the case where chemical effects were not considered, with a net reduction apparent even after cooling to ambient temperature. These heretofore-neglected effects may have a correspondingly significant impact on the performance of heated structures in rock, such as repositories for the containment of radioactive wastes.

  3. Proceedings of the Joint IAEA/CSNI Specialists` Meeting on Fracture Mechanics Verification by Large-Scale Testing held at Pollard Auditorium, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Pugh, C.E.; Bass, B.R.; Keeney, J.A. [comps.] [Oak Ridge National Lab., TN (United States)

    1993-10-01T23:59:59.000Z

    This report contains 40 papers that were presented at the Joint IAEA/CSNI Specialists` Meeting Fracture Mechanics Verification by Large-Scale Testing held at the Pollard Auditorium, Oak Ridge, Tennessee, during the week of October 26--29, 1992. The papers are printed in the order of their presentation in each session and describe recent large-scale fracture (brittle and/or ductile) experiments, analyses of these experiments, and comparisons between predictions and experimental results. The goal of the meeting was to allow international experts to examine the fracture behavior of various materials and structures under conditions relevant to nuclear reactor components and operating environments. The emphasis was on the ability of various fracture models and analysis methods to predict the wide range of experimental data now available. The individual papers have been cataloged separately.

  4. Time-resolved measurement of photon emission during fast crack propagation in three-point bending fracture of silica glass and soda lime glass

    SciTech Connect (OSTI)

    Shiota, Tadashi, E-mail: tshiota@ceram.titech.ac.jp; Sato, Yoshitaka; Yasuda, Kouichi [Department of Metallurgy and Ceramics Science, Tokyo Institute of Technology, 2-12-1-S7-13 Ookayama, Meguro-ku, Tokyo 152-8550 (Japan)] [Department of Metallurgy and Ceramics Science, Tokyo Institute of Technology, 2-12-1-S7-13 Ookayama, Meguro-ku, Tokyo 152-8550 (Japan)

    2014-03-10T23:59:59.000Z

    Simultaneous time-resolved measurements of photon emission (PE) and fast crack propagation upon bending fracture were conducted in silica glass and soda lime glass. Observation of fracture surfaces revealed that macroscopic crack propagation behavior was similar between the silica glass and soda lime glass when fracture loads for these specimens were comparable and cracks propagated without branching. However, a large difference in the PE characteristics was found between the two glasses. In silica glass, PE (645–655?nm) was observed during the entire crack propagation process, whereas intense PE (430–490?nm and 500–600?nm) was observed during the initial stages of propagation. In contrast, only weak PE was detected in soda lime glass. These results show that there is a large difference in the atomic processes involved in fast crack propagation between these glasses, and that PE can be used to study brittle fracture on the atomic scale.

  5. Hydraulic Fractures: multiscale phenomena, asymptotic and numerical solutions

    E-Print Network [OSTI]

    Peirce, Anthony

    Hydraulic Fractures: multiscale phenomena, asymptotic and numerical solutions SANUM Conference (UMN) Eduard Siebrits (SLB) #12;2 Outline · Examples of hydraulic fractures · Governing equations well stimulation Fracturing Fluid Proppant #12;5 Quarries #12;6 Magma flow Tarkastad #12;7 Model EQ 1

  6. Hydraulic Fractures: multiscale phenomena, asymptotic and numerical solutions

    E-Print Network [OSTI]

    Peirce, Anthony

    Hydraulic Fractures: multiscale phenomena, asymptotic and numerical solutions CSIRO CSS TCP Detournay (UMN) Eduard Siebrits (SLB) #12;2 Outline · Examples of hydraulic fractures · Governing equations well stimulation Fracturing Fluid Proppant #12;5 Quarries #12;6 Magma flow Tarkastad #12;7 Model EQ 1

  7. Role of seepage forces on hydraulic fracturing and failure patterns

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Role of seepage forces on hydraulic fracturing and failure patterns Alexander Rozhko Thesis September 2007 #12;ii Role of seepage forces on hydraulic fracturing and failure patterns Abstract. The mechanical role of seepage forces on hydraulic fracturing and failure patterns was studied both

  8. Creation and Impairment of Hydraulic Fracture Conductivity in Shale Formations 

    E-Print Network [OSTI]

    Zhang, Junjing

    2014-07-10T23:59:59.000Z

    Multi-stage hydraulic fracturing is the key to the success of many shale gas and shale oil reservoirs. The main objectives of hydraulic fracturing in shale are to create artificial fracture networks that are conductive for oil and gas flow...

  9. Poroelastic modeling of fracture-seismic wave interaction

    SciTech Connect (OSTI)

    Nakagawa, Seiji

    2008-08-15T23:59:59.000Z

    Rock containing a compliant, fluid-filled fracture can be viewed as one case of heterogeneous poroelastic media. When this fracture is subjected to seismic waves, a strong contrast in the elastic stiffness between the fracture itself and the background can result in enhanced grain-scale local fluid flow. Because this flow--relaxing the pressure building up within the fracture--can increase the dynamic compliance of the fracture and change energy dissipation (attenuation), the scattering of seismic waves can be enhanced. Previously, for a flat, infinite fracture, we derived poroelastic seismic boundary conditions that describe the relationship between a finite jump in the stress and displacement across a fracture, expressed as a function of the stress and displacement at the boundaries. In this paper, we use these boundary conditions to determine frequency-dependent seismic wave transmission and reflection coefficients. Fluid-filled fractures with a range of mechanical and hydraulic properties are examined. From parametric studies, we found that the hydraulic permeability of a fracture fully saturated with water has little impact on seismic wave scattering. In contrast, the seismic response of a partially water-saturated fracture and a heterogeneous fracture filled with compliant liquid (e.g., supercritical CO{sub 2}) depended on the fracture permeability.

  10. MODELING OF NATURALLY FRACTURED RESERVOIRS BY FORMAL HOMOGENIZATION TECHNIQUES*

    E-Print Network [OSTI]

    Douglas Jr., Jim

    MODELING OF NATURALLY FRACTURED RESERVOIRS BY FORMAL HOMOGENIZATION TECHNIQUES* Todd Arbogast,y Jim in naturally fractured reservoirs. A single component in a single phase and two-component mis- cible. porous medium, double porosity, fractured reservoir, homogenization. yDepartment of Mathematics, Purdue

  11. ESTIMATION OF MATRIX BLOCK SIZE DISTRIBUTION IN NATURALLY FRACTURED RESERVOIRS

    E-Print Network [OSTI]

    Stanford University

    ESTIMATION OF MATRIX BLOCK SIZE DISTRIBUTION IN NATURALLY FRACTURED RESERVOIRS A Report Submitted;2 ABSTRACT Interporosity flow in a naturslly fractured reservoir is modelled by a new formulation of the distribution. Thus, observed pressure response from fractured reservoirs can be analysed to obtain the matrix

  12. EFFECTS OF WATER INJECTION INTO FRACTURED GEOTHERMAL RESERVOIRS

    E-Print Network [OSTI]

    Stanford University

    SGP-TR-57 SGP-TR-57 EFFECTS OF WATER INJECTION INTO FRACTURED GEOTHERMAL RESERVOIRS: A SUMMARY INTO FRACTURED GEOTHERMAL RESERVOIRS A SUMMARY OP EXPERImCE WORtDWIDE Roland N. Horne Stanford University ABSTRACT Reinjection of water i n t o fractured geothermal reservoirs holds potential both f o r

  13. HYDRAULIC STIMULATION OF NATURAL FRACTURES AS REVEALED BY INDUCED MICROEARTHQUAKES,

    E-Print Network [OSTI]

    -1- HYDRAULIC STIMULATION OF NATURAL FRACTURES AS REVEALED BY INDUCED MICROEARTHQUAKES, CARTHAGE, December, 2001 Manuscript # 01066 LAUR# 01-1204 #12;Hydraulic Stimulation of Natural Fractures -2- ABSTRACT We have produced a high-resolution microseismic image of a hydraulic fracture stimulation

  14. Modeling Turbulent Hydraulic Fracture Near a Free Surface

    E-Print Network [OSTI]

    Modeling Turbulent Hydraulic Fracture Near a Free Surface Victor C. Tsai Seismological Laboratory consider a hydraulic fracture problem in which the crack grows parallel to a free surface, subject to fully components. wall Wall shear stress. ^· Non-dimensionalized ·. 1 Introduction Hydraulic fracture has been

  15. Modeling Turbulent Hydraulic Fracture Near a Free Surface

    E-Print Network [OSTI]

    Modeling Turbulent Hydraulic Fracture Near a Free Surface Victor C. Tsai Seismological Laboratory consider a hydraulic fracture problem in which the crack grows parallel to a free surface, subject to fully components. ^· Non-dimensionalized ·. 1 Introduction Hydraulic fracture has been studied for many years

  16. Estimating Major and Minor Natural Fracture Patterns in Gas

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    Estimating Major and Minor Natural Fracture Patterns in Gas Shales Using Production Data Razi Identification of infill drilling locations has been challenging with mixed results in gas shales. Natural fractures are the main source of permeability in gas shales. Natural fracture patterns in shale has a random

  17. Creation and Impairment of Hydraulic Fracture Conductivity in Shale Formations

    E-Print Network [OSTI]

    Zhang, Junjing

    2014-07-10T23:59:59.000Z

    Multi-stage hydraulic fracturing is the key to the success of many shale gas and shale oil reservoirs. The main objectives of hydraulic fracturing in shale are to create artificial fracture networks that are conductive for oil and gas flow...

  18. Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor is enhanced by compressive

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor la Santé et de la Recherche Médicale Running title Cancellous bone culture in a dynamic 3D bioreactor

  19. Rate Transient Analysis in Shale Gas Reservoirs with Transient Linear Behavior 

    E-Print Network [OSTI]

    Bello, Rasheed O.

    2010-07-14T23:59:59.000Z

    Many hydraulically fractured shale gas horizontal wells in the Barnett shale have been observed to exhibit transient linear behavior. This transient linear behavior is characterized by a one-half slope on a log-log plot of rate against time...

  20. Effects of stretching and cycling on the fatigue behavior of polymer-supported Ag thin films

    E-Print Network [OSTI]

    Effects of stretching and cycling on the fatigue behavior of polymer-supported Ag thin films Gi March 2013 Keywords: Fatigue Thin films Fatigue crack initiation Intergranular failure Ductile fracture on characterizing the mechanical behavior of thin metal films and have observed that metals in thin-film form can

  1. Rate Transient Analysis in Shale Gas Reservoirs with Transient Linear Behavior

    E-Print Network [OSTI]

    Bello, Rasheed O.

    2010-07-14T23:59:59.000Z

    Many hydraulically fractured shale gas horizontal wells in the Barnett shale have been observed to exhibit transient linear behavior. This transient linear behavior is characterized by a one-half slope on a log-log plot of rate against time...

  2. Curr Pharm Des . Author manuscript Bisphosphonates and bone diseases: past, present and future

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget s disease of bone

  3. Shell Formation and Bone Strength Laying Hens

    E-Print Network [OSTI]

    Shell Formation and Bone Strength in Laying Hens Effects of Age, Daidzein and Exogenous Estrogen Cover aquarelle: E. Spörndly-Nees #12;Shell Formation and Bone Strength in Laying Hens Effects of Age eggshells as shell quality declines with age during the laying period. This is a concern for food safety

  4. Mechanical bone strength in the proximal tibia

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    . These findings were a pilot study of the technique, which will subsequently be used for human tibial bone. Such data is relevant in the human with respect to the ability of the bone at various distances from the condyle to support the "flat-plate" loading...

  5. Ibuprofen Administered Pre- or Post- Simulated Resistance Exercise Training Does Not Diminsh Gains in Bone Formation or Bone Mass

    E-Print Network [OSTI]

    Cunningham, David

    2012-02-14T23:59:59.000Z

    IBUPROFEN ADMINSTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINISH GAINS IN BONE FORMATION OR BONE MASS A Thesis by DAVID ARTHUR CUNNINGHAM Submitted to the Office of Graduate Studies of Texas A... Training Does Not Diminish Gains in Bone Formation or Bone Mass Copyright 2011 David Arthur Cunningham IBUPROFEN ADMINISTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINSH GAINS IN BONE FORMATION OR BONE MASS A Thesis...

  6. A Nonlocal Peridynamic Plasticity Model for the Dynamic Flow and Fracture of Concrete.

    SciTech Connect (OSTI)

    Vogler, Tracy; Lammi, Christopher James

    2014-10-01T23:59:59.000Z

    A nonlocal, ordinary peridynamic constitutive model is formulated to numerically simulate the pressure-dependent flow and fracture of heterogeneous, quasi-brittle ma- terials, such as concrete. Classical mechanics and traditional computational modeling methods do not accurately model the distributed fracture observed within this family of materials. The peridynamic horizon, or range of influence, provides a characteristic length to the continuum and limits localization of fracture. Scaling laws are derived to relate the parameters of peridynamic constitutive model to the parameters of the classical Drucker-Prager plasticity model. Thermodynamic analysis of associated and non-associated plastic flow is performed. An implicit integration algorithm is formu- lated to calculate the accumulated plastic bond extension and force state. The gov- erning equations are linearized and the simulation of the quasi-static compression of a cylinder is compared to the classical theory. A dissipation-based peridynamic bond failure criteria is implemented to model fracture and the splitting of a concrete cylinder is numerically simulated. Finally, calculation of the impact and spallation of a con- crete structure is performed to assess the suitability of the material and failure models for simulating concrete during dynamic loadings. The peridynamic model is found to accurately simulate the inelastic deformation and fracture behavior of concrete during compression, splitting, and dynamically induced spall. The work expands the types of materials that can be modeled using peridynamics. A multi-scale methodology for simulating concrete to be used in conjunction with the plasticity model is presented. The work was funded by LDRD 158806.

  7. Interference Fracturing: Non-Uniform Distributions of Perforation Clusters that Promote Simultaneous Growth of Multiple Hydraulic Fractures

    E-Print Network [OSTI]

    Peirce, Anthony

    Simultaneous Growth of Multiple Hydraulic Fractures A.P. Peirce, University of British Columbia and A.P. Bunger in horizontal well stimulation is the generation of hydraulic fractures (HFs) from all perforation clusters shadowing" that refers to suppression of some hydraulic fractures by the compressive stresses exerted

  8. Identifying Best Practices in Hydraulic Fracturing Using

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    . Treating Rate Medina Treating Pressure Medina Production Remaining Gas Ultimate Gas Gas Months Prod Gas Medina and Whirlpool sands of southwest New York State are considered to be tight gas sands. Most wells, are fractured upon completion to provide economic amounts of gas. #12;SPE 72385 BACKGROUND A dataset

  9. Coupled Flow and Deformation Modeling of Carbon Dioxide Migration in the Presence of a Caprock Fracture during Injection

    SciTech Connect (OSTI)

    Siriwardane, Hema J.; Gondle, Raj K.; Bromhal, Grant S.

    2013-08-01T23:59:59.000Z

    Understanding the transport of carbon dioxide (CO{sub 2}) during long-term CO{sub 2} injection into a typical geologic reservoir, such as a saline aquifer, could be complicated because of changes in geochemical, hydrogeological, and hydromechanical behavior. While the caprock layer overlying the target aquifer is intended to provide a tight, impermeable seal in securing injected CO{sub 2}, the presence of geologic uncertainties, such as a caprock fracture or fault, may provide a channel for CO{sub 2} leakage. There could also be a possibility of the activation of a new or existing dormant fault or fracture, which could act as a leakage pathway. Such a leakage event during CO{sub 2} injection may lead to a different pressure and ground response over a period of time. In the present study, multiphase fluid flow simulations in porous media coupled with geomechanics were used to investigate the overburden geologic response and plume behavior during CO{sub 2} injection in the presence of a hypothetical permeable fractured zone in a caprock, existing or activated. Both single-phase and multiphase fluid flow simulations were performed. The CO{sub 2} migration through an existing fractured zone leads to changes in the fluid pressure in the overburden geologic layers and could have a significant impact on ground deformation behavior. Results of the study show that pressure signatures and displacement patterns are significantly different in the presence of a fractured zone in the caprock layer. The variation in pressure and displacement signatures because of the presence of a fractured zone in the caprock at different locations may be useful in identifying the presence of a fault/fractured zone in the caprock. The pressure signatures can also serve as a mechanism to identify the activation of leakage pathways through the caprock during CO{sub 2} injection. Pressure response and ground deformation behavior from sequestration modeling could be useful in the development of smart technologies to monitor safe CO{sub 2} storage and understand CO{sub 2} transport, with limited field instrumentation.

  10. A Triple-Porosity Model for Fractured Horizontal Wells

    E-Print Network [OSTI]

    Alahmadi, Hasan Ali H.

    2010-10-12T23:59:59.000Z

    . The model consists of three contiguous porous media: the matrix, less permeable micro-fractures and more permeable macro-fractures. Only the macro-fractures produce to the well while they are fed by the micro-fractures only. Consequently, the matrix feeds... the micro-fractures only. Therefore, the flow is sequential from one medium to the other. Four sub-models are derived based on the interporosity flow assumption between adjacent media, i.e., pseudosteady state or transient flow assumption. These are fully...

  11. Characterization and significance of a stylolitic fracture system determined from horizontal core and borehole imaging data, Hanifa Reservoir, Abqaiq Field (SA)

    SciTech Connect (OSTI)

    Luthy, S.T.; Grover, G. [Saudi Aramco, Dhahran (Saudi Arabia); Wiltse, E. [Schlumberger, Al-Khobar (Saudi Arabia)

    1995-08-01T23:59:59.000Z

    The Hanifa reservoir at Abqaiq Field, eastern Saudi Arabia, consists of microporous (up to 30% porosity) lime mudstones with low matrix permeability (< 10 md). SEM imagery reveals a crystal framework texture of micro-rhombic calcite crystals with 2-5 {mu}m-sized intercrystalline pore spaces. Fluid transmissibility was preliminarily identified as via fractures as indicated by no stratigraphic predictability to fluid flow, high flow over thin stratigraphic intervals, little relationship between high flow and high porosity intervals, large disparity between core Kh and well-test Kh, and observation offractures in cores and borehole imaging logs front horizontal Hanifa wells. Integration of descriptions from over 4000 fractures observed in borehole images together with descriptions of over 500 fractures identified from vertica1 and horizontal cores has resulted in further characterization of the fracture system. The fractures are open to partially-open, with an east-to northeast orientation, and they cluster in low porosity zones which are characterized by intense stylolitization. These sub-parallel, nearly vertical, discontinuous fractures terminate at stylolites, or pinchout locally into tight carbonate matrix, and contain appreciable amounts of dead oil and calcite cement. In zones of particularly intense stylolitization, fracturing may be locally pervasive, giving the rock a brecciated appearance. Together, the stylolites and stylolite-related fractures form the primary permeability system ofthe Hanifa reservoir. This fracture system architecture is critical to understanding the production characteristics of the reservoir, which include anomalously high fluid flow in low porosity zones or transition zones between high and low porosity, radial flow behavior from well tests, smaller than expected differences in well productivity between vertical and horizontal wells, and limited injection water breakthrough.

  12. Naturally fractured tight gas reservoir detection optimization

    SciTech Connect (OSTI)

    NONE

    1996-09-30T23:59:59.000Z

    The focus of this report was on preparing data and modules for Piceance Basin-wide fracture prediction. A review of the geological data input and automated history reconstruction approach was made. Fluid pressure data analysis and preliminary basin simulations were carried out. These activities are summarized briefly below and reviewed in more detail in Appendices A-E. Appendix D is a review of the fluid pressure data and its implications for compartmentation. Preliminary fracture prediction computations on generic basins are presented in Appendix E; these were carried out as part of our code testing activities. The results of these two Appendices are the beginning of what will be the basis of the model testing; fluid pressures are directly comparable with the model predictions and are a key element of fracture nucleation and presentation. We summarize the tectonic and sedimentary history of the Piceance Basin based on our automated history reconstruction and published interpretations. The narrative and figures provide the basic material we have quantified for our CIRF.B basin simulator input. This data supplements our existing well data interpretation approach. It provides an independent check of the automated sedimentary/subsidence history reconstruction module. Fluid pressure data was gathered and analyzed. This data serves two functions. Fluid pressure distribution across the basin provides a quantitative test as it is a direct prediction of CIRF.B. Furthermore, fluid pressure modifies effective stress. It thereby enters fracture nucleation criteria and fracture extension rate and aperture laws. The pressure data is presented in Appendix Din terms of overpressure maps and isosurfaces.

  13. Advanced hydraulic fracturing methods to create in situ reactive barriers

    SciTech Connect (OSTI)

    Murdoch, L. [FRX Inc., Cincinnati, OH (United States)]|[Clemson Univ., SC (United States). Dept. of Geological Sciences; Siegrist, B.; Meiggs, T. [Oak Ridge National Lab., TN (United States)] [and others

    1997-12-31T23:59:59.000Z

    This article describes the use of hydraulic fracturing to increase permeability in geologic formations where in-situ remedial action of contaminant plumes will be performed. Several in-situ treatment strategies are discussed including the use of hydraulic fracturing to create in situ redox zones for treatment of organics and inorganics. Hydraulic fracturing methods offer a mechanism for the in-situ treatment of gently dipping layers of reactive compounds. Specialized methods using real-time monitoring and a high-energy jet during fracturing allow the form of the fracture to be influenced, such as creation of assymmetric fractures beneath potential sources (i.e. tanks, pits, buildings) that should not be penetrated by boring. Some examples of field applications of this technique such as creating fractures filled with zero-valent iron to reductively dechlorinate halogenated hydrocarbons, and the use of granular activated carbon to adsorb compounds are discussed.

  14. Feasibility of a borehole VHF radar technique for fracture mapping

    SciTech Connect (OSTI)

    Chang, H.T.

    1984-01-01T23:59:59.000Z

    Experiments were conducted to establish the feasibility of a downhole high-frequency electromagnetic technique for location of fractures in the vicinity of boreholes. An existing flame-cut slot in granite was filled with salt water to simulate a brine-filled fracture. A transmitter consisting of a phased dual-dipole array arranged to provide a directional signal toward the fracture was installed in a borehole opposite the fracture. A receiver operated at 30 to 300 MHz was also located in the same borehole. The radar returns from the simulated fracture were detectable in boreholes located at distances of up to 12 meters from the fracture. These results indicate for the first time the feasibility of a downhole VHF radar for use in a single borehole for detection of fractures located away from the borehole.

  15. Control of interface fracture in silicon nitride ceramics: influence of different rare earth elements

    SciTech Connect (OSTI)

    Sun, E.Y.; Becher, P.F.; Waters, S.B.; Hsueh, Chun-Hway; Plucknett, K.P. [Oak Ridge National Lab., TN (United States); Hoffmann, M.J. [Karlsruhe Univ. (T.H.) (Germany). Inst. fuer Keramik im Maschinenbau

    1996-10-01T23:59:59.000Z

    The toughness of self-reinforced silicon nitride ceramics is improved by enhancing crack deflection and crack bridging mechanisms. Both mechanisms rely on the interfacial debonding process between the elongated {Beta}-Si{sub 3}N{sub 4} grains and the intergranular amorphous phases. The various sintering additives used for densification may influence the interfacial debonding process by modifying the thermal and mechanical properties of the intergranular glasses, which will result in different residual thermal expansion mismatch stresses; and the atomic bonding structure across the {Beta}-Si{sub 3}N{sub 4} glass interface. Earlier studies indicated that self-reinforced silicon nitrides sintered with different rare earth additives and/or different Y{sub 2}O{sub 3}:AI{sub 2}0{sub 3} ratios could exhibit different fracture behavior that varied from intergranular to transgranular fracture. No studies have been conducted to investigate the influence of sintering additives on the interfacial fracture in silicon nitride ceramics. Because of the complexity of the material system and the extremely small scale, it is difficult to conduct quantitative analyses on the chemistry and stress states of the intergranular glass phases and to relate the results to the bulk properties. The influence of different sintering additives on the interfacial fracture behavior is assessed using model systems in which {Beta}-Si{sub 3}N{sub 4}whiskers are embedded in SIAIRE (RE: rare-earth) oxynitride glasses. By systematically varying the glass composition, the role of various rare-earth additives on interfacial fracture has been examined. Specifically, four different additives were investigated: Al{sub 2}0{sub 3}, Y{sub 2}0{sub 3}, La{sub 2}O{sub 3}, and Yb{sub 2}O{sub 3}. In addition, applying the results from the model systems, the R- curve behavior of self-reinforced silicon nitride ceramics sintered with different Y{sub 2}0{sub 3}:AI{sub 2}0{sub 3} ratios was characterized.

  16. Treatment of Extraspinal Painful Bone Metastases with Percutaneous Cementoplasty: A Prospective Study of 50 Patients

    SciTech Connect (OSTI)

    Anselmetti, Giovanni Carlo, E-mail: giovanni.anselmetti@ircc.it; Manca, Antonio [Institute for Cancer Research and Treatment, Interventional Radiology Unit (Italy); Ortega, Cinzia; Grignani, Giovanni [Institute for Cancer Research and Treatment, Oncology Unit (Italy); DeBernardi, Felicino [Institute for Cancer Research and Treatment, Anesthesiology Unit (Italy); Regge, Daniele [Institute for Cancer Research and Treatment, Radiology Unit (Italy)

    2008-11-15T23:59:59.000Z

    The aim of this study was to assess the efficacy of percutaneous cementoplasty (PC) with polymethylmethacrylate (PMMA) in painful extravertebral lytic bone metastases not responding to conventional therapy. Fifty patients (25 females), mean age 64.7 {+-} 11.2 years, underwent PC after giving informed consent. Procedures were performed under fluoroscopy (1/50) or combined fluoroscopy-CT (49/50) guidance in local anesthesia or under deep sedation in 7 patients with large metastases who underwent radiofrequency thermoablation (RFA) in the same session. Seventy lesions were treated (1-6 per patient; average, 1.4 {+-} 0.9), arranging in size from 1 to 10 cm (average, 3.6 {+-} 2.1 cm). Mean volume of PMMA per lesion was 5.9 {+-} 3.2 ml (range, 1.5-15.0 ml). Pain was prospectively evaluated on an 11-point visual analog scale (VAS) before and after the procedure (follow-up, 15 to 36 months). Mean VAS score dropped from 9.1 {+-} 1.2 (range: 6-10) to 2.1 {+-} 2.5 (range: 0-9). Mean VAS difference was 7.0 {+-} 2.3 (range, 1-10; p < 0.0001, Wilcoxon signed rank test). Forty-seven of the 50 patients (94%) suspended narcotic drugs, in 22 (44%) pain was controlled with a nonsteroidal anti-inflammatory drug, in 25 (50%) analgesic therapy was suspended, and 13 of 50 (26%) had complete pain regression. In 3 of the 50 patients (6%) pain was not improved. No statistical difference between osteoplasty and osteoplasty plus RFA was found (p = 0.8338, Mann-Whitney test). No complications arose during the procedure. Two patients with metastases in the femoral diaphysis reported a fracture 1 month after treatment. PC is effective to obtain pain regression in painful bone metastases not responding to conventional analgesic therapy; bone consolidation cannot be obtained in the diaphysis of long weight-bearing bones.

  17. Application of synchrotron radiation computed microtomography for quantification of bone microstructure in human and rat bones

    SciTech Connect (OSTI)

    Parreiras Nogueira, Liebert; Barroso, Regina Cely; Pereira de Almeida, Andre; Braz, Delson; Almeida, Carlos Eduardo de; Borba de Andrade, Cherley; Tromba, Giuliana [Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Physics Institute / State University of Rio de Janeiro, 20550-900, Rio de Janeiro (Brazil); Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Laboratory of Radiological Sciences / State University of Rio de Janeiro, Rio de Janeiro (Brazil); Sincrotrone Trieste SCpA, Strada Statale S.S. 14 km 163.5, 34012 Basovizza, Trieste (Italy)

    2012-05-17T23:59:59.000Z

    This work aims to evaluate histomorphometric quantification by synchrotron radiation computed microto-mography in bones of human and rat specimens. Bones specimens are classified as normal and pathological (for human samples) and irradiated and non-irradiated samples (for rat ones). Human bones are specimens which were affected by some injury, or not. Rat bones are specimens which were irradiated, simulating radiotherapy procedures, or not. Images were obtained on SYRMEP beamline at the Elettra Synchrotron Laboratory in Trieste, Italy. The system generated 14 {mu}m tomographic images. The quantification of bone structures were performed directly by the 3D rendered images using a home-made software. Resolution yielded was excellent what facilitate quantification of bone microstructures.

  18. Permeability and Dispersion Coefficients in Rocks with Fracture Network - 12140

    SciTech Connect (OSTI)

    Lee, C.K.; Htway, M.Z. [Handong Global University, 3 Namsong-ri, Heunghae-eub, Buk-gu, Pohang, Kyungbuk, 791-708 (Korea, Republic of); Yim, S.P. [Korea Atomic Energy Research Institute, P.O.Box 150, Yusong, Daejon, 305-600 (Korea, Republic of)

    2012-07-01T23:59:59.000Z

    Fluid flow and solute transport are considered for a rock medium with a fracture network with regard to the effective permeability and the dispersion coefficients. To investigate the effects of individual fractures a three-fracture system is chosen in which two are parallel and the third one connects the two at different angles. Specifically the micro-cell boundary-value problems(defined through multiple scale analysis) are solved numerically by using finite elements to calculate the permeability and dispersion coefficients. It is shown that the permeability depends significantly on the pattern of the fracture distribution and the dispersion coefficient is influenced by both the externally imposed pressure gradient (which also reflects the flow field) and the direction of the gradient of solute concentration on the macro-scale. From the calculations of the permeability and dispersion coefficients for solute in a rock medium with a fracture network the following conclusions are drawn. 1. The permeability of fractured medium depends on the primary orientation of the fracture network and is influenced by the connecting fractures in the medium. 2. The cross permeability, e.g., permeability in the direction normal to the direction of the external pressure gradient is rather insensitive to the orientation of the fracture network. 3. Calculation of permeability is most efficiently achieved with optimal discretization across individual fractures and is rather insensitive to the discretization along the fracture.. 4. The longitudinal dispersion coefficient Dxx of a fractured medium depends on both the macro-scale concentration gradient and the direction of the flow (pressure gradient). Hence both features must be considered when investigating solute transport in a fractured medium. (authors)

  19. Naturally fractured tight gas reservoir detection optimization

    SciTech Connect (OSTI)

    NONE

    1999-06-01T23:59:59.000Z

    Building upon the partitioning of the Greater Green River Basin (GGRB) that was conducted last quarter, the goal of the work this quarter has been to conclude evaluation of the Stratos well and the prototypical Green River Deep partition, and perform the fill resource evaluation of the Upper Cretaceous tight gas play, with the goal of defining target areas of enhanced natural fracturing. The work plan for the quarter of November 1-December 31, 1998 comprised four tasks: (1) Evaluation of the Green River Deep partition and the Stratos well and examination of potential opportunity for expanding the use of E and P technology to low permeability, naturally fractured gas reservoirs, (2) Gas field studies, and (3) Resource analysis of the balance of the partitions.

  20. Lisburne Formation fracture characterization and flow modeling

    E-Print Network [OSTI]

    Karpov, Alexandre Valerievich

    2001-01-01T23:59:59.000Z

    lead to exponential distrtbutions; multiplicatory processes as they occur in breakage lead 10 to lognormal distributions; and continuity of the process from smallest to largest sizes produces hyperbolic (fractal) distributions. However, a rigorous... of fractures on related outcrops was in the range of 1, 6-1. 8. Brock (1971) stated an important rule of thumb of fractal studies: the linearity on the double logarithmic plot should extend over at least two or three orders of naagnitude ol particle size...

  1. Microdamage accumulation in bovine trabecular bone

    E-Print Network [OSTI]

    Moore, Tara L. Arthur (Tara Lee Arthur), 1972-

    2001-01-01T23:59:59.000Z

    When bone is loaded beyond its failure point, it develops damage in the form of microcracks. Normally, microcracks are repaired by the remodeling process, limiting the number of in vivo microcracks. However, if the rate ...

  2. Composite gelatin delivery system for bone regeneration

    E-Print Network [OSTI]

    Hager, Elizabeth A. (Elizabeth Ann)

    2005-01-01T23:59:59.000Z

    In this thesis, the chemical/mechanical properties and biocompatibility of gelatin were investigated to produce a gelatin scaffold for the release of bone morphogenetic proteins (BMPs) from composite particles. This delivery ...

  3. FRACTURE FAILURE CRITERIA OF SOFC PEN STRUCTURE

    SciTech Connect (OSTI)

    Liu, Wenning N.; Sun, Xin; Khaleel, Mohammad A.; Qu, Jianmin

    2007-04-30T23:59:59.000Z

    Thermal stresses and warpage of the PEN are unavoidable due to the temperature changes from the stress-free sintering temperature to room temperature and mismatch of the coefficients of thermal expansion (CTE) of various layers in the PEN structures of solid oxide fuel cells (SOFC) during the PEN manufacturing process. In the meantime, additional mechanical stresses will also be created by mechanical flattening during the stack assembly process. The porous nature of anode and cathode in the PEN structures determines presence of the initial flaws and crack on the interfaces of anode/electrolyte/cathode and in the interior of the materials. The sintering/assembling induced stresses may cause the fracture failure of PEN structure. Therefore, fracture failure criteria for SOFC PEN structures is developed in order to ensure the structural integrity of the cell and stack of SOFC. In this paper, the fracture criteria based on the relationship between the critical energy release rate and critical curvature and maximum displacement of the warped cells caused by the temperature changes as well as mechanical flattening process is established so that possible failure of SOFC PEN structures may be predicted deterministically by the measurement of the curvature and displacement of the warped cells.

  4. Effects of oxygen on fracturing fluids

    SciTech Connect (OSTI)

    Walker, M.L.; Shuchart, C.E.; Yaritz, J.G.; Norman, L.R.

    1995-11-01T23:59:59.000Z

    The stability of polysaccharide gels at high temperature is limited by such factors as pH, mechanical degradation, and oxidants. Oxygen is unavoidably placed in fracturing fluids through dissolution of air. To prevent premature degradation of the fracturing fluid by this oxidant, oxygen scavengers are commonly used. In this paper, the effects of oxygen and various oxygen scavengers on gel stability will be presented. Mechanical removal of oxygen resulted in surprisingly stable fracturing gels at 275 F. However, chemical removal of oxygen gave mixed results. Test data from sodium thiosulfate, sodium sulfite, and sodium erythorbate used as oxygen scavengers/gel stabilizers showed that the efficiency of oxygen removal from gels did not directly coincide with the viscosity retention of the gel, and large excesses of additives were necessary to provide optimum gel stabilization. The inability of some oxygen scavengers to stabilize the gel was the result of products created from the interaction of oxygen with the oxygen scavenger, which in turn, produced species that degraded the gel. The ideal oxygen scavenger should provide superior gel stabilization without creating detrimental side reaction products. Of the materials tested, sodium thiosulfate appeared to be the most beneficial.

  5. Development of an analytical solution for thermal single-well injection-withdrawal tests in horizontally fractured reservoirs

    E-Print Network [OSTI]

    Jung, Y.

    2014-01-01T23:59:59.000Z

    Transfer Area in Fractured Reservoirs, paper presented attests in horizontally fractured reservoirs Yoojin Jung Earthtests in horizontally fractured reservoirs where fluid flow

  6. Use of TOUGHREACT to Simulate Effects of Fluid Chemistry on Injectivity in Fractured Geothermal Reservoirs with High Ionic Strength Fluids

    E-Print Network [OSTI]

    Xu, Tianfu; Zhang, Guoxiang; Pruess, Karsten

    2005-01-01T23:59:59.000Z

    swelling in a fractured geothermal reservoir, Proceedings ofon Injectivity in Fractured Geothermal Reservoirs with Highdry rock and hot fractured rock reservoirs in a sustainable

  7. Report Number 1: Metallurgical characterization of the HAZ in A516-70 and evaluation of fracture toughness specimens

    SciTech Connect (OSTI)

    Lundin, C.D.; Zhou, G.; Khan, K.K.

    1995-07-01T23:59:59.000Z

    An extensive study has been conducted on A516 grade 70 steel to investigate the effect of shallow cracks in weldment HAZs. Charpy V-notch (CVN) and crack-tip opening displacement (CTOD) tests were utilized to characterize the fracture toughness behavior of the heat-affected zone (HAZ) of A516-70 SMAW weldments. The test results are explained on the basis of microstructural features in the HAZ and fractographic examination. Optical light microscopy (OLM) and scanning electron microscopy (SEM) were used for these evaluations. A computer-assisted imaging system was also utilized and it proved to be a powerful tool for fracture surface analysis. It was evident from the testing of thermally simulated HAZs of A516-70, that the CGHAZ has the lowest toughness. The need for welding techniques to create actual weld HAZs without an influence from secondary weld passes was addressed during the course of this investigation. A welding procedure was developed which is capable of producing ``singular`` HAZs in actual welds. The ``singular`` HAZ technique produced a non-overlapped continuous HAZ through the full plate thickness. A good correlation was found between thermally simulated HAZ behavior and ``singular`` HAZ behavior in terms of fracture toughness, hardness and microstructure.

  8. Fracture testing of Edwards limestone: a statistical treatment 

    E-Print Network [OSTI]

    Redding, David Earl

    1993-01-01T23:59:59.000Z

    Parameters. . 21 8. Goodness-of-Fit Statistic (Alpha) for Rubber Fracture Testing of Edwards Limestone. . 9. Sum of Square Residuals for Predicted Geometry vs. Base Geometry. . 38 10. Residuals in Sigma Theta Maximum at the Median Probability Value... for Predicted Geometry vs. Base Geometry. . 38 LIST OF FIGURES Figure 1. Rubber Fracture Test Geometry. Page 2. Hollow Brass Cylinder Calibration. 13 3. Sigma Theta Max vs. Volume. . 18 4A. Cumulative Probability vs. Sigma Theta Max. Rubber Fracture...

  9. Bone Growth, Maintenance and Loss in the Neolithic Community of Çatalhöyük, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Bone Growth, Maintenance and Loss in the Neolithic CommunityThe examination of bone maintenance and loss is another wellchanging patterns of bone maintenance typically observed in

  10. apophyseal ring fractures: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    system 4 2 Ring solutions Kolokolnikov, Theodore 90 Self-potential observations during hydraulic fracturing University of California eScholarship Repository Summary: hydraulic...

  11. ankle joint fractures: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    for hydrocarbon production, control and manipulation of water supplies events induced by hydraulic fracturing. The effect of a thin weak elastic layer was investigated by Jones...

  12. adjacent compression fractures: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    12;MRCM New Approach Multiple Stankewitz, Rich 140 Self-potential observations during hydraulic fracturing University of California eScholarship Repository Summary: hydraulic...

  13. arch fracture intraoperatively: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    formation determined. Szymczak, P 2009-01-01 149 Self-potential observations during hydraulic fracturing University of California eScholarship Repository Summary: hydraulic...

  14. acute compression fracture: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    12;MRCM New Approach Multiple Stankewitz, Rich 112 Self-potential observations during hydraulic fracturing University of California eScholarship Repository Summary: hydraulic...

  15. acetabular fracture fixation: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    knowledge about the po... Wilke, C O 2002-01-01 104 Self-potential observations during hydraulic fracturing University of California eScholarship Repository Summary: hydraulic...

  16. apophyseal ring fracture: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    system 4 2 Ring solutions Kolokolnikov, Theodore 90 Self-potential observations during hydraulic fracturing University of California eScholarship Repository Summary: hydraulic...

  17. Imaging, Characterizing, and Modeling of Fracture Networks and...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    code (modeling at the reservoir scale) - CFD: NETL's computational fluid dynamics code (modeling at the fracture scale) * Develop fat-ray double-difference tomography...

  18. Evaluation of subsurface fracture geometry using fluid pressure...

    Open Energy Info (EERE)

    subsurface fracture geometry using fluid pressure response to solid earth tidal strain Jump to: navigation, search OpenEI Reference LibraryAdd to library Report: Evaluation of...

  19. SciTech Connect: CRACK TIP PLASTICITY AND FRACTURE INITIATION...

    Office of Scientific and Technical Information (OSTI)

    N50000* --Metals, Ceramics, & Other Materials; CRACKS; FRACTURE PROPERTIES; METALS BUILDING MATERIALSfracture of metal, crack tip plasticity and initiation criteria for;...

  20. Aligned fractures modeled as boundary conditions within saturated ...

    E-Print Network [OSTI]

    2015-03-30T23:59:59.000Z

    e di Geofisica Sperimentale, OGS. SUMMARY. Fractures in a fluid-saturated poroelastic -Biot- medium are very thin, compliant and highly permeable layers.

  1. Fractured reservoirs: An analysis of coupled elastodynamic and ...

    E-Print Network [OSTI]

    Daley, T., Schoenberg, M., Rutqvist, J., and Nihei, K.

    2006-08-28T23:59:59.000Z

    Aug 28, 2006 ... pliance and fluid-permeability tensors of a layer containing closely spaced ...... Coupled thermo-hydromechanical processes of fractured media.

  2. Finding Large Aperture Fractures in Geothermal Resource Areas...

    Broader source: Energy.gov (indexed) [DOE]

    Seismic Survey DOE Geothermal Peer Review 2010 - Presentation. Project summary: Drilling into large aperture open fractures (LAFs) typically yield production wells with...

  3. Finding Large Aperture Fractures in Geothermal Resource Areas...

    Broader source: Energy.gov (indexed) [DOE]

    3-D mapping of Large Aperture Fractures (LAF's) * Budget: 679,000 - Phase 2: Drilling - January-December, 2011. * Task 4: Stepout drilling from existing production wells....

  4. AN APPROACH TO THE FRACTURE HYDROLOGY AT STRIPA: PRELIMINARY RESULTS

    E-Print Network [OSTI]

    Gale, J.E.

    2010-01-01T23:59:59.000Z

    Geochemistry and Isotope Hydrology of Groundwaters in theAN APPROACH TO THE FRACTURE HYDROLOGY AT STRIPA: PRELIMINARYGeochemistry and Isotope Hydrology of Groundwaters in the

  5. Detection and Characterization of Natural and Induced Fractures...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    of Enhanced Geothermal Systems Project objectives: Combine geophysical methods for reservoir and fracture characterization with rock physics measurements made under in-situ...

  6. Tracer Methods for Characterizing Fracture Creation in Enhanced...

    Broader source: Energy.gov (indexed) [DOE]

    Geothermal Systems (EGS); 2010 Geothermal Technology Program Peer Review Report Fracture Characterization in Enhanced Geothermal Systems by Wellbore and Reservoir Analysis; 2010...

  7. Tracer Methods for Characterizing Fracture Stimulation in Enhanced...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Geothermal Systems; 2010 Geothermal Technology Program Peer Review Report Fracture Characterization in Enhanced Geothermal Systems by Wellbore and Reservoir Analysis; 2010...

  8. Fracture Characterization in Enhanced Geothermal Systems by Wellbore...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Characterization in Enhanced Geothermal Systems by Wellbore and Reservoir Analysis; 2010 Geothermal Technology Program Peer Review Report Fracture Characterization in Enhanced...

  9. Reservoir-Scale Fracture Permeability in the Dixie Valley, Nevada...

    Open Energy Info (EERE)

    Nevada, Geothermal Field Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Paper: Reservoir-Scale Fracture Permeability in the Dixie Valley,...

  10. Characterization of subsurface fracture patterns in the Coso...

    Open Energy Info (EERE)

    microearthquake seismorgrams Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Proceedings: Characterization of subsurface fracture patterns in the...

  11. Characterization Of Fracture Patterns In The Geysers Geothermal...

    Open Energy Info (EERE)

    Patterns In The Geysers Geothermal Reservoir By Shear-Wave Splitting Jump to: navigation, search OpenEI Reference LibraryAdd to library Report: Characterization Of Fracture...

  12. Characterizing Fractures in the Geysers Geothermal Field by Micro...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Geothermal Field by Micro-seismic Data, Using Soft Computing, Fractals, and Shear Wave Anisotropy Characterizing Fractures in the Geysers Geothermal Field by Micro-seismic...

  13. Integrated 3D Acid Fracturing Model for Carbonate Reservoir Stimulation

    E-Print Network [OSTI]

    Wu, Xi

    2014-06-23T23:59:59.000Z

    workflow is illustrated in Figure 3.3. The approach starts with a fracture simulator, which uses a geomechanical model, to calculate fracture width during the pad injection. A hydraulic fracture is created at the defined injection condition. Next, we... be directly found from the output of Fracpro. Table 3.1 shows an output file example from Fracpro for a fracture geometry at the end of a pad injection. The geometry data is restored in an “.fpx” file, named “PROJECT_NAME.fpx” and can be read using any text...

  14. alternate fracture toughness: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    specic stiness and uid ow L Lafayette, IN 47907-1397, USA Accepted 7 October 1999 Abstract Fracture specic stiness and uid ow through a single...

  15. arrest fracture toughness: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    specic stiness and uid ow L Lafayette, IN 47907-1397, USA Accepted 7 October 1999 Abstract Fracture specic stiness and uid ow through a single...

  16. advanced fracturing technology: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    specic stiness and uid ow L Lafayette, IN 47907-1397, USA Accepted 7 October 1999 Abstract Fracture specic stiness and uid ow through a single...

  17. Advanced Hydraulic Fracturing Technology for Unconventional Tight Gas Reservoirs

    SciTech Connect (OSTI)

    Stephen Holditch; A. Daniel Hill; D. Zhu

    2007-06-19T23:59:59.000Z

    The objectives of this project are to develop and test new techniques for creating extensive, conductive hydraulic fractures in unconventional tight gas reservoirs by statistically assessing the productivity achieved in hundreds of field treatments with a variety of current fracturing practices ranging from 'water fracs' to conventional gel fracture treatments; by laboratory measurements of the conductivity created with high rate proppant fracturing using an entirely new conductivity test - the 'dynamic fracture conductivity test'; and by developing design models to implement the optimal fracture treatments determined from the field assessment and the laboratory measurements. One of the tasks of this project is to create an 'advisor' or expert system for completion, production and stimulation of tight gas reservoirs. A central part of this study is an extensive survey of the productivity of hundreds of tight gas wells that have been hydraulically fractured. We have been doing an extensive literature search of the SPE eLibrary, DOE, Gas Technology Institute (GTI), Bureau of Economic Geology and IHS Energy, for publicly available technical reports about procedures of drilling, completion and production of the tight gas wells. We have downloaded numerous papers and read and summarized the information to build a database that will contain field treatment data, organized by geographic location, and hydraulic fracture treatment design data, organized by the treatment type. We have conducted experimental study on 'dynamic fracture conductivity' created when proppant slurries are pumped into hydraulic fractures in tight gas sands. Unlike conventional fracture conductivity tests in which proppant is loaded into the fracture artificially; we pump proppant/frac fluid slurries into a fracture cell, dynamically placing the proppant just as it occurs in the field. From such tests, we expect to gain new insights into some of the critical issues in tight gas fracturing, in particular the roles of gel damage, polymer loading (water-frac versus gel frac), and proppant concentration on the created fracture conductivity. To achieve this objective, we have designed the experimental apparatus to conduct the dynamic fracture conductivity tests. The experimental apparatus has been built and some preliminary tests have been conducted to test the apparatus.

  18. Dispersed Fluid Flow in Fractured Reservoirs- an Analysis of...

    Open Energy Info (EERE)

    Distributions Abstract A methodology for analyzing the internal flow characteristics of a fractured geothermal reservoir using tracer-determined residence time distribution curves...

  19. Analysis Of Macroscopic Fractures In Granite In The Hdr Geothermal...

    Open Energy Info (EERE)

    nearly parallel to the maximum horizontal stress. In this favorable situation, hydraulic injections will tend both to reactivate natural fractures at low pressures, and to...

  20. 1112323-danimer-abstract-hydraulic-fractures | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Oil Recovery Deepwater Tech Methane Hydrate Field Demo of Eco-Friendly Propped Hydraulic Fractures 11123-23 Primary Performer DaniMer Scientific, LLC (Bainbridge, GA)...

  1. Finite element modeling of hydraulic fracturing in 3D

    E-Print Network [OSTI]

    2013-03-22T23:59:59.000Z

    Mar 22, 2013 ... Gautier. A.. Touzelet. S.: Tracer testing of the geothermal heat ex- ... R.: A field demonstra- tion of hydraulic fracturing for solid waste diposal—.

  2. Joint inversion of electrical and seismic data for Fracture char...

    Broader source: Energy.gov (indexed) [DOE]

    Joint inversion of electrical and seismic data for Fracture char. and Imaging of Fluid Flow in Geothermal Systems Michael Batzle, PI Colorado School of Mines Track Name: Fluid...

  3. Imaging, Characterizing, and Modeling of Fracture Networks and...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Project title: Stimulation at Desert Peak and Bradys reservoirs: modeling with the coupled THM code FEHM Seismic Fracture Characterization Methods for Enhanced Geothermal Systems...

  4. AN INTEGRATED APPROACH TO CHARACTERIZING BYPASSED OIL IN HETEROGENEOUS AND FRACTURED RESERVOIRS USING PARTITIONING TRACERS

    SciTech Connect (OSTI)

    Akhil Datta-Gupta

    2004-08-01T23:59:59.000Z

    We explore the use of efficient streamline-based simulation approaches for modeling and analysis partitioning interwell tracer tests in heterogeneous and fractured hydrocarbon reservoirs. The streamline approach is generalized to model water injection in naturally fractured reservoirs through the use of a dual media approach. The fractures and matrix are treated as separate continua that are connected through a transfer function, as in conventional finite difference simulators for modeling fractured systems. A detailed comparison with a commercial finite difference simulator shows very good agreement. Furthermore, an examination of the scaling behavior of the computation time indicates that the streamline approach is likely to result in significant savings for large-scale field applications. We also propose a novel approach to history matching finite-difference models that combines the advantage of the streamline models with the versatility of finite-difference simulation. In our approach, we utilize the streamline-derived sensitivities to facilitate history matching during finite-difference simulation. The use of finite-difference model allows us to account for detailed process physics and compressibility effects. The approach is very fast and avoids much of the subjective judgments and time-consuming trial-and-errors associated with manual history matching. We demonstrate the power and utility of our approach using a synthetic example and two field examples. Finally, we discuss several alternative ways of using partitioning interwell tracer tests (PITTs) in oil fields for the calculation of oil saturation, swept pore volume and sweep efficiency, and assess the accuracy of such tests under a variety of reservoir conditions.

  5. Modeling Acid Transport and Non-Uniform Etching in a Stochastic Domain in Acid Fracturing

    E-Print Network [OSTI]

    Mou, Jianye

    2010-10-12T23:59:59.000Z

    distributions and do not consider the contribution of channels to the conductivity. An acid fracture conductivity correlation needs the average fracture width at zero closure stress. Existing correlations calculate average fracture width using dissolved rock...

  6. Imaging Hydraulic Fractures: Source Location Uncertainty Analysis At The UPRC Carthage Test Site

    E-Print Network [OSTI]

    Li, Yingping

    1996-01-01T23:59:59.000Z

    Hydraulic fracturing is a useful tool for enhancing gas and oil production. High-resolution seismic imaging of the fracture geometry and fracture growth process is the key in determining optimal spacing and location of ...

  7. Analyzing Aqueous Solution Imbibition into Shale and the Effects of Optimizing Critical Fracturing Fluid Additives 

    E-Print Network [OSTI]

    Plamin, Sammazo Jean-bertrand

    2013-09-29T23:59:59.000Z

    Two methods of hydraulic fracturing most widely utilized on unconventional shale gas and oil reservoirs are “gelled fracturing” and “slick-water fracturing”. Both methods utilize up to several million gallons of water-based fluid per well in a...

  8. Hydraulic Fracture Optimization with a Pseudo-3D Model in Multi-layered Lithology 

    E-Print Network [OSTI]

    Yang, Mei

    2011-10-21T23:59:59.000Z

    Hydraulic Fracturing is a technique to accelerate production and enhance ultimate recovery of oil and gas while fracture geometry is an important aspect in hydraulic fracturing design and optimization. Systematic design ...

  9. Degradation of Guar-Based Fracturing Gels: A Study of Oxidative and Enzymatic Breakers

    E-Print Network [OSTI]

    Sarwar, Muhammad Usman

    2012-02-14T23:59:59.000Z

    Unbroken gel and residue from guar-based fracturing gels can be a cause for formation damage. The effectiveness of a fracturing treatment depends on better achieveing desired fracture geometry, proper proppant placement and after that, a good clean...

  10. Seismic scattering attributes to estimate reservoir fracture density : a numerical modeling study

    E-Print Network [OSTI]

    Pearce, Frederick D. (Frederick Douglas), 1978-

    2003-01-01T23:59:59.000Z

    We use a 3-D finite difference numerical model to generate synthetic seismograms from a simple fractured reservoir containing evenly-spaced, discrete, vertical fracture zones. The fracture zones are represented using a ...

  11. Seismic Scattering Attributes to Estimate Reservoir Fracture Density: A Numerical Modeling Study

    E-Print Network [OSTI]

    Pearce, Frederick Douglas

    We use a 3-D finite difference numerical model to generate synthetic seismograms from a simple fractured reservoir containing evenly-spaced, discrete, vertical fracture zones. The fracture zones are represented using a ...

  12. Fluid escape from reservoirs: implications from cold seeps, fractures and injected sands

    E-Print Network [OSTI]

    Mazzini, Adriano

    Abstract Fluid escape from reservoirs: implications from cold seeps, fractures and injected sands fluids escape from hydrocarbon reservoirs through permeable networks of fractures, injected sands. Within fractures and injected sands, oxidation of chained hydrocarbons supplies bicarbonate to the co

  13. Hydromechanical interactions in a fractured carbonate reservoir inferred from hydraulic and mechanical measurements

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Hydromechanical interactions in a fractured carbonate reservoir inferred from hydraulic, France Abstract Hydromechanical coupled processes in a shallow fractured carbonate reservoir rock were fracture network made up of vertical faults and bedding planes. Hydromechanical response of the reservoir

  14. A triple-continuum pressure-transient model for a naturally fractured vuggy reservoir

    E-Print Network [OSTI]

    2007-01-01T23:59:59.000Z

    well test data from a fractured-vuggy reservoir in Westernwell test data from a fractured-vuggy reservoir in Westerndata for two wells from a naturally fractured vuggy oil reservoir,

  15. The Effect of HF/NH4F Etching on the Morphology of Surface Fractures on Fused Silica

    SciTech Connect (OSTI)

    Wong, L; Suratwala, T; Feit, M D; Miller, P E; Steele, R A

    2008-04-03T23:59:59.000Z

    The effects of HF/NH{sub 4}F, wet chemical etching on the morphology of individual surface fractures (indentations, scratches) and of an ensemble of surface fractures (ground surfaces) on fused silica glass has been characterized. For the individual surface fractures, a series of static or dynamic (sliding) Vickers and Brinnell indenters were used to create radial, lateral, Hertzian cone and trailing indentation fractures on a set of polished fused silica substrates which were subsequently etched. After short etch times, the visibility of both surface and subsurface cracks is significantly enhanced when observed by optical microscopy. This is attributed to the removal of the polishing-induced Bielby layer and the increased width of the cracks following etching allowing for greater optical scatter at the fracture interface. The removal of material during etching was found to be isotropic except in areas where the etchant has difficulty penetrating or in areas that exhibit significant plastic deformation/densification. Isolated fractures continue to etch, but will never be completely removed since the bottom and top of the crack both etch at the same rate. The etching behavior of ensembles of closely spaced cracks, such as those produced during grinding, has also been characterized. This was done using a second set of fused silica samples that were ground using either fixed or loose abrasives. The resulting samples were etched and both the etch rate and the morphology of the surfaces were monitored as a function of time. Etching results in the formation of a series of open cracks or cusps, each corresponding to the individual fractures originally on the surface of the substrate. During extended etching, the individual cusps coalesce with one another, providing a means of reducing the depth of subsurface damage and the peak-to-valley roughness. In addition, the material removal rate of the ground surfaces was found to scale with the surface area of the cracks as a function of etch time. The initial removal rate for the ground surface was typically 3.5 x the bulk etch rate. The evolving morphology of ground surfaces during etching was simulated using an isotropic finite difference model. This model illustrates the importance that the initial distributions of fracture sizes and spatial locations have on the evolution of roughness and the rate at which material is removed during the etching process. The etching of ground surfaces can be used during optical fabrication to convert subsurface damage into surface roughness thereby reducing the time required to produce polished surfaces that are free of subsurface damage.

  16. Innovative Composites Through Reinforcement Morphology Design - a Bone-Shaped-Short-Fiber Composite

    SciTech Connect (OSTI)

    Zhu, Y.T.; Valdez, J.A.; Beyerlain, I.J.; Stout, M.G.; Zhou, S.; Shi, N.; Lowe, T.C.

    1999-06-29T23:59:59.000Z

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project at Los Alamos National Laboratory (LANL). The objective of this project is to improve the strength and toughness of conventional short-fiber composites by using innovative bone-shaped-short (BSS) fibers as reinforcement. We fabricated a model polyethylene BSS fiber-reinforced polyester-matrix composite to prove that fiber morphology, instead of interfacial strength, solves the problem. Experimental tensile and fracture toughness test results show that BSS fibers can bridge matrix cracks more effectively, and consume many times more energy when pulled out, than conventional-straight-short (CSS) fibers. This leads to both higher strength and fracture toughness for the BSS-fiber composites. A computational model was developed to simulate crack propagation in both BSS- and CSS-fiber composites, accounting for stress concentrations, interface debonding, and fiber pullout. Model predictions were validated by experimental results and will be useful in optimizing BSS-fiber morphology and other material system parameters.

  17. Statistical analysis of surface lineaments and fractures for characterizing naturally fractured reservoirs

    SciTech Connect (OSTI)

    Guo, Genliang; George, S.A.; Lindsey, R.P.

    1997-08-01T23:59:59.000Z

    Thirty-six sets of surface lineaments and fractures mapped from satellite images and/or aerial photos from parts of the Mid-continent and Colorado Plateau regions were collected, digitized, and statistically analyzed in order to obtain the probability distribution functions of natural fractures for characterizing naturally fractured reservoirs. The orientations and lengths of the surface linear features were calculated using the digitized coordinates of the two end points of each individual linear feature. The spacing data of the surface linear features within an individual set were, obtained using a new analytical sampling technique. Statistical analyses were then performed to find the best-fit probability distribution functions for the orientation, length, and spacing of each data set. Twenty-five hypothesized probability distribution functions were used to fit each data set. A chi-square goodness-of-fit test was used to rank the significance of each fit. A distribution which provides the lowest chi-square goodness-of-fit value was considered the best-fit distribution. The orientations of surface linear features were best-fitted by triangular, normal, or logistic distributions; the lengths were best-fitted by PearsonVI, PearsonV, lognormal2, or extreme-value distributions; and the spacing data were best-fitted by lognormal2, PearsonVI, or lognormal distributions. These probability functions can be used to stochastically characterize naturally fractured reservoirs.

  18. Patterns and perspectives in applied fracture mechanics

    SciTech Connect (OSTI)

    Merkle, J.G.

    1994-12-31T23:59:59.000Z

    This lecture begins with a overview of applied fracture mechanics pertinent to safety of pressure vessels. It then progresses to a chronological panorama of experimental and analytical results. To be useful and dependable in safety analysis of real structures, new analysis developments must be physically realistic, which means that they must accurately describe physical cause and effect. Consequently, before mathematical modeling can begin, cause and effect must be established from experimental data. This can be difficult and time consuming, but worth the effort. Accordingly, the theme of this paper is that the search for patterns is constant and vital. This theme is illustrated by the development of small, single-specimen, fracture toughness testing techniques. It is also illustrated by the development, based on two different published large-strain, elastic-plastic, three-dimensional finite-element analyses, of a hypothesis concerning three-dimensional loss of constraint. When a generalization of Irwin`s thickness-normalized plastic-zone parameter, reaches a value close to 2{pi}, the through-thickness contraction strain at the apex of the near-tip logarithmic-spiral slip-line region becomes the dominant negative strain accommodating crack opening. Because slip lines passing from the midplane to the stress-free side surfaces do not have to curve, once these slip lines are established, stresses near the crack tip are only elevated by strain hardening and constraint becomes significantly relaxed. This hypothesis, based on published three-dimensional elastic-plastic analyses, provides a potentially valuable means for gaining additional insight into constraint effects on fracture toughness by considering the roles played by the plastic strains as well as the stresses that develop near a crack tip.

  19. Turbulent flow of gas in fractures

    E-Print Network [OSTI]

    Koh, Wong In

    1974-01-01T23:59:59.000Z

    sises of 40 - 60, 20 - 40 and 10 - 20 mesh and with varying concentration of proppants . The confining pressure was varied for each core up to $, 000 psi step by step. The proppant concentration in each fracture was varied up to a complete monolayer... an ovex'bux'den pressure of 4, 000 psi, the reduction in flow capaoity would vary from 86 $ to 76 4 with corresponding change of pressure dxop from 2, 000 psi to 7, 000 psi across a 320 ft long fractuxe. ACKHOWLEDGENEN% The author wishes to extend...

  20. Recent developments in dynamic fracture: Some perspectives

    E-Print Network [OSTI]

    Fineberg, Jay

    2015-01-01T23:59:59.000Z

    We briefly review a number of important recent experimental and theoretical developments in the field of dynamic fracture. Topics include experimental validation of the equations of motion for straight tensile cracks (in both infinite media and strip geometries), validation of a new theoretical description of the near-tip fields of dynamic cracks incorporating weak elastic nonlinearities, a new understanding of dynamic instabilities of tensile cracks in both 2D and 3D, crack front dynamics, and the relation between frictional motion and dynamic shear cracks. Related future research directions are briefly discussed.

  1. Recent developments in dynamic fracture: Some perspectives

    E-Print Network [OSTI]

    Jay Fineberg; Eran Bouchbinder

    2015-04-19T23:59:59.000Z

    We briefly review a number of important recent experimental and theoretical developments in the field of dynamic fracture. Topics include experimental validation of the equations of motion for straight tensile cracks (in both infinite media and strip geometries), validation of a new theoretical description of the near-tip fields of dynamic cracks incorporating weak elastic nonlinearities, a new understanding of dynamic instabilities of tensile cracks in both 2D and 3D, crack front dynamics, and the relation between frictional motion and dynamic shear cracks. Related future research directions are briefly discussed.

  2. Fracture Characterization Technologies | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdf Jump to:ar-80m.pdfFillmoreGabbsSalonga, NewCornersFoxFracture Characterization

  3. Prediction of effects of hydraulic fracturing using reservoir and well flow simulation

    SciTech Connect (OSTI)

    Mineyuki Hanano; Tayuki Kondo

    1992-01-01T23:59:59.000Z

    This paper presents a method to predict and evaluate effects of hydraulic fracturing jobs by using reservoir and well flow numerical simulation. The concept of the method i5 that steam production rate at the operating well head pressure is predicted with different fracture conditions which would be attained by the hydraulic fracturing jobs. Then, the effects of the hydraulic fracturing is evaluated by comparing the predicted steam production rate and that before the hydraulic fracturing. This course of analysis will suggest how large fracture should be created by the fracturing job to attain large enough increase in steam production at the operating condition and the best scheme of the hydraulic fracturing job.

  4. Photoplethysmography for non-invasive measurement of bone hemodynamic responses to changes in external pressure

    E-Print Network [OSTI]

    Mateus, Jaime (Pereira de Mateus Silva)

    2011-01-01T23:59:59.000Z

    Adequate blood supply and circulation in bones is required to maintain a healthy skeleton, and inadequate blood perfusion is associated with numerous bone pathologies and a decrease in bone mineral density (BMD). Bone ...

  5. The effect of three hemostatic agents on early bone healing in an animal model

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    B, Sjogren S: Effects of bone wax on rabbit cranial boneRR: The effect of bone wax on the healing of experimentaland healing using bone wax and a soluble polymer material.

  6. Transferability of cleavage fracture parameters between notched and cracked geometries

    E-Print Network [OSTI]

    Boyer, Edmond

    and specimen geometry dependence of cleavage fracture micromechanisms of a French pressure vessel steel (A508 that only NT tests with a mean fracture strain lower than 25% have to be considered to make sure ; ¢ 50 £ C ]. Also a unique set of Weibull parameters was found to describe all the NT tests over

  7. Approaching Zero: Using Fractured Crystals in Metrology for Replica Molding

    E-Print Network [OSTI]

    Prentiss, Mara

    and technology.1-6 It is, however, difficult (if not impossible) to fabricate masters below 5 nm using-crystalline silicon wafers (two- or three-inch p- and n-doped silicon wafers with 2-nm layers of native silicon oxide to stabilize and prevent complete fracture of the wafer by dissipating the mechanical energy of fracture

  8. Identifying fracture zones in the Austin Chalk using seismic attributes

    E-Print Network [OSTI]

    Bafia, Daniel Joseph

    1998-01-01T23:59:59.000Z

    . After studying various attributes, it was determined that there is no direct evidence of these fracture zones, but areas that are more prone to fracturing can be deduced from lithology. "Clean chalk, or areas that lack shale interbeds, is more brittle...

  9. Reply to Davies: Hydraulic fracturing remains a possible mechanism for

    E-Print Network [OSTI]

    Jackson, Robert B.

    LETTER Reply to Davies: Hydraulic fracturing remains a possible mechanism for observed methane in aquifers overlying the Marcellus formation but asserts that we prematurely ascribed its cause to hydraulic mechanisms were leaky gas well casings and the possibility that hydraulic fracturing might generate new

  10. CLEAVAGE FRACTURE MICROMECHANISMS RELATED TO WPS EFFECT IN RPV STEEL

    E-Print Network [OSTI]

    Boyer, Edmond

    CLEAVAGE FRACTURE MICROMECHANISMS RELATED TO WPS EFFECT IN RPV STEEL S. R. Bordet1 , B. Tanguy1 , S vessel (RPV) steel. In this purpose, different WPS fracture test results obtained on compact tensile (CT fractographic investigations and finite element (FE) calculations, demonstrate a strong material aspect to WPS

  11. Fracture toughness and process zone kinetics in amorphous polymers

    SciTech Connect (OSTI)

    Kim, A.

    1992-01-01T23:59:59.000Z

    Usually, a process (deformation) zone is formed ahead of a crack as a response to the stress concentration in ductile materials. Then the crack initiation and propagation are inseparable from the evolution of the process zone accompanying the crack. Thus the kinetics of process zone evolution is closely coupled with the time dependency of fracture. In this study, we report the effects of weathering, scale and loading rate on fracture toughness parameters, and the kinetics of process zone evolution. We also propose a kinetic equation for process zone as a basis for modeling of the time dependency of polycarbonate fracture. Since the well-known Griffith's criterion is usually implemented for characterization of brittle fracture, we have reviewed the applicability of the conventional toughness parameter to characterization of brittle polymers. After that we applied the developed experimental and analytical technique to polycarbonate which possesses ductility and thus does not obey the conventional fracture toughness characterization requirements. The fracture toughness analysis leads to recognition of the important role of process zone evolution in fracture phenomena. As result, one of the main topics of the present work is the experimental and theoretical studies of the process zone kinetics. The kinetic equation is derived following the first principle of thermodynamics of irreversible processes. It provides a master curve for the process zone evolution for various initial conditions. The kinetic equation for the evolution of the process zone in polycarbonate is the main achievement of the thesis. The results provide the basis for mathematical modeling of time dependency of fracture.

  12. Identifying fracture zones in the Austin Chalk using seismic attributes 

    E-Print Network [OSTI]

    Bafia, Daniel Joseph

    1998-01-01T23:59:59.000Z

    . After studying various attributes, it was determined that there is no direct evidence of these fracture zones, but areas that are more prone to fracturing can be deduced from lithology. "Clean chalk, or areas that lack shale interbeds, is more brittle...

  13. Reactor Material Program Fracture Toughness of Type 304 Stainless Steel

    SciTech Connect (OSTI)

    Awadalla, N.G.

    2001-03-28T23:59:59.000Z

    This report describes the experimental procedure for Type 304 Stainless Steel fracture toughness measurements and the application of results. Typical toughness values are given based on the completed test program for the Reactor Materials Program (RMP). Test specimen size effects and limitations of the applicability in the fracture mechanics methodology are outlined as well as a brief discussion on irradiation effects.

  14. Seismic response of fractures and induced anisotropy in poroelastic media

    E-Print Network [OSTI]

    Santos, Juan

    Seismic response of fractures and induced anisotropy in poroelastic media Juan E. Santos stituto) and R. Mart´inez Corredor (UNLP) Department of Mathematics, University of Calgary, October 2014 Seismic variations of velocity and attenuation of seismic waves. Seismic response of fractures and induced anisotropy

  15. A Novel Model for Fracture Acidizing with Important Thermal Effects

    E-Print Network [OSTI]

    Lyons, John

    2013-12-05T23:59:59.000Z

    with the formation and the heat generated by acid reaction with the rock) on reaction rate and mass transfer of acid inside the fracture. In this study, a new fracture acidizing model is presented that uses the lattice Boltzmann method for fluid transport...

  16. THE EFFECT OF SURFACE TENSION IN MODELING INTERFACIAL FRACTURE

    E-Print Network [OSTI]

    THE EFFECT OF SURFACE TENSION IN MODELING INTERFACIAL FRACTURE By Tsvetanka Sendova and Jay R: 612-626-7370 URL: http://www.ima.umn.edu #12;The Effect of Surface Tension in Modeling Interfacial. The proposed model of bi-material crack ascribes curvature-dependent surface tension to both the fracture

  17. Adaptive Methods for Modelling Transport Processes in Fractured Subsurface Systems

    E-Print Network [OSTI]

    Cirpka, Olaf Arie

    ­ discrete Galerkin method applying finite differences for the discretization in time and the StreamlineAdaptive Methods for Modelling Transport Processes in Fractured Subsurface Systems 3rd­adaptive methods for modelling transport processes in fractured rock. As a simplification, ideal tracers

  18. Atom-to-continuum methods for gaining a fundamental understanding of fracture.

    SciTech Connect (OSTI)

    McDowell, David Lynn (Georgia Institute of Technology, Atlanta, GA); Reedy, Earl David, Jr.; Templeton, Jeremy Alan; Jones, Reese E.; Moody, Neville Reid; Zimmerman, Jonathan A.; Belytschko, Ted. (Northwestern University, Evanston, IL); Zhou, Xiao Wang; Lloyd, Jeffrey T. (Georgia Institute of Technology, Atlanta, GA); Oswald, Jay (Northwestern University, Evanston, IL); Delph, Terry J. (Lehigh University, Bethlehem, PA); Kimmer, Christopher J. (Indiana University Southeast, New Albany, IN)

    2011-08-01T23:59:59.000Z

    This report describes an Engineering Sciences Research Foundation (ESRF) project to characterize and understand fracture processes via molecular dynamics modeling and atom-to-continuum methods. Under this aegis we developed new theory and a number of novel techniques to describe the fracture process at the atomic scale. These developments ranged from a material-frame connection between molecular dynamics and continuum mechanics to an atomic level J integral. Each of the developments build upon each other and culminated in a cohesive zone model derived from atomic information and verified at the continuum scale. This report describes an Engineering Sciences Research Foundation (ESRF) project to characterize and understand fracture processes via molecular dynamics modeling and atom-to-continuum methods. The effort is predicated on the idea that processes and information at the atomic level are missing in engineering scale simulations of fracture, and, moreover, are necessary for these simulations to be predictive. In this project we developed considerable new theory and a number of novel techniques in order to describe the fracture process at the atomic scale. Chapter 2 gives a detailed account of the material-frame connection between molecular dynamics and continuum mechanics we constructed in order to best use atomic information from solid systems. With this framework, in Chapter 3, we were able to make a direct and elegant extension of the classical J down to simulations on the scale of nanometers with a discrete atomic lattice. The technique was applied to cracks and dislocations with equal success and displayed high fidelity with expectations from continuum theory. Then, as a prelude to extension of the atomic J to finite temperatures, we explored the quasi-harmonic models as efficient and accurate surrogates of atomic lattices undergoing thermo-elastic processes (Chapter 4). With this in hand, in Chapter 5 we provide evidence that, by using the appropriate energy potential, the atomic J integral we developed is calculable and accurate at finite/room temperatures. In Chapter 6, we return in part to the fundamental efforts to connect material behavior at the atomic scale to that of the continuum. In this chapter, we devise theory that predicts the onset of instability characteristic of fracture/failure via atomic simulation. In Chapters 7 and 8, we describe the culmination of the project in connecting atomic information to continuum modeling. In these chapters we show that cohesive zone models are: (a) derivable from molecular dynamics in a robust and systematic way, and (b) when used in the more efficient continuum-level finite element technique provide results that are comparable and well-correlated with the behavior at the atomic-scale. Moreover, we show that use of these same cohesive zone elements is feasible at scales very much larger than that of the lattice. Finally, in Chapter 9 we describe our work in developing the efficient non-reflecting boundary conditions necessary to perform transient fracture and shock simulation with molecular dynamics.

  19. Dynamics of window glass fracture in explosions

    SciTech Connect (OSTI)

    Beauchamp, E.K.; Matalucci, R.V.

    1998-05-01T23:59:59.000Z

    An exploratory study was conducted under the Architectural Surety Program to examine the possibility of modifying fracture of glass in the shock-wave environment associated with terrorist bombings. The intent was to explore strategies to reduce the number and severity of injuries resulting from those attacks. The study consisted of a series of three experiments at the Energetic Materials Research and Testing Center (EMRTC) of the New Mexico Institute of Mining and Technology at Socorro, NM, in which annealed and tempered glass sheets were exposed to blast waves at several different levels of overpressure and specific impulse. A preliminary assessment of the response of tempered glass to the blast environment suggested that inducing early failure would result in lowering fragment velocity as well as reducing the loading from the window to the structure. To test that possibility, two different and novel procedures (indentation flaws and spot annealing) were used to reduce the failure strength of the tempered glass while maintaining its ability to fracture into small cube-shaped fragments. Each experiment involved a comparison of the performance of four sheets of glass with different treatments.

  20. Pressure grouting of fractured basalt flows

    SciTech Connect (OSTI)

    Shaw, P.; Weidner, J.; Phillips, S.; Alexander, J.

    1996-04-01T23:59:59.000Z

    This report describes a field trial of pressure grouting in basalt and the results of subsequent coring and permeability measurement activities. The objective was to show that the hydraulic conductivity of fractured basalt bedrock can be significantly reduced by pressure injection of cementitious materials. The effectiveness of the pressure grout procedure was evaluated by measuring the change in the hydraulic conductivity of the bedrock. The extent of grout penetration was established by analyzing postgrout injection drilling chips for the presence of a tracer in the grout and also by examining cores of the treated basalt. Downhole radar mapping was used to establish major lava flow patterns and follow water movement during a surface infiltration test. A site called Box Canyon, which is located northwest of the INEL, was chosen for this study due to the similarity of this surface outcrop geology to that of the underlying bedrock fracture system found at the Radioactive Waste Management Complex. This study showed that hydraulic conductivity of basalt can be reduced through pressure grouting of cementitious material.