Sample records for bone ash bone

  1. INVEST IN YOUR BONES Bone Basics

    E-Print Network [OSTI]

    replace- ment at menopause may prevent bone loss and/or osteoporosis. Also find out if there is a need in your bones? Osteoporosis, a major health problem in America, affects over 10 million persons, with 34 million at a high risk of developing the disease (National Osteoporosis Foundation, 2010). Dubbed

  2. Biodegradable synthetic bone composites

    DOE Patents [OSTI]

    Liu, Gao; Zhao, Dacheng; Saiz, Eduardo; Tomsia, Antoni P.

    2013-01-01T23:59:59.000Z

    The invention provides for a biodegradable synthetic bone composition comprising a biodegradable hydrogel polymer scaffold comprising a plurality of hydrolytically unstable linkages, and an inorganic component; such as a biodegradable poly(hydroxyethylmethacrylate)/hydroxyapatite (pHEMA/HA) hydrogel composite possessing mineral content approximately that of human bone.

  3. Invest in Your Bones Bone Mineral Calcium and Vitamin D

    E-Print Network [OSTI]

    beans, eggs, and nuts. Sardines and salmon with bones, oysters, kidney beans, and tofu made with calcium

  4. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1995-05-09T23:59:59.000Z

    A device is described for stimulating bone tissue by applying a low level alternating current signal directly to the patient`s skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures. 5 figs.

  5. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, James W. (Aiken, SC)

    1995-01-01T23:59:59.000Z

    A device for stimulating bone tissue by applying a low level alternating current signal directly to the patient's skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures.

  6. INVEST IN YOUR BONES Living with Osteoporosis

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Living with Osteoporosis Leaflet 5 Living with osteoporosis can be done environment safe to avoid falls. Early detection of bone loss or osteoporosis is now possible with bone to be most effective in reducing bone loss during the five to ten years following menopause, when bone loss

  7. Endocortical bone loss in osteoporosis: the role of bone surface availability

    E-Print Network [OSTI]

    Buenzli, Pascal R; Clement, John G; Pivonka, Peter

    2012-01-01T23:59:59.000Z

    Age-related bone loss and postmenopausal osteoporosis are disorders of bone remodelling, in which less bone is reformed than resorbed. Yet, this dysregulation of bone remodelling does not occur equally in all bone regions. Loss of bone is more pronounced near the endocortex, leading to cortical wall thinning and medullary cavity expansion, a process sometimes referred to as "trabecularisation" or "cancellisation". Cortical wall thinning is of primary concern in osteoporosis due to the strong reduction in bone mechanical properties that it is associated with. In this paper, we examine the possibility that the nonuniformity of microscopic bone surface availability could explain the nonuniformity of bone loss in osteoporosis. We use a simple computational model of bone remodelling, in which microscopic bone surface availability influences bone turnover rate, to simulate the evolution of the bone volume fraction profile across the midshaft of a long bone. We find that bone loss is accelerated near the endocortica...

  8. Understanding the Interactions of Collagen with Mineral in Bone: Working Towards Developing a Realistic Composite

    E-Print Network [OSTI]

    Greenaway, Alan

    . · Mini-project on bone nodule formation. · Neutron scattering on whole bone. · Analysis of bone explants

  9. Regulation of thrombopoietin in bone marrow

    E-Print Network [OSTI]

    McIntosh, Bryan James

    2007-01-01T23:59:59.000Z

    R: gacagagttagtcttgccactgcaa Prb: actgatttgctcctggcggccatMutant prb: tggagctgactgatttactactagcagcaatgc Cyclophilin (L: tggcacatgaatcctggaata Prb: ttcgagctctgagcactggagaga Bone

  10. Bone Mineral Density, Bone Turnover, and Systemic Inflammation in Non-cirrhotics with Chronic Hepatitis C

    E-Print Network [OSTI]

    Lai, J; Shoback, DMA; Zipperstein, J; Lizaola, B; Tseng, S; Terrault, NA

    2015-01-01T23:59:59.000Z

    Mun˜oz-Torres M, et al. Bone mineral density, serum insulin-et al. Osteoporosis and bone mineral metabolism disorders in1069-9. 11. George J. Bone mineral density and disorders of

  11. Biomimetic hydroxyapatite as a new consolidating agent for archaeological bone

    E-Print Network [OSTI]

    North, Alexis

    2014-01-01T23:59:59.000Z

    R.E.M.  2002.  “Bone  Diagenesis:  An  Overview  of  2000.  “Patterns  of  Diagenesis  in  Bone  I:  The  element  Studies  of  Diagenesis  in  Prehistoric  Bone. ”  

  12. Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair Compared to the Trochlea in a

    E-Print Network [OSTI]

    Buschmann, Michael

    Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair femoral condylar (MFC) versus femoral trochlear (TR) defects 3 months after bone marrow stimulation: cartilage repair; medial femoral condyle; trochlea; bone marrow stimulation; meniscus degeneration Articular

  13. Positive modulator of bone morphogenic protein-2

    DOE Patents [OSTI]

    Zamora, Paul O. (Gaithersburg, MD); Pena, Louis A. (Poquott, NY); Lin, Xinhua (Plainview, NY); Takahashi, Kazuyuki (Germantown, MD)

    2009-01-27T23:59:59.000Z

    Compounds of the present invention of formula I and formula II are disclosed in the specification and wherein the compounds are modulators of Bone Morphogenic Protein activity. Compounds are synthetic peptides having a non-growth factor heparin binding region, a linker, and sequences that bind specifically to a receptor for Bone Morphogenic Protein. Uses of compounds of the present invention in the treatment of bone lesions, degenerative joint disease and to enhance bone formation are disclosed.

  14. BONE CARE FOR THE POSTMENOPAUSAL WOMAN

    E-Print Network [OSTI]

    Shihadeh, Alan

    Osteoporosis is a disease characterized by low bone mass and deterioration in the microarchitecture of bone tissue, leading to an increased risk of fracture. Osteoporosis occurs when the bone mass decreases more fracture). Osteoporosis has no signs or symptoms until a fracture occurs ­ this is why it is often called

  15. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    x ORIGINAL ARTICLE Bone mineral density and fractures inwas associated with lower bone mineral density (BMD) at theKeywords Bone loss . Bone mineral density . Elderly .

  16. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-01-01T23:59:59.000Z

    The present invention relates to the electrical treatment of biological tissue. In particular, the present invention discloses a device that produces discrete electrical pulse trains for treating osteoporosis and accelerating bone growth. According to its major aspects and broadly stated, the present invention consists of an electrical circuit configuration capable of generating Bassett-type waveforms shown with alternative signals provide for the treatment of either fractured bones or osteoporosis. The signal generator comprises a quartz clock, an oscillator circuit, a binary divider chain, and a plurality of simple, digital logic gates. Signals are delivered efficiently, with little or no distortion, and uniformly distributed throughout the area of injury. Perferably, power is furnished by widely available and inexpensive radio batteries, needing replacement only once in several days. The present invention can be affixed to a medical cast without a great increase in either weight or bulk. Also, the disclosed stimulator can be used to treat osteoporosis or to strengthen a healing bone after the cast has been removed by attaching the device to the patient`s skin or clothing.

  17. WRITTEN IN BONE: Bone Biographer's Casebook Douglas Owsley and Karin Bruwelheide

    E-Print Network [OSTI]

    Mathis, Wayne N.

    afflictions that would have made daily life miserable. In addition to dental disease and gout, his bones were

  18. J Bone Miner Metab . Author manuscript Mineral maturity and crystallinity index are distinct characteristics of bone

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    J Bone Miner Metab . Author manuscript Page /1 13 Mineral maturity and crystallinity index are distinct characteristics of bone mineral Delphine Farlay 1 * , G rard Panczeré 2 , Christian Rey 3 , Pierre the hypothesis that mineral maturity and crystallinity index are two different characteristics of bone mineral

  19. PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism

    E-Print Network [OSTI]

    Toledo, University of

    PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism Beata regulating systemic energy homeostasis. In this article, we review current knowledge on the role of PPARs of bone marrow microenvironment and its possible contribution to the systemic regulation of energy

  20. A quantification strategy for missing bone mass in case of osteolytic bone lesions

    SciTech Connect (OSTI)

    Fränzle, Andrea, E-mail: a.fraenzle@dkfz.de; Giske, Kristina [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Bretschi, Maren; Bäuerle, Tobias [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Hillengass, Jens [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany)] [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany); Bendl, Rolf [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)

    2013-12-15T23:59:59.000Z

    Purpose: Most of the patients who died of breast cancer have developed bone metastases. To understand the pathogenesis of bone metastases and to analyze treatment response of different bone remodeling therapies, preclinical animal models are examined. In breast cancer, bone metastases are often bone destructive. To assess treatment response of bone remodeling therapies, the volumes of these lesions have to be determined during the therapy process. The manual delineation of missing structures, especially if large parts are missing, is very time-consuming and not reproducible. Reproducibility is highly important to have comparable results during the therapy process. Therefore, a computerized approach is needed. Also for the preclinical research, a reproducible measurement of the lesions is essential. Here, the authors present an automated segmentation method for the measurement of missing bone mass in a preclinical rat model with bone metastases in the hind leg bones based on 3D CT scans. Methods: The affected bone structure is compared to a healthy model. Since in this preclinical rat trial the metastasis only occurs on the right hind legs, which is assured by using vessel clips, the authors use the left body side as a healthy model. The left femur is segmented with a statistical shape model which is initialised using the automatically segmented medullary cavity. The left tibia and fibula are segmented using volume growing starting at the tibia medullary cavity and stopping at the femur boundary. Masked images of both segmentations are mirrored along the median plane and transferred manually to the position of the affected bone by rigid registration. Affected bone and healthy model are compared based on their gray values. If the gray value of a voxel indicates bone mass in the healthy model and no bone in the affected bone, this voxel is considered to be osteolytic. Results: The lesion segmentations complete the missing bone structures in a reasonable way. The mean ratiov{sub r}/v{sub m} of the reconstructed bone volume v{sub r} and the healthy model bone volume v{sub m} is 1.07, which indicates a good reconstruction of the modified bone. Conclusions: The qualitative and quantitative comparison of manual and semi-automated segmentation results have shown that comparing a modified bone structure with a healthy model can be used to identify and measure missing bone mass in a reproducible way.

  1. Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor is enhanced by compressive

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor la Santé et de la Recherche Médicale Running title Cancellous bone culture in a dynamic 3D bioreactor

  2. Curr Pharm Des . Author manuscript Bisphosphonates and bone diseases: past, present and future

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget s disease of bone

  3. Shell Formation and Bone Strength Laying Hens

    E-Print Network [OSTI]

    Shell Formation and Bone Strength in Laying Hens Effects of Age, Daidzein and Exogenous Estrogen Cover aquarelle: E. Spörndly-Nees #12;Shell Formation and Bone Strength in Laying Hens Effects of Age eggshells as shell quality declines with age during the laying period. This is a concern for food safety

  4. Mechanical bone strength in the proximal tibia

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    . These findings were a pilot study of the technique, which will subsequently be used for human tibial bone. Such data is relevant in the human with respect to the ability of the bone at various distances from the condyle to support the "flat-plate" loading...

  5. Ibuprofen Administered Pre- or Post- Simulated Resistance Exercise Training Does Not Diminsh Gains in Bone Formation or Bone Mass

    E-Print Network [OSTI]

    Cunningham, David

    2012-02-14T23:59:59.000Z

    IBUPROFEN ADMINSTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINISH GAINS IN BONE FORMATION OR BONE MASS A Thesis by DAVID ARTHUR CUNNINGHAM Submitted to the Office of Graduate Studies of Texas A... Training Does Not Diminish Gains in Bone Formation or Bone Mass Copyright 2011 David Arthur Cunningham IBUPROFEN ADMINISTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINSH GAINS IN BONE FORMATION OR BONE MASS A Thesis...

  6. Think of your bones as a "bank" where

    E-Print Network [OSTI]

    Baker, Chris I.

    can get osteoporosis (ah-stee-oh-puh- ROH-sis) when you get older. Osteoporosis is a disease in which the bones become weak and more likely to break (fracture). People with osteoporosis most often break bones in the hip, spine, and wrist. 1 #12;Normal bone Bone with osteoporosis Reprinted from The Surgeon General

  7. Application of synchrotron radiation computed microtomography for quantification of bone microstructure in human and rat bones

    SciTech Connect (OSTI)

    Parreiras Nogueira, Liebert; Barroso, Regina Cely; Pereira de Almeida, Andre; Braz, Delson; Almeida, Carlos Eduardo de; Borba de Andrade, Cherley; Tromba, Giuliana [Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Physics Institute / State University of Rio de Janeiro, 20550-900, Rio de Janeiro (Brazil); Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Laboratory of Radiological Sciences / State University of Rio de Janeiro, Rio de Janeiro (Brazil); Sincrotrone Trieste SCpA, Strada Statale S.S. 14 km 163.5, 34012 Basovizza, Trieste (Italy)

    2012-05-17T23:59:59.000Z

    This work aims to evaluate histomorphometric quantification by synchrotron radiation computed microto-mography in bones of human and rat specimens. Bones specimens are classified as normal and pathological (for human samples) and irradiated and non-irradiated samples (for rat ones). Human bones are specimens which were affected by some injury, or not. Rat bones are specimens which were irradiated, simulating radiotherapy procedures, or not. Images were obtained on SYRMEP beamline at the Elettra Synchrotron Laboratory in Trieste, Italy. The system generated 14 {mu}m tomographic images. The quantification of bone structures were performed directly by the 3D rendered images using a home-made software. Resolution yielded was excellent what facilitate quantification of bone microstructures.

  8. Microdamage accumulation in bovine trabecular bone

    E-Print Network [OSTI]

    Moore, Tara L. Arthur (Tara Lee Arthur), 1972-

    2001-01-01T23:59:59.000Z

    When bone is loaded beyond its failure point, it develops damage in the form of microcracks. Normally, microcracks are repaired by the remodeling process, limiting the number of in vivo microcracks. However, if the rate ...

  9. CORTICAL BONE FRACTURE R. O. RITCHIE

    E-Print Network [OSTI]

    Ritchie, Robert

    with menopause in aging women, can lead to osteoporosis, a condition of low bone mass associated the therapeutic benefits of antiresorptive agents in treating osteoporosis (6,7) has re-emphasized the ne- cessity

  10. Composite gelatin delivery system for bone regeneration

    E-Print Network [OSTI]

    Hager, Elizabeth A. (Elizabeth Ann)

    2005-01-01T23:59:59.000Z

    In this thesis, the chemical/mechanical properties and biocompatibility of gelatin were investigated to produce a gelatin scaffold for the release of bone morphogenetic proteins (BMPs) from composite particles. This delivery ...

  11. Bone Growth, Maintenance and Loss in the Neolithic Community of Çatalhöyük, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Bone Growth, Maintenance and Loss in the Neolithic CommunityThe examination of bone maintenance and loss is another wellchanging patterns of bone maintenance typically observed in

  12. Photoplethysmography for non-invasive measurement of bone hemodynamic responses to changes in external pressure

    E-Print Network [OSTI]

    Mateus, Jaime (Pereira de Mateus Silva)

    2011-01-01T23:59:59.000Z

    Adequate blood supply and circulation in bones is required to maintain a healthy skeleton, and inadequate blood perfusion is associated with numerous bone pathologies and a decrease in bone mineral density (BMD). Bone ...

  13. The effect of three hemostatic agents on early bone healing in an animal model

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    B, Sjogren S: Effects of bone wax on rabbit cranial boneRR: The effect of bone wax on the healing of experimentaland healing using bone wax and a soluble polymer material.

  14. Bisphosphonates and Bone diseases: past, present and future Bisphosphonates are stable analogues of the naturally-occuring inorganic

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget's disease of bone

  15. Engineered nanomedicine for myeloma and bone microenvironment targeting

    E-Print Network [OSTI]

    Swami, Archana

    Bone is a favorable microenvironment for tumor growth and a frequent destination for metastatic cancer cells. Targeting cancers within the bone marrow remains a crucial oncologic challenge due to issues of drug availability ...

  16. Cellular and molecular immunotherapeutics derived from the bone marrow stroma

    E-Print Network [OSTI]

    Parekkadan, Biju

    2008-01-01T23:59:59.000Z

    The bone marrow contains a multipotent stromal cell, commonly referred to as a mesenchymal stem cell (MSC). There has been recent interest in the clinical use of MSCs for cell-based therapy because: (1) bone marrow aspiration ...

  17. Original article Analysis of muscle and bone weight variation

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . The commonalities ranged from 0.76 (drumstick muscle) to 0.92 (neck bone) and the uniqueness (special size factors and drumstick bone factors. The correlation coefficient between the first factor score and carcass muscle was 0

  18. Two-dimensional ultrasonic computed tomography of growing bones.

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Two-dimensional ultrasonic computed tomography of growing bones. P. Lasaygues, E. Franceschini, R: Ultrasonic Computed Tomography, Bone imaging, Born approximation, iterative distorted method I. INTRODUCTION imaging process, using ultrasonic computed tomography. Although this method is known to provide

  19. Mechanistic fracture criteria for the failure of human cortical bone

    SciTech Connect (OSTI)

    Nalla, Ravi K.; Kinney, John H.; Ritchie, Robert O.

    2002-12-13T23:59:59.000Z

    A mechanistic understanding of fracture in human bone is critical to predicting fracture risk associated with age and disease. Despite extensive work, a mechanistic framework for describing how the underlying microstructure affects the failure mode in bone is lacking.

  20. Three-dimensional terahertz computed tomography of human bones

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    spectroscopy cannot rival with dual energy x-ray absorptiometry (DEXA) to identify the bone mineral density

  1. Dynamic Behavior and Microstructural Properties of Cancellous Bone.

    E-Print Network [OSTI]

    Boyer, Edmond

    A total of 15 distal parts of bovine femoral bones were used for this study (72 hours post mortemDynamic Behavior and Microstructural Properties of Cancellous Bone. S. Laporte1 , F. David1 , V of the cancellous bone and to identify the link between this mechanical behavior and the microstructural properties

  2. Bone loss during energy restriction: mechanistic role of leptin 

    E-Print Network [OSTI]

    Baek, Kyunghwa

    2009-05-15T23:59:59.000Z

    ), dual energy X-ray absorptiometry (DEXA) and mechanical testing. As a whole body measure, biochemical markers of bone turnover can be used to quantify changes in bone formation (e.g., osteocalcin, OC) and bone resorption (e.g., deoxypyridonoline...

  3. Prediction and Informative Risk Factor Selection of Bone Diseases

    E-Print Network [OSTI]

    Zhang, Aidong

    data and use these integrated features to effectively predict osteoporosis and bone fractures. We; disease memory; osteoporosis; bone fracture. ! 1 INTRODUCTION Risk factor (RF) analysis based on patients on the study of osteoporosis and bone fracture prediction. Over the past few decades, osteoporosis has been

  4. INVEST IN YOUR BONES Daily Activities

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Daily Activities Leaflet 3 Another osteoporosis prevention step to decrease lifestyle. Let's see how you can do that. If you have osteoporosis, follow carefully the activity program. Remember the following about osteoporosis: is largely preventable and treatable is a serious

  5. Nanoscale Surface Topography to Guide Bone Growth

    E-Print Network [OSTI]

    Nanoscale Surface Topography to Guide Bone Growth P R O J E C T L E A D E R : Jirun Sun (American T S Designed and fabricated devices with nanoscale surface topography. Controlled cell alignment by varying the height and aspect ratio of the surface features. R E F E R E N C E Exploring cellular contact guidance

  6. Interactions between microenvironment and cancer cells in two animal models of bone metastasis

    E-Print Network [OSTI]

    Boyer, Edmond

    1 Interactions between microenvironment and cancer cells in two animal models of bone metastasis of characteristics leading to osteoclastogenesis only in the bone microenvironment. Key words: Bone metastasis;3 INTRODUCTION Bone is a preferential site for metastasis in different types of cancer. Bone metastases induce

  7. BONE LOSS IN RELATION TO HYPOTHALAMIC ATROPHY IN ALZHEIMER'S DISEASE

    E-Print Network [OSTI]

    Loskutova, Natalia Y.

    2011-05-12T23:59:59.000Z

    considerable burden on the health system, patients, and caregivers. 1.2 Alzheimer’s Disease and Bone Loss Bone health is an important issue in aging and AD. Osteoporosis–related fractures are among the major health and socioeconomic concerns in aging... of bone fractures, and a determining factor in clinical diagnosis of osteoporosis (Ammann and Rizzoli 2003). Several studies in women suggest that low BMD is associated with poorer cognitive function and subsequent cognitive decline (Yaffe, Browner et al...

  8. Bone Cancer Rates in Dinosaurs Compared with Modern Vertebrates

    E-Print Network [OSTI]

    L. C. Natarajan; A. L. Melott; B. M. Rothschild; L. D. Martin

    2007-10-16T23:59:59.000Z

    Data on the prevalence of bone cancer in dinosaurs is available from past radiological examination of preserved bones. We statistically test this data for consistency with rates extrapolated from information on bone cancer in modern vertebrates, and find that there is no evidence of a different rate. Thus, this test provides no support for a possible role of ionizing radiation in the K-T extinction event.

  9. allowing normal bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    assays. Correlations of fluoride levels between normal bone near the Nancy Medina; Chester W. Douglass; Gary M. Whitford; Robert N. Hoover; Thomas R. Fears 6 Differential...

  10. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    their results, the researchers recommended that vitamin D levels be checked and kept on well--balanced levels to maintain the structural integrity of bones and avoid...

  11. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on different size scales within bone, as well as the role of sustained irradiation damage. Combining in situ mechanical testing with synchrotron x-ray diffraction imaging and...

  12. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    Skeleton. In Bone Loss and Osteoporosis: An AnthropologicalThe radiological diagnosis of osteoporosis: A new approach.170. Birnbaum, E. 1992. Osteoporosis: A Summary of Recent

  13. ancient human bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reich, David 159 OsteoConduct: Wireless Body-Area Communication based on Bone Conduction Energy Storage, Conversion and Utilization Websites Summary: , Measurement, Human Factors....

  14. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    present and that diagenesis (chemical exchange between therisk assessment. Diagenesis, or the chemical exchangeto assess the level of diagenesis in a bone without chemical

  15. attenuates bone cancer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    human bone were studied via the small scale mechanical loading test. Failure analysis was conducted... Jang, Eunhwa 2012-10-19 19 ORIGINAL ARTICLE JBMR Cancer Treatment...

  16. arm bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TO ENSURE HUMAN SAFETY Lingqi Zeng and Gary M. Bone Engineering Websites Summary: , and robot and human velocities. The impact experiments are performed with an apparatus...

  17. Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Bala Krishnamoorthy, Department of Mathematics, Washington State University

    E-Print Network [OSTI]

    Krishnamoorthy, Bala

    1 Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Strength Bala to failure in axial compression. Predictive variables included age, gender, bone mineral density (BMD mineral density, spine surgery. #12;3 Introduction The allograft bone industry is guided by practices

  18. Osteopontin deficiency increases bone fragility but preserves bone mass Philipp J. Thurner a,b

    E-Print Network [OSTI]

    Ritchie, Robert

    density (BMD) is the most common diagnostic used to assess fracture risk [1,2], yet less than half of non to osteopontin in bone, many of which have the potential to impact material properties. To elucidate the role role for OPN in preventing crack propagation. This significant decline in fracture toughness

  19. Quantity and Quality of Trabecular Bone in the Femur Are Enhanced by a Strongly Anabolic, Noninvasive

    E-Print Network [OSTI]

    serve as the basis for a biomechanically based intervention for osteoporosis. To evaluate intervention for osteoporosis. (J Bone Miner Res 2002;17:349­357) Key words: osteoporosis, osteogenic, anabolic, bone formation, bone quality, osteogenic INTRODUCTION OSTEOPOROSIS, A disease characterized

  20. Structural Analysis of Human and Bovine Bone for Development of Synthetic Materials 

    E-Print Network [OSTI]

    Jang, Eunhwa

    2012-10-19T23:59:59.000Z

    With increasing demands in bone repair and replacement, this research investigates the microstructure, properties and performance of bovine bone, human bone, and synthetic materials. Doing so, experimental approaches were used to exam and compare...

  1. Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells

    E-Print Network [OSTI]

    Aliotta, Jason M.

    2008-01-01T23:59:59.000Z

    Bone marrow production of lung cells: the impact of G-CSF,bone marrow to reconstitute lung epithelium. Am. J. Respirof Bone Marrow Cells into Lung Cells Mark S. Dooner 1 *,

  2. Role of middle-ear inertial component of bone conduction in chinchilla

    E-Print Network [OSTI]

    Chhan, David

    2013-01-01T23:59:59.000Z

    Bone conduction describes the mechanisms that produce a hearing sensation when the skull bones are subjected to vibration. Multiple components and pathways have been suggested to contribute to total bone-conducted sound. ...

  3. Mechanical bone strength in the proximal tibia 

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    KNEE REPLACEMENT 3 2. 1 Mechanics of the Knee 2. 1. 1 knee Structure. 2. 1. 2 Bone Strength of Proximal Tibia. 2. 2 Total Knee Replacement. '2. 3 Research Prospective III MECHANICS OF MATERIALS. . 3 3 5 7 8 10 3. 1 Normal Stress and Strain... Specimens. 4. 1. 2 Mechanical Test. . 4. 2 Statistical Analysis. . . . . . . . . . . . . 18 18 18 19 V RESULTS AND CONCLUSIONS. 20 5. 1 Results. . 20 5. 2 Discussion and Conclusions. Page 24 REFERENCES. 27 VITA. 29 LIST OF FIGURES FIGURE 2. 1...

  4. Ash, calcium, phosphorus and magnesium content of the metacarpus of hereford cows under different nutritional and physiological conditions 

    E-Print Network [OSTI]

    Haque, Mozammel

    1967-01-01T23:59:59.000Z

    ASH, CALCIUM, PHOSPHORUS AND MAGNESIUM CONTENT OF THE METACARPUS OF HEREFORD COWS UNDER DIFFERENT NUTRITIONAL AND PHYSIOLOGICAL CONDITIONS A Thesis By MOZAMMEL HAQUE Submitted to the Graduate College of the Texas A&M University in partial... centages of Calcium, Phosphorus snd Magnesium in Bone Ash for Cows Gi;en Different Treatments During Pre- And Post-Partum Periods 22 10 Analysis of Variance oi Calcium in Bone Ash Dun an's )tultiple tvange Test 1'or Calcium in Bone Ash. Analy...

  5. WOMEN'S GLOBAL HEALTH INSTITUTE NUTR59000/BMS59800: WOMEN'SHEALTH:BONE

    E-Print Network [OSTI]

    /remodeling, mechanics;Tools of assessment Epidemiology of osteoporosis Development of peak bone mass ­ nutrition/exercise Adult Bone: Women's reproductive choices ­ oral contraceptives, pregnancy, lactation Menopause: Biology

  6. Novel Techniques for High-Resolution Functional Imaging of Trabecular Bone

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    associated with osteoporosis (1, 2). Osteoporosis results in bone loss and deterioration in trabecular a primary endpoint in osteoporosis diagnosis and monitoring. Where strong correlations between bone density

  7. Bone Growth, Maintenance and Loss in the Neolithic Community of Çatalhöyük, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Interpreting Bone Loss and Osteoporosis in Past Populations.2005. How many women have osteoporosis? Journal of Bone and1987. Postmenopausal osteoporosis: single screening method

  8. In Vivo Evaluation of the Presence of Bone Marrow in Cortical Porosity in Postmenopausal Osteopenic Women

    E-Print Network [OSTI]

    Goldenstein, Janet; Kazakia, Galateia; Majumdar, Sharmila

    2010-01-01T23:59:59.000Z

    bone resorption in osteoporosis. Calcif. Tissue Int. Augat,Porosity in Women with Osteoporosis. Vienna, Austria:porosity in women with osteoporosis. J. Bone Miner. Res.

  9. Verrucous carcinoma of the foot affecting the bone: Utility of the computed tomography scanner

    E-Print Network [OSTI]

    García-Gavín, J; González-Vilas, D; Rodríguez-Pazos, L; Sánchez-Aguilar, D; Toribio, J

    2010-01-01T23:59:59.000Z

    Frassica FJ, Fishman EK. Computed tomography of the bones ofbone: Utility of the computed tomography scanner J García-of bone invasion. Computed tomography (CT) showed a lytic

  10. Controlling the Bone Marrow Dynamics in Cancer Chemotherapy

    E-Print Network [OSTI]

    Ledzewicz, Urszula

    Professor Award 1 #12;find optimal strategies for chemotherapy treatments of the cancer, where Controlling the Bone Marrow Dynamics in Cancer Chemotherapy Urszula Ledzewicz1 and Heinz Sch In the paper a mathematical model for the growth of the bone marrow under cell-cycle specific cancer

  11. Microcapsule-Induced Toughening of Bone Cement Gina M. Miller

    E-Print Network [OSTI]

    Sottos, Nancy R.

    27 Microcapsule-Induced Toughening of Bone Cement Gina M. Miller Senior in Aerospace Engineering R. White, and TAM Prof. Nancy R. Sottos Acrylic bone cement is the primary material used cement, it may be possible to extend the lifetime of the implant, thus reducing the occurrence

  12. Therapeutic Agents for the Prevention and Restoration of Bone Mass

    E-Print Network [OSTI]

    Slatton, Clint

    osteoporosis-related bone loss. According to the National Osteoporosis Foundation, osteoporosis is a major osteoporosis Advantages · Selectively blocks osteoclastic bone resorption by a novel mechanism, providing in post-menopausal women. This ultimately leads to fractures resulting from minimal falls and accidents

  13. Bone motion analysis from dynamic MRI: acquisition and tracking

    E-Print Network [OSTI]

    Gilles, Benjamin

    overload, impingement or femoral head instability. For both the diagnosis and the surgical planningBone motion analysis from dynamic MRI: acquisition and tracking Benjamin Gilles1 , Rosalind Perrin2 methods in order to auto- matically extract active bone kinematics from multi-slice real-time dy- namic

  14. Biomechanics in bone tissue engineering Dominique P. Pioletti*

    E-Print Network [OSTI]

    Guerraoui, Rachid

    such a procedure truly is, we report, in Figure 1(a), the particular case of a posterior surgical approachBiomechanics in bone tissue engineering Dominique P. Pioletti* Laboratory of Biomechanical 18 January 2010) Biomechanics may be considered as central in the development of bone tissue

  15. Protocadherin-7 induces bone metastasis of breast cancer

    SciTech Connect (OSTI)

    Li, Ai-Min [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China)] [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China); Tian, Ai-Xian [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Zhang, Rui-Xue [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China)] [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China); Ge, Jie [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Sun, Xuan [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Cao, Xu-Chen, E-mail: caoxuch@126.com [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)

    2013-07-05T23:59:59.000Z

    Highlights: •PCDH7 is overexpression in high bone metastatic MDA-MB-231 cells. •PCDH7 is up-regulation in bone metastatic breast cancer tissues. •Suppression of PCDH7 inhibits cell proliferation, migration, and invasion in vitro. •PCDH7 induces breast cancer bone metastasis in vivo. -- Abstract: Breast cancer had a propensity to metastasize to bone, resulting in serious skeletal complications associated with poor outcome. Previous study showed that Protocadherin-7 (PCDH7) play an important role in brain metastatic breast cancer, however, the role of PCDH7 in bone metastatic breast cancer has never been explored. In the present study, we found that PCDH7 expression was up-regulation in bone metastatic breast cancer tissues by real-time PCR and immunohistochemistry assays. Furthermore, suppression of PCDH7 inhibits breast cancer cell proliferation, migration, and invasion in vitro by MTT, scratch, and transwell assays. Most importantly, overexpression of PCDH7 promotes breast cancer cell proliferation and invasion in vitro, and formation of bone metastasis in vivo. These data provide an important insight into the role of PCDH7 in bone metastasis of breast cancer.

  16. On the Estimation of Bone Status Rasmus Paulsen

    E-Print Network [OSTI]

    Osteoporosis Diagnostics. The subject of this thesis is medical image analysis with special attention to X Reinhold Paulsen Keywords Osteoporosis, bone status, radius, contact radiographs, cortical geometry, en algorithm developed by Torsana Osteoporosis Diagnostics. A simulated bone is made by simulated x

  17. A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone Marrow Mesenchymal Stem Cell Transplantation

    E-Print Network [OSTI]

    Miga, Michael I.

    A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone generation, and an iterative optimization (using finite element analysis) of the fracture callus material approach includes acquisition of microCT image volumes, biomechanical testing, finite element mesh

  18. Relation between hydrogen isotopic ratios of bone collagen and rain

    SciTech Connect (OSTI)

    Cormie, A.B.; Schwarcz, H.P. (McMaster Univ., Hamilton, Ontario (Canada)); Gray, J. (Univ. of Alberta, Edmonton (Canada))

    1994-01-01T23:59:59.000Z

    The hydrogen isotopic value ([delta]D) of deer bone collagen is related to both [delta]D of rain during the growing season and growing season relative humidity (RH). With correction for the effects of RH, bone [delta]D is related to growing season rain [delta]D in a simple manner with a slope of 1.0. This indicates that, with RH correction, there are no additional sources of bias in the [delta]D of bone due to unaccounted for biologic or climatic effects. Due to a low sensitivity of bone [delta]D to RH effects, both yearly and growing season rain [delta]D can be estimated with considerable accuracy (R = 0.97 and R = 0.96) from bone collagen [delta]D and [delta][sup 15]N. Here, [delta][sup 15]N is used to correct bone [delta]D for the effects of RH. From these estimates of rain [delta]D, it may then be possible to evaluate temperature since the [delta]D of rain primarily reflects local temperature. Therefore, the measurement of bone collagen [delta]D has good potential for evaluating paleoclimates.

  19. The effects of low environmental cadmium exposure on bone density

    SciTech Connect (OSTI)

    Trzcinka-Ochocka, M., E-mail: ochocka@imp.lodz.pl [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Jakubowski, M. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Szymczak, W. [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland) [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland); Insitute of Psychology, University of Lodz (Poland); Janasik, B.; Brodzka, R. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)

    2010-04-15T23:59:59.000Z

    Recent epidemiological data indicate that low environmental exposure to cadmium, as shown by cadmium body burden (Cd-U), is associated with renal dysfunction as well as an increased risk of cadmium-induced bone disorders. The present study was designed to assess the effects of low environmental cadmium exposure, at the level sufficient to induce kidney damage, on bone metabolism and mineral density (BMD). The project was conducted in the area contaminated with cadmium, nearby a zinc smelter located in the region of Poland where heavy industry prevails. The study population comprised 170 women (mean age=39.7; 18-70 years) and 100 men (mean age=31.9; 18-76 years). Urinary and blood cadmium and the markers of renal tubular dysfunction ({beta}{sub 2}M-U RBP, NAG), glomerular dysfunction (Alb-U and {beta}{sub 2}M-S) and bone metabolism markers (BAP-S, CTX-S) as well as forearm BMD, were measured. The results of this study based on simple dose-effect analysis showed the relationship between increasing cadmium concentrations and an increased excretion of renal dysfunction markers and decreasing bone density. However, the results of the multivariate analysis did not indicate the association between exposure to cadmium and decrease in bone density. They showed that the most important factors that have impact on bone density are body weight and age in the female subjects and body weight and calcium excretion in males. Our investigation revealed that the excretion of low molecular weight proteins occurred at a lower level of cadmium exposure than the possible loss of bone mass. It seems that renal tubular markers are the most sensitive and significant indicators of early health effects of cadmium intoxication in the general population. The correlation of urinary cadmium concentration with markers of kidney dysfunction was observed in the absence of significant correlations with bone effects. Our findings did not indicate any effects of environmental cadmium exposure on bone density.

  20. Processing of hydroxylapatite coatings on titanium alloy bone prostheses

    DOE Patents [OSTI]

    Nastasi, Michael A. (Espanola, NM); Levine, Timothy E. (Santa Clara, CA); Mayer, James W. (Phoenix, AZ); Pizziconi, Vincent B. (Phoenix, AZ)

    1998-01-01T23:59:59.000Z

    Processing of hydroxylapatite sol-gel films on titanium alloy bone prostheses. A method utilizing non-line-of-sight ion beam implantation and/or rapid thermal processing to provide improved bonding of layers of hydroxylapatite to titanium alloy substrates while encouraging bone ingrowth into the hydroxylapatite layers located away from the substrate, is described for the fabrication of prostheses. The first layer of hydroxylapatite is mixed into the substrate by the ions or rapidly thermally annealed, while subsequent layers are heat treated or densified using ion implantation to form layers of decreasing density and larger crystallization, with the outermost layers being suitable for bone ingrowth.

  1. ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone

    E-Print Network [OSTI]

    Price, Paul A.

    ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone Po-Yu Chen · Damon the hierarchical structure of mineral in mature bone. A method to completely deproteinize bone without altering of mineral and protein constituents. SEM revealed that bone minerals are fused together and form a sheet

  2. Interactive Separation of Segmented Bones in CT Volumes Using Graph Cut

    E-Print Network [OSTI]

    Ju, Tao

    mask customized to the shape of the bone, such as the femoral head. However, creat- ing masks for bones of different methodology have been reported for bone segmen- tation (see a recent survey in [1]). DueInteractive Separation of Segmented Bones in CT Volumes Using Graph Cut Lu Liu, David Raber, David

  3. Bone density and geometry in juvenile racehorses fed differing amounts of minerals

    E-Print Network [OSTI]

    Nolan, Meghan Muire

    2002-01-01T23:59:59.000Z

    designed as low, moderate, moderately high and high. Radiographs of the third metacarpal (MCIII) were taken on day 0, 28, 60, 92 and 124 to evaluate change in bone density and bone geometry. Bone density was expressed as radiographic bone aluminum...

  4. Computer modeling approach for microsphere-packed bone scaffold Pallavi Lal, Wei Sun*

    E-Print Network [OSTI]

    Sun, Wei

    bone graft [5,6], for structural and human cellular assessment of scaffolds for bone repair [7 modeling approach for constructing a three-dimensional microsphere-packed bone graft structure is presented packing model to determine the number of microspheres packed in a synthesized bone graft. The pore size

  5. Prediction of the elastic modulus of the trabecular bone based on X-ray computed tomography

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . INTRODUCTION The investigation of the mechanical properties of trabe- cular bone presents a major challenge

  6. Evaluation of radionuclide bone-imaging for the early detection of sepsis in a model of equine neonatal osteomyelitis

    E-Print Network [OSTI]

    Taylor, James Rutledge

    1986-01-01T23:59:59.000Z

    method of detecting bone abnormalities. The two main factors determining the degree of radiopharmaceutical uptake in bones, and thereby assessing the functional integrity of bone, have been identified as bone blood flow and bone turnover rates.... The resultant infection and induced metabolic changes should produce a positive Technetium-99m MDP ( Tc-MDP) 99m bone scan, a positive scan using Indium-111-oxine labeled leukocytes and radiographic changes characterized by decreased bone density . Seven...

  7. autotaxin controls bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Bykowski; Johnny Huard, Ph.D.; Lee E. Weiss, Ph.D.; Joseph E. Losee; Phil G. Campbell, Ph.D. 3 Akt1 in Osteoblasts and Osteoclasts Controls Bone Remodeling University of Kansas -...

  8. On the Mechanistic Origins of Toughness in Bone

    E-Print Network [OSTI]

    Launey, Maximilien E.

    One of the most intriguing protein materials found in nature is bone, a material composed of assemblies of tropocollagen molecules and tiny hydroxyapatite mineral crystals that form an extremely tough, yet lightweight, ...

  9. Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics

    E-Print Network [OSTI]

    Vuik, Kees

    Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics E.M.van Aken 1107895 of the joint and to relieve the pain, a prosthesis to replace the glenoid of the shoulder joint is an option

  10. affects bone tissue: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  11. acute bone marrow: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  12. abnormal bone growth: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  13. abnormally high bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  14. acute bone crises: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  15. anorganic bone clinical: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  16. abnormal bone development: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  17. absorptiometry bone densitometer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  18. alveolar bone cells: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  19. acute bone infarcts: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  20. acellular bone explants: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  1. adverse events bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    marrow disease Daldrup-Link, H E; Henning, T; Link, T M 2007-01-01 316 Bone loss during energy restriction: mechanistic role of leptin Texas A&M University - TxSpace Summary:...

  2. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, James W. (108 Independent Blvd., Aiken, SC 29801)

    1993-01-01T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  3. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-06-08T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  4. ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone

    E-Print Network [OSTI]

    Ritchie, Robert

    ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone in adult rats /Accepted: 3 September 2013 /Published online: 11 April 2014 # International Osteoporosis Foundation and National Osteoporosis Foundation 2014 Abstract Summary We used an osteopenic adult ovariectomized (OVX) rat

  5. areal bone mineral: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2.2.4 Risk factors 22 2.2.5 Morbidity and mortality 23 2.3 Units Laughlin, Robert B. 103 Rare earth element systematics of fossil bone revealed by LA-ICPMS analysis Environmental...

  6. Modular ‘Click-in-Emulsion’ Bone-Targeted Nanogels

    E-Print Network [OSTI]

    Heller, Daniel A.

    A new class of nanogel demonstrates modular biodistribution and affinity for bone. Nanogels, ~70 nm in diameter and synthesized via an astoichiometric click-chemistry in-emulsion method, controllably display residual, free ...

  7. Children cortical bone characterisation: the ultrasonic J.-P. Berteaua

    E-Print Network [OSTI]

    Boyer, Edmond

    infantile osteo-pathologies. That is why there is a strong interest in the characterisation of the growing specific location (close to cancerous cells) or cadaveric bone. They indicate a lower Young's modulus

  8. Trabecular bone dosimetry using a Monte Carlo code

    E-Print Network [OSTI]

    Zuzarte de Mendonca, Anne

    1993-01-01T23:59:59.000Z

    The nuclear medicine community needs radiation ~ dose estimates to patients who are administered radiopharmaceuticals for therapy or diagnosis. These estimates should be as accurate as possible for any organ, and especially for the bone since the bone... of Nuclear Medicine formed a committee to fulfill the needs of the nuclear medicine community to determine the radiation absorbed dose to patients who are athninistered radiopharmaceuticals. The objectives of the Medical Internal Radiation Dose Committee...

  9. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    and the epiphysis are wider than the diaphysis. Cortical bone is denser than trabecular bone as shown in Fig. 2.1b. In the overall adult human skeleton, the skeletal mass is 80% cortical bone and 20% trabecular bone (4). However, the distribution of cortical... surfaces. Moreover, they did not use the volume 6 Table 2.1. Summary of experimental results on trabecular bone from previous research Source Type of bone Size of specimen Carter & Hayes (3) Bovine, Human ?20.6x5mm Cylinder E =3790? 0.06 ? 3 , ? c...

  10. Common variants in the region around Osterix are associated with bone mineral density and growth in childhood

    E-Print Network [OSTI]

    Peltonen, Leena

    Peak bone mass achieved in adolescence is a determinant of bone mass in later life. In order to identify genetic variants affecting bone mineral density (BMD), we performed a genome-wide association study of BMD and related ...

  11. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model 

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    In this study, trabecular architecture is considered as a cellular solid structure, including both intact and damaged bone models. ??Intact?? bone models were constructed based on ideal versions of 25, 60 and 80-year-old ...

  12. Methods for identifying cancellous bone specimen location and size for the Reduced Platen Compression Test 

    E-Print Network [OSTI]

    Cowen, Kyle Ray

    2013-02-22T23:59:59.000Z

    , and stimuli on the skeleton and its ability to perform these everyday functions. The current state of bone testing is focused on understanding the mechanical properties of bone through use of traditional mechanical testing procedures such as three point...

  13. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    properties of proximal tibia were measured using in vivo peripheral quantitative CT. Bone formation rate was quantified on the periosteal the surface by standard bone histomorphometry after intraperitoneal injections of calcein. There was a significant main...

  14. Metabolic modeling for the deposition of transuranic nuclides on bone surfaces 

    E-Print Network [OSTI]

    Halter, Donald Anthony

    1997-01-01T23:59:59.000Z

    to bone surfaces. Although only plutonium was used in the evaluation of this model, any bone surface-seeking, alpha-emitting nuclide, and any class compound, can be used with this model....

  15. Apatite-polymer composites for the controlled delivery of bone morphogenetic proteins

    E-Print Network [OSTI]

    Yong, Tseh-Hwan

    2005-01-01T23:59:59.000Z

    Current treatment of bone defects due to trauma, cancer, or degenerative spine diseases involves the implantation of a bone graft. Autografts, which are harvested from the patient's own body, are associated with problems ...

  16. Bone Canonical WNT/B-Catenin Signaling in Models of Reduced Microgravity

    E-Print Network [OSTI]

    Macias, Brandon 1979-

    2012-10-25T23:59:59.000Z

    translates into molecular osteogenic signals in bone cells is unknown. Radiation exposure is another potent inducer of bone loss, namely observed on Earth in the clinical setting following radiotherapy procedures. It is expected that long duration space...

  17. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training 

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    Young and ovariectomized animals eating diets rich in omega-3 polyunsaturated fatty acids (n-3 PUFAs) exhibit enhanced bone formation and decrease bone loss, respectively. Eicosapentaenoic acid, an n-3 PUFA found in fish ...

  18. Detection of bone disease in dogs by radioisotope scanning

    E-Print Network [OSTI]

    Morris, Earl Louis

    1971-01-01T23:59:59.000Z

    f = fractional abundance 6 = cross section thermal neutron f1~ &t (1-e ) = decay factor The usual method of administration of radio- isotopes is intravenously but some have been given orally. 4 high bone to tissue ratio must be achieved... is limited by their availability because they must be produced close to where they will be used. MATERIALS AND METHODS The use of 2 radioactive isotopes for bone scanning in dogs was studied. Sr and Sr were 85 87m selected as the isotopes to be studied...

  19. Measurement of bone mineral content in caged and active cats 

    E-Print Network [OSTI]

    Tveter, Diane Ellen

    1988-01-01T23:59:59.000Z

    errors but these can be reduced by using two different x-ray energies. Dual energy CT operates on a basis similar to dual photon absorptiometry (explained below). The difference in attenuation between tissue and bone is greater for a lower energy... to act as a soft tissue equivalent (35). Effects of fat and soft tissue are decreased when dual energy CT is used (33). Data from each of the two different photon energies are combined and result in images of soft tissue and bone mineral regions. Beam...

  20. The effects of eccentric training on muscle-bone function

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE... December 1999 Major Subject: Kinesiology THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Subinitted to the Office of Graduate Studies of Texas A8iM University in partial fulfillment of the requirements...

  1. Patients with Patellofemoral Pain Exhibit Elevated Bone Metabolic Activity at the Patellofemoral Joint

    E-Print Network [OSTI]

    Delp, Scott

    . While we cannot measure bone stress in vivo, we can visualize bone metabolic activity using 18 F NaF PET/CT, which may be related to bone stress. Our goals were to use 18 F NaF PET/CT to evaluate whether subjects. Published by Wiley Periodicals, Inc. J Orthop Res Keywords: patellofemoral pain; 18 F NaF PET/CT; bone

  2. Is decreased bone mineral density associated with development of scoliosis? A bipedal osteopenic rat model

    E-Print Network [OSTI]

    Dede, Ozgur; Akel, Ibrahim; Demirkiran, Gokhan; Yalcin, Nadir; Marcucio, Ralph; Acaroglu, Emre

    2011-01-01T23:59:59.000Z

    more time standing erect. Dual energy X-ray absorbtiometry (acid; DEXA: Dual energy X-ray absorptiometry; BMD: Bone

  3. 3D Bone Microarchitecture Modeling and Fracture Risk Department of Computer

    E-Print Network [OSTI]

    Buffalo, State University of New York

    technique for the diagnosis of osteoporosis is Bone Mineral Density (BMD) measurement based on dual energy X

  4. Calcium phosphate cement augmentation of cancellous bone screws can compensate for the absence of cortical fixation

    E-Print Network [OSTI]

    Guerraoui, Rachid

    Calcium phosphate cement augmentation of cancellous bone screws can compensate for the absence Keywords: Screw fixation Pullout force Calcium phosphate cement Osteoporotic bone a b s t r a c with cement. Previous studies have shown that bone augmentation with Calcium Phosphate (CaP) cement

  5. Augmentation of bone defect healing using a new biocomposite scaffold: An in vivo study in sheep

    E-Print Network [OSTI]

    Guerraoui, Rachid

    replacement, where significant bone loss can be found either under the tibial tray or in the femoral partAugmentation of bone defect healing using a new biocomposite scaffold: An in vivo study in sheep U March 2010 Keywords: Biocomposite Bone substitute In vivo Poly(L-lactic acid) b-Tricalcium phosphate a b

  6. Design and validation of automated femoral bone morphology measurements in cerebral palsy

    E-Print Network [OSTI]

    Lee, Jehee

    Design and validation of automated femoral bone morphology measurements in cerebral palsy Noyeol, Seoul, South Korea #12;Abstract Accurate quantification of bone morphology is important for monitoring an automatic bone morphology measurement method using one or two radiographs. The study focused on 4

  7. A method for calibration of bone driver transducers to measure the mastoid impedance Reggie Weecea

    E-Print Network [OSTI]

    Allen, Jont

    bone vibrator transducers for clinical measurements, the transfer of energy from the bone driver by known masses. This absolute calibration is based upon a circuit model of the driver, describing specialized equipment not available in the clinic, and a refined bone driver circuit model is proposed

  8. A Graph-based Approach for Computational Model of Bone Microstructure

    E-Print Network [OSTI]

    Buffalo, State University of New York

    azhang@buffalo.edu ABSTRACT Osteoporosis, a condition in which bones become fragile and more likely bone due to osteoporosis. The diagnosis of osteoporosis is commonly done by tests that measure for the diagnosis of osteoporosis are limited due to the lack of good measurements of bone quality. In this paper

  9. Modelling by percolation theory of the behaviour of natural coral used as bone substitute.

    E-Print Network [OSTI]

    Boyer, Edmond

    Modelling by percolation theory of the behaviour of natural coral used as bone substitute. Y the resorption and ossification of natural coral implanted in bones. The first step of the process.barbotteau@qse.tohoku.ac.jp) #12;Modelling by percolation theory of the behaviour of natural coral used as bone substitute.2 1

  10. Histologic Comparison of Regenerate Bone Produced from Dentate Versus Edentulous Transport Discs in Bone Transport Distraction Osteogenesis

    E-Print Network [OSTI]

    Sevilla Gaitan, Carlos

    2013-12-10T23:59:59.000Z

    and the recipient bone segment (Nagashima, Rondon-Newby et al. 2012). Histologic examination of the midline tissues was performed in the present study to establish whether or not bony union has occurred. Main Goal The main goal of this study was to analyze... emphasis on characteristics related to the quality and quantity of the new regenerate bone formed (Zapata, Halvachs et al. 2011; Zapata, Opperman et al. 2011; Nagashima, Rondon-Newby et al. 2012). Nagashima et al. concluded that after four weeks...

  11. Evolution of Matrix and Bone -Carboxyglutamic Acid Proteins in Vertebrates*

    E-Print Network [OSTI]

    Price, Paul A.

    or reconstructed through the use of comparative genomics and data mining. These sequences were compared with available annotated sequences (a total of 48 complete or nearly complete sequences, 28 BGPs and 20 MGPs of biological functions such as skeletogenesis and bone maintenance (BGP and MGP), hemostasis (prothrombin, clot

  12. FSH Directly Regulates Bone Mass Yuanzhen Peng,1

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    .01.051 SUMMARY Postmenopausal osteoporosis, a global public health problem, has for decades been attributed and function. We suggest that high circulating FSH causes hypogonadal bone loss. INTRODUCTION Osteoporosis., 1993; Manolagas and Jilka, 1995). After menopause, resorption significantly exceeds formation

  13. Invest in Your Bones Osteoporosis--The Silent Disease

    E-Print Network [OSTI]

    Invest in Your Bones Osteoporosis--The Silent Disease Leaflet 2 Osteoporosis, a painful of State Health Services, 2008). Osteoporosis is preventable and/or treatable. Accordingly, osteoporosis of height, and chronic back pain. Hip fracture, the most serious consequence of osteoporosis, threatens one

  14. The effects of eccentric training on muscle-bone function 

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    , mechanical testing at this site showed greater tibiae stiffness in the exercised bone than that of the OVX group (+28.5%). No significant differences were found in tibial ultimate load to fracture, ultimate strength or modulus of elasticity. In summary...

  15. Spectral Analysis and Connectivity of Porous Microstructures in Bone

    E-Print Network [OSTI]

    Golden, Kenneth M.

    that quantifies brine connectivity and its thermal evolution can also help assess the impact of osteoporosis on trabecular structure. Central to our approach is the spectral measure of a composite material, which contains, in dense cortical bone the pores can be sparse and disconnected, yet exhibit increasing volume fraction

  16. Splenic concentration of bone imaging agents in functional asplenia

    SciTech Connect (OSTI)

    Dhekne, R.D.

    1981-07-01T23:59:59.000Z

    Three cases of sickle cell disease associated with functional asplenia are described. The spleen was not visualized on routine Tc-99m-sulfur colloid scan. The bone scan performed with Tc-99m-phosphate compounds revealed abnormal splenic activity in all three cases. The previous case reports and the literature on this subject are reviewed.

  17. Metastatic calcification of the stomach imaged on a bone scan

    SciTech Connect (OSTI)

    Goldstein, R.; Ryo, U.Y.; Pinsky, S.M.

    1984-10-01T23:59:59.000Z

    A whole body bone scan obtained on a 21-year-old woman with sickle cell disease and chronic renal failure showed localization of the radionuclide diffusely in the stomach. The localization of the radionuclide represented metastatic calcification of the stomach caused by secondary hyperparathyroidism.

  18. Random lasing in bone tissue Qinghai Song,1

    E-Print Network [OSTI]

    Kim, Young L.

    of Biomedical Engineering, Purdue University, West Lafayette, Indiana 47907, USA 2 School of Electrical, 2010; posted March 26, 2010 (Doc. ID 122271); published April 28, 2010 Owing to the low-loss and high and deformation mecha- nisms in bone still remain relatively unexplored, in part, due to current technical

  19. A multiscale mechanobiological model of bone remodelling predicts site-specific bone loss in the femur during osteoporosis and mechanical disuse

    E-Print Network [OSTI]

    Lerebours, C; Scheiner, S; Pivonka, P

    2015-01-01T23:59:59.000Z

    We propose a multiscale mechanobiological model of bone remodelling to investigate the site-specific evolution of bone volume fraction across the midshaft of a femur. The model includes hormonal regulation and biochemical coupling of bone cell populations, the influence of the microstructure on bone turnover rate, and mechanical adaptation of the tissue. Both microscopic and tissue-scale stress/strain states of the tissue are calculated from macroscopic loads by a combination of beam theory and micromechanical homogenisation. This model is applied to simulate the spatio-temporal evolution of a human midshaft femur scan subjected to two deregulating circumstances: (i) osteoporosis and (ii) mechanical disuse. Both simulated deregulations led to endocortical bone loss, cortical wall thinning and expansion of the medullary cavity, in accordance with experimental findings. Our model suggests that these observations are attributable to a large extent to the influence of the microstructure on bone turnover rate. Mec...

  20. Methods for testing the strength of cancellous bone and tested method effects on cortical bone in the ovariectomized rat 

    E-Print Network [OSTI]

    Ruhmann, Sean Phillip

    1998-01-01T23:59:59.000Z

    In this study, two mechanical testing procedures were developed to test the strength of cancellous bone from the proximal tibia of the rat, the "punch method" and the "whole slice method". These were used to quantify the effect of ovariectomy on rat...

  1. Methods for testing the strength of cancellous bone and tested method effects on cortical bone in the ovariectomized rat

    E-Print Network [OSTI]

    Ruhmann, Sean Phillip

    1998-01-01T23:59:59.000Z

    of the effect of two testing methods, torsion and three-point bending, on the mechanical strength of the rat femur and the changes in strength due to ovariectomy. From these tests, little change in cortical bone properties for the OVX rats compared to the Sham...

  2. Mechanical loading attenuates loss of bone mass and bone strength induced by immobilization and calcium-deficiency 

    E-Print Network [OSTI]

    Inman, Cynthia Lynn

    1996-01-01T23:59:59.000Z

    mechanically loaded by a unique four-point loading machine three times per week. After six weeks of treatment, all animals were sacrificed, both tibia removed and tested for bone mineral density (BMD) by dual energy X-ray absorptiometry, stiffness and ultimate...

  3. Measuring the whole bone marrow asset in humans by a computational approach to integrated PET/CT imaging.

    E-Print Network [OSTI]

    Piana, Michele

    ; 7 CNR-SPIN. Genova. Italy Running Head: PET/CT measurement of bone marrow volume AddressMeasuring the whole bone marrow asset in humans by a computational approach to integrated PET/CT to chemotherapy. Keywords: PET/CT; bone marrow imaging; image processing. #12;2 Introduction Bone marrow (BM

  4. Identification of a hypoxic population of bone marrow cells

    SciTech Connect (OSTI)

    Allalunis, M.J.; Chapman, J.D.; Turner, A.R.

    1983-02-01T23:59:59.000Z

    A technique using collagenase has been devised to release and separate, with reproducibility, hematopoietic cells (HC) from various microenvironments of mouse femurs. HC were assayed by an in vitro gel culture technique used traditionally to score granulocyte-macrophage precursor cells (CFU-C). CFU-C which resided in the medullary cavity and endosteal regions were sensitive to ionizing radiation and resistant to misonidazole (MISO) cytotoxicity. CFU-C which resided within the compact bone were resistant to ionizing radiation and sensitive to the cytotoxic action of MISO. These results suggest that HC which reside in the bone are hypoxic and retain clonogenic potential. When animals were exposed to various treatments with MISO followed by myelotoxic doses of cyclophosphamide (CTX) or total body irradiation (TBI), the LD/sub 50/ of both agents was significantly reduced. This result suggests that a hypoxic component of HC could be important in the regenerative process within the marrow after such myelotoxic trauma.

  5. Exposure to cadmium and persistent organochlorine pollutants and its association with bone mineral density and markers of bone metabolism on postmenopausal women

    SciTech Connect (OSTI)

    Rignell-Hydbom, A., E-mail: anna.rignell-hydbom@med.lu.se [Department of Occupational and Environmental Medicine, Lund University (Sweden); Skerfving, S.; Lundh, T.; Lindh, C.H. [Department of Occupational and Environmental Medicine, Lund University (Sweden)] [Department of Occupational and Environmental Medicine, Lund University (Sweden); Elmstahl, S. [Division of Geriatric Medicine, Department of Health Sciences, Lund University, Malmue University Hospital (Sweden)] [Division of Geriatric Medicine, Department of Health Sciences, Lund University, Malmue University Hospital (Sweden); Bjellerup, P. [Center for Clinical Research, Uppsala University, Department of Clinical Chemistry, Vaesteras (Sweden)] [Center for Clinical Research, Uppsala University, Department of Clinical Chemistry, Vaesteras (Sweden); Juensson, B.A.G.; Struemberg, U. [Department of Occupational and Environmental Medicine, Lund University (Sweden)] [Department of Occupational and Environmental Medicine, Lund University (Sweden); Akesson, A. [Institute of Environmental Medicine, Karolinska Institutet, Stockholm (Sweden)] [Institute of Environmental Medicine, Karolinska Institutet, Stockholm (Sweden)

    2009-11-15T23:59:59.000Z

    Environmental contaminants such as cadmium and persistent organochlorine pollutants have been proposed as risk factors of osteoporosis, and women may be at an increased risk. To assess associations between exposure to cadmium and two different POPs (2,2',4,4',5,5'-hexachlorobiphenyl CB-153, 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene p,p'-DDE), on one hand, and bone effects, on the other, in a population-based study among postmenopausal (60-70 years) Swedish women with biobanked blood samples. The study included 908 women and was designed to have a large contrast of bone mineral densities, measured with a single photon absorptiometry technique in the non-dominant forearm. Biochemical markers related to bone metabolism were analyzed in serum. Exposure assessment was based on cadmium concentrations in erythrocytes and serum concentrations of CB-153 and p,p'-DDE. Cadmium was negatively associated with bone mineral density and parathyroid hormone, positively with the marker of bone resorption. However, this association disappeared after adjustment for smoking. The major DDT metabolite (p,p'-DDE) was positively associated with bone mineral density, an association which remained after adjustment for confounders, but the effect was weak. There was no evidence that the estrogenic congener (CB-153) was associated with any of the bone markers. In conclusion, no convincing associations were observed between cadmium and POPs, on one hand, and bone metabolism markers and BMD, on the other.

  6. A comparative histological study of fossil and recent bone tissues

    E-Print Network [OSTI]

    Enlow, Donald H.

    1955-01-01T23:59:59.000Z

    ? scopic inspection. A wet section, as viewed during trial grinding examinations, will appear more transparent than the dried, finished mount. Any of the standard laboratory abrasives, such as finely powdered carborundum, polishing alumina, or powdered... by hand with the bone section in direct contact with the revolving surface of a power-driven lap wheel. Finely powdered abrasive, such as carborundum or cleansing pov/der, is applied in the form of water paste to the wheel. Periodic inspection under a...

  7. Effects of hyperparathyroidism and calcium on bone healing

    E-Print Network [OSTI]

    Hubbard, Gene Borden

    1975-01-01T23:59:59.000Z

    lesions, blood chemistry data and microscopic examination of bone, The citations on the following pages follow the style of the Sutrnaf. 0$ She. Amuck'. can Vetenanacq Medx. caf. Ass acL aX&0n. CHAPTER II LITERATURE REVIEW Trauma has traditionally...- parathyroidism; however, lameness disappeared in horses fed a standard ration containing 0. 52; calcium and 0. 45+ phosphorus. The case history of a man with hyperparathyroidism in which the main clinical feature was multiple nonuniting 7 fractures has been...

  8. Porous coatings from wire mesh for bone implants

    DOE Patents [OSTI]

    Sump, Kenneth R. (Richland, WA)

    1986-01-01T23:59:59.000Z

    A method of coating areas of bone implant elements and the resulting implant having a porous coating are described. Preselected surface areas are covered by a preform made from continuous woven lengths of wire. The preform is compressed and heated to assure that diffusion bonding occurs between the wire surfaces and between the surface boundaries of the implant element and the wire surfaces in contact with it. Porosity is achieved by control of the resulting voids between the bonded wire portions.

  9. Aging and Fracture of Human Cortical Bone and Tooth Dentin

    SciTech Connect (OSTI)

    Ager, Joel; Koester, Kurt J.; Ager III, Joel W.; Ritchie, Robert O.

    2008-05-07T23:59:59.000Z

    Mineralized tissues, such as bone and tooth dentin, serve as structural materials in the human body and, as such, have evolved to resist fracture. In assessing their quantitative fracture resistance or toughness, it is important to distinguish between intrinsic toughening mechanisms which function ahead of the crack tip, such as plasticity in metals, and extrinsic mechanisms which function primarily behind the tip, such as crack bridging in ceramics. Bone and dentin derive their resistance to fracture principally from extrinsic toughening mechanisms which have their origins in the hierarchical microstructure of these mineralized tissues. Experimentally, quantification of these toughening mechanisms requires a crack-growth resistance approach, which can be achieved by measuring the crack-driving force, e.g., the stress intensity, as a function of crack extension ("R-curve approach"). Here this methodology is used to study of the effect of aging on the fracture properties of human cortical bone and human dentin in order to discern the microstructural origins of toughness in these materials.

  10. Patients with Patellofemoral Pain Exhibit Elevated Bone Metabolic Activity at the Patellofemoral Joint

    E-Print Network [OSTI]

    Delp, Scott

    NaF PET/CT, which may be related to bone stress. Our goals were to use 18 F NaF PET/CT to evaluate: patellofemoral pain; 18 F NaF PET/CT; bone metabolic activity Patellofemoral pain syndrome is often characterized the specific regions of tracer uptake. 18 F NaF PET/CT is an alter- native to Tc-99m MDP bone scintigraphy

  11. Frontal and orbital bone infarctions causing periorbital swelling in patients with sickle cell anemia

    SciTech Connect (OSTI)

    Garty, I.; Koren, A.; Garzozi, H.

    1984-10-01T23:59:59.000Z

    Two cases of unilateral and bilateral periorbital hematomas occurred in patients with sickle cell anemia. The cause of periorbital swelling in these cases was found to be orbital and frontal bone infarctions, respectively, diagnosed by technetium Tc 99m medronate bone scintigraphy. To our knowledge, periorbital bone infarction, as a part of the differential diagnosis of periorbital hematoma and as part of the possible ocular manifestations in patients with sickle cell anemia, has not previously been described.

  12. Mitigating Disuse Bone Loss: Role of Resistance Exercise and Beta-Adrenergic Signaling

    E-Print Network [OSTI]

    Swift, Joshua Michael

    2011-08-08T23:59:59.000Z

    on Bone During Extended Bed Rest (Human) Only a few long-term bed rest investigations have successfully mitigated bone loss with exercise paradigms. Combined supine flywheel resistive and treadmill exercise during 90-day bed rest in young men... novel rodent resistance exercise device using flywheel technology was used by Fluckey et al (57) to demonstrate the effects of maximal voluntary squats, performed during suspension, on changes in metaphyseal bone mass. The flywheel exercise protocol...

  13. Journal of Biomechanics 41 (2008) 10621068 Nonlinear ultrasound can detect accumulated damage in human bone

    E-Print Network [OSTI]

    2008-01-01T23:59:59.000Z

    due to the fact that osteoporosis and bone fragility are increasingly widespread diseases. Fracture increases exponentially with age, with a significant increase corresponding to the beginning of menopause

  14. Preparation and characterization of calcium phosphate ceramics and Composites as bone substitutes

    E-Print Network [OSTI]

    Zhang, Xing

    2007-01-01T23:59:59.000Z

    bone. Natural porous calcium carbonate skeletons, coral andconversion of calcium carbonate marine skeletons in (NH 4 )conversions of calcium carbonate skeletons (e.g. coral,

  15. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    risk of vertebral osteoporosis compared to men with noto identify patients with osteoporosis. Keywords Bone loss .associated with COPD, osteoporosis is believed to affect 36%

  16. Bone mineral density and blood metals in premenopausal women

    SciTech Connect (OSTI)

    Pollack, A.Z., E-mail: pollacka@mail.nih.gov [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States); Mumford, S.L. [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)] [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States); Wactawski-Wende, J. [Department of Social and Preventive Medicine, University at Buffalo, State University of New York, Buffalo, NY (United States)] [Department of Social and Preventive Medicine, University at Buffalo, State University of New York, Buffalo, NY (United States); Yeung, E.; Mendola, P.; Mattison, D.R.; Schisterman, E.F. [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)] [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)

    2013-01-15T23:59:59.000Z

    Exposure to metals, specifically cadmium, lead, and mercury, is widespread and is associated with reduced bone mineral density (BMD) in older populations, but the associations among premenopausal women are unclear. Therefore, we evaluated the relationship between these metals in blood and BMD (whole body, total hip, lumbar spine, and non-dominant wrist) quantified by dual energy X-ray absorptiometry in 248 premenopausal women, aged 18-44. Participants were of normal body mass index (mean BMI 24.1), young (mean age 27.4), 60% were white, 20% non-Hispanic black, 15% Asian, and 6% other race group, and were from the Buffalo, New York region. The median (interquartile range) level of cadmium was 0.30 {mu}g/l (0.19-0.43), of lead was 0.86 {mu}g/dl (0.68-1.20), and of mercury was 1.10 {mu}g/l (0.58-2.00). BMD was treated both as a continuous variable in linear regression and dichotomized at the 10th percentile for logistic regression analyses. Mercury was associated with reduced odds of decreased lumbar spine BMD (0.66, 95% confidence interval: 0.44, 0.99), but overall, metals at environmentally relevant levels of exposure were not associated with reduced BMD in this population of healthy, reproductive-aged women. Further research is needed to determine if the blood levels of cadmium, lead, and mercury in this population are sufficiently low that there is no substantive impact on bone, or if effects on bone can be expected only at older ages.

  17. Hydroxyapatite-binding peptides for bone growth and inhibition

    DOE Patents [OSTI]

    Bertozzi, Carolyn R. (Berkeley, CA); Song, Jie (Shrewsbury, MA); Lee, Seung-Wuk (Walnut Creek, CA)

    2011-09-20T23:59:59.000Z

    Hydroxyapatite (HA)-binding peptides are selected using combinatorial phage library display. Pseudo-repetitive consensus amino acid sequences possessing periodic hydroxyl side chains in every two or three amino acid sequences are obtained. These sequences resemble the (Gly-Pro-Hyp).sub.x repeat of human type I collagen, a major component of extracellular matrices of natural bone. A consistent presence of basic amino acid residues is also observed. The peptides are synthesized by the solid-phase synthetic method and then used for template-driven HA-mineralization. Microscopy reveal that the peptides template the growth of polycrystalline HA crystals .about.40 nm in size.

  18. Zhejiang Bone New Material Technology Co Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty Edit withTianlinPapers HomeXuanenYongzhouYunnanZhangye LonghuiZhejiang Bone New

  19. Bone status in high levels cyclists J Clin Densitom. 2012 Jan-Mar;15(1):103-7. Evaluation of the Bone Status in High-Level Cyclists

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    health Organization has defined osteoporosis in post-menopausal women as a T-score value less than -2) defines a "low bone density". In post-menopausal women as well as in elderly in general, results are more

  20. Analyzing the effects of alcohol on IGF-I in bone and plasma and on IGF-I mRNA in the liver and bone

    E-Print Network [OSTI]

    Stine, Christina Nicole

    2001-01-01T23:59:59.000Z

    Alcohol consumption is occurring in the younger generation. It has been found that the sooner people started drinking the shorter they are. Alcohol has also been shown to reduce peak bone mass. Alcohol inhibits osteoblastic proliferation which...

  1. The bending and dynamic mechanical properties of cortical bone: the effects of sodium fluoride and the relationship to physical properties 

    E-Print Network [OSTI]

    McCurdy-Rahn, Megan Calista

    1998-01-01T23:59:59.000Z

    Bone is a complex organic composite material. The graphics. interface between the mineral and organic phases of bone is significant both to medicine and to the biokinetics, a field which seeks to create advanced synthetic materials by copying...

  2. The effect of alcohol on the bone growth spurt of rats at a time equivalent to adolescent females

    E-Print Network [OSTI]

    Chaffin, Catherine Lee

    1997-01-01T23:59:59.000Z

    . The trabecular bone that remained was widely separated and reduced in thickness. These changes are similar to those observed in osteoporosis. The cause and mechanism of the reduced bone volume after alcohol abuse remains unclear. Alcohol consumption at an early...

  3. Development of high strength hydroxyapatite for bone tissue regeneration using nanobioactive glass composites

    SciTech Connect (OSTI)

    Shrivastava, Pragya; Dalai, Sridhar; Vijayalakshmi, S. [Centre for Research in Nanotechnology and Science, IIT Bombay (India); Sudera, Prerna; Sivam, Santosh Param [Amity Institute of Nanotechnology, Amity University, Noida, Uttar Pradesh-201303 (India); Sharma, Pratibha [Dept of Energy Science and Engineering, IIT Bombay (India)

    2013-02-05T23:59:59.000Z

    With an increasing demand of biocompatible bone substitutes for the treatment of bone diseases and bone tissue regeneration, bioactive glass composites are being tested to improvise the osteoconductive as well as osteoinductive properties. Nanobioactive glass (nBG) composites, having composition of SiO{sub 2} 70 mol%, CaO 26 mol % and P{sub 2}O{sub 5} 4 mol% were prepared by Freeze drying method using PEG-PPG-PEG co-polymer. Polymer addition improves the mechanical strength and porosity of the scaffold of nBG. Nano Bioactive glass composites upon implantation undergo specific reactions leading to the formation of crystalline hydroxyapatite (HA). This is tested in vitro using Simulated Body Fluid (SBF). This high strength hydroxyapatite (HA) layer acts as osteoconductive in cellular environment, by acting as mineral base of bones, onto which new bone cells proliferate leading to new bone formation. Strength of the nBG composites as well as HA is in the range of cortical and cancellous bone, thus proving significant for bone tissue regeneration substitutes.

  4. High-speed photography of compressed human trabecular bone correlates whitening to microscopic damage

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    of trabecular bone is mainly motivated by the huge impact of osteoporosis in post-menopausal women and the aged is mainly motivated by the reduction of bone strength due to osteoporosis, a systemic skeletal disease [10.elsevier.com/locate/engfracmech #12;comes with a concomitant increase of fracture risk. Post-menopausal women and the elderly

  5. High-Speed Photography of Human Trabecular Bone during Compression Philipp J. Thurner1

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    of this research is motivated by the immense costs of health care and social impacts due to osteoporosis in post-menopausal women and the aged. Osteoporosis results in bone loss and change of trabecular architecture, causing of osteoporosis, a systemic, skeletal disease2 , which comes with a reduction of bone strength and a concomitant

  6. Estrogen protects bone by inducing Fas ligand in osteoblasts to regulate osteoclast survival

    E-Print Network [OSTI]

    Brown, Myles

    for post-menopausal osteoporosis (Sambrook and Cooper, 2006). Estrogen and ERs are important for bone and Musculoskeletal Biology, Wyeth Research, Collegeville, PA, USA Estrogen deficiency in menopause is a major cause of osteoporosis in women. Estrogen acts to maintain the appropriate ratio between bone-forming osteoblasts

  7. Mineralization of Decalcified Bone Occurs Under Cell Culture Conditions and Requires Bovine Serum But Not Cells

    E-Print Network [OSTI]

    Price, Paul A.

    Mineralization of Decalcified Bone Occurs Under Cell Culture Conditions and Requires Bovine Serum mineralization in the absence of cells. For this model, we utilized EDTA- decalcified new-born rat tibias with the cartilaginous ends intact, allowing us to visually determine the spec- ificity of mineralization within the bone

  8. Correlating mechanical properties of cancellous bone in the rat with various density measures 

    E-Print Network [OSTI]

    Ramaswamy, Ramya

    2004-09-30T23:59:59.000Z

    , and to correlate the mechanical properties of the rodent cancellous bone with the various density measures. Analytical studies were made to assess the effect of the size and shape of the platen based on the values from mechanical testing of the cancellous bone...

  9. Calcium balance and bone density in immature horses fed a high protein diet

    E-Print Network [OSTI]

    Spooner, Holly Sue

    2006-10-30T23:59:59.000Z

    . Blood samples, feces, and urine were collected during the 116-day study to determine any diet effect on pH and mineral balance. Radiographs were made of the left third metacarpal (MCIII) to determine bone density via radiographic bone aluminum...

  10. Targeting bone-microenvironment-tumour cell interactions : IGF-1 receptor kinase inhibitors. 

    E-Print Network [OSTI]

    Logan, John Gordon

    2012-11-30T23:59:59.000Z

    Bone metastases are a frequent clinical complication associated with cancer. The aim of this PhD thesis was to set up a model system for the study of tumour cell – bone cell interactions in vitro, ex vivo and in vivo and ...

  11. Bone Motion Analysis From Dynamic MRI: Ac-quisition and Tracking

    E-Print Network [OSTI]

    Gilles, Benjamin

    of mechanical overload, impingement or femoral head instability. For both diagnosis and surgical planning, an acBone Motion Analysis From Dynamic MRI: Ac- quisition and Tracking INTRODUCTION Periacetabular- curate estimate of hip joint bone motion is required. Orthopedists can use animated 3D models, prior

  12. Bone Surface Reconstruction From CT/MR Images Using Fast Marching and Level Set Methods1)

    E-Print Network [OSTI]

    Chetverikov, Dmitry

    Bone Surface Reconstruction From CT/MR Images Using Fast Marching and Level Set Methods1) Istv surfaces reconstructed from MR volumes are shown. 1 Outline of the project One of our current projects steps of bone surface reconstruction from CT/MR slice images. 2 Main steps of reconstruction 2.1

  13. Research Paper A method for calibration of bone driver transducers to measure the mastoid

    E-Print Network [OSTI]

    Allen, Jont

    vibrator transducers for clinical measurements, the transfer of energy from the bone driver depends. This absolute calibration is based upon a circuit model of the driver, describing it with three frequency in the clinic, and a refined bone driver circuit model is proposed to better capture the observed behaviors. Ã?

  14. Development/Plasticity/Repair The Bone Morphogenetic Protein Roof Plate Chemorepellent

    E-Print Network [OSTI]

    Butler, Samantha

    Development/Plasticity/Repair The Bone Morphogenetic Protein Roof Plate Chemorepellent Regulates, Toronto, Ontario, Canada M5G 1X8 Commissural spinal axons extend away from the roof plate (RP) in response to the dorsal midline and are generated by the bone morphogenetic proteins (BMPs) in the roof plate (RP) (Liem

  15. Bone Loss in Diabetes: Use of Antidiabetic Thiazolidinediones and Secondary Osteoporosis

    E-Print Network [OSTI]

    Toledo, University of

    Bone Loss in Diabetes: Use of Antidiabetic Thiazolidinediones and Secondary Osteoporosis Beata secondary osteoporosis. Risk factors for development of TZD-induced secondary osteoporosis are gender (women healing in T2DM patients on TZD therapy. Keywords Diabetes . Thiazolidinediones . Bone . Osteoporosis

  16. A multi-scale bone study to estimate the risk of fracture related to osteoporosis

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    A multi-scale bone study to estimate the risk of fracture related to osteoporosis Abdelwahed' Orléans, 8, Rue Léonard de Vinci 45072 Orléans, France Objective: Osteoporosis is a disease marked. Bone fractures caused by the osteoporosis become increasingly important goal for both clinicians

  17. Classification and volumetric analysis of temporal bone pneumatization using cone beam computed tomography

    E-Print Network [OSTI]

    Terasaki, Mark

    bone pneumatization in adults using cone beam computed tomography (CBCT) scans. Study Design. A total Oral Pathol Oral Radiol 2014;117:376-384) The advances in cone beam computed tomography (CBCT) overClassification and volumetric analysis of temporal bone pneumatization using cone beam computed

  18. Finite-Element Analysis of Biting Behavior and Bone Stress in the

    E-Print Network [OSTI]

    Dumont, Elizabeth R.

    Finite-Element Analysis of Biting Behavior and Bone Stress in the Facial Skeletons of Bats biting behavior and bite force data gathered in the field with finite-element (FE) analysis. Our FE words: biting behavior; bone stress; adaptation; finite-ele- ment analysis; Chiroptera Mammal evolution

  19. Bone marrow transplantation after the Chernobyl nuclear accident

    SciTech Connect (OSTI)

    Baranov, A.; Gale, R.P.; Guskova, A.; Piatkin, E.; Selidovkin, G.; Muravyova, L.; Champlin, R.E.; Danilova, N.; Yevseeva, L.; Petrosyan, L. (Institute of Biophysics of the Ministry of Health and Clinical Hospital, Moscow (USSR))

    1989-07-27T23:59:59.000Z

    On April 26, 1986, an accident at the Chernobyl nuclear power station in the Soviet Union exposed about 200 people to large doses of total-body radiation. Thirteen persons exposed to estimated total-body doses of 5.6 to 13.4 Gy received bone marrow transplants. Two transplant recipients, who received estimated doses of radiation of 5.6 and 8.7 Gy, are alive more than three years after the accident. The others died of various causes, including burns (the cause of death in five), interstitial pneumonitis (three), graft-versus-host disease (two), and acute renal failure and adult respiratory distress syndrome (one). There was hematopoietic (granulocytic) recovery in nine transplant recipients who could be evaluated, six of whom had transient partial engraftment before the recovery of their own marrow. Graft-versus-host disease was diagnosed clinically in four persons and suspected in two others. Although the recovery of endogenous hematopoiesis may occur after exposure to radiation doses of 5.6 to 13.4 Gy, we do not know whether it is more likely after the transient engraftment of transplanted stem cells. Because large doses of radiation affect multiple systems, bone marrow recovery does not necessarily ensure survival. Furthermore, the risk of graft-versus-host disease must be considered when the benefits of this treatment are being weighed.

  20. Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a

    E-Print Network [OSTI]

    Ariza Moreno, Pilar

    Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a , H descubrimientos s/n 41092 Seville (Spain) a jsanz@us.es, b helgaem@gmail.com, c mpariza@us.es Keywords: Bone-cement of the last XX century. Normally, implant is fixed to bone by means of a polymer material known as bone cement

  1. Estimation of the 3D self-similarity parameter of trabecular bone from its 2D projection

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    of osteoporosis is mainly based on dual energy X-ray absorptiometry which amounts to measuring bone mass

  2. EARLY PREVENTIVE EFFECTS OF RISEDRONATE IN A RAT MODEL WITH MASSIVE BONE LOSS DUE TO ORCHIDECTOMY AND

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    and disuse induced osteoporosis. ORX and BTX models were combined to see if their effects were cumulative on trabecular bone mass and bone architecture. KEY WORDS: Osteoporosis Orchidectomy Disuse Risedronate Bone-remodeling rate is observed in women after menopause or surgica

  3. Computational analysis of whole body CT documents a bone structure alteration in adult advanced chronic lymphocytic leukemia

    E-Print Network [OSTI]

    Piana, Michele

    progression. PET/CT images were analyzed using dedicated software, able to recognize an external 2-pixel bone ring whose Hounsfield coefficient served as cut off to recognize trabecular and compact bone. PET/CT of the disease. Keywords: Image Analysis, Bone Marrow, Skeletal Structure, ACLL, PET/CT #12;3 Introduction

  4. Effect of cryo-induced microcracks on microindentation of hydrated cortical bone tissue

    SciTech Connect (OSTI)

    Yin Ling, E-mail: ling.yin@jcu.edu.au [School of Engineering, James Cook University, Townsville, QLD 4811 (Australia); Venkatesan, Sudharshan [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia); Webb, Daryl [Electron Microscopy Unit, Australian National University, Canberra, ACT 0200 (Australia); Kalyanasundaram, Shankar; Qin Qinghua [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia)

    2009-08-15T23:59:59.000Z

    Microcracks accumulate in cortical bone tissue as a consequence of everyday cyclic loading. However, it remains unclear to what extent microdamage accumulation contributes to an increase in fracture risk. A cryo-preparation technique was applied to induce microcracks in cortical bone tissue. Microcracks with lengths up to approximately 20 {mu}m, which were initiated mainly on the boundaries of haversian canals, were observed with cryo-scanning electron microscopy. A microindentation technique was applied to study the mechanical loading effect on the microcracked hydrated bone tissue. The microindentation patterns were section-scanned using confocal laser scanning microscopy to understand the deformation and bone damage mechanisms made by mechanical loading. The results show that there was no significant difference with respect to microhardness between the original and microcracked hydrated cortical bone tissues (ANOVA, p > 0.05). The cryo-induced microcracks in the bone tissue were not propagated further under the mechanical loads applied. The deformation mechanism of the microcracked cortical bone tissue was plastic deformation, not brittle fracture.

  5. Jefferson Lab Man Donates Bone Marrow to Save 12-Year-Old Boy...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to MCV where he was admitted for the overnight procedure. He received a general anesthesia; then the doctors extracted two liters of bone marrow from his body. The life-saving...

  6. Discovery of novel anti-inflammatory proteins inspired by bone marrow mesenchymal stem cell secretions

    E-Print Network [OSTI]

    Milwid, Jack Miles

    2011-01-01T23:59:59.000Z

    Bone marrow mesenchymal stem cells (MSCs) may soon become the first FDA-approved stem cell therapy for autoimmune and inflammatory disease. Our lab originally hypothesized that much of the therapeutic activity of MSCs may ...

  7. Investigation of bone response to implant materials by electron microscopy and computer simulation

    E-Print Network [OSTI]

    Wang, Hao, 1974-

    2004-01-01T23:59:59.000Z

    (cont.) implementation of this scintigraphic method for quantitative studies of osteoblast-mediated mineralization in vitro. A 2-D truss finite element model is used to study the remodeling of trabecular bone. Using strain ...

  8. Bone Canonical WNT/B-Catenin Signaling in Models of Reduced Microgravity 

    E-Print Network [OSTI]

    Macias, Brandon 1979-

    2012-10-25T23:59:59.000Z

    of the series was conducted at Brookhaven National Laboratory. To quantify the impact of the abovementioned countermeasures and space radiation on bone, mechanical testing, peripheral quantitative computed tomography, micro-computed tomography, histomorphometry...

  9. Longitudinal ultrasound measurement of the equine third metacarpal bone as a predictor of mechanical testing properties 

    E-Print Network [OSTI]

    Dyer, Stephanie Ann

    1999-01-01T23:59:59.000Z

    diagnostic technique to identify the onset of bucked shins. The purpose of this study was to determine if the longitudinal speed of sound as measured by Soundscan 2000[] was an appropriate predictor of bone strength characterized by mechanical testing...

  10. Methods and modeling for the reduced platen compression of cancellous bone in the rodent proximal tibia 

    E-Print Network [OSTI]

    Rogers, William Elliott

    2002-01-01T23:59:59.000Z

    This study focused on the reduced platen compression (RPC) test of cancellous bone in the rodent proximal tibia. The objective was to improve methods for this mechanical test, specifically in the areas of specimen location, specimen preparation...

  11. Immobilized sonic hedgehog N-terminal signaling domain enhances differentiation of bone marrow-derived

    E-Print Network [OSTI]

    Schaffer, David V.

    , and immobilized onto interpenetrating polymer network (IPN) surfaces also grafted with a bone sialoprotein presented to cells using an intrinsically nonfouling interpenetrating polymer network (IPN).12,13 In spite

  12. The effects of alcohol consumption after menopause on bone regulating hormones

    E-Print Network [OSTI]

    Blaschke, Dawn Lewis

    1999-01-01T23:59:59.000Z

    The goal of this project was to determine if the alcohol-associated increase in osteopenia as observed in ovariectomized rats, which simulated human females after menopause, was due to the elect of alcohol on hormones that regulate bone metabolism...

  13. attenuates bone cancer-induced: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2007-01-01 300 MR imaging of therapy-induced changes of bone marrow University of California eScholarship Repository Summary: Treatment effects due to irradiation, chemotherapy...

  14. Method for palliation of pain in human bone cancer using therapeutic tin-117m compositions

    DOE Patents [OSTI]

    Srivastava, S.C.; Meinken, G.E.; Mausner, L.F.; Atkins, H.L.

    1998-12-29T23:59:59.000Z

    The invention provides a method for the palliation of bone pain due to cancer by the administration of a unique dosage of a tin-117m (Sn-117m) stannic chelate complex in a pharmaceutically acceptable composition. In addition, the invention provides a method for simultaneous palliation of bone pain and radiotherapy in cancer patients using compositions containing Sn-117m chelates. The invention also provides a method for palliating bone pain in cancer patients using Sn-117m-containing compositions and monitoring patient status by imaging the distribution of the Sn-117m in the patients. Also provided are pharmaceutically acceptable compositions containing Sn-117m chelate complexes for the palliation of bone pain in cancer patients. 5 figs.

  15. Method for palliation of pain in human bone cancer using therapeutic tin-117m compositions

    DOE Patents [OSTI]

    Srivastava, Suresh C. (Setauket, NY); Meinken, George E. (Middle Island, NY); Mausner, Leonard F. (Stony Brook, NY); Atkins, Harold L. (Setauket, NY)

    1998-12-29T23:59:59.000Z

    The invention provides a method for the palliation of bone pain due to cancer by the administration of a unique dosage of a tin-117m (Sn-117m) stannic chelate complex in a pharmaceutically acceptable composition. In addition, the invention provides a method for simultaneous palliation of bone pain and radiotherapy in cancer patients using compositions containing Sn-117m chelates. The invention also provides a method for palliating bone pain in cancer patients using Sn-117m-containing compositions and monitoring patient status by imaging the distribution of the Sn-117m in the patients. Also provided are pharmaceutically acceptable compositions containing Sn-117m chelate complexes for the palliation of bone pain in cancer patients.

  16. Effects of High Dietary Iron and Gamma Radiation on Oxidative Stress and Bone

    E-Print Network [OSTI]

    Yuen, Evelyn P

    2013-04-19T23:59:59.000Z

    (induced by feeding a high iron diet) and gamma radiation exposure would independently increase markers of oxidative stress and markers of oxidative damage and result in loss of bone mass, with the combined treatment having additive or synergistic effects...

  17. Pretreatment levels of bone turnover and the antifracture efficacy of alendronate: The fracture intervention trial

    E-Print Network [OSTI]

    2006-01-01T23:59:59.000Z

    in postmenopausal osteoporosis. Cal- cif Tissue Int 65:359–in postmeno- pausal osteoporosis. J Bone Miner Res 12:624–among women without osteoporosis at baseline. Although they

  18. Race/ethnic differences in bone mineral densities in older men

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    the Baltimore men’s osteoporosis study. J Bone Miner Res 13.center genetic study of osteoporosis. Osteoporos Int 17:125–Leung Jockey Club Centre for Osteoporosis Care and Control,

  19. The harmful effects of late-onset alcohol consumption on cortical bone in aged rats 

    E-Print Network [OSTI]

    Bowlin, Julie Lee

    2001-01-01T23:59:59.000Z

    to determine bone chemistry and morphological parameters. The effects of alcohol consumption, the aging process and caloric restriction were examined after obtaining results from this experiment. From the results found, it is evident that alcohol does have a...

  20. Self-assembling peptide hydrogels modulate in vitro chondrogenesis of bovine bone marrow stromal cells

    E-Print Network [OSTI]

    Kopesky, Paul Wayne

    Our objective was to test the hypothesis that self-assembling peptide hydrogel scaffolds provide cues that enhance the chondrogenic differentiation of bone marrow stromal cells (BMSCs). BMSCs were encapsulated within two ...

  1. Factors Affecting the Mechanical Behavior of Bone Subrata Saha, Ph.D.

    E-Print Network [OSTI]

    Gilbert, Robert P.

    Factors Affecting the Mechanical Behavior of Bone by Subrata Saha, Ph.D. Research Professor-mail: subrata.saha@downstate.edu ABSTRACT The load carrying capacity of our skeletal system depends

  2. Non-invasive shock wave stimulated periosteum for bone tissue engineering

    E-Print Network [OSTI]

    Kearney, Cathal (Cathal John)

    2011-01-01T23:59:59.000Z

    The cambium cells of the periosteum, which are known osteoprogenitor cells, have limited suitability for clinical applications of bone tissue engineering due to their low cell number (2-5 cells thick). Extracorporeal shock ...

  3. Analysis of a Fossil Bone from the Archaeological Settlement Malu Rosu, Romania by Accelerator Mass Spectrometry

    E-Print Network [OSTI]

    Agata Olariu; Ion V. Popescu; Ragnar Hellborg; Kristina Stenström; Mikko Faarinen; Per Persson; Bengt Erlandsson; Göran Skog; Emilian Alexandrescu

    2001-03-13T23:59:59.000Z

    A fossil bone from the archaeological site Malu Rosu Giurgiu, in Romania has been analyzed by accelerator mass spectrometry to estimate its age by determining its $^{14}$C content. The radiocarbon age of the bone is in agreement with the date obtained by the method for age determination, based on fluorine content. This is the first radiocarbon dating for the final Neolithic period, for this archaeological settlement in the Romanian region.

  4. Estimating cancellous bone properties of the rat from mechanical testing of the femoral neck 

    E-Print Network [OSTI]

    Groves, Jennifer Ann

    1998-01-01T23:59:59.000Z

    ESTIMATING CANCELLOIJS BONE PROPERTIES OF THE RAT FROM MECHANICAL TESTING OF THE FEMORAL NECK A Thesis by JENNIFER ANN GROVES Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 1998 Major Subject: Mechanical Engineering ESTIMATING CANCELLOUS BONE PROPERTIES OF THE RAT FROM MECHANICAL TESTING OF THE FEMORAL NECK A Thesis by JENNIFER ANN GROVES Submitted to Texas Ai8:M University...

  5. Analyzing the effects of alcohol on IGF-I in bone and plasma and on IGF-I mRNA in the liver and bone 

    E-Print Network [OSTI]

    Stine, Christina Nicole

    2001-01-01T23:59:59.000Z

    (Member) John E. Bauer (Chair of Nutrition) Bryan H. Johnson (Department Head) August 2001 Major: Nutrition ABSTRACT Analyzing the Effects of Alcohol on IGF-I in Bone and Plasma and on IGF-I mRNA in the Liver and Bone. (August 2001) Christina... different effector pathways to increase proliferation at the growth plate (Klaus et al. , 1998). Therefore Vitamin D may not have an effect on IGF-I. Alcoholics have decreased plasma 25-hydroxyvitamin D which is an indicator of Vitamin D status (Peris et...

  6. Automated simulation of areal bone mineral density assessment in the distal radius from high-resolution peripheral quantitative computed tomography

    E-Print Network [OSTI]

    Burghardt, A. J.; Kazakia, G. J.; Link, T. M.; Majumdar, S.

    2009-01-01T23:59:59.000Z

    Bone mineral density . DXA . HR-pQCT . Osteoporosis .Simulation Introduction Osteoporosis is a conditionclinical assessment of osteoporosis status were identified

  7. Characterization of the effects of x-ray irradiation on the hierarchical structure and mechanical properties of human cortical bone

    E-Print Network [OSTI]

    Barth, Holly

    2012-01-01T23:59:59.000Z

    in   bone   strength.   Osteoporosis  Int    2006;17:319-­??fragility   in   aging,   osteoporosis,   and   diabetes  mellitus.  Osteoporosis  Int    2010;21:195-­??214.  

  8. Electron Microscopy and Analytical X-ray Characterization of Compositional and Nanoscale Structural Changes in Fossil Bone

    E-Print Network [OSTI]

    Boatman, Elizabeth

    2012-01-01T23:59:59.000Z

    of questions surrounding the diagenesis and fossilization ofthe consequences of diagenesis for that particular feature (on the concept of bone diagenesis and how it relates to

  9. Comparative analysis of 11 different radioisotopes for palliative treatment of bone metastases by computational methods

    SciTech Connect (OSTI)

    Guerra Liberal, Francisco D. C., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, Adriana Alexandre S., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, João Manuel R. S., E-mail: tavares@fe.up.pt [Instituto de Engenharia Mecânica e Gestão Industrial, Faculdade de Engenharia, Universidade do Porto, Rua Dr. Roberto Frias s/n, Porto 4200-465 (Portugal)

    2014-11-01T23:59:59.000Z

    Purpose: Throughout the years, the palliative treatment of bone metastases using bone seeking radiotracers has been part of the therapeutic resources used in oncology, but the choice of which bone seeking agent to use is not consensual across sites and limited data are available comparing the characteristics of each radioisotope. Computational simulation is a simple and practical method to study and to compare a variety of radioisotopes for different medical applications, including the palliative treatment of bone metastases. This study aims to evaluate and compare 11 different radioisotopes currently in use or under research for the palliative treatment of bone metastases using computational methods. Methods: Computational models were used to estimate the percentage of deoxyribonucleic acid (DNA) damage (fast Monte Carlo damage algorithm), the probability of correct DNA repair (Monte Carlo excision repair algorithm), and the radiation-induced cellular effects (virtual cell radiobiology algorithm) post-irradiation with selected particles emitted by phosphorus-32 ({sup 32}P), strontium-89 ({sup 89}Sr), yttrium-90 ({sup 90}Y ), tin-117 ({sup 117m}Sn), samarium-153 ({sup 153}Sm), holmium-166 ({sup 166}Ho), thulium-170 ({sup 170}Tm), lutetium-177 ({sup 177}Lu), rhenium-186 ({sup 186}Re), rhenium-188 ({sup 188}Re), and radium-223 ({sup 223}Ra). Results: {sup 223}Ra alpha particles, {sup 177}Lu beta minus particles, and {sup 170}Tm beta minus particles induced the highest cell death of all investigated particles and radioisotopes. The cell survival fraction measured post-irradiation with beta minus particles emitted by {sup 89}Sr and {sup 153}Sm, two of the most frequently used radionuclides in the palliative treatment of bone metastases in clinical routine practice, was higher than {sup 177}Lu beta minus particles and {sup 223}Ra alpha particles. Conclusions: {sup 223}Ra and {sup 177}Lu hold the highest potential for palliative treatment of bone metastases of all radioisotopes compared in this study. Data reported here may prompt future in vitro and in vivo experiments comparing different radionuclides for palliative treatment of bone metastases, raise the need for the careful rethinking of the current widespread clinical use of {sup 89}Sr and {sup 153}Sm, and perhaps strengthen the use of {sup 223}Ra and {sup 177}Lu in the palliative treatment of bone metastases.

  10. Synchrotron imaging reveals bone healing and remodelling strategies in extinct and extant vertebrates

    SciTech Connect (OSTI)

    Anne, Jennifer [Univ. of Manchester (United Kingdom); Edwards, Nicholas P. [Univ. of Manchester (United Kingdom); Wogelius, Roy A. [Univ. of Manchester (United Kingdom); Tumarkin-Deratzian, Allison R. [Temple Univ., Philadelphia, PA (United States); Sellers, William I. [Univ. of Manchester (United Kingdom); van Veelen, Arjen [Univ. of Manchester (United Kingdom); Bergmann, Uwe [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Sokaras, Dimosthenis [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Alonso-Mori, Roberto [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Ignatyev, Konstantin [Diamond Light Source (United Kingdom); Egerton, Victoria M. [Univ. of Manchester (United Kingdom); Manning, Phillip L. [Univ. of Manchester (United Kingdom)

    2014-04-23T23:59:59.000Z

    Current understanding of bone healing and remodelling strategies in vertebrates has traditionally relied on morphological observations through the histological analysis of thin sections. However, chemical analysis may also be used in such interpretations, as different elements are known to be absorbed and used by bone for different physiological purposes such as growth and healing. These chemical signatures are beyond the detection limit of most laboratory-based analytical techniques (e.g. scanning electron microscopy). However, synchrotron rapid scanning–X-ray fluorescence (SRS–XRF) is an elemental mapping technique that uniquely combines high sensitivity (ppm), excellent sample resolution (20–100 ?m) and the ability to scan large specimens (decimetre scale) approximately 3000 times faster than other mapping techniques. Here, we use SRS–XRF combined with microfocus elemental mapping (2–20 ?m) to determine the distribution and concentration of trace elements within pathological and normal bone of both extant and extinct archosaurs (Cathartes aura and Allosaurus fragilis). Results reveal discrete chemical inventories within different bone tissue types and preservation modes. Chemical inventories also revealed detail of histological features not observable in thin section, including fine structures within the interface between pathological and normal bone as well as woven texture within pathological tissue.

  11. Synchrotron imaging reveals bone healing and remodelling strategies in extinct and extant vertebrates

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Anne, Jennifer; Edwards, Nicholas P.; Wogelius, Roy A.; Tumarkin-Deratzian, Allison R.; Sellers, William I.; van Veelen, Arjen; Bergmann, Uwe; Sokaras, Dimosthenis; Alonso-Mori, Roberto; Ignatyev, Konstantin; et al

    2014-04-23T23:59:59.000Z

    Current understanding of bone healing and remodelling strategies in vertebrates has traditionally relied on morphological observations through the histological analysis of thin sections. However, chemical analysis may also be used in such interpretations, as different elements are known to be absorbed and used by bone for different physiological purposes such as growth and healing. These chemical signatures are beyond the detection limit of most laboratory-based analytical techniques (e.g. scanning electron microscopy). However, synchrotron rapid scanning–X-ray fluorescence (SRS–XRF) is an elemental mapping technique that uniquely combines high sensitivity (ppm), excellent sample resolution (20–100 ?m) and the ability to scan large specimensmore »(decimetre scale) approximately 3000 times faster than other mapping techniques. Here, we use SRS–XRF combined with microfocus elemental mapping (2–20 ?m) to determine the distribution and concentration of trace elements within pathological and normal bone of both extant and extinct archosaurs (Cathartes aura and Allosaurus fragilis). Results reveal discrete chemical inventories within different bone tissue types and preservation modes. Chemical inventories also revealed detail of histological features not observable in thin section, including fine structures within the interface between pathological and normal bone as well as woven texture within pathological tissue.« less

  12. Human Cementum Protein 1 induces expression of bone and cementum proteins by human gingival fibroblasts

    SciTech Connect (OSTI)

    Carmona-Rodriguez, Bruno [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Alvarez-Perez, Marco Antonio [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Narayanan, A. Sampath [Department of Pathology, School of Medicine, UW, Seattle (United States); Zeichner-David, Margarita [Center for Craniofacial Molecular Biology, School of Dentistry, USC, Los Angeles (United States); Reyes-Gasga, Jose [Instituto de Fisica, UNAM (Mexico); Molina-Guarneros, Juan [Facultad de Medicina, UNAM (Mexico); Garcia-Hernandez, Ana Lilia [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Suarez-Franco, Jose Luis [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Chavarria, Ivet Gil [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Villarreal-Ramirez, Eduardo [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Arzate, Higinio [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico)]. E-mail: harzate@servidor.unam.mx

    2007-07-06T23:59:59.000Z

    We recently presented evidence showing that a human cementoblastoma-derived protein, named Cementum Protein 1 (CEMP1) may play a role as a local regulator of cementoblast differentiation and cementum-matrix mineralization. This protein was shown to be expressed by cementoblasts and progenitor cells localized in the periodontal ligament. In this study we demonstrate that transfection of CEMP1 into human gingival fibroblasts (HGF) induces mineralization and expression of bone and cementum-matrix proteins. The transfected HGF cells had higher alkaline phosphatase activity and proliferation rate and they expressed genes for alkaline phosphatase, bone sialoprotein, osteocalcin, osteopontin, the transcription factor Runx2/Cbfa1, and cementum attachment protein (CAP). They also produced biological-type hydroxyapatite. These findings indicate that the CEMP1 might participate in differentiation and mineralization of nonosteogenic cells, and that it might have a potential function in cementum and bone formation.

  13. Clinical Assessment of Percutaneous Radiofrequency Ablation for Painful Metastatic Bone Tumors

    SciTech Connect (OSTI)

    Kojima, Hiroyuki, E-mail: kojimah@takii.kmu.ac.jp; Tanigawa, Noboru; Kariya, Shuji; Komemushi, Atsushi; Shomura, Yuzo; Sawada, Satoshi [Kansai Medical University Takii Hospital, Department of Radiology (Japan)

    2006-12-15T23:59:59.000Z

    Purpose. To investigate the pain-alleviating effects of radiofrequency ablation (RFA) on metastatic bone tumors in relation to tumor size, combined therapy, and percent tumor necrosis rate following RFA. Methods. Subjects comprised 24 patients with 28 painful metastatic bone tumors. A 17G internally cooled electrode was inserted into the tumor for CT guidance and ablation was performed. Bone cement was injected following RFA for 4 tumors involving a weight-bearing bone, while 5 tumors were treated using combined RFA and external irradiation. Percent necrosis rate of the tumor was measured using contrast-enhanced computed tomography 1 week after RFA. Results. Improvement in the visual analog scale (VAS) score was 4.6 {+-} 2.2 for large tumors (>5 cm, n = 12), 3.7 {+-} 1.8 for medium-sized tumors (3.1-5.0 cm, n = 11), and 3.5 {+-} 1.7 for small tumors ({<=}3 cm, n = 4), with no significant differences noted among tumor sizes. Improvement in the VAS score was 3.5 {+-} 1.3 for the 4 tumors in the RFA + bone cement group, 3.2 {+-} 1.9 for the 5 tumors in the RFA + radiation therapy group, and 4.8 {+-} 2.2 for the 18 tumors in the RFA group. No significant differences were identified between groups. The improvement in the VAS score was 3.8 {+-} 2.3, 4.0 {+-} 1.9, and 4.7 {+-} 2.6 in patients with tumor necrosis rates of 0-49%, 50-74%, and 75-100%, respectively. No significant association was observed among these three groups. Conclusion. Percutaneous RFA therapy was effective in relieving pain due to metastatic bone tumors. No relationships appear to exist between initial response and tumor size, combined therapy, and percent tumor necrosis.

  14. Development of a three-dimensional in vitro model to study the effect of vitamin D on bone metastatic breast cancer

    E-Print Network [OSTI]

    Li, Danda

    2011-08-31T23:59:59.000Z

    Breast cancer has a high prevalence among women and most patients suffer from metastasis to bone. The mechanisms involved in breast cancer bone metastasis are poorly understood. Three-dimensional (3D) tissue culture systems are becoming a focus...

  15. J Bone Miner Res . Author manuscript Fracture risk prediction using BMD and clinical risk factors in early

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ,651 peri- and early post-menopausal women (mean age (± SD): 54 4 yr) with a mean follow-up period of 13 Density ; Female ; Fractures, Bone ; etiology ; Humans ; Middle Aged ; Osteoporosis, Postmenopausal definition of osteoporosis ( ), i.e. a bone mineral density (BMD) value less than 2.5 standard deviations

  16. Mineral Maturity and Crystallinity Index Are Distinct Characteristics of Bone D. Farlay, G. Panczer, C. Rey, P. D. Delmas

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Mineral Maturity and Crystallinity Index Are Distinct Characteristics of Bone Mineral D. Farlay, G in "Journal of Bone and Mineral Metabolism 2010;28(4):433-45" DOI : 10.1007/s00774-009-0146-7 #12;Abstract The purpose of this study was to test the hypothesis that mineral maturity and crystallinity index are two

  17. Wavelet based characterization of ex vivo vertebral trabecular bone structure with 3T MRI compared to microCT

    SciTech Connect (OSTI)

    Krug, R; Carballido-Gamio, J; Burghardt, A; Haase, S; Sedat, J W; Moss, W C; Majumdar, S

    2005-04-11T23:59:59.000Z

    Trabecular bone structure and bone density contribute to the strength of bone and are important in the study of osteoporosis. Wavelets are a powerful tool to characterize and quantify texture in an image. In this study the thickness of trabecular bone was analyzed in 8 cylindrical cores of the vertebral spine. Images were obtained from 3 Tesla (T) magnetic resonance imaging (MRI) and micro-computed tomography ({micro}CT). Results from the wavelet based analysis of trabecular bone were compared with standard two-dimensional structural parameters (analogous to bone histomorphometry) obtained using mean intercept length (MR images) and direct 3D distance transformation methods ({micro}CT images). Additionally, the bone volume fraction was determined from MR images. We conclude that the wavelet based analyses delivers comparable results to the established MR histomorphometric measurements. The average deviation in trabecular thickness was less than one pixel size between the wavelet and the standard approach for both MR and {micro}CT analysis. Since the wavelet based method is less sensitive to image noise, we see an advantage of wavelet analysis of trabecular bone for MR imaging when going to higher resolution.

  18. Revised estimates of electron absorbed fractions and radionuclide S-values in trabecular bone

    E-Print Network [OSTI]

    Parry, Robert Alan

    1995-01-01T23:59:59.000Z

    of trabecular bone in the skeleton. (Adapted from ICRP 1975). 45 Table 5. 3. Relative weights of dry bones as percentages of total skeleton. (Adapted from ICRP 1975), 45 Table 5. 4. Fractional distribution of red marrow in the skeleton. (Adapted from ICRP... Table 6. 3. Average and maximum beta-particle energy for selected radionuclides. 69 Table 6. 4. S-values for sources in the marrow (in mGy'A4Bq 's '). Target: Marrow 7l Table 6. 5. S-values for sources in the marrow (in mGyMBq 's ') Target...

  19. Dynamic T{sub 2}-mapping during magnetic resonance guided high intensity focused ultrasound ablation of bone marrow

    SciTech Connect (OSTI)

    Waspe, Adam C.; Looi, Thomas; Mougenot, Charles; Amaral, Joao; Temple, Michael; Sivaloganathan, Siv; Drake, James M. [Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada); Philips Healthcare Canada, Markham, ON, L6C 2S3 (Canada); Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada); Department of Applied Mathematics, University of Waterloo, Waterloo, ON, N2L 3G1 (Canada); Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada)

    2012-11-28T23:59:59.000Z

    Focal bone tumor treatments include amputation, limb-sparing surgical excision with bone reconstruction, and high-dose external-beam radiation therapy. Magnetic resonance guided high intensity focused ultrasound (MR-HIFU) is an effective non-invasive thermotherapy for palliative management of bone metastases pain. MR thermometry (MRT) measures the proton resonance frequency shift (PRFS) of water molecules and produces accurate (<1 Degree-Sign C) and dynamic (<5s) thermal maps in soft tissues. PRFS-MRT is ineffective in fatty tissues such as yellow bone marrow and, since accurate temperature measurements are required in the bone to ensure adequate thermal dose, MR-HIFU is not indicated for primary bone tumor treatments. Magnetic relaxation times are sensitive to lipid temperature and we hypothesize that bone marrow temperature can be determined accurately by measuring changes in T{sub 2}, since T{sub 2} increases linearly in fat during heating. T{sub 2}-mapping using dual echo times during a dynamic turbo spin-echo pulse sequence enabled rapid measurement of T{sub 2}. Calibration of T{sub 2}-based thermal maps involved heating the marrow in a bovine femur and simultaneously measuring T{sub 2} and temperature with a thermocouple. A positive T{sub 2} temperature dependence in bone marrow of 20 ms/ Degree-Sign C was observed. Dynamic T{sub 2}-mapping should enable accurate temperature monitoring during MR-HIFU treatment of bone marrow and shows promise for improving the safety and reducing the invasiveness of pediatric bone tumor treatments.

  20. DU145 human prostate cancer cells express functional Receptor Activator of NF-B: New insights in the prostate cancer bone metastasis process.

    E-Print Network [OSTI]

    Boyer, Edmond

    in the prostate cancer bone metastasis process. Mori K.1, 2, * , Le Goff B. 1, 2 , Charrier C. 1, 2 , Battaglia S cells, thus facilitating prostate cancer metastasis development in bone. We confirm that RANKL is a factor that facilitates metastasis to bone by acting as an activator of both osteoclasts and RANK

  1. IBMS BoneKEy. 2009 April;6(4):132-149 http://www.bonekey-ibms.org/cgi/content/full/ibmske;6/4/132

    E-Print Network [OSTI]

    and osteoporosis, yet uniquely ­ without targeting the resident fat or bone cell. IBMS BoneKEy. 2009 April;6(4):132-149. ©2009 International Bone & Mineral Society Introduction Osteoporosis and obesity, two of the most billion dollars in annual health service costs. (1) Osteoporosis, a disease characterized by diminished

  2. APPLICATIONS OF ALGEBRAIC MULTIGRID TO LARGE-SCALE FINITE ELEMENT ANALYSIS OF WHOLE BONE MICRO-MECHANICS ON THE IBM SP

    E-Print Network [OSTI]

    California at Berkeley, University of

    APPLICATIONS OF ALGEBRAIC MULTIGRID TO LARGE-SCALE FINITE ELEMENT ANALYSIS OF WHOLE BONE MICRO,5 Abstract. Accurate micro-finite element analyses of whole bones require the solution of large sets architectures. Key words. multigrid, trabecular bone, human vertebral body, finite element method, massively

  3. School of Architecture, Design and the Built Environment Project Title: Artificial bone for prosthetic hip joints

    E-Print Network [OSTI]

    Evans, Paul

    formation by the Additive Manufacturing (AM) direct printing process. The artificial bone must and the development of new additive manufacturing techniques for medical devices. The group has active links and structural gradients into the prosthesis. It is envisioned this could involve the use of additively

  4. Nonlinear resonant ultrasound spectroscopy (NRUS) applied to damage assessment in bone

    E-Print Network [OSTI]

    Alamos National Laboratory of the University of California, Los Alamos, New Mexico 87545 Received 25 May NRUS is a resonance-based technique exploiting the significant nonlinear behavior of damaged materials obtained through the measurement of bone mineral density BMD obtained from x-ray densitometric techniques.1

  5. In vitro analysis of biodegradable polymer blend/hydroxyapatite composites for bone

    E-Print Network [OSTI]

    Weiss, Lee E.

    In vitro analysis of biodegradable polymer blend/hydroxyapatite composites for bone tissue engineering Kacey G. Marra,1 Jeffrey W. Szem,2 Prashant N. Kumta,3 Paul A. DiMilla,4 Lee E. Weiss5 1 14 April 1999 Abstract: Blends of biodegradable polymers, poly(capro- lactone) and poly

  6. Estimated number of women likely to benefit from bone mineral density measurement in France

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ; Menopause Introduction The prevalence of osteoporosis is rising, most notably in postmenopausal women years of age with risk factors for osteoporosis likely to lead to bone mineral density measurement, an investigation reimbursed by the French national health insurance system in patients at risk for osteoporosis

  7. Differential Maintenance of Cortical and Cancellous Bone Strength Following Discontinuation of

    E-Print Network [OSTI]

    Ritchie, Robert

    and with combination of osteoporosis medications are needed to improve our treatment of osteoporosis. ß 2011 American; RALOXIFENE Introduction A number of drugs offer some protection against post- menopausal bone loss and nonvertebral fractures in postmenopausal osteoporosis.(3) While bisphosphonates such as ALN may accumulate

  8. Feeding Bone Meal to Range Cattle on the Coastal Plains of Texas : Preliminary Report.

    E-Print Network [OSTI]

    Schmidt, H.

    1926-01-01T23:59:59.000Z

    TO RANGE CATTLE 15 Ullllt deca espc T : (Figure 4), or a piece of old hide that has not yet completely yed. Occasionally an animal may be seen licking on the partially ~sed bones of a foul-smelling carcass. he facts related above have probably been...

  9. 1174 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 53, NO. 6, JUNE 2006 Microwave Drilling of Bones

    E-Print Network [OSTI]

    Gefen, Amit

    1174 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 53, NO. 6, JUNE 2006 Microwave Drilling*, Member, IEEE Abstract--This paper presents a feasibility study of drilling in fresh wet bone tissue in vitro using the microwave drill method [Jerby et al., 2002], toward testing its applicability

  10. 3D Reconstruction of the Femoral Bone using two X-ray Images from Orthogonal Views

    E-Print Network [OSTI]

    3D Reconstruction of the Femoral Bone using two X-ray Images from Orthogonal Views B. Nikkhahe of the femur and 97 % of the model femur shaft less than 2 mm from the CT scan. Also the femoral head visualization of the femur including the femoral collumn and condyles is important for the clinician in a number

  11. Changes in bone morphology and composition following long-term alcohol consumption

    E-Print Network [OSTI]

    Hebert, Valerie Anne

    1998-01-01T23:59:59.000Z

    The objective of this study is to determine the effect ics. of long-term alcohol consumption on bone morphology and composition. Female Sprague-Dawley rats were fed one of three diets (alcohol, pair-fed, or chow) for 18 months. The rats were...

  12. Bone ingrowth in a shoulder prosthesis E.M.van Aken

    E-Print Network [OSTI]

    Vuik, Kees

    Bone ingrowth in a shoulder prosthesis E.M.van Aken 1107895 emvanaken@hotmail.com Delft, 2006 and to relief the pain, a prosthesis to replace the glenoid of the shoulder joint is an option. The shoulder. The prosthesis, often made of stainless steal combined with polyethylene, re- #12;4 places this glenoid cavity

  13. A method for calibration of bone driver transducers to measure the mastoid Reggie Weece a

    E-Print Network [OSTI]

    Allen, Jont

    2010 Available online xxxx a b s t r a c t When using bone vibrator transducers for clinical a circuit model of the driver, describing it with three frequency-dependent parameters. Once these three circuit model is proposed to better capture the observed behaviors. Ã? 2010 Published by Elsevier B.V. 1

  14. The consequence of late-onset alcohol abuse in aged bone: a histomorhometric analysis

    E-Print Network [OSTI]

    Barker, Lisa Setchfield

    2000-01-01T23:59:59.000Z

    The objective of this experiment was to examine the effect of late-onset alcohol abuse on aged bone using the rat model. Thirty female Fischer 344 rats were separated by weights into one of four groups: baseline, alcohol-fed, pair-fed, and pellet...

  15. Calcium balance and bone density in immature horses fed a high protein diet 

    E-Print Network [OSTI]

    Spooner, Holly Sue

    2006-10-30T23:59:59.000Z

    is easy and non-invasive, the variability among horses is quite high, and thus it is best used for observations of changes in bone density over time for a specific animal. Computer assisted tomography (CAT scan) and dual energy x-ray 7...

  16. From a Dry Bone to a Genetic Portrait: A Case Study of Sickle Cell Anemia

    E-Print Network [OSTI]

    From a Dry Bone to a Genetic Portrait: A Case Study of Sickle Cell Anemia MARINA FAERMAN,1* ALMUT identification; Y chromosome polymorphic markers; sickle cell anemia ABSTRACT The potential and reliability sample, which represented a documented case of sickle cell anemia. -globin gene sequences obtained from

  17. Correlation of mechanical viscoelastic properties to microstructure of equine cortical bone tissue

    E-Print Network [OSTI]

    Ayers, Andrew Kerr

    1995-01-01T23:59:59.000Z

    , there is a fair amount of subjectivity that is involved when deciding borderline grid points The current investigation used a diff'erent method in which an image analysis program, Optimas 4 2, is used to threshold the image of the bone In this procedure...

  18. Microfluidic purification and analysis of hematopoietic stem cells from bone Romana Schirhagl,a

    E-Print Network [OSTI]

    Zare, Richard N.

    Microfluidic purification and analysis of hematopoietic stem cells from bone marrow Romana to separate them from a whole-marrow sample. A microfluidic device was fabricated using an integrated membrane are restricted by the limited availability of stem cell sources.2,3 We believe that microfluidics can be used

  19. BONE DENSITOMETRY IN PEDIATRIC POPULATIONS: DISCREPANCIES IN THE DIAGNOSIS OF OSTEOPOROSIS BY DXA AND CT

    E-Print Network [OSTI]

    Valero-Cuevas, Francisco

    BONE DENSITOMETRY IN PEDIATRIC POPULATIONS: DISCREPANCIES IN THE DIAGNOSIS OF OSTEOPOROSIS BY DXA, osteoporosis is frequently overdiagnosed in children when using dual-energy x-ray absorptiometry (DXA osteoporosis in pediatric populations. (J Pediatr 2005;146:776-9) D ual-energy x-ray absorptiometry (DXA

  20. On Smoothing Surfaces in Voxel Based Finite Element Analysis of Trabecular Bone

    E-Print Network [OSTI]

    Frey, Pascal

    On Smoothing Surfaces in Voxel Based Finite Element Analysis of Trabecular Bone Peter Arbenz on complicated domains composed of often hundreds of millions of voxel elements. The finite element analysis finite element (FE) analysis. The approach based on the FE analysis leads to linear systems of equations

  1. Sex Differences in Long Bone Fatigue Using a Rat Model Luisa D. Moreno,1

    E-Print Network [OSTI]

    Waldman, Stephen D.

    response to fatigue, we also determined the creep that occurred during the fatigue test. From the creep progress (Fig. 1). Caler and Carter32 studied cortical bone creep behavior during fatigue testing. When adaptation. From these results, we hypothesized that creep was the underlying mechanism that accounted

  2. Metabolic modeling for the deposition of transuranic nuclides on bone surfaces

    E-Print Network [OSTI]

    Halter, Donald Anthony

    1997-01-01T23:59:59.000Z

    to recalculate integrated activity over fifty years, U, values, as a function of intake for use in dose calculations for plutonium deposit on bone surfaces. These values were compared with those in ICRP-30 and showed a substantial decrease in the estimated dose...

  3. Mitigating Disuse Bone Loss: Role of Resistance Exercise and Beta-Adrenergic Signaling 

    E-Print Network [OSTI]

    Swift, Joshua Michael

    2011-08-08T23:59:59.000Z

    . Recent data gathered from crew members on the International Space Station (ISS) illustrates the significant losses of bone mineral density (BMD) and geometry of the femoral neck (15). Dual-energy x-ray absorptiometry (DXA) and QCT scans were taken...

  4. Changes in bone morphology and composition following long-term alcohol consumption 

    E-Print Network [OSTI]

    Hebert, Valerie Anne

    1998-01-01T23:59:59.000Z

    The objective of this study is to determine the effect ics. of long-term alcohol consumption on bone morphology and composition. Female Sprague-Dawley rats were fed one of three diets (alcohol, pair-fed, or chow) for 18 ...

  5. A 3D Statistical Shape Model Of The Pelvic Bone For Segmentation

    E-Print Network [OSTI]

    Andrzejak, Artur

    patient models from 3D image data. Within the setting of a hybrid system (applicator plus MR tomograph. Left: hybrid system (MRT plus applicator), Right: MRT slice image from the abdomen with pelvic bone. 1 on heating up affected tissue compartments to temperatures above 42 degree Celsius without damaging

  6. Lung cancer-derived Dickkopf1 is associated with bone metastasis and the mechanism involves the inhibition of osteoblast differentiation

    SciTech Connect (OSTI)

    Chu, Tianqing; Teng, Jiajun; Jiang, Liyan; Zhong, Hua; Han, Baohui, E-mail: baohuihan1@163.com

    2014-01-17T23:59:59.000Z

    Highlights: •DKK1 level was associated with NSCLC bone metastases. •Lung tumor cells derived DKK1 inhibited osteoblast differentiation. •Lung tumor cells derived DKK1 modulates ?-catenin and RUNX2. -- Abstract: Wnt/?-catenin signaling and Dickkopf1 (DKK1) play important roles in the progression of lung cancer, which preferably metastasizes to skeleton. But the role of them in bone dissemination is poorly understood. This study aims to define the role of DKK1 in lung cancer bone metastases and investigate the underlying mechanism. Our results demonstrated that DKK1 over-expression was a frequent event in non-small-cell lung cancer (NSCLC) blood samples, and serous DKK1 level was much higher in bone metastatic NSCLC compared to non-bone metastatic NSCLC. We also found that conditioned medium from DKK1 over-expressing lung cancer cells inhibited the differentiation of osteoblast, determined by alkaline phosphatase activity and osteocalcin secretion, whereas the conditioned medium from DKK1 silencing lung cancer cells exhibited the opposite effects. Mechanistically, DKK1 reduced the level of ?-catenin and RUNX2, as well as inhibiting the nuclear translocation of ?-catenin. Taken together, these results suggested that lung cancer-produced DKK1 may be an important mechanistic link between NSCLC and bone metastases, and targeting DKK1 may be an effective method to treat bone metastase of NSCLC.

  7. Adult equine bone-marrow stromal cells produce a cartilage-like ECM superior to animal-matched adult chondrocytes

    E-Print Network [OSTI]

    Kisiday, John D.

    Our objective was to evaluate the age-dependent mechanical phenotype of bone marrow stromal cell- (BMSC-) and chondrocyte-produced cartilage-like neo-tissue and to elucidate the matrix-associated mechanisms which generate ...

  8. Rational design to control multipotent stromal cell migration for applications in bone tissue engineering and injury repair

    E-Print Network [OSTI]

    Wu, Shan, Ph. D. Massachusetts Institute of Technology

    2011-01-01T23:59:59.000Z

    Multipotent stromal cells derived from bone marrow hold great potential for tissue engineering applications because of their ability to home to injury sites and to differentiate along mesodermal lineages to become osteocytes, ...

  9. Regional geologic characterization of the Second Bone Spring Sandstone, Delaware basin, Lea and Eddy Counties, New Mexico

    E-Print Network [OSTI]

    Downing, Amanda Beth

    2001-01-01T23:59:59.000Z

    The Bone Spring Formation is a series of interbedded siliciclastics and carbonates that were deposited in the Delaware basin during the Leonardian (Early Permian). It consists of the First, Second and Third Carbonate and the First, Second and Third...

  10. Adaptations of Trabecular Bone to Low Magnitude Vibrations Result in More Uniform Stress and Strain Under Load

    E-Print Network [OSTI]

    magnitude mechanical stimuli 10 microstrain induced at high frequencies are anabolic to trabe- cular bone strain or stress , the resultant stresses and strains within trabe- culae were more uniformly distributed

  11. Gary M. Bone, Andrew Lambert and Mark Edwards Abstract This paper describes the development of a novel

    E-Print Network [OSTI]

    Bone, Gary

    Gary M. Bone, Andrew Lambert and Mark Edwards Abstract ­ This paper describes the development from the top of a pile was described by Taylor, Blake and Cox [3]. They used a wrist-mounted camera

  12. Effect of dietary calcium and phosphorus levels on performance and bone development of large-framed developing boars

    E-Print Network [OSTI]

    Robinson, Robert Glen

    1975-01-01T23:59:59.000Z

    in determining bone strength. His expertise and willingness to help on short notice many times under adverse conditions will always be remembered. Special recognition is also due and gratefully given to personal friends Darrell Knabe and Edward Gregg...

  13. Potential commercial application of a bi-layer bone-ligament regeneration scaffold to anterior cruciate ligament replacement

    E-Print Network [OSTI]

    Li, Jessica C. (Jessica Ching-Yi)

    2006-01-01T23:59:59.000Z

    A business model was created in order to explore the commercial application of a bi-layer bone-ligament scaffold to the treatment of torn anterior cruciate ligaments (ACL) requiring replacement. The two main keys in producing ...

  14. Intra-arterial Autologous Bone Marrow Cell Transplantation in a Patient with Upper-extremity Critical Limb Ischemia

    SciTech Connect (OSTI)

    Madaric, Juraj, E-mail: jurmad@hotmail.com [National Institute of Cardiovascular Diseases (NUSCH) and Slovak Medical University, Department of Cardiology and Angiology (Slovakia)] [National Institute of Cardiovascular Diseases (NUSCH) and Slovak Medical University, Department of Cardiology and Angiology (Slovakia); Klepanec, Andrej [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)] [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia); Mistrik, Martin [Clinic of Hematology and Transfusiology, Faculty Hospital (Slovakia)] [Clinic of Hematology and Transfusiology, Faculty Hospital (Slovakia); Altaner, Cestmir [Slovak Academy of Science, Institute of Experimental Oncology (Slovakia)] [Slovak Academy of Science, Institute of Experimental Oncology (Slovakia); Vulev, Ivan [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)] [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)

    2013-04-15T23:59:59.000Z

    Induction of therapeutic angiogenesis by autologous bone marrow mononuclear cell transplantation has been identified as a potential new option in patients with advanced lower-limb ischemia. There is little evidence of the benefit of intra-arterial cell application in upper-limb critical ischemia. We describe a patient with upper-extremity critical limb ischemia with digital gangrene resulting from hypothenar hammer syndrome successfully treated by intra-arterial autologous bone marrow mononuclear cell transplantation.

  15. Characterization of host lymphoid cells in antibody-facilitated bone marrow chimeras

    SciTech Connect (OSTI)

    McCarthy, S.A.; Griffith, I.J.; Gambel, P.; Francescutti, L.H.; Wegmann, T.G.

    1985-07-01T23:59:59.000Z

    The authors have produced stable murine antibody-facilitated (AF) chimeras by the simultaneous injection of P1 bone marrow cells and anti-P2 monoclonal antibody into normal (unirradiated) adult (P1 X P2)F1 recipients. These AF chimeras are healthy, long-lived, and exhibit no overt signs of graft-versus-host disease. They are immunocompetent and tolerant of host, P2-encoded alloantigens. Donor cell engraftment and takeover, monitored by glucosephosphate isomerase isozyme patterns, is usually complete (greater than 95%) in the peripheral blood, bone marrow, and hemopoietic stem cell compartments of long-term (greater than 3 months posttransplantation) AF chimeras. The authors report here, however, that splenic, lymph node, and thymic leukocytes of AF chimeras represent donor/host chimeric populations. Spleen cell populations of AF chimeras exhibit substantial chimera-to-chimera variation in the preponderant residual host cell type(s) present. Interpretations of the implications of these findings are discussed.

  16. Evaluation of Radiation Dose Effects on Rat Bones Using Synchrotron Radiation Computed Microtomography

    SciTech Connect (OSTI)

    Nogueira, Liebert Parreiras; Braz, Delson [Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Barroso, Regina Cely [Physics Institute / State University of Rio de Janeiro, 20550-900, Rio de Janeiro (Brazil); Almeida, Carlos Eduardo de; Andrade, Cherley Borba [Laboratory of Radiological Sciences / State University of Rio de Janeiro, Rio de Janeiro (Brazil); Tromba, Giuliana [Sincrotrone Trieste SCpA, Strada Statale S.S. 14 km 163.5, 34012 Basovizza, Trieste (Italy)

    2011-12-13T23:59:59.000Z

    In this work, we investigated the consequences of irradiation in the femora and ribs of rats submitted to radiation doses of 5 Gy. Three different sites in femur specimens (head, distal metaphysis and distal epiphysis) and one in ribs (ventral) were imaged using synchrotron radiation microcomputed tomography to assess trabecular bone microarchitecture. Histomorphometric quantification was calculated directly from the 3D microtomographic images using synchrotron radiation. The 3D microtomographic images were obtained at the SYRMEP (SYnchrotron Radiation for MEdical Physics) beamline at the Elettra Synchrotron Laboratory in Trieste, Italy. A better understanding of the biological interactions that occur after exposure to photon radiation is needed in order to optimize therapeutic regimens and facilitate development and strategies that decrease radiation-induced side effects in humans. Results showed significant differences between irradiated and non-irradiated specimens, mostly in head and distal metaphysis bone sites.

  17. Treatment of Extraspinal Painful Bone Metastases with Percutaneous Cementoplasty: A Prospective Study of 50 Patients

    SciTech Connect (OSTI)

    Anselmetti, Giovanni Carlo, E-mail: giovanni.anselmetti@ircc.it; Manca, Antonio [Institute for Cancer Research and Treatment, Interventional Radiology Unit (Italy); Ortega, Cinzia; Grignani, Giovanni [Institute for Cancer Research and Treatment, Oncology Unit (Italy); DeBernardi, Felicino [Institute for Cancer Research and Treatment, Anesthesiology Unit (Italy); Regge, Daniele [Institute for Cancer Research and Treatment, Radiology Unit (Italy)

    2008-11-15T23:59:59.000Z

    The aim of this study was to assess the efficacy of percutaneous cementoplasty (PC) with polymethylmethacrylate (PMMA) in painful extravertebral lytic bone metastases not responding to conventional therapy. Fifty patients (25 females), mean age 64.7 {+-} 11.2 years, underwent PC after giving informed consent. Procedures were performed under fluoroscopy (1/50) or combined fluoroscopy-CT (49/50) guidance in local anesthesia or under deep sedation in 7 patients with large metastases who underwent radiofrequency thermoablation (RFA) in the same session. Seventy lesions were treated (1-6 per patient; average, 1.4 {+-} 0.9), arranging in size from 1 to 10 cm (average, 3.6 {+-} 2.1 cm). Mean volume of PMMA per lesion was 5.9 {+-} 3.2 ml (range, 1.5-15.0 ml). Pain was prospectively evaluated on an 11-point visual analog scale (VAS) before and after the procedure (follow-up, 15 to 36 months). Mean VAS score dropped from 9.1 {+-} 1.2 (range: 6-10) to 2.1 {+-} 2.5 (range: 0-9). Mean VAS difference was 7.0 {+-} 2.3 (range, 1-10; p < 0.0001, Wilcoxon signed rank test). Forty-seven of the 50 patients (94%) suspended narcotic drugs, in 22 (44%) pain was controlled with a nonsteroidal anti-inflammatory drug, in 25 (50%) analgesic therapy was suspended, and 13 of 50 (26%) had complete pain regression. In 3 of the 50 patients (6%) pain was not improved. No statistical difference between osteoplasty and osteoplasty plus RFA was found (p = 0.8338, Mann-Whitney test). No complications arose during the procedure. Two patients with metastases in the femoral diaphysis reported a fracture 1 month after treatment. PC is effective to obtain pain regression in painful bone metastases not responding to conventional analgesic therapy; bone consolidation cannot be obtained in the diaphysis of long weight-bearing bones.

  18. Bone Implant Interface Investigation by Synchrotron Radiation X-Ray Microfluorescence

    SciTech Connect (OSTI)

    Calasans-Maia, M. [Odondology Department, Fluminense Federal Univeristy, Niteroi 24030-900, RJ (Brazil); Sales, E.; Lopes, R. T. [Nuclear Instrumentation Laboratory-PEN/COPPE, Federal Univeristy of Rio de Janeiro, Rio de Janeiro 21941-914, RJ (Brazil); Granjeiro, J. M. [Department of Cell and Molecular Biology, Fluminense Federal University, Niteroi 24030-900, RJ (Brazil); Lima, I. [Odondology Department, Fluminense Federal Univeristy, Niteroi 24030-900, RJ (Brazil); Department of Mechanical Engineering and Energy, Rio de Janeiro State University, Regional Campus-Polytechnic Institute-Alberto Rangel, s/n, Vila Nova, room 308, 28630-050, Nova Friburgo, RJ (Brazil)

    2010-04-06T23:59:59.000Z

    Zinc is known to play a relevant role in growth and development; it has stimulatory effects on in vitro and in vivo bone formation and an inhibitory effect on in vitro osteoclastic bone resorption. The inorganic component of the bone tissue is nonstoichiometric apatite; changes in the composition of hidroxyapatite are subject of studies in order to improve the tissue response after implantation. The objective of this study was to investigate the effect of 0.5% zinc-containing hydroxyapatite in comparison to hydroxyapatite on osseous repair of rabbit's tibia. Cylinders (2x6 mm) of both materials were produced according to the specification of the International Organization for Standardization. Ethics Commission on Teaching and Research in Animals approved this project (HUAP-195/06). Fifteen White New Zealand rabbits were submitted to general anesthesia and two perforations (2 mm) were made in each tibia for implantation of zinc-containing hydroxyapatite cylinders (left tibia) and hydroxyapatite cylinders (right tibia). After 1, 2 and 4 weeks, the animals were killed and one fragment of each tibia with the cylinder was collected and embedded in a methacrylate-based resin and cut into slices (approx200 {mu}m thickness), parallel to the implant's long axis with a precision diamond saw for Synchrotron Radiation X-ray Microfluorescence investigation. The accomplishment of the standard procedures helped the planning, execution and the comparative analysis of the results. The chemical and physical properties of the biomaterials were modified after its implantation and the incorporation of zinc. Both materials are biocompatible and promote osteoconduction and favored bone repair.

  19. The Relation of Lime and Phosphoric Acid to the Growth and Bone Development of White Rats.

    E-Print Network [OSTI]

    Blum, J. K. (Joseph Kelly)

    1931-01-01T23:59:59.000Z

    LIBRARY, A & M COLLEGE. CAMPUS. TEXAS AGRICULTURAL EXPERIMENT STATION A. B. CONNER, DIRECTOR College Station, Brazos County, Texas BULLETIN NO. 441 DECEMBER, 1931 DIVISION OF CHEMISTRY The Relation of Lime and Phosphoric Acid to the Growth... and Bone Development of White Rats 2 ., .t .I* .-. /.' AGRICULTURAL AND MECHANICAL COLLEGE OF TEXAS--. .. T. 0. WALTON, President ..- STATION STAFF+ ADMINISTRATION: VETERINARY SCIENCE: A B. CONNER M S. Director *M. FRANCIS, D. V. M., Chief. R: E...

  20. Automatic detection of bone fragments in poultry using multi-energy x-rays

    DOE Patents [OSTI]

    Gleason, Shaun S. (Knoxville, TN); Paulus, Michael J. (Knoxville, TN); Mullens, James A. (Knoxville, TN)

    2002-04-09T23:59:59.000Z

    At least two linear arrays of x-ray detectors are placed below a conveyor belt in a poultry processing plant. Multiple-energy x-ray sources illuminate the poultry and are detected by the detectors. Laser profilometry is used to measure the poultry thickness as the x-ray data is acquired. The detector readout is processed in real time to detect the presence of small highly attenuating fragments in the poultry, i.e., bone, metal, and cartilage.

  1. Functional Interference Clusters in Cancer Patients With Bone Metastases: A Secondary Analysis of RTOG 9714

    SciTech Connect (OSTI)

    Chow, Edward, E-mail: Edward.Chow@sunnybrook.c [Odette Cancer Centre, Toronto, ON (Canada); James, Jennifer [RTOG Statistical Center, Philadelphia, PA (United States); Barsevick, Andrea [Fox Chase Cancer Center, Cheltenham, PA (United States); Hartsell, William [Good Samaritan Cancer Center, Downers Grove, IL (United States); Ratcliffe, Sarah [University of Pennsylvania School of Medicine, Philadelphia, PA (United States); Scarantino, Charles [Rex Healthcare Cancer Center, Raleigh, NC (United States); Ivker, Robert [Newark Beth Israel Medical Center, Newark, NJ (Israel); Roach, Mack [UCSF Comprehensive Cancer Center, San Francisco, CA (United States); Suh, John [Cleveland Clinic Foundation, Cleveland, OH (United States); Petersen, Ivy [Mayo Clinic, Rochester, MN (United States); Konski, Andre [Fox Chase Cancer Center, Cheltenham, PA (United States); Demas, William [Akron City Hospital Cancer Care Center, Inc., Akron, OH (United States); Bruner, Deborah [Abramson Cancer Center, Philadelphia, PA (United States)

    2010-04-15T23:59:59.000Z

    Purpose: To explore the relationships (clusters) among the functional interference items in the Brief Pain Inventory (BPI) in patients with bone metastases. Methods: Patients enrolled in the Radiation Therapy Oncology Group (RTOG) 9714 bone metastases study were eligible. Patients were assessed at baseline and 4, 8, and 12 weeks after randomization for the palliative radiotherapy with the BPI, which consists of seven functional items: general activity, mood, walking ability, normal work, relations with others, sleep, and enjoyment of life. Principal component analysis with varimax rotation was used to determine the clusters between the functional items at baseline and the follow-up. Cronbach's alpha was used to determine the consistency and reliability of each cluster at baseline and follow-up. Results: There were 448 male and 461 female patients, with a median age of 67 years. There were two functional interference clusters at baseline, which accounted for 71% of the total variance. The first cluster (physical interference) included normal work and walking ability, which accounted for 58% of the total variance. The second cluster (psychosocial interference) included relations with others and sleep, which accounted for 13% of the total variance. The Cronbach's alpha statistics were 0.83 and 0.80, respectively. The functional clusters changed at week 12 in responders but persisted through week 12 in nonresponders. Conclusion: Palliative radiotherapy is effective in reducing bone pain. Functional interference component clusters exist in patients treated for bone metastases. These clusters changed over time in this study, possibly attributable to treatment. Further research is needed to examine these effects.

  2. An experimental study of diffusional properties of small ions and nonelectrolytes in compact bone 

    E-Print Network [OSTI]

    Bilge, Huseyin Fertac

    1978-01-01T23:59:59.000Z

    in mineralized tissue is lacking, and no direct measurement of the diffusion coefficient in bone has been reported. RESEARCH OBJECTIVES The overall objective of this investigation was to experimentally determine selected passive mass transport properties... The objective of the research reported was tn determine the diffu- sion coefficients of Na , urea, and glucose and permeability of water through compact hone. The methodology used involved construction of diffusion cells for controlled diffusion...

  3. Growth and bone development in weanling quarter horses fed diets supplemented with sodium zeolite-A

    E-Print Network [OSTI]

    Frey, Kimberly Suzanne

    1991-01-01T23:59:59.000Z

    ) possibly due to SZA's high ion-exchange capabilities (Roland, 1985; Miles, 1986); however, natural zeolites have not been shown to improve egg shell quality especially in diets low in calcium (Nakaue and Koelliker, 1981). This could be due...GROWTH AND BONE DEVELOPMENT IN WEANLING QUARTER HORSES FED DIETS SUPPLEMENTED WITH SODIUM ZEOLITE-A A Thesis by KIMBERLY SUZANNE FREY Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment...

  4. Immunization with FSH? fusion protein antigen prevents bone loss in a rat ovariectomy-induced osteoporosis model

    SciTech Connect (OSTI)

    Geng, Wenxin; Yan, Xingrong; Du, Huicong; Cui, Jihong; Li, Liwen, E-mail: liven@nwu.edu.cn; Chen, Fulin, E-mail: chenfl@nwu.edu.cn

    2013-05-03T23:59:59.000Z

    Highlights: •A GST-FSH fusion protein was successfully expressed in E. coli. •Immunization with GST-FSH antigen can raise high-titer anti-FSH polyclonal sera. •Anti-FSH polyclonal sera can neutralize osteoclastogenic effect of FSH in vitro. •FSH immunization can prevent bone loss in a rat osteoporosis model. -- Abstract: Osteoporosis, a metabolic bone disease, threatens postmenopausal women globally. Hormone replacement therapy (HTR), especially estrogen replacement therapy (ERT), is used widely in the clinic because it has been generally accepted that postmenopausal osteoporosis is caused by estrogen deficiency. However, hypogonadal ? and ? estrogen receptor null mice were only mildly osteopenic, and mice with either receptor deleted had normal bone mass, indicating that estrogen may not be the only mediator that induces osteoporosis. Recently, follicle-stimulating hormone (FSH), the serum concentration of which increases from the very beginning of menopause, has been found to play a key role in postmenopausal osteoporosis by promoting osteoclastogenesis. In this article, we confirmed that exogenous FSH can enhance osteoclast differentiation in vitro and that this effect can be neutralized by either an anti-FSH monoclonal antibody or anti-FSH polyclonal sera raised by immunizing animals with a recombinant GST-FSH? fusion protein antigen. Moreover, immunizing ovariectomized rats with the GST-FSH? antigen does significantly prevent trabecular bone loss and thereby enhance the bone strength, indicating that a FSH-based vaccine may be a promising therapeutic strategy to slow down bone loss in postmenopausal women.

  5. Age-related changes in the plasticity and toughness of human cortical bone at multiple length-scales

    SciTech Connect (OSTI)

    Zimmermann, Elizabeth A.; Schaible, Eric; Bale, Hrishikesh; Barth, Holly D.; Tang, Simon Y.; Reichert, Peter; Busse, Bjoern; Alliston, Tamara; Ager III, Joel W.; Ritchie, Robert O.

    2011-08-10T23:59:59.000Z

    The structure of human cortical bone evolves over multiple length-scales from its basic constituents of collagen and hydroxyapatite at the nanoscale to osteonal structures at nearmillimeter dimensions, which all provide the basis for its mechanical properties. To resist fracture, bone’s toughness is derived intrinsically through plasticity (e.g., fibrillar sliding) at structural-scales typically below a micron and extrinsically (i.e., during crack growth) through mechanisms (e.g., crack deflection/bridging) generated at larger structural-scales. Biological factors such as aging lead to a markedly increased fracture risk, which is often associated with an age-related loss in bone mass (bone quantity). However, we find that age-related structural changes can significantly degrade the fracture resistance (bone quality) over multiple lengthscales. Using in situ small-/wide-angle x-ray scattering/diffraction to characterize sub-micron structural changes and synchrotron x-ray computed tomography and in situ fracture-toughness measurements in the scanning electron microscope to characterize effects at micron-scales, we show how these age-related structural changes at differing size-scales degrade both the intrinsic and extrinsic toughness of bone. Specifically, we attribute the loss in toughness to increased non-enzymatic collagen cross-linking which suppresses plasticity at nanoscale dimensions and to an increased osteonal density which limits the potency of crack-bridging mechanisms at micron-scales. The link between these processes is that the increased stiffness of the cross-linked collagen requires energy to be absorbed by “plastic” deformation at higher structural levels, which occurs by the process of microcracking.

  6. Assessment of trabecular bone structure using MDCT: comparison of 64- and 320-slice CT using HR-pQCT as the reference standard

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    slice MDCT . HR-pQCT . Osteoporosis . Structure analysis .bone Introduction Osteoporosis is defined as a systemicmethod in current osteoporosis diagnosis is the assessment

  7. Expression of T cell antigen receptor genes in the thymus of irradiated mice after bone marrow transplantation

    SciTech Connect (OSTI)

    Matsuzaki, G.; Yoshikai, Y.; Kishihara, K.; Nomoto, K.

    1988-01-15T23:59:59.000Z

    Sequential appearance of the expression of T cell antigen receptor genes was investigated in the thymus of irradiated mice at the early stage after transplantation of Thy-1 congeneic H-2 compatible allogeneic bone marrow cells. The first cells to repopulate the thymus on day 7 after bone marrow transplantation were intrathymic radioresistant T cell precursors, which expanded mainly to CD4+CD8+ host-type thymocytes by day 14. A high level of gamma gene expression but a much reduced level of alpha and beta gene expression were detected in the host-type thymocytes on day 7. During regeneration of these cells, gamma-chain messages fell to low level and alpha and beta mRNA levels increased. The thymus of the recipients began to be repopulated by donor-derived T cells about 2 wk after bone marrow transplantation and was almost completely replaced by the third week. An ordered expression of gamma then beta and alpha-chain gene transcript was also observed in the donor-type thymocytes at the early stage after bone marrow transplantation. The use of thymocytes at early stage in whole-body irradiated bone marrow chimera provides a pertinent source for investigating the molecular mechanism of T cell differentiation in adult thymus.

  8. X-band EPR imaging as a tool for gradient dose reconstruction in irradiated bones

    SciTech Connect (OSTI)

    Leveque, Philippe; Godechal, Quentin; Bol, Anne; Trompier, Francois; Gallez, Bernard [Biomedical Magnetic Resonance Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium); Molecular Imaging and Experimental Radiotherapy Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium); Institut de Surete Nucleaire et de Radioprotection, F-92262 Fontenay-aux-Roses (France); Biomedical Magnetic Resonance Unit, Universite catholique de Louvain, B-1200 Brussels (Belgium)

    2009-09-15T23:59:59.000Z

    Purpose: Various tools are currently available for dose reconstruction in individuals after accidental exposure to ionizing radiation. Among the available biological analyses, Monte Carlo simulations, and biophysical methods, such as electron paramagnetic resonance (EPR), the latter has proved its usefulness for retrospective dosimetry. Although EPR spectroscopy is probably the most sensitive technique, it does not provide spatial dosimetric data. This information is, however, highly desirable when steep dose gradient irradiations are involved. The purpose of this work was to explore the possibilities of EPR imaging (EPRI) for spatial dose reconstruction in irradiated biological material. Methods: X-band EPRI was used to reconstruct ex vivo the relative dose distribution in human bone samples and hydroxyapatite phantoms after irradiation with brachytherapy seeds or x rays. Three situations were investigated: Homogeneous, stepwise gradient, and continuous gradient irradiation. Results: EPRI gave a faithful relative spin density distribution in bone samples and in hydroxyapatite phantoms. Measured dose ratios were in close agreement with the actual delivered dose ratios. EPRI was able to distinguish the dose gradients induced by two different sources ({sup 125}I and {sup 192}Ir). However, the measured spatial resolution of the system was 1.9 mm and this appeared to be a limiting factor. The method could be improved by using new signal postprocessing strategies. Conclusions: This study demonstrates that EPRI can be used to assess the regional relative dose distribution in irradiated bone samples. The method is currently applicable to ex vivo measurements of small size samples with low variation in tissue density but is likely to be adapted for in vivo application using L-band EPRI.

  9. The consequence of late-onset alcohol abuse in aged bone: a histomorhometric analysis 

    E-Print Network [OSTI]

    Barker, Lisa Setchfield

    2000-01-01T23:59:59.000Z

    of the requirements for the degree of MASTER OF SCIENCE Approved as to style and content by: . Wayn ampson (Co-Chair of Committee) Joanne R. Lupton (Co-Chair of Committee) kfa A. Hog (Member) John E. Bauer ( air of Faculty of Nutrition) Brya . hn (Head... dehydrated within a vacuum by an ethanol gradient of 70 10 to 100'/o over four days, followed by two-24-hour acetone steps, and then embedded in methyl methacrylate. " Using a Jung Polycut E microtome (Leica, Germany), the plastic-embedded bones were...

  10. A parametric analysis of bone fixation plates on fractured equine third metacarpal

    E-Print Network [OSTI]

    Ray, Donald Reagan

    1970-01-01T23:59:59.000Z

    of metallic materials, were also being investigated and tried clinically. The earliesr types of metal plates to be used were made of nickel-steel, iron, or silver (1). These early plates were generally attached to the fractured Numbers in parentheses...A P~TRIC ANALYSIS OI' BONE FIXATION PLATES ON FRACTURED EQUINE THIRD lKTACARPAL A Thesis by Donald Reagan Ray Submitted to tnk Graduate College of Texas A&N University in partial fulfillment of the requirement for the degree of MASTER...

  11. Biochemical markers of bone modeling and remodeling in juvenile racehorses at varying mineral intakes

    E-Print Network [OSTI]

    Eller, Elena Maria

    2007-09-17T23:59:59.000Z

    . Resorption begins with recruitment of preosteoclasts, followed by differentiation into mature osteoclasts that then attach to the skeletal surface (Kleerekoper, 1996). During resorption (or demineralization) mineral is removed from the skeleton creating a... levels in the diet not be allowed to exceed Ca levels as ratios of Ca:P less than 1:1 appear to inhibit Ca absorption (NRC, 1989). Although Mg does not comprise as great a percentage of bone as do both Ca and P, 60% of the Mg in the body 8...

  12. Essential requirement of I-A region-identical host bone marrow or bone marrow-derived cells for tumor neutralization by primed L3T4+ T cells

    SciTech Connect (OSTI)

    Ozawa, H.; Iwaguchi, T.; Kataoka, T.

    1987-12-01T23:59:59.000Z

    The antitumor activity of Meth A-hyperimmunized BALB/c mouse spleen cells (Meth A-Im-SPL) was assayed by the Winn test in H-2 incompatible bone marrow chimeras in closed colony CD-1 (nu/nu), inbred DDD/1(nu/nu) (H-2s), or inbred BALB/c(nu/nu) (H-2d) mice as recipients. We found that Meth A-Im-SPL suppressed Meth A growth in the chimera nude mice which were reconstituted with bone marrow cells of the H-2d haplotype (i.e., BALB/c, DBA/2 and B10.D2), but not in the chimeras which were reconstituted with bone marrow cells of the H-2a, H-2b, or H-2k haplotype (i.e., B10.A, B10, and B10.BR). These results suggested that H-2 restriction occurred between Meth A-Im-SPL and bone marrow or bone marrow-derived cells in tumor neutralization. Furthermore, Meth A-Im-SPL did not suppress Meth 1 tumors (antigenically distinct from Meth A tumors) in the presence or absence of mitomycin C-treated Meth A in a Winn assay. These results suggested that there is tumor specificity in the effector phase as well as in the induction phase. The phenotype of the effectors in the Meth A-Im-SPL was Thy-1.2+ and L3T4+, because Meth A-Im-SPL lost their antitumor activity with pretreatment with anti-Thy-1.2 monoclonal antibody (mAb) and complement or anti-L3T4 mAb and complement, but not with anti-Lyt-2.2 mAb and complement or complement alone. Positively purified L3T4+ T cells from Meth A-Im-SPL (Meth A-Im-L3T4), obtained by the panning method, suppressed the tumor growth in the chimera nude mice which were reconstituted with bone marrow cells of B10.KEA2 mice (that were I-A region-identical with Meth A-Im-L3T4 cells but not others in H-2) as well as B10.D2 cells (that were fully identical with Meth A-Im-L3T4 cells in H-2). We conclude that Meth A-Im-SPL (L3T4+) neutralized the tumors in collaboration with I-A region-identical host bone marrow or bone marrow-derived cells, and the neutralization was not accompanied by the bystander effect.

  13. Characterization of the effects of x-ray irradiation on the hierarchical structure and mechanical properties of human cortical bone

    SciTech Connect (OSTI)

    Barth, Holly; Zimmermann, Elizabeth; Schaible, Eric; Tang, Simon; Alliston, Tamara; Ritchie, Robert

    2011-08-19T23:59:59.000Z

    Bone comprises a complex structure of primarily collagen, hydroxyapatite and water, where each hierarchical structural level contributes to its strength, ductility and toughness. These properties, however, are degraded by irradiation, arising from medical therapy or bone-allograft sterilization. We provide here a mechanistic framework for how irradiation affects the nature and properties of human cortical bone over a range of characteristic (nano to macro) length-scales, following x-­ray exposures up to 630 kGy. Macroscopically, bone strength, ductility and fracture resistance are seen to be progressively degraded with increasing irradiation levels. At the micron-­scale, fracture properties, evaluated using in-situ scanning electron microscopy and synchrotron x-ray computed micro-tomography, provide mechanistic information on how cracks interact with the bone-matrix structure. At sub-micron scales, strength properties are evaluated with in-situ tensile tests in the synchrotron using small-/wide-angle x-ray scattering/diffraction, where strains are simultaneously measured in the macroscopic tissue, collagen fibrils and mineral. Compared to healthy bone, results show that the fibrillar strain is decreased by ~40% following 70 kGy exposures, consistent with significant stiffening and degradation of the collagen. We attribute the irradiation-­induced deterioration in mechanical properties to mechanisms at multiple length-scales, including changes in crack paths at micron-­scales, loss of plasticity from suppressed fibrillar sliding at sub-­micron scales, and the loss and damage of collagen at the nano-­scales, the latter being assessed using Raman and Fourier-Transform-Infrared spectroscopy and a fluorometric assay.

  14. Effect of the {delta}-aminolevulinate dehydratase polymorphism on the accumulation of lead in bone and blood in lead smelter workers

    SciTech Connect (OSTI)

    Fleming, D.E.B.; Chettle, D.R. [McMaster Univ., Hamilton, Ontario (Canada). Dept. of Physics and Astronomy] [McMaster Univ., Hamilton, Ontario (Canada). Dept. of Physics and Astronomy; Wetmur, J.G.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)] [Mount Sinai School of Medicine, New York, NY (United States); Robin, J.P. [Noranda Inc., Montreal, Quebec (Canada)] [Noranda Inc., Montreal, Quebec (Canada); Boulay, D.; Richard, N.S. [Brunswick Mining and Smelting Corp. Ltd., Belledune, New Brunswick (Canada). Occupational Health Services] [Brunswick Mining and Smelting Corp. Ltd., Belledune, New Brunswick (Canada). Occupational Health Services; Gordon, C.L.; Webber, C.E. [Hamilton Health Sciences Corp., Hamilton, Ontario (Canada). Dept. of Nuclear Medicine] [Hamilton Health Sciences Corp., Hamilton, Ontario (Canada). Dept. of Nuclear Medicine

    1998-04-01T23:59:59.000Z

    Lead inhibition of the zinc metalloenzyme {delta}-aminolevulinate dehydratase (ALAD) is one of the most sensitive indicators of blood lead levels. Whole blood lead, serum lead, and ALAD genotype were determined for 381 lead smelter workers, including 70 workers expressing the ALAD allele, whose blood lead elevations were observed for more than 20 years of employment. The same employees demonstrated higher serum lead levels. Using a cumulative blood lead index (CBLI) for each worker, based on individual blood lead histories, and in vivo X-ray fluorescence measurements of bone lead to estimate total lead body burden, the slopes of linear relations of bone lead to CBLI were greater for workers homoallelic for ALAD, indicating more efficient uptake of lead from blood into bone. This effect was most significant in calcaneus bone and for workers hired since 1977. Decreased transfer of blood lead into bone in individuals expressing the ALAD allele contrasted with increased blood lead.

  15. The safety and efficacy of an injectable bone substitute in dental sockets demonstrated in a human clinical trial

    E-Print Network [OSTI]

    Boyer, Edmond

    in a water-soluble cellulose polymer carrier phase. It was used for filling bone defects after tooth extractions in eleven patients. The first objective of the study was to investigate the safety of the filler of the implanted areas were harvested and analyzed by using micro-computed tomography, non-decalcified histology

  16. Effects of bone marrow-derived cells on monocrotaline-and hypoxia-induced pulmonary hypertension in mice

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    hypertension in mice William Raoul,1 Orianne Wagner-Ballon,6 Guitanouch Saber,1 Anne Hulin,5 Elisabeth Marcos the difference in their effects depends on the mechanism of pulmonary hypertension (PH) remains unknown of monocrotaline (MCT)- induced pulmonary hypertension, Zhao et al. [9] showed that bone marrow-derived endothelial

  17. Prevention of Postmenopausal Bone Loss by a Low-Magnitude, High-Frequency Mechanical Stimuli: A Clinical Trial Assessing Compliance,

    E-Print Network [OSTI]

    , skeleton, aging, menopause, bone, antiresorptive INTRODUCTION OSTEOPOROSIS, A DISEASE CHARACTERIZED, double-blind, and placebo-controlled clinical trial in 70 women, 3­8 years past the menopause, examined the potential for a noninvasive, mechanically mediated intervention for osteoporosis. This non

  18. Bone quality measurements Osteoporos Int. 2011 Aug;22(8):2225-40. New laboratory tools in the assessment

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ,version1-1Jul2013 Author manuscript, published in "Osteoporosis International 22, 8 (2011) 2225-2240" DOI Force Microscopy FEA Finite Element Analysis Introduction Fragility fractures due to osteoporosis and affect ~30 % of women after the menopause and ~10 % of men. Dual Energy bone densitometry (DXA) has

  19. A Novel Method for the Evaluation of Mechanical Properties of Cancellous Bone in the Rat Distal Femur 

    E-Print Network [OSTI]

    Lucas, Matthew W.

    2010-01-14T23:59:59.000Z

    .................................................................................................................. 35 3.7.1 Analysis of Mechanical Testing Data .............................................................. 35 3.7.2 Material Properties ........................................................................................... 37 3.7.3 Core....2 Osteoporosis and the Ovariectomized Rat Model .................................................... 5 2.3 Mechanical Testing of Cancellous Bone in Rats ..................................................... 5 2.3.1 Femoral Neck Testing...

  20. Genetic Inactivation of ERK1 and ERK2 in Chondrocytes Promotes Bone Growth and Enlarges the Spinal Canal

    E-Print Network [OSTI]

    Genetic Inactivation of ERK1 and ERK2 in Chondrocytes Promotes Bone Growth and Enlarges the Spinal dysplasia. In mouse models of achondroplasia, recent studies have implicated the ERK MAPK pathway, a pathway and ERK MAPK signaling in chondrocytes also causes premature synchondrosis closure in the cranial base

  1. Spectral analysis and connectivity of porous microstructures in bone Kenneth M. Golden , N. Benjamin Murphy, Elena Cherkaev

    E-Print Network [OSTI]

    Cherkaev, Elena

    also help assess the impact of osteoporosis on trabecular structure. Central to our approach- structures, ranging from a solid network of connected trabeculae containing numerous connected pores, in dense cortical bone the pores can be sparse and disconnected, yet exhibit increasing volume fraction

  2. Anti-CD45 radioimmunotherapy using 211At with bone marrow transplantation prolongs survival in a disseminated murine leukemia model

    SciTech Connect (OSTI)

    Orozco, Johnnie J.; Back, Tom; Kenoyer, Aimee L.; Balkin, Ethan R.; Hamlin, Donald K.; Wilbur, D. Scott; Fisher, Darrell R.; Frayo, Shani; Hylarides, Mark; Green, Damian J.; Gopal, Ajay K.; Press, Oliver W.; Pagel, John M.

    2013-05-15T23:59:59.000Z

    Anti-CD45 Radioimmunotherapy using an Alpha-Emitting Radionuclide 211At Combined with Bone Marrow Transplantation Prolongs Survival in a Disseminated Murine Leukemia Model ABSTRACT Despite aggressive chemotherapy combined with hematopoietic cell transplant (HCT), many patients with acute myeloid leukemia (AML) relapse. Radioimmunotherapy (RIT) using antibodies (Ab) labeled primarily with beta-emitting radionuclides has been explored to reduce relapse.

  3. The Wnt Co-receptor LRP5 Is Essential for Skeletal Mechanotransduction but Not for the Anabolic Bone

    E-Print Network [OSTI]

    - of-function mutations in LRP5 cause the human skeletal disease osteoporosis-pseudoglioma syndrome com- ponent of the skeletal fragility phenotype in individuals affected with osteoporosis in the regulation of bone mass and strength. For example, the autosomal recessive human disease osteoporosis

  4. DESIGN OF FOAM COVERING FOR ROBOTIC ARMS TO ENSURE HUMAN SAFETY Lingqi Zeng and Gary M. Bone

    E-Print Network [OSTI]

    Bone, Gary

    , and robot and human velocities. The impact experiments are performed with an apparatus simulating the humanDESIGN OF FOAM COVERING FOR ROBOTIC ARMS TO ENSURE HUMAN SAFETY Lingqi Zeng and Gary M. Bone@mcmaster.ca ABSTRACT Unintentional physical human-robot contact is becoming more common as robots operate in closer

  5. On the effect of x-ray irradiation on the deformation and fracture behavior of human cortical bone

    SciTech Connect (OSTI)

    Barth, Holly D.; Launey, Maximilien E.; McDowell, Alastair A.; Ager III, Joel W.; Ritchie, Robert O.

    2010-01-10T23:59:59.000Z

    In situ mechanical testing coupled with imaging using high-energy synchrotron x-ray diffraction or tomography imaging is gaining in popularity as a technique to investigate micrometer and even sub-micrometer deformation and fracture mechanisms in mineralized tissues, such as bone and teeth. However, the role of the irradiation in affecting the nature and properties of the tissue is not always taken into account. Accordingly, we examine here the effect of x-ray synchrotron-source irradiation on the mechanistic aspects of deformation and fracture in human cortical bone. Specifically, the strength, ductility and fracture resistance (both work-of-fracture and resistance-curve fracture toughness) of human femoral bone in the transverse (breaking) orientation were evaluated following exposures to 0.05, 70, 210 and 630 kGy irradiation. Our results show that the radiation typically used in tomography imaging can have a major and deleterious impact on the strength, post-yield behavior and fracture toughness of cortical bone, with the severity of the effect progressively increasing with higher doses of radiation. Plasticity was essentially suppressed after as little as 70 kGy of radiation; the fracture toughness was decreased by a factor of five after 210 kGy of radiation. Mechanistically, the irradiation was found to alter the salient toughening mechanisms, manifest by the progressive elimination of the bone's capacity for plastic deformation which restricts the intrinsic toughening from the formation 'plastic zones' around crack-like defects. Deep-ultraviolet Raman spectroscopy indicated that this behavior could be related to degradation in the collagen integrity.

  6. Liquid-Solid Phase Transition Alloy as Reversible and Rapid Molding Bone Cement

    E-Print Network [OSTI]

    Yi, Liting; Liu, Jing

    2013-01-01T23:59:59.000Z

    Bone cement has been demonstrated as an essential restorative material in the orthopedic surgery. However current materials often imply unavoidable drawbacks, such as tissue-cement reaction induced thermal injuries and troublesome revision procedure. Here we proposed an injectable alloy cement to address such problems through its liquid-solid phase transition mechanism. The cement is made of a unique alloy BiInSnZn with a specifically designed low melting point 57.5{\\deg}C. This property enables its rapid molding into various shapes with high plasticity. Some fundamental characteristics including mechanical strength behaviors and phase transition-induced thermal features have been measured to demonstrate the competence of alloy as unconventional cement with favorable merits. Further biocompatible tests showed that this material could be safely employed in vivo. In addition, experiments also found the alloy cement capability as an excellent contrast agent for radiation imaging. Particularly, the proposed alloy...

  7. Suppressor cells in transplantation tolerance. II. maturation of suppressor cells in the bone marrow chimera

    SciTech Connect (OSTI)

    Tutschka, P.J.; Ki, P.F.; Beschorner, W.E.; Hess, A.D.; Santos, G.W.

    1981-10-01T23:59:59.000Z

    Histoincompatible bone marrow allografts were established in lethally irradiated rats. At various times after transplantation, the spleen cells were harvested, subjected to mixed lymphocyte cultures, and assayed for suppressor cells in vitro and in vivo by adoptive transfer studies. Alloantigen-nonspecific suppressor cells appeared in the chimera at 40 days after grafting, coinciding with the resolution of graft-versus-host disease (GVHD). At 250 days the nonspecific suppressor cells were replaced by suppressor cells specifically suppressing donor-versus-host alloantigen responses. At 720 days suppressor cells could no longer be identified by in vitro methods but were identified by in vivo adoptive transfer of transplantation tolerance. After injection of host-type antigen into chimeras, the suppressor cells could be again demonstrated by in vitro methods.

  8. Suppressor cells in transplantation tolerance II. Maturation of suppressor cells in the bone marrow chimera

    SciTech Connect (OSTI)

    Tutschka, P.J.; Ki, P.F.; Beschorner, W.E.; Hess, A.D.; Santos, G.W.

    1981-10-01T23:59:59.000Z

    Histoincompatible bone marrow allografts were established in lethally irradiated rats. At various times after transplantation, the spleen cells were harvested, subjected to mixed lymphocyte cultures, and assayed for suppressor cells in vitro and in vivo by adoptive transfer studies. Alloantigen-nonspecific suppressor cells appeared in the chimera at 40 days after grafting, coinciding with the resolution of graft-versus-host disease (GVHD). At 250 days the nonspecific suppressor cells were replaced by suppressor cells specifically suppressing donor-versus-host alloantigen responses. At 720 days suppressor cells could no longer be identified by in vitro methods but were identified by in vivo adoptive transfer of transplantation tolerance. After injection of host-type antigen into chimeras, the suppressor cells could be again demonstrated by in vitro methods.

  9. Anti-bacterial immunity to Listeria monocytogenes in allogeneic bone marrow chimera in mice

    SciTech Connect (OSTI)

    Onoe, K.; Good, R.A.; Yamamoto, K.

    1986-06-01T23:59:59.000Z

    Protection and delayed-type hypersensitivity (DTH) to the facultative intracellular bacterium Listeria monocytogenes (L.m.) were studied in allogeneic and syngeneic bone marrow chimeras. Lethally irradiated AKR (H-2k) mice were successfully reconstituted with marrow cells from C57BL/10 (B10) (H-2b), B10 H-2-recombinant strains or syngeneic mice. Irradiated AKR mice reconstituted with marrow cells from H-2-compatible B10.BR mice, (BR----AKR), as well as syngeneic marrow cells, (AKR----AKR), showed a normal level of responsiveness to the challenge stimulation with the listeria antigens when DTH was evaluated by footpad reactions. These mice also showed vigorous activities in acquired resistance to the L.m. By contrast, chimeric mice that had total or partial histoincompatibility at the H-2 determinants between donor and recipient, (B10----AKR), (B10.AQR----AKR), (B10.A(4R)----AKR), or (B10.A(5R)----AKR), were almost completely unresponsive in DTH and antibacterial immunity. However, when (B10----AKR) H-2-incompatible chimeras had been immunized with killed L.m. before challenge with live L.m., these mice manifested considerable DTH and resistance to L.m. These observations suggest that compatibility at the entire MHC between donor and recipient is required for bone marrow chimeras to be able to manifest DTH and protection against L.m. after a short-term immunization schedule. However, this requirement is overcome by a preceding or more prolonged period of immunization with L.m. antigens. These antigens, together with marrow-derived antigen-presenting cells, can then stimulate and expand cell populations that are restricted to the MHC (H-2) products of the donor type.

  10. Adaptive differentiation of H-2- and Igh-restricted B lymphocyte in tetraparental bone marrow chimera

    SciTech Connect (OSTI)

    Yamamoto, H.; Bitoh, S.; Fujimoto, S.

    1987-01-15T23:59:59.000Z

    Immunization of BALB/c mice with MOPC-104E myeloma protein induced idiotype-specific enhancing B cells that acted on anti-dextran antibody producing B cells. The enhancing cells have the surface phenotype of B cells. With the use of several H-2 or Igh congenic mice, it was found that the cooperation among B cells was controlled by both the major histocompatibility complex (MHC) and Igh. The capability to generate enhancing B cell activity was analyzed by using tetraparental bone marrow chimeras. (C57BL/6 X BALB/c)F1 mice, for example, were lethally irradiated and were reconstituted with C57BL/6 and BALB/c bone marrow cells. Nine to 12 wk after the reconstitution, the chimeras were immunized with the myeloma protein and were tested for their enhancing B cell activity. After the removal of C57BL/6 origin cells by treatment with anti-H-2b + complement, residual cells exhibited enhancing B cell activity on BALB.B, as well as BALB/c antidextran antibody response. This indicates that the generation of H-2-restricted, idiotype-specific enhancing B cell activity differentiated adaptively so as to recognize foreign MHC as self under chimeric conditions. On the other hand, splenic B cells treated with anti-H-2d + complement did not enhance the responses of BALB/c or BALB.B. Even in a chimeric environment, the B cells of C57BL/6 origin could not obtain the ability to generate enhancing B cell activity upon immunization of the idiotype. The results described here, taken in conjunction with our previous studies, suggest that the Ig heavy chain gene(s) predominantly control the Igh restriction properties of enhancing B cells, and the capability of MHC recognition by B cells is selected under chimeric conditions.

  11. Temperature Measurement During Polymerization of Bone Cement in Percutaneous Vertebroplasty: An In Vivo Study in Humans

    SciTech Connect (OSTI)

    Anselmetti, Giovanni Carlo, E-mail: giovanni.anselmetti@ircc.it; Manca, Antonio [Institute for Cancer Research and Treatment (IRCC), Interventional Radiology Unit (Italy); Kanika, Khanna; Murphy, Kieran [Johns Hopkins Hospital, Radiology and Radiological Science (United States); Eminefendic, Haris [Institute for Cancer Research and Treatment (IRCC), Radiology Unit (Italy); Masala, Salvatore ['Tor Vergata' University General Hospital, Department of Diagnostic Imaging, Molecular Imaging, Interventional Radiology and Radiotherapy (Italy); Regge, Daniele [Institute for Cancer Research and Treatment (IRCC), Radiology Unit (Italy)

    2009-05-15T23:59:59.000Z

    Aim of the study was to 'in vivo' measure temperature, during percutaneous vertebroplasty (PV), within a vertebral body injected with different bone cements. According to the declaration of Helsinki, 22 women (60-80 years; mean, 75 years) with painful osteoporotic vertebral collapse underwent bilateral transpedicular PV on 22 lumbar vertebrae. Two 10-G vertebroplasty needles were introduced into the vertebra under digital fluoroscopy; a 16-G radiofrequency thermoablation needle (Starburst XL; RITA Medical System Inc., USA), carrying five thermocouples, was than coaxially inserted. Eleven different bone cements were injected and temperatures were measured every 30 s until temperatures dropped under 45{sup o}C. After the thermocouple needle was withdrawn, bilateral PV was completed with cement injection through the vertebroplasty needle. Unpaired Student's t-tests, Kruskal-Wallis test, and Wilcoxon signed rank test were used to evaluate significant differences (p < 0.05) in peak temperatures, variations between cements, and clinical outcome. All procedures were completed without complications, achieving good clinical outcomes (p < 0.0001). Regarding average peak temperature, cements were divided into three groups: A (over 60{sup o}C), B (from 50{sup o} to 60{sup o}C), and C (below 50{sup o}C). Peak temperature in Group A (86.7 {+-} 10.7{sup o}C) was significantly higher (p = 0.0172) than that in Groups B (60.5 {+-} 3.7{sup o}C) and C (44.8 {+-} 2.6{sup o}C). The average of all thermocouples showed an extremely significant difference (p = 0.0002) between groups. None of the tested cements maintained a temperature {>=}45{sup o}C for more than 30 min. These data suggest that back-pain improvement is obtained not by thermal necrosis but by mechanical consolidation only. The relative necrotic thermal effect in vertebral metastases seems to confirm that analgesia must be considered the main intent of PV.

  12. Nanomechanics and ultrastructural studies of cortical bone : fundamental insights regarding structure-function, mineral-organic force mechanics interactions, and heterogeneity

    E-Print Network [OSTI]

    Tai, Kuangshin

    2007-01-01T23:59:59.000Z

    Although the mechanics of bone has been studied extensively at the micro- and macro-scale, the nano-scopic level is perhaps the most illuminating as this is the length scale at which the individual constituents interact. ...

  13. Changing the Mechanical Properties of PMMA Bone Cement with Nano and Micro Particles Ricardo F. Pinto, Brandon J. Johnson, L. D. Timmie Topoleski

    E-Print Network [OSTI]

    Alonso, Juan J.

    in the vacuum mixer. During the exothermic polymerization of the bone cement, the liquid rubber should testing. Specimens were then retrieved and tested individually in three point bending quasi-static loading

  14. Human {beta}-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old

    SciTech Connect (OSTI)

    Beraud-Colomb, E. [Genetique Medicale et Developpement, Marseille (France)]|[Laboratoire d`Anthropologie, Marseille (France); Maroc, N. [Genetique Medicale et Developpement, Marseille (France); Roubin, R. [Institut Paoli-Calmettes, Marseille (France)] [and others

    1995-12-01T23:59:59.000Z

    Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the P-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for P-globin frameworks by sequencing through two variable positions and for a polymorphic (AT){sub x}(T){sub y} microsatellite 500 bp upstream of the P-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible. 34 refs., 3 figs., 2 tabs.

  15. A Novel Method for the Evaluation of Mechanical Properties of Cancellous Bone in the Rat Distal Femur

    E-Print Network [OSTI]

    Lucas, Matthew W.

    2010-01-14T23:59:59.000Z

    Walton Lucas, B.S., Lipscomb University Co-Chairs of Advisory Committee: Dr. Harry Hogan Dr. Susan Bloomfield The mechanical properties of the cancellous bone in the laboratory rat animal model... the cortical shell for 50 slices in a region starting ~0.5 mm below the most proximal portion of the growth plate for each animal. Images were binarized (threshold of 100 on a 0-255 scale) and the following parameters were assessed for the three- dimensional...

  16. A Signal-Inducing Bone Cement for Magnetic Resonance Imaging-Guided Spinal Surgery Based on Hydroxyapatite and Polymethylmethacrylate

    SciTech Connect (OSTI)

    Wichlas, Florian, E-mail: florian.wichlas@charite.de; Seebauer, Christian J.; Schilling, Rene [University Charite, Center for Musculoskeletal Surgery (Germany); Rump, Jens [University Charite, Department of Radiology (Germany); Chopra, Sascha S. [University Charite, Center for Musculoskeletal Surgery (Germany); Walter, Thula; Teichgraeber, Ulf K. M. [University Charite, Department of Radiology (Germany); Bail, Hermann J. [University Charite, Center for Musculoskeletal Surgery (Germany)

    2012-06-15T23:59:59.000Z

    The aim of this study was to develop a signal-inducing bone cement for magnetic resonance imaging (MRI)-guided cementoplasty of the spine. This MRI cement would allow precise and controlled injection of cement into pathologic lesions of the bone. We mixed conventional polymethylmethacrylate bone cement (PMMA; 5 ml methylmethacrylate and 12 g polymethylmethacrylate) with hydroxyapatite (HA) bone substitute (2-4 ml) and a gadolinium-based contrast agent (CA; 0-60 {mu}l). The contrast-to-noise ratio (CNR) of different CA doses was measured in an open 1.0-Tesla scanner for fast T1W Turbo-Spin-Echo (TSE) and T1W TSE pulse sequences to determine the highest signal. We simulated MRI-guided cementoplasty in cadaveric spines. Compressive strength of the cements was tested. The highest CNR was (1) 87.3 (SD 2.9) in fast T1W TSE for cements with 4 {mu}l CA/ml HA (4 ml) and (2) 60.8 (SD 2.4) in T1W TSE for cements with 1 {mu}l CA/ml HA (4 ml). MRI-guided cementoplasty in cadaveric spine was feasible. Compressive strength decreased with increasing amounts of HA from 46.7 MPa (2 ml HA) to 28.0 MPa (4 ml HA). An MRI-compatible cement based on PMMA, HA, and CA is feasible and clearly visible on MRI images. MRI-guided spinal cementoplasty using this cement would permit direct visualization of the cement, the pathologic process, and the anatomical surroundings.

  17. Booster irradiation to the spleen following total body irradiation. A new immunosuppressive approach for allogeneic bone marrow transplantation

    SciTech Connect (OSTI)

    Lapidot, T.; Singer, T.S.; Salomon, O.; Terenzi, A.; Schwartz, E.; Reisner, Y.

    1988-10-15T23:59:59.000Z

    Graft rejection presents a major obstacle for transplantation of T cell-depleted bone marrow in HLA-mismatched patients. In a primate model, after conditioning exactly as for leukemia patients, it was shown that over 99% of the residual host clonable T cells are concentrated in the spleen on day 5 after completion of cytoreduction. We have now corroborated these findings in a mouse model. After 9-Gy total body irradiation (TBI), the total number of Thy-1.2+ cells in the spleen reaches a peak between days 3 and 4 after TBI. The T cell population is composed of both L3T4 (helper) and Lyt-2 (suppressor) T cells, the former being the major subpopulation. Specific booster irradiation to the spleen (5 Gy twice) on days 2 and 4 after TBI greatly enhances production of donor-type chimera after transplantation of T cell-depleted allogeneic bone marrow. Similar enhancement can be achieved by splenectomy on day 3 or 4 after TBI but not if splenectomy is performed 1 day before TBI or 1 day after TBI, strengthening the hypothesis that, after lethal TBI in mice, the remaining host T cells migrate from the periphery to the spleen. These results suggest that a delayed booster irradiation to the spleen may be beneficial as an additional immunosuppressive agent in the conditioning of leukemia patients, in order to reduce the incidence of bone marrow allograft rejection.

  18. Innovative Composites Through Reinforcement Morphology Design - a Bone-Shaped-Short-Fiber Composite

    SciTech Connect (OSTI)

    Zhu, Y.T.; Valdez, J.A.; Beyerlain, I.J.; Stout, M.G.; Zhou, S.; Shi, N.; Lowe, T.C.

    1999-06-29T23:59:59.000Z

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project at Los Alamos National Laboratory (LANL). The objective of this project is to improve the strength and toughness of conventional short-fiber composites by using innovative bone-shaped-short (BSS) fibers as reinforcement. We fabricated a model polyethylene BSS fiber-reinforced polyester-matrix composite to prove that fiber morphology, instead of interfacial strength, solves the problem. Experimental tensile and fracture toughness test results show that BSS fibers can bridge matrix cracks more effectively, and consume many times more energy when pulled out, than conventional-straight-short (CSS) fibers. This leads to both higher strength and fracture toughness for the BSS-fiber composites. A computational model was developed to simulate crack propagation in both BSS- and CSS-fiber composites, accounting for stress concentrations, interface debonding, and fiber pullout. Model predictions were validated by experimental results and will be useful in optimizing BSS-fiber morphology and other material system parameters.

  19. Pyrolysis and gasification of meat-and-bone-meal: Energy balance and GHG accounting

    SciTech Connect (OSTI)

    Cascarosa, Esther [Thermochemical Processes Group, Aragón Institute for Engineering Research (I3A), Universidad de Zaragoza (Spain); Boldrin, Alessio, E-mail: aleb@env.dtu.dk [Department of Environmental Engineering. Technical University of Denmark, Kongens Lyngby (Denmark); Astrup, Thomas [Department of Environmental Engineering. Technical University of Denmark, Kongens Lyngby (Denmark)

    2013-11-15T23:59:59.000Z

    Highlights: • GHG savings are in the order of 600–1000 kg CO{sub 2}-eq. per Mg of MBM treated. • Energy recovery differed in terms of energy products and efficiencies. • The results were largely determined by use of the products for energy purposes. - Abstract: Meat-and-bone-meal (MBM) produced from animal waste has become an increasingly important residual fraction needing management. As biodegradable waste is routed away from landfills, thermo-chemical treatments of MBM are considered promising solution for the future. Pyrolysis and gasification of MBM were assessed based on data from three experimental lab and pilot-scale plants. Energy balances were established for the three technologies, providing different outcomes for energy recovery: bio-oil was the main product for the pyrolysis system, while syngas and a solid fraction of biochar were the main products in the gasification system. These products can be used – eventually after upgrading – for energy production, thereby offsetting energy production elsewhere in the system. Greenhouse gases (GHG) accounting of the technologies showed that all three options provided overall GHG savings in the order of 600–1000 kg CO{sub 2}-eq. per Mg of MBM treated, mainly as a consequence of avoided fossil fuel consumption in the energy sector. Local conditions influencing the environmental performance of the three systems were identified, together with critical factors to be considered during decision-making regarding MBM management.

  20. Patterns of Practice of Palliative Radiotherapy in Africa, Part 1: Bone and Brain Metastases

    SciTech Connect (OSTI)

    Sharma, Vinay [Johannesburg Hospital, University of Witwatersrand, Johannesburg (South Africa)], E-mail: sharmav@medicine.wits.ac.za; Gaye, Papa Macoumba M.Med. [Institut Curie, Hopital Aristide le Dentec, Univesite Cheikh Anta Diop de Dakar, Dakar (Senegal); Wahab, Sherif Abdel [Ain Shams University, Abbasia, Cairo (Egypt); Ndlovu, Ntokozo [Medical School, Radiotherapy Centre, Harare (Zimbabwe); Ngoma, Twalib [Ocean Road Hospital, Ocean Road Cancer Institute, Dar Es Salaam (Tanzania); Vanderpuye, Verna [Korle Bu Teaching Hospital, Accra (Ghana); Sowunmi, Anthonia [Teaching Hospital, University of Lagos, Surulere, Lagos (Nigeria); Kigula-Mugambe, Joseph [Radiotherapy Department, Makerere University, Kampala (Uganda); Jeremic, Branislav [International Atomic Energy Agency, Vienna (Austria)

    2008-03-15T23:59:59.000Z

    Purpose: To provide data on the pattern of practice of palliative radiotherapy (RT) on the African continent. Methods and Materials: A questionnaire was distributed to participants in a regional training course of the International Atomic Energy Agency in palliative cancer care and sent by e-mail to other institutions in Africa. Requested information included both infrastructure and human resources available and the pattern of RT practice for metastatic and locally advanced cancers. Results: Of 35 centers contacted, 24 (68%) completed the questionnaire. Although RT is used by most centers for most metastatic cancers, liver and lung metastases are treated with chemotherapy. Of 23 centers, 14 (61%) had a single RT regimen as an institutional policy for treating painful bone metastases, but only 5 centers (23%) of 23 used 8 Gy in 1 fraction. Brain metastases were being treated by RT to the whole brain to 30 Gy in 10 fractions, either exclusively (n = 13, 56%) or in addition to the use of 20 Gy in 5 fractions (n = 3, 14%). Conclusion: Radiotherapy is a major component of treatment of cancer patients in African countries. There is consensus among few centers for treatment schedules for almost all sites regarding time and dose-fractionation characteristics of RT regimens used and/or indications for the use of RT in this setting.

  1. Bone marrow-derived mesenchymal stem cells enhance angiogenesis via their ?6?1 integrin receptor

    SciTech Connect (OSTI)

    Carrion, Bita; Kong, Yen P. [Department of Biomedical Engineering, University of Michigan, Ann Arbor, MI 48109 (United States); Kaigler, Darnell [Department of Biomedical Engineering, University of Michigan, Ann Arbor, MI 48109 (United States); Department of Periodontics and Oral Medicine, University of Michigan, Ann Arbor, MI 48109 (United States); Putnam, Andrew J., E-mail: putnam@umich.edu [Department of Biomedical Engineering, University of Michigan, Ann Arbor, MI 48109 (United States)

    2013-11-15T23:59:59.000Z

    Bone marrow-derived mesenchymal stem cells (BMSCs) facilitate the angiogenic response of endothelial cells (ECs) within three-dimensional (3D) matrices in vivo and in engineered tissues in vitro in part through paracrine mediators and by acting as stabilizing pericytes. However, the molecular interactions between BMSCs and nascent tubules during the process of angiogenesis are not fully understood. In this study, we have used a tractable 3D co-culture model to explore the functional role of the ?6?1 integrin adhesion receptor on BMSCs in sprouting angiogenesis. We report that knockdown of the ?6 integrin subunit in BMSCs significantly reduces capillary sprouting, and causes their failure to associate with the nascent vessels. Furthermore, we demonstrate that the BMSCs with attenuated ?6 integrin proliferate at a significantly lower rate relative to either control cells expressing non-targeting shRNA or wild type BMSCs; however, despite adding more cells to compensate for this deficit in proliferation, deficient sprouting persists. Collectively, our findings demonstrate that the ?6 integrin subunit in BMSCs is important for their ability to stimulate vessel morphogenesis. This conclusion may have important implications in the optimization of cell-based strategies to promote angiogenesis. Highlights: • BMSCs stimulate angiogenesis, but the mechanisms remain unclear. • We silenced the expression of the ?6 integrin subunit in BMSCs. • Silencing this receptor subunit significantly inhibited angiogenic sprouting. • Knocking down ?6 integrin affected laminin and ?SMA expression. • Silencing ?6 integrin expression also reduced BMSC proliferation.

  2. Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells

    SciTech Connect (OSTI)

    Dooner, Mark; Aliotta, Jason M.; Pimental, Jeffrey; Dooner, Gerri J.; Abedi, Mehrdad; Colvin, Gerald; Liu, Qin; Weier, Heinz-Ulli; Dooner, Mark S.; Quesenberry, Peter J.

    2007-12-31T23:59:59.000Z

    Green-fluorescent protein (GFP) labeled marrow cells transplanted into lethally irradiated mice can be detected in the lungs of transplanted mice and have been shown to express lung specific proteins while lacking the expression of hematopoietic markers. We have studied marrow cells induced to transit cell cycle by exposure to IL-3, IL-6, IL-11 and steel factor at different times of culture corresponding to different phases of cell cycle. We have found that marrow cells at the G1/S interface have a 3-fold increase in cells which assume a lung phenotype and that this increase is no longer seen in late S/G2. These cells have been characterized as GFP{sup +} CD45{sup -} and GFP{sup +} cytokeratin{sup +}. Thus marrow cells with the capacity to convert into cells with a lung phenotype after transplantation show a reversible increase with cytokine induced cell cycle transit. Previous studies have shown the phenotype of bone marrow stem cells fluctuates reversibly as these cells traverse cell cycle, leading to a continuum model of stem cell regulation. The present studies indicate that marrow stem cell production of nonhematopoietic cells also fluctuates on a continuum.

  3. Contrasting Effects of Vasculogenic Induction Upon Biaxial Bioreactor Stimulation of Mesenchymal Stem Cells and Endothelial Progenitor Cells Cocultures in Three-Dimensional Scaffolds under in Vitro and in Vivo Paradigms for Vascularized Bone Tissue Engineering

    E-Print Network [OSTI]

    Liu, Yuchun

    Clinical translation of bone tissue engineering approaches for fracture repair has been hampered by inadequate vascularization required for maintaining cell survival, skeletal regeneration, and remodeling. The potential ...

  4. Contrasting Effects of Vasculogenic Induction Upon Biaxial Bioreactor Stimulation of Mesenchymal Stem Cells and Endothelial Progenitor Cells Cocultures in Three-Dimensional Scaffolds Under In Vitro and In Vivo Paradigms for Vascularized Bone Tissue Engineering

    E-Print Network [OSTI]

    Teoh, Swee-Hin

    Clinical translation of bone tissue engineering approaches for fracture repair has been hampered by inadequate vascularization required for maintaining cell survival, skeletal regeneration, and remodeling. The potential ...

  5. Efficient natural defense mechanisms against Listeria monocytogenes in T and B cell-deficient allogeneic bone marrow radiation chimeras. Preactivated macrophages are the main effector cells in an early phase after bone marrow transfer

    SciTech Connect (OSTI)

    Roesler, J.; Groettrup, E.B.; Baccarini, M.; Lohmann-Mattes, M.L. (Fraunhofer-Institut ITA, Hannover (Germany, F.R.))

    1989-09-01T23:59:59.000Z

    Radiation chimeras in the early phase after bone marrow transplantation are a good model to study the efficiency of the body's nonspecific defense system represented by macrophages (M phi), polymorphonuclear cells (PMN), and NK cells. These cell types are present in large numbers in spleen and liver at that time, whereas the specific immune system represented by T and B cells is functionally deficient. We previously reported enhanced activities in vitro of M phi (and PMN) from recipient animals in an early phase after allogeneic bone marrow transfer. We here demonstrate that these activities result in enhanced spontaneous resistance against Listeria monocytogenes in vivo: CFU of L. monocytogenes in spleen and liver 48 h after infection were about 1 or 2 to 4 log steps less than in untreated control mice of donor or host haplotype. This enhanced resistance decreased over the 4-mo period after marrow transfer. Preactivated M phi were identified as the most important effector cells. Isolated from spleen and peritoneal cavity, they performed enhanced killing of phagocytosed Listeria. Such preactivated M phi occurred in recipient animals after transfer of allogeneic but not of syngeneic bone marrow. The precise mechanism of M phi activation in the allogeneic radiation chimera in the complete absence of any detectable T cell function is not clear at present. However, these preactivated M phi display an important protective effect against L. monocytogenes: chimeras could eliminate Listeria without acquisition of positive delayed-type sensitivity when infected with 10(3) bacteria. An inoculum of 5 . 10(3) L. monocytogenes resulted either in prolonged survival compared with normal mice of the recipient haplotype or in definitive survival accompanied by a positive delayed-type sensitivity.

  6. SU-E-J-162: Quality Assurance Procedures for MR Guided Focused Ultrasound Treatment of Bone Metastasis

    SciTech Connect (OSTI)

    Chen, L; Chen, X; Wang, B; Gupta, R; Ma, C [Fox Chase Cancer Center, Philadelphia, PA (United States)

    2014-06-01T23:59:59.000Z

    Purpose: The purpose of this work is to develop and verify our quality assurance (QA) procedures to ensure the safety and efficacy of MR-guided focused ultrasound (MRgFUS) treatment of bone metastases. Methods: A practical QA program was developed. Monthly and daily QA (DQA) procedures were performed. The major QA items included the checks of the machine hardware, software and patient safety features. Briefly, these checks/tests include: 1) the cooling system reservoir and treatment table; 2) power to the treatment table; 3) the MR coil; 4) the transducer position with MRI; 5) image display on the treatment work station; 6) the effective focal spot in 3 directions using MR thermometry; and 7) all the safety devices including a sonication lamp, and the emergency stop-sonication switches. In order to avoid patient skin burn, it is important to remove gas bubbles in the interfaces between the treatment table and the gel pad, and the gel pad and patients skin during the patient setup. Our QA procedures have been verified and evaluated through patient treatments. Seven patients with scapula, humeral head, sacrum, ilium, pubic ramus and acetabular bone metastases were treated using MRgFUS. Results: Our study showed that all seven patients tolerated the MRgFUS treatment well. No skin toxicity or other complications were observed. The pain score (0–10) using the visual analog scale (VAS) was significantly reduced from 8.0 ± 1.1 before treatment to 4.7 ± 3.0, 3.0 ± 1.5, 3.2 ± 2.8 and 3.4 ± 1.5 at one day, one month, two months and three months after the MRgFUS treatment, respectively. Conclusion: We demonstrated that with the appropriate QA procedures, MRgFUS is a safe, effective and noninvasive treatment modality for palliation of bone metastases.

  7. Limited Chemotherapy and Shrinking Field Radiotherapy for Osteolymphoma (Primary Bone Lymphoma): Results From the Trans-Tasman Radiation Oncology Group 99.04 and Australasian Leukaemia and Lymphoma Group LY02 Prospective Trial;Bone; Lymphoma; Radiotherapy; Chemotherapy; Clinical trial

    SciTech Connect (OSTI)

    Christie, David, E-mail: david.christie@premion.com.au [Premion and Bond University, Gold Coast, Queensland (Australia); Dear, Keith [Department of Epidemiology and Population Studies, Australian National University, Canberra, New South Wales (Australia); Le, Thai [BHB, Premion, Brisbane, Queensland (Australia); Barton, Michael [Collaboration for Cancer Outcomes and Research (CCORE) and University of NSW, Sydney, New South Wales (Australia); Wirth, Andrew [Peter MacCallum Cancer Institute, Melbourne, Victoria (Australia); Porter, David [Auckland Hospital, Auckland (New Zealand); Roos, Daniel [Royal Adelaide Hospital, Adelaide, South Australia (Australia); Pratt, Gary [Royal Brisbane Hospital, Brisbane, Queensland (Australia)

    2011-07-15T23:59:59.000Z

    Purpose: To establish benchmark outcomes for combined modality treatment to be used in future prospective studies of osteolymphoma (primary bone lymphoma). Methods and Materials: In 1999, the Trans-Tasman Radiation Oncology Group (TROG) invited the Australasian Leukemia and Lymphoma Group (ALLG) to collaborate on a prospective study of limited chemotherapy and radiotherapy for osteolymphoma. The treatment was designed to maintain efficacy but limit the risk of subsequent pathological fractures. Patient assessment included both functional imaging and isotope bone scanning. Treatment included three cycles of CHOP chemotherapy and radiation to a dose of 45 Gy in 25 fractions using a shrinking field technique. Results: The trial closed because of slow accrual after 33 patients had been entered. Accrual was noted to slow down after Rituximab became readily available in Australia. After a median follow-up of 4.3 years, the five-year overall survival and local control rates are estimated at 90% and 72% respectively. Three patients had fractures at presentation that persisted after treatment, one with recurrent lymphoma. Conclusions: Relatively high rates of survival were achieved but the number of local failures suggests that the dose of radiotherapy should remain higher than it is for other types of lymphoma. Disability after treatment due to pathological fracture was not seen.

  8. Oxygen tension regulates the osteogenic, chondrogenic and endochondral phenotype of bone marrow derived mesenchymal stem cells

    SciTech Connect (OSTI)

    Sheehy, Eamon J.; Buckley, Conor T. [Trinity Centre for Bioengineering, School of Engineering, Trinity College Dublin, Dublin 2 (Ireland)] [Trinity Centre for Bioengineering, School of Engineering, Trinity College Dublin, Dublin 2 (Ireland); Kelly, Daniel J., E-mail: kellyd9@tcd.ie [Trinity Centre for Bioengineering, School of Engineering, Trinity College Dublin, Dublin 2 (Ireland)

    2012-01-06T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer Expansion in low oxygen enhances MSC proliferation and osteogenesis. Black-Right-Pointing-Pointer Differentiation in low oxygen enhances chondrogenesis and suppresses hypertrophy. Black-Right-Pointing-Pointer Oxygen can regulate the MSC phenotype for use in tissue engineering applications. -- Abstract: The local oxygen tension is a key regulator of the fate of mesenchymal stem cells (MSCs). The objective of this study was to investigate the effect of a low oxygen tension during expansion and differentiation on the proliferation kinetics as well as the subsequent osteogenic and chondrogenic potential of MSCs. We first hypothesised that expansion in a low oxygen tension (5% pO{sub 2}) would improve both the subsequent osteogenic and chondrogenic potential of MSCs compared to expansion in a normoxic environment (20% pO{sub 2}). Furthermore, we hypothesised that chondrogenic differentiation in a low oxygen environment would suppress hypertrophy of MSCs cultured in both pellets and hydrogels used in tissue engineering strategies. MSCs expanded at 5% pO{sub 2} proliferated faster forming larger colonies, resulting in higher cell yields. Expansion at 5% pO{sub 2} also enhanced subsequent osteogenesis of MSCs, whereas differentiation at 5% pO{sub 2} was found to be a more potent promoter of chondrogenesis than expansion at 5% pO{sub 2}. Greater collagen accumulation, and more intense staining for collagen types I and X, was observed in pellets maintained at 20% pO{sub 2} compared to 5% pO{sub 2}. Both pellets and hydrogels stained more intensely for type II collagen when undergoing chondrogenesis in a low oxygen environment. Differentiation at 5% pO{sub 2} also appeared to inhibit hypertrophy in both pellets and hydrogels, as demonstrated by reduced collagen type X and Alizarin Red staining and alkaline phosphatase activity. This study demonstrates that the local oxygen environment can be manipulated in vitro to either stabilise a chondrogenic phenotype for use in cartilage repair therapies or to promote hypertrophy of cartilaginous grafts for endochondral bone repair strategies.

  9. Validation of a simple and fast method to quantify in vitro mineralization with fluorescent probes used in molecular imaging of bone

    SciTech Connect (OSTI)

    Moester, Martiene J.C. [Department of Radiology, Leiden University Medical Center (Netherlands)] [Department of Radiology, Leiden University Medical Center (Netherlands); Schoeman, Monique A.E. [Department of Orthopedic Surgery, Leiden University Medical Center (Netherlands)] [Department of Orthopedic Surgery, Leiden University Medical Center (Netherlands); Oudshoorn, Ineke B. [Department of Radiology, Leiden University Medical Center (Netherlands) [Department of Radiology, Leiden University Medical Center (Netherlands); Percuros BV, Leiden (Netherlands)] [Netherlands; Beusekom, Mara M. van [Department of Radiology, Leiden University Medical Center (Netherlands)] [Department of Radiology, Leiden University Medical Center (Netherlands); Mol, Isabel M. [Department of Radiology, Leiden University Medical Center (Netherlands) [Department of Radiology, Leiden University Medical Center (Netherlands); Percuros BV, Leiden (Netherlands)] [Netherlands; Kaijzel, Eric L.; Löwik, Clemens W.G.M. [Department of Radiology, Leiden University Medical Center (Netherlands); Rooij, Karien E. de, E-mail: k.e.de_rooij@lumc.nl [Department of Radiology, Leiden University Medical Center (Netherlands) [Department of Radiology, Leiden University Medical Center (Netherlands); Percuros BV, Leiden (Netherlands)] [Netherlands

    2014-01-03T23:59:59.000Z

    Highlights: •We validate a simple and fast method of quantification of in vitro mineralization. •Fluorescently labeled agents can detect calcium deposits in the mineralized matrix of cell cultures. •Fluorescent signals of the probes correlated with Alizarin Red S staining. -- Abstract: Alizarin Red S staining is the standard method to indicate and quantify matrix mineralization during differentiation of osteoblast cultures. KS483 cells are multipotent mouse mesenchymal progenitor cells that can differentiate into chondrocytes, adipocytes and osteoblasts and are a well-characterized model for the study of bone formation. Matrix mineralization is the last step of differentiation of bone cells and is therefore a very important outcome measure in bone research. Fluorescently labelled calcium chelating agents, e.g. BoneTag and OsteoSense, are currently used for in vivo imaging of bone. The aim of the present study was to validate these probes for fast and simple detection and quantification of in vitro matrix mineralization by KS483 cells and thus enabling high-throughput screening experiments. KS483 cells were cultured under osteogenic conditions in the presence of compounds that either stimulate or inhibit osteoblast differentiation and thereby matrix mineralization. After 21 days of differentiation, fluorescence of stained cultures was quantified with a near-infrared imager and compared to Alizarin Red S quantification. Fluorescence of both probes closely correlated to Alizarin Red S staining in both inhibiting and stimulating conditions. In addition, both compounds displayed specificity for mineralized nodules. We therefore conclude that this method of quantification of bone mineralization using fluorescent compounds is a good alternative for the Alizarin Red S staining.

  10. Pin loosening in external skeletal fixation: a biomechanical and microstructural comparison of the near and far cortex pin-bone interfaces

    E-Print Network [OSTI]

    McDonald, Darryl Eugene

    1993-01-01T23:59:59.000Z

    ANO FAR CORTEX PIN-BONE INTERFACES A Thesis by DARRYL EUGENE MCDONALD, JR. Approved as to style and content by: Donald . Hu se (Chair of Committee) Ross H. Palmer (Member) Wi)1 A. Hyman ember) Margaret R. Slater (Member) John R. ust (Head... of Department) August 1993 ABSTRACT Pin Loosening in External Skeletal Fixation: A Biomechanical and Microstructural Comparison of the Near and Far Cortex Pin-Bone Interfaces. (August 1993) Darryl Eugene McDonald, Jr. , B. S. ; B. S. ; D. V. M. , Texas...

  11. CX3CR1 Is Expressed by Prostate Epithelial Cells and Androgens Regulate the Levels of CX3CL1/Fractalkine in the Bone Marrow

    E-Print Network [OSTI]

    Fatatis, Alessandro

    CX3CR1 Is Expressed by Prostate Epithelial Cells and Androgens Regulate the Levels of CX3CL1 human osteoblasts in vitro. Thus, the interaction of fractalkine with its receptor CX3CR1 could play a crucial role in vivo by directing circulating prostate cancer cells to the bone. We found that although CX

  12. Probing dietary change of the Kwaday Dan Ts'i`nchi individual, an ancient glacier body from British Columbia: II. Deconvoluting whole skin and bone

    E-Print Network [OSTI]

    Kohler, Tim A.

    British Columbia: II. Deconvoluting whole skin and bone collagen d13 C values via carbon isotope analysis Beattie e , Richard P. Evershed a,* a Organic Geochemistry Unit, Bristol Biogeochemistry Research Centre Department of Anthropology, Washington State University, Pullman, WA 99164-4910, USA d British Columbia

  13. Bisphosphonate-Associated Osteonecrosis of the Jaw: Report of a Task Force of the American Society for Bone and Mineral Research

    E-Print Network [OSTI]

    Dennett, Daniel

    Editorial Bisphosphonate-Associated Osteonecrosis of the Jaw: Report of a Task Force reports were also reviewed. Results and Conclusions: A case definition was developed so that subsequent studies could report on the same condition. The task force defined ONJ as the presence of exposed bone

  14. Sequential High-Impact, Free-Fall Loading and Zoledronic Acid as a Novel Pre-Treatment for Disuse-Induced Bone Loss 

    E-Print Network [OSTI]

    Boudreaux, Ramon

    2014-03-31T23:59:59.000Z

    -43). While dual-energy X-ray absorptiometry (DXA) yields two- dimensional outcomes, such as areal BMD (aBMD), QCT is capable of producing three- dimensional and compartment-specific (cortical and cancellous) properties of bone (e.g., volumetric BMD [v...

  15. Ash pelletization

    SciTech Connect (OSTI)

    Woodall, M.

    1994-12-31T23:59:59.000Z

    Ash pelletization is outlined under the following topics: projects with CSX involvement; US Generating (Cedar Bay), Jacksonville, FL; Hydra-Co (Salt City Project), Solvay, NY; Virginia Power, Yorktown Plant; US Generating; Indiantown, FL; Future Projects; Development of ash disposal site;s Reuse of ash product; and Utility Survey.

  16. The relationship between the bone mineral density and urinary cadmium concentration of residents in an industrial complex

    SciTech Connect (OSTI)

    Shin, Minah; Paek, Domyung [Institute of Health and Environment, Department of Environmental Health, School of Public Health, Seoul National University, Gwanak-599, Gwanak-gu, Seoul 151-742 (Korea, Republic of)] [Institute of Health and Environment, Department of Environmental Health, School of Public Health, Seoul National University, Gwanak-599, Gwanak-gu, Seoul 151-742 (Korea, Republic of); Yoon, Chungsik, E-mail: csyoon@snu.ac.kr [Institute of Health and Environment, Department of Environmental Health, School of Public Health, Seoul National University, Gwanak-599, Gwanak-gu, Seoul 151-742 (Korea, Republic of)] [Institute of Health and Environment, Department of Environmental Health, School of Public Health, Seoul National University, Gwanak-599, Gwanak-gu, Seoul 151-742 (Korea, Republic of)

    2011-01-15T23:59:59.000Z

    Background: An association between cadmium exposure and bone mineral density (BMD) has been demonstrated in elderly women, but has not been well studied in youths and men. Some studies report either no or a weak association between cadmium exposure and bone damage. Objectives: This study was designed to investigate the relationship between the urinary cadmium (U-Cd) levels and BMD of females and males of all ages. Methods: A total of 804 residents near an industrial complex were surveyed in 2007. U-Cd and BMD on the heel (non-dominant calcaneus) were analyzed with AAS-GTA and Dual-Energy X-ray absorptiometry, respectively. Demographic characteristics were collected by structured questionnaires. Osteoporosis and osteopenia were defined by BMD cut-off values and T-scores set by the WHO; T score>-1, normal; -2.5=}1.0 {mu}g/g creatinine) in females (OR=2.92; 95% CI, 1.51-5.64) and in males (OR=3.37; 95% CI, 1.09-10.38). With the multiple linear regression model, the BMD of the adult group was negatively associated with U-Cd (<0.05), gender (female, p<0.001) and age (p<0.001). The BMD of participants who were {<=}19 years of age was negatively associated with gender (female, p<0.01), whereas it was positively associated with age and BMI (p<0.001). BMD was not associated with exercise, smoking habits, alcohol consumption, job or parental education. Conclusion: Results suggested that U-Cd might be associated with osteopenia as well as osteoporosis in both male and female adults. Age and female gender were negatively associated with BMD in the adult group, whereas age was positively associated with BMD in the youth group. Cadmium exposure may be a potential risk factor for lower-BMD and osteopenia symptoms as well as for osteoporosis symptoms. - Research Highlights: {yields} The relationship between the urinary cadmium levels and BMD was investigated. {yields} U-Cd was associated with osteopenia and osteoporosis in adults. {yields} Cadmium exposure may be a potential risk factor for lower-BMD and osteopenia.

  17. A comparison of the concentrations of certain chlorinated hydrocarbons and polychlorinated biphenyls in bone marrow and fat tissue of children and their concentrations in breast milk

    SciTech Connect (OSTI)

    Scheele, J.; Teufel, M.; Niessen, K.H. [Univ. of Heidelberg, Mannheim (Germany)

    1995-12-31T23:59:59.000Z

    Chlorinated hydrocarbon (CHC) and polychlorinated biphenyl (PCB) concentrations in the bone marrow of 57 children were compared with the concentrations in adipose tissue of 50 children and the concentrations in breast milk in the Federal Republic of Germany from 1984 to 1991. The concentrations of hexachlorobenzene (HCB), the dichlorodiphenyl-trichlorethane (DDT)-metabolites, and polychlorinated biphenyl (PCB) congeners no. 138 and no. 153 were increased threefold, while the concentrations of several hexachloro-cyclohexane (HCH)-isomers and PCB congener no. 180 were only increased two fold. Because breast feeding is the primary source of CHC and PCB in toddlers and infants we also compared the concentrations in bone marrow of children with the concentrations in breast milk and found approximately fourfold higher concentrations for the most highly chlorinated PCB congener no. 180, but only threefold higher concentrations for PCB 138 and 153 and the DDT-metabolites. The concentrations of {beta}-HCH and HCB were only slightly higher in bone marrow. 15 refs., 2 figs.

  18. Crack Propagation in Bone on the Scale of Mineralized Collagen Fibrils : Role of Polymers with Sacrificial Bonds and Hidden Length

    E-Print Network [OSTI]

    Wenyi Wang; Ahmed Elbanna

    2014-08-04T23:59:59.000Z

    Sacrificial bonds and hidden length (SBHL) in structural molecules provide a mechanism for energy dissipation at the nanoscale. It is hypothesized that their presence leads to greater fracture toughness than what is observed in materials without such features. Here, we investigate this hypothesis using a simplified model of a mineralized collagen fibril sliding on a polymeric interface with SBHL systems. A 1D coarse-grained nonlinear spring-mass system is used to model the fibril. Rate-and-displacement constitutive equations are used to describe the mechanical properties of the polymeric system. The model quantifies how the interface toughness increases as a function of polymer density and number of sacrificial bonds. Other characteristics of the SBHL system, such as the length of hidden loops and the strength of the bonds, are found to influence the results. The model also gives insight into the variations in the mechanical behavior in response to physiological changes, such as the degree of mineralization of the collagen fibril and polymer density in the interfibrillar matrix. The model results provide constraints relevant for bio-mimetic material design and multiscale modeling of fracture in human bone.

  19. Evaluation of dual energy quantitative CT for determining the spatial distributions of red marrow and bone for dosimetry in internal emitter radiation therapy

    SciTech Connect (OSTI)

    Goodsitt, Mitchell M., E-mail: goodsitt@umich.edu; Shenoy, Apeksha; Howard, David; Christodoulou, Emmanuel; Dewaraja, Yuni K. [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Shen, Jincheng [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States)] [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States); Schipper, Matthew J. [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Wilderman, Scott [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Chun, Se Young [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)] [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)

    2014-05-15T23:59:59.000Z

    Purpose: To evaluate a three-equation three-unknown dual-energy quantitative CT (DEQCT) technique for determining region specific variations in bone spongiosa composition for improved red marrow dose estimation in radionuclide therapy. Methods: The DEQCT method was applied to 80/140 kVp images of patient-simulating lumbar sectional body phantoms of three sizes (small, medium, and large). External calibration rods of bone, red marrow, and fat-simulating materials were placed beneath the body phantoms. Similar internal calibration inserts were placed at vertebral locations within the body phantoms. Six test inserts of known volume fractions of bone, fat, and red marrow were also scanned. External-to-internal calibration correction factors were derived. The effects of body phantom size, radiation dose, spongiosa region segmentation granularity [single (?17 × 17 mm) region of interest (ROI), 2 × 2, and 3 × 3 segmentation of that single ROI], and calibration method on the accuracy of the calculated volume fractions of red marrow (cellularity) and trabecular bone were evaluated. Results: For standard low dose DEQCT x-ray technique factors and the internal calibration method, the RMS errors of the estimated volume fractions of red marrow of the test inserts were 1.2–1.3 times greater in the medium body than in the small body phantom and 1.3–1.5 times greater in the large body than in the small body phantom. RMS errors of the calculated volume fractions of red marrow within 2 × 2 segmented subregions of the ROIs were 1.6–1.9 times greater than for no segmentation, and RMS errors for 3 × 3 segmented subregions were 2.3–2.7 times greater than those for no segmentation. Increasing the dose by a factor of 2 reduced the RMS errors of all constituent volume fractions by an average factor of 1.40 ± 0.29 for all segmentation schemes and body phantom sizes; increasing the dose by a factor of 4 reduced those RMS errors by an average factor of 1.71 ± 0.25. Results for external calibrations exhibited much larger RMS errors than size matched internal calibration. Use of an average body size external-to-internal calibration correction factor reduced the errors to closer to those for internal calibration. RMS errors of less than 30% or about 0.01 for the bone and 0.1 for the red marrow volume fractions would likely be satisfactory for human studies. Such accuracies were achieved for 3 × 3 segmentation of 5 mm slice images for: (a) internal calibration with 4 times dose for all size body phantoms, (b) internal calibration with 2 times dose for the small and medium size body phantoms, and (c) corrected external calibration with 4 times dose and all size body phantoms. Conclusions: Phantom studies are promising and demonstrate the potential to use dual energy quantitative CT to estimate the spatial distributions of red marrow and bone within the vertebral spongiosa.

  20. Fibroblast growth factor 2 inhibits up-regulation of bone morphogenic proteins and their receptors during osteoblastic differentiation of human mesenchymal stem cells

    SciTech Connect (OSTI)

    Biver, Emmanuel, E-mail: ebiver@yahoo.fr [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France) [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Department of Rheumatology, Lille University Hospital, Roger Salengro Hospital, 59037 Lille cedex (France); Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland); Soubrier, Anne-Sophie [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France) [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Department of Rheumatology, Lille University Hospital, Roger Salengro Hospital, 59037 Lille cedex (France); Thouverey, Cyril [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland)] [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland); Cortet, Bernard [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France) [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Department of Rheumatology, Lille University Hospital, Roger Salengro Hospital, 59037 Lille cedex (France); Broux, Odile [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France)] [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France); Caverzasio, Joseph [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland)] [Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14 (Switzerland); Hardouin, Pierre [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France)] [Physiopathology of Inflammatory Bone Diseases, EA 4490, University Lille North of France, Quai Masset, Bassin Napoleon, BP120, 62327 Boulogne sur Mer (France)

    2012-11-02T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer FGF modulates BMPs pathway in HMSCs by down-regulating BMP/BMPR expression. Black-Right-Pointing-Pointer This effect is mediated by ERK and JNK MAPKs pathways. Black-Right-Pointing-Pointer Crosstalk between FGF and BMPs must be taken into account in skeletal bioengineering. Black-Right-Pointing-Pointer It must also be considered in the use of recombinant BMPs in orthopedic and spine surgeries. -- Abstract: Understanding the interactions between growth factors and bone morphogenic proteins (BMPs) signaling remains a crucial issue to optimize the use of human mesenchymal stem cells (HMSCs) and BMPs in therapeutic perspectives and bone tissue engineering. BMPs are potent inducers of osteoblastic differentiation. They exert their actions via BMP receptors (BMPR), including BMPR1A, BMPR1B and BMPR2. Fibroblast growth factor 2 (FGF2) is expressed by cells of the osteoblastic lineage, increases their proliferation and is secreted during the healing process of fractures or in surgery bone sites. We hypothesized that FGF2 might influence HMSC osteoblastic differentiation by modulating expressions of BMPs and their receptors. BMP2, BMP4, BMPR1A and mainly BMPR1B expressions were up-regulated during this differentiation. FGF2 inhibited HMSCs osteoblastic differentiation and the up-regulation of BMPs and BMPR. This effect was prevented by inhibiting the ERK or JNK mitogen-activated protein kinases which are known to be activated by FGF2. These data provide a mechanism explaining the inhibitory effect of FGF2 on osteoblastic differentiation of HMSCs. These crosstalks between growth and osteogenic factors should be considered in the use of recombinant BMPs in therapeutic purpose of fracture repair or skeletal bioengineering.

  1. The effects of zeranol and two dietary levels of calcium and phosphorus on performance, carcass and bone characteristics, and calcium status in feedlot lambs

    E-Print Network [OSTI]

    Hutcheson, John Paul

    1991-01-01T23:59:59.000Z

    of parathyroid hormone (PTH) and Ca. Lambs were assigned to either an implant or non-implant treatment group, and either a high dietary Ca(. 84) and P(. 64) or normal dietary Ca(. 44) and P(. 3 ' ) in a 2 X 2 factorial arrangement of treatments. Lambs were... to determine the effects of zeranol and two dietary levels of Ca and P on performance, carcass and bone charateristics, serum parathyroid hormone and Ca concentrations. Lambs were randomly assigned to either an implant or non-implant treatment group...

  2. Lead effects on development and function of bone marrow-derived dendritic cells promote Th2 immune responses

    SciTech Connect (OSTI)

    Gao Donghong [Biggs Laboratory, Wadsworth Center, New York State Department of Health, Empire State Plaza, Albany, NY 12201-0509 (United States); Mondal, Tapan K. [Biggs Laboratory, Wadsworth Center, New York State Department of Health, Empire State Plaza, Albany, NY 12201-0509 (United States); Lawrence, David A. [Biggs Laboratory, Wadsworth Center, New York State Department of Health, Empire State Plaza, Albany, NY 12201-0509 (United States)]. E-mail: lawrencd@wadsworth.org

    2007-07-01T23:59:59.000Z

    Although lead (Pb) has significant effects on the development and function of macrophages, B cells, and T cells and has been suggested to promote allergic asthma in mice and humans, Pb modulation of bone marrow (BM)-derived dendritic cells (DCs) and the resultant DC effects on Th1 and Th2 development have not been examined. Accordingly, we cultured BM cells with murine granulocyte macrophage-colony stimulating factor (mGM-CSF) {+-} PbCl{sub 2}. At day 10, culture supernatant (SN) and non-adherent cells were harvested for analysis. Additionally, day 10 non-adherent BM-DCs were harvested and recultured with mGM-CSF + LPS {+-} Pb for 2 days. The day 10 Pb exposure significantly inhibited BM-DC generation, based on CD11c expression. Although fewer DCs were generated with Pb, the existing Pb-exposed DCs had significantly greater MHC-II expression than did the non-Pb-exposed DCs. However, these differences diminished upon LPS stimulation. After LPS stimulation, CD80, CD86, CD40, CD54, and MHC-II were all up-regulated on both Pb-DCs and DCs, but Pb-DCs expressed significantly less CD80 than did DCs. The CD86:CD80 ratio suggests a Pb-DC potential for Th2 cell development. After LPS stimulation, IL-6, IL-10, IL-12 (p70), and TNF-{alpha} levels significantly increased with both Pb-DCs and DCs, but Pb-DCs produced significantly less cytokines than did DCs, except for IL-10, which further supports Pb-DC preferential skewing toward type-2 immunity. In vitro studies confirm that Pb-DCs have the ability to polarize antigen-specific T cells to Th2 cells. Pb-DCs also enhanced allogeneic and autologous T cell proliferation in vitro, and in vivo studies suggested that Pb-DCs inhibited Th1 effects on humoral and cell-mediated immunity. The Pb effect was mainly on DCs, rather than on T cells, and Pb's modification of DC function appears to be the main cause of Pb's promotion of type-2-related immunity, which may relate to Pb's enhanced activation of the Erk/MAP kinase pathway.

  3. Clonal deletion of self-reactive T cells in irradiation bone marrow chimeras and neonatally tolerant mice. Evidence for intercellular transfer of Mlsa

    SciTech Connect (OSTI)

    Speiser, D.E.; Schneider, R.; Hengartner, H.; MacDonald, H.R.; Zinkernagel, R.M. (Univ. Hospital, Zuerich (Switzerland))

    1989-08-01T23:59:59.000Z

    Tolerance to Mlsa has been shown to be associated with clonal deletion of cells carrying TCR beta chain variable regions V beta 6 or V beta 8.1 in mice possessing I-E antigens. To evaluate the rules of tolerance induction to Mlsa we prepared irradiation bone marrow chimeras expressing Mlsa or Mlsb and I-E by different cell types. Deletion of V beta 6+, Mlsa-reactive T cells required the presence of Mlsa and I-E products either on bone marrow-derived cells or on irradiated recipient cells. Tolerance was induced when Mlsa and I-E were expressed by distinct cells of the chimera. Also neonatally tolerized mice exhibited depletion of V beta 6+ cells after injection of I-E- Mlsa spleen cells (DBA/1) into newborn I-E+ Mlsb mice (BALB/c x B10.G)F1. These results suggest that the product of the Mlsa locus is soluble and/or may be transferred from cell to cell and bound to I-E antigens. The chimera experiments also showed that tolerance to Mlsa is H-2 allele independent, i.e., is apparently unrestricted. Differentiation of chimeric (H-2d/Mlsa x H-2q/Mlsb)F1 stem cells in either an H-2d or an H-2q thymus revealed that tolerance assessed by absence of V beta 6+ T cells is not dependent on the thymically determined restriction specificity of T cells.

  4. Photoacoustic and ultrasonic probing of bone density in ex-vivo animal tissues The purpose of the proposed research is to develop fundamental physical, instrumental and biological aspects of two novel

    E-Print Network [OSTI]

    of bone deterioration and loss (osteoporosis) occurring in (mainly) post-menopausal women on Earth and in a weightlessness (or microgravity) environment, known as disuse osteoporosis. One student will be involved diagnosis and monitoring of osteoporosis on Earth- and space-based patients. The 4th year thesis student

  5. A dual model HU conversion from MRI intensity values within and outside of bone segment for MRI-based radiotherapy treatment planning of prostate cancer

    SciTech Connect (OSTI)

    Korhonen, Juha, E-mail: juha.p.korhonen@hus.fi [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland) [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland); Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland); Kapanen, Mika [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland) [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland); Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland); Department of Medical Physics, Tampere University Hospital, POB-2000, 33521 Tampere (Finland); Keyriläinen, Jani; Seppälä, Tiina; Tenhunen, Mikko [Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland)] [Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland)

    2014-01-15T23:59:59.000Z

    Purpose: The lack of electron density information in magnetic resonance images (MRI) poses a major challenge for MRI-based radiotherapy treatment planning (RTP). In this study the authors convert MRI intensity values into Hounsfield units (HUs) in the male pelvis and thus enable accurate MRI-based RTP for prostate cancer patients with varying tissue anatomy and body fat contents. Methods: T{sub 1}/T{sub 2}*-weighted MRI intensity values and standard computed tomography (CT) image HUs in the male pelvis were analyzed using image data of 10 prostate cancer patients. The collected data were utilized to generate a dual model HU conversion technique from MRI intensity values of the single image set separately within and outside of contoured pelvic bones. Within the bone segment local MRI intensity values were converted to HUs by applying a second-order polynomial model. This model was tuned for each patient by two patient-specific adjustments: MR signal normalization to correct shifts in absolute intensity level and application of a cutoff value to accurately represent low density bony tissue HUs. For soft tissues, such as fat and muscle, located outside of the bone contours, a threshold-based segmentation method without requirements for any patient-specific adjustments was introduced to convert MRI intensity values into HUs. The dual model HU conversion technique was implemented by constructing pseudo-CT images for 10 other prostate cancer patients. The feasibility of these images for RTP was evaluated by comparing HUs in the generated pseudo-CT images with those in standard CT images, and by determining deviations in MRI-based dose distributions compared to those in CT images with 7-field intensity modulated radiation therapy (IMRT) with the anisotropic analytical algorithm and 360° volumetric-modulated arc therapy (VMAT) with the Voxel Monte Carlo algorithm. Results: The average HU differences between the constructed pseudo-CT images and standard CT images of each test patient ranged from ?2 to 5 HUs and from 22 to 78 HUs in soft and bony tissues, respectively. The average local absolute value differences were 11 HUs in soft tissues and 99 HUs in bones. The planning target volume doses (volumes 95%, 50%, 5%) in the pseudo-CT images were within 0.8% compared to those in CT images in all of the 20 treatment plans. The average deviation was 0.3%. With all the test patients over 94% (IMRT) and 92% (VMAT) of dose points within body (lower than 10% of maximum dose suppressed) passed the 1 mm and 1% 2D gamma index criterion. The statistical tests (t- and F-tests) showed significantly improved (p ? 0.05) HU and dose calculation accuracies with the soft tissue conversion method instead of homogeneous representation of these tissues in MRI-based RTP images. Conclusions: This study indicates that it is possible to construct high quality pseudo-CT images by converting the intensity values of a single MRI series into HUs in the male pelvis, and to use these images for accurate MRI-based prostate RTP dose calculations.

  6. E n g i n E E r i n g t h E F u t u r E o F r o b o t i c s bone-chilling cold. blistering heat. toxic fumes.

    E-Print Network [OSTI]

    Gupta, Abhinav

    E n g i n E E r i n g t h E F u t u r E o F r o b o t i c s bone-chilling cold. blistering heat automation technologies for the oil & gas industry Explorer travels untethered through natural gas mains and wastewater with- out harming the environment. ENVIROBOT® is in daily use at shipyards and storage facili

  7. Randomized, Double-Blinded, Placebo-Controlled, Trial of Risedronate for the Prevention of Bone Mineral Density Loss in Nonmetastatic Prostate Cancer Patients Receiving Radiation Therapy Plus Androgen Deprivation Therapy

    SciTech Connect (OSTI)

    Choo, Richard [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States)] [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Lukka, Himu [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada)] [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada); Cheung, Patrick [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada)] [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada); Corbett, Tom [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada)] [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada); Briones-Urbina, Rosario [Department of Medicine, Women's College Hospital, University of Toronto, Toronto (Canada)] [Department of Medicine, Women's College Hospital, University of Toronto, Toronto (Canada); Vieth, Reinhold [Departments of Nutritional Sciences and Laboratory Medicine and Pathology, Mount Sinai Hospital, University of Toronto, Toronto (Canada)] [Departments of Nutritional Sciences and Laboratory Medicine and Pathology, Mount Sinai Hospital, University of Toronto, Toronto (Canada); Ehrlich, Lisa [Department of Radiology, Sunnybrook Health Sciences Center, University of Toronto (Canada)] [Department of Radiology, Sunnybrook Health Sciences Center, University of Toronto (Canada); Kiss, Alex [Department of Health Policy, Management, and Evaluation, Sunnybrook Health Sciences Center, University of Toronto, Toronto (Canada)] [Department of Health Policy, Management, and Evaluation, Sunnybrook Health Sciences Center, University of Toronto, Toronto (Canada); Danjoux, Cyril, E-mail: Cyril.danjoux@sunnybrook.ca [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada)] [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada)

    2013-04-01T23:59:59.000Z

    Purpose: Androgen deprivation therapy (ADT) has been used as an adjuvant treatment to radiation therapy (RT) for the management of locally advanced prostate carcinoma. Long-term ADT decreases bone mineral density (BMD) and increases the risk of osteoporosis. The objective of this clinical trial was to evaluate the efficacy of risedronate for the prevention of BMD loss in nonmetastatic prostate cancer patients undergoing RT plus 2 to 3 years of ADT. Methods and Materials: A double-blinded, placebo-controlled, randomized trial was conducted for nonmetastatic prostate cancer patients receiving RT plus 2 to 3 years of ADT. All had T scores > ?2.5 on dual energy x-ray absorptiometry at baseline. Patients were randomized 1:1 between risedronate and placebo for 2 years. The primary endpoints were the percent changes in the BMD of the lumbar spine at 1 and 2 years from baseline, measured by dual energy x-ray absorptiometry. Analyses of the changes in BMD and bone turnover biomarkers were carried out by comparing mean values of the intrapatient changes between the 2 arms, using standard t tests. Results: One hundred four patients were accrued between 2004 and 2007, with 52 in each arm. Mean age was 66.8 and 67.5 years for the placebo and risedronate, respectively. At 1 and 2 years, mean (±SE) BMD of the lumbar spine decreased by 5.77% ± 4.66% and 13.55% ± 6.33%, respectively, in the placebo, compared with 0.12% ± 1.29% at 1 year (P=.2485) and 0.85% ± 1.56% (P=.0583) at 2 years in the risedronate. The placebo had a significant increase in serum bone turnover biomarkers compared with the risedronate. Conclusions: Weekly oral risedronate prevented BMD loss at 2 years and resulted in significant suppression of bone turnover biomarkers for 24 months for patients receiving RT plus 2 to 3 years of ADT.

  8. Epitopes associated with the MHC restriction site of T cells. II. Somatic generation of Iat epitopes on T cells in radiation bone marrow chimeras

    SciTech Connect (OSTI)

    Asano, Y.; Tada, T.

    1987-01-01T23:59:59.000Z

    We described in this paper systematic alterations in the expression of unique I region controlled epitopes on helper T cells (Th) in chimeras according to the changes in their H-2 restriction specificity. Taking advantage of the reactivity of monoclonal antibodies (anti-Iat) putatively specific for the epitopes indirectly controlled by I region and expressed in association with the Iak restriction site of Th, we examined the alterations of these epitopes on Th cells from various bone marrow chimeras. Iatk epitopes were physiologically expressed on Iak-restricted but not on Iab-restricted Th cells in (H-2k X H-2b)F1 mice. In the chimeric condition, the H-2k-restricted Th of B6----F1 chimera acquired the expression of Iatk even though B6 Th is unable to express Iatk when developed under the physiologic condition. Iatk are also found on Th of fully allogeneic chimera of B6----C3H, whereas Th cells of C3H----B6 completely lost the Iatk expression. These results indicate that Iat epitopes originally defined as unique I region-controlled determinants selectively expressed on T cells are not encoded by the I region genes but are associated with the T cell receptor that sees the self Ia. The epitopes undergo the adaptive alterations according to the acquisition of a new MHC restriction. This is the first example to demonstrate the epitope associated with T cell receptor which undergo the systematic adaptive differentiation.

  9. Differentiation and functional maturation of bone marrow-derived intestinal epithelial T cells expressing membrane T cell receptor in athymic radiation chimeras

    SciTech Connect (OSTI)

    Mosley, R.L.; Styre, D.; Klein, J.R. (Univ. of Tulsa, OK (USA))

    1990-09-01T23:59:59.000Z

    The thymus dependency of murine intestinal intraepithelial lymphocytes (IEL) was studied in an athymic F1----parent radiation chimera model. IEL, although not splenic or lymph node lymphocytes, from athymic chimeras displayed normal levels of cells bearing the class-specific T cell Ag, CD4 and CD8; the TCR-associated molecule, CD3; and the Thy-1 Ag. Moreover, two-color flow cytometric analyses of IEL from athymic mice demonstrated regulated expression of T cell Ag characteristic of IEL subset populations from thymus-bearing mice. In immunoprecipitation experiments, surface TCR-alpha beta or TCR-gamma delta were expressed on IEL, although not on splenic lymphocytes, from athymic chimeras. That IEL from athymic chimeras constituted a population of functionally mature effector cells activated in situ, similar to IEL from thymus-bearing mice, was demonstrated by the presence of CD3-mediated lytic activity of athymic lethally irradiated bone marrow reconstituted IEL. These data provide compelling evidence that intestinal T cells do not require thymic influence for maturation and development, and demonstrate that the microenvironment of the intestinal epithelium is uniquely adapted to regulate IEL differentiation.

  10. Calibration Human Voxel Phantoms for In Vivo Measurement of ''2 sup 4 sup 1 Am in Bone at the Whole Body Counter Facility of CIEMAT

    E-Print Network [OSTI]

    Moraleda, M; Navarro, J F; Navarro, T

    2002-01-01T23:59:59.000Z

    The Whole Body Counting facility of CIEMAT is capable of carrying out In-Vivo measurements of radionuclides emitting X-rays and low energy gamma radiation internally deposited in the body. The system to use for this purpose consists of flour Low energy Germanium (LeGe) Camberra detectors working in the energy range from 10 to 1000 keV. Physical phantoms with a known contamination in the organ of interest are normally used for the calibration of the LEGe detection system. In this document we present a calibration method using the Monte Carlo technique (MCNP4C) over a voxel phantom obtained from a computerized tomography of a real human head. The phantom consists of 104017 (43x59x41) cubic voxels, 4 mn on each side, os specific tissues, but for this simulation only two types are taken into account: adipose tissue and hard bone. The skull is supposed to be contaminated with ''241 Am and the trajectories of the photons are simulated till they reach the germanium detectors. The detectors were also simulated in det...

  11. Continuous high expression of XBP1 and GRP78 is important for the survival of bone marrow cells in CCl{sub 4}-treated cirrhotic liver

    SciTech Connect (OSTI)

    Marumoto, Yoshio [Department of Gastroenterology and Hepatology, Yamaguchi University Graduate School of Medicine, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan); Terai, Shuji [Department of Gastroenterology and Hepatology, Yamaguchi University Graduate School of Medicine, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan)], E-mail: terais@yamaguchi-u.ac.jp; Urata, Yohei; Matsumoto, Toshihiko; Mizunaga, Yuko; Yamamoto, Naoki; Jin, Haiyan; Fujisawa, Koichi [Department of Gastroenterology and Hepatology, Yamaguchi University Graduate School of Medicine, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan); Murata, Tomoaki [Science Research Center, Yamaguchi University, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan); Shinoda, Koh [Department of Neuroanatomy and Neuroscience, Yamaguchi University School of Medicine, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan); Nishina, Hiroshi [Department of Developmental and Regenerative Biology, Medical Research Institute, Tokyo Medical and Dental University, 1-5-45, Yushima, Bunkyo-ku, Tokyo 113-8510 (Japan); Sakaida, Isao [Department of Gastroenterology and Hepatology, Yamaguchi University Graduate School of Medicine, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505 (Japan)

    2008-03-14T23:59:59.000Z

    We have previously shown that infusion of bone marrow cells (BMC) improves CCl{sub 4}-induced cirrhosis. However, it is unclear why the injected BMC are resistant to CCl{sub 4} damage and subsequently improve the local microenvironment in damaged liver. To analyze the cellular phenomena involved in this process, we studied the damaged liver using electron microscopy. We found that CCl{sub 4} caused rough endoplasmic reticula to swell in hepatocytes. To analyze the gene expression patterns associated with this process, we conducted PCR-selected suppressive subtractive hybridization. We found that expression levels of HSP84, HSP40, and XBP1 differed markedly between control liver and liver infused with BMC. Immunohistochemical staining revealed that expression levels of HSP84 and HSP40 were markedly higher in the early phase of differentiation immediately after BMC infusion, but decreased over time. XBP1 expression remained high during the late phase, and GRP78 expression increased with XBP1 activation. We also found that GFP-positive BMC expressed XBP1 and GRP78. XBP1 and GRP78 are associated with ER stress. Thus, continuous high XBP1 and GRP78 expression might be essential for the survival and proliferation of BMC in a CCl{sub 4}-induced persistent liver damage environment.

  12. Bone-derived mesenchymal stromal cells from HIV transgenic mice exhibit altered proliferation, differentiation capacity and paracrine functions along with impaired therapeutic potential in kidney injury

    SciTech Connect (OSTI)

    Cheng, Kang; Rai, Partab; Lan, Xiqian; Plagov, Andrei; Malhotra, Ashwani [Feinstein Institute for Medical Research, North Shore-Long Island Jewish Health System, Manhassett, NY (United States); Gupta, Sanjeev [Departments of Medicine and Pathology, Marion Bessin Liver Research Center, Diabetes Center, Cancer Center, Ruth L. and David S. Gottesman Institute for Stem Cell and Regenerative Medicine Research, Institute for Clinical and Translational Research, Albert Einstein College of Medicine, Bronx, NY (United States); Singhal, Pravin C., E-mail: psinghal@nshs.edu [Feinstein Institute for Medical Research, North Shore-Long Island Jewish Health System, Manhassett, NY (United States)

    2013-08-15T23:59:59.000Z

    Mesenchymal stem cells (MSCs) secrete paracrine factors that could be cytoprotective and serve roles in immunoregulation during tissue injury. Although MSCs express HIV receptors, and co-receptors, and are susceptible to HIV infection, whether HIV-1 may affect biological properties of MSCs needs more study. We evaluated cellular proliferation, differentiation and paracrine functions of MSCs isolated from compact bones of healthy control mice and Tg26 HIV-1 transgenic mice. The ability of MSCs to protect against cisplatin toxicity was studied in cultured renal tubular cells as well as in intact mice. We successfully isolated MSCs from healthy mice and Tg26 HIV-1 transgenic mice and found the latter expressed viral Nef, Vpu, NL4-3 and Vif genes. The proliferation and differentiation of Tg26 HIV-1 MSCs was inferior to MSCs from healthy mice. Moreover, transplantation of Tg26 HIV-1 MSCs less effectively improved outcomes compared with healthy MSCs in mice with acute kidney injury. Also, Tg26 HIV-1 MSCs secreted multiple cytokines, but at significantly lower levels than healthy MSCs, which resulted in failure of conditioned medium from these MSCs to protect cultured renal tubular cells from cisplatin toxicity. Therefore, HIV-1 had adverse biological effects on MSCs extending to their proliferation, differentiation, function, and therapeutic potential. These findings will help in advancing mechanistical insight in renal injury and repair in the setting of HIV-1 infection. -- Highlights: •MSCs isolated from HIV mice displayed HIV genes. •MSCs isolated from HIV mice exhibited attenuated growth and paracrine functions. •AKI mice with transplanted HIV-MSC displayed poor outcome. •HIV-1 MSC secreted multiple cytokines but at a lower level.

  13. Activation of fly ash

    DOE Patents [OSTI]

    Corbin, D.R.; Velenyi, L.J.; Pepera, M.A.; Dolhyj, S.R.

    1986-08-19T23:59:59.000Z

    Fly ash is activated by heating a screened magnetic fraction of the ash in a steam atmosphere and then reducing, oxidizing and again reducing the hydrothermally treated fraction. The activated fly ash can be used as a carbon monoxide disproportionating catalyst useful in the production of hydrogen and methane.

  14. Activation of fly ash

    DOE Patents [OSTI]

    Corbin, David R. (New Castle, DE); Velenyi, Louis J. (Lyndhurst, OH); Pepera, Marc A. (Northfield, OH); Dolhyj, Serge R. (Parma, OH)

    1986-01-01T23:59:59.000Z

    Fly ash is activated by heating a screened magnetic fraction of the ash in a steam atmosphere and then reducing, oxidizing and again reducing the hydrothermally treated fraction. The activated fly ash can be used as a carbon monoxide disproportionating catalyst useful in the production of hydrogen and methane.

  15. Fly ash carbon passivation

    DOE Patents [OSTI]

    La Count, Robert B; Baltrus, John P; Kern, Douglas G

    2013-05-14T23:59:59.000Z

    A thermal method to passivate the carbon and/or other components in fly ash significantly decreases adsorption. The passivated carbon remains in the fly ash. Heating the fly ash to about 500 and 800 degrees C. under inert gas conditions sharply decreases the amount of surfactant adsorbed by the fly ash recovered after thermal treatment despite the fact that the carbon content remains in the fly ash. Using oxygen and inert gas mixtures, the present invention shows that a thermal treatment to about 500 degrees C. also sharply decreases the surfactant adsorption of the recovered fly ash even though most of the carbon remains intact. Also, thermal treatment to about 800 degrees C. under these same oxidative conditions shows a sharp decrease in surfactant adsorption of the recovered fly ash due to the fact that the carbon has been removed. This experiment simulates the various "carbon burnout" methods and is not a claim in this method. The present invention provides a thermal method of deactivating high carbon fly ash toward adsorption of AEAs while retaining the fly ash carbon. The fly ash can be used, for example, as a partial Portland cement replacement in air-entrained concrete, in conductive and other concretes, and for other applications.

  16. Elevated extracellular calcium increases expression of bone morphogenetic protein-2 gene via a calcium channel and ERK pathway in human dental pulp cells

    SciTech Connect (OSTI)

    Tada, Hiroyuki [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)] [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Nemoto, Eiji, E-mail: e-nemoto@umin.ac.jp [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)] [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan); Kanaya, Sousuke; Hamaji, Nozomu; Sato, Hisae; Shimauchi, Hidetoshi [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)] [Division of Periodontology and Endodontology, Tohoku University Graduate School of Dentistry, Sendai 980-8575 (Japan)

    2010-04-16T23:59:59.000Z

    Dental pulp cells, which have been shown to share phenotypical features with osteoblasts, are capable of differentiating into odontoblast-like cells and generating a dentin-like mineral structure. Elevated extracellular Ca{sup 2+}Ca{sub o}{sup 2+} has been implicated in osteogenesis by stimulating the proliferation and differentiation of osteoblasts; however, the role of Ca{sub o}{sup 2+} signaling in odontogenesis remains unclear. We found that elevated Ca{sub o}{sup 2+} increases bone morphogenetic protein (BMP)-2 gene expression in human dental pulp cells. The increase was modulated not only at a transcriptional level but also at a post-transcriptional level, because treatment with Ca{sup 2+} increased the stability of BMP-2 mRNA in the presence of actinomycin D, an inhibitor of transcription. A similar increase in BMP-2 mRNA level was observed in other human mesenchymal cells from oral tissue; periodontal ligament cells and gingival fibroblasts. However, the latter cells exhibited considerably lower expression of BMP-2 mRNA compared with dental pulp cells and periodontal ligament cells. The BMP-2 increase was markedly inhibited by pretreatment with an extracellular signal-regulated kinase (ERK) inhibitor, PD98059, and partially inhibited by the L-type Ca{sup 2+} channels inhibitor, nifedipine. However, pretreatment with nifedipine had no effect on ERK1/2 phosphorylation triggered by Ca{sup 2+}, suggesting that the Ca{sup 2+} influx from Ca{sup 2+} channels may operate independently of ERK signaling. Dental pulp cells do not express the transcript of Ca{sup 2+}-sensing receptors (CaSR) and only respond slightly to other cations such as Sr{sup 2+} and spermine, suggesting that dental pulp cells respond to Ca{sub o}{sup 2+} to increase BMP-2 mRNA expression in a manner different from CaSR and rather specific for Ca{sub o}{sup 2+} among cations.

  17. Study on proliferative responses to host Ia antigens in allogeneic bone marrow chimera in mice: sequential analysis of the reactivity and characterization of the cells involved in the responses

    SciTech Connect (OSTI)

    Iwabuchi, K.; Ogasawara, K.; Ogasawara, M.; Yasumizu, R.; Noguchi, M.; Geng, L.; Fujita, M.; Good, R.A.; Onoe, K.

    1987-01-01T23:59:59.000Z

    Irradiation bone marrow chimeras were established by reconstitution of lethally irradiated AKR mice with C57BL/10 marrow cells to permit serial analysis of the developing reactivities of lymphocytes from such chimeras, (B10----AKR), against donor, host, or third party antigens. We found that substantial proliferative responses to Ia antigens of the recipient strain and also to third party antigens were generated by the thymocytes obtained from the irradiation chimeras at an early stage after bone marrow reconstitution. The majority of the responding thymocytes had surfaces lacking demonstrable peanut agglutinin receptors and were donor type Thy-1+, Ly-2-, and L3T4+ in both anti-recipient and anti-third party MLR. In anti-host responses, however, Ly-2+ thymocytes seemed to be at least partially involved. This capacity of thymus cells to mount a response to antigens of the recipient strain declined shortly thereafter, whereas the capacity to mount MLR against third party antigens persisted. The spleen cells of (B10----AKR) chimeras at the same time developed a more durable capability to exhibit anti-host reactivities and a permanent capability of reacting to third party allo-antigens. The stimulator antigens were Ia molecules on the stimulator cells in both anti-recipient and anti-third party MLR. The responding splenocytes were of donor origin and most of them had Thy-1+, Ly-1+2-, and L3T4+ phenotype.

  18. Evaluation of Bone Fixation Implants 

    E-Print Network [OSTI]

    Perkins, Luke 1990-

    2012-12-10T23:59:59.000Z

    This research investigates the effects of the human body on the mechanical, chemical, and morphological properties of the surface of internal fixation devices. Stainless steel and titanium devices that had failed were provided from the Shandong...

  19. Evaluation of Bone Fixation Implants

    E-Print Network [OSTI]

    Perkins, Luke 1990-

    2012-12-10T23:59:59.000Z

    This research investigates the effects of the human body on the mechanical, chemical, and morphological properties of the surface of internal fixation devices. Stainless steel and titanium devices that had failed were provided from the Shandong...

  20. Systemic atherosclerosis and bone density

    E-Print Network [OSTI]

    Hyder, Joseph Anthony

    2006-01-01T23:59:59.000Z

    Woo and P. C. Leung (2005). "Osteoporosis is associated withV. Chomka (1998). "Osteoporosis and coronary atherosclerosisV. Chomka (1998). "Osteoporosis and coronary atherosclerosis

  1. Systemic atherosclerosis and bone density

    E-Print Network [OSTI]

    Hyder, Joseph Anthony

    2006-01-01T23:59:59.000Z

    K. Liu, J. C. Nelson, D. O'Leary, M. F. Saad, S. Shea, M.K. Liu, J. C. Nelson, D. O'Leary, M. F. Saad, S. Shea, M.J. W. MacCluer, D. H. O'Leary and B. D. Mitchell (2004). "

  2. Ashing properties of coal blends

    SciTech Connect (OSTI)

    Biggs, D.L.

    1982-03-01T23:59:59.000Z

    The fusion properties of sulfur materials present in coals were investigated. The treatment of the samples of eleven different coals is described. Thermal treatment of low temperature ashing (LTA) concentrates of eight of the coals was performed, and raw and wash ashing curves were examined to determine what quantitative correlations, if any, exist between ashing parameters and rank of coal. The actual form of the function which describes the ashing curve is derived.

  3. Coal ash utilization in India

    SciTech Connect (OSTI)

    Michalski, S.R.; Brendel, G.F.; Gray, R.E. [GAI Consultants, Inc., Pittsburgh, PA (United States)

    1998-12-31T23:59:59.000Z

    This paper describes methods of coal combustion product (CCP) management successfully employed in the US and considers their potential application in India. India produces about 66 million tons per year (mty) of coal ash from the combustion of 220 mty of domestically produced coal, the average ash content being about 30--40 percent as opposed to an average ash content of less than 10 percent in the US In other words, India produces coal ash at about triple the rate of the US. Currently, 95 percent of this ash is sluiced into slurry ponds, many located near urban centers and consuming vast areas of premium land. Indian coal-fired generating capacity is expected to triple in the next ten years, which will dramatically increase ash production. Advanced coal cleaning technology may help reduce this amount, but not significantly. Currently India utilizes two percent of the CCP`s produced with the remainder being disposed of primarily in large impoundments. The US utilizes about 25 percent of its coal ash with the remainder primarily being disposed of in nearly equal amounts between dry landfills and impoundments. There is an urgent need for India to improve its ash management practice and to develop efficient and environmentally sound disposal procedures as well as high volume ash uses in ash haulback to the coalfields. In addition, utilization should include: reclamation, structural fill, flowable backfill and road base.

  4. E-Print Network 3.0 - ash bottom ash Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Summary: of bottom ash, 3 million tons of boiler slag, and 28 million tons of clean-coal ash materials) were produced... CONTAINING CLEAN-COAL ASH AND CLASS F FLY ASH By...

  5. Modeling volcanic ash dispersal

    ScienceCinema (OSTI)

    None

    2011-10-06T23:59:59.000Z

    Explosive volcanic eruptions inject into the atmosphere large amounts of volcanic material (ash, blocks and lapilli). Blocks and larger lapilli follow ballistic and non-ballistic trajectories and fall rapidly close to the volcano. In contrast, very fine ashes can remain entrapped in the atmosphere for months to years, and may affect the global climate in the case of large eruptions. Particles having sizes between these two end-members remain airborne from hours to days and can cover wide areas downwind. Such volcanic fallout entails a serious threat to aircraft safety and can create many undesirable effects to the communities located around the volcano. The assessment of volcanic fallout hazard is an important scientific, economic, and political issue, especially in densely populated areas. From a scientific point of view, considerable progress has been made during the last two decades through the use of increasingly powerful computational models and capabilities. Nowadays, models are used to quantify hazard scenarios and/or to give short-term forecasts during emergency situations. This talk will be focused on the main aspects related to modeling volcanic ash dispersal and fallout with application to the well known problem created by the Eyjafjöll volcano in Iceland. Moreover, a short description of the main volcanic monitoring techniques is presented.

  6. Ash deposit workshop: Class outline

    SciTech Connect (OSTI)

    Hatt, R. [Commercial Testing & Engineering Co., Lexington, KY (United States)

    1996-12-31T23:59:59.000Z

    Ash deposits formed from the combustion of coal and other fuels have plagued the steam production industry from the start. The ash fusion test has been around for over eighty years. As steam plant size increased, so have the problems associated with ash deposits. This workshop is designed to cover: (1) The basic types of deposits. (2) Causes of deposits. (3) Analytical procedures for resolving, or at least providing information about deposits and fuels, and (4) Deposit removal and reduction techniques.

  7. Post-bone-marrow-transplant leukemia cutis

    E-Print Network [OSTI]

    2013-01-01T23:59:59.000Z

    of myeloid neoplasms and acute leukemia: rationale andextramedullary acute myeloid leukemia. Blood . 2011 Oct 6;transplantation for acute myelogenous leukemia with leukemia

  8. Effects of osteoporosis therapies on bone biomechanics

    E-Print Network [OSTI]

    Easley, Sarah Kathleen

    2010-01-01T23:59:59.000Z

    Data 55 kVp, BH: 200 mg HA/ccm, Scaling Calib. defaultDensity) Density: unit mg HA/ccm Density: slope 2.62261993e+Data 55 kVp, BH: 200 mg HA/ccm, Scaling Calib. default unit

  9. Fracture, aging and disease in bone

    E-Print Network [OSTI]

    Ager, J.W.; Balooch, G.; Ritchie, R.O.

    2006-01-01T23:59:59.000Z

    on glucocorticoid-induced osteoporosis. Rheumatic DiseaseGlucocorticoid-induced osteoporosis. Endocrinol Metab. Clin.of cortico-steroid osteoporosis. A meta-analysis. Osteoporos

  10. Mandible versus Long Bone Marrow Cells

    E-Print Network [OSTI]

    Chaichanasakul, Thawinee

    2012-01-01T23:59:59.000Z

    diseases, such as osteoporosis, hyperparathyroidism, orbone density and osteoporosis (Jeffcoat et al. 2000; Kribbsglucocorticoid-induced osteoporosis. Endocrinology, 140(10),

  11. Effects of osteoporosis therapies on bone biomechanics

    E-Print Network [OSTI]

    Easley, Sarah Kathleen

    2010-01-01T23:59:59.000Z

    study. R EFERENCES National Osteoporosis Foundation. http://in patients with osteoporosis: a paired biopsy study. J Bonein women with osteoporosis: the Fracture Intervention Trial.

  12. Bioactive Glass Scaffolds for Bone Regeneration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Working at ALS Beamline 8.3.2, researchers from Berkeley Lab and the Imperial College London have created bioactive glass scaffolds that mirror nature's efficient materials. The...

  13. Bioactive Glass Scaffolds for Bone Regeneration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced Materials Find Find More Like This Return toBioactive Glass

  14. Bioactive Glass Scaffolds for Bone Regeneration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced Materials Find Find More Like This Return toBioactive

  15. Bioactive Glass Scaffolds for Bone Regeneration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced Materials Find Find More Like This Return toBioactiveBioactive

  16. Bioactive Glass Scaffolds for Bone Regeneration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced Materials Find Find More Like This Return

  17. Bioactive Glass Scaffolds for Bone Regeneration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced Materials Find Find More Like This ReturnBioactive Glass Scaffolds

  18. Bioactive Glass Scaffolds for Bone Regeneration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWPAlumniComplexMaterial Science |Materials Center atLSUBioactive

  19. Bioactive Glass Scaffolds for Bone Regeneration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWPAlumniComplexMaterial Science |Materials Center

  20. Bioactive Glass Scaffolds for Bone Regeneration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWPAlumniComplexMaterial Science |Materials CenterBioactive Glass

  1. Long duration ash probe

    DOE Patents [OSTI]

    Hurley, J.P.; McCollor, D.P.; Selle, S.J.

    1994-07-26T23:59:59.000Z

    A long duration ash probe includes a pressure shell connected to a port in a combustor with a sample coupon mounted on a retractable carriage so as to retract the sample coupon within the pressure shell during soot blowing operation of the combustor. A valve mounted at the forward end of the pressure shell is selectively closeable to seal the sample coupon within the shell, and a heating element in the shell is operable to maintain the desired temperature of the sample coupon while retracted within the shell. The carriage is operably mounted on a pair of rails within the shell for longitudinal movement within the shell. A hollow carrier tube connects the hollow cylindrical sample coupon to the carriage, and extends through the carriage and out the rearward end thereof. Air lines are connected to the rearward end of the carrier tube and are operable to permit coolant to pass through the air lines and thence through the carrier tube to the sample coupon so as to cool the sample coupon. 8 figs.

  2. Long duration ash probe

    DOE Patents [OSTI]

    Hurley, John P. (Grand Forks, ND); McCollor, Don P. (Grand Forks, ND); Selle, Stanley J. (Grand Forks, MN)

    1994-01-01T23:59:59.000Z

    A long duration ash probe includes a pressure shell connected to a port in a combustor with a sample coupon mounted on a retractable carriage so as to retract the sample coupon within the pressure shell during sootblowing operation of the combustor. A valve mounted at the forward end of the pressure shell is selectively closeable to seal the sample coupon within the shell, and a heating element in the shell is operable to maintain the desired temperature of the sample coupon while retracted within the shell. The carriage is operably mounted on a pair of rails within the shell for longitudinal movement within the shell. A hollow carrier tube connects the hollow cylindrical sample coupon to the carriage, and extends through the carriage and out the rearward end thereof. Air lines are connected to the rearward end of the carrier tube and are operable to permit coolant to pass through the air lines and thence through the carrier tube to the sample coupon so as to cool the sample coupon.

  3. ash dispersion utilizing: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    in the USA for all coal ashes was approximately 34% in the year products containing clean coal ash compared to conventional coal ash. Utilization of clean coal ash is much...

  4. Advanced Characterisation of Municipal Solid Waste Ashes

    E-Print Network [OSTI]

    Advanced Characterisation of Municipal Solid Waste Ashes Preparatory thesis Randi Skytte Pedersen is to investigate Municipal Solid Waste (MSW) ashes with respect to particle sizes, structures and composition with characterisation of Municipal Solid Waste (MSW) ashes from the Danish power plant M°abjergværket, Holstebro. MSW

  5. Petrographic characterization of economizer fly ash

    SciTech Connect (OSTI)

    Valentim, B.; Hower, J.C.; Soares, S.; Guedes, A.; Garcia, C.; Flores, D.; Oliveira, A. [University of Porto, Oporto (Portugal). Center of Geology

    2009-11-15T23:59:59.000Z

    Policies for reducing NOx emissions have led power plants to restrict O{sub 2}, resulting in high-carbon fly ash production. Therefore, some potentially useful fly ash, such as the economizer fly ash, is discarded without a thorough knowledge of its composition. In order to characterize this type of fly ash, samples were collected from the economizer Portuguese power plant burning two low-sulfur bituminous coals. Characterization was also performed on economizer fly ash subsamples after wet sieving, density and magnetic separation. Analysis included atomic absorption spectroscopy, loss-on-ignition, scanning electron microscopy/energy-dispersive X-ray spectroscopy, optical microscopy, and micro-Raman spectroscopy.

  6. ACAA fly ash basics: quick reference card

    SciTech Connect (OSTI)

    NONE

    2006-07-01T23:59:59.000Z

    Fly ash is a fine powdery material created when coal is burned to generate electricity. Before escaping into the environment via the utility stacks, the ash is collected and may be stored for beneficial uses or disposed of, if necessary. The use of fly ash provides environmental benefits, such as the conservation of natural resources, the reduction of greenhouse gas emissions and eliminating the needed for ash disposal in landfills. It is also a valuable mineral resource that is used in construction and manufacturing. Fly ash is used in the production of Portland cement, concrete, mortars and stuccos, manufactured aggregates along with various agricultural applications. As mineral filler, fly ash can be used for paints, shingles, carpet backing, plastics, metal castings and other purposes. This quick reference card is intended to provide the reader basic source, identification and composition, information specifically related to fly ash.

  7. Analysis of load redistribution in diaphyseal bone following staged screw removal from bone plates

    E-Print Network [OSTI]

    Nixon, Joseph Craig

    1987-01-01T23:59:59.000Z

    of RCO202, strain (5+12)/2 of LC0301 through LCO306, and strain (5+12)/2 of LEX206 had non-zero intercepts at zero strain. Upon examination of the data from LEX201 through LEX207, it was noted that strain 6 is positive in four of the six instances... are lower for the experimental group than the control group. For example, for REX102 through REX107, seventeen of the forty-six strains are lower than the corresponding control strains. This is not the expected result. For LEX202 through LEX207 twenty o...

  8. Combustion with reduced carbon in the ash

    DOE Patents [OSTI]

    Kobayashi, Hisashi; Bool, III, Lawrence E.

    2005-12-27T23:59:59.000Z

    Combustion of coal in which oxygen is injected into the coal as it emerges from burner produces ash having reduced amounts of carbon.

  9. ash leachate generation: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    72 Key To Ash Sources FGD-1 MPU 8 Materials Science Websites Summary: Key To Ash Sources FGD-1 MPU 8 FGD-2 Alliant Energy FGD-3 WPS Pulliam Ash 12;Center for By-Products...

  10. ash quality characterization: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    78 Key To Ash Sources FGD-1 MPU 8 Materials Science Websites Summary: Key To Ash Sources FGD-1 MPU 8 FGD-2 Alliant Energy FGD-3 WPS Pulliam Ash 12;Center for By-Products...

  11. Treatment of fly ash for use in concrete

    DOE Patents [OSTI]

    Boxley, Chett (Park City, UT)

    2012-05-15T23:59:59.000Z

    A process for treating fly ash to render it highly usable as a concrete additive. A quantity of fly ash is obtained that contains carbon and which is considered unusable fly ash for concrete based upon foam index testing. The fly ash is mixed with a quantity of spray dryer ash (SDA) and water to initiate a geopolymerization reaction and form a geopolymerized fly ash. The geopolymerized fly ash is granulated. The geopolymerized fly ash is considered usable fly ash for concrete according to foam index testing. The geopolymerized fly ash may have a foam index less than 40%, and in some cases less than 20%, of the foam index of the untreated fly ash. An optional alkaline activator may be mixed with the fly ash and SDA to facilitate the geopolymerization reaction. The alkaline activator may contain an alkali metal hydroxide, carbonate, silicate, aluminate, or mixtures thereof.

  12. ash blended cement: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    biomass blends Texas A&M University - TxSpace Summary: , low ash partially composted manure LAPC, high ash raw manure HARM, and high ash partially composted manure HAPC)...

  13. Development of dredged ash disposal area, Paradise fossil plant

    SciTech Connect (OSTI)

    Not Available

    1989-02-01T23:59:59.000Z

    Paradise Steam-Electric Plant coal-fired facility in Muhlenberg County, Kentucky. This project is to construct a dredge pond near the Jacobs Creek ash pond capable of storing fly ash dredged from the ash pond. This will provide approximately 10 years of additional fly ash storage in the fly ash pond. Effluent from the dredge pond will be returned to the Jacobs Creek ash pond for discharge to Jacobs Creek. 4 figs., 5 tabs.

  14. ashes oral biotillgaenglighet: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ash 1. Halima Hadiahmetovi?; D. D. Sarajevo; M. Sc; Raza Sunulahpai?; Bosnia Herzegovina 97 Leachate Geochemical Results for Ash Samples from the June 2007 Angora...

  15. Development of an Accelerated Ash-Loading Protocol for Diesel...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    an Accelerated Ash-Loading Protocol for Diesel Particulate Filters Development of an Accelerated Ash-Loading Protocol for Diesel Particulate Filters Poster presentation at the 2007...

  16. Ashe County - Wind Energy System Ordinance | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Tribal Government Utility Program Info State North Carolina Program Type SolarWind Permitting Standards Provider Ashe County Planning Department In 2007 Ashe County...

  17. Impact of Biodiesel on Ash Emissions and Lubricant Properties...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Biodiesel on Ash Emissions and Lubricant Properties Affecting Fuel Economy and Engine Wear Impact of Biodiesel on Ash Emissions and Lubricant Properties Affecting Fuel Economy and...

  18. ash intranasal instillation: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    there is no mixing of insufficiently thermally treated material with bottom ash. Good fire control Columbia University 17 Characteristics and Uses for Ash Environmental...

  19. ash deposition propensities: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Environments (>3.5 km), banded iron, volcanic ashes Summary diagrams available Clastic depositional environments Harbor, David 57 Ash Dump Site Manager: EHS&RM Biology and...

  20. Uncovering Fundamental Ash-Formation Mechanisms and Potential...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Analysis of Ash Formation and Transport Key Parameters Affecting DPF Performance Degradation and Impact on Lifetime Fuel Economy Non-Destructive X-ray Measurement of Soot, Ash,...

  1. Minimizing Lubricant-Ash Requirement and Impact on Emission Aftertreat...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Minimizing Lubricant-Ash Requirement and Impact on Emission Aftertreatment Systems via an Oil Conditioning Filter Minimizing Lubricant-Ash Requirement and Impact on Emission...

  2. Ash Chemistry in MSW Incineration Plants

    E-Print Network [OSTI]

    Ash Chemistry in MSW Incineration Plants: Advanced Characterization and Thermodynamic Introduction to Municipal Solid Waste Incineration 2 Chapter 2 Plants Considered and Samples Collected 5 Chapter 3 Mapping of Ash Chemistry in MSWI Plants 8 Chapter 4 Advanced Characterization Methods 12 4

  3. Fly Ash Amendments Catalyze Soil Carbon Sequestration

    SciTech Connect (OSTI)

    Amonette, James E.; Kim, Jungbae; Russell, Colleen K.; Palumbo, A. V.; Daniels, William L.

    2003-09-15T23:59:59.000Z

    We tested the effects of four alkaline fly ashes {Class C (sub-bituminous), Class F (bituminous), Class F [bituminous with flue-gas desulfurization (FGD) products], and Class F (lignitic)} on a reaction that simulates the enzyme-mediated formation of humic materials in soils. The presence of FGD products completely halted the reaction, and the bituminous ash showed no benefit over an ash-free control. The sub-bituminous and lignitic fly ashes, however, increased the amount of polymer formed by several-fold. The strong synergetic effect of these ashes when enzyme is present apparently arises from the combined effects of metal oxide co-oxidation (Fe and Mn oxides), alkaline pH, and physical stabilization of the enzyme (porous silica cenospheres).

  4. Treatment of fly ash for use in concrete

    SciTech Connect (OSTI)

    Boxley, Chett; Akash, Akash; Zhao, Qiang

    2013-01-08T23:59:59.000Z

    A process for treating fly ash to render it highly usable as a concrete additive. A quantity of fly ash is obtained that contains carbon and which is considered unusable fly ash for concrete based upon foam index testing. The fly ash is mixed with an activator solution sufficient to initiate a geopolymerization reaction and for a geopolymerized fly ash. The geopolymerized fly ash is granulated. The geopolymerized fly ash is considered usable fly ash for concrete according to foam index testing. The geopolymerized fly ash may have a foam index less than 35% of the foam index of the untreated fly ash, and in some cases less than 10% of the foam index of the untreated fly ash. The activator solution may contain an alkali metal hydroxide, carbonate, silicate, aluminate, or mixtures thereof.

  5. Treatment of fly ash for use in concrete

    DOE Patents [OSTI]

    Boxley, Chett (Park City, UT); Akash, Akash (Salt lake City, UT); Zhao, Qiang (Natick, MA)

    2012-05-08T23:59:59.000Z

    A process for treating fly ash to render it highly usable as a concrete additive. A quantity of fly ash is obtained that contains carbon and which is considered unusable fly ash for concrete based upon foam index testing. The fly ash is mixed with an activator solution sufficient to initiate a geopolymerization reaction and for a geopolymerized fly ash. The geopolymerized fly ash is granulated. The geopolymerized fly ash is considered usable fly ash for concrete according to foam index testing. The geopolymerized fly ash may have a foam index less than 35% of the foam index of the untreated fly ash, and in some cases less than 10% of the foam index of the untreated fly ash. The activator solution may contain an alkali metal hydroxide, carbonate, silicate, aluminate, or mixtures thereof.

  6. Fluidized bed gasification ash reduction and removal process

    DOE Patents [OSTI]

    Schenone, Carl E. (Madison, PA); Rosinski, Joseph (Vanderbilt, PA)

    1984-12-04T23:59:59.000Z

    In a fluidized bed gasification system an ash removal system to reduce the particulate ash to a maximum size or smaller, allow the ash to cool to a temperature lower than the gasifier and remove the ash from the gasifier system. The system consists of a crusher, a container containing level probes and a means for controlling the rotational speed of the crusher based on the level of ash within the container.

  7. Fluidized bed gasification ash reduction and removal system

    DOE Patents [OSTI]

    Schenone, Carl E. (Madison, PA); Rosinski, Joseph (Vanderbilt, PA)

    1984-02-28T23:59:59.000Z

    In a fluidized bed gasification system an ash removal system to reduce the particulate ash to a maximum size or smaller, allow the ash to cool to a temperature lower than the gasifier and remove the ash from the gasifier system. The system consists of a crusher, a container containing level probes and a means for controlling the rotational speed of the crusher based on the level of ash within the container.

  8. Fly ash enhanced metal removal process

    SciTech Connect (OSTI)

    Nonavinakere, S. [Plexus Scientific Corp., Annapolis, MD (United States); Reed, B.E. [West Virginia Univ., Morgantown, WV (United States). Dept. of Civil Engineering

    1995-12-31T23:59:59.000Z

    The primary objective of the study was to evaluate the effectiveness of fly ashes from local thermal power plants in the removal of cadmium, nickel, chromium, lead, and copper from aqueous waste streams. Physical and chemical characteristics of fly ashes were determined, batch isotherm studies were conducted. A practical application of using fly ash in treating spent electroless nickel (EN) plating baths by modified conventional precipitation or solid enhanced metal removal process (SEMR) was investigated. In addition to nickel the EN baths also contains completing agents such as ammonium citrate and succinic acid reducing agents such as phosphate and hypophosphite. SEMR experiments were conducted at different pHs, fly ash type and concentrations, and settling times.

  9. Environmental aspects of the Brandywine ash site

    SciTech Connect (OSTI)

    Simek, E.; Potera, G.; Schuller, R.; Herritt, M.; Wagner, R.

    1984-05-01T23:59:59.000Z

    The Brandywine ash site, located in Prince Georges County, Maryland, is owned and operated by the Potomac Electric Power Company (PEPCO). This site was designed specifically for the storage of the large quantities of coal ash produced at PEPCO's nearby Chalk Point Generating Station. Environmental Resources Management, Inc. (ERM), with assistance from the Maryland Department of Natural Resources, Tidewater Administration, conducted a study of this site for the Maryland Power Plant Siting Program (PPSP) to determine if ash constituents are adversely affecting the environment. Section 1 of this report is an introduction to coal ash and its physical/chemical characteristics. Section 2 describes the environment at the site and in adjacent areas. Within this setting, a description of the facility is presented as Section 3. Section 4 relies on the previous sections to point out any likely effects of the facility on the environment and to discount unlikely interactions. Key conclusions are presented in Section 5.

  10. Stabilization/solidification of TSCA incinerator ash

    SciTech Connect (OSTI)

    Spence, R.D.; Trotter, D.R.; Francis, C.L.; Morgan, I.L.

    1994-06-01T23:59:59.000Z

    Stabilization/solidification is a well-known waste treatment technique that utilizes different additives and processes. The Phoenix Ash Technology of the Technical Innovation Development Engineering Company is such a technique that uses Cass C fly ash and mechanical pressure to make brick waste forms out of solid wastes, such as the bottom ash from the Toxic Substances Control Act incinerator at the Oak Ridge K-25 Site. One advantage of this technique is that no volume increase over the bulk volume of the bottom ash occurs. This technique should have the same high pH stabilization for Resource Conservation and Recovery Act metals as similar techniques. Also, consolidation of the bottom ash minimizes the potential problems of material dispersion and container corrosion. The bottom ash was spiked with {sup 99}{Tc} to test the effectiveness of the bricks as a physical barrier. The {sup 99}{Tc} leachability index measured for these bricks was 6.8, typical for the pertechnetate anion in cementitious waste forms, indicating that these bricks have accessible porosity as high as that of other cementitious waste forms, despite the mechanical compression, higher waste form density, and water resistant polymer coating.

  11. Utilization of pulverized fuel ash in Malta

    SciTech Connect (OSTI)

    Camilleri, Josette [Department of Building and Civil Engineering, Faculty of Architecture and Civil Engineering, University of Malta, Msida (Malta); Sammut, Michael [Department of Pathology, St. Luke's Hospital, G'Mangia (Malta); Montesin, Franco E. [Department of Building and Civil Engineering, Faculty of Architecture and Civil Engineering, University of Malta, Msida (Malta)]. E-mail: franco.montesin@um.edu.mt

    2006-07-01T23:59:59.000Z

    In Malta all of the waste produced is mixed and deposited at various sites around the island. None of these sites were purpose built, and all of the waste is above groundwater level. The landfills are not engineered and do not contain any measures to collect leachate and gases emanating from the disposal sites. Another waste, which is disposed of in landfills, is pulverized fuel ash (PFA), which is a by-product of coal combustion by the power station. This has been disposed of in landfill, because its use has been precluded due to the radioactivity of the ashes. The aim of this study was to analyze the chemical composition of the pulverized fuel ash and to attempt to utilize it as a cement replacement in normal concrete mixes in the construction industry. The levels of radiation emitted from the ashes were measured by gamma spectrometry. The results of this study revealed that although at early ages cement replacement by PFA resulted in a reduction in compressive strength (P = 0), when compared to the reference concrete at later ages the strengths measured on concrete cores were comparable to the reference concrete (P > 0.05). The utilization of PFA up to 20% cement replacement in concrete did not raise the radioactivity of the concrete. In conclusion, utilization of PFA in the construction industry would be a better way of disposing of the ashes rather than controlling the leachate and any radioactivity emitted by the landfilled ashes.

  12. Scale-Up and Demonstration of Fly Ash Ozonation Technology

    SciTech Connect (OSTI)

    Rui Afonso; R. Hurt; I. Kulaots

    2006-03-01T23:59:59.000Z

    The disposal of fly ash from the combustion of coal has become increasingly important. When the fly ash does not meet the required specification for the product or market intended, it is necessary to beneficiate it to achieve the desired quality. This project, conducted at PPL's Montour SES, is the first near full-scale ({approx}10 ton/day), demonstration of ash ozonation technology. Bituminous and sub bituminous ashes, including two ash samples that contained activated carbon, were treated during the project. Results from the tests were very promising. The ashes were successfully treated with ozone, yielding concrete-suitable ash quality. Preliminary process cost estimates indicate that capital and operating costs to treat unburned carbon are competitive with other commercial ash beneficiation technologies at a fraction of the cost of lost sales and/or ash disposal costs. This is the final technical report under DOE Cooperative Agreement No.: DE-FC26-03NT41730.

  13. Hydrothermal reaction of fly ash. Final report

    SciTech Connect (OSTI)

    Brown, P.W.

    1994-12-31T23:59:59.000Z

    The reactions which occur when fly ash is treated under hydrothermal conditions were investigated. This was done for the following primary reasons. The first of these is to determine the nature of the phases that form to assess the stabilities of these phases in the ambient environment and, finally, to assess whether these phases are capable of sequestering hazardous species. The second reason for undertaking this study was whether, depending on the composition of the ash and the presence of selected additives, it would be possible under hydrothermal conditions to form compounds which have cementitious properties. Formation of four classes of compounds, which bracket likely fly ash compositional ranges, were selected for study. The classes are calcium silicate hydrates, calcium selenates, and calcium aluminosulfates, and silicate-based glasses. Specific compounds synthesized were determined and their stability regions assessed. As part of stability assessment, the extent to which selected hazardous species are sequestered was determined. Finally, the cementing properties of these compounds were established. The results obtained in this program have demonstrated that mild hydrothermal conditions can be employed to improve the reactivity of fly ash. Such improvements in reactivity can result in the formation of monolithic forms which may exhibit suitable mechanical properties for selected applications as building materials. If the ashes involved are considered hazardous, the mechanical properties exhibited indicated the forms could be handled in a manner which facilitates their disposal.

  14. Approaches to the petrographic characterization of fly ash

    SciTech Connect (OSTI)

    Hower, J.C.; Rathbone, R.F.; Graham, U.M. [Univ. of Kentucky, Lexington, KY (United States)] [and others

    1995-08-01T23:59:59.000Z

    The enhanced understanding of fly ash properties provided by petrographic analysis, a level of detail chemical analysis cannot provide, will be essential in the upgrading and utilization of fly ash produced in boilers retrofitted to meet clean air standards. Howe et al estimated that over 25% of the fly ash produced in Kentucky in 1992 would not have met the Kentucky Department of Transportation limit of 3% loss-on-ignition (LOI) for class F fly ash used as a Portland cement admixture. The conversion of boilers to low-NO{sub x} emission units increases fly ash carbon, hence LOI, by 150-200% rendering the fly ash unsuitable for highway construction use in concrete. The preservation of fly ash`s market share will require increased attention to the removal of excess carbon from the fly ash. In this paper, we will discuss the basic components of fly ash. An example of the petrographic analysis of fly ash from a Kentucky power plant will be used to illustrate the partitioning of fly ash components by size, as well as within the fly ash collection system.

  15. Extraction of trace metals from fly ash

    DOE Patents [OSTI]

    Blander, Milton (Palos Park, IL); Wai, Chien M. (Moscow, ID); Nagy, Zoltan (Woodridge, IL)

    1984-01-01T23:59:59.000Z

    A process for recovering silver, gallium and/or other trace metals from a fine grained industrial fly ash associated with a process for producing phosphorous, the fly ash having a silicate base and containing surface deposits of the trace metals as oxides, chlorides or the like, with the process being carried out by contacting the fly ash with AlCl.sub.3 in an alkali halide melt to react the trace metals with the AlCl.sub.3 to form compositions soluble in the melt and a residue containing the silicate and aluminum oxide or other aluminum precipitate, and separating the desired trace metal or metals from the melt by electrolysis or other separation techniques.

  16. Extraction of trace metals from fly ash

    DOE Patents [OSTI]

    Blander, M.; Wai, C.M.; Nagy, Z.

    1983-08-15T23:59:59.000Z

    A process is described for recovering silver, gallium and/or other trace metals from a fine grained industrial fly ash associated with a process for producing phosphorous. The fly ash has a silicate base and contains surface deposits of the trace metals as oxides, chlorides or the like. The process is carried out by contacting the fly ash with AlCl/sub 3/ in an alkali halide melt to react the trace metals with the AlCl/sub 3/ to form compositions soluble in the melt and a residue containing the silicate and aluminum oxide or other aluminum precipitate, and separating the desired trace metal or metals from the melt by electrolysis or other separation techniques.

  17. ash utilization symposium: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Websites Summary: Center for By-Products Utilization USE OF CLASS F FLY ASH AND CLEAN-COAL ASH BLENDS FOR CAST Report No.CBU-1996-07 July 1996 Presented and Published at the...

  18. Eco-friendly fly ash utilization: potential for land application

    SciTech Connect (OSTI)

    Malik, A.; Thapliyal, A. [Indian Institute of Technology Delhi, New Delhi (India)

    2009-07-01T23:59:59.000Z

    The increase in demand for power in domestic, agricultural, and industrial sectors has increased the pressure on coal combustion and aggravated the problem of fly ash generation/disposal. Consequently the research targeting effective utilization of fly ash has also gained momentum. Fly ash has proved to be an economical substitute for expensive adsorbents as well as a suitable raw material for brick manufacturing, zeolite synthesis, etc. Fly ash is a reservoir of essential minerals but is deficient in nitrogen and phosphorus. By amending fly ash with soil and/or various organic materials (sewage sludge, bioprocess materials) as well as microbial inoculants like mycorrhizae, enhanced plant growth can be realized. Based on the sound results of large scale studies, fly ash utilization has grown into prominent discipline supported by various internationally renowned organizations. This paper reviews attempts directed toward various utilization of fly ash, with an emphasis on land application of organic/microbial inoculants amended fly ash.

  19. ash solvent extraction: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Alessandro 2013-01-01 27 ASH PNEUMATIC TRANSPORT UNDER ELECTROFILTERS OF UNIT 5 THERMAL POWER PLANT TUZLA CiteSeer Summary: Ash pneumatic transport is basic on fact that at...

  20. 2007 world of coal ash conference proceedings

    SciTech Connect (OSTI)

    NONE

    2007-07-01T23:59:59.000Z

    The theme of the conference was science, applications and sustainability. Papers are presented under the following topics: aggregates/geotechnology; agriculture; ash facility; management; CCT products; cement and concrete; chemistry and mineralogy; emerging technology; environmental; LOI/beneficiation/handling; mercury; mining and regulations and standards. The poster papers are included as well.

  1. Screening technology reduces ash in spiral circuits

    SciTech Connect (OSTI)

    Brodzik, P. [Derrick Corp., Buffalo, NY (United States)

    2007-05-15T23:59:59.000Z

    In 2006, the James River Coal Co. selected the Stack Sizer to remove the minus 100 mesh high ash clay fraction from the clean coal spiral product circuits at the McCoy-Elkhorn Bevins Branch prep plant and at the Blue Diamond Leatherwood prep plant in Kentucky. The Stack Sizer is a multi-deck, high-frequency vibrating screen capable of separations as fine as 75 microns when fitted with Derrick Corp.'s patented high open area urethane screen panels. Full-scale lab tests and more than 10 months of continuous production have confirmed that the Stack Sizer fitted with Derrick 100 micron urethane screen panels consistently produces a clean coal fraction that ranges from 8 to 10% ash. Currently, each five-deck Stack Sizer operating at the Bevins Branch and Leatherwood prep plants is producing approximately 33 tons per hour of clean coal containing about 9% ash. This represents a clean coal yield of about 75% and an ash reduction of about 11% from the feed slurry. 3 figs. 2 tabs.

  2. Properties of concrete containing wood/coal fly ash mixtures

    SciTech Connect (OSTI)

    Boylan, D.M.; Larrimore, C.L.; Fouad, F.

    1999-07-01T23:59:59.000Z

    Utilities are increasingly interested in co-firing wood with coal in existing pulverized coal units. The co-firing technology is a means of developing a relatively low-cost renewable energy resource, as well as of supporting customers and community by making energy with biomass that might otherwise have been land-filled. However, recent changes in the ASTM C618 standard for fly ash as cement replacement restrict the definition of fly ash that includes non-coal sources. As a result, wood co-firing could affect the market for the fly ash, reducing ash sales revenue, increasing ash disposal costs, and overall substantially increasing the cost of the co-firing technology. In order to address concerns about the effect of wood ash/coal ash mixtures on concrete properties, a study was conducted by University of Alabama at Birmingham, Southern Company, EPRI, and the State of Alabama. This study compared the effects on properties of concrete made with fly ash from coal and made with fly ash from co-firing up to 30% wood with coal. Fly ashes from three plants were used, with two of the ashes from actual co-firing experience and the third an artificial blend of wood and coal ash. Concrete test cylinders were made of several cement/fly ash mixes, and enough were made to allow testing periodically over a one year time period. Test measurements included workability, setting time, air content, compressive and flexural strength, rapid chloride permeability and freeze thaw. It was concluded on the basis of these tests that the wood ash content had no detrimental effect on the plastic and hardened properties of the concrete.

  3. Water quality investigation of Kingston Fossil Plant dry ash stacking

    SciTech Connect (OSTI)

    Bohac, C.E.

    1990-04-01T23:59:59.000Z

    Changing to a dry ash disposal systems at Kingston Fossil Plant (KFP) raises several water quality issues. The first is that removing the fly ash from the ash pond could alter the characteristics of the ash pond discharge to the river. The second concerns proper disposal of the runoff and possibly leachate from the dry ash stack. The third is that dry ash stacking might change the potential for groundwater contamination at the KFP. This report addresses each of these issues. The effects on the ash pond and its discharge are described first. The report is intended to provide reference material to TVA staff in preparation of environmental review documents for new ash disposal areas at Kingston. Although the investigation was directed toward analysis of dry stacking, considerations for other disposal options are also discussed. This report was reviewed in draft form under the title Assessment of Kingston Fossil Plant Dry Ash Stacking on the Ash Pond and Groundwater Quality.'' 11 refs., 3 figs., 18 tabs.

  4. acquired bone marrow: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    S. , Oklahoma State University; D. V. M. , Oklahoma State University Directed by: Dr. Chester A. Gleiser The study was designed to determine... the effects of nutritional...

  5. affect bone formation: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    R. Bykowski; Johnny Huard, Ph.D.; Lee E. Weiss, Ph.D.; Joseph E. Losee; Phil G. Campbell, Ph.D. 9 Ibuprofen Administered Pre- or Post- Simulated Resistance Exercise Training...

  6. alveolar bone formation: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    R. Bykowski; Johnny Huard, Ph.D.; Lee E. Weiss, Ph.D.; Joseph E. Losee; Phil G. Campbell, Ph.D. 12 Ibuprofen Administered Pre- or Post- Simulated Resistance Exercise Training...

  7. affects bone formation: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    R. Bykowski; Johnny Huard, Ph.D.; Lee E. Weiss, Ph.D.; Joseph E. Losee; Phil G. Campbell, Ph.D. 9 Ibuprofen Administered Pre- or Post- Simulated Resistance Exercise Training...

  8. apatite cha bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    been used toremovePbfrom aqueous Ma, Lena 13 A Survey for Low-Mass Stars and Brown Dwarfs in the Eta Cha and Eps Cha Young Associations Astrophysics (arXiv) Summary: I...

  9. autologous bone augmentation: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    patients with severely restricted peripheral Peli, Eli 72 RESEARCH ARTICLE Open Access SMART: scalable and modular augmented reality Engineering Websites Summary: RESEARCH...

  10. antler trabecular bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Trabecular Architecture Variation in the Chimpanzee (Pan troglodytes): Evidence Environmental Sciences and Ecology Websites Summary: : locomotion and manipulation. The...

  11. affects trabecular bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Trabecular Architecture Variation in the Chimpanzee (Pan troglodytes): Evidence Environmental Sciences and Ecology Websites Summary: : locomotion and manipulation. The...

  12. Consolidant particle transport in limestone, concrete and bone 

    E-Print Network [OSTI]

    Campbell, Alanna Stacey

    2013-11-28T23:59:59.000Z

    The use of chemically compatible nano and fine particle colloidal consolidants is a new development within the field of cultural heritage conservation and applied most widely so far to the historic built environment. The ...

  13. assess 3d bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Websites Summary: from a real-life application. 1 Introduction Recent advances in 3D printing technology have made of materials, higher printing speeds, and lower costs....

  14. autogenous bone dust: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    galaxies, a method for the dust mass evaluation, which accounts for the dust temperature distribution, is here presented and discussed. The derived dust masses turn out to...

  15. UNCONTROLLED SEIZURES AND BONE HEALTH AMONG ADULT EPILEPSY PATIENTS

    E-Print Network [OSTI]

    Yamada, Mikiko

    2013-12-31T23:59:59.000Z

    .g., menopause, liver disease, viral hepatitis, renal disease, chronic kidney disease, pancreatic diseases, primary hyperparathyroidism, hyperthyroidism, inflammatory conditions, rheumatoid arthritis, Paget’s disease, osteoporosis, alcoholism); patients... costs for fracture treatment secondary to osteoporosis are reported to be $19 billion in the United States and are predicted to increase to $25.3 billion by 2025.43 Thus, appropriate fracture prevention and risk reduction among patients with epilepsy...

  16. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    from osteoporosis than men, once menopause has completed (osteoporosis for women today is clearly associated with menopause,osteoporosis is greatly mediated by factors that are independent of the menopause-

  17. acetabular bone defect: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    REHABILITATION ENGINEERING, VOL. 15, NO. 2, JUNE 2007 Acetabular Loading in Active Abduction Biology and Medicine Websites Summary: in acetabular frac- ture treatment is not...

  18. Investigation into mechanical properties of bone and its main constituents

    E-Print Network [OSTI]

    Evdokimenko, Ekaterina

    2012-01-01T23:59:59.000Z

    A review,” Materials Science and Engineering C, 30, 331-temperatures,” Materials Science and Engineering C, 31, 523-materials,” Materials Science and Engineering C, 31 (4),

  19. autogenous cortical bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  20. autopod cortical bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cortical systems for local and global integration in discourse comprehension Giovanna Egidi a, Biology and Medicine Websites Summary: Cortical systems for local and global...

  1. animal bone models: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Computer Technologies and Information Sciences Websites Summary: . A pseudo-colored hollow cloth bowl with three pinned vertices is simulated collapsing under the force...

  2. adsorbed bone sialoprotein: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    C. N. Likos,*, K. A. Vaynberg, H. Lowen, and N. J. Wagner Physics Websites Summary: brush. These results agree with previous studies of the surface forces of gelatin adsorbed...

  3. Measurement of bone mineral content in caged and active cats

    E-Print Network [OSTI]

    Tveter, Diane Ellen

    1988-01-01T23:59:59.000Z

    cat that was scanned three times 33 Table 6. BNC/W values (gm/cm) on a caged cat that was scanned twice 33 LIST OF FIGURES Page Diagram of the vertebral column of cat 18 Illustration of spine (dorsal view) for an active cat . . . . . . . . . 23... radiation, and beam hardening (1, 27, 37). The higher energy of 153Gd photons allows scanning of larger body parts such as the spine and the hip. The beam is produced using a well collimated 153Gd source with two photon energies at 44 keV, and 100 ke...

  4. Dickkopf-1 in Craniofacial Bone and Tooth Development

    E-Print Network [OSTI]

    Rodgers, Anika Sarah

    2014-08-20T23:59:59.000Z

    receptor-related protein MM Multiple Myeloma MMP Matrix metalloproteinase OB Osteoblast OC Osteoclast vii OCN Osteocalcin OPG Osteoprotegerin OSX Osterix PDL Periodontal Ligament RANK Receptor activator of nuclear factor kappa RANKL Receptor activator... ................................................................................................. 71 x LIST OF FIGURES Page Figure 1-1 Generation of a transgenic mouse .................................................................. 71 Figure 1-2 Generation of gene targeted mice using embryonic stem (ES) cells...

  5. The effects of adult-onset alcoholism on cortical bone

    E-Print Network [OSTI]

    Moe, Atha Louise

    2001-01-01T23:59:59.000Z

    -fed liquid control diet or rat pellet chow for either 8 or 14 weeks. An additional group of animals (alcohol cessation and pair-fed cessation) was fed the alcohol diet for 8 weeks with pair-fed partners receiving the liquid control diet. These animals were...

  6. The Effects of Obesity on Murine Cortical Bone

    E-Print Network [OSTI]

    Martin, Sophi

    2010-01-01T23:59:59.000Z

    3 1.3 – Factors in the Obesity – Fracture Risk24 ii 3.1 – Childhood obesity and fracturexiv CHAPTER 1 – Introduction to Obesity and Cortical

  7. affecting bone mineral: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    for Mineral and Energy Physics Websites Summary: Institute for Mineral and Energy Resources Answering Global Resource and Energy Challenges 12;Answering Global Resource and...

  8. alters bone mineral: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    for Mineral and Energy Physics Websites Summary: Institute for Mineral and Energy Resources Answering Global Resource and Energy Challenges 12;Answering Global Resource and...

  9. absorptiometric bone mineral: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    for Mineral and Energy Physics Websites Summary: Institute for Mineral and Energy Resources Answering Global Resource and Energy Challenges 12;Answering Global Resource and...

  10. acrylic bone cement: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    acrylic Engineering Websites Summary: as an admixture Jingyao Cao, D.D.L. Chung* Composite Materials Research Laboratory, University at Buffalo, State University of New York,...

  11. acrylic bone cements: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    acrylic Engineering Websites Summary: as an admixture Jingyao Cao, D.D.L. Chung* Composite Materials Research Laboratory, University at Buffalo, State University of New York,...

  12. Effects of dietary silicon on bone characteristics of poultry

    E-Print Network [OSTI]

    Plyler, James Edward

    1977-01-01T23:59:59.000Z

    den menschlichen barn. Biochem. Zeitschrift 94:163-173. Jones, L. H. P. , and K. V. Handreck, 1967. Silica in soils, plants and animals. Adv. Agron. 19:107-149. King, E. J. , and T. H. Belt, 1938. The physiological and pathological aspects.... C. Nottle, M. C. , 1966. Silica metabolism of the Marino sheep. Australian J. Agr. Res. 17:175-182. Roberson, R. H. , 1975. Effect of silicate, calcium, phosphorus, manganese, and zinc on performance of broiler chicks. Poultry Sci. 54...

  13. A STUDY OF ULTRASONIC WAVE PROPAGATION IN BONES

    E-Print Network [OSTI]

    zyserman

    tion mechanisms; different models for the latter are introduced ... The aim of this report is to analyse the propagation of ultrasonic ... propagation depends on the values of different model ...... Santos J.E., Corberó J.M., Ravazzoli C.L., and Hens

  14. absolutely normal bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    advance Machian physics by maintaining that the heliocentric system must be replaced by Tycho Brahe's geocentric system. We show that while geocentrism relies on Mach's contention...

  15. "Bone Softening," a Practical Way to Utilize Small Fish

    E-Print Network [OSTI]

    . Even in Japan, where per-capita fish consumption is about 5 times that of the United States, small tons in 1986) is used primarily for fish meal rather than for direct human consumption. Looking for ways to increase direct consumption of sar dines and other small fishes, Japanese researchers

  16. Colloquium: Failure of molecules, bones, and the Earth itself

    E-Print Network [OSTI]

    Buehler, Markus J.

    Materials fail by recurring rupture and shearing of interatomic bonds at microscopic, molecular scales, leading to disintegration of matter at macroscale and a loss of function. In this Colloquium, the state-of-the-art of ...

  17. Investigation into mechanical properties of bone and its main constituents

    E-Print Network [OSTI]

    Evdokimenko, Ekaterina

    2012-01-01T23:59:59.000Z

    during the progression of osteoporosis will help to clarifyfor prevention and cure of osteoporosis in the future.D, Rosen, CJ. (Eds. ), Osteoporosis, 3rd ed. Elsevier, Inc,

  18. Structural and biological studies of bone morphogenetic protein-15

    E-Print Network [OSTI]

    McMahon, Heather Eileen

    2007-01-01T23:59:59.000Z

    homolog, GDF-9; both proteins lack the fourth of seventhe recombinant protein with this mutation lacks biologicallacks biological activity and, intriguingly, the mutant protein

  19. antibiotic bone cement: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    early stage hydration of different classes of oilwell cement Bentz, Dale P. 142 NISTIR 7232 CEMHYD3D: A Three-Dimensional Cement Hydration Engineering Websites Summary: NISTIR...

  20. agonist attenuates bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and borehole acoustic models. The validity of the scheme is established using a 3D homogenous isotropic ... Krasovec, Mary L. 2003-01-01 39 THE ATTENUATED RAY TRANSFORM...

  1. assessing bone mass: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    distributions Computer Technologies and Information Sciences Websites Summary: 2.4 Contaminant Transport Assessment and Management (CONTAM) The Contam research area focuses...

  2. air bone particles: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Websites Summary: . Superluminal particles could provide most of the cosmic (dark) matter and produce very high-energy cosmic rays of high-energy cosmic rays; b) signa-...

  3. MR imaging of therapy-induced changes of bone marrow

    E-Print Network [OSTI]

    Daldrup-Link, H E; Henning, T; Link, T M

    2007-01-01T23:59:59.000Z

    applications, compared to PET-CT because of the improvedimaging methods, such as PET-CT and PET- MR in the treatment

  4. arthritis bone erosion: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    from arthritis. Our method involves fitting a pair of models Magee, Derek 17 Cavitation erosion of materials. Open Access Theses and Dissertations Summary: ??This...

  5. arthritis bone erosions: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    from arthritis. Our method involves fitting a pair of models Magee, Derek 17 Cavitation erosion of materials. Open Access Theses and Dissertations Summary: ??This...

  6. accessory navicular bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AUTOMOTIVE ACCESSORIES: RETHINKING DESIGN MATERIALS THROUGH CORNSTARCH, SUGARCANE AND HEMP CiteSeer Summary: Current bioproducts or bio-based products do not only require less...

  7. Bone breakage in laying hens as affected by dietary supplements

    E-Print Network [OSTI]

    Moore, David Joe

    1975-01-01T23:59:59.000Z

    pullets and were reared in floor pens, At maturity the birds were placed in individual cages for twelve 28-day periodsi Cage dimensions were 30 ~ 48 cm, wide, 45. 72 cm+ deep, and 8 ' 26 cmi high One hundred eighty hens were placed in house 11B... the twelfth period in most groups than was found in Experiment I, and essentially equal in four groups to the starting value of 5 06 kgb It has been reported by Rotenberg et al ~ (1970), Wabeck et al (1972), and Meyer and Sunde (1974) that exercise is a...

  8. activity bone mineral: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Foreign investment: Coal 45 1 Oil 4.7 6 Industrial minerals: Cement 42 1 Fluorspar 55 1 Rare earths 85 1 Metals: Aluminum 325 Mineral-filled polypropylene: Improvement of scratch...

  9. archival temporal bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Temporal Search Web Archives Computer Technologies and Information Sciences Websites Summary: Temporal...

  10. Celebrating Black History Month with DOE's Sheri Bone | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube platformBuilding RemovalCSS LetterStateDepartment of Energy

  11. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes | NationalCurriculum IntroductionInvestor14,566Irradiation

  12. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes | NationalCurriculum

  13. Prehistoric Animal Bones Found at Pantex | National Nuclear Security

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)IntegratedSpeedingTechnical Information STIPAdministration

  14. Celebrating Black History Month with DOE's Sheri Bone | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof EnergyAdministration-Desert Southwest

  15. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Scienceand Requirements Recently ApprovedReliabilityPrincipal

  16. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Scienceand Requirements Recently ApprovedReliabilityPrincipalResearch Finds Vitamin D Deficiency

  17. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's PossibleRadiation Protection Technical s o Freiberge s 3 % A PB 2 7 7 2ResearchAreas andResearch

  18. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's PossibleRadiation Protection Technical s o Freiberge s 3 % A PB 2 7 7 2ResearchAreas

  19. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's PossibleRadiation Protection Technical s o Freiberge s 3 % A PB 2 7 7 2ResearchAreasResearch Finds

  20. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's PossibleRadiation Protection Technical s o Freiberge s 3 % A PB 2 7 7 2ResearchAreasResearch

  1. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's PossibleRadiation Protection Technical s o Freiberge s 3 % A PB 2 7 7

  2. Archaeopteryx Feathers and Bone Chemistry Fully Revealed via Synchrotron

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWPAlumni AlumniFederal FacilityApril 27, 2015-SpecialImaging

  3. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the Key

  4. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the KeyIrradiation Effects

  5. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the KeyIrradiation

  6. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is the

  7. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12 Investigation Peer ReviewIron is theIrradiation Effects on

  8. Manufacture of ceramic tiles from fly ash

    DOE Patents [OSTI]

    Hnat, James G. (Collegeville, PA); Mathur, Akshay (Tampa, FL); Simpson, James C. (Perkiomenville, PA)

    1999-01-01T23:59:59.000Z

    The present invention relates to a process for forming glass-ceramic tiles. Fly ash containing organic material, metal contaminants, and glass forming materials is oxidized under conditions effective to combust the organic material and partially oxidize the metallic contaminants and the glass forming materials. The oxidized glass forming materials are vitrified to form a glass melt. This glass melt is then formed into tiles containing metallic contaminants.

  9. Manufacture of ceramic tiles from fly ash

    DOE Patents [OSTI]

    Hnat, J.G.; Mathur, A.; Simpson, J.C.

    1999-08-10T23:59:59.000Z

    The present invention relates to a process for forming glass-ceramic tiles. Fly ash containing organic material, metal contaminants, and glass forming materials is oxidized under conditions effective to combust the organic material and partially oxidize the metallic contaminants and the glass forming materials. The oxidized glass forming materials are vitrified to form a glass melt. This glass melt is then formed into tiles containing metallic contaminants. 6 figs.

  10. Market assessment of PFBC ash use

    SciTech Connect (OSTI)

    Bland, A. E.; Brown, T. H., Western Research Institute

    1998-01-01T23:59:59.000Z

    Pressurized fluidized bed combustion (PFBC) of coal is undergoing demonstration in the United States, as well as throughout the world. American Electric Power`s (AEP`s) bubbling PFBC 70 MWe Tidd demonstration program in Ohio and pilot-scale development at Foster Wheeler Energia Oy 10 MWth circulating PFBC at Karhula, Finland, have demonstrated the advantages of PFBC technology. Further technology development in the US is planned with the deployment of the technology at the MacIntosh Clean Coal project in Lakeland, Florida. Development of uses for solid wastes from PFBC coal-fired power systems is being actively pursued as part of the demonstration of PFBC technologies. Ashes collected from Foster Wheeler Energia Oy pilot circulating PFBC tests in Karhula, Finland, operating on (1) low sulfur subbituminous and (2) high sulfur bituminous coal; and ash from the AEP`s high-sulfur bituminous coal-fired bubbling PFBC in Brilliant, Ohio, were evaluated in laboratory and pilot-scale ash use testing at Western Research Institute (WRI).

  11. Coal ash by-product reutilization

    SciTech Connect (OSTI)

    Muncy, J. [Potomac Electric Power Co., Washington, DC (United States); Miller, B. [DYNA Corp., Upper Marlboro, MD (United States)

    1997-09-01T23:59:59.000Z

    Potomac Electric Power Company (PEPCO) has as part of its vision and value statement that, ``We are responsible stewards of environmental and corporate resources.`` With this moral imperative in mind, a project team was charged with initiating the Coal Pile Liner Project--installing a membrane liner under the existing coal storage pile at the Morgantown Generating Station. The existing coal yard facilities were constructed prior to the current environmental regulations, and it became necessary to upgrade the storage facilities to be environmentally friendly. The project team had two objectives in this project: (1) prevent coal pile leachate from entering the groundwater system; (2) test the viability of using coal ash by-products as an aggregate substitute for concrete applications. Both objectives were met, and two additional benefits were achieved as well: (1) the use of coal ash by-products as a coal liner produced significant cost savings to the project directly; (2) the use of coal ash by-products reduced plant operation and maintenance expenses.

  12. SINGLE ELEMENT TEST PREDICTIONS FOR STRESS-STRAIN BEHAVIOR OF PANKI FLY-ASH

    E-Print Network [OSTI]

    Prashant, Amit

    : Fly-ash is a waste product produced by burning of coal at thermal power plants. It is often used. Introduction Fly-ash is a fine powdery material, produced by burning of coal at thermal power plants. Fly-ash need to dispose fly-ash from these ponds. Fly-ash is often used as structural fill in order to dispose

  13. Mercury capture by distinct fly ash carbon forms

    SciTech Connect (OSTI)

    Hower, J.C.; Maroto-Valer, M.M.; Taulbee, D.N.; Sakulpitakphon, T.

    1999-07-01T23:59:59.000Z

    Carbon was separated from the fly ash from a Kentucky power plant using density gradient centrifugation. Using a lithium heterolpolytungstate high-density media, relative concentrations of inertinite (up to 85% vol.), isotropic carbon (up to 79% vol.), and anisotropic carbon (up to 76% vol.) were isolated from the original fly ash. Mercury concentration was lowest in the parent fly ash (which contains non-carbon components); followed by inertinite, isotropic coke, mixed isotropic-anisotropic coke fraction, and, with the highest concentration, the anisotropic coke concentrate. The latter order corresponds to the increase in BET surface area of the fly ash carbons. Previous studies have demonstrated the capture of mercury by fly ash carbon. This study confirms prior work demonstrating the varying role of carbon types in the capture, implying that variability in the carbon content influences the amount of mercury retained on the fly ash.

  14. Mechanical loading attenuates loss of bone mass and bone strength induced by immobilization and calcium-deficiency

    E-Print Network [OSTI]

    Inman, Cynthia Lynn

    1996-01-01T23:59:59.000Z

    of mechanical regulation of the skeleton by examining the mechanisms of cell stimulation in a controlled in vivo loading environment (Raab- Cullen et al. 1994). I~obl to It is well established that the skeleton adapts to the level of stress which is placed... University, Omaha, Nebraska. 26 The loading device is designed to accommodate the anatomy of an adult rat's right tibia (Figure 1) (Raab-Cullen et al. 1994). The pads (Figure 2) are constructed of balsa wood and sheathed with surgical tubing to minimize...

  15. Determination of Ash in Biomass: Laboratory Analytical Procedure...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Ash in Biomass Laboratory Analytical Procedure (LAP) Issue Date: 7172005 A. Sluiter, B. Hames, R. Ruiz, C. Scarlata, J. Sluiter, and D. Templeton Technical Report NREL...

  16. Kinetics of beneficiated fly ash by carbon burnout

    SciTech Connect (OSTI)

    Okoh, J.M.; Dodoo, J.N.D.; Diaz, A. [Univ. of Maryland Eastern Shore, Princess Anne, MD (United States). Dept. of Natural Sciences; Ferguson, W.; Udinskey, J.R. Jr.; Christiana, G.A. [Delmarva Power, Wilmington, DE (United States)

    1997-12-31T23:59:59.000Z

    The presence of carbon in fly ash requires an increase in the dosage of the air-entraining admixture for concrete mix, and may cause the admixture to lose efficiency. Specifying authorities for the concrete producers have set maximum allowable levels of residual carbon. These levels are the so called Loss On Ignition (LOI). The concrete producers` day-to-day purchasing decisions sets the LOI at 4%. The objective of the project is to investigate the kinetics of oxidation of residual carbon present in coal fly ash as a possible first step toward producing low-carbon fly ash from high-carbon, low quality fly ash.

  17. ash transportation distance: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ash 1. Halima Hadiahmetovi?; D. D. Sarajevo; M. Sc; Raza Sunulahpai?; Bosnia Herzegovina 4 Dimensional contraction via Markov transportation distance Francois...

  18. Data Summary Report for Hanford Site Coal Ash Characterization

    SciTech Connect (OSTI)

    Sulloway, H. M.

    2012-03-06T23:59:59.000Z

    The purpose of this report is to present data and findings from sampling and analysis of five distinct areas of coal ash within the Hanford Site River Corridor

  19. ash aqueous carbonation: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    carbon content, specific surface area Aydilek, Ahmet 3 Issues with the Use of Fly Ash for Carbon Sequestration A.V. Palumbo1* Environmental Management and Restoration Websites...

  20. alkaline coal ash: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    from pulverized coal pulverized-coal-fired furnaces, cyclone furnaces, or advanced clean-coal technology furnaces. The ash collected from pulverized-coal-fired furnaces is fly...

  1. Detailed Characterization of Lubricant-Derived Ash-Related Species...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Species in the Ring Pack and Ash Emissions and Their Dependence on Crankcase Oil Properties Key Parameters Affecting DPF Performance Degradation and Impact on Lifetime Fuel Economy...

  2. The variability of fly ash and its effects on selected properties of fresh Portland cement/fly ash mortars

    E-Print Network [OSTI]

    McKerall, William Carlton

    1980-01-01T23:59:59.000Z

    the needed quality control of concrete . Another source of concern results from the recent development of lignite and sub-bituminous coal as fuel sources. The ash produced from these coals is of a different chemical composition than traditional bituminous... 50 percent to greater than 200 percent of a control test. An exhaustive literature review has revealed neglig1ble information concerning the PAI of sub- b1tuminous and lignite ashes. Research is greatly needed to determine the ash properties...

  3. Arsenic remediation of drinking water using iron-oxide coated coal bottom ash

    E-Print Network [OSTI]

    MATHIEU, JOHANNA L.

    2010-01-01T23:59:59.000Z

    using Iron-oxide Coated Coal Ash. In Arsenic Contaminationwater using  iron?oxide coated coal bottom ash  Johanna L.  using iron-oxide coated coal bottom ash JOHANNA L. MATHIEU

  4. E-Print Network 3.0 - ash related problems Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ash related problems Page: << < 1 2 3 4 5 > >> 1 By-Products Utilization Summary: of clean coal ash will increase. Finding practical solutions to this "ash problem" is essential...

  5. Utilization of Ash Fractions from Alternative Biofuels used in Power Plants

    E-Print Network [OSTI]

    Utilization of Ash Fractions from Alternative Biofuels used in Power Plants PSO Project No. 6356 July 2008 Renewable Energy and Transport #12;2 Utilization of Ash Fractions from Alternative Biofuels)...............................................................................7 2. Production of Ash Products from Mixed Biofuels

  6. Cell Ashing for Trace Element Analysis: A New Approach Based on Ultraviolet/Ozone

    E-Print Network [OSTI]

    Gilbert, Pupa Gelsomina De Stasio

    : synchrotron spectromicroscopy; micro- chemical analysis; MEPHISTO; ashing; incineration; trace element. Ashing ashing is based on high-temperature incineration or on the exposure to oxygen plasma (1­ 4). We adopted

  7. Ash, calcium, phosphorus and magnesium content of the metacarpus of hereford cows under different nutritional and physiological conditions

    E-Print Network [OSTI]

    Haque, Mozammel

    1967-01-01T23:59:59.000Z

    !c-, i, 13&:- ce N, a?d Ila& old Ff. Frost. 1965. Corri!Jr&Lion oL. bone rr &, orp- l?r& acct . ifc raiatioii reich Lhe physical bebav iur of I 'ai'. cd bi&ne, , ) L?curtal He, . 44:33-41. r'' orr!nti ii. , N. , G. '3 . Pa?at t' an 1 I". 'i'(eric i &3...

  8. E-Print Network 3.0 - ash quarterly technical Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Utilization Summary: Center for By-Products Utilization RECENT ADVANCES IN RECYCLING CLEAN- COAL ASH By Tarun R. Naik... -Strength Materials (CLSM); 232, Fly Ash and Natural...

  9. E-Print Network 3.0 - ash based geopolymer Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Utilization Summary: . CHARACTERIZATION AND APPLICATION OF CLASS F FLY ASH AND CLEAN-COAL ASH FOR CEMENT-BASED MATERIALS 2 The major... large amounts of conventional or...

  10. E-Print Network 3.0 - ash Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Utilization Summary: Center for By-Products Utilization RECENT ADVANCES IN RECYCLING CLEAN- COAL ASH By Tarun R. Naik... -Strength Materials (CLSM); 232, Fly Ash and Natural...

  11. E-Print Network 3.0 - ash penurunan kadar Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Utilization Summary: Center for By-Products Utilization RECENT ADVANCES IN RECYCLING CLEAN- COAL ASH By Tarun R. Naik... -Strength Materials (CLSM); 232, Fly Ash and Natural...

  12. E-Print Network 3.0 - ash paving demonstration Sample Search...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AND DEMONSTRATION... Center for By-Products Utilization RECENT ADVANCES IN RECYCLING CLEAN- COAL ASH By Tarun R. Naik... -Strength Materials (CLSM); 232, Fly Ash and Natural...

  13. E-Print Network 3.0 - ashes Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Utilization Summary: Center for By-Products Utilization RECENT ADVANCES IN RECYCLING CLEAN- COAL ASH By Tarun R. Naik... -Strength Materials (CLSM); 232, Fly Ash and Natural...

  14. E-Print Network 3.0 - ash ahto lobjakas Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Utilization Summary: Center for By-Products Utilization RECENT ADVANCES IN RECYCLING CLEAN- COAL ASH By Tarun R. Naik... -Strength Materials (CLSM); 232, Fly Ash and Natural...

  15. E-Print Network 3.0 - ash based gepolymer Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Utilization Summary: . CHARACTERIZATION AND APPLICATION OF CLASS F FLY ASH AND CLEAN-COAL ASH FOR CEMENT-BASED MATERIALS 2 The major... large amounts of conventional or...

  16. IN HARM'S WAY: Lack Of Federal Coal Ash

    E-Print Network [OSTI]

    Short, Daniel

    IN HARM'S WAY: Lack Of Federal Coal Ash Regulations Endangers Americans And Their Environment 2010 Thirty-nine New Damage Cases of Contamination from Improperly Disposed Coal Combustion Waste, Editor and Contributing Author #12;IN HARM'S WAY: Lack of Federal Coal Ash Regulations Endangers

  17. Process for the recovery of alumina from fly ash

    DOE Patents [OSTI]

    Murtha, M.J.

    1983-08-09T23:59:59.000Z

    An improvement in the lime-sinter process for recovering alumina from pulverized coal fly ash is disclosed. The addition of from 2 to 10 weight percent carbon and sulfur to the fly ash-calcium carbonate mixture increase alumina recovery at lower sintering temperatures.

  18. Biological impact studies of the Faulkner ash site

    SciTech Connect (OSTI)

    Klose, P.N.; Potera, G.T.

    1984-08-01T23:59:59.000Z

    The Potomac Electric Power Company (PEPCO) has operated the Faulkner coal ash storage facility in southern Charles County, Maryland since 1970. This site handles all the coal ash produced at the nearby Morgantown Generating Stations. Environmental Resources Management, Inc. (ERM) produced an earlier report (Simek, et al., 1983) for PPSP entitled, Environmental Aspects of the Faulkner Ash Site. That report presented a compilation of existing data and newly-generated field information on the ash site and its influence on the local environment. Several questions remained as a result of the analyses carried out for the above study. These were: (a) Are trees downgradient of the site accumulating metals associated with the ash. (b) Is Zekiah Swamp Run being affected by dissolved or precipitated metals. (c) Are invertebrates in Zekiah Swamp Run accumulating metals from the ash site. The studies described herein present data on each of the three questions. Results indicate that no adverse effects on water quality, invertebrates, or trees are occurring. Elevated levels of aluminum, cadmium, and manganese were found throughout the watershed, both above and below the ash site, but no relationship to the ash site could be established.

  19. STRATEGIES AND TECHNOLOGY FOR MANAGING HIGH-CARBON ASH

    SciTech Connect (OSTI)

    Robert Hurt; Eric Suuberg; John Veranth; Xu Chen

    2003-05-20T23:59:59.000Z

    The overall objective of the present project is to identify and assess strategies and solutions for the management of industry problems related to carbon in ash. Specific research issues to be addressed include: (1) the effect of parent fuel selection on ash properties and adsorptivity, including a first ever examination of the air entrainment behavior of ashes from alternative (non-coal) fuels; (2) the effect of various low-NOx firing modes on ash properties and adsorptivity; and (3) the kinetics and mechanism of ash ozonation. This data will provide scientific and engineering support of the ongoing process development activities. During this fourth project period we completed the characterization of ozone-treated carbon surfaces and wrote a comprehensive report on the mechanism through which ozone suppresses the adsorption of concrete surfactants.

  20. STRATEGIES AND TECHNOLOGY FOR MANAGING HIGH-CARBON ASH

    SciTech Connect (OSTI)

    Robert Hurt; Eric Suuberg; John Veranth; Xu Chen

    2002-09-10T23:59:59.000Z

    The overall objective of the present project is to identify and assess strategies and solutions for the management of industry problems related to carbon in ash. Specific research issues to be addressed include: (1) the effect of parent fuel selection on ash properties and adsorptivity, including a first ever examination of the air entrainment behavior of ashes from alternative (non-coal) fuels; (2) the effect of various low-NOx firing modes on ash properties and adsorptivity; and (3) the kinetics and mechanism of ash ozonation. This data will provide scientific and engineering support of the ongoing process development activities. During this fourth project period we completed the characterization of ozone-treated carbon surfaces and wrote a comprehensive report on the mechanism through which ozone suppresses the adsorption of concrete surfactants.