Powered by Deep Web Technologies
Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Bon Homme Yankton El Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Yankton El Assn, Inc Yankton El Assn, Inc Jump to: navigation, search Name Bon Homme Yankton El Assn, Inc Place South Dakota Utility Id 1898 Utility Location Yes Ownership C NERC Location MRO Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Coincidental Peak Billing Industrial Demand & Energy Billing 75-350 kva Commercial Farm Single-Phase Residential Interruptible Commercial Irrigation Single-Phase Uncontrolled Industrial Irrigation, Off Season Industrial Irrigation, Single-Phase Controlled Industrial Irrigation, Single-Phase Controlled Pivot Energy Only Commercial

2

Bon Homme County, South Dakota: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Bon Homme County, South Dakota: Energy Resources Bon Homme County, South Dakota: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.9814835°, -97.87216° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.9814835,"lon":-97.87216,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

3

Yankton County, South Dakota: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Yankton County, South Dakota: Energy Resources Yankton County, South Dakota: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 43.016179°, -97.3516558° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.016179,"lon":-97.3516558,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

4

Yankton School District Wind Project | Open Energy Information  

Open Energy Info (EERE)

School District Wind Project School District Wind Project Jump to: navigation, search Name Yankton School District Wind Project Facility Yankton School District Sector Wind energy Facility Type Community Wind Location SD Coordinates 42.896858°, -97.41584° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.896858,"lon":-97.41584,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

5

Prdiction des conflits dans des systmes homme-machine.  

E-Print Network [OSTI]

??Prdiction des conflits dans le systmes homme-machine. Le travail fait partie de la recherche consacre des problmes d'interaction homme-machine et aux conflits entre l'homme (more)

Pizziol, Sergio

2013-01-01T23:59:59.000Z

6

Bons Ventos Geradora de Energia S A | Open Energy Information  

Open Energy Info (EERE)

Bons Ventos Geradora de Energia S A Bons Ventos Geradora de Energia S A Jump to: navigation, search Name Bons Ventos Geradora de Energia S.A. Place Fortaleza, Ceara, Brazil Sector Wind energy Product Brazilian-based wind project developer, subsidiary of Grupo Servtec. Coordinates -3.718404°, -38.542924° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-3.718404,"lon":-38.542924,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

7

Du vieil Homme au nouveau: trans-humanisme? Dfis pour penser lHomme de demain  

Science Journals Connector (OSTI)

Rsum Lide dun Homme nouveau, dun Homme qui ne souffrirait pas ou plus, dun Homme qui vivrait toujours plus longtemps, voire dun Homme enfin crateur de sa propre existence nest pas nouvelle. Les recherches dun Graal, dune liqueur de jouvence, dune potion miraculeuse hantent lhumain depuis la nuit des temps et ont fait lobjet de tant de mythes. Le temps des mythes semble rsolu pour certains. Les promoteurs dune rvolution de lhumain se runissent dans des associations trs actives qui disposent dnormes fonds financiers, afin de promouvoir leurs recherches en vue damliorer lhomme quitte ce quil devienne autre, notion contenue dans le trans-humanisme. Lamlioration des comptences intellectuelles et des capacits physiques et biologiques, notion appele mliorisme ou en anglais enhancement, est au cur de leurs rflexions, de leurs recherches. Ces modifications des conditions de vie de lhomme sont possibles, grce aux fantastiques progrs de la science et des biotechnologies. La mise en commun de toutes les sciences de linformatique, de la biotechnologie, des nanotechnologies et sur la cognition appele convergence NBIC donne lillusion de pouvoir dpasser la finitude humaine et dentrer doucement dans une re damortalit. Notre propos est daider comprendre ces perspectives menant des modifications de lhumain et de souligner certaines questions thiques quelles suscitent. Summary What's about the new man, a man who will not be suffering and enduring pain, a man who will live forever, and a man who will be his own creator? Since the beginning of the world, man searches the grail, the fountain of youth, which constitutes the base of myths. Since 1980s, searchers in many fields as nanotechnology, biotechnology, sciences in numerical knowledge and science in cognition, called as NBIC convergence, have worked together to go always further. Convergence of these searchers makes possible the creation of a new man. Enhancement of the man asks humanity many ethical questions. The purpose of this article is to present ethical considerations induced by these different new prospects.

A. de Broca

2012-01-01T23:59:59.000Z

8

COLE DOCTORALE SCIENCES DE L'HOMME ET DE LA SOCIETE LABORATOIRE  

E-Print Network [OSTI]

?COLE DOCTORALE SCIENCES DE L'HOMME ET DE LA SOCIETE LABORATOIRE ACTIVITE MOTRICE ET ADAPTATION SCIENCES DE L'HOMME ET DE LA SOCIETE LABORATOIRE ACTIVITE MOTRICE ET ADAPTATION PSYCHOPHYSIOLOGIQUE (AMAPP

Paris-Sud XI, Université de

9

Progress towards accelerating HOMME on hybrid multi- core systems  

SciTech Connect (OSTI)

The suitability of a spectral element based dynamical core (HOMME) within the Community Atmospheric Model (CAM) for GPU-based architectures is examined and initial performance results are reported. This work was done within a project to enable CAM to run at high resolution on next generation, multi-petaflop systems. The dynamical core is the present focus because it dominates the performance profile of our target problem. HOMME enjoys good scalability due to its underlying cubed-sphere mesh with full two-dimensional decomposition and the localization of all computational work within each element. The thread blocking and code changes that allow HOMME to effectively use GPUs are described along with a rewritten vertical remapping scheme which improves performance on both CPUs and GPUs. Validation of results in the full HOMME model is also described. Remaining issues affecting performance include optimizing the boundary exchanges for the case of multiple spectral elements being computed on the GPU and using multiple CUDA streams to overlap data transfers with computations.

Archibald, Richard K [ORNL; Carpenter, Ilene L [ORNL; Evans, Katherine J [ORNL; Larkin, Jeff [Cray, Inc.; Micikevicius, Paulius [ORNL; Rosinski, James [NOAA, Boulder, CO; Schwarzmeier, James L [ORNL; Taylor, Mark [Sandia National Laboratories (SNL)

2011-01-01T23:59:59.000Z

10

Data:3a32114d-1809-4573-8a7c-a2a0230d041c | Open Energy Information  

Open Energy Info (EERE)

d-1809-4573-8a7c-a2a0230d041c d-1809-4573-8a7c-a2a0230d041c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Single-Phase Controlled Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

11

Data:37c6cd1a-15f1-407a-ac2c-4d3136741f29 | Open Energy Information  

Open Energy Info (EERE)

a-15f1-407a-ac2c-4d3136741f29 a-15f1-407a-ac2c-4d3136741f29 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Rural Residential Single-Phase Sector: Residential Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

12

Data:E18d89b7-56cd-42d4-91fa-8327da7d25ba | Open Energy Information  

Open Energy Info (EERE)

b7-56cd-42d4-91fa-8327da7d25ba b7-56cd-42d4-91fa-8327da7d25ba No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Farm Single-Phase Sector: Residential Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

13

AOScomments  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Alternate Operations Study Alternate Operations Study 2013 Meeting Comments A F N Aces Flandreau Municipal Electric Northwest Iowa Power Cooperative Argus Media H O B Heartland Consumers Power District Otter Tail Power Company Basin Electric Cooperative Otter Tail Power Company 2 Basin Electric Cooperative 2 I Bon Homme Yankton Electric Assoc Irrigation & Electrical Districts Association S Sanborn Electric C L Sioux Valley Energy Central Iowa Power Cooperative L & O Power Cooperative South Dakota Municipal League Central Power Electric Cooperative Lake Region Electric South Dakota Municipal League 2 City of Beresford Lyon Rural Electric Cooperative South Eastern Electric Coop City of Cavalier Lyon-Lincoln Elect Coop City of Henning T City of Laurel M Town of Pickstown City of Melrose Marshall Municipal

14

Data:945188fc-2394-46e9-b4e0-471f63d3fed5 | Open Energy Information  

Open Energy Info (EERE)

fc-2394-46e9-b4e0-471f63d3fed5 fc-2394-46e9-b4e0-471f63d3fed5 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation Single-Phase Uncontrolled Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

15

Data:6793dbb6-203f-4fec-b734-2aebaee98017 | Open Energy Information  

Open Energy Info (EERE)

dbb6-203f-4fec-b734-2aebaee98017 dbb6-203f-4fec-b734-2aebaee98017 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Small Commercial Single-Phase Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

16

Data:68947f56-5be5-474a-9246-2dca88e83a7d | Open Energy Information  

Open Energy Info (EERE)

-5be5-474a-9246-2dca88e83a7d -5be5-474a-9246-2dca88e83a7d No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Demand & Energy Billing 75-350 kva Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

17

Data:D4b211c5-938e-45ab-a5b8-edc53ed137e1 | Open Energy Information  

Open Energy Info (EERE)

c5-938e-45ab-a5b8-edc53ed137e1 c5-938e-45ab-a5b8-edc53ed137e1 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Three-Phase Controlled Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

18

Data:350aa617-2f1b-4069-907e-0c40fe10a1e3 | Open Energy Information  

Open Energy Info (EERE)

17-2f1b-4069-907e-0c40fe10a1e3 17-2f1b-4069-907e-0c40fe10a1e3 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Single-Phase Controlled Pivot Energy Only Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous

19

Data:A1033a3d-3ede-44fd-b543-8d8c7d856c76 | Open Energy Information  

Open Energy Info (EERE)

a3d-3ede-44fd-b543-8d8c7d856c76 a3d-3ede-44fd-b543-8d8c7d856c76 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Coincidental Peak Billing Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

20

Data:44fb2115-d097-4078-b11e-cde48f1f7da9 | Open Energy Information  

Open Energy Info (EERE)

fb2115-d097-4078-b11e-cde48f1f7da9 fb2115-d097-4078-b11e-cde48f1f7da9 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Large Load 350-1500kva Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Data:D9dbd362-cb4e-4007-91f7-9fd58ec6182c | Open Energy Information  

Open Energy Info (EERE)

dbd362-cb4e-4007-91f7-9fd58ec6182c dbd362-cb4e-4007-91f7-9fd58ec6182c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Town Residential Single-Phase Sector: Residential Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

22

Universit Charles-de-Gaulle Lille III Ecole doctorale Sciences de l'Homme et de la Socit  

E-Print Network [OSTI]

à Salt Lake City, ancienne directrice du département de danse moderne de l'Université dUniversité Charles-de-Gaulle ­ Lille III Ecole doctorale « Sciences de l'Homme et de la Société,version1-8Nov2013 #12;Université Charles-de-Gaulle ­ Lille III Ecole doctorale « Sciences de l'Homme et de

Paris-Sud XI, Université de

23

Microsoft PowerPoint - UTSRWorkshop-Oct2010-Bons.pptx  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS FOR DEPOSITION RESISTANCE WITH 1400C COMBUSTOR EXIT TEMPERATURES AND SYNGAS WATER VAPOR LEVELS Ch i S ith B tt B k P h th Sh k Chris Smith, Brett Barker, Prashanth Shankaran Josh Webb, Brian Casaday Dr. Ali Ameri, Dr. Jeffrey Bons "THE" OHIO STATE UNIVERSITY THE OHIO STATE UNIVERSITY Robert Laycock, Dr. Thomas Fletcher "THE" BRIGHAM YOUNG UNIVERSITY "THE" BRIGHAM YOUNG UNIVERSITY (3-year grant awarded Oct 2009) 1 MOTIVATION/NEED * Operational Issues -Fuel flexibility (range of feedstock heat release) y ( g ) -Diluent use (e.g. steam) -Filtration requirements * Technical Challenges - Higher firing temperature I d h t t f ( t dil t) - Increased heat transfer (steam diluent) - Potential for increased levels of airborne contaminants

24

Overexpression of wild-type PKD2 leads to increased proliferation and invasion of BON endocrine cells  

SciTech Connect (OSTI)

Carcinoid tumors are rare neuroendocrine tumors with a predilection for the gastrointestinal tract. Protein kinase D (PKD), a novel serine/threonine protein kinase, has been implicated in the regulation of transport processes in certain cell types. We have reported an important role for PKD in stimulated peptide secretion from a human (BON) carcinoid cell line; however, the role of PKD isoforms, including PKD2, in the proliferation and invasion of carcinoid tumors remains unclear. In the present study, we found that overexpression of PKD2 by stable transfection of BON cells with PKD2-wild type (PKD2{sub WT}) significantly increased proliferation and invasion compared to cells transfected with PKD2-kinase dead (PKD2{sub KD}) or pcDNA3 (control). Similarly, inhibition of PKD2 activity with small interfering RNA (siRNA) significantly decreased proliferation and invasion compared to cells transfected with non-targeting control (NTC) siRNA. These data support an important role for PKD2 in carcinoid tumor progression. Targeted inhibition of the PKD family may prove to be a novel treatment option for patients with carcinoid tumors.

Jackson, Lindsey N. [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Li Jing [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX (United States); Chen, L. Andy [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Townsend, Courtney M. [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Evers, B. Mark [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States) and Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX (United States)]. E-mail: mevers@utmb.edu

2006-09-29T23:59:59.000Z

25

Fondation Maison des sciences de l'homme -190 avenue de France -75013 Paris -France http://www.msh-paris.fr -FMSH-WP-2013-35  

E-Print Network [OSTI]

://www.msh-paris.fr - FMSH-WP-2013-35 Working Papers Series Climate Change in Visual Communication: From `This is Not a Pipe #12;Climate Change in Visual Communication 2/15 Fondation Maison des sciences de l'homme - 190 avenue this document Kiyomitsu Yui, Climate Change in Visual Communication: From `This is Not a Pipe' to `This

Paris-Sud XI, Université de

26

Use of SiBN and SiBON films prepared by plasma enhanced chemical vapor deposition from borazine as interconnection dielectrics  

SciTech Connect (OSTI)

Thin films of silicon boron nitride (SiBN) of typical composition Si{sub 0.09}B{sub 0.39}N{sub 0.51} and silicon boron oxynitride (SiBON) of typical composition Si{sub 0.16}B{sub 0.29}O{sub 0.41}N{sub 0.14} were prepared by plasma enhanced chemical vapor deposition and the properties of these films were evaluated with respect to their suitability as interconnection dielectrics in microelectronic fabrication. Films were deposited on 125 mm silicon substrates in a parallel-plate reactor at a substrate temperature of 400 C and a plasma power of 0.5 W/cm{sup 2}. Boron nitride, for comparison of electrical properties, was deposited from borazine (B{sub 3}N{sub 3}H{sub 6}); silicon boron nitride was deposited from borazine, disilane (Si{sub 2}H{sub 6}), and ammonia (NH{sub 3}); silicon boron oxynitride was deposited from borazine, disilane, ammonia, and nitrous oxide (N{sub 2}O). Metal-insulator-metal capacitors were fabricated and electrical measurements indicated that all three films had excellent dielectric properties with dielectric constants of 4.1, 4.7, and 3.9 for BN, SiBN, and SiBON, respectively. Tests of conformality indicated that deposition into trenches with an aspect ratio of 4:1 gave conformality greater than 70%. Silicon boron oxynitride was shown to be an excellent barrier to the diffusion of copper. A planar, single level metal-insulator structure was constructed using a SiBN/SiBON insulator with copper metallization.

Kane, W.F.; Cohen, S.A.; Hummel, J.P.; Luther, B. [IBM Research Div., Yorktown Heights, NY (United States). T.J. Watson Research Center; Beach, D.B. [Oak Ridge National Lab., TN (United States). Chemical and Analytical Sciences Div.

1997-02-01T23:59:59.000Z

27

Data:7b859fcd-47b5-4102-ab05-3fe1364c5be5 | Open Energy Information  

Open Energy Info (EERE)

fcd-47b5-4102-ab05-3fe1364c5be5 fcd-47b5-4102-ab05-3fe1364c5be5 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Large Farm, Single-Phase Sector: Residential Description: * Applicable to large farm and rural residential 37.5 to 100kva. Additional transformer fee 37.5 kva $2.75/month. Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage

28

Data:776691a8-8f15-4a1d-8750-9fc4b3d9132c | Open Energy Information  

Open Energy Info (EERE)

91a8-8f15-4a1d-8750-9fc4b3d9132c 91a8-8f15-4a1d-8750-9fc4b3d9132c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Off Season Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

29

Data:02c3db94-dc82-47c7-8f9d-d4c57e9fc8ae | Open Energy Information  

Open Energy Info (EERE)

4-dc82-47c7-8f9d-d4c57e9fc8ae 4-dc82-47c7-8f9d-d4c57e9fc8ae No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Large Load Voluntary Load Control Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

30

Data:F56db83d-b034-41af-a4da-a91d395f7fdf | Open Energy Information  

Open Energy Info (EERE)

db83d-b034-41af-a4da-a91d395f7fdf db83d-b034-41af-a4da-a91d395f7fdf No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Interruptible Sector: Commercial Description: * Coincident demand is $ 17.80. Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous

31

Data:43b429eb-2d1c-4b3f-91e7-f5a71dda9dae | Open Energy Information  

Open Energy Info (EERE)

9eb-2d1c-4b3f-91e7-f5a71dda9dae 9eb-2d1c-4b3f-91e7-f5a71dda9dae No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Small Commercial, Single-Phase Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

32

Hommes, femmes et territoires du vin (1960-2010). Les Appellations d'Origine Contrle (AOC), modle de dveloppement local la  

E-Print Network [OSTI]

Hommes, femmes et territoires du vin (1960-2010). Les Appellations d'Origine Contrôlée (AOC) Université Bordeaux 3, UMR ADES 5185 Située en Bourgogne, l'Appellation d'Origine Contrôlée (AOC) Saint superficie totale), la France compte à présent 357 Appellations d'Origine Contrôlée (AOC)2 . Signe tangible

Paris-Sud XI, Université de

33

Combining VisNIR hyperspectral imagery and legacy measured soil profiles to map subsurface soil properties in a Mediterranean area (Cap-Bon, Tunisia)  

Science Journals Connector (OSTI)

Abstract Previous studies have demonstrated that Visible Near InfraRed (VisNIR) hyperspectral imagery is a cost-efficient way to map soil properties at fine resolutions (~5m) over large areas. However, such mapping is only feasible for the soil surface because the effective penetration depths of optical sensors do not exceed several millimeters. This study aims to determine how VisNIR hyperspectral imagery can serve to map the subsurface properties at four depth intervals (1530cm, 3060cm, 60100cm and 30100cm) when used with legacy soil profiles and images of parameters derived from digital elevation model (DEM). Two types of surfacesubsurface functions, namely linear models and random forests, that estimate subsurface property values from surface values and landscape covariates were first calibrated over the set of legacy measured profiles. These functions were then applied to map the soil properties using the hyperspectral-derived digital surface soil property maps and the images of landscape covariates as input. Error propagation was addressed using a Monte Carlo approach to estimate the mapping uncertainties. The study was conducted in a pedologically contrasted 300km2-cultivated area located in the Cap Bon region (Northern Tunisia) and tested on three soil surface properties (clay and sand contents and cation exchange capacity). The main results were as follows: i) fairly satisfactory (cross-validation R2 between 0.55 and 0.81) surfacesubsurface functions were obtained for predicting the soil properties at 1530cm and 3060cm, whereas predictions at 60100cm were less accurate (R2 between 0.38 and 0.43); ii) linear models outperformed random-forest models in developing surfacesubsurface functions; iii) due to the error propagations, the final predicted maps of the subsurface soil properties captured from 1/3 to 2/3 of the total variance with a significantly decreasing performance with depth; and iv) these maps brought significant improvements over the existing soil maps of the region and showed soil patterns that largely agreed with the local pedological knowledge. This paper demonstrates the added value of combining modern remote sensing techniques with old legacy soil databases.

Philippe Lagacherie; Anne-Ruth Sneep; Ccile Gomez; Sinan Bacha; Guillaume Coulouma; Mohamed Hdi Hamrouni; Insaf Mekki

2013-01-01T23:59:59.000Z

34

Case Study No. 2: Bon Apptit Management Company  

E-Print Network [OSTI]

and hormone use, seafood health and sustainability,began with a sustainable seafood educational tour around thelearning how to make better seafood choices. This effort

Thistlethwaite, Rebecca; Brown, Martha

2010-01-01T23:59:59.000Z

35

Interface Homme-Machine Ralit virtuelle, ralit augmente  

E-Print Network [OSTI]

ou 195 + 50 pour les étudiants) #12;COMMENT CR?ER DE LA R?ALIT? AUGMENT?E? Google Sketchup, pluggin

Pitti, Alexandre

36

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

solvents solvents B-6 Pre-Combustion solvents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 Co 2 CaPture from igCC gas streams using aC-abC ProCess primary project goals SRI International is developing, for integrated gasification combined cycle (IGCC)-based power plants, a carbon dioxide (CO 2 ) capture technology based on the use of a high-ca- pacity and low-cost aqueous ammoniated solution containing ammonium carbonate (AC), which reacts with CO 2 to form ammonium bicarbonate (ABC).

37

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

solvents solvents B-198 Post-Combustion solvents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 DeveloPment anD Demonstration of Waste heat integration With solvent ProCess for more effiCient Co 2 removal from Coal-fireD flue gas primary project goals Southern Company Services is developing viable heat integration methods for the capture of carbon dioxide (CO 2 ) produced from pulverized coal (PC) combustion. The project will quantify energy-efficiency improvements to the CO 2 capture process by utilizing a waste heat recovery technology, High-Efficiency System (HES). technical goals * Reduction of the amount of extraction steam required for sensible heat load in the

38

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sorbents sorbents B-302 Post-Combustion sorbents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 benCh-sCale DeveloPment anD testing of raPiD Pressure swing absorPtion for Carbon DioxiDe CaPture primary project goals WR Grace and the University of South Carolina are developing a rapid pressure swing adsorption (PSA) process to evaluate concept cost and performance benefits by testing a bench-scale system using a low-cost, structured adsorbent with low-pressure drop, high mass-transfer rates, high capacity, and high availability that will enable large feed through- puts. technical goals * Develop an attrition-resistant and low-pressure drop structured adsorbent based on a

39

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sorbents sorbents B-14 Pre-Combustion sorbents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 aDvanCeD Carbon DioxiDe CaPture teChnology for low-rank Coal integrateD gasifiCation CombineD CyCle (igCC) systems primary project goals TDA will investigate the technical and economic advantages of using an integrated carbon dioxide (CO 2 ) sorbent and water-gas shift (WGS) catalyst system in an integrated gasifi- cation combined cycle (IGCC) power plant, fueled with low-rank coal, and designed to capture more than 90% of the CO 2 emissions. technical goals * TDA will evaluate the physical mix of the sorbent and catalyst pellets within the same

40

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AdvAnced compression AdvAnced compression B-540 AdvAnced compression U.s. depArtment of energy AdvAnced cArbon dioxide cAptUre r&d progrAm: technology UpdAte, mAy 2013 novel concepts for the compression of lArge volUmes of co 2 primary project goals Southwest Research Institute (SwRI) is developing novel compression technology concepts to reduce carbon dioxide (CO 2 ) compression power requirements by 10% compared to conventional compressor designs. The basic concept is a semi-isothermal compression pro- cess where the CO 2 is continually cooled using an internal cooling jacket rather than using conventional interstage cooling. The project has completed thermodynamic (Phase I) and prototype testing (Phase II). A full-scale demonstration of a multi-stage, internally cooled

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

membranes membranes B-370 Post-Combustion membranes u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 eleCtroChemiCal membrane for Carbon DioxiDe CaPture & Power generation primary project goals FuelCell Energy, Inc. (FCE) is developing an electrochemical membrane (ECM)-based Combined Electric Power and Carbon Dioxide Separation (CEPACS) system for carbon dioxide (CO 2 ) capture that also provides additional electrical power generation. The project includes bench-scale testing of an 11.7 m 2 -area ECM (molten carbonate fuel cell) system for CO 2 capture, purification, and compression. technical goals * Perform contaminant effect testing to establish maximum permissible concentrations of

42

E-Print Network 3.0 - activities bon voyage Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

that Voyager is seeing activity upstream of the shock... Relation between the solar wind dynamic pressure at Voyager 2 and the energetic particle events... at Voyager 1...

43

Energy Efficiency and Conservation Block Grant Program  

Broader source: Energy.gov (indexed) [DOE]

U.S. Department of Energy Categorical Exclusion Determination Form Project Title Program or Field Office: Energy Efficiency and Conservation Block Grant Program SD-TRIBE-YANKTON SIOUX TRIBE Location: Tribe SD-TRIBE- YANKTON SIOUX TRIBE SD American Recovery and Reinvestment Act: Proposed Action or Project Descriptio The Yankton Sioux Tribe of South Dakota proposes to employ a Tribal Grant Coordinator to oversee the

44

Appendix B: CArBon dioxide CApture teChnology SheetS R&D CollaboRations  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

R&D CollaboRations R&D CollaboRations B-556 R&D CollaboRations U.s. DepaRtment of eneRgy aDvanCeD CaRbon DioxiDe CaptURe R&D pRogRam: teChnology UpDate, may 2013 paRtneRship foR Co 2 CaptURe primary project goals The University of North Dakota Energy and Environmental Research Center (UNDEERC) is conducting pilot-scale testing to demonstrate and evaluate a range of carbon dioxide (CO 2 ) capture technologies to develop key technical and economic information that can be used to examine the feasibility of capture technologies as a function of fuel type and system configuration. technical goals * Integrate a high-efficiency flexible capture system with existing pilot-scale combustion

45

Appendix B: CArBon dioxide CApture teChnology SheetS Oxy-COmbustiOn  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oxy-COmbustiOn Oxy-COmbustiOn B-424 Oxy-COmbustiOn u.s. Department Of energy aDvanCeD CarbOn DiOxiDe Capture r&D prOgram: teChnOlOgy upDate, may 2013 Oxygen transpOrt membranes fOr inDustrial appliCatiOns primary project goals Praxair is optimizing oxygen transport membrane (OTM) performance, materials, and process configurations leading to subsequent development-scale testing of OTM technology for synthesis gas (syngas) production applications, providing valuable experience needed to develop commercial OTM technology in industrial applications and future utility-scale

46

Appendix B: CArBon dioxide CApture teChnology SheetS Oxygen PrOductiOn  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oxygen PrOductiOn Oxygen PrOductiOn B-500 Oxygen PrOductiOn u.S. dePartment Of energy advanced carbOn diOxide caPture r&d PrOgram: technOlOgy uPdate, may 2013 itm Oxygen technOlOgy fOr integratiOn in igcc and Other advanced POwer generatiOn SyStemS primary project goals Air Products and Chemicals set out to design and develop an ion transport membrane (ITM) based on ceramics that selectively transport oxygen (O 2 ) ions when operated at high temperature. This high-temperature process may be integrated with advanced power genera- tion processes that require O 2 as a feedstock, such as integrated gasification combined cycle (IGCC) and other clean energy and industrial applications. technical goals * Design, construct, and operate a 0.1-ton/day (TPD) technology development unit

47

Berlin, le 25 janvier 2007 Evaluation et politiques: Y a-t-il de bons indicateurs pour la recherche?  

E-Print Network [OSTI]

(derived from the works of Amartya Sen). Then I try to apply these conceptions towards research evaluation

Paris-Sud XI, Université de

48

Combining boron isotopes and carbamazepine to trace sewage in salinized groundwater: a case study in Cap Bon, Tunisia  

E-Print Network [OSTI]

treatment and so recognized as a pertinent tracer of wastewater contamination. The system equilibrium of Research in Rural Engineering of Water and Forestry), rue Hédi Karray, B.P.10- 2080 Ariana, Tunisia based on a managed aquifer recharge with treated wastewater. Water quality monitoring was implemented

Paris-Sud XI, Université de

49

Ziyad Rahbani, une figure indite de l'homme de thtre au Liban  

E-Print Network [OSTI]

sous le nom de ta`ziyeh, emprunté au Persan. Voir l'article de Sabrina Mervin dans ce volume. Arnaud

Paris-Sud XI, Université de

50

COLE DOCTORALE SCIENCES DE L'HOMME ET DE LA SOCIET LABORATOIRE CEDETE EA 1210  

E-Print Network [OSTI]

'Orléans Discipline/ Spécialité : Géographie-Aménagement-Environnement Gouvernance des ressources forestières au Gabon'études au Gabon et de subvenir aux nombreux besoins du financement de la thèse. Entre les officiels et ceux. - Brice Didier KOUMBA MABERT (CNDIO-GABON) et Khy-Meng NAY (BRGM) pour l'aide à la réalisation des cartes

51

Behavioral Heterogeneity in Stock Prices H. Peter Boswijk Cars H. Hommes Sebastiano Manzan  

E-Print Network [OSTI]

11, NL-1018 WB Amsterdam, The Netherlands; e-mail: s.manzan@uva.nl, web- page: httpNDEF, University of Amsterdam, the Netherlands Abstract We estimate a dynamic asset pricing model characterized acknowledged. This re- search has been supported by the Netherlands Organization for Scientific Research (NWO

Tesfatsion, Leigh

52

US Army Corps of Engineers Portland District  

E-Print Network [OSTI]

) 1,200 Steelhead Kelt passage at BON Passage behavior to inform decision on BON powerhouse priority

53

The Darlington Centre and Forum Restaurant 174 City Road, Darlington NSW 2008 Ph: 9351 4664 Email: forum.restaurant@sydney.edu.au Bon Appetite!  

E-Print Network [OSTI]

and crafted so you can eat fresh, seasonal produce sourced from ethical and sustainable suppliers. #12;The with a shot of Pedro Jimenez Sherry and 9 a shot of Black Rose tea COFFEE & TEA Toby's Estate: Latte Paraguay and real cola nut grown by the Mende & Temne people of Sierra Leone. Lemmy Lemonade: Give your

Viglas, Anastasios

54

Motion plan n in g for m ulti-robot assem bly M . BON ER T, L. H. SHU and B. BEN H ABIB  

E-Print Network [OSTI]

-type optim ization problem s. H owever, in these augm ented TSPs (TSP+) , both the `sales- person' (a robot, Euclidean, Ch ebysh ev, prize collectin g an d tim e-depen - den t TSP variation s ( Dubowsky an d Blubaugh

Shu, Lily H.

55

This article was downloaded by: [b-on: Biblioteca do conhecimento online ISPA] On: 15 January 2013, At: 09:17  

E-Print Network [OSTI]

-401, Coimbra, Portugal b Eco-Ethology Research Unit & Centro de Biociências, ISPA, Rua Jardim do Tabaco 34, 1149-041, Lisboa, Portugal c ICNB ­ DGACZH, Reserva Natural do Paul de Arzila, Rua do Bairro 1, 3045 do Porto, Campus Agrário de Vairão, Rua Padre Armando Quintas, P-4485-661, Vairão, Portugal e

56

L'identit gomtrie variable des jeunes hommes Kali'na de Mana (Guyane franaise) : sur quelle mesure ?  

E-Print Network [OSTI]

disperse au Brésil, au Surinam, jusqu'au Guyana et au Venezuela (Ethnies 1985 :14). En 1958, la population, conséquence de la guerre civile du Surinam. Aujourd'hui, les Kali'na sont entre de 2800 et 4000 individus

Paris-Sud XI, Université de

57

COLE DOCTORALE SCIENCES DE L'HOMME ET DE LA SOCIETE LABORATOIRE Activit Motrice et Adaptation PsychoPhysiologique  

E-Print Network [OSTI]

Motrice et Adaptation PsychoPhysiologique TH?SE présentée par : Nabil ILMANE soutenue le : 11 Mars 2009

Boyer, Edmond

58

Interactions entre langage et processus visuels rapides: une tude chez l'homme normal, l'aphasique et le singe  

E-Print Network [OSTI]

données suggère maintenant qu'une rapide réponse motrice de catégorisation peut être déclen- chée sur la pro- et rétro-actif. Deux types de réponse seront étudiés: la réponse motrice rapide (automatique et ainsi pouvoir isoler des conditions dans lesquelles la réponse motrice rapide du sujet est exécutée avec

Paris-Sud XI, Université de

59

MUSUM NATIONAL D'HISTOIRE NATURELLE ED 227 Sciences de la Nature et de l'Homme  

E-Print Network [OSTI]

ACTIVIT?S LITTORALES AU GABON Sous la direction de : Monsieur le Professeur Serge BAHUCHET Composition du SAVOIR-FAIRE DANS UN CONTEXTE PLURICULTUREL ?TUDE COMPARATIVE DES ACTIVIT?S LITTORALES AU GABON Sous la, frères, Mamans et Papas du Gabon, qu'ils soient gabonais, béninois, congolais, sénégalais, togolais

Paris-Sud XI, Université de

60

Hommes et milieux : volution, interactions Participation des elus C aux comits de visite des units par l'AERES  

E-Print Network [OSTI]

de visite des unités par l'AERES La section 31 du comité national, lors de la session d'automne 2012, demande par cette motion à la direction de l'AERES d'intégrer systématiquement dans les comités de visite que leur opinion puisse s'exprimer et être prise en compte au cours de l'évaluation des unités par l'AERES

van Tiggelen, Bart

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Universit Bordeaux 1 Les Sciences et les Technologies au service de l'Homme et de l'environnement  

E-Print Network [OSTI]

Ingénieur de Recherche - SAFT, Bordeaux Examinateur Mme A. ROUGIER Directrice de Recherche - ICMCB, Bordeaux travail. Mes remerciements vont également à Monsieur Patrick Bernard, Ingénieur de Recherche à SAFT

Paris-Sud XI, Université de

62

CX-005522: Categorical Exclusion Determination | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

522: Categorical Exclusion Determination 522: Categorical Exclusion Determination CX-005522: Categorical Exclusion Determination South Dakota-Tribe-Yankton Sioux Tribe CX(s) Applied: B5.1 Date: 03/30/2011 Location(s): South Dakota Office(s): Energy Efficiency and Renewable Energy Energy Efficiency and Conservation Block Grant. The Yankton Sioux Tribe of South Dakota proposes to employ a Tribal Grant Coordinator to oversee the Yankton Sioux Tribe?s Solar Energy Project and to utilize funds to pay for training costs/stipends to trainees attending a training course on assembling solar air heating systems. The trainees would install solar collector panels (approximately 10-15 solar heating panels per building) on approximately 3 to 6 tribal buildings. DOCUMENT(S) AVAILABLE FOR DOWNLOAD CX-005522.pdf More Documents & Publications

63

L'Utopisme technologique dans la science-fiction hollywoodienne, 1982-2010 : transhumanisme, posthumanit et le rve de "l'homme-machine".  

E-Print Network [OSTI]

??La technologie et le progrs technologique occupent une place centrale dans l'histoire et dans l'imaginaire amricain. En mme temps que la Rvolution Industrielle apparaissent aux (more)

Achouche, Mehdi

2011-01-01T23:59:59.000Z

64

Des premiers villages aux premiers europens autour de l'estuaire du Gabon : quatre millnaires d'interactions entre l'homme et son milieu.  

E-Print Network [OSTI]

??La thse porte sur la mise au jour d'une squence culturelle continue dans le nord-ouest du Gabon, sur le territoire de la Province de l'Estuaire. (more)

Clist, Bernard

2005-01-01T23:59:59.000Z

65

Fondation Maison des sciences de l'homme -190 avenue de France -75013 Paris -France http://www.msh-paris.fr -FMSH-WP-2013-37  

E-Print Network [OSTI]

://www.msh-paris.fr - FMSH-WP-2013-37 Working Papers Series The Coal Renaissance and Cosmopolitized Low-Carbon Societies paradox: the `phenomenal' and `histori- cally incredible' resurgence of coal. Exploration of the source transition. C o s m o p o l i t a n risk communities halshs-00842922,version1-9Jul2013 #12;The Coal

Boyer, Edmond

66

The Gospel According to Zola: National Identity and Naturalist Utopia in Fin-de-Sicle France  

E-Print Network [OSTI]

University Press, 2007. Camus, Albert. Lhomme rvolt.Tzvetan Todorov, Albert Camus, Jean-Paul Sartre, and Pierre-Grasset et Fasquelle, 1998); Camus, Lhomme rvolt (Paris:

Zupsich, Gina Katherine

2010-01-01T23:59:59.000Z

67

Etude de la modulation de la rponse cellulaire au stress oxydatif par les protines VP24 des virus Marburg et Ebola.  

E-Print Network [OSTI]

??Les virus Ebola (EBOV) et Marburg (MARV) causent des fivres hmorragiques chez les primates, y compris lhomme. Le taux de ltalit peut atteindre 90% et (more)

Page, Audrey

68

Etude de la modulation de la rponse cellulaire au stress oxydatif par les protines VP24 des virus Marburg et Ebola.  

E-Print Network [OSTI]

??Les virus Ebola (EBOV) et Marburg (MARV) causent des fivres hmorragiques chez les primates, y compris l'homme. Le taux de ltalit peut atteindre 90% et (more)

Page, Audrey

2012-01-01T23:59:59.000Z

69

Geographical Notes  

Science Journals Connector (OSTI)

... xix., dealing with South America, M. Elisee Reclus' great work, "Nouvelle Geographic Universelle: La Terre et les Hommes,"has been completed. Twenty years have elapsed since ...

1894-01-11T23:59:59.000Z

70

Dynamique des savoirs et des savoir-faire dans un contexte pluriculturel. tude comparative des activits littorales au Gabon.  

E-Print Network [OSTI]

??Les littoraux sont des espaces d'interfaces non seulement cologiques, mais aussi humaines. De tout temps peupls ou traverss par des hommes de cultures et de (more)

Sabinot, Catherine

2008-01-01T23:59:59.000Z

71

Inhibition of Potential Lethal Damage Repair and Related Gene Expression after Carbon-ion Beam Irradiation to Human Lung Cancer Grown in Nude Mice  

Science Journals Connector (OSTI)

......Gy for X-ray and 5 Gy for car- bon-ion beam because each...after exposure to X-ray or car- bon-ion beams was reported...GCAGCCGCTATTACCGTATC TGTGCCAGTGTCATCATCAA Genes defective in diseases associated with...after exposure to X-ray or car- bon-ion beams has been observed......

Tomoyasu Yashiro; Kumiko Koyama-Saegusa; Takashi Imai; Takehiko Fujisawa; Tadaaki Miyamoto

2007-09-01T23:59:59.000Z

73

Human Rights  

ScienceCinema (OSTI)

Daniel Meyer, Prsident de la ligue franaise de dfense de droits de l'homme et du citoyen fait un expos sur son engagement (politique). Dans la deuxime partie, une avocate brsilienne (en exil)donne un tmoignage de la violation des droits de l'homme sous la dictature militaire de son pays; elle a dfendu pendant 6 ans des prisonniers politiques.

None

2011-04-25T23:59:59.000Z

74

Old Oyo Influences on the Transformation of Lucum Identity in Colonial Cuba  

E-Print Network [OSTI]

The Bon Maroon Wars in Suriname. Leiden: E. J. Brill, 1990.and Musical Transformations in Suriname c. 1775 until afterand Susu Xylophones in Suriname. Paper presented at

Lovejoy, Henry B.

2012-01-01T23:59:59.000Z

75

Download  

Science Journals Connector (OSTI)

Sep 10, 1975 ... cepts radiant energy and uses it to pro- duce new ... Here we present an alternative derivation of Ban- ..... and particulate organic car- bon were...

2000-01-11T23:59:59.000Z

76

tel-00550139,version1-23Dec2010 tel-00550139,version1-23Dec2010  

E-Print Network [OSTI]

'ai eues avec bon nombre de chercheurs du DMSC. Merci à vous Bertrand, Christian, Daniel(s), Françoise

Paris-Sud XI, Université de

77

Download  

Science Journals Connector (OSTI)

Production of chlorinated hydrocarbons and methyl iodide by the red microalga. Porphyridium .... bons were extracted from the water samples by purging and.

1999-05-20T23:59:59.000Z

78

Remarkable Sounds  

Science Journals Connector (OSTI)

... croyet que les mes des hommes sont la tor-mentees de froid."("La Cosmographie universelle,"Basle, 1552, p. 1051.) Against this error Arngrimus lonas writes, but ...

KUMAGUSU MINAKATA

1896-02-06T23:59:59.000Z

79

Albert Camus et le christianisme.  

E-Print Network [OSTI]

??Pour Albert Camus le problme dominant du XXe sicle est de savoir, "si l'homme sans le secours de l'ternel ou de la pense rationaliste peut (more)

Reekie, Julia Lamont

2012-01-01T23:59:59.000Z

80

The immunology of Human cytomegalovirus latency: could latent infection be cleared by novel immunotherapeutic strategies?  

E-Print Network [OSTI]

. Wilkinson GW, Tomasec P, Stanton RJ, Armstrong M, Prod'homme V, Aicheler R, et al. Modulation of natural killer cells by human cytomegalovirus. Journal of clinical virology : the official publication of the Pan American Society for Clinical Virology. 2008...

Wills, M. R.; Poole, Emma; Lau, Betty; Krishna, Ben; Sinclair, John

2014-08-18T23:59:59.000Z

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Multi-Agent Based Techniques for Coordinating the Distribution of Electricity in a Micro-Grid Environment  

E-Print Network [OSTI]

vehicles, to ultra-low carbon vehicles (ULCV) such as hybrids, electric vehicles and hydrogen fuel cell. 2 Background Research To reduce carbon emissions and ensure that the UK low car- bon emissions plan to the current national grid, the in- creasing demand for electricity will only result in more car- bon emissions

Southampton, University of

82

Studies on Biological Effects of Ion Beams on Lethality, Molecular Nature of Mutation, Mutation Rate, and Spectrum of Mutation Phenotype for Mutation Breeding in Higher Plants  

Science Journals Connector (OSTI)

......rearrangements preferably induced by car- bon ions have different molecular...mutant, suv2-1, which is defective in cell-cycle arrest in response...Rearrangement of the DNA in car- bon ion-induced mutants...mutant in Arabidopsis thaliana is defective in the DNA damage response......

Atsushi Tanaka; Naoya Shikazono; Yoshihiro Hase

2010-05-01T23:59:59.000Z

83

Radiation-induced ICAM-1 Expression via TGF-?1 Pathway on Human Umbilical Vein Endothelial Cells; Comparison between X-ray and Carbon-ion Beam Irradiation  

Science Journals Connector (OSTI)

......expression in cells irradiated with car- bon-ion beam and the same...HUVE cells at 48 hours after car- bon beam irradiation. ICAM-1...human lymphoblasts and mice are defective in radiation- induced apoptosis...endothelial growth factor in lung car- cinoma cells. Int J Radiat......

Hiroki Kiyohara; Yasuki Ishizaki; Yoshiyuki Suzuki; Hiroyuki Katoh; Nobuyuki Hamada; Tatsuya Ohno; Takeo Takahashi; Yasuhiko Kobayashi; Takashi Nakano

2011-05-01T23:59:59.000Z

84

PUBLICATIONS, CONFERENCE PRESENTATIONS AND REPORTS Refereed Publications  

E-Print Network [OSTI]

Petroleum Technology, February 2008, Vol. 47, No.2, 52-61. 25. Bon, J., Sarma, H.K., Rodrigues, J.T. and Bon, J.G., "Reservoir Fluid Sampling Revisited - A Practical Perspective", SPE Reservoir Evaluation in SPE News Australasia, October/November 2003, Issue 79. 17. H.K. Sarma, N. Yazawa, R.G. Moore, S

Williams, John M.

85

High-temperature formation of concentric fullerene-like structures within foam-like carbon: Experiment and molecular dynamics simulation  

E-Print Network [OSTI]

car- bon ion implantation,4 and arc discharge from a carbon target in water.5 Onionlike structures of concentric fullerene-like structures, car- bon onions can be formed in a variety of harsh environments laser operating at 532 nm, generating 12 ps pulses at a rep- etition rate of 1.5 MHz, with average power

Powles, Rebecca

86

Estimation of Yields of OH Radicals in Water Irradiated by Ionizing Radiation  

Science Journals Connector (OSTI)

......simulations by Monte Car- lo method have...time being, an alternative approach may still...the spur. The energy Es to form a spur...a function of energy (keV/amu...protons, helium- , car- bon-, neon...Solution with Car- bon- and Nitrogen...Chemistry of High-Energy Carbon, Neon......

Hiroshi Yamaguchi; Yukio Uchihori; Nakahiro Yasuda; Masashi Takada; Hisashi Kitamura

2005-09-01T23:59:59.000Z

87

The relationship between electronmolecule collision cross?sections, experimental Townsend primary and secondary ionization coefficients and constants, electric strength and molecular structure of gaseous hydrocarbons  

Science Journals Connector (OSTI)

...and constants, electric strength and molecular...hydrogen atoms/car- bon{hydrogen...relevant electron energy range being deter...Townsend ionization; electric strength; molecular...length (i.e. car- bon nucleus...the same in the energy range of interest...Lond. A (2000) Electric characteristics...

2000-01-01T23:59:59.000Z

88

Constitution (1987). Haitian French Creole  

E-Print Network [OSTI]

jistis tout bon vre. 3. Konstitisyon sa a la, pou peyi d Ayiti kanpe solid, pou li kanpe an fm, an pami tout nasyon. Pou li pa restavk okenn lot peyi. Pou li kenbe tou sa ki f Ayisyen, se Ayisyen tout bon, ni nan sa yo mete konfyans yo ladan, ni... nan jan yo viv, ni nan fason youn svi ak 1L 4. Konstitisyon sa a la, pou demokrasi pouse bon rasin nan peyi a. Pou tout moun gen dwa suiv lide yo lib. Pou direksyon peyi a pa toujou rete nan men menm moun ak menm gwoup moun tout tan. Pou psonn...

1994-01-01T23:59:59.000Z

89

Page not found | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

51 - 27160 of 28,904 results. 51 - 27160 of 28,904 results. Download CX-005520: Categorical Exclusion Determination Oregon-City-Beaverton CX(s) Applied: A1, B2.5, B5.1 Date: 03/30/2011 Location(s): Beaverton, Oregon Office(s): Energy Efficiency and Renewable Energy http://energy.gov/nepa/downloads/cx-005520-categorical-exclusion-determination Download CX-005522: Categorical Exclusion Determination South Dakota-Tribe-Yankton Sioux Tribe CX(s) Applied: B5.1 Date: 03/30/2011 Location(s): South Dakota Office(s): Energy Efficiency and Renewable Energy http://energy.gov/nepa/downloads/cx-005522-categorical-exclusion-determination Download CX-005435: Categorical Exclusion Determination Energy Efficiency and Conservation Block Grant - Sidewalks near schools CX(s) Applied: B5.1 Date: 03/22/2011 Location(s): Greenville County, South Carolina

90

Categorical Exclusion Determinations: Office of Energy Efficiency and  

Broader source: Energy.gov (indexed) [DOE]

30, 2011 30, 2011 CX-005524: Categorical Exclusion Determination Massachusetts Institute of Technology Clean Energy Prize CX(s) Applied: A9 Date: 03/30/2011 Location(s): Massachusetts Office(s): Energy Efficiency and Renewable Energy, Golden Field Office March 30, 2011 CX-005522: Categorical Exclusion Determination South Dakota-Tribe-Yankton Sioux Tribe CX(s) Applied: B5.1 Date: 03/30/2011 Location(s): South Dakota Office(s): Energy Efficiency and Renewable Energy March 30, 2011 CX-005520: Categorical Exclusion Determination Oregon-City-Beaverton CX(s) Applied: A1, B2.5, B5.1 Date: 03/30/2011 Location(s): Beaverton, Oregon Office(s): Energy Efficiency and Renewable Energy March 30, 2011 CX-005516: Categorical Exclusion Determination Florida-City-Hollywood CX(s) Applied: B2.5, B5.1

91

Novel Complexes Featuring Unusual Polynuclear Co(III)-Fe(III...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

E.N. Chygorin, O.V. Nesterova, J.A. Rusanova, V.N. Kokozay, V.N. Bon (Kiev University, Ukraine), R. Boa, (Trnava University, Slovakia) Fig. 2. 77 K Mssbauer spectrum of the...

92

PROPOSITION (Allocation de  

E-Print Network [OSTI]

appliquées) avec un gout pour la théorie et des compétences avérées en programmation. Un bon niveau de

Jeanjean, Louis

93

Supercomputer Analysis of Sedimentary Basins  

Science Journals Connector (OSTI)

...expelled from source rocks, hydrocar-bons...accumulate into petroleum reservoirs. Reservoirs may form in rocks that resisted compaction...In Eq. 1, + is porosity, a and, 3 are...kz are directional permeabilities,, u is fluid viscosity...

CRAIG M. BETHKE; STEPHEN P. ALTANER; WENDY J. HARRISON; CRAIG UPSON

1988-01-15T23:59:59.000Z

94

Detecting and quantifying oxygen functional groups on graphite nanofibers by fluorescence labeling  

E-Print Network [OSTI]

as adsorbents for small organic molecules from aqueous streams [5], electrodes for fuel cells [6], hydrogen 0008 that was detected by FLOSS on nitric acid-oxidized GCNFs totaled approximately 2.5% of surface car- bon, present

Borguet, Eric

95

Glucose Fermentation Pathway of Thermoanaerobium brockii  

Science Journals Connector (OSTI)

...the growth phase, cell suspensions were...toluene-treated cell suspensions were...L-lactate, acetate, hydrogen, and car- bon dioxide production...Clostridium pasteurianum. Cell extracts also contained...catabolic amounts of hydrogen- ase, phosphotransacetylase...

R. Lamed; J. G. Zeikus

1980-03-01T23:59:59.000Z

96

Aerosol Science and Technology, 44:11401145, 2010 Copyright American Association for Aerosol Research  

E-Print Network [OSTI]

application in fuel cells and sensors involving adsorp- tion and dissociation of hydrogen, oxygen, and various. Activated carbon, car- bon nanotubes (CNTs), carbon nanosheets, and silica (SiO2) gel have often been

Huang, Jiaxing

97

Investigation into the Effect of Surface Treatment on the Wettability and the Bondability of Low Surface Energy Materials  

Science Journals Connector (OSTI)

An experimental effort has been undertaken to examine the effect of surface treatment on various low surface energy thermoplastic materials to promote wettability and ... measurements were correlated with the bon...

J. P. Jeandrau

1984-01-01T23:59:59.000Z

98

Bibliography and Index of the Literature on Gas Chromatography1964 November 1, 1963 to November 1, 1964  

Science Journals Connector (OSTI)

......Abstract) 941 GAS-SOLID ADSORPTION...HYDROCAR- BONS AND NITROGEN HETEROCYCLES...FRESH - AND SALT WATER ALGAE, Klenk...DEVICE FOR A GAS CHROMATOGRAPH...April 1964) 1080 SOLUBILITY IN WATER OF PARAFFIN...CORRELATION OF GAS CHROMATO- GRAPHIC......

Mignon Gill; Seaton T. Preston; Jr.

1964-12-01T23:59:59.000Z

99

portation and Greenhouse Gas (MUNTAG) model is a macroscopic, highly aggregate model that works at the municipal level and solely  

E-Print Network [OSTI]

identifies the following four sectors: buildings; trans- portation and land use; energy supply; and municipal GHG inventory. This work is part of a project to write a guide called Getting to Car- bon Neutral

Illinois at Chicago, University of

100

Three-dimensional spatial coordinates of individual plankton ...  

Science Journals Connector (OSTI)

A highly unsaturated fatty acid predicts car- bon transfer ... 2,400 ml of water, at 750 mm depth, can be analysed with a resolution ..... power of the technique.

1910-00-71T23:59:59.000Z

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

The Jovian system: the last outpost for life?  

Science Journals Connector (OSTI)

......and other sources of energy. This material accumulated...methane, ammonia and car- bon dioxide. However...time. In addition, energy sources available on...atmosphere interface. An alternative energy source to surface-based......

Julian Hiscox

1999-04-01T23:59:59.000Z

102

POLZ, MARTIN F., JONATHAN J. ROBINSON, COLLEEN M ...  

Science Journals Connector (OSTI)

efficiently the abundant yet ephemeral local energy sources, primarily geothermally .... parative analyses of the ratios of the stable isotopes of car- bon and nitrogen. ..... Our experiments were designed to test the two alternative hypotheses that...

103

Site-specific and ontogenetic variations in nutrition of mussels ...  

Science Journals Connector (OSTI)

a consistent energy source throughout their life or if they switch trophic modes depending on ... a significant contribution of photosynthetically derived car- bon. As postmetamorphic ..... alternative hypothesis is that larval and postlarval carbon

1999-03-11T23:59:59.000Z

104

Tumor Induction in Mice Locally Irradiated with Carbon Ions: A Retrospective Analysis  

Science Journals Connector (OSTI)

......dose fractionation nor linear energy transfer affected tumor induction...700 patients by Year 2004. Car- bon ions, high LET (linear energy transfer) radiation, are...penumbra near collimators. Alternative explanation for the linear......

Koichi Ando; Sachiko Koike; Chisa Oohira; Toshiaki Ogiu; Fumio Yatagai

2005-06-01T23:59:59.000Z

105

the page - American Society of Limnology and Oceanography  

Science Journals Connector (OSTI)

May 28, 1981 ... We thank A. F. Carlucci and C. C. Price for providing the cultures and K. J. ..... threne (a fossil fuel aromatic hydrocar- bon) show essentially zero...

2000-02-08T23:59:59.000Z

106

Purification de l'hexafluorure d'uranium.  

E-Print Network [OSTI]

??Lhexafluorure duranium (UF6), est le seul compos utilis ltat gazeux dans les procds denrichissement pour la production du combustible nuclaire. Pour le bon droulement (more)

Benzouaa, Rachid

2014-01-01T23:59:59.000Z

107

Padova, 29 novembre 2010 Arturo Lorenzoni  

E-Print Network [OSTI]

energy technologies have to give proper answers to 2 main challenges in the long term. We need to find the sustainable soluBons to the energy supply conundrum. Most energy companies have very short Bme horizons due to stock

Schenato, Luca

108

fois, ils semblent aussi impliqus dans une tape postrieure l'initiation qui est la promo-  

E-Print Network [OSTI]

E.A. & Recknagel R.O. (1983) Carbon tetrachloride and bromotrichloromethane toxi- city. Dual role.A., Fernan- dez Y. & Mitjavila S. (1986) Radical activation of car- bon tetrachloride in foetal and maternal

Paris-Sud XI, Université de

109

Tribology International 40 (2007) 345349 A comparative study on the structure and hardness enhancement  

E-Print Network [OSTI]

by a combination of soft BON film and hard TiN film using low- (100 kHz) and high (13.56 MHz)-frequency RF plasma) substrate by low and high RF frequency plasma-assisted metal­organic chemical vapor deposition rights reserved. Keywords: Hard coatings; A-BON/nc-TiN bilayers; PAMOCVD; Low- and high-frequency RF

Boo, Jin-Hyo

110

Raphal Schirmer Universit Bordeaux 3, ADES CNRS UMR 5185  

E-Print Network [OSTI]

(AOC) a servi de cadre à ce processus. En dehors de ces territoires, la vigne a connu un profond déclinGraphie : Terre des hommes, 1544 (2012) 22-24" #12;2 affirmée. L'AOC Cornas (Ardèche) ne comprend ainsi que cent

Boyer, Edmond

111

Problem of Questioning  

ScienceCinema (OSTI)

Le Prof.Leprince-Ringuet, chercheur sur le plan scientifique, artistique et humain, parle de la remise en question des hommes et la remise en question scientifique fondamentale ou exemplaire- plusieurs personnes prennent la parole p.ex Jeanmairet, Adam, Gregory. Le Prof.Gregory clot la soire en remerciant le Prof.Leprince-Ringuet

None

2011-04-25T23:59:59.000Z

112

Centenarian Einstein  

ScienceCinema (OSTI)

Commmoration de A.Einstein avec 4 orateurs pour honnorer sa mmoire: le prof.Weisskopf parlera de l'homme de science engag, Daniel Amati du climat de la physique aux annes 1920, Sergio Fubini de l'heure scientifique d'A.Einstein et le prof.Berob(?)

None

2011-04-25T23:59:59.000Z

113

Everest  

ScienceCinema (OSTI)

Chris Bonington, est n Hampstead et a fait des tudes University Collge School Londres et au Royal Military Academy Sundhorst. Il est un alpiniste mondialement connu qui a fait un grand nombre de premiers ascensions, comme celle de la face sud-ouest de l'Everest avec une quipe de 70 hommes en septembre 1975

None

2011-04-25T23:59:59.000Z

114

STFC(2007)85 MINUTES OF THE FIFTH MEETING HELD ON 4 SEPTEMBER 2007 AT THE  

E-Print Network [OSTI]

& Innovation Group Paul Williams In Attendance: Tim Bestwick (for Item 5) David Eakins (for Item 1) Peter) Raymond Prud'homme (for Item 1) Andrew Taylor Jacqui Williams (for Item 1) Chris Thompson (Council Secretary) Ruth Jeans (Minute Secretary) APOLOGIES Apologies were received from Keith Burnett and Jeff Down

Crowther, Paul

115

Jacques Cardinal Dpartement de littrature compare  

E-Print Network [OSTI]

retrouvé), Robert Musil (L'homme sans qualités), Jean-Paul Sartre (La nausée), Albert Camus (La peste), etc nausée (Folio) A. Malraux, La condition humaine (Folio plus) A. Camus, La peste (Folio) M. Blanchot, L

Parrott, Lael

116

FAS1000 Introduction l'interculturel Hiver 2014 Charge de cours : Eftihia Mihelakis  

E-Print Network [OSTI]

intégrés dans un recueil de textes.** Artaud, « Cahiers du retour à Paris » Campbell, Half-Breed Camus, L'?tranger Camus, L'Homme révolté de Champlain, « Des sauvages » Deleuze et Guattari, Kafka : pour une littérature

Parrott, Lael

117

Emerging principles of regulatory evolution  

Science Journals Connector (OSTI)

...principles of regulatory evolution 10.1073/pnas.0700488104 Benjamin Prud'homme Nicolas Gompel Sean B. Carroll *Howard Hughes...1873 . 48 Protas ME Hersey C Kochanek D Zhou Y Wilkens H Jeffery WR Zon LI Borowsky R Tabin CJ ( 2006 ) Nat Genet 38 : 107...

Benjamin Prud'homme; Nicolas Gompel; Sean B. Carroll

2007-01-01T23:59:59.000Z

118

Robotique de service: robots assistants ou quipiers  

E-Print Network [OSTI]

l'equipe hommes-robots #12;3 Robots Programmed and repetitive activity: welding, painting1 Robotique de service: robots assistants ou équipiers Rachid Alami LAAS-CNRS Toulouse - France La robotique de service en Midi-Pyrénées ­ 25 Novembre 2011 - LAAS! !! Les robots parmi nous #12;2 !! Robots

Ingrand, François

119

Single Sheet Functionalized Graphene by Oxidation and Thermal Expansion of Graphite  

E-Print Network [OSTI]

,X,O Margarita Herrera-Alonso, David L. Milius, Roberto Car,,§ Robert K. Prud'homme, and Ilhan A. Aksay, the functionalized and defective graphene sheets do not collapse back to graphite oxide but are highly agglomerated and Roberto Car (Princeton University) showed that the stress-strain behaviors of graphene sheets and SWCNTs

Aksay, Ilhan A.

120

ESPACE PROBLEME, FUSION ET PARALLLISME DANS LES INTERFACES MULTIMODALES  

E-Print Network [OSTI]

Homme­Machine est l'extension des facultés sensori­motrices des ordinateurs en vue de répondre aux­machine [Krueger, 1985]. L'objectif des ``interfaces nouvelles'' est d'étendre les facultés sensori­motrices des

Nigay, Laurence

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Anticipation visuo-motrice en tlopration ,PSOpPHQWDWLRQ GH PpFDQLVPHV GDQWLFLSDWLRQ  

E-Print Network [OSTI]

Anticipation visuo-motrice en téléopération 1 ,PSOpPHQWDWLRQ GH PpFDQLVPHV G humain et d'une machine. Dans cette étude, le comportement d'anticipation visuo- motrice observé chez l, bionique, interfaçage homme-machine, coordinations visuo- motrices. Université d'Evry, Laboratoire des

122

ESPACE PROBLEME, FUSION ET PARALLLISME DANS LES INTERFACES MULTIMODALES  

E-Print Network [OSTI]

Homme-Machine est l'extension des facultés sensori-motrices des ordinateurs en vue de répondre aux-machine [Krueger, 1985]. L'objectif des "interfaces nouvelles" est d'étendre les facultés sensori-motrices des

Nigay, Laurence

123

Understanding and preserving nature THE MUSUM THROUGH  

E-Print Network [OSTI]

and anatomy courses, in French (not Latin) 1739 - Georges-Louis Leclerc, Count de Buffon, named Intendant - Musée de l'Homme reopens #12;Welcome to the French Muséum national d'Histoire naturelle. Like nature and innovations, professions and collections, knowledge sharing and partnerships, are broad in scope

124

COMIT FRANAIS D'HISTOIRE DE LA GOLOGIE -Troisime srie -  

E-Print Network [OSTI]

ELLENBERGER Analyse d'ouvrage Ezio Vaccari : "Giovanni Arduino (1714-1795) Il contributo di uno scienziato Giovanni ARDUINO, je venais d'écrire que cet homme était "encore très insuffisamment étudié par les minutieux de tous les documents manuscrits relatifs à ARDUINO conservés dans les diverses bibliothèques : un

Boyer, Edmond

125

ERTZSCHEID Olivier. MatredeconfrencesenSciencesde l'informationetdelacommunication.  

E-Print Network [OSTI]

par mail. Titre français : «L'homme est un document comme les autres: du World Wide Web au WorldLife Web ». Titre anglais : «From World Wide Web to World Life Web: human-beings are like any or intimate data can easily track our intentions, our social relationships. They have a very deep

Paris-Sud XI, Université de

126

Donald Frederick, LLNL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Donald Donald Frederick, LLNL - Presented at Supercomputing '11 Lawrence Livermore National Laboratory, P. O. Box 808, Livermore, CA 94551! Case Study: Beyond Homogeneous Decomposition with Qbox Scaling Long-Range Forces on Massively Parallel Systems LLNL---PRES---508651 Case S tudy: O utline * Problem D escripBon * ComputaBonal A pproach * Changes f or S caling LLNL---PRES---508651 Computer s imulaBons o f m aterials Computer s imulaBons a re w idely used t o p redict t he p roperBes o f new m aterials o r u nderstand t he properBes o f e xisBng o nes LLNL---PRES---508651 SimulaBon o f M aterials f rom F irst--- Principles First---principles m ethods: Calculate p roperBes o f a g iven m aterial d irectly f rom fundamental p hysics e quaBons. * No e mpirical p arameters Can m ake p redic-ons a bout c

127

Investigation of Soap Powders  

E-Print Network [OSTI]

in the presence of such a large excess of NajjSO* as is usually present, does not give a sharp end point, but a gradual fading from yellow to pink so that some little practice is necessary before the operator can hit the end point accurately. Practice does... and soap. Bon Ami Manufactured by Bon Ami Company, New York, I. Y. Wt. 10 ounces Price 10 cents. Analysis. Moisture .......... 0.28# Soap 6.54# Albite 93,18# Total 100.00^ IT. B. Albite is an orthoclase of the following composition: Si0 2 68...

Bragg, G.A.

1913-01-01T23:59:59.000Z

128

Ann bay lodyans 5 / se Bryant Freeman ("Tonton Liben") ki pare ti liv sa a  

E-Print Network [OSTI]

genyen. Tijo we yon tig ki te tonbe nan yon gwo twou. Li pa t kapab soti paske twou a fon. Kounye a tig la prizonye. Li di Tijo: "Ou se yon bon ti gason, ede m soti, souple." Tijo reponn: "Si mwen retire ou nan twou a, ou ap manje m." Tig la di: "O... non, bon ti pitit mwen, mwen p ap manje ou. Pa panse sa, non." Tijo mande li: "Eske ou ap pwomet mwen ou p ap manje m?" "Wi, pwomes fet," tig la di I avek gwo vwa li. Tijo ede tig la soti nan twou a. Le tig la fin soti, li vole sou T i j...

Freeman, Bryant C.

2000-01-01T23:59:59.000Z

129

Part 11, Authors: N To Ozzard  

E-Print Network [OSTI]

., v. 10, C.-R., p. iii. [W?.] 1904 a.?Nouveau cas de T?nia canina L. chez l'homme homme

Segal, Dorothy B.; Ray, Doris H.; Hassall, Albert; Doss, Mildred A.

1950-01-01T23:59:59.000Z

130

UNIVERSITE DE RENNES 2 Sous le sceau de l`Universit europenne de Bretagne.  

E-Print Network [OSTI]

­ Humanités et sciences de l'homme PREFICS (EA 3207/UMR 8143) La culture de l'information en reformation Thèse reformation - 2009 tel-00421928,version1-5Oct2009 #12;Le Deuff, Olivier. La culture de linformation en reformation2009 2 Remerciements Mes remerciements vont à tous ceux qui m`ont supporté dans la réalisation de

Boyer, Edmond

131

Memorial V.J.Glaser  

ScienceCinema (OSTI)

Plusieurs orateurs rendent hommage au grand physicien et scientifique Vladimir Jurko Glaser (1924 - 1984) qui travaillait au Ruder Boscovic Institut Zagreb avant de venir au Cern en 1957 o il trouvait un poste permanent au dpartement de physique thorique. Walter Tearing, Harry Lehmann,Henry Epstein, Jacques Bros et Andr Martin font des rsums biographiques de leurs collgue et ami en honorant ses grands qualits d'homme et ses remarquables conqutes de la science et leurs accomplissement.

None

2011-04-25T23:59:59.000Z

132

Dlivr par Universit Paul Valry Montpellier III Prpare au sein de l'cole doctorale 60  

E-Print Network [OSTI]

fluence motrice tel-00968210,version1-31Mar2014 #12;La plus grande vertu de l'Homme est peut-être la'action et de l'évaluation émotionnelle : effets de fluence motrice L'approche constructiviste de l'évaluation émotionnelle, fondés sur le caractère hédonique de la fluence motrice, c'est-à-dire l'aisance avec laquelle une

Paris-Sud XI, Université de

133

Communication affiche, IEA'94, Toronto, Canada, Aot 1994, Volume 4, Page 464 RETOURS D'INFORMATION SENSORIMOTEURS DES DISPOSITIFS PHYSIQUES  

E-Print Network [OSTI]

, interface multi­sensori­motrice, retour d'information haptique. L'une des activités actuelles en recherche sur les interfaces homme­machine vise à augmenter les capacités de communication sensori­motrices des'information sensori­ moteurs. Nous avons supprimé les informations sensori­motrices qu'une souris de type Macintosh

Nigay, Laurence

134

Cinquime colloque hypermdias et apprentissages 331 LA RALIT VIRTUELLE  

E-Print Network [OSTI]

développent une interactivité proche de l'activité sensori-motrice qui fait l'essence du quotidien de l'ordinateur. Elle s'élabore en suivant des règles de communication sensori-motrice naturelles à l'homme (schèmes utilisateur en interaction sensori-motrice. L'utilisateur est immergé plus ou moins intensément au sein cet

Paris-Sud XI, Université de

135

Near-death experiences (NDE) Expriences aux frontires de la mort  

E-Print Network [OSTI]

Near-death experiences (NDE) Expériences aux frontières de la mort Expériences de mort imminente (Mt/Mc/Lc) - Jeune homme à Naïn (Lc) - Lazare (Jn) 4. Récits de NDE : pénibilité du passage et nature Vénérable (673-735) : histoire de Drythelm NDE = Evénement de tous les temps #12;Bergeron et Montana (1877

Halazonetis, Thanos

136

A scalable and adaptable solution framework within components of the CCSM  

SciTech Connect (OSTI)

A framework for a fully implicit solution method is implemented into (1) the High Order Methods Modeling Environment (HOMME), which is a spectral element dynamical core option in the Community Atmosphere Model (CAM), and (2) the Parallel Ocean Program (POP) model of the global ocean. Both of these models are components of the Community Climate System Model (CCSM). HOMME is a development version of CAM and provides a scalable alternative when run with an explicit time integrator. However, it suffers the typical time step size limit to maintain stability. POP uses a time-split semi-implicit time integrator that allows larger time steps but less accuracy when used with scale interacting physics. A fully implicit solution framework allows larger time step sizes and additional climate analysis capability such as model steady state and spin-up efficiency gains without a loss in scalability. This framework is implemented into HOMME and POP using a new Fortran interface to the Trilinos solver library, ForTrilinos, which leverages several new capabilities in the current Fortran standard to maximize robustness and speed. The ForTrilinos solution template was also designed for interchangeability; other solution methods and capability improvements can be more easily implemented into the models as they are developed without severely interacting with the code structure. The utility of this approach is illustrated with a test case for each of the climate component models.

Evans, Katherine J [ORNL; Rouson, Damian [Sandia National Laboratories (SNL); Salinger, Andy [Sandia National Laboratories (SNL); Taylor, Mark [Sandia National Laboratories (SNL); White III, James B [ORNL; Weijer, Wilbert [Los Alamos National Laboratory (LANL)

2009-01-01T23:59:59.000Z

137

Haitian Creole-English English-Haitian Creole Medical Dictionary  

E-Print Network [OSTI]

; orifice, aperture b * corner of mouth - anba upside down chire, ~ manje sores at comer of mouth - dlo salivation * fann harelip, cleft lip; cleft palate - Il anm, ~ II pa bon, ~ II pa gou to have no appetite ~ Il f dio to make one's mouth...

Freeman, Bryant C.

1992-01-01T23:59:59.000Z

138

Geophysical Research Abstracts Vol. 14, EGU2012-PREVIEW, 2012  

E-Print Network [OSTI]

was monitored to trace the effectiveness of artificial recharge, based on boron isotopes, to better determine (Cape Bon, Tunisia): insights from Boron isotopes. L. Cary (1), J. Casanova (1), A. Mekni (2,3), N. Sodium, potassium and boron were clearly in deficit compared to a mixing line with seawater, whereas

Paris-Sud XI, Université de

139

Glacioeustatic Transgressive Reflux: Stratiform Dolomite in Pennsylvanian Bioherms of the Western Orogrande Basin, New Mexico  

Science Journals Connector (OSTI)

...mound rocks from the Virgilian Panther Seep Formation, Hembrillo Canyon...suggesting that, in general, car-bon in the dolomites was derived...alteration of dolomite: A review: Car-bonates and Evaporites, v...Simo, T., eds., Advances in Car-bonate Sequence Stratigraphy...

Gerilyn S. Soreghan; Michael H. Engel; Roger A. Furley; Katherine A. Giles

140

LATTER-DAY TAXIDERMY  

Science Journals Connector (OSTI)

...supposition that he had obtained a compound of car-bon and alumina he gave it the name...by him. For example, a reclini'ng panther, with young, on the whole a fine piece...staff, at one of the entrances, and a panther, in bronaze, within, are examples of...

Vernon L. Kiellogge

1893-09-15T23:59:59.000Z

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

The Molecular Fossil Record of Oleanane and Its Relation to Angiosperms  

Science Journals Connector (OSTI)

...well-defined, organic-rich, fine-grained sedimentary rocks. Commonly...environments contain organic matter derived from...with total organic car-bon...of thermal maturation are minimized...Magdalena Basin, Co-lombia...material from Illinois, United...

J. Michael Moldowan; Jeremy Dahl; Bradley J. Huizinga; Frederick J. Fago; Leo J. Hickey; Torren M. Peakman; David Winship Taylor

1994-08-05T23:59:59.000Z

142

Substrate Utilization by an Oxalate-Consuming Spirillum Species in Relation to Its Growth in Ozonated Water  

Science Journals Connector (OSTI)

...assimilable organic car- bon compounds (AOC), were calculated from the obtained Nmax values and the Y values for acetate. The AOC concen- trations for both strains were...with each oth- er. In ozonated water, AOC concentrations available for strain NOX...

D. van der Kooij; W. A. M. Hijnen

1984-03-01T23:59:59.000Z

143

O P I N I O N Biogenic vs. geologic carbon emissions and forest  

E-Print Network [OSTI]

greenhouse gas (GHG) accounting of woody biomass energy generation. While there are many other environmental, biogenic carbon, carbon debt, forest biomass, greenhouse gas accounting Received 20 April 2011; revised the amount of car- bon in the cycle'. This view recently has been reiterated by many (e.g. Hale, 2010; Lucier

Vermont, University of

144

RALLYE MATHMATIQUE D'AUVERGNE 2013  

E-Print Network [OSTI]

résoudre. Bon courage à tous ! Françoise Barachet, IA-IPR en mathématiques Jean-Alain Roddier, IA-IPR en posées, l'argumentation, la présentation. Conception et Rédaction : IREM, APMEP, IUFM, IA­IPR de

Sart, Remi

145

Role of PeptidePeptide Interactions in Stabilizing Peptide-Wrapped Single-Walled Carbon Nanotubes: A Molecular Dynamics Study  

E-Print Network [OSTI]

, and energy conservation devices.2 Unfortunately, car- bon nanotubes are extremely hydrophobic which leadsRole of Peptide­Peptide Interactions in Stabilizing Peptide-Wrapped Single-Walled Carbon Nanotubes at biopolymers@wiley. com INTRODUCTION S ingle-walled carbon nanotubes (SWNTs) are hollow cylinders formed

Nielsen, Steven O.

146

Chirality dependence of the density-of-states singularities in carbon nanotubes S. Reich and C. Thomsen  

E-Print Network [OSTI]

approach and yields the energy splitting for an arbitary chiral angle in metallic nanotubes. SemiconductingChirality dependence of the density-of-states singularities in carbon nanotubes S. Reich and C-of-states singularities in single-walled car- bon nanotubes. Our approximation goes beyond the lowest-order, isotropic

Nabben, Reinhard

147

International Journal of Hydrogen Energy 31 (2006) 7792 www.elsevier.com/locate/ijhydene  

E-Print Network [OSTI]

for fueling automotives to reduce car- bon dioxide emissions, limit dependence on imported petroleum-grade crude oils into transport fuels. World oil refineries and chemical plants' demand for hydrogen-free tech- nologies, including either battery- or fuel-cell--operated vehicles. However, the H2 fuel

Yildiz, Bilge

148

Contribution of restricted rotors to quantum sieving of hydrogen isotopes B. C. Hathorn,1  

E-Print Network [OSTI]

have come to the forefront as a possible storage medium for hydrogen for fuel-cell de- vices. A number of isotopically substituted hydrogen molecules adsorbed into single-walled car- bon nanotubes are calculated usingContribution of restricted rotors to quantum sieving of hydrogen isotopes B. C. Hathorn,1 B. G

Hathorn, Bryan C.

149

Raman spectroscopy of amorphous, nanostructured, diamondlike carbon, and nanodiamond  

Science Journals Connector (OSTI)

...possible presence of hydrogen and nitrogen. The...magnetic storage disks, car parts, biomedical...alloys, (a) without hydrogen, (b) with hydrogen...C, sp3 C and N. fuel cells. Nanostructured...classified as stage 2 car- bons with increasing...

2004-01-01T23:59:59.000Z

150

One-Carbon Metabolism in Methanogens: Evidence for Synthesis of a Two-Carbon Cellular Intermediate and Unification of Catabolism and Anabolism in Methanosarcina barkeri  

Science Journals Connector (OSTI)

...or methanol. Cell suspensions synthesized...the absence of hydrogen. Cell extracts catalyzed...carriers (i.e., car- boxydihydromethanopterin...the presence of hydrogen gas. Iodopropane...for analysis. Cell suspensions assimilated...intermediate from one-car- bon compounds...

William R. Kenealy; J. G. Zeikus

1982-08-01T23:59:59.000Z

151

Control-oriented input-delay model of the distributed temperature of a SI engine exhaust  

E-Print Network [OSTI]

shifting [8]. This open-loop technique leads to a faster heating of the catalyst but also yields combustion the combustion: hydrocar- bons HC, carbon monoxide CO and nitrogen oxide NOx. Yet, conversion efficiency Delphine to activate chemical re- actions and the catalyst conversion ratio is poor [18]. Therefore, speed

152

through the digestive tract of patients with a malabsorption syndrome. In addition, our  

E-Print Network [OSTI]

digestibility car- bon from dietary CHO. Effect of algal fibre supplementation (Eucheuma cottonii) on intestinal of their nutritional properties, this work inves- tigated the possible effects of algal polysac- charides sequence of test meals (800 g of maize starch + casein) sup- plemented either with 40 g of algal fibres

Boyer, Edmond

153

Name /css_comb_104895/comb_5d11/Mp_1 09/29/2002 01:05AM Plate # 0 pg 1 # 1 Proceedings of the Combustion Institute, Volume 29, 2002/pp. 000000  

E-Print Network [OSTI]

of the Combustion Institute, Volume 29, 2002/pp. 000­000 DIOXIN AND FURAN FORMATION ON CuCl2 FROM CHLORINATED. Heated nitrogen gas streams containing 7.8% oxygen, 1.7% benzene vapor, and equal amounts of 2], poly- cyclic aromatic hydrocarbons [5], and graphitic car- bon [6]. Formation rates from precursors

Mulholland, James A.

154

ELSEVIER Computational Materials Science 2 (1994) 468-474 Modifying the buckyball  

E-Print Network [OSTI]

of C60- inspired carbon fullerenes. At present, the most intensively investigated systems are multi 1994) Abstract Structural and electronic properties of carbon clusters, in particular the C60 triggered a world-wide interest in this novel form of car- bon. The resulting research effort first concen

155

1932-4510/07/$25.002007IEEE SEPTEMBER 2007 | IEEE NANOTECHNOLOGY MAGAZINE | 13 CHONGWU ZHOU, AKSHAY KUMAR, AND KOUNGMIN RYU  

E-Print Network [OSTI]

. The most commonly used techniques include arc discharge, laser ablation, and chemical vapor deposition (CVD). CNTs were first discovered when Iijima examined the prod- ucts from an arc discharge between two far, car- bon nanotubes (CNTs) stand out due to their remarkable electrical, mechani- cal, optical

Zhou, Chongwu

156

JOURNAL DE PHYSIQUE Colloque C8, Supplhment au no 12, Tome 49, dhcembre 1988  

E-Print Network [OSTI]

JOURNAL DE PHYSIQUE Colloque C8, Supplhment au no 12, Tome 49, dhcembre 1988 NEUTRON SCATTERING a better understanding of the magnetic correlations of FegoZrlo we have performed small angle neutron scattering (SANS) and polarized- beam spin rotation experiments on amorphous rib- bons (approximately 25 prn

Boyer, Edmond

157

Structure and Density of Mo and Acid Sites in Mo-Exchanged H-ZSM5 Catalysts for Nonoxidative Methane Conversion  

E-Print Network [OSTI]

of natural gas to higher hydrocar- bons and aromatics remains an important industrial challenge Methane Conversion Richard W. Borry III, Young Ho Kim, Anne Huffsmith, Jeffrey A. Reimer, and Enrique and gas phase transport, exchange at acid sites, and react to form H2O. The amount of H2O evolved during

Iglesia, Enrique

158

Atomic and molecular adsorption on RhMn alloy surface: A first principles study  

E-Print Network [OSTI]

and hydrogen from reforming of natural gas and coal to hydro- carbon Fishcher-Tropsch synthesis and oxygenates- bon and partial oxidation of methane.15 The importance of Rh catalysts on catalytic reactions molecules in terms of the energetics and site preferences on Rh catalysts as well as the effects of Mn added

Li, Weixue

159

Defective fullerenes and nanotubes as molecular magnets: An ab initio study Yong-Hyun Kim,* Jin Choi, and K. J. Chang  

E-Print Network [OSTI]

Defective fullerenes and nanotubes as molecular magnets: An ab initio study Yong-Hyun Kim,* Jin ordering are not well es- tablished, the experimental evidence for ferromagnetic car- bon nanostructures in the magnetic behavior, and suggested a possible link between magnetism and defects in the pure carbon network

160

/ http://www.sciencemag.org/content/early/recent / 3 April 2014 / Page 1 / 10.1126/science.1252268 The availability of high-quality, large, single-crystal Si wafers is funda-  

E-Print Network [OSTI]

separated by defective grain boundaries that degrade their electri- cal and mechanical properties (8, 9 and coalesce into a uniform sin- gle-crystal layer without grain bounda- ry defects, even if the nucleation and the relatively high car- bon solubility hamper the direct growth of high-quality monolayer graphene on Si (16

Napp, Nils

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

JOURNAL OF BACTERIOLOGY, Dec. 2003, p. 71607168 Vol. 185, No. 24 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.24.71607168.2003  

E-Print Network [OSTI]

are required for growth on C1 substrates; how- ever, mutants defective for the H4MPT pathway reveal a unique characterization of four mutants defective in the H4MPT pathway and place them into three different phenotypic pathway in M. extorquens AM1. Methylotrophic bacteria growing aerobically on single-car- bon (C1

162

Biological Gain of Carbon-ion Radiotherapy for the Early Response of Tumor Growth Delay and against Early Response of Skin Reaction in Mice  

Science Journals Connector (OSTI)

......observed for 77 keV/mm carbon ions. The RBE values of low-LET car- bons (14 and 20 keV/mm) ranged from 1.2 to 1.7, and...T-cells after low-dose gamma-irradiation is not linked with defective Ku86 protein. Int. J. Radiat. Biol. 77: 329339. 27......

Koichi Ando; Sachiko Koike; Akiko Uzawa; Nobuhiko Takai; Takeshi Fukawa; Yoshiya Furusawa; Mizuho Aoki; Yasuyuki Miyato

2005-03-01T23:59:59.000Z

163

ABSTRACTS IN REPORTS CONCERNING ELECTRON MICROSCOPY PUBLISHED IN JAPAN:  

Science Journals Connector (OSTI)

......Thoracic Lymphatics of Living Rabbits and Sites of Escape of Car- bon Particles from the Vessels: Fumihiko KATO (First Dept...deafness. Using light and elect- ron microscopy he studied the defective organ of Corti in Shaker-1 mouse, one strain of congeni......

ABSTRACTS

1967-01-01T23:59:59.000Z

164

POSTER SESSIONS:  

Science Journals Connector (OSTI)

......the other radiosensitive cell lines of SX9 (defective in DNA-PKcs, XRCC7), SX10 (defective in DNA ligase IV) and M10 (XRCC4) were about...Center, Kyoto University. The system includes car- bon K, aluminium K, molybdenum L, iron......

Synchrotron radiation

2002-12-01T23:59:59.000Z

165

ABSTRACTS:  

Science Journals Connector (OSTI)

......central body of the virus vanished or became defective very frequently. 4) In the cytoplasm...The fine structure of martensite in plain car- bon steels has been studied by transmission...around the dislocations and tiny metastable car- bides precipitate in situ. With the......

ABSTRACTS

1965-01-01T23:59:59.000Z

166

THE FORTY-FIRST ANNUAL MEETING OF THE JAPANESE SOCIETY OF ELECTRON MICROSCOPY:  

Science Journals Connector (OSTI)

......000 kV DF is superior to BF up to Ael for gold as well as for car- bon. Despite the larger effect, DF mode at 1,000 kV is...shift in the [TTT] direction. 232 41st Annual Meeting The defective image in the specimen, thinned parallel to the (001) plane......

The Forty-first Annual Meeting of the Japanese Society of Electron Microscopy

1985-01-01T23:59:59.000Z

167

Raman spectroscopy of graphite  

Science Journals Connector (OSTI)

...G for graphite. The other modes are either observed only on defective samples or are very weak in intensity like the G peak that was...al. 2001); a similar behaviour is also observed in other car- bon materials (Ferrari & Robertson 2001; Maultzsch et al...

2004-01-01T23:59:59.000Z

168

Two-Step Mechanism for Low-Temperature Oxidation of Vacancies in Graphene Johan M. Carlsson,1,* Felix Hanke,1  

E-Print Network [OSTI]

for nanoparticles [2]. Controlled oxidation of car- bon materials is also used to add functional oxygen (O) groups (STM) experiments, for instance, demonstrate that the defect-free regions of the basal plane oxygen and attachment of oxygen atoms on defective graphite. However, the main product in these TPD

169

Scanning tunnelling microscopy of carbon nanotubes  

Science Journals Connector (OSTI)

...sheet into a cylinder where the car- bon lattice is joined seamlessly...consist of at least a pair of defective rings, e.g. squares, pentagons...sized (Meunier et al. 1999), defective (Meunier & Lambin 1998, 2000...Blase, X., Devita, A. & Car, R. 1997 Electronic structure...

2004-01-01T23:59:59.000Z

170

Nitrogen Addition Increases Carbon Storage in Soils, But Not in Trees, in  

E-Print Network [OSTI]

nitrogen (N) species and car- bon dioxide (CO2) in the atmosphere globally. Received 18 August 2012Nitrogen Addition Increases Carbon Storage in Soils, But Not in Trees, in an Eastern U.S. Deciduous regions receive elevated rates of atmospheric nitrogen (N) deposition from air pollution. To evalu- ate

Templer, Pamela

171

Introduction: The Ocean's Meridional Overturning Circulation Andreas Schmittner1  

E-Print Network [OSTI]

currents encompassing all ocean basins. It transports large amounts of water, heat, salt, car- bon current (ACC) of the Southern Ocean. There, it mixes with other deep water masses like Pacific Deep WaterIntroduction: The Ocean's Meridional Overturning Circulation Andreas Schmittner1 , John C.H. Chiang

Schmittner, Andreas

172

February 18, 2009 The A Priori  

E-Print Network [OSTI]

about some agent's knowledge, we might say something like `that's a priori for him.' [Kripke, 1980 careless about distinguishing a priority from analyticity and necessity. (Roughly: something is a priori of some fairly specific sort, might be required for that. [BonJour, 2005, p.99] ­ The positive condition

Fitelson, Branden

173

THSE DE DOCTORAT DE L'UNIVERSIT PIERRE ET MARIE CURIE  

E-Print Network [OSTI]

pour leur sympathique contribution au bon déroulement de cette thèse. Merci également à l'ensemble des factor CaMK Ca2+ /calmodulin-dependent protein kinases CCI Chronic constriction injury (ligature lâche du and Statistical Manual of Mental Disorders EGF

Paris-Sud XI, Université de

174

Murchison presolar carbon grains of different density fractions: A Raman spectroscopic perspective  

E-Print Network [OSTI]

for inorganic sp2 -bonded carbon. Based on their D/G intensity ratios, those grains were grouped.1), "glassy carbon" (D/G > 1.1), and "unusual sp2 -bonded graphitic car- bon" (with extremely intense 2ndMurchison presolar carbon grains of different density fractions: A Raman spectroscopic perspective

175

Grid 2020: Toward a Policy of Renewable & Distributed Resources  

E-Print Network [OSTI]

;12 Virtual Power Plant: 2002-2020 Multi-direction and variability of DER power flows drive circuit years, which would make solar power less expensive than retail electricity in roughly 20 states" David, DoE, USCHP #12;6 Wide Area CoordinaBon & Controls Location of Variable Wind, Solar

176

Journal of Power Sources 195 (2010) 18411844 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

to react with oxygen, forming water. Recent advances in MFCs have increased power produc- tion or modifying the car- bon surface. In an MFC with anaerobic sludge as the inoculum, power was increased from 0Journal of Power Sources 195 (2010) 1841­1844 Contents lists available at ScienceDirect Journal

177

Structure and interactions in simple solutions  

Science Journals Connector (OSTI)

...cations have with both water and alcohol molecules...concentration and scattering power of each atom type Phil...ensembles containing 300 water molecules and 6 alcohol...CC, the methyl group car- bon sites C, the methyl...group hydrogen H. The water hydrogen sites are labelled...

2004-01-01T23:59:59.000Z

178

Journal of Power Sources 134 (2004) 16 Synthesis and physical/electrochemical characterization of Pt/C  

E-Print Network [OSTI]

Journal of Power Sources 134 (2004) 1­6 Synthesis and physical/electrochemical characterization Department of Mechanical Engineering, Hong Kong University of Science and Technology, Clear Water Bay alloys on a car- bon support. The high surface area of a Pt and its alloys can be rendered by using

Zhao, Tianshou

179

U.S. JGOFS NEWS U.S. JGOFS: A Component of the U.S. Global Change Research Program  

E-Print Network [OSTI]

Global models of the ocean car- bon cycle have two moving parts. First, a production part is used the sunlit eu- photic zone of the ocean is remineralized at each depth horizon in the water column is a power-law function of depth. This curve is used widely in global simulations to repre- sent

McGillicuddy Jr., Dennis J.

180

-Amino acids, although less abundant than their -analogues, are also present in peptides and other natural  

E-Print Network [OSTI]

Polyhydroxyalkanoates (PHAs) are a family of carbon, energy and/or reducing power storage polymers, which a characteristic pro- ton NMR signal at 3.15 ppm for the hydroxy hydrogen at car- bon 3. In our experimental work was consumed. Compound 2 was reacted with sodium azide in water using hexadecyltributylphosphonium bromide

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

THE IMPORTANCE OF THE GAS-GRAIN INTERACTION T. J. Millar  

E-Print Network [OSTI]

of interstellar grains can be described by a power-law: n(a)da / a 3:5 da and combining the op- tical properties atoms and taking up 10% of the total car- bon budget. These molecules, called polycyclic aromatic of water, but con- tain substantial components of methanol, ca

Millar, Tom

182

Z .Surface and Coatings Technology 127 2000 260 265 Characterization of carbon nitride thin films deposited by  

E-Print Network [OSTI]

-screw adapter and monitored by measuring the back reflection power at the end of a water load. A mixture polycrystalline car- bon nitride films, and the resulting mechanical proper- ties are not as good as predicted a valve between the deposition chamber and the vacuum pumps. The microwave power was adjusted by a four

Gao, Hongjun

183

Increasing Proton Exchange Membrane Fuel Cell Catalyst Effectiveness Through Sputter Deposition  

E-Print Network [OSTI]

, University of South Carolina, Columbia, South Carolina 29208, USA b Plug Power, Incorporated, Latham, New and carbon- supported catalyst.3-6 It is this three-phase interface of catalyst, car- bon, and electrolyte typically Nafion® that allows effective gas and water diffusion and proton transport and electron transport

184

VOLUME 93 NUMBER 23 5 JUNE 2012  

E-Print Network [OSTI]

, rainfall, and the concentration of car- bon dioxide [New et al., 1999; Tans et al., 1996 regional networks together to measure the fluxes of carbon dioxide, water vapor, and sen- sible heat are needed to move air to the sen- sor, have access to a power line. The cur- rent generation of carbon

185

ORIGINAL PAPER Evaluating sedimentary geochemical lake-level tracers  

E-Print Network [OSTI]

Walker Lake has been generated through analysis of total inorganic car- bon (TIC), total organic carbon (TOC), and oxy- gen and carbon isotope ratios (d18 O and d13 C) of both downcore bulk TIC and ostracods in %TIC, %TOC, and d13 C and d18 O of TIC and ostracods are all associated to varying degrees with changes

Linsley, Braddock K.

186

Magnetic Properties and Diffusion of Adatoms on a Graphene Sheet P. O. Lehtinen,1  

E-Print Network [OSTI]

Magnetic Properties and Diffusion of Adatoms on a Graphene Sheet P. O. Lehtinen,1 A. S. Foster,1 A storage in nanotube based batteries [7], catalytic growth [8], junc- tions [9], and quantum dot creation,17] and diffusion [18] of a car- bon adatom on a graphene sheet, yet the results were markedly different, and none

Nordlund, Kai

187

2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim722 wileyonlinelibrary.com  

E-Print Network [OSTI]

and material degradation is crucial for the rational design of high-performance lithium ion batteries (LIBs-layer graphene nanorib- bons remain mechanically robust after lithiation. This distinct contrast manifests. In addition, a new in situ chemical lithiation method is introduced for fast screening of battery materials

Chen, Sow-Hsin

188

JOURNAL OF BACTERIOLOGY, 0021-9193/01/$04.00 0 DOI: 10.1128/JB.183.8.24632475.2001  

E-Print Network [OSTI]

or 1,2-propanediol requires B12 and provides a car- bon and energy source, but growth. The Alternative Electron Acceptor Tetrathionate Supports B12-Dependent Anaerobic Growth of Salmonella enterica of these carbon sources supports anaerobic growth with any of the alternative electron acceptors tested thus far

California at Davis, University of

189

Relationships between Carcinogenicity and Theoretical Reactivity Indices in Polycyclic Aromatic Hydrocarbons  

Science Journals Connector (OSTI)

...usually several alternatives are available for...meso-9,10-car bon atoms of anthracene...molecular orbital energies are , @= a + mj3...de localization energy @Edel@/f3...led us to examine alternative indices. One such...Table 10. Composite Energy Indices Transformation...

Iden A. Smith; Gregory D. Berger; Paul G. Seybold; and M. P. Serv

1978-09-01T23:59:59.000Z

190

Bioreactor Development for Biological Hydrogen Production  

E-Print Network [OSTI]

Huang National Renewable Energy Laboratory 1617 Cole Boulevard, Golden, CO 80401 ed The biologically-mediated water-gas shift reaction, in which carbon monoxide is oxidized to car- bon dioxide while temperature and lack of equilibrium limitation make the biological shift reaction a promising alternative

191

MEDS and PocR are novel domains with a predicted role in sensing simple hydrocarbon derivatives in prokaryotic signal transduction systems  

Science Journals Connector (OSTI)

......genes encoding alternative sigma factors in...1999Aerotaxis and other energy-sensing behavior...dichloromethane as the sole car-bon and energy source, DcmR dissociates...genes encoding alternative sigma factors in...Aerotaxis and other energy-sensing behavior......

Vivek Anantharaman; L. Aravind

2005-06-01T23:59:59.000Z

192

Recent Insights into the Biological Action of Heavy-Ion Radiation  

Science Journals Connector (OSTI)

......exogenous genes.59) An alternative regimen includes the combination...combina- tion with high-energy X-rays, which acted...GJIC contributed to car- bon ion-induced bystander...chemicals such as retinoids, car- otenoids and green tea...X-ray-induced mammary car- cinogenesis in female......

Nobuyuki Hamada

2009-01-01T23:59:59.000Z

193

A&G Volume 54 Issue 1, Full Issue  

Science Journals Connector (OSTI)

......lithoautotrophic means of both energy genera- tion and carbon...render it an available energy source (Weiss et al...subsurface. Finally, an alternative inorganic electron acceptor...some iron reducers is car- bon monoxide (CO...made available as an energy source through downward......

A&G Volume 54 Issue 1; Full Issue

2013-02-01T23:59:59.000Z

194

Microdosimetric Approach to NIRS-defined Biological Dose Measurement for Carbon-ion Treatment Beam  

Science Journals Connector (OSTI)

......value into the lineal energy, yi. The Ny value was...function of the linear energy transfer (LET) of mono-energetic...with an initial kinetic energy of 290 MeV/u with a...pulse by defocusing car- bon-ions with electric...low-intensity beam. So, an alternative parallel-plate ionization......

Yuki Kase; Tatsuaki Kanai; Makoto Sakama; Yuji Tameshige; Takeshi Himukai; Hiroyuki Nose; Naruhiro Matsufuji

2011-01-01T23:59:59.000Z

195

Manipulating RuBisCO accumulation in the green alga, Chlamydomonas reinhardtii  

E-Print Network [OSTI]

Manipulating RuBisCO accumulation in the green alga, Chlamydomonas reinhardtii Xenie Johnson photosynthetic car- bon metabolism towards alternative pathways. Keywords RuBisCO � Chloroplast � RNA stability between green algae (Chlamydomonas X. Johnson (&) Centre National de la Recherche Scientifique, Unite

196

American Economic Journal: Economic Policy 2009, 1:1, 106146 http://www.aeaweb.org/articles.php?doi=10.1257/pol.1.1.106  

E-Print Network [OSTI]

- bon emissions rate or, equivalently, the carbon emissions per unit of output, allows fuel producers to achieve a given carbon emissions rate by exibly altering their production of fuels.2 Senators John Mc (e.g., energy versus miles), and how emissions rates are measured (e.g., upstream versus downstream

Rothman, Daniel

197

Route-Specific Passage and Survival of Steelhead Kelts at The Dalles and Bonneville Dams, 2012 - Final Report  

SciTech Connect (OSTI)

This study was mainly focused on evaluating the route-specific passage and migration success of steelhead kelts passing downstream through The Dalles Dam (TDA) and Bonneville Dam (BON) at Columbia River (CR) river kilometers 309 and 234 respectively. Oregon Department of Fish and Wildlife (ODFW) personnel collected, tagged and released out-migrating steelhead kelts in the tributaries of the Deschutes River, 15 Mile Creek and Hood River between April 14 and June 4, 2012. A PIT tag was injected into each kelts dorsal sinus whereas a Juvenile Salmon Acoustic Telemetry System (JSATS) acoustic micro-transmitter was attached to an external FLoy T-bar tag and inserted into the dorsal back musculature using a Floy tagging gun. JSATS cabled arrays were deployed at TDA and BON and autonomous node arrays were deployed near Celilo, Oregon (CR325); the BON forebay (CR236); the BON tailrace (CR233); near Knapp, Washington (CR156); and near Kalama, Washington (CR113) to monitor the kelts movement while passing through the dams and above mentioned river cross-sections.

Rayamajhi, Bishes; Ploskey, Gene R.; Woodley, Christa M.; Weiland, Mark A.; Faber, Derek M.; Kim, Jin A.; Colotelo, Alison HA; Deng, Zhiqun; Fu, Tao

2013-07-31T23:59:59.000Z

198

Impact of a major ice storm on an old-growth hardwood forest  

E-Print Network [OSTI]

forestière, produc- tivité forestière. [Traduit par la Rédaction] Hooper et al. 75 Introduction Ice storms litter produced by ice storms is a substantial, yet little studied, pool of energy, car- bonImpact of a major ice storm on an old-growth hardwood forest Michael C. Hooper, Ken Arii

Lechowicz, Martin J.

199

cDNA Cloning and Characterization of a High Affinity Aryl Hydrocarbon Receptor in a Cetacean, the Beluga, Delphinapterus leucas  

E-Print Network [OSTI]

,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and related PHAHs cause toxicity via activation of the aryl hydrocar- bon receptor demonstrated specific, high-affinity [3 H]TCDD binding. Satura- tion binding analysis was used to compare-expressed AHRs from a dioxin-sensitive mouse strain (Ahb­1 allele) and humans. The beluga AHR bound [3 H

Hahn, Mark E.

200

2,3,7,8-Tetrachlorodibenzo-p-dioxin Induces Premature Activation of the KLF2 Regulon during  

E-Print Network [OSTI]

2,3,7,8-Tetrachlorodibenzo-p-dioxin Induces Premature Activation of the KLF2 Regulon during, Wisconsin 53706 The environmental pollutant 2,3,7,8-tetrachlorodibenzo-p- dioxin (TCDD, dioxin) causes,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)2 is the most toxic congener of a family of halogenated aromatic hydrocar- bons

Bradfield, Christopher A.

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Introduction Aerial surveys from aircraft are a critical component of many environmental research,  

E-Print Network [OSTI]

. For localized surveys, small Unmanned Air Vehicles (UAVs) equipped with color and near infrared cameras accuracy assessment and improvement of detection probabilities. Autonomous Unmanned Aerial Vehicle (UAV) for Ecological Research Franklin Percival1 , Leonard Pearlstine2 , Bon Dewitt3 , Scot Smith3 , Adam Watts1

Mazzotti, Frank

202

Simulation of Nitrogen Emissions in a Premixed Hydrogen Flame Stabilized on a Low Swirl Burner  

E-Print Network [OSTI]

of fuels such as pure hydrogen and hydrogen-seeded hydrocarbon mixtures. However, many hydrogen-rich fuels in the context of a laboratory-scale low swirl burner fueled with a lean hydrogen-air mixture at atmospheric of burning lean hydrogen or hydrogen-enriched lean hydrocar- bon fuels (e.g., [2­5]). For these fuels

Bell, John B.

203

Atmos. Chem. Phys., 11, 14731490, 2011 www.atmos-chem-phys.net/11/1473/2011/  

E-Print Network [OSTI]

in- duced (fossil fuel combustion, biomass burning) in the car- bon cycle. All these combustion The contribution from both natural and human-induced biomass burning and from fossil fuel combustion to the an of CO2 is the domestic combustion of biomass fuels (Kituyi et al., 2001; Ludwig et al., 2003). Reg

Meskhidze, Nicholas

204

oo Ris Report No. 268 Danish Atomic Energy Commission  

E-Print Network [OSTI]

box calculations to three-dimensional overall cal- culations inclusive of the void and temperature Cell Data Supply for Box Calculations ... 36 5. Fuel Bon Calculations 37 5.1. Description of the Bus Calculation« 36 5.2. Comparisons withOtter Calculations 41 6. Control Rods 56 6.1. Cross Sections for Control

205

arXiv:1002.0679v1[cond-mat.mes-hall]3Feb2010 Theory of resonant photon drag in monolayer graphene  

E-Print Network [OSTI]

distribution in energy. The drag current essentially depends on the polarization of radiation and, in general, is not parallel to q. The perpendicular current component appears if the in-plain electric field is tilted towards. INTRODUCTION Though the theoretical study of two-dimensional car- bon has a long history [1],[2],[3],[4] only

Shepelyansky, Dima

206

Inner-shell excitation of gas phase carbonates and a,c-dicarbonyl compounds  

E-Print Network [OSTI]

correlation of the C 1s ! p? C@O transition energy and the relative oxidation at the carbonyl car- bon and dimethyldicarbonate ­ have been recorded in the gas phase with inner shell electron energy loss spectroscopy in the scattering regime dominated by electric dipole transitions. All spectra are presented on absolute oscillator

Hitchcock, Adam P.

207

1162 IEEE TRANSACTIONS ON CIRCUITS AND SYSTEMS, VOL. CAS-32, NO. 11, NOVEMBER 1985 Transactions Briefs  

E-Print Network [OSTI]

Absfruct -A z-plane continued fraction expansion (CFE) that is related to the first Cauer s-plane CFE via B&on's LDI transformation is consid- ered. Necessary and sufficient conditions are imposed on the CFE for a polynomial to be stable (have all its zeros inside the z-plane unit circle). The implementation of this CFE

Bistritz, Yuval

208

Rfrigration domestique : enqute sur les pratiques des consommateurs et recommandations en matire d'hygine  

E-Print Network [OSTI]

energy consumption and water available for microbial circulation and growth. Thus, an important interrogées. Cette condensation suggère une mauvaise fermeture de la porte avec pour conséquence une plus recommandation importante est donc de vérifier que le joint de porte est en bon état et que la porte ferme bien

Paris-Sud XI, Université de

209

A Comprehensive Two-Dimensional Gas Chromatography Method for Analyzing Extractable Petroleum Hydrocarbons in Water and Soil  

Science Journals Connector (OSTI)

......fuel samples, including gasoline (18,20,21), diesel...temperature of 340 C. Run times were approximately...sample containing C9C36 straight chain aliphatics and...Determination of oxygenates in gasoline by GC GC. J. High Resolut...aromatic hydrocar- bons in gasolines by flow modulated comprehensive......

Stacy K. Seeley; Steven V. Bandurski; Robert G. Brown; James D. McCurry; John V. Seeley

210

3 Carbide Precipitation Carbides are largely responsible for the commercial failure of many of the early  

E-Print Network [OSTI]

.1. Transition carbides, such as and the various orthorhombic forms listed in Table 3.1, only form because Precipitation 64 Table 3.1 Carbides in bainite or in tempered bainite. Fe, M/C is the ratio of metal to car- bon3 Carbide Precipitation Carbides are largely responsible for the commercial failure of many

Cambridge, University of

211

Eos, Vol. 86, No. 42, 18 October 2005 to shed light on poorly understood piercement  

E-Print Network [OSTI]

-term changes in oxygen,car- bon dioxide (CO2 ),and several other measur- able parameters since the last global and Predictability (CLIVAR)/CO2 Repeat Hydrog- raphy component of the Global Earth Observ- ing System of Systems, freshwater,and CO2 .The CLIVAR/CO2 Repeat Hydrography program builds upon earlier programs (e.g.,the World

Talley, Lynne D.

212

TREKiSM Issue 37  

E-Print Network [OSTI]

This is gold. Kirk is perfect, Spock Is bon san d p 0 s tag (~, 0 f course. GET WELL W1Sr-I[S to Lilld(] C. Brown, who's now back clt work folJowj'lg surgcl'y, fucing a...

1984-01-01T23:59:59.000Z

213

IEEE Wireless Communications June 201248 1536-1284/12/$25.00 2012 IEEE RECENT ADVANCES IN  

E-Print Network [OSTI]

, security, reliability and integration of renewable energy. Currently, most of the power grids are based of the electricity capacity from distributed and renewable energy sources. The European Smart Grids Technology and the integration of renewable energy to meet the EU target on car- bon emissions reduction by year 2020 [2

Shihada, Basem

214

Worldwide, accelerating glacier loss provides independent and startling evidence that global warming is occurring1 It is now clear that the Earth is warming rapidly due to man-made emissions of carbon dioxide and other heat-trap-  

E-Print Network [OSTI]

-made emissions of carbon dioxide and other heat-trap- ping gases, which blanket the planet and cause temperatures future limits on carbon emissions. · Electricity consumers should opt for "green power" where imperative that emissions of the main heat-trapping gas, car- bon dioxide (CO2), are significantly reduced

Combes, Stacey A.

215

Design and Analysis of Salmonid Tagging Studies in the Columbia Basin, Volume XIII; Appraisal of System-Wide Survival Estimation of Snake River Yearling Chinook Salmon Released in 1997 and 1988, Using PIT-Tags Recovered from Caspian Tern and Double-Crested Cormorant Breeding Colonies on Rice Island, 1997-1998 Technical Report.  

SciTech Connect (OSTI)

PIT-tags recovered from tern and cormorant breeding colonies at Rice Island and observations from the interrogation systems at John Day and Bonneville Dams were incorporated into survival analyses. Whether the estimates for the upper reaches of the system, between Lower Granite and McNary Dams were as expected (with weighted averages S{sub LGR-LGS} = 0.996, S{sub LGS-LMN} = 0.837, and S{sub LMN-McN} = 0.941), those for the lower reaches, between John Day and Bonneville Dams, appeared positively biased with survival estimates typically greater than 1. Their weighted averages were S{sub McN-JDA} = 0.707 and S{sub JDA-BON} = 1.792 for 1997 releases. For the 1998 releases, they were S{sub McN-JDA} = 0.795 and S{sub JDA-BON} = 1.312. If the estimates for the lower reaches were biased, the estimates for the whole project would also be biased (S{sub LGR-BON} = 0.819). We determined that bias could have arisen if the terns and cormorants of Rice Island fished for salmon yearlings in waters of the BON-Rice reach at low rates (M{sub BON-Rice} {le} 0.2), and the rates of tag-deposition and tag-detection were low (R{sub D} x R{sub R} {le} 0.4). Moreover, unknown levels of uncensored post-detection mortality and scavenging of previously dead salmon yearlings may have also added to the bias.

Skalski, John R.; Perez-Comas, Jose A. (University of Washington, School of Fisheries, Seattle, WA)

2000-05-01T23:59:59.000Z

216

Turbine Surface Degradation with Service and Its Effects on Performance  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Jeffrey Bons Jeffrey Bons Co-PIs: Iowa State University - Drs. Tom Shih and ZJ Wang University of Cincinnati - Drs. Tafi Hamed and Widen Tabakoff Air Force Research Lab - Dr. Richard Rivir SCIES Project 02- 01- SR104 DOE COOPERATIVE AGREEMENT DE-FC26-02NT41431 Tom J. George, Program Manager, DOE/NETL Richard Wenglarz, Manager of Research, SCIES Project Awarded (06/01/02, 36 Month Duration) $563,712 Total Contract Value Turbine Surface Degradation with Service and Its Effects on Performance Brigham Young University JPB/BYU/29Oct2003 BYU-UTSR-Oct03, 29 Oct 2003, JPB The Gas Turbine Community NEEDS adequate tools to estimate the associated loss in engine performance with service time. ROUGH! ARE TURBINES Surface Degradation - Increases Heat Transfer - Reduces Efficiency GAS TURBINE NEED

217

Carbon Capture Innovation: Making an IMPACCT on Coal | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal February 16, 2012 - 4:48pm Addthis The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs Over the past 20 years, nearly three-fourths of human-caused emissions came

218

Carbon Capture Innovation: Making an IMPACCT on Coal | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal February 16, 2012 - 4:48pm Addthis The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs Over the past 20 years, nearly three-fourths of human-caused emissions came

219

Turbine Surface Degradation with Service and Its Effects on Performance  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Peer Review Workshop III Peer Review Workshop III 18-20 October 2005 Jeffrey Bons BYU Z.J. Wang (3-D) Tom Shih (2-D) Iowa State University IOWA STATE UNIVERSITY Aerospace Engineering Turbine Surface Degradation with Service and Its Effects on Performance - 2-D/3-D CFD Simulations of Rough Surfaces- * Perform detailed CFD simulations to generate understanding of flow and heat transfer phenomena over rough surfaces. * Use understanding generated to develop engineering models to predict heat transfer and friction on rough surfaces. Objectives IOWA STATE UNIVERSITY Aerospace Engineering Accomplishments * Performed 2-D and 3-D CFD simulations. * Generated a preliminary engineering model. 3-D CFD: Z.J. Wang * 1/6 -1/3 of the span (from Jeffrey Bons' experiment) selected for the computational domain; * 2 mm, 1 mm and 0.5 mm resolutions for coarse, medium and

220

Tunisia's production peaks, exploration busy  

SciTech Connect (OSTI)

This paper reports on the oil and gas exploration industry in Tunisia which is continuing to experience an almost unprecedented boom as the effects of the favorable fiscal and legislative regime work through the recent discoveries come on stream. Perhaps the most significant of the new discoveries is 1 Belli on Cap Bon, which Marathon tested at a rate of 6,800 b/d of oil with reported potential of as much as 15,000 b/d.

Mrad, R.; M'Rabet, A.; Chine, N. (Enterprise Tunisienne d'Activites Petrolieres (TN)); Davies, W.C.

1991-12-23T23:59:59.000Z

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Haitian-English Dictionary  

E-Print Network [OSTI]

, Uberleben auf Kreolisch. Port-au-Prince: La Presse Evangelique, 1990. Bryant C. Freeman, Haitian-English English-Haitian Medical Dictionary, with Glossary of Food and Drink. Port-au-Prince: La Presse Evangelique, 1992. Seconded., 1997, Third ed., 1999.... Bryant C. Freeman, ed. Ann Bay Lodyans [Haitian Folktales in Haitian]. Lawrence: Uni versity of Kansas Institute of Haitian Studies; Port-au-Prince: Bon Nouvel, 1996- 1997. 2 e ed., 2000. 16 volumes. Bryant C. Freeman, Haitian Creole for Peace Support...

Freeman, Bryant C.; Laguerre, Jowel C.

2000-01-01T23:59:59.000Z

222

Z .Diamond and Related Materials 10 2001 364 369 Experimental data vs. 3-D model calculations of HFCVD  

E-Print Network [OSTI]

rH and3 4 2 C H rH process gas mixtures and to examine in detail the process of C lC inter-conversion between C and C hydrocar-2 1 bon species in the gas phase. Another important con- Zsideration in the gas phase. It has been2 2 2 2 1 shown that cooler regions distant from the filament need

Bristol, University of

223

Universite de Toulon Th`ese de doctorat  

E-Print Network [OSTI]

'oeuvre dans la g´en´eration des vaguelettes par le vent, sans m^eme parler de ph´enom`enes comme les vagues sc`etres `a prendre en compte. La compr´ehension des interactions entre les ondes ´electromagn´etiques et la d'antennes radar [4]. Un bon exemple d'interaction complexe en incidence rasante ayant des cons

Boyer, Edmond

224

Supplementary information Figure S1: Left: Comparison of PM2.5 levels measured with one of the optical  

E-Print Network [OSTI]

Palau Reial L3 87 24 21 6 Bon Pastor L9 145 98 46 28 Sagrera L9 180 53 59 19 Mean Mean in trains PM10 PM10 std PM2.5 std 5min 1.20 0.22 0.43 0.10 Fontana L3 0.49 0.10 0.15 0.05 Palau Reial L3 0.30 0.08 0

Meskhidze, Nicholas

225

Deux soeurs et Jsus, quel enseignement? (Luc Ce rcit se situe dans le cadre large de la monte vers Jrusalem (9,51-19,28), la  

E-Print Network [OSTI]

François Bovon.3 L'amour du prochain étant illustré par la parabole du bon Samaritain, l'amour de Dieu est normative, et vise à "encourager à opter pour une certaine attitude de foi". (François BOVON, L Verlagsanstalt, 1987, p. 212. 3 François BOVON, L'Evangile selon St Luc, 1996, p. 82. 4 Charles Talbert juge

Paris-Sud XI, Université de

226

Private development of artificial reefs  

E-Print Network [OSTI]

when compared with terestrial ecosystems. Recent studies at Woods Hole Oceanographic Institution emphasized that the oceans are far from an unlimited resource. The net pro- duction of the open ocean is about 50 grams of fixed car- bon per square... enhanced already existing fisheries. The continental shelf of the Gulf of Mexico is an expanse of shallow ocean bottom, and is the area inhabited by the majority of the commercially valuable reef fishes. Much of the shelf area, however, is r...

Burns, Arthur Allen

1978-01-01T23:59:59.000Z

227

Vers une adoption de la France ? Hugh Clout1  

E-Print Network [OSTI]

sur la nécessité d'acquérir une connaissance des langues étrangères, de Cole Harris sur l sont vraiment intéressants. Au contraire, il y a un petit article de la plume de William Mead, publié en 1963 et intitulé « The adoption of other lands », qui me semble plein de bon sens. Mead était, et

Paris-Sud XI, Université de

228

LA REVUE DE L'EPI N 85 DES CD-ROM POUR L'COLE PRIMAIRE DES CD-ROM POUR L'COLE PRIMAIRE  

E-Print Network [OSTI]

65 LA REVUE DE L'EPI N° 85 DES CD-ROM POUR L'?COLE PRIMAIRE DES CD-ROM POUR L'?COLE PRIMAIRE Jacques B?ZIAT EDUCAMPA COMMENT ENRICHIR SA BO?TE ? OUTILS SCOLAIRE ET P?DAGOGIQUE L'EPI diffuse le CD-Rom EDUCAMPA 1 (voir bon de commande page 236 de cette revue). Avec ce CD-Rom, Jean Marc Campaner nous livre

Paris-Sud XI, Université de

229

UNIVERSITE PARIS-SUD XI INSTITUT DE PHYSIQUE NUCLEAIRE D'ORSAY  

E-Print Network [OSTI]

réactions de production de dileptons en collision proton-proton avec HADES Soutenue publiquement le 28 mars les membres de la collaboration HADES avec qui j'ai échangé de bons moments. Je remercie les membres-00297939,version1-16Jul2008 #12;Table des matières 1 Motivations physiques de l'expérience HADES 7 1.1 La

Paris-Sud XI, Université de

230

Cahiers d'Etudes Africaines, n183, 2006, pp.493-512 Julien Bonhomme  

E-Print Network [OSTI]

, le voici donc, le grand Esprit, avec ses richesses inouïes ! »* Au Gabon, la figure de l'homme blanc de dix-sept ans, arrive pour la première fois au Gabon afin d'y rejoindre son père qui travaille dans récolter quelques fonds, il est de nouveau au Gabon au début de l'année 1856. Ses premières expéditions le

Paris-Sud XI, Université de

231

Restavk: yon ti esklav ann Ayiti tounen yon Ameriken ki pwofes lekl  

E-Print Network [OSTI]

an, tande, ba 1 kichoy pou 1 manje." Anjela pran m. 2 Li mande: "Ki non 1 genyen?" Florans fe yon ti grate tet epi 1 di: "Bobi." Florans pa t bezwen yon lot timoun, men, kondisyon lajan Filip pase ave 1 la te two bon pou 1 ta di non. Chak swa... kado nan men tonton Nwel epi ki nan fete fet yo, se timoun ki gen manman ak papa toutbon. 11 Chapit 2 - Lekol Chak samdi maten, Florans chita chita 1 nan dodin li, anba gwo pyebwa ki nan lakou devan an. L ap tann pratik li pase vin vann vyann...

Cadet, Jean Robert; Kadè , Jan Wobè

2000-01-01T23:59:59.000Z

232

Transit La Runion / Crozet du 2 au 7 Dcembre Prparation du mouillage KER12 cage aluminium compacte flottabilit intgre  

E-Print Network [OSTI]

bouée Panther Remarques : Les largueurs sont retenus par un bout à la structure pour éviter qu'ils ne se lieu de 90°. Ce n'est pas dramatique car l'élingue en chaîne de ce mouillage est très courte et devrait seront pas bonnes car ce n'est pas le bon numéro de série du radar, les données affichées sur le radar ne

233

Carbon Dioxide Emission Factors for U.S. Coal by Origin and Destination  

Science Journals Connector (OSTI)

In-ground coal quality data, including C, S, ash, fixed carbon, and heating values, are from COALQUAL (11), IGS (12), and Keystone (13, 14). ... For example, examination of 2082 bituminous Kentucky coals led Sakulpitakphon et al. (28) to reject the notion that a single CO2 emission factor can be used as typical for any given rank of coal. ... Quick, J. C.; Tabet, D. E.; Wakefield, S.; Bon, R. L. Optimizing Technology to Reduce Mercury and Acid Gas Emissions from Electric Power Plants: A GIS Study of Coal Chemistry, ...

Jeffrey C. Quick

2010-03-16T23:59:59.000Z

234

Measurement of routinely encountered neutron field doses using portable survey instruments and a Bonner multisphere system  

E-Print Network [OSTI]

against two 10 Ci PuBe neutron sources. Measurements were m de at a research reactor facility and a cyclotron facility using a Victoreen 4BBA portable survey instrument, a Ludlum Mode1 15 portable survey instrument and a Bonner multisphere system. Data... Detector Response as a Function of Neutron Energy Page Figure 2. Plot of BON25G Spectral Output Figure 3, Flux-to-Dose Rate Conversion Factors for Neutrons . . . . 8 Figure 4. Data Measurement Locations at NSC 13 Figure 5. Data Measurement Locations...

Davis, Donald Reed

2012-06-07T23:59:59.000Z

235

Survival Rates of Juvenile Salmonids Passing Through the Bonneville Dam and Spillway in 2008  

SciTech Connect (OSTI)

This report describes a 2008 acoustic telemetry survival study conducted by the Pacific Northwest National Laboratory for the Portland District of the U.S. Army Corps of Engineers. The study estimated the survival of juvenile Chinook salmon and steelhead passing Bonneville Dam (BON) and its spillway. Of particular interest was the relative survival of smolts detected passing through end spill bays 1-3 and 16-18, which had deep flow deflectors immediately downstream of spill gates, versus survival of smolts passing middle spill bays 4-15, which had shallow flow deflectors.

Ploskey, Gene R.; Weiland, Mark A.; Faber, Derrek M.; Deng, Zhiqun; Johnson, Gary E.; Hughes, James S.; Zimmerman, Shon A.; Monter, Tyrell J.; Cushing, Aaron W.; Wilberding, Matthew C.; Durham, Robin E.; Townsend, R. L.; Skalski, J. R.; Buchanan, Rebecca A.; Kim, Jina; Fischer, Eric S.; Meyer, Matthew M.; McComas, Roy L.; Everett, Jason

2009-12-28T23:59:59.000Z

236

Ann bay lodyans 12 / Se Bryant Freeman ("Tonton Liben") ki pare ti liv sa a  

E-Print Network [OSTI]

a, Bondye fe yon bon ti melanj: li pran bwode ki gen nan pan, di ki gen nan woch, fines ki gen nan ke zwazo, douse ki gen nan siwo myel, mechanste ki gen nan tig, chale ki gen nan dife, fredi ki gen nan lanej. Bondye kontwole yo, sa pa ase.... Yo te viv ansanm pandan kek tan konsa. Men yon jou, msye a al devan Bondye ansanm ak fi a. Li pote I remet Bondye. Li di konsa: "Bondye, m pa kapab viv ak zanmi ou ban mwen an. Li pale san rete, li fatige m twop, menm yon ti poze m pa kab fe. Sa...

Freeman, Bryant C.

2000-01-01T23:59:59.000Z

237

Publications of the Life Sciences Division, ORNL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

LSD logo Life Sciences Division LSD logo Life Sciences Division Oak Ridge National Laboratory Programs Partners Organization Highlights In the News --- Home Internal (Restricted Access) Contacts Publications 2003 Publications/Presentations Akabani, G., S. J. Kennel, and M. R. Zalutsky, "Microdosimetric analysis of alpha-particle-emitting targeted radiotherapeutics using histological images," J. Nucl. Med. 44(5):792-805 (May 2003). Allain, L. R., D. N. Stratis, C. M. Cullum, J. Mobley, M. R. Hajaligol, and T. Vo-Dinh, "Real-time detection of PAH mixtures in the vapor phase at high temperatures," J. Anal. Appl. Pyrolysis 66(1-2):145-154 (January 2003). Chain, P., J. Lamerdin, F. Larimer, W. Regala, V. Lao, M. Land, L. Hauser, A. Hooper, M. Klotz, J. Norton, L. Sayavedra- Soto, D. Arciero, N. Hommes, M. Whittaker, and D. Arp, "Complete Genome Sequence of the Ammonia-Oxidizing Bacterium and Obligate Chemolithoautotroph NitrosomonaseEuropaea," J. Bacteriology 185(9):2759-2773 (May 2003).

238

Raman Spectra of Graphite Oxide and Functionalized Graphene Sheets  

Science Journals Connector (OSTI)

Konstantin N. Kudin , Bulent Ozbas , Hannes C. Schniepp , Robert K. Prud'homme , Ilhan A. Aksay , and Roberto Car * ... 25 Theoretical evaluation of the Raman spectra requires first-, second-, and third-order energy derivatives, among which the most demanding are the second-order derivatives of the energy with respect to the atomic positions (force constants)26 and the third-order polarizability derivatives, twice with respect to the electric field (yielding polarizability) and once with respect to the atomic positions (Raman intensity tensors). ... and the described stable structural isomers (obtained by 2-atom transformations), the ?-orbital energy levels, ?-electron populations, bond orders, and delocalization (resonance) energies were obtained in Hueckel and approx.-SCF ...

Konstantin N. Kudin; Bulent Ozbas; Hannes C. Schniepp; Robert K. Prud'homme; Ilhan A. Aksay; Roberto Car

2007-12-22T23:59:59.000Z

239

Relation entre mcanismes de dfense et alliance thrapeutique  

Science Journals Connector (OSTI)

Rsum Lobjectif principal de cette tude tait dvaluer la relation entre lalliance thrapeutique et vingt mcanismes de dfense dans un chantillon psychiatrique franais, en diffrenciant les rsultats obtenus pour les hommes et les femmes. Les alliances thrapeutiques positive et ngative ont galement t diffrencies dans nos analyses. Soixante patients adultes ont complt le Defense Style Questionnaire-40 (DSQ-40) ainsi que le Helping Alliance questionnaire-II (HAq-II). Nos rsultats mettent en avant la prsence de liens entre lalliance thrapeutique et certains mcanismes de dfense. Le style de dfense mature apparait comme un prdicteur significatif de lalliance thrapeutique (R2 adj =0,36, F =12,39, ?=0,65, p alliance positive est associe plusieurs mcanismes de dfense: chez les hommes, lannulation se distingue, chez les femmes, cest lagression passive. En ce qui concerne lalliance thrapeutique ngative, seul le dplacement est significatif et uniquement chez les hommes. Ces rsultats rvlent notamment la ncessit de prendre en considration le sexe dans ltude des mcanismes et de leur lien avec lalliance thrapeutique. SummaryIntroduction The therapeutic alliance can be defined as a collaborative relationship between the patient and the practitioner. It represents an essential component of the psychotherapeutic process (Ambresin et al., 2007; Cungi, 2006; Martin et al., 2000). Some authors suggest that a good alliance can have a favorable impact on the therapeutic success (Barber et al., 2000; Hubble, Duncan, & Miller 1999; Horvath & Luborsky, 1993; Horvath & Symonds, 1991). This alliance can be influenced by psychological and behavioral factors (Cungi, 2006) Thus, some defense mechanisms could prevent change or, on the contrary could facilitate adaptation (Ambresin et al., 2007) and have an impact on the therapeutic success (Muris & Merckelbach, 1996). However, the relationship between therapeutic alliance and defense mechanisms represents an insufficiently explored field (Ambresin et al., 2007; Cungi, 2006). The aim of the present study was to examine the relationship between therapeutic alliance and twenty defense mechanisms in a sample of French psychiatric patients, by differentiating results in men and women. We also examined the positive and the negative therapeutic alliance. Method Sixty patients aged from 18 to 58 (M = 41.50; SD = 11.03) completed the French versions of the Defense Style Questionnaire 40 (DSQ-40) and the Helping Alliance questionnaire II (HAq-II). Results Therapeutic alliance was significantly associated with each defense style: mature (.62), neurotic (.45) p alliance (R2 adj =.36, F = 12.39, ?=.65, p alliance (R2 adj =.36, F = 12.34, ?=.62, p alliance was significantly associated with all mature defenses, three neurotic defenses (reaction formation, pseudo altruism, idealization) and four immature defenses (splitting, denial, somatization, passive aggression). Among men, three mature defenses was associated (anticipation, humor, sublimation), four neurotic (reaction formation, pseudo altruism, idealization and undoing) and two immature (somatization and denial). The negative therapeutic alliance, in our total sample was associated with two immature defenses (denial and dissociation). Among men, displacement was the only defense associated with negative alliance, among women no defenses was significant Discussion These results highlight the relationship between therapeutic alliance and some defense mechanisms, like some authors have suggested (Ambresin et al., 2007; Bond & Perry, 2004; Bond, 2004). Moreover, some defenses appeared to be more associated with a positive or a negative therapeutic alliance, and could depend on the patient gender. Conclusion The present study confirms the impo

S. Laconi; L. Cailhol; L. Pourcel; C. Thalamas; M. Lapeyre-Mestre; H. Chabrol

2014-01-01T23:59:59.000Z

240

untitled  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

UNIVERSIT UNIVERSIT Y OF CALIFORNIA Lawrence Radiation Laboratory Berkeley, California Contract No. W -740S-eng -48 UCRL-9966 I THE PATH OF CARBON IN PHOTOSYNTHESIS Melvin Calvin Nobel Prize Lecture December 11, 1961 ) Nobel Prize Lecture December 11, 1961 UCRL-9966 THE PATH OF Ck'1BON IN PHOI'CBYHTHESIS Melvin Calvin Department of Chemistry and Lawrence Radiation Laboratory University of California, Berkeley 4, California ll'JTRODUCTION It is almost sixty years since Emil Fischer was describing on 8 platform such as this one some of the work Which led to the basic know- ledge of the structure of glucose and its relatives. l Today we "ill be concerned ,.itha description of the experiments "lhich have led to a know- ledge of the principal reactions by which those carbohydrate structures are created by photos~rnthetic organisms from carbon dioxide and water,

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

degj0196 19..34  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

critical critical role of monitoring, verification, and accounting for geologic carbon dioxide storage projects Sean I. Plasynski, John T. Litynski, Howard G. McIlvried, Derek M. Vikara, and Rameshwar D. Srivastava A B S T R A C T A growing concern that increasing levels of greenhouse gases in the atmosphere are contributing to global climate change has led to a search for economical and environmentally sound ways to reduce car- bon dioxide (CO 2 ) emissions. One promising approach is CO 2 cap- ture and permanent storage in deep geologic formations, such as depleted oil and gas reservoirs, unminable coal seams, and deep brine-containing (saline) formations. However, successful implemen- tation of geologic storage projects will require robust monitoring, veri- fication, and accounting (MVA) tools. This article deals with all aspects of MVA activities associated with such geologic CO 2 storage

242

Microsoft Word - 2006FactSR120.doc  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Deposition of Alternative (Syngas) Fuels on Turbine Blades with Film Cooling Deposition of Alternative (Syngas) Fuels on Turbine Blades with Film Cooling FACT SHEET I. PROJECT PARTICIPANTS Drs. Jeffrey Bons and Thomas Fletcher, Brigham Young University, 435 CTB, PO Box 24201, Provo, Utah 84602 (801) 422-8036 jbons@byu.edu Tom George, National Energy Technology Laboratory, P O Box 880, 3610 Collins Ferry Rd, Morgantown, WV 26507-0880 (304) 285-4825 tgeorg@netl.doe.gov Richard Wenglarz, South Carolina Institute for Energy Studies, 386-2 College Ave., Clemson, SC 29634 (864) 656-2267 rwnglrz@clemson.edu II. PROJECT DESCRIPTION A. Objectives This effort will address three critical technical issues associated with syngas use in gas turbines: (1) The effects of syngas deposition, erosion, and corrosion at elevated temperatures

243

Deposition of Alternative (Syngas) Fuels on Turbine Blades with Film Cooling  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ACERC ACERC Dr. Jeffrey Bons and Dr. Thomas Fletcher BRIGHAM YOUNG UNIVERSITY SCIES Project 05-01-SR-120 with support from General Electric, Siemens-Westinghouse, Solar Turbines, Praxair UTSR Peer Workshop III, Clemson University, SC Oct. 18-20, 2005 Deposition of Alternative ( Deposition of Alternative ( Syngas Syngas ) Fuels on ) Fuels on Turbine Blades with Film Cooling Turbine Blades with Film Cooling Alternate fuels (e.g. coal, petcoke, and biomass) are being cons Alternate fuels (e.g. coal, petcoke, and biomass) are being cons idered to idered to produce produce syngas syngas fuels to replace natural gas in power turbines fuels to replace natural gas in power turbines Despite gas cleanup, small levels of airborne particulate (e.g. Despite gas cleanup, small levels of airborne particulate (e.g. 0.1 0.1 ppmw

244

Microsoft PowerPoint - UTSR-2010-Pennst-UNDOSU-comb.ppt [Compatibility Mode]  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Workshop - Aerodynamics/Heat Transfer Breakout Workshop - Aerodynamics/Heat Transfer Breakout Oct 20 2010 Oct. 20,2010 Forrest Ames, UND Jeffrey Bons, OSU Motivation ot at o Turbine design considerations: Ash Deposition on F-100 Vane Leading Edge - Higher T T4 - LE Clogging Potential C b g (Ref: Kim et al., 1993) - Combustors: - High turbulence levels - Non-uniformities - Non uniformities - Film cooling - Larger leading edge diam. g g g - Better TBC coatings Ash Deposition on Better tools for turbine vane LE heat l d li i d 2 p CFM56-5B Vane Leading Edge (Ref: Smith et al., 2010) load, cooling requirements, and potential for deposition??? Critical Unanswered Questions Critical Unanswered Questions  What is the effect of increased LE radius on d iti ? deposition?  What is the effect of increased inlet turbulence on

245

Academic Advisory Board Activities and Perspectives  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Advisory Board Advisory Board Activities and Perspectives Karen A. Thole, Chair Academic Advisory Board Virginia Tech, Mechanical Engineering Department Peer Review Workshop October 20, 2005 * Review of the Academic Advisory Board * Activities since 2004 Peer Review Workshop * Open discussion Discussion Topics Chair: Karen Thole, Virginia Tech Co-Chair: Tim Lieuwen, Georgia Tech Secretary: Vince McDonell, U of California-Irvine Education: Yongho Sohn, U of Central Florida Combustion: Dom Santavicca, Penn State Materials: Eric Jordan, U of Connecticut Aero / Ht Transfer: Jeffrey Bons, Brigham Young Diagnostics: Scott Sanders, U. of Wisconsin Academic Advisory Board (AAB) Contact any of us with your concerns/issues!!! Goals for the AAB * Provide guidance to the UTSR Program

246

Contribution of organic carbon to wood smoke particulate matter absorption  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Contribution of organic carbon to wood smoke particulate matter absorption Contribution of organic carbon to wood smoke particulate matter absorption of solar radiation Title Contribution of organic carbon to wood smoke particulate matter absorption of solar radiation Publication Type Journal Article Year of Publication 2012 Authors Kirchstetter, Thomas W., and Tracy L. Thatcher Journal Atmospheric Chemistry and Physics Volume 12 Pagination 6067-6072 Abstract A spectroscopic analysis of 115 wintertime partic- ulate matter samples collected in rural California shows that wood smoke absorbs solar radiation with a strong spectral se- lectivity. This is consistent with prior work that has demon- strated that organic carbon (OC), in addition to black car- bon (BC), appreciably absorbs solar radiation in the visible and ultraviolet spectral regions. We apportion light absorp-

247

DOE/EIS-0397: Lyle Falls Fish Passage Project Final Environmental Impact Statement (November 2008)  

Broader source: Energy.gov (indexed) [DOE]

Lyle Falls Fish Passage Project Lyle Falls Fish Passage Project Final Environmental Impact Statement DOE/EIS-0397 November 2008 B O N N E V I L L E P O W E R A D M I N I S T R A T I O N BON N E V I L L E POW E R AD M I N I S T R A T I O N DOE/BP-3957 November 2008 Lyle Falls Fish Passage Facility Lyle Falls Fish Passage Project Final Environmental Impact Statement Bonneville Power Administration Confederated Tribes and Bands of the Yakama Nation Washington Department of Fish and Wildlife U.S.D.A. Forest Service November 2008 Lyle Falls Fish Passage Facility Lyle Falls Fish Passage Project Final Environmental Impact Statement (EIS) DOE/EIS-0397

248

Regmi Research Series ,Year 3, December 1, 1971  

E-Print Network [OSTI]

!t the tlinrcrorf, l re4tionshipl1 bctl:eon the kine; and Kn-.til-.'olti would rot last long' and th,:t oither the Icing or tIc qtl()cn '1o!}ld dio 5oon. 6 At the 5EUOO tilOO J they spr.:l~d the rwoor that Girvanyuddha Dir Bitty'am Stah would dio of sll... in Octoh::r 1642: t" , -, , Kiq; Rajondra then besan to dance t o tho tune of the Junior Quwn, Rajyalaxmi Dlvi. Previously, Rajyaln;ani O(ni had felt afraid that th: eyv~ of her. infant 'Bons, Rapandra Bikram and Birendra nikr

Regmi, Mahesh C

1971-01-01T23:59:59.000Z

249

Quel avenir pour le sport?  

Science Journals Connector (OSTI)

Rsum Le progrs technologique reprsente un moteur de dveloppement mais, dans cette mesure mme, il se lie laction dissolvante exerce par la technologie sur le noyau thicopolitique du sport. Si le monde sportif ne se dote pas, dans un temps qui devient court, de moyens de protection autour dun thme, celui des enjeux de transformation dans les rapports entre science, homme, sport et technologies, nous pourrons peut-tre assister la fin du sport de comptition, du moins tel que nous le connaissons. De quoi demain sera-t-il fait? La mutation technologique que reprsente le passage aux nanosciences et nanotechnologies saccompagnera dun phnomne de transversalit appel mtaconvergence, prcipitant un bouleversement de la condition humaine, qui amne diverses organisations scientifiques voquer lenjeu dun homme en transition, dun transhumanisme en quelque sorte. Lubris dsignait chez les Grecs anciens tout ce qui dpasse la mesure, mais encore faut-il tre en situation de dire o se situe la limite. Jusquo pouvons-nous aller trop loin? Le dfi est celui de lubris technologique. Technological progress stands as a force for improvement, but simultaneously it can also be seen as an element that is wearing away the ethical and political core of sport. If, before a deadline that is looming ever closer, the world of sport fails to take steps to protect itself in one particular respect, that of considering what is at stake in terms of the changing relationships between science, mankind, sport and technology, then we may be seeing the end of competitive sport, at least as we know it. What will tomorrow be made of? The technological change that is coming with the move towards nanosciences and nanotechnology will bring with it a transversal phenomenon known as metaconvergence resulting in a revolution in the human condition that has led some scientific organisations to raise the prospect of a human being in transition, a kind of transhumanism. Hubris was the word used by the ancient Greeks for that which went too far, but one needs to be in a position to say where the limits lie. How far can we go before it becomes too far? The challenge is that of technological hubris.

J. Wauthier

2008-01-01T23:59:59.000Z

250

Where have all the flowers gone: deforestation in the Third World  

SciTech Connect (OSTI)

The papers in this issue (and in its companion issue) describe tropical forest destruction and analyze implications at several levels. The contributions are representative of the major regions of the tropical moist forests (TMFs) - Amazonia, Africa, and Indo-Malaysia - and reveal a process whose ramifications will affect all parts and components of the biosphere. The authors and titles of the 13 paprs are: Norman Myers, Deforestation in the Tropics: Who Gains, Who Loses; William M. Denevan, Swiddens and Cattle Versus Forest: The Imminent Demise of the Amazon Rain Forest Reexamined; Stephen G. Bunker, Impact of Deforestation on Peasant Communities in the Medio Amazonas of Brazil; Susanna B. Hecht, Deforestation in the Amazon Basin: Magnitude, Dynamics and Soil-Resource Effects; K. Twum-Barima, Forests of Ghana - A Diminishing Asset; J. Leroy Deval (English abstract), Man and Development in the Forests of Gabon; J. Leroy Deval, L'Homme et Le Developpement de La Foret du Gabon Dans Le Passe; Faustin Legault (English Translation), Reforestation in the Republic of Gabon; Faustin Legault, Le Reboisement en Republique Gabonaise; Peter S. Ashton, Forest Conditions in the Tropics of Asia and the Far East; Gurmit Singh K.S., Destroying Malaysian Forests; Kuswata Kartawinata, Environmental Consequences of Tree Removal from the Forest in Indonesia; and Robert Goodland, Indonesia's Environmental Progress in Economic Development.

Not Available

1981-01-01T23:59:59.000Z

251

Dissection coronarienne post-traumatique associe un syndrome de Dandy-Walker: A propos dun cas  

Science Journals Connector (OSTI)

Rsum Nous rapportons le cas dun homme de 49 ans, victime dun accident de la voie publique avec incarcration et polytraumatisme, pour lequel lquipe mdicale a t confronte au pige classique de la prise en charge des traumatismes thoracique svre : savoir, relguer au second plan latteinte thoracique en la prsence dautres points dappel. Dans notre cas, ce fut une atteinte neurologique : un syndrome de Dandy-Walker, vritable pige iconographique car pouvant tre confondu avec une lsion crbrale hmorragique. Par cette observation, nous raffirmons la ncessit dune prise en charge systmatique de tout traumatisme thoracique svre en effectuant un lectrocardiogramme, un dosage de la troponine T et une chocardiographie transsophagienne. Summary We report the case of a 49-year-old automobile accident victim. The patient presented multiple injuries including blunt chest trauma. Myocardial necrosis was only detected after extrication from the damaged vehicle. Cardiological care was also delayed due to the presence in the same patient of an asymptomatic Dandy-Walker syndrome (possible confusion with cerebral hemorrhage). This cas troponine T and transthoracic enchocardiography.

A. Bensad; D. Amiri-Bensad; M. Noizet; C. Lhacene; A. Delvaux

2005-01-01T23:59:59.000Z

252

Comparaison palocognitive des niveaux moustrien et magdalnien de la grotte Tournal (Bize, Aude)  

Science Journals Connector (OSTI)

Rsum Nous analysons la chane opratoire de traitement des grands mammifres identifie sur les niveaux magdalnien et moustrien du site de Tournal (Bize, Aude). Les rsultats comportementaux sont exploits laide de la mthode de psychologie cognitive des actions mentales finalises, dont les lments danalyse sont dune part les objets manipuls par les Prhistoriques et dautre part les proprits qui leur ont t attribues par ces hommes. Objets et proprits sont lis par relations binaires. Ces relations sont traites par SIMBOL, un logiciel dvelopp lIPH (Institut de palontologie humaine) partir dun algorithme, STONE, publi initialement au Laboratoire de psychologie exprimentale de Paris-8. SIMBOL produit un graphe de la reprsentation de la tche en mmoire, pour chaque niveau, autorisant ainsi une comparaison rigoureuse des activits cognitives aux deux poques. Nous observons que les graphes moustrien et magdalnien sont trs similaires. Nous pouvions y voir lindice de la trs grande proximit cognitive des deux types dhommes ayant utilis le site ces priodes diffrentes. De plus la complexit cognitive apparat comparable dun graphe lautre, cest--dire du niveau moustrien au niveau magdalnien. La fluidit cognitive augmente sensiblement du graphe moustrien au graphe magdalnien, les glissements de sens, les analogies, semblant tre favoriss en contexte magdalnien. Peut-on y voir un lindice de capacits cognitives plus complexifies chez les magdalniens que chez les nandertaliens? Des rsultats ultrieurs doivent venir valider ou infirmer ces hypothses, et augmenter le corpus de donnes potentielles ouvert par cette nouvelle approche. We analyse the functional processing chain of large mammals acquired at the mousterian and magdalenian levels of the Tournal cave (Bize, Aude). Palethnologic results are analysed through a method from experimental psychology of goal oriented activities. The elements are the objects used by prehistoric man and their properties. Objects and properties are linked by binary relationships. These relationships are processed by software, SIMBOL, developed at the IPH, based on an algorithm initially published by the Laboratoire de psychologie exprimentale of Paris-8. SIMBOL returns the cognitive graph of the task representation for the mousterian and the magdalenian layer, allowing a rigorous comparison of the cognitive activities on both periods. The main result is that the logical structure is preserved when passing from one level to the other. This could be interpreted as a due to the noticeable cognitive similarity of the men from the different periods, along with the fact that cognitive complexity seems to be the same on both graphs. Cognitive fluidity improves from mousterian to magdalenian suggesting that cognitive mechanisms such as sense sliding and analogies could be easier at the magdalenian level. Could we interpret this result as a due to a greater creativity at the magdalenian level than at the mousterian one? Further investigations are needed to state this, as well as enhanced data volume, potentially allowed by this entirely new method.

I Saillot; M Patou-Mathis

2002-01-01T23:59:59.000Z

253

Obligate autotrophy in the ammonia oxidizing bacterium Nitrosomonas europaea.  

SciTech Connect (OSTI)

Closing report for project DOE-FG02-03ER15436. The project studied obligate autotrophy in the ammonia oxidizing bacterium Nitrosomonas europaea. Nitrosomonas europaea can obtain all of its energy and reductant for growth from the oxidation of ammonia to nitrite and is, therefore, classified as a chemolithotroph. This bacterium is also an autotroph, which can derive all cellular carbon from carbon dioxide. N. europaea seems incapable of growth with other carbon or energy sources. This restricted capability is surprising given that ammonia is a poor energy source. The main goal of the project was to examine the basis of autotrophy in N. europaea or, thought of another way, to determine the barriers to heterotrophy. The approach was enabled by the N. europaea genome sequence, stimulating new ways of thinking about this physiological paradoxan insistence on a single, albeit poor, energy source. Objective 1 was to examine the expression and regulation of the genes coding for alpha-ketoglutarate dehydrogenase, determine if the enzymes activity is present, and determine whether alteration of the expression levels influences autotrophic growth. Although Nitrosomonas europaea lacks measurable alpha-ketoglutarate dehydrogenase activity, the genome sequence revealed the presence of the genes encoding the enzyme. A knockout mutation was created in the sucA gene encoding the E1 subunit. Compared to wild-type cells, the mutant strain showed an accelerated loss of ammonia monooxygenase and hydroxylamine oxidoreductase activities upon entering stationary phase. In addition, unlike wild-type cells, the mutant strain showed a marked lag in the ability to resume growth in response to pH adjustments in late stationary phase. The results were published in Hommes N.G., Kurth E. G., Sayavedra-Soto L.A., and Arp D.J. (2006) Disruption of sucA, which encodes a subunit of alpha-ketoglutarate dehydrogenase, affects the survival of Nitrosomonas europaea in stationary phase. Journal of Bacteriology 188:343-347. Objective 2 was to determine the basis of fructose stimulation of growth on ammonia, examine fructose metabolism, and determine the impact of other compounds on growth on ammonia. Previous studies showed that N. europaea can utilize limited amounts of certain organic compounds, including amino acids, pyruvate, and acetate, although no organic compound has been reported to support the growth of N. europaea. The genomic sequence of N. europaea revealed a potential permease for fructose. N. europaea utilized fructose and other compounds as carbon sources to support growth. Cultures were incubated in the presence of fructose or other organic compounds in sealed bottles purged of CO(2). In these cultures, addition of either fructose or pyruvate as the sole carbon source resulted in a two- to threefold increase in optical density and protein content in 3 to 4 days. Studies with [(14)C]fructose showed that >90% of the carbon incorporated by the cells during growth was derived from fructose. Cultures containing mannose, glucose, glycerol, mannitol, citrate, or acetate showed little or no growth. N. europaea was not able to grow with fructose as an energy source, although the presence of fructose did provide an energy benefit to the cells. These results show that N. europaea can be grown in carbon dioxide free medium by using fructose and pyruvate as carbon sources and may now be considered a facultative chemolithoorganotroph. The results were published in Hommes N.G., Sayavedra-Soto L.A. and Arp. D.J. (2003). Chemolithotrophic growth of Nitrosomonas europaea on fructose. Journal of Bacteriology. 185:6809-2773. Objective 3 attempted to grow N. europaea heterotrophically through pathways predicted by the genome. Experiments with mutant strains and complementation studies were performed to test whether N. europaea can utilize other carbon sources. N. europaea was not able to grow heterotrophically in the conditions tested in this objective.

Daniel James Arp; Luis Alberto Sayavedra-Soto

2006-01-01T23:59:59.000Z

254

De lhumanisme au posthumanisme: le destin du corps  

Science Journals Connector (OSTI)

Rsum Lhumanisme aurait-il fait son temps? Comment vivre au milieu des autres quand lhumain devient une sorte de rsultante entre nature et biotechnologies? Ne faut-il pas abandonner notre nature si fragile pour advenir une posture inaltrable, voire dmatrialise? Le corps semble bien tre la prison de lme pour certains contemporains qui envisagent donc sa dsintgration. Notre propos tente de montrer combien cette tentative de fusion dans un grand tout, renvoie une profonde dpression de ltre ou un refus conscient ou non de se raliser, voire dassumer sa condition. Le monde transhumain est un monde o les nanorobots dtruiront les agents pathognes, les erreurs ADN voire limineront les toxines. Ainsi, lhomme pourra se dcliner sous une nouvelle version v 2.0. Est-ce une fin en soi? Que dire alors celles et ceux qui semblent aspirs par cette dynamique si ce nest que cest peut tre la fragilit de la naissance, la beaut du dveloppement et de la vie qui est le cur de notre humanit? Summary Is it the end of Humanism? How can we actually live together, when human want to be a patchwork mixing nature and biotechnologies? Many people seem to give up their weakness and hope in a new unaffected situation. As body seems to be jail of soul, people want to split it. Our purpose tries to explain the reasons of this paradoxal course. Transhumanism is related to depression and conscious or unconscious refusal to assume their conditions. How can we help people who consider this evolution as an end as itself? What can we tell to them, if the fragility of the birth and the beauty of development are the core of the human being?

J.-M. Besnier

2012-01-01T23:59:59.000Z

255

2  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

G - COMPRESSED NATURAL GAS SYSTEM OPERATIONS G - COMPRESSED NATURAL GAS SYSTEM OPERATIONS Rev. 0, July 9, 2001 G.1 NORMAL STARTUP To conduct normal startup, proceed as follows: 1. Open the supply from Southwest Gas (V-101) and activate AOV-102. a. Open one filter (V-105/V-108 or V-109/V-112), with the other filter line closed and filter drains closed. b. Verify that the SWG supply pressure is 30 psi (PI 104 and PI 118). c. Verify that the blowdown filter is set to drain. 2. Open the by-pass supply to Gemini V-119 and V-18. 3. Gemini discharge valve configuration: a. Open V-19, -20, -20A. b. Valve into operation one set of coalescening filters: Open V-21 and V-22 and Close V-23 and V-24 Or Close V-21 and V-22 and Open V-23 and V-24. 4. Open V-25 at fill and dispenser cabinet 1. 5. Optional the booster blower or Hy-Bon compressor:

256

SWERA borrador051110  

Open Energy Info (EERE)

informe nacional informe nacional GEF MEM DGE Preparado por: Ing. Norbert Bons Borrador 14-11-05 SWERA borrador 14-11-2005 1 2 MEM DGE - Fundación Solar Contenido Prefacio 5 Resumen ejecutivo 6 Introducción 7 Datos socioeconómicos 7 Geografía y clima de Guatemala 7 Las energías renovables en Guatemala 9 La situación energética del país 13 Balance de energía de Guatemala 13 Marco institucional del sub-sector eléctrico 14 Ministerio de Energía y Minas 14 Comisión Nacional de Energía 15 Administrador del Mercado Mayorista 15 Autoridad designada para los créditos de carbono 16 Marco regulatorio del sub-sector eléctrico 16 Ley general de electricidad 17 Ley de incentivos para el desarrollo de proyectos de energía renovable 17 Sistema eléctrico 17 Generación 17 Transporte 18 Distribución 19 Mercado eléctrico

257

Shane Canon, David Skinner and Jay Srinivasan! NUG2013  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Canon, David Skinner and Canon, David Skinner and Jay Srinivasan! NUG2013 NERSC and HTC --- 1 --- February 1 2, 2 013 Science Strategies @ NERSC Science at Scale P etascale t o E xascale Science through Volume Thousands t o M illions o f S imula6ons Science in Data Petabytes t o Exabytes 2 3 Materials (Genome) Project * Need to gather slides 4 5 Common T hemes * Throughput O riented / E mbarrassingly p arallel * Rapidly I ncreasing d emand f or c omputaBon (outpacing M oore's L aw) * OIen D ata I ntensive * Scaling f rom d esktop o r m id---range s ystems t o HPC c lass s ystems Approaches * Throughput Q ueues * Private/User A llocaFon - Task F armer ( NERSC D eveloped o r C ray P rovided) - MyHadoop - MySGE * Shared - CCM/Torque * Hybrid? - High---Throughput Q ueue S ystems 6 Throughput Queues * Serial Q ueue o n C

258

Preliminary consideration of selected chemical and oceanographic factors influential in the formation of the alumino-silicate fraction of some recent sediments  

E-Print Network [OSTI]

SOmSM y-Lu LW hLqAhCh LIM hAIAhCh yBIySIWOLWABIm Bb nSnWAJAIY LYSIWm LIM AI MAmWA--SM wLWSO1 cSWW-AIY ?LB-AIAWAy y-Lu wLm bBCIM WB SqjArAW WjS YOSLWSO LMmBOnWABI WSIMSIyASm bBO YL-LyWBmS LIM mCyOBmS rCW MAM IBW OSWLAI WjSmS yLOrBjuMOLWSm wjSI -SLyjSM w...SWW-AIY y-Lum wSOS MSWSOhAISM ru WjS :AmyjS yB-BOAhSWOAy hSWjBM CmAIY L 9Sy?hLI pBMS- :x mnSyWOBnjBWBhSWSO1 cWLIMLOM OBCWAIS hSyjLIAyL- LIL-umSm Bb hLOAIS mSMAhSIWm wSOS bBCIM WB rS Bb -AWW-S mAYIAbAyLIyS rS-Bw LI SAYjW hAyOBI #SdCA&L-SIW MALhSWSOPK, c...

Whitehouse, Ulysses Grant

1955-01-01T23:59:59.000Z

259

Acoustic Telemetry Studies of Juvenile Chinook Salmon Survival at the Lower Columbia Projects in 2006  

SciTech Connect (OSTI)

The Portland District of the U.S. Army Corps of Engineers contracted with the Pacific Northwest National Laboratory (PNNL) to conduct three studies using acoustic telemetry to estimate detection probabilities and survival of juvenile Chinook salmon at three hydropower projects on the lower Columbia River. The primary goals were to estimate detection and survival probabilities based on sampling with JSATS equipment, assess the feasibility of using JSATS for survival studies, and estimate sample sizes needed to obtain a desired level of precision in future studies. The 2006 JSATS arrays usually performed as well or better than radio telemetry arrays in the JDA and TDA tailwaters, and underperformed radio arrays in the BON tailwater, particularly in spring. Most of the probabilities of detection on at least one of all arrays in a tailwater exceeded 80% for each method, which was sufficient to provide confidence in survival estimates. The probability of detection on one of three arrays includes survival and detection probabilities because fish may die or pass all three arrays undetected but alive.

Ploskey, Gene R.; Weiland, Mark A.; Hughes, James S.; Zimmerman, Shon A.; Durham, Robin E.; Fischer, Eric S.; Kim, Jina; Townsend, Richard L.; Skalski, John R.; McComas, Roy L.

2008-02-01T23:59:59.000Z

260

Analyse palocognitive de la couche5 de la Grotte Scladina Sclayn, Belgique  

Science Journals Connector (OSTI)

Rsum Les donnes comportementales fournies par la palethnologie sont traites l'aide d'outils mthodologiques de la psychologie cognitive des actions finalises. Les units lmentaires de l'analyse sont les objets et proprits considrs par les hommes ayant occup le site. Objets et proprits sont lis par relations binaires puis traits par SIMBOL, un programme dvelopp l'IPH selon l'algorithme usuel de production des graphes cognitifs. SIMBOL fournit le treillis de Galois de la catgorisation associe aux tches de boucherie sur le site. Cette mthode permet une approche rigoureuse des activits cognitives anciennes. Elle pourrait fournir aux archopsychologues les bases de discussion communes qui font dfaut actuellement. En effet, les concepts psychologiques sont souvent utiliss sans rfrence leur signification d'origine. Nous proposons ici des rsultats prliminaires concernant la couche moustrienne de la grotte Scladina prs de Namur, Belgique (M.-H. Moncel, M. Patou-Mathis, M. Otte, 1998). Ces rsultats fournissent une vue du processus de catgorisation tel qu'il s'est droul sur le site concernant le traitement de certains grands mammifres. Des comparaisons entre sites permettront ultrieurement d'atteindre une perspective sur l'volution de la cognition lors de l'hominisation. The behavioural data reconstructed by archaeologists is processed with mathematical tools from cognitive psychology and especially the field of goal oriented actions: the elements of the analysis are the artefacts found on the site and the properties ascribed to these objects by the men who occupied the site. Objects and properties are linked by binary relationships, then processed by SIMBOL, a simple Excel VBA software developed at the IPH, after an initial publication of the Laboratoire de Psychologie Exprimentale of University Paris-8. SIMBOL returns a simplified Galois lattice, which is a graph of the categorization associated to the task representation in memory. This method is a way to reach a rigorous description of the cognitive activities of ancient men. We assume that this new approach could allow archaeologists to clarify the current debates about ancient cognition, which so far lack common basis: in fact the authors usually use cognitive terms and theories without any reference to their scientific meanings among psychologists. As an example, we processed the behavioural data reconstructed from the site excavation of a belgian cave, Scladina, which corresponds to a halt of middle paleolithic hunters (M.-H. Moncel, M. Patou-Mathis, M. Otte, 1998). These preliminary results give an instant view of the categorization process related to the subsistence behaviour of the men who occupied the site. This mathematical approach will help provide psychologists and archaeologists with interesting data about evolutionary cognition, when enough data about various sites and periods is collected.

I Saillot

2002-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bon homme yankton" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Apport de lcho-Doppler vasculaire dans les infarctus crbraux Brazzaville (Congo)  

Science Journals Connector (OSTI)

RsumObjectif Dterminer la prvalence des lsions carotidiennes au cours des infarctus crbraux Brazzaville (Congo). Patients et mthodes Il sagit dune tude transversale descriptive, mene Brazzaville entre janvier 2011et juin 2012. Elle a port sur une srie conscutive de 73patients victimes dun infarctus crbral ou dun accident ischmique transitoire, document par un scanner crbral. Tous les patients ont bnfici dun cho-Doppler des troncs supra-aortiques, ralis dans le cadre du bilan tiologique. Lexamen a consist en la recherche de plaques dathrome, dune infiltration paritale par la mesure de lpaisseur intima-mdia (EIM), de stnose ou docclusion carotidiennes. Rsultats Il sagissait de 49hommes (67%) et 24femmes (33%), gs en moyenne de 58,711,8ans. Laccident vasculaire tait transitoire chez 11patients (15%) et constitu chez 62 (85%). Les principaux facteurs de risque vasculaires identifis taient une hypertension artrielle connue et traite dans 66cas (90,4%), une dyslipidmie dans 16cas (22%), un diabte sucr dans 9cas (12,3%), et un tabagisme dans 5cas (6,8%), avec un taux de cumul de 2,5facteurs par individu. Lcho-Doppler des troncs supra-aortiques, normal chez 44patients (60,3%) tait pathologique chez les 29autres (39,7%). Les principales anomalies mises en vidence taient une plaque dans 10cas (13,7%), une infiltration paritale dans 19cas (26%) avec une EIM moyenne de 0,860,11mm gauche et 0,830,11mm droite. Deux cas de stnose modre taient nots respectivement sur les carotides internes droite et gauche. Conclusion Cette tude prliminaire confirme lexistence danomalies athromateuses carotidiennes au cours des accidents vasculaires crbraux ischmiques. Ces lsions, quoique non significatives, doivent tre recherches en vue damliorer la prise en charge des patients haut risque vasculaire. SummaryObjective To determine the prevalence of the carotid lesions during ischemic strokes. Methods This was a descriptive cross-sectional study, conducted in Brazzaville from January 2011 to June 2012 in a consecutive series of 73patients, victims of a transient ischemic attack or ischemic stroke, documented by a brain computed tomography. All patients underwent vascular ultrasonography of the supra-aortic trunks, carried out within the framework of etiological assessment. The examination searched for plaques, parietal infiltration (measurement of intima-media thickness), and carotid stenosis or occlusion. Results There were 49 men (67%) and 24 women (33%), mean age 58.711.8years. Eleven patients (15%) had a transient ischemic attack and 62 (85%) an ischemic stroke. The identified independent vascular risk factors were known and treated hypertension (n=66, 90.4%), dyslipidemia (n=16, 22%), diabetes mellitus (n=9, 12.3%), and smoking (n=5, 6.8%), with on average 2.5factors per individual. Vascular ultrasonography of the supra-aortic trunks, normal in 44patients (60.3%) was pathological in the other 29(39.7%). The main anomalies were atheromatous plaque (n=10, 13.7%), parietal infiltration (n=19, 26%). On average intima-media thickness was 0.860.11mm on the left and 0.830.11mm on the right. Two cases of moderate stenosis were noted on the right and left internal carotids, respectively. Conclusion This preliminary study confirms the existence of carotid atherosclerosis anomalies during ischemic strokes. These lesions, though non-significant, must nevertheless be taken into consideration when searching for the cause of stroke in high-risk vascular patients.

S.M. Ikama; B.M. Nsitou; P.M. Ossou-Nguiet; G.F. Otiobanda; E. Matali

2014-01-01T23:59:59.000Z

262

valuation prospective des effets du stage dinitiation pratique sur le recrutement des internes durologie Paris : rsultats dfinitifs  

Science Journals Connector (OSTI)

ResumeObjectifs valuer les effets dun stage dinitiation pratique lurologie sur le recrutement des internes parisiens depuis la mise en place de lExamen National Classant (ENC). Matriels et mthodes Depuis 2004, tous les internes nomms en chirurgie Paris ont particip un stage dinitiation lurologie avant de prendre leur fonction hospitalire. Un questionnaire leur a t remis. Lenqute prospective sest intresse : lge, le sexe, lexistence dun stage durologie pendant lexternat et au souhait dorientation au sein des 11 disciplines chirurgicales. Les internes ont t recontacts annuellement pour connatre lvolution de leur orientation professionnelle. Rsultats Population. Deux cent cinquante cinq internes ont particip dont 145 femmes (56,9%) et 110 hommes (43,1%). Lge moyen tait de 24,6 5 ans (22-31). 173 internes taient issus dun CHU parisien (67,8%) et 82 (32,2%) dun CHU de province. Cinquante deux internes (21,2%) avaient effectu au moins un stage dans un service durologie pendant leur externat. Disciplines chirurgicales. Lorthopdie a t le plus souvent cite (n=48; 28,9%). Lurologie a t choisie par 32 internes (12,5%) qui avaient effectu un stage dexterne dans la spcialit dans 28 cas. la fin du stage, 18 internes taient tents par lurologie. un an, 31 internes134 (91,2%) ont confirm leur choix pour Iurologie. Conclusion La ralisation dun stage pratique intervenant trs tt dans la formation des jeunes chirurgiens est une bonne solution pour les initier a lurologie. En bnficiant dun choix clair, les internes les plus motives sont incits rejoindre volontairement notre discipline. SummaryObjectives To evaluate the effects of a practical introduction to urology session on the recruitment of Parisian interns since introduction of the National Classljjing Examination. Materials and methods Since 2004, all surgery interns appointed in Paris have participated in a practical introduction to urology session before starting work in hospital. They were asked to complete a questionnaire. The prospective survey studied: age, gender, urology training as a medical student and the intern's preferences in relation to 11 surgical specialties. Interns were recontacted annually to determine their choice of specialization. Results Population. 255 interns participated, including 145 females (56.9%) and 110 maies (43.1%). The mean age was 24.6 5 years (range: 22-31). 173 interns were attached to a Parisian teaching hospital (67.8%) and 82 (32.2%) were attached to a provincial teaching hospital. 52 interns (21.2%) had completed at least one attachment in a urology department during their medical training. Surgical specialties. Orthopaedics was most frequently listed (n = 48 ; 28.9%). Urology was chosen by 32 interns (12.5%), 28 of whom had completed an urology attachment during their medical training. At the end of the introductory training sessions, 18 interns were tempted by urology. At one year, 31/34 interns (91.2%) confirmed their choice in favour of urology. Conclusion A practical training sessions very early in the training of young surgeons is a good solution to introduce them to urology. Based on a more informed choice, the most motivated interns are encouraged to preferentially choose this discipline.

Graldine Pignot; Sbastien Beley; Stphane Larr; Francis Dubosq; Ambroise Salin; Baptiste Albouy; Pascal Simon; Emmanuel Rolland; Emmanuel Chartier-Kastler; Franois Richard; Morgan Rouprt

2007-01-01T23:59:59.000Z

263

Motivations et choix des tudiants en mdecine franais souhaitant accomplir une carrire chirurgicale: enqute nationale auprs de 1742externes en DCEM4  

Science Journals Connector (OSTI)

RsumBut de ltude Analyser les souhaits et les motivations professionnelles dun large chantillon dtudiants en mdecine de fin de deuxime cycle pour leur choix de spcialits chirurgicales. Matriel et mthode En dcembre2008, 2588tudiants ont particip un examen blanc national. Avant dobtenir leur rsultat sur Internet, les tudiants taient invits rpondre un questionnaire qui comprenait des questions sociodmographiques, sur le choix de la spcialit et sur la motivation faire carrire dans les spcialits chirurgicales. Les trois principaux facteurs de motivation conduisant ce choix devaient tre prciss parmi une liste de 11items. Rsultats Les tudiants provenaient de 39facults de mdecine. Parmi eux, 1742 (67%) ont rpondu au questionnaire. Mille quatre-vingt-sept tudiants taient de sexe fminin (62%). Deux cent vingt tudiants navaient pas donn dorientation professionnelle (13%) et parmi les 1522rponses disponibles, 522tudiants (34%) voulaient sorienter vers la chirurgie. Le sexe influenait ce choix: 44% des tudiants masculins (n=252) voulaient devenir chirurgiens contre 29% des tudiantes (n=270); p<0,0001. Les trois spcialits les plus prises taient la gyncologie (n=137), lorthopdie (n=91) et lophtalmologie (n=57). Le sexe influenait lactivit: 82% des futurs gyncologues taient des femmes alors que 73% des futurs urologues taient des hommes; p<0,0001. Lintrt des pathologies (n=356, 23%), la possibilit dun exercice libral (n=280, 18%) et la qualit de vie (n=175, 11%) taient les motivations le plus souvent voques pour justifier le choix. Conclusion Un tiers des tudiants en mdecine souhaitent devenir chirurgiens. La fminisation, la qualit de vie, les revenus sont les principaux facteurs qui influencent le type de spcialisation chirurgicale. SummaryStudy goal To analyze the desires and professional motivations of a large sample of final-year medical students regarding their choice to pursue training in surgical specialties. Material and methods In December2008, 2588medical students participated in the National Medical Examination; when the students sought to access examination results on the Internet, they were invited to respond to a questionnaire regarding sociodemographic information, their choice of specialization, and their motivations for choosing a career in surgery. They were asked to rank the three most important motivating factors from a list of 11possible choices. Results The 2588examinees were drawn from 39French medical schools; 1742 (67%) responded to the questionnaire. Sixty-two percent were female. Two hundred and twenty students (13%) had not yet chosen a career path. Of the remaining 1522students, 522 (34%) were oriented toward surgery. Gender was an important factor: 44% of male students (n=252) and only 29% of female students (n=270) (p<0.0001) elected surgery. The three preferred surgical sub-specialties were gynecology (n=137), orthopedics (n=91), and ophthalmology (n=57). Gender also influenced the choice of sub-specialty focus: 82% of future gynecologists were female while 73% of future urologists were male (p<0.0001). Interest in specific diseases (23%, n=356), the possibility of private practice (18%, n=280), and quality of life (11%, n=175) were the most frequent factors evoked for a particular choice. Conclusion A third of medical students wish to pursue a surgical career. Feminine gender, quality of life, and anticipated remuneration are the principal factors, which influence the choice of surgical sub-specialization.

J.-H. Lefvre; L. Karila; S. Kerneis; M. Rouprt

2010-01-01T23:59:59.000Z