Powered by Deep Web Technologies
Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Monitoring- Based Commissioning with Advanced EMIS Analysis  

E-Print Network [OSTI]

?EMIS ? The?cornerstone?of?MBCx?is?a?comprehensive? Energy?Management?Information?System?(EMIS) An?EMIS?is?an?analytical?engine?with?capabilities?above?and? beyond?that?of?a?BAS.??Capabilities?include?up?to: ? Utility?cost?and?billing?analysis ? Enhanced...

Ratkovich, B.

2013-01-01T23:59:59.000Z

2

Electromagnetic Interference (EMI) Shielding of Single-Walled Carbon  

E-Print Network [OSTI]

Electromagnetic Interference (EMI) Shielding of Single-Walled Carbon Nanotube Epoxy Composites Ning (SWNT)-polymer composites have been fabricated to evaluate the electromagnetic interference (EMI

Gao, Hongjun

3

Sion Power Corp formerly Moltech Corp | Open Energy Information  

Open Energy Info (EERE)

Sion Power Corp formerly Moltech Corp Sion Power Corp formerly Moltech Corp Jump to: navigation, search Name Sion Power Corp (formerly Moltech Corp) Place Tucson, Arizona Zip AZ 85756 Sector Vehicles Product Tucson, Arizona-based privately held developer of thin-film lithium-sulfur rechargeable batteries for propelling vehicles and other high energy-density applications. Coordinates 32.221553°, -110.969754° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.221553,"lon":-110.969754,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

4

Bons Ventos Geradora de Energia S A | Open Energy Information  

Open Energy Info (EERE)

Bons Ventos Geradora de Energia S A Bons Ventos Geradora de Energia S A Jump to: navigation, search Name Bons Ventos Geradora de Energia S.A. Place Fortaleza, Ceara, Brazil Sector Wind energy Product Brazilian-based wind project developer, subsidiary of Grupo Servtec. Coordinates -3.718404°, -38.542924° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-3.718404,"lon":-38.542924,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

5

Electromagnetic Isotope Separation Lab (EMIS) | ORNL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electromagnetic Isotope Separation Lab Electromagnetic Isotope Separation Lab May 30, 2013 ORNL established the Stable Isotope Enrichment Laboratory (SIEL) as part of a project funded by the DOE Office of Science, Nuclear Physics Program to develop a modernized electromagnetic isotope separator (EMIS), optimized for separation of a wide range of stable isotopes. The SIEL is located in the Building 6010 Shield Test Station, space formerly allocated to the Oak Ridge Electron Linear Accelerator, on the main campus of ORNL. ORNL staff have designed and built a nominal 10 mA ion current EMIS (sum of all isotopes at the collector) in the SIEL. This EMIS is currently being tested to determine basic performance metrics such as throughput and enrichment factor per pass. This EMIS unit and space will be used to

6

Energy Management Inc EMI | Open Energy Information  

Open Energy Info (EERE)

EMI EMI Jump to: navigation, search Name Energy Management Inc (EMI) Place Boston, Massachusetts Zip 21160 Sector Wind energy Product Independent project developer and parent of Cape Wind Associates, which is developing the 468MW wind project proposed for the waters off Massachusetts. Coordinates 42.358635°, -71.056699° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.358635,"lon":-71.056699,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

7

FRm : John A. Deny, DitiSion Of  

Office of Legacy Management (LM)

to : lieads of Divisions am3 Man DAW.: December 6, 1954 to : lieads of Divisions am3 Man DAW.: December 6, 1954 FRm : John A. Deny, DitiSion Of SPNBOL : csm-R:AcB The attached tabulation of active AEC contracts over $l,ooO,Mx) haa been ,xepared as a result of recurring requests fcr infmmatirm cm ow larger contracts. It consists ox- Pa-t I - E+ime contracts and Pert II - Sub- ccdxacts, and lists the contracts alphabetically bq Operations Office to shar; (1) tne of work being prformed by the contractcr; (2) contract rmter; (3).ac&ated dollar obligation; (4) tspe of contract, i.e., cost m or fixed ,rlce; ad, (5) the est+ted completion date. 1. Arcbitict-Engineer (AE) 2. DnSita constnlctfon 3. Research and Dewlopnent (R&D) 4. Haterids, Supplies and EquiFment for Constructian (=---.) 5. Materials, supplies and Equippent, other @e&other)

8

Bon Homme County, South Dakota: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Bon Homme County, South Dakota: Energy Resources Bon Homme County, South Dakota: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.9814835°, -97.87216° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.9814835,"lon":-97.87216,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

9

Bon Homme Yankton El Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Yankton El Assn, Inc Yankton El Assn, Inc Jump to: navigation, search Name Bon Homme Yankton El Assn, Inc Place South Dakota Utility Id 1898 Utility Location Yes Ownership C NERC Location MRO Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Coincidental Peak Billing Industrial Demand & Energy Billing 75-350 kva Commercial Farm Single-Phase Residential Interruptible Commercial Irrigation Single-Phase Uncontrolled Industrial Irrigation, Off Season Industrial Irrigation, Single-Phase Controlled Industrial Irrigation, Single-Phase Controlled Pivot Energy Only Commercial

10

Experiences with Software Quality Metrics in the EMI middlewate  

E-Print Network [OSTI]

The EMI Quality Model has been created to define, and later review, the EMI (European Middleware Initiative) software product and process quality. A quality model is based on a set of software quality metrics and helps to set clear and measurable quality goals for software products and processes. The EMI Quality Model follows the ISO/IEC 9126 Software Engineering Product Quality to identify a set of characteristics that need to be present in the EMI software. For each software characteristic, such as portability, maintainability, compliance, etc, a set of associated metrics and KPIs (Key Performance Indicators) are identified. This article presents how the EMI Quality Model and the EMI Metrics have been defined in the context of the software quality assurance activities carried out in EMI. It also describes the measurement plan and presents some of the metrics reports that have been produced for the EMI releases and updates. It also covers which tools and techniques can be used by any software project to ...

Alandes, M; Meneses, D; Pucciani, G

2012-01-01T23:59:59.000Z

11

Electromagnetic Interference (EMI) Resisting Analog Integrated Circuit Design Tutorial  

E-Print Network [OSTI]

ELECTROMAGNETIC INTERFERENCE (EMI) RESISTING ANALOG INTEGRATED CIRCUIT DESIGN TUTORIAL A Thesis by JINGJING YU Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE August 2012 Major Subject: Electrical Engineering ELECTROMAGNETIC INTERFERENCE (EMI) RESISTING ANALOG INTEGRATED CIRCUIT DESIGN TUTORIAL A Thesis by JINGJING YU Submitted to the Office...

Yu, Jingjing

2012-10-19T23:59:59.000Z

12

Calculation of Conducted EMI Generated by Single-Ended Primary Inductance Converter  

E-Print Network [OSTI]

electromagnetic interference (EMI) to measurement results. Copyright © 2012 Praise Worthy Prize S.r.l. - All rights reserved Keywords: electromagnetic interference (EMI), emission, frequency domain analysis

Paris-Sud XI, Université de

13

Resolving EMI Issues To Optimize Accelerator Beam Diagnostic Performance  

SciTech Connect (OSTI)

If you have struggled to get the last bit of performance from a beam diagnostic only to find your dynamic range limited by external sources of electromagnetic interference (EMI) once the system is installed, then you will find this tutorial on electromagnetic compatibility and grounding useful. The tutorial will provide some simple, direct methods to analyze, understand and mitigate the impact of EMI on beam diagnostic systems. Several common and unique accelerator EMI sources will be characterized. The dependencies of source frequency and distance to the source on the optimal choice of grounding and shielding methods will be illustrated. The emphasis is on a stepwise process that leads to understanding and cost-effective resolution of EMI impacts on beam diagnostic systems.

Thuot, Michael [Los Alamos National Laboratory, LANSCE Division, Los Alamos, New Mexico (United States)

2004-11-10T23:59:59.000Z

14

IEEE TRANSACTIONS ON ELECTROMAGNETIC COMPATIBILITY, VOL. 44, NO. 4, NOVEMBER 2002 495 A New Nonlinear Model of EMI-Induced  

E-Print Network [OSTI]

predictions. Index Terms--Demodulation, electromagnetic compatibility (EMC), electromagnetic interference (EMI are useful in the sizing of electromagnetic interference (EMI) filtering structures. Usually, RFI distortion

15

1560 IEEE TRANSACTIONS ON POWER ELECTRONICS, VOL. 22, NO. 4, JULY 2007 An EMI Reduction Technique for Digitally Controlled SMPS  

E-Print Network [OSTI]

spectrum technique and system for re- ducing average electromagnetic interference (EMI) in low blocks causes signif- icant electromagnetic interference (EMI) problems, despite the relatively low

Prodiæ, Aleksandar

16

Custom Spectral Shaping for EMI Reduction in Electronic Ballasts  

E-Print Network [OSTI]

modulating waveforms, for custom spectral shaping of the fundamental harmonic of electronic ballastsCustom Spectral Shaping for EMI Reduction in Electronic Ballasts Sandra Johnson, Yan Yin, Regan Zane Colorado Power Electronics Center University of Colorado at Boulder Boulder, Colorado 80309

17

A new approach to modelling the impact of EMI on MOSFET DC behaviour R. Fernndez-Garca, 1  

E-Print Network [OSTI]

the DC MOSFET behaviour under electromagnetic interference (EMI) is presented. The model is able-power law directly applied to a MOSFET under EMI impact. KEYWORDS: MOSFET, Electromagnetic Interference (EMI: Electronic systems are disturbed by electromagnetic interference (EMI) which can potentially disrupt

Paris-Sud XI, Université de

18

Disruption of Particle Detector Electronics by Beam Generated EMI  

SciTech Connect (OSTI)

The possibility that radio frequency beam generated electromagnetic interference (EMI) could disrupt the operation of particle detector electronics has been of some concern since the inception of short pulse electron colliders more than 30 years ago [1]. Some instances have been reported where this may have occurred but convincing evidence has not been available. This possibility is of concern for the International Linear Collider (ILC). We have conducted test beam studies demonstrating that electronics disruption does occur using the vertex detector electronics (VXD) from the SLD detector which took data at the SLC at SLAC. We present the results of those tests, and we describe the need for EMI standards for beam and detector instrumentation in the IR region at the ILC.

Bower, G.; /SLAC; Sugimoto, Y.; /KEK, Tsukuba; Sinev, N.; /Oregon U.; Arnold, R.; Woods, M.; /SLAC

2007-06-27T23:59:59.000Z

19

SIGNATURE OF THIS CO U A RECORD OF THIS DEC SION. NEPA Compliance Officer Signature:  

Broader source: Energy.gov (indexed) [DOE]

THIS THIS CO U A RECORD OF THIS DEC SION. NEPA Compliance Officer Signature: .PA Compliance Officer Page 1 of 1 PINC-5.F2. t1.01A11) U.S. DEPARMENT OF ENERGY FERE PROJECT MANAGEMENT CENTER NEPA DETERI\ ITNATION RECIPIENT:The University of Texas at Austin STATE: TX PROJECT Techno-economic Modeling of the Integration of 20% Wind and Large-scale energy storage in ERCOT TITLE : by 2030 Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-PS36-09G099009 DE -EE0001 385 GF0-1 0-026 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including

20

Parasitic Effects of Grounding Paths on Common-Mode EMI Filter's Performance in Power Electronics Systems  

SciTech Connect (OSTI)

High-frequency common-mode (CM) electromagnetic-interference (EMI) noise is difficult to suppress in electronics systems. EMI filters are used to suppress CM noise, but their performance is greatly affected by the parasitic effects of the grounding paths. In this paper, the parasitic effects of the grounding paths on an EMI filter's performance are investigated in a motor-drive system. The effects of the mutual inductance between two grounding paths are explored. Guidelines for the grounding of CM EMI filters are derived. Simulations and experiments are finally carried out to verify the theoretical analysis.

Wang, Shuo [ORNL; Maillet, Yoann [Virginia Polytechnic Institute and State University (Virginia Tech); Wang, Fei [ORNL; Lai, Rixin [General Electric; Luo, Fang [Virginia Polytechnic Institute and State University (Virginia Tech); Boroyevich, Dushan [Virginia Polytechnic Institute and State University (Virginia Tech)

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Finding Source of Electromagnetic Interference (EMI) to GPS Using a Network Sensors  

E-Print Network [OSTI]

Finding Source of Electromagnetic Interference (EMI) to GPS Using a Network Sensors Shau-Shiun Jan, Per Enge Department of Aeronautics and Astronautics Stanford University ABSTRACT Any electromagnetic interference (EMI) to GPS must invoke a fast location and removal response, because of the high military

Stanford University

22

Survival of the western pond turtle (Emys marmorata) in an urban California environment  

E-Print Network [OSTI]

Survival of the western pond turtle (Emys marmorata) in an urban California environment Phillip Q, 2320 Storer Hall, University of California, Davis, CA 95616, USA b Turtle Bay Museum and Arboretum; accepted 9 November 2002 Abstract The western pond turtle Emys (formerly Clemmys) marmorata is declining

Grether, Gregory

23

Microsoft PowerPoint - UTSRWorkshop-Oct2010-Bons.pptx  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS FOR DEPOSITION RESISTANCE WITH 1400C COMBUSTOR EXIT TEMPERATURES AND SYNGAS WATER VAPOR LEVELS Ch i S ith B tt B k P h th Sh k Chris Smith, Brett Barker, Prashanth Shankaran Josh Webb, Brian Casaday Dr. Ali Ameri, Dr. Jeffrey Bons "THE" OHIO STATE UNIVERSITY THE OHIO STATE UNIVERSITY Robert Laycock, Dr. Thomas Fletcher "THE" BRIGHAM YOUNG UNIVERSITY "THE" BRIGHAM YOUNG UNIVERSITY (3-year grant awarded Oct 2009) 1 MOTIVATION/NEED * Operational Issues -Fuel flexibility (range of feedstock heat release) y ( g ) -Diluent use (e.g. steam) -Filtration requirements * Technical Challenges - Higher firing temperature I d h t t f ( t dil t) - Increased heat transfer (steam diluent) - Potential for increased levels of airborne contaminants

24

IINDIX IYSTIMS DIVISION ANN ARIOR, MICH. NO. EMI Protection De sign Guideline  

E-Print Network [OSTI]

been prepared as a guide for use by ALSEP experiment fabrication and subsystem designers. Prepared by the elimination of any harmful EMI. As a guide for achieving this inter- ference free design, the ALSEP program, shall be an integral part of the system or component. The most important aspects of design

Rathbun, Julie A.

25

iGrace emotional computational model for EmI companion robot.  

E-Print Network [OSTI]

0 iGrace ­ emotional computational model for EmI companion robot. S´ebastien Saint. Introduction A new challenge in Robotics is to create systems capable of behaviour enhancement due modality in human communication. Robotherapy, a field in robotics, attempts to apply the principles

Paris-Sud XI, Université de

26

EMI, TWA 800 and Swissair 111 Peter B. Ladkin and Willi Schepper  

E-Print Network [OSTI]

in an older aircraft. 1 #12; aircraft wiring, and electromagnetic interference issues. Section 4 refutes should be more thoroughly investigated than it has been. In particular, she suspects electromagnetic interference (EMI) with aircraft electrical systems from high- intensity radiation #12;elds (HIRF), which we

Ladkin, Peter B.

27

EMI, TWA 800 and Swissair 111 Peter B. Ladkin and Willi Schepper  

E-Print Network [OSTI]

in an older aircraft. 1 #12;aircraft wiring, and electromagnetic interference issues. Section 4 refutes should be more thoroughly investigated than it has been. In particular, she suspects electromagnetic interference (EMI) with aircraft electrical systems from high- intensity radiation fields (HIRF), which we

Ladkin, Peter B.

28

EMI-INDUCED FAILURES IN PWM CONTROLLERS FOR SMPS Franco Fiori  

E-Print Network [OSTI]

increased environmental electromagnetic pollution. On the other hand, the continuous demand of low power years the research activities have been focused on the design of elementary building blocks and system polluted environment. In the following sections, the main phenomena induced by EMI in last generation smart

29

EnvironMEntAl chEMiStry College of Natural Science and Mathematics  

E-Print Network [OSTI]

) aqueous/ environmental geochemistry, and (iii) environmental toxicology and contaminant fate. Students mayEnvironMEntAl chEMiStry College of Natural Science and Mathematics Department of Chemistry; PhD: 32 credits Environmental chemistry focuses on the chemical processes influencing the composition

Hartman, Chris

30

Overexpression of wild-type PKD2 leads to increased proliferation and invasion of BON endocrine cells  

SciTech Connect (OSTI)

Carcinoid tumors are rare neuroendocrine tumors with a predilection for the gastrointestinal tract. Protein kinase D (PKD), a novel serine/threonine protein kinase, has been implicated in the regulation of transport processes in certain cell types. We have reported an important role for PKD in stimulated peptide secretion from a human (BON) carcinoid cell line; however, the role of PKD isoforms, including PKD2, in the proliferation and invasion of carcinoid tumors remains unclear. In the present study, we found that overexpression of PKD2 by stable transfection of BON cells with PKD2-wild type (PKD2{sub WT}) significantly increased proliferation and invasion compared to cells transfected with PKD2-kinase dead (PKD2{sub KD}) or pcDNA3 (control). Similarly, inhibition of PKD2 activity with small interfering RNA (siRNA) significantly decreased proliferation and invasion compared to cells transfected with non-targeting control (NTC) siRNA. These data support an important role for PKD2 in carcinoid tumor progression. Targeted inhibition of the PKD family may prove to be a novel treatment option for patients with carcinoid tumors.

Jackson, Lindsey N. [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Li Jing [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX (United States); Chen, L. Andy [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Townsend, Courtney M. [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Evers, B. Mark [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States) and Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX (United States)]. E-mail: mevers@utmb.edu

2006-09-29T23:59:59.000Z

31

rillEdge is a software system that provides real-time deci-sion support when drilling oil wells. Decisions are sup-  

E-Print Network [OSTI]

D rillEdge is a software system that provides real-time deci- sion support when drilling oil wells developed DrillEdge to reduce the cost and decrease the probability of fail- ures in oil well drilling. Currently, DrillEdge continuously mon- itors around 30 oil well drilling operations in parallel for sever

Aamodt, Agnar

32

THE WIRED SURVEY. IV. NEW DUST DISKS FROM THE McCOOK and SION WHITE DWARF CATALOG  

SciTech Connect (OSTI)

We have compiled photometric data from the Wide-field Infrared Survey Explorer All Sky Survey and other archival sources for the more than 2200 objects in the original McCook and Sion Catalog of Spectroscopically Identified White Dwarfs. We applied color-selection criteria to identify 28 targets whose infrared spectral energy distributions depart from the expectation for the white dwarf (WD) photosphere alone. Seven of these are previously known WDs with circumstellar dust disks, five are known central stars of planetary nebulae, and six were excluded for being known binaries or having possible contamination of their infrared photometry. We fit WD models to the spectral energy distributions of the remaining ten targets, and find seven new candidates with infrared excess suggesting the presence of a circumstellar dust disk. We compare the model dust disk properties for these new candidates with a comprehensive compilation of previously published parameters for known WDs with dust disks. It is possible that the current census of WDs with dust disks that produce an excess detectable at K-band and shorter wavelengths is close to complete for the entire sample of known WDs to the detection limits of existing near-IR all-sky surveys. The WD dust disk candidates now being found using longer wavelength infrared data are drawn from a previously underrepresented region of parameter space, in which the dust disks are overall cooler, narrower in radial extent, and/or contain fewer emitting grains.

Hoard, D. W.; Wachter, Stefanie [Max Planck Institut fuer Astronomie, D-69117 Heidelberg (Germany); Debes, John H. [Space Telescope Science Institute, Baltimore, MD 21218 (United States); Leisawitz, David T. [Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Cohen, Martin, E-mail: hoard@mpia.de [Monterey Institute for Research in Astronomy, Marina, CA 93933 (United States)

2013-06-10T23:59:59.000Z

33

EMI-and Energy-Aware Scheduling of Switching Power Supplies in Hard Real-Time Embedded Systems  

E-Print Network [OSTI]

without it affecting circuits sensitive to electromagnetic interference (EMI) such as high-impedance input periods of time indicate electromagnetic interference or power supply fluctuations, caused by the op

Dean, Alexander G.

34

Vehicle Technologies Office Merit Review 2014: High Efficiency, Low EMI and Positioning Tolerant Wireless Charging of EVs  

Broader source: Energy.gov [DOE]

Presentation given by Hyundai at 2014 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Office Annual Merit Review and Peer Evaluation Meeting about high efficiency, low EMI and...

35

EMI shield enhancement through the addition of copper coated glass fibers  

E-Print Network [OSTI]

E. , University of Wisconsin-Madison Chair of Committee: Dr. G. W. Halldin This research investigated the feasibility of using copper coated glass fibers to increase the EMI shielding characteristics of vinyl ester thermosetting resin. The fibers were coated... 35 36 37 41 41 48 55 57 58 58 58 58 60 61 62 62 62 Plate Times. Surface Area Analysis Scanning Electron Microscopy. MOLDED COMPOSITE MATERIALS. Resin. Sample Preparation. Evaluation. Scanning Electron Microscopy Flexural...

Montanye, Jeffrey Richard

1988-01-01T23:59:59.000Z

36

EMI (electromagnetic interference) potential of proposed 115KV line near B-691  

SciTech Connect (OSTI)

The Laser Operated Diamond Turning Machine (LODTM) is housed in Building 691. This facility contains electronic measurement and control systems which could be susceptible to interfering electromagnetic interference (EMI) generated by sources external to B-691. In particular, concern has been expressed that such harmful EMI signals could be produced by the proposed WAPA 115KV feeder line which would be routed approximately 30 feet from the East side of the facility. Also, there has been some concern expressed about the effects of the resulting electromagnetic (EM) fields on personnel in the proximity of the power line. Since it is necessary to measure the EM fields to ascertain if a hazard does indeed exist, and since we in ERD have been performing such field measurements for many years, we were contacted to determine the field levels from the line that might be expected inside and close to B-691. This report describes our approach, equipment and calibration procedures, analysis techniques used, results, and suggestions for future work in related areas. 9 refs., 41 figs.

Latorre, V.R.; Wythe, D.M.

1989-07-27T23:59:59.000Z

37

IEEE TRANSACTIONS ON ELECTROMAGNETIC COMPATIBILITY, VOL. 42, NO. 1, FEBRUARY 2000 97 Nonlinear EMI Simulation of an AM Detector at the  

E-Print Network [OSTI]

compatibility and electromagnetic interference (EMC/EMI) simula- tion up to the baseband signal processing path with mea- surements and PSPICE simulation data. Index Terms--AM detector, electromagnetic interference and electromagnetic interference (EMC/EMI) effects on radio systems is increasing significantly. The extensive growth

Loyka, Sergey

38

A Comparison of Software-Based Techniques Intended to Increase the Reliability of Embedded Applications in the Presence of EMI  

E-Print Network [OSTI]

system has been shown to be a common failure mode in the presence of electromagnetic interference Corruption, Electromagnetic Interference, Function Token, NOP Fill #12;2 1. Introduction Recent economic are concerned with the influence of electromagnetic interference (EMI) on embedded automotive applications

Pont, Michael J.

39

HOME RANGE SIZE, MOVEMENT AND HABITAT USE FOR A POPULATION OF BLANDING'S TURTLES (EMYS BLANDINGII) IN THE UPPER MISSISSIPPI  

E-Print Network [OSTI]

HOME RANGE SIZE, MOVEMENT AND HABITAT USE FOR A POPULATION OF BLANDING'S TURTLES (EMYS BLANDINGII TABLE OF CONTENTS LIST OF FIGURES iii LIST OF TABLES iv HOME RANGE SIZE, MOVEMENT AND HABITAT USE. HOME RANGE AND HABITAT COMPOSITION MAPS FOR ALL 17 RADIO-TRACKED TURTLES IN THE UPPER MISSISSIPPI RIVER

Janzen, Fredric

40

EMI/RFI and Power Surge Withstand Guidance for the U.S. Nuclear Regulatory Commission  

SciTech Connect (OSTI)

This paper discusses the regulatory guidance implemented by U.S. NRC for minimizing malfunctions and upsets in safety-related instrumentation and control (I and C) systems in nuclear power plants caused by electromagnetic interference (EMI), radio-frequency interference (RFI), and power surges. The engineering design, installation, and testing practices deemed acceptable to U.S. NRC are described in Regulatory Guide (RG) 1.180, ''Guidelines for Evaluating Electromagnetic and Radio-Frequency in Safety-Related Instrumentation and Control Systems'' (January 2000) and in a Safety Evaluation Report (SER) endorsing EPRI TR-102323, ''Guidelines for Electromagnetic Interference Testing in Power Plants,'' (April 1996). These engineering practices provide a well-established, systematic approach for ensuring electromagnetic compatibility (EMC) and surge withstand capability (SWC).

Ewing, PD

2001-09-07T23:59:59.000Z

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Use of SiBN and SiBON films prepared by plasma enhanced chemical vapor deposition from borazine as interconnection dielectrics  

SciTech Connect (OSTI)

Thin films of silicon boron nitride (SiBN) of typical composition Si{sub 0.09}B{sub 0.39}N{sub 0.51} and silicon boron oxynitride (SiBON) of typical composition Si{sub 0.16}B{sub 0.29}O{sub 0.41}N{sub 0.14} were prepared by plasma enhanced chemical vapor deposition and the properties of these films were evaluated with respect to their suitability as interconnection dielectrics in microelectronic fabrication. Films were deposited on 125 mm silicon substrates in a parallel-plate reactor at a substrate temperature of 400 C and a plasma power of 0.5 W/cm{sup 2}. Boron nitride, for comparison of electrical properties, was deposited from borazine (B{sub 3}N{sub 3}H{sub 6}); silicon boron nitride was deposited from borazine, disilane (Si{sub 2}H{sub 6}), and ammonia (NH{sub 3}); silicon boron oxynitride was deposited from borazine, disilane, ammonia, and nitrous oxide (N{sub 2}O). Metal-insulator-metal capacitors were fabricated and electrical measurements indicated that all three films had excellent dielectric properties with dielectric constants of 4.1, 4.7, and 3.9 for BN, SiBN, and SiBON, respectively. Tests of conformality indicated that deposition into trenches with an aspect ratio of 4:1 gave conformality greater than 70%. Silicon boron oxynitride was shown to be an excellent barrier to the diffusion of copper. A planar, single level metal-insulator structure was constructed using a SiBN/SiBON insulator with copper metallization.

Kane, W.F.; Cohen, S.A.; Hummel, J.P.; Luther, B. [IBM Research Div., Yorktown Heights, NY (United States). T.J. Watson Research Center; Beach, D.B. [Oak Ridge National Lab., TN (United States). Chemical and Analytical Sciences Div.

1997-02-01T23:59:59.000Z

42

College of AgriCulturAl SCienCeS AgriCulturAl reSeArCh And CooperAtive extenSion Access and AllocAtion of  

E-Print Network [OSTI]

College of AgriCulturAl SCienCeS · AgriCulturAl reSeArCh And CooperAtive extenSion Access and Alloc- gation, recreation, and hydro- electric power generation, do not involve withdrawing water from its level of government is best suited to regulate water use. Predictions that climate change will influence

Boyer, Elizabeth W.

43

The Copper Sulfide Coating on Polyacrylonitrile with Chelating Agents by an Electroless Deposition Method and its EMI Shielding Effectiveness  

SciTech Connect (OSTI)

In this study, a variety of concentrations of chelating agents were added to obtain the anchoring effect and chelating effect in the electroless plating bath. The mechanism of the Cu{sub x(x=1,2)}S growth and the electromagnetic interference shielding effectiveness (EMI SE) of the composite were studied. It was found that the vinyl acetate residued in PAN substrate would be purged due to the swelling effect by chelating agents solution. And then, the anchoring effect occurred due to the hydrogen bonding between the pits of PAN substrate and the chelating agent. Consequently, the copper sulfide layer deposited by the electroless plating reaction with EDTA and TEA. The swelling degree (S{sub d}) was proposed and evaluated from the FT-IR spectra. The relationship between swelling degree of the PAN films and EDTA (C) is expressed as: S{sub d} = 0.13+0.90xe and (-15.15C). And TEA series is expressed as: S{sub d} = 0.07+1.00xe and (-15.15C). On the other hand, the FESEM micrograph showed that the average thickness of copper sulfide increased from 76 nm to 383 nm when the concentration of EDTA increased from 0.00M to 0.20M. Consequently, the EMI SE of the composites increased from 10{approx}12 dB to 25{approx}27 dB. The GIA-XRD analyze indicated that the deposited layer consisted of CuS and Cu{sub 2}S.

Roan, M.-L. [Department of Electro-optical Engineering, Lan-Yan Institute of Technology, Taiwan (China); Chen, Y.-H.; Huang, C.-Y. [Department of Materials Engineering, Tatung University, Taiwan (China)

2008-08-28T23:59:59.000Z

44

Combining VisNIR hyperspectral imagery and legacy measured soil profiles to map subsurface soil properties in a Mediterranean area (Cap-Bon, Tunisia)  

Science Journals Connector (OSTI)

Abstract Previous studies have demonstrated that Visible Near InfraRed (VisNIR) hyperspectral imagery is a cost-efficient way to map soil properties at fine resolutions (~5m) over large areas. However, such mapping is only feasible for the soil surface because the effective penetration depths of optical sensors do not exceed several millimeters. This study aims to determine how VisNIR hyperspectral imagery can serve to map the subsurface properties at four depth intervals (1530cm, 3060cm, 60100cm and 30100cm) when used with legacy soil profiles and images of parameters derived from digital elevation model (DEM). Two types of surfacesubsurface functions, namely linear models and random forests, that estimate subsurface property values from surface values and landscape covariates were first calibrated over the set of legacy measured profiles. These functions were then applied to map the soil properties using the hyperspectral-derived digital surface soil property maps and the images of landscape covariates as input. Error propagation was addressed using a Monte Carlo approach to estimate the mapping uncertainties. The study was conducted in a pedologically contrasted 300km2-cultivated area located in the Cap Bon region (Northern Tunisia) and tested on three soil surface properties (clay and sand contents and cation exchange capacity). The main results were as follows: i) fairly satisfactory (cross-validation R2 between 0.55 and 0.81) surfacesubsurface functions were obtained for predicting the soil properties at 1530cm and 3060cm, whereas predictions at 60100cm were less accurate (R2 between 0.38 and 0.43); ii) linear models outperformed random-forest models in developing surfacesubsurface functions; iii) due to the error propagations, the final predicted maps of the subsurface soil properties captured from 1/3 to 2/3 of the total variance with a significantly decreasing performance with depth; and iv) these maps brought significant improvements over the existing soil maps of the region and showed soil patterns that largely agreed with the local pedological knowledge. This paper demonstrates the added value of combining modern remote sensing techniques with old legacy soil databases.

Philippe Lagacherie; Anne-Ruth Sneep; Ccile Gomez; Sinan Bacha; Guillaume Coulouma; Mohamed Hdi Hamrouni; Insaf Mekki

2013-01-01T23:59:59.000Z

45

Field application of EMI coatings investigation of coating materials and stylus electroplating protocols for shielded facilities. Final report  

SciTech Connect (OSTI)

To maintain reliable electromagnetic interference (EMI) shielding for electronic equipment shelter interfaces, mating surfaces such as doors and interfaces must provide low contact resistances and be resistant to excessive amounts of corrosion and mechanical wear that would tend to degrade their shielding integrity. The objective of this research was to establish the efficacy of stylus electroplating as a potentially viable field maintenance/repair technique for application of corrosion resistant, wear resistant coatings in order to help maintain the shielding integrity of those interfaces. Aluminum alloy (6061-T6) knife-edge and channel test pieces were stylus electroplated with tin or tin-lead coatings with nickel or copper underlayers. A custom-designed electroplating tool developed for electroplating the complex geometry of a knife-edge substrate appears to provide better control of the plating process and circumvents possible interference with previously deposited areas. This research has resulted in an optimized procedure for producing coatings that exhibit greater adherence, better uniformity, less scarring, and fewer blisters and ridges compared to those previously reported. An optimum electroplating strategy is suggested, which includes applying tin or tin-lead top layers over a thick layer of copper and a thin nickel strike.

Stephenson, L.D.; Donoho, L.H.

1996-03-01T23:59:59.000Z

46

E:\\PUBLAW\\PUBL058.109  

Broader source: Energy.gov (indexed) [DOE]

tees for the following gasification projects: (1) INTEGRATED GASIFICATION COMBINED CYCLE PROJECTS.- Integrated gasification combined cycle plants meeting the emis- sion levels...

47

Tropical biomass burning smoke plume size, shape, reflectance, and age based on 2001??2009 MISR imagery of Borneo  

E-Print Network [OSTI]

C. S. Zender et al. : Tropical biomass burning smoke plumeslaboratory measurements of biomass-burning emis- sions: 1.aerosol optical depth biomass burning events: a comparison

Zender, C. S; Krolewski, A. G; Tosca, M. G; Randerson, J. T

2012-01-01T23:59:59.000Z

48

(This is a sample cover image for this issue. The actual cover is not yet available at this time.) This article appeared in a journal published by Elsevier. The attached  

E-Print Network [OSTI]

Elsevier B.V. All rights reserved. 1. Introduction Roads have varied ecological impacts on the adjacent, roadside maintenance, and vehicle emis- sions (Forman, 2000; Lee e

Neher, Deborah A.

49

Reactive nitrogen, ozone and ozone production in the Arctic troposphere and the impact of stratosphere-troposphere exchange  

E-Print Network [OSTI]

CO for combustion plumes, acetonitrile (CH 3 CN) for biomassand biomass burning emis- sions (Fig. 4 and Table 3a). Combustion

2011-01-01T23:59:59.000Z

50

EMI and Charger procedure  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

0 0 Revision 3 Effective February 1, 2008 Measurement and Evaluation of Electric Vehicle Battery Charger Performance Prepared by Electric Transportation Applications Prepared by: _______________________________ Date:__________ Nick Fengler Approved by: ______________________________________________ Date: _______________ Donald B. Karner ETA-NTP010 Revision 3 2 TABLE OF CONTENTS 1.0 Objective 3 2.0 Purpose 3 3.0 Documentation 3 4.0 Prerequisites 3 5.0 Charger Operation 4 6.0 Battery Charger Evaluation 7 7.0 Out Of Service Endurance 8 8.0 Charging Efficiency 8 9.0 Glossary 9

51

EMI and Charger procedure  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 5 Revision 1 Effective June 2008 Battery Charger Performance Prepared by Electric Transportation Applications Prepared by: _______________________________ Date:__________ Garrett P. Beauregard Approved by: ______________________________________________ Date: _______________ Donald B. Karner ETA-GTP005 Revision 1 2 Table of Contents 1 Objective ................................................................................................................................. 3 2 Purpose.................................................................................................................................... 3 3 Documentation........................................................................................................................

52

Atmos. Chem. Phys., 8, 54895520, 2008 www.atmos-chem-phys.net/8/5489/2008/  

E-Print Network [OSTI]

, fertilizer applications, biomass burning, motor vehicle emis- sions, and coal combustion (Apsimon et al. This work is distributed under the Creative Commons Attribution 3.0 License. Atmospheric Chemistry

Meskhidze, Nicholas

53

Atmos. Chem. Phys., 8, 61556168, 2008 www.atmos-chem-phys.net/8/6155/2008/  

E-Print Network [OSTI]

typical coal-combustion pollution to a complex mixture of domestic, industrial and traffic emis- sions. This work is distributed under the Creative Commons Attribution 3.0 License. Atmospheric Chemistry

Meskhidze, Nicholas

54

Journal of Hazardous Materials A135 (2006) 2131 Leaching of chromated copper arsenate (CCA)-treated wood in a  

E-Print Network [OSTI]

-treated wood is incinerated, resulting arsenic emis- sions demand the use of proper air pollution control, mining waste, or wood. The feasibility of managing CCA-treated wood in monofills was examined using

Florida, University of

55

Satellite observations of ozone and nitrogen dioxide: from retrievals to emission estimates  

E-Print Network [OSTI]

Satellite observations of ozone and nitrogen dioxide: from retrievals to emission estimates #12 Satellite observations of ozone and nitrogen dioxide: from retrievals to emission es- timates / by Bas Subject headings: satellite retrieval / nitrogen dioxide / ozone / air pollution / emis- sion estimates

Haak, Hein

56

Combustion and Flame 151 (2007) 532541 www.elsevier.com/locate/combustflame  

E-Print Network [OSTI]

PAH isomers (such as benzo-a- pyrene), as well as their halogenated aromatics (such as dioxins the formation and emis- sion of trace pollutants such as PAH and dioxins, still need to be developed

Senkan, Selim M.

57

Biogeosciences, 7, 18771902, 2010 www.biogeosciences.net/7/1877/2010/  

E-Print Network [OSTI]

and fire suppression as a function of population density. Simulated fire carbon emis- sions ranged between Africa and a high bias over South America when compared to satellite-based products. The net terrestrial

Hoffman, Forrest M.

58

Case Study No. 2: Bon Apptit Management Company  

E-Print Network [OSTI]

and hormone use, seafood health and sustainability,began with a sustainable seafood educational tour around thelearning how to make better seafood choices. This effort

Thistlethwaite, Rebecca; Brown, Martha

2010-01-01T23:59:59.000Z

59

Deoxybenzoin-Based Polyarylates as Halogen-Free Fire-Resistant Kenneth A. Ellzey, T. Ranganathan, Joseph Zilberman, E. Bryan Coughlin,*  

E-Print Network [OSTI]

, processing, and engineering of halogen-free, low heat release, fire-resistant materials present important with high carbon monoxide emis- sion.7,8 Ideal flame-retardant polymers would possess high thermal stabilityDeoxybenzoin-Based Polyarylates as Halogen-Free Fire-Resistant Polymers Kenneth A. Ellzey, T

60

Atmos. Chem. Phys., 11, 1291712924, 2011 www.atmos-chem-phys.net/11/12917/2011/  

E-Print Network [OSTI]

of Technology, IMK-IFU, Garmisch-Partenkirchen, Germany 2Karlsruhe Institute of Technology, IMK-TRO, Karlsruhe-fired power installations. We show how the current generation of clean technology reduces the emis- sion for clean fossil fuel combustion W. Junkermann1, B. Vogel2, and M. A. Sutton3 1Karlsruhe Institute

Meskhidze, Nicholas

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Analysis of C1-C16 Hydrocarbons Using Dual-Column Capillary GC: Application to Exhaust Emissions from Passenger Car and Motorcycle Engines  

Science Journals Connector (OSTI)

......the analysis of gasoline, diesel, and 2-stroke motorcycle...hydrocarbons identified by GC in the diesel engine emis sions. Of the...used on motorcycles in some markets, such engines are in a small...relative merits of gasoline and diesel exhaust on the basis of the......

C.A. Jemma; P.R. Shore; K.A. Widdicombe

1995-01-01T23:59:59.000Z

62

TRNEWS287JULYAUGUST2013 The author is a Professor  

E-Print Network [OSTI]

and to protect the large investment in the transportation network. How can transportation pro- fessionals play, but with consequent carbon emis- sions. u The most recent round of international climate negotiations again failed and scientific methods that prioritized investment, improved safety, and developed efficient manage- ment

Garfunkel, Eric

63

Atmos. Chem. Phys., 14, 75857599, 2014 www.atmos-chem-phys.net/14/7585/2014/  

E-Print Network [OSTI]

periods that had different levels of diesel influence, as well as directly in the exhaust plumes organic aerosol (POA) emis- sions in diesel vehicle exhaust. This finding is supported by the detection. The sim- ilarity in OA and BC mass spectra for gasoline and diesel engine exhaust is likely to confound

Cohen, Ronald C.

64

Atmos. Chem. Phys., 11, 503518, 2011 www.atmos-chem-phys.net/11/503/2011/  

E-Print Network [OSTI]

with carbon monoxide and emission ratios from the burning of household biofuels, indi- cate a strong influence of biofuel burning to NMHC emis- sions in this region. Conversely, the ratios of ethane and propane to carbon; Wang et al., 2009). Monsoon circulation is characterized by the southwesterly Somali jet in the lower

Meskhidze, Nicholas

65

arXiv:0706.1256v1[astro-ph]8Jun2007 30th International Cosmic Ray Conference  

E-Print Network [OSTI]

] spans over 3000 km2 in Malarg¨ue (Argentina), at 1400 m a.s.l., investigating the ultra high energy cos, Argentina 2 Av. San Martin Norte 304 (5613) Malarg¨ue, Prov. de Mendoza, Argentina bertou filled with 12 m3 of water, can detect the putative high energy emis- sion of a GRB (photons down

66

6 JUNE 2014 VOL 344 ISSUE 6188 1095SCIENCE sciencemag.org ne reason for the use of biofuels is  

E-Print Network [OSTI]

the positive treatment of biofu- els in the 2007 IPCC report, a number of economic and life-cycle analysis (LCA ecosystems by stimulating expansion of agriculture but accomplish little or no reduction in GHG emissions that, on the basis of LCA, biofuels can help reduce GHG emis- sions. However, it notes that production

Napp, Nils

67

C O L L E G E O F E N G I N E E R I N G New worlds of discovery BY PAM REINIG AND DENNIS SMITH  

E-Print Network [OSTI]

into the hydrogen-rich gas required by fuel-cell vehicles. The emis- sion- and petroleum-free cars are still in the initiative are investigating new catalysts for fuel cells and new high-performance materials for adhesives technolo- gies, he says, we can replace our current fossil-fuel economy with one based on renewable

Lin, Zhiqun

68

UNSUPERVISED CONDITION CHANGE DETECTION IN LARGE DIESEL ENGINES  

E-Print Network [OSTI]

diesel engines and stationary power plants. The possibility of early detecting small defects priorUNSUPERVISED CONDITION CHANGE DETECTION IN LARGE DIESEL ENGINES Niels Henrik Pontoppidan and Jan detection in large diesel engines from acoustical emis- sion sensor signal and compared to more classical

69

Secondary emission gas chamber  

E-Print Network [OSTI]

For a hadron calorimeter active element there is considered a gaseous secondary emis-sion detector (150 micron gap, 50 kV/cm). Such one-stage parallel plate chamber must be a radiation hard, fast and simple. A model of such detector has been produced, tested and some characteristics are presented.

V. In'shakov; V. Kryshkin; V. Skvortsov

2014-12-10T23:59:59.000Z

70

The Measurement of Trace Emissions and Combustion Characteristics for a Mass Fire  

E-Print Network [OSTI]

32 The Measurement of Trace Emissions and Combustion Characteristics for a Mass Fire Ronald A of emissions from biomass burning on global climate. While the burning of biomass constitutes a large fraction of world emis- sions, there are insufficient data on the combustion efficiency, emission factors, and trace

71

International Journal of Greenhouse Gas Control 16 (2013) 129144 Contents lists available at SciVerse ScienceDirect  

E-Print Network [OSTI]

.elsevier.com/locate/ijggc Comparative lifecycle inventory (LCI) of greenhouse gas (GHG) emissions of enhanced oil recovery (EOR) methods inventory (LCI) to compare the lifecycle greenhouse gas (GHG) emis- sions of enhanced oil recovery (EOR oil recovery CCS Biomass IGCC NGCC Carbon credits a b s t r a c t This study uses a process lifecycle

Jaramillo, Paulina

72

DOI: 10.1126/science.1093758 , 1926 (2003);302Science  

E-Print Network [OSTI]

in the U.S. Congress that would reduce greenhouse gas emissions. Al- though the McCain-Lieberman Climate.sciencemag.orgDownloadedfrom #12;of the projected growth in greenhouse gas emissions over the next 100 years is from developing will require substantial reductions in greenhouse gas emis- sions; hence, the Kyoto Protocol is recognized

Malcolm, Stephen

73

Climate Dynamics (1996) 12:711721 q Springer-Verlag 1996  

E-Print Network [OSTI]

(Revelle and Suess 1957) a broad spectrum of re- search. One key question concerns the amount of ex- cess thousand years circula- tion. At present, approximately one third of CO2 emis- sions enter the ocean termed biological pumps are caused by the formation of soft tissue matter (soft tis- sue pump

Winguth, Arne

74

DOI: 10.1002/adma.200501267 Field-Emission Behavior of a Carbon-Nanotube-Implanted Co  

E-Print Network [OSTI]

on substrates and metal electrodes using arc discharge or chemical vapor deposition do not perform well as field-threshold electric fields and large emis- sion-current densities.[1­4] Many research groups have devel- oped various electrical conductivity, high aspect ratio, and sharp tip morphology.[3,4] However, CNTs deposited

Hong, Soon Hyung

75

Water Vapor Radiometry : Outline of Goals and Tasks for the Spring Semester 2001  

E-Print Network [OSTI]

that can accu­ rately measure the spectrum of the water vapor emis­ sion. The current receivers follow, as in a conventional re­ ceiver, the correlation receiver splits the rf signal into two with a splitter that follows the feed horn. Both branches are mixed with a carefully controlled ther­ mal load. A 180 ffi phase shift

Backer, Don

76

Development of a Long-Range Lightning Detection Network for the Pacific: Construction, Calibration, and Performance*  

E-Print Network [OSTI]

Net/LLDN was carefully assessed. Long-range lightning flash detection efficiency (DE) and location accuracy (LA) modelsDevelopment of a Long-Range Lightning Detection Network for the Pacific: Construction, Calibration-frequency (VLF) emis- sions generated by lightning, called sferics, to propagate over long distances. The new

Businger, Steven

77

VOL. 32, No.4 UNL WATER CENTER AUGUST 2000 New Method For Detecting Trace Amounts of MTBE  

E-Print Network [OSTI]

water their use to help curb growing prob- at spill sites. lems with air pollution. MTBE is the most emis-by Steve Ress sions, are considered small. Gasoline additives that help keep our air clean can- "Most of the information available on oxygenates 10 mine the extent of their environmental impacts

Nebraska-Lincoln, University of

78

Atmos. Chem. Phys., 14, 76017616, 2014 www.atmos-chem-phys.net/14/7601/2014/  

E-Print Network [OSTI]

nitrogen- containing species. Anthropogenic nitric oxide (NO) emis- sions react to form nitrogen dioxide. The fate of nitrogen oxide pollution during high-latitude winter is controlled by reactions of dinitrogen. Joyce et al.: NOx fate at high latitudes Figure 1. A nocturnal nitrogen schematic with emphasis on N2O5

Pierce, Jeffrey

79

Atmos. Chem. Phys., 9, 92099223, 2009 www.atmos-chem-phys.net/9/9209/2009/  

E-Print Network [OSTI]

on the consumption of fuel, and on the emis- sions to the atmosphere. The predictions of fuel consump- tion were (RoPax), the predicted and reported values of annual fuel consumption agreed within an accuracy of 6) that is used in vessel navigation. The emissions are computed based on the relationship of the in- stantaneous

Meskhidze, Nicholas

80

Atmos. Chem. Phys., 13, 18371852, 2013 www.atmos-chem-phys.net/13/1837/2013/  

E-Print Network [OSTI]

-0244, USA 2Atmospheric, Earth, and Energy Division; Lawrence Livermore National Laboratory, 7000 East Avenue. The performance of the transport model has been investigated by comparing the wind direction and speed, the implementation of measures within the United States and other countries to monitor the emis- sions of greenhouse

Keeling, Ralph

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

A SIGNAL SYNTHESIS PROCEDURE DESIGNED FOR DISCREET OCEAN ACOUSTIC TOMOGRAPHY  

E-Print Network [OSTI]

the detection probability of active emis- sions by a nearby unknown interceptor. Finally, this procedure is ap in ship noise with the constraint to have an accurate estimation of the channel parameters. Results tomography, parameter estimation, sig- nal detection, optimization, performance analysis 1. INTRODUCTION

Boyer, Edmond

82

Analysis of C1-C16 Hydrocarbons Using Dual-Column Capillary GC: Application to Exhaust Emissions from Passenger Car and Motorcycle Engines  

Science Journals Connector (OSTI)

......can be present in diesel exhaust. 3,5...indicative of a more general problem. The PLOT...the gas phase of diesel exhaust. With such...bags. Workers at General Motors (19) have...identified by GC in the diesel engine emis sions...mode of the European Cycle are also shown in......

C.A. Jemma; P.R. Shore; K.A. Widdicombe

1995-01-01T23:59:59.000Z

83

Tellus (2007), 59B, 199210 C 2007 The Authors Journal compilation C 2007 Blackwell Munksgaard  

E-Print Network [OSTI]

to fossil fuel emis- sions, oc CO2 is the contribution from the ocean surface flux, bio CO2. These studies usu- ally require determination of the fossil fuel component of the observation, which can experiment are used to quantify changes in the fossil fuel CO2 prediction from the CO tracer method

Stanier, Charlie

84

Atmos. Chem. Phys., 7, 35873596, 2007 www.atmos-chem-phys.net/7/3587/2007/  

E-Print Network [OSTI]

on the emis- sion data in Seoul and Northeast Asia: Gasoline and diesel vehicles, residential coal use, coke daily and seasonal variations. High contributions of biomass burning and coal (residential and coke oven ovens, coal power plants, biomass burning, and natural gas (NG) combustion. The ma- jor sources

Meskhidze, Nicholas

85

Hydrogen cars have zero emissions at the tailpipe  

E-Print Network [OSTI]

infrastructure would provide jobs · Hydrogen fuel cells have a higher "tank to wheel' efficiency than gasoline effi- ciency from plants other than corn #12;· Hydrogen fuel cells are currently very expensive · Fuel hydrogen from fossil fuels or elec- tricity made from coal produces the same emis- sions as any other fuel

Bowen, James D.

86

Green-Aware Routing in GMPLS Networks J. Wang, S. Ruepp, A.V. Manolova, L. Dittmann  

E-Print Network [OSTI]

in the energy consumption and the concomitant green house gases (GHG) emis- sions. Despite the efforts that provides a detailed study of a green-aware OSPF protocol. I. INTRODUCTION The energy consumption the advantage of being green, in the sense that no GHGs are emitted during the energy production, in contrast

Politècnica de Catalunya, Universitat

87

Recent Developments of the Modelica "Buildings" Library for Building Energy and Control Systems  

E-Print Network [OSTI]

consumption and related green house gas emis- sions. For example, in the United States, build- ings consume 2. Section 4 presents applications with models for multizone airflow simulation and for co-simulation in these packages augment models from the Modelica Standard Library and from the Modelica.Fluid library. Base

88

BOOK REVIEW Thomas G. Moore: 1998, `Climate of Fear' (Why We Shouldn't Worry about Global  

E-Print Network [OSTI]

, will be a golden age for man. Forecasts of severe impact are overstated. Rather, agriculture will benefit, people in Congress when it comes to debating the Kyoto Treaty on restricting greenhouse gas emissions. Dr. Moore is an important element for restricting greenhouse gas emis- sions, and a discussion of economic scenarios

89

1998 IEEE TRANSACTIONS ON PLASMA SCIENCE, VOL. 36, NO. 5, OCTOBER 2008 Controlling the Plasma Flow in the  

E-Print Network [OSTI]

. Fisch are with the Princeton Plasma Physics Laboratory, Princeton, NJ 08540 USA (e-mail: yraitses1998 IEEE TRANSACTIONS ON PLASMA SCIENCE, VOL. 36, NO. 5, OCTOBER 2008 Controlling the Plasma Flow electron emis- sion. The thruster operation in this mode greatly expands the range of the plasma

90

UF/IFAS ExtEnSIon SaraSota County  

E-Print Network [OSTI]

Spriggs - Community & School Gardens Coordinator regional team Stephen Futch ­ Citrus John Stevely ­ Sea

Jawitz, James W.

91

Review : integration of EMI technique with global vibration technique  

E-Print Network [OSTI]

In the last decade, the development of Structural Health Monitoring (SHM) has been skyrocketing because of the serious consequences that come with structural failure. Traditional damage detection techniques, also known as ...

Ni, Suteng

2013-01-01T23:59:59.000Z

92

Using EMI for Electrical Energy Disaggregation in the Home  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

Energy Usage Saturday, July 12, 14 Disaggregated Energy Usage Saturday, July 12, 14 HVAC 73 Water Heater 44 Dryer 33 Electronics 14 Others 7 DVR 21 Disaggregated Energy...

93

From fusion to total disassembly: global stopping in heavy-ion collisions  

E-Print Network [OSTI]

Using the quantum molecular dynamics model, we aim to investigate the emis- sion of light complex particles, and degree of stopping reached in heavy-ion colli- sions. We took incident energies between 50 and 1000 MeV/nucleon. In addition, central and peripheral collisions and different masses are also considered. We ob- serve that the light complex particles act in almost similar manner as anisotropic ratio. In other words, multiplicity of light complex particles is an indicator of global stopping in heavy-ion collisions. We see that maximum light complex particles and stopping is obtained for heavier masses in central collisions.

Jatinder K. Dhawan; Narinder Dhiman; Aman D. Sood; Rajeev K. Puri

2010-07-12T23:59:59.000Z

94

Strategies and Technologies for Improving Air Quality Around Ports  

E-Print Network [OSTI]

Association EMI Electromagnetic Interference EPApotential electromagnetic interference (EMI), and several

Khan, Mohammad Yusuf

2013-01-01T23:59:59.000Z

95

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

solvents solvents B-6 Pre-Combustion solvents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 Co 2 CaPture from igCC gas streams using aC-abC ProCess primary project goals SRI International is developing, for integrated gasification combined cycle (IGCC)-based power plants, a carbon dioxide (CO 2 ) capture technology based on the use of a high-ca- pacity and low-cost aqueous ammoniated solution containing ammonium carbonate (AC), which reacts with CO 2 to form ammonium bicarbonate (ABC).

96

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

solvents solvents B-198 Post-Combustion solvents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 DeveloPment anD Demonstration of Waste heat integration With solvent ProCess for more effiCient Co 2 removal from Coal-fireD flue gas primary project goals Southern Company Services is developing viable heat integration methods for the capture of carbon dioxide (CO 2 ) produced from pulverized coal (PC) combustion. The project will quantify energy-efficiency improvements to the CO 2 capture process by utilizing a waste heat recovery technology, High-Efficiency System (HES). technical goals * Reduction of the amount of extraction steam required for sensible heat load in the

97

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sorbents sorbents B-302 Post-Combustion sorbents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 benCh-sCale DeveloPment anD testing of raPiD Pressure swing absorPtion for Carbon DioxiDe CaPture primary project goals WR Grace and the University of South Carolina are developing a rapid pressure swing adsorption (PSA) process to evaluate concept cost and performance benefits by testing a bench-scale system using a low-cost, structured adsorbent with low-pressure drop, high mass-transfer rates, high capacity, and high availability that will enable large feed through- puts. technical goals * Develop an attrition-resistant and low-pressure drop structured adsorbent based on a

98

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sorbents sorbents B-14 Pre-Combustion sorbents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 aDvanCeD Carbon DioxiDe CaPture teChnology for low-rank Coal integrateD gasifiCation CombineD CyCle (igCC) systems primary project goals TDA will investigate the technical and economic advantages of using an integrated carbon dioxide (CO 2 ) sorbent and water-gas shift (WGS) catalyst system in an integrated gasifi- cation combined cycle (IGCC) power plant, fueled with low-rank coal, and designed to capture more than 90% of the CO 2 emissions. technical goals * TDA will evaluate the physical mix of the sorbent and catalyst pellets within the same

99

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AdvAnced compression AdvAnced compression B-540 AdvAnced compression U.s. depArtment of energy AdvAnced cArbon dioxide cAptUre r&d progrAm: technology UpdAte, mAy 2013 novel concepts for the compression of lArge volUmes of co 2 primary project goals Southwest Research Institute (SwRI) is developing novel compression technology concepts to reduce carbon dioxide (CO 2 ) compression power requirements by 10% compared to conventional compressor designs. The basic concept is a semi-isothermal compression pro- cess where the CO 2 is continually cooled using an internal cooling jacket rather than using conventional interstage cooling. The project has completed thermodynamic (Phase I) and prototype testing (Phase II). A full-scale demonstration of a multi-stage, internally cooled

100

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

membranes membranes B-370 Post-Combustion membranes u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 eleCtroChemiCal membrane for Carbon DioxiDe CaPture & Power generation primary project goals FuelCell Energy, Inc. (FCE) is developing an electrochemical membrane (ECM)-based Combined Electric Power and Carbon Dioxide Separation (CEPACS) system for carbon dioxide (CO 2 ) capture that also provides additional electrical power generation. The project includes bench-scale testing of an 11.7 m 2 -area ECM (molten carbonate fuel cell) system for CO 2 capture, purification, and compression. technical goals * Perform contaminant effect testing to establish maximum permissible concentrations of

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

E-Print Network 3.0 - activities bon voyage Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

that Voyager is seeing activity upstream of the shock... Relation between the solar wind dynamic pressure at Voyager 2 and the energetic particle events... at Voyager 1...

102

Process development for a field emission structure  

E-Print Network [OSTI]

self-aligned process technology has been developed to fabricate field emis- sion structures using standard semiconductor fabrication procedures. Arrays of field emission diode structures incorporating silicon cathodes have been fabricated... already been fa. bricated. The aim of' this research is focused on developing a process technology to fabri- cate field emission structures incorporating a low work function cathode material. In addition, this technology must allow for adjustable anode...

Legg, James Derek

2012-06-07T23:59:59.000Z

103

JCAP06(2013)008 ournal of Cosmology and Astroparticle Physics  

E-Print Network [OSTI]

and gravitational wave emis- sion 3 2.1 Canonical long gamma-ray bursts from massive stars 4 2.2 Low-luminosity GRBs and engine-driven supernovae 5 2.3 Mergers and short gamma-ray bursts 6 2.4 Bursting magnetars 7 2.5 Cosmic cosmic events including gamma-ray bursts (GRBs), core-collapse supernovae (CCSNe), soft- gamma repeater

Tanner, David B.

104

DEPARTMENT OF THE ARMY U.S. ARMY ENGINEER DIV1SION,GREAT LAKES AND OHIO RIVER  

E-Print Network [OSTI]

ANDER, PITTSBURGH DISTRICT SUBJECT: Remedial Investigation Repijrt. Parks Township, Shallow Land Disposal Area 1 Disposal Arua (SLDA) site Remedial Investigation Report, FUSRAP Program. 2. I approvc distribution of the Parks Ttwnship. Stiallow Land Disposal Area, Remedial Investigation Report. 3. The POC for CELRD is Mr

US Army Corps of Engineers

105

sions (EC) directives have both legally and functionally separated rail operations from infrastructure ownership and management, the  

E-Print Network [OSTI]

infrastructure ownership and management, the government-owned national railways still maintain a symbiotic rela exhibiting high levels of utilization, and slots will eventually come to be viewed as the valuable resources, administrative, and operational improvements (2). In such an envi- ronment, flexible means for utilizing slots

106

Appendix B: CArBon dioxide CApture teChnology SheetS R&D CollaboRations  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

R&D CollaboRations R&D CollaboRations B-556 R&D CollaboRations U.s. DepaRtment of eneRgy aDvanCeD CaRbon DioxiDe CaptURe R&D pRogRam: teChnology UpDate, may 2013 paRtneRship foR Co 2 CaptURe primary project goals The University of North Dakota Energy and Environmental Research Center (UNDEERC) is conducting pilot-scale testing to demonstrate and evaluate a range of carbon dioxide (CO 2 ) capture technologies to develop key technical and economic information that can be used to examine the feasibility of capture technologies as a function of fuel type and system configuration. technical goals * Integrate a high-efficiency flexible capture system with existing pilot-scale combustion

107

Appendix B: CArBon dioxide CApture teChnology SheetS Oxy-COmbustiOn  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oxy-COmbustiOn Oxy-COmbustiOn B-424 Oxy-COmbustiOn u.s. Department Of energy aDvanCeD CarbOn DiOxiDe Capture r&D prOgram: teChnOlOgy upDate, may 2013 Oxygen transpOrt membranes fOr inDustrial appliCatiOns primary project goals Praxair is optimizing oxygen transport membrane (OTM) performance, materials, and process configurations leading to subsequent development-scale testing of OTM technology for synthesis gas (syngas) production applications, providing valuable experience needed to develop commercial OTM technology in industrial applications and future utility-scale

108

Appendix B: CArBon dioxide CApture teChnology SheetS Oxygen PrOductiOn  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oxygen PrOductiOn Oxygen PrOductiOn B-500 Oxygen PrOductiOn u.S. dePartment Of energy advanced carbOn diOxide caPture r&d PrOgram: technOlOgy uPdate, may 2013 itm Oxygen technOlOgy fOr integratiOn in igcc and Other advanced POwer generatiOn SyStemS primary project goals Air Products and Chemicals set out to design and develop an ion transport membrane (ITM) based on ceramics that selectively transport oxygen (O 2 ) ions when operated at high temperature. This high-temperature process may be integrated with advanced power genera- tion processes that require O 2 as a feedstock, such as integrated gasification combined cycle (IGCC) and other clean energy and industrial applications. technical goals * Design, construct, and operate a 0.1-ton/day (TPD) technology development unit

109

Berlin, le 25 janvier 2007 Evaluation et politiques: Y a-t-il de bons indicateurs pour la recherche?  

E-Print Network [OSTI]

(derived from the works of Amartya Sen). Then I try to apply these conceptions towards research evaluation

Paris-Sud XI, Université de

110

Combining boron isotopes and carbamazepine to trace sewage in salinized groundwater: a case study in Cap Bon, Tunisia  

E-Print Network [OSTI]

treatment and so recognized as a pertinent tracer of wastewater contamination. The system equilibrium of Research in Rural Engineering of Water and Forestry), rue Hédi Karray, B.P.10- 2080 Ariana, Tunisia based on a managed aquifer recharge with treated wastewater. Water quality monitoring was implemented

Paris-Sud XI, Université de

111

NORTHWESTERN UNIVERSITY Qualification of Autonomous Crack Monitoring Systems  

E-Print Network [OSTI]

Levels and Electromagnetic Interference (EMI)............................................12 Computer

112

Research Focus  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Focus Focus Work at FEERC is centered on three interrelated areas of research: fuels, engines, and emis- sions. FEERC scientists study the impacts of fuel properties on advanced combustion processes as well as on emissions and emission control strategies and devices. The range of fuels studied includes gaseous (natural gas) and liquid fuels from conventional and unconventional fossil- based sources, as well as non-petroleum fuels from synthetic and renewable sources. The FEERC conducts research on innovative internal combustion engine technologies and control systems for improved efficiency. Combining novel diagnostic and experimental methods with modeling, the Center's scientists also develop improved understanding of the functions and key mechanisms of emission control devices

113

The development and presentation of a short course on stack sampling  

E-Print Network [OSTI]

and Regulations of the Texas Air Control Board, major sources of emis- sion within the state must be monitored by accurately measuring all pollutants under normal operating condi- tions, and the results of such measurements must be submitted to the Board... Dr . W. B . Harris, Dr . D. T. Hanson, and Dr. W. L. Perry for their help in preparing this thesis. I wish also to thank the Texas Air Pollution Control Services for their gracious cooperation and assistance in planning and presenting this short...

Bentzen, Gordon Warren

2012-06-07T23:59:59.000Z

114

Development of an international standard for electromagnetic interference (EMI)/radio frequency interference (RFI)  

SciTech Connect (OSTI)

This paper covers the development of an international standard that establishes the requirements for electromagnetic compatibility testing of instrumentation and control equipment supplied for use in systems important to safety at nuclear power plants. The standard lists the applicable IEC standards (principally the IEC 61000 series) which define the general test methods, and provides the necessary application-specific parameters and criteria to ensure that nuclear safety requirements are met. This standard was prepared with the leadership by the Russian National Committee representatives to the International Electrotechnical Commission (IEC). (authors)

Sarylov, V. [EMC Test Center, NUIT, FSUE RIPT, Moscow (Russian Federation); Shumov, S. [FSUE SEC SNIIP, Moscow (Russian Federation); Quinn, E. [ANS, Dana Point, CA (United States)

2006-07-01T23:59:59.000Z

115

High Efficiency, Low EMI and Positioning Tolerant Wireless Charging of EVs  

Broader source: Energy.gov [DOE]

2013 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Program Annual Merit Review and Peer Evaluation Meeting

116

US Army Corps of Engineers Portland District  

E-Print Network [OSTI]

) 1,200 Steelhead Kelt passage at BON Passage behavior to inform decision on BON powerhouse priority

117

The Darlington Centre and Forum Restaurant 174 City Road, Darlington NSW 2008 Ph: 9351 4664 Email: forum.restaurant@sydney.edu.au Bon Appetite!  

E-Print Network [OSTI]

and crafted so you can eat fresh, seasonal produce sourced from ethical and sustainable suppliers. #12;The with a shot of Pedro Jimenez Sherry and 9 a shot of Black Rose tea COFFEE & TEA Toby's Estate: Latte Paraguay and real cola nut grown by the Mende & Temne people of Sierra Leone. Lemmy Lemonade: Give your

Viglas, Anastasios

118

Motion plan n in g for m ulti-robot assem bly M . BON ER T, L. H. SHU and B. BEN H ABIB  

E-Print Network [OSTI]

-type optim ization problem s. H owever, in these augm ented TSPs (TSP+) , both the `sales- person' (a robot, Euclidean, Ch ebysh ev, prize collectin g an d tim e-depen - den t TSP variation s ( Dubowsky an d Blubaugh

Shu, Lily H.

119

This article was downloaded by: [b-on: Biblioteca do conhecimento online ISPA] On: 15 January 2013, At: 09:17  

E-Print Network [OSTI]

-401, Coimbra, Portugal b Eco-Ethology Research Unit & Centro de Biociências, ISPA, Rua Jardim do Tabaco 34, 1149-041, Lisboa, Portugal c ICNB ­ DGACZH, Reserva Natural do Paul de Arzila, Rua do Bairro 1, 3045 do Porto, Campus Agrário de Vairão, Rua Padre Armando Quintas, P-4485-661, Vairão, Portugal e

120

FIRST EVALUATION OF EMI MODEL OF INTERACTION This article presents research work done in the domain of  

E-Print Network [OSTI]

in the domain of nonverbal emotional interaction for the EmotiRob project. It is a component of the MAPH project expressive. Our experiments on the subject have helped us determine the minimum number of degrees of liberty experimentation. We begin the article by MAPH and EmotiRob project presentation. Then, we quickly describe

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Crystal ball 2011emi4_236 1..26 In this feature, leading researchers in the field of environ-  

E-Print Network [OSTI]

, Laboratory for Microbiology, Philipps- University Marburg, Marburg, Germany (Email: bremer@ staff that no microorganism can actively transport water through an energy-consuming process across its cytoplasmic membrane. In the course of evolution, they have found ways to indirectly deter- mine the direction and scale of the water

Babu, M. Madan

122

Msx genes are expressed in the carapacial ridge of turtle shell: a study of the European pond turtle, Emys orbicularis  

Science Journals Connector (OSTI)

The turtle shell forms by extensive ossification of dermis... Msx genes are involved in the development of limb mesenchyme and of various skeletal structures. In particular, precocious Msx expression is recorded ...

Christine Vincent; Martine Bontoux; Nicole M. Le Douarin

2003-09-01T23:59:59.000Z

123

High power peripheral coupled waveguide electroabsorption modulator for analog fiber-optic link applications  

E-Print Network [OSTI]

Electromagnetic Interference . . . . . . . . . . . . . . . . . . .and immune to electromagnetic interference (EMI) [18, 19].

Xie, Xiaobo

2007-01-01T23:59:59.000Z

124

Overview of Forest Observations in the GEOSS Work Plan  

E-Print Network [OSTI]

change & GHG emis. Water+energy exchanges Climate Land change & GHG emis. Water+energy exchanges Weather

125

winter_96  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ELECTRIC'S GREENFIELD ELECTRIC'S GREENFIELD IGCC READY FOR DEMONSTRATION Tampa Electric Company (TEC) has reached a major milestone in its goal to bring clean, low-cost energy to the consumer well into the 21st century. Begun with an independent community plant siting effort, TEC in October initiated operation of a 250-MWe (net) Integrated Gasification Combined- Cycle (IGCC) system. This is the first increment of a planned build-out to 1,150 MWe at the new Polk Power Plant in Polk County, Florida. The advanced IGCC system offers high efficiency, extremely low emis- sions, and saleable solids and liquids in lieu of wastes. In addition to using an environmentally advanced power generation technology, the project will convert some 1,500 acres of phosphate mining spoils to useable

126

Annual Energy Outlook 2005  

Gasoline and Diesel Fuel Update (EIA)

[1] [1] The projections in AEO2005 are based on Federal and State laws and regulations in effect on October 31, 2004. The potential impacts of pending or proposed legislation, regulations, and standards-or of sections of legislation that have been enacted but that require funds or imple- menting regulations that have not been provided or speci- fied-are not reflected in the projections. Legislation and Regulations [2]The SEER is a measure of cooling performance that is used to rate the efficiency of central air conditioners and heat pumps. It is defined as the ratio of cooling output (in Btu) to total electric energy input (in watthours) during normal annual usage. [3] National Resources Defense Council v. Abraham, U.S. Court of Appeals, 2nd District. [4]U.S. Environmental Protection Agency, "National Emis- sion Standards for Hazardous Air Pollutants for Indus- trial, Commercial,

127

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Low-Swirl Injectors for Hydrogen Gas Low-Swirl Injectors for Hydrogen Gas Turbines in Near-Zero Emissions Coal Power Plants-Lawrence Berkeley National Laboratory Background The U.S. Department of Energy Hy(DOE) Lawrence Berkeley National Laboratory (LBNL) is leading a project in partnership with gas turbine manufacturers and universities to develop a robust ultra-low emission combustor for gas turbines that burn high hydrogen content (HHC) fuels derived from gasification of coal. A high efficiency and ultra-low emissions HHC fueled gas turbine is a key component of a near-zero emis- sions integrated gasification combined cycle (IGCC) clean coal power plant. This project is managed by the DOE National Energy Technology Laboratory (NETL). NETL is researching advanced turbine technology with the goal of producing reliable,

128

Word Pro - Untitled1  

U.S. Energy Information Administration (EIA) Indexed Site

6 Biomass Resources 6 Biomass Resources U.S. Energy Information Administration / Annual Energy Review 2011 113 Notes: * Data are for total biomass per square kilometer. * km 2 = square kilometer. * This study estimates the biomass resources currently available in the United States by county. It includes the following feedstock categories: crop residues (5 year average: 2003-2007), forest and primary mill residues (2007), secondary mill and urban wood waste (2002), methane emis- sions from landfills (2008), domestic wastewater treatment (2007), and animal manure (2002). For more information on the data development, please refer to http://www.nrel.gov/docs/fy06osti/39181.pdf. Although, the document contains the methodology for the development of an older assessment,

129

5-07.pub  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

May 2007 May 2007 HIGHLIGHTS Page 1 Fossil Energy Techline, "DOE Signs FutureGen Cooperative Agree- ment." On April 10, The US Department of Energy (DOE) and the Future- Gen Alliance agreed to terms of the next phase of the FutureGen project, valued at $42.5 million. FutureGen is a first-of-its- kind, near-zero emissions coal-fueled power plant that will integrate carbon dioxide capture and stor- age technology to reduce greenhouse gas emis- sions. The cooperative agreement outlines the inclusions in the current project phase and up- dates to overall cost esti- mates for the project. Cur- rent funding will pay for a detailed summary of the project's conceptual designs, final site selection, negotia- tion of a site agreement, and release of required National Environmental Policy Act (NEPA) documentation.

130

205b  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Environmental and Environmental and Water Resources MULTI-POLLUTANT EMISSION CONTROL: PILOT PLANT STUDY OF TECHNOLOGIES FOR REDUCING HG, SO 3 , & NOX Background In December 2000, EPA announced its intention to regulate mercury emis- sions from coal-fired power plants. Additionally, President Bush's Clear Skies Act calls for reduction in mercury from the electric utility sector. In anticipation of these actions, U.S. Department of Energy's National Energy Technology Laboratory (NETL) issued a competitive solicitation for advanced/novel mercury control technologies. CONSOL was awarded a cooperative agreement from this solicitation. Previous research conducted by CONSOL and others showed that mercury can be removed from the flue gas from coal-fired furnaces by cooling the flue

131

ch_5  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

22 22 5.2.6 AIR RESOURCES Air pollutant emissions associated with construction and operation of facilities to support the waste processing al- ternatives could affect the air resources in the region of the INEEL. DOE characterized air emission rates and calculated maximum consequences at onsite and offsite locations from projects associated with proposed waste processing alternatives. The assessments include emis- sions from stationary sources (facility stacks); fugitive sources from construction activities; and mobile sources (trucks, cranes, tractors, etc.) that would operate in sup- port of projects under each waste processing alternative. The types of emissions assessed are the same as those in the baseline assessment in Section 4.7, Air Resources, namely, radionuclides, criteria pollutants (carbon

132

3-07.pub  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DOE News Release, "President Requests $863 Million for Fossil Energy Programs: FY2008 Fossil DOE News Release, "President Requests $863 Million for Fossil Energy Programs: FY2008 Fossil Budget Request One of Largest Since Taking Office." President Bush's Fiscal Year (FY) 2008 budget for the Office of Fossil Energy totals $863 million, a 33 percent increase over last year's budget. The proposal focuses on early initiation of an expansion of the Strategic Petroleum Reserve to 1.5 billion barrels by 2027; accelerating the development of carbon sequestration technologies to manage and virtually eliminate emis- sions of the greenhouse gas carbon dioxide from fossil fuel use in power generation and other industrial activ- ity; and moving forward with the design and early work on the FutureGen Initiative. Funding for the FutureGen Initiative will increase two-

133

What is the GREET Fleet Footprint Calculator  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

GREET Fleet Calculator can estimate petroleum and carbon GREET Fleet Calculator can estimate petroleum and carbon footprints of both on-road vehicles and off-road equipment. What is the GREET Fleet Footprint Calculator? As early adopters of new vehicle technologies, fleets are vital to the success of alternative fuels and advanced vehicles (AFVs). The Greenhouse gases, Regulated Emis- sions, and Energy use in Transportation (GREET) Fleet Foot- print Calculator can help fleets decide on the AFVs that will best help them meet a variety of organizational goals and legal requirements, including reducing their petroleum use and greenhouse gas (GHG) emissions. Currently, the United States imports nearly half of its oil. 1 Because the United States uses about 70% of its oil for transportation, decreasing petroleum consumption in vehicles can substantially

134

cctoday_fall_2005_Final.indd  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

491 * ISSUE NO. 64, FALL 2005 491 * ISSUE NO. 64, FALL 2005 A NEWSLETTER ABOUT INNOVATIVE TECHNOLOGIES FOR COAL UTILIZATION NEW DOE PROGRAM TO ADVANCE FUEL CELL CENTRAL POWER STATIONS Recent advances in technology have precipitated movement of fuel cells into the central power arena in support of FutureGen - coal-based central power plants capable of co-producing electricity and clean fuels (including hydrogen), enabling carbon sequestration, and producing near-zero emis- sions. While the initial focus of the Offi ce of Fossil Energy (FE) stationary fuel cell research and development program has been on distributed genera- tion applications, the strategy has always included eventual integration with central power plants. The central power element of the strategy is now being implemented under the Fuel Cell Coal-Based Systems program.

135

Proj226  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3 3 Sequestration MIDCONTINENT INTERACTIVE DIGITAL CARBON ATLAS AND RELATIONAL DATABASE (MIDCARB) Background Current federal energy policy assumes that fossil fuels will continue to be the primary source of energy for the United States and the world well into the 21st century. However, there is growing concern about the possible role of increas- ing atmospheric concentration of carbon dioxide (CO 2 ) on climate change. For this reason, it may become necessary to manage anthropogenic CO 2 emis- sions. Sequestering CO 2 in geological reservoirs may be one way to safely store carbon over long periods of time, if the proper data and tools to analyze the geological feasibility as well as the associated costs can be developed. The Midcontinent Interactive Digital Carbon Atlas and Relational DataBase

136

Alternative Fuels in Trucking Volume 5, Number 3  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

lmost 50% of the petroleum lmost 50% of the petroleum consumed in the United States is imported. By the year 2000, 73% of total petroleum demand will be imported, making America vulnerable to a cutoff in our energy lifeline. Transportation, which is 98% dependent on petroleum, uses two-thirds of the oil consumed in the United States. If we instead used American-produced natural gas to power our vehicles, we could become energy independent. Natural gas could also solve some of our toughest environmental prob- lems. Gasoline- and diesel-fueled cars, trucks, and buses produce half of all air pollution in the United States. Natural gas would cut emis- sions to zero. Congress has recognized the opportunity and enacted legislation to provide incentives for or mandate the production of alternative fuel

137

National Renewable Energy  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

Because original equipment Because original equipment manufacturer (OEM) vehicles designed to run on compressed natural gas (CNG) and liquefied petroleum gas (LPG) have only been available in limited models in past years, many fleets have had to rely on conversions as a source for alternative fuel vehicles (AFVs). The Federal fleet is no different-so far it has converted approximately 900 vehicles to CNG or LPG, providing the National Renewable Energy Laboratory (NREL) with an opportunity to test a variety of conversion kits. When buying a new AFV or having a gasoline vehicle convert- ed, fleet managers need to ask the right questions about the emis- sions performance they can expect, according to researchers at NREL. "Question them. Don't take [good emissions performance] for granted," said Robert Motta,

138

Fire dynamics during the 20th century simulated by the Community Land Model  

E-Print Network [OSTI]

emi. [TgC/year] HI HI-FS South America HI HI-FS Equatorialdelta carbon emi [%] South America Central Asia carbon emi (ica, NHSA: Northern Hem. South America, SHSA: Southern Hem.

2010-01-01T23:59:59.000Z

139

IEEE TRANSACTIONS ON INDUSTRY APPLICATIONS, VOL. 47, NO. 1, JANUARY/FEBRUARY 2011 223 EMI Study of Three-Phase Inverter-Fed Motor Drives  

E-Print Network [OSTI]

of Three-Phase Inverter-Fed Motor Drives Bertrand Revol, James Roudet, Jean-Luc Schanen, Senior Member setup and can be used during the design of a variable-speed inverter motor association. The objective in an inverter­motor association in order to depict the influence of elements, such as the elec- tromagnetic

Paris-Sud XI, Université de

140

SPECTROSCOPIE D'EMISSION SUR PLASMA INDUIT PAR LASER (LIBS) POUR LE SUIVI EN CONTINU DES POLLUANTS EMIS DES SOURCES FIXES  

E-Print Network [OSTI]

for monitoring of air pollution by industrial sources ABSTRACT The emission of heavy metals from fixes sources able to perform continuous and in-situ controls of heavy metal emissions from fixed sources and is able to perform quantitative analysis of metal micrometric particulates, at the direct source

Boyer, Edmond

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

PERFORMANCE CHARACTERISTICS OF THE FERMILAB 15-FOOT BUBBLE CHAMBER WITH A 1/3-SCALE INTERNAL PICKET FENCE (IPF) AND A TWO-PLANE EXTERNAL MUON IDENTIFIER (EMI)  

E-Print Network [OSTI]

L. Stevenson, G. P. Yost; Fermilab: B. Chrisman, D. Gee, A.of Hawaii; and M. Atac, Fermilab; "Status of the InternalPicket Fence for the Fermilab 15-Foot Bubble Chamber", U. H.

Stevenson, M.L.

2011-01-01T23:59:59.000Z

142

Applied computational electromagnetic society Journal, pages: 139-148, March, 2004 Coupling Between Highly Conducting and Permeable Metallic Objects in the EMI  

E-Print Network [OSTI]

discrimination and possibly contaminating ground water with explosive residues. Most if not all UXO are composite time. In some cases, the ordinance is broken in parts upon impact with the ground, complicating. The false alarm rate produced by clutter is extremely high and typically causes the majority of remediation

Shubitidze, Fridon

143

Impact of the introduction of the red-eared slider (Trachemys scripta elegans) on survival rates of the European pond turtle (Emys orbicularis)  

Science Journals Connector (OSTI)

Recent massive imports of slider turtles, (Trachemys scripta elegans...) into Europe as pets have induced frequent release of these exotic turtles in natural habitats. As a consequence, T. s. elegans...is now wid...

A. Cadi; P. Joly

2004-12-01T23:59:59.000Z

144

Microsoft Word - HV-BPL Final Report to NETL.doc  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

verified. The team spent time searching for noise sources referred to as Electromagnetic Interference or EMI. EMI is defined here as intentional or unintentional noise created...

145

Project no. 516369 Electromagnetic compatibility between rolling stock and  

E-Print Network [OSTI]

to anything in that environment. Electromagnetic interference (EMI): Degradation of the performance compatibility EMI Electromagnetic interference ETSI European Telecommunications Standards Institute FM Frequency

Paris-Sud XI, Université de

146

NIST Special Publication 800-29 A COMPARISON OF THE SECURITY REQUIREMENTS  

E-Print Network [OSTI]

............................................................................... 5 2.1.8. Electromagnetic Interference/ Electromagnetic Compatibility (EMI/EMC) ................ 5 ............................................................................. 18 3.3.8. Electromagnetic Interference/Electromagnetic Compatibility (EMI/EMC) ............... 20

147

IEEE TRANSACTIONS ON ELECTROMAGNETIC COMPATIBILITY, VOL. 55, NO. 5, OCTOBER 2013 883 Characterization of Changes in LDO  

E-Print Network [OSTI]

sensitive to electromagnetic interference (EMI) coupled onto the power supply, with concomitant output--Ageing, electromagnetic compatibility (EMC), electromagnetic interference (EMI), immunity drift, low dropout (LDO) voltage

Paris-Sud XI, Université de

148

EMF Measurements, Surveys & Risk Assessment 115 Juliad Court, Suite 105 EMF Mitigation -Shielding & Cancellation Fredericksburg, VA 22406  

E-Print Network [OSTI]

the site. AC ELF Electromagnetic Interference (EMI) Electron microscopes (SEMs, TEMs, STEMs), Focus Ion (audio, video, telephone & data), electromagnetic induction generates electromagnetic interference (EMI

Ohta, Shigemi

149

A Demonstration of Tracking the Position of a Moving LEGO Train using the Cricket Indoor Location System  

E-Print Network [OSTI]

), electromagnetic interference (EMI), clock skew, and other problems associated with metallic interconnects

150

An MT-Style Optical Package for Optical Data Transmission  

E-Print Network [OSTI]

have created a new kind of problem called electromagnetic interference (EMI). To suppress the serious

Gan, K. K.

151

Fiber-based sensors by: Khanh Kieu  

E-Print Network [OSTI]

......................................................................................................................... 3 ACU-1000/TRP-1000 Unintended Electromagnetic Interference (EMI) Performance . 4 Summary

Kieu, Khanh

152

A fast-response microfiber coupler tip high temperature sensor Ming Ding*a  

E-Print Network [OSTI]

, and electrical sources like power supply noise, electromagnetic interference (EMI), or radia- tion from lightning

153

ORNL 2010-G01079/jcn UT-B ID 200701874  

E-Print Network [OSTI]

promises a significant reduction in inverter cost and volume, plus lower electromagnetic interference (EMI

154

Photonic Crystal Fibers Advances in Fiber Optics  

E-Print Network [OSTI]

susceptible to electromagnetic interference (EMI) from signals on neighbouring lines. From a speed perspective

La Rosa, Andres H.

155

Low Frequency Architecture for Multi-Lamp CCFL Systemswith Capacitive Ignition  

E-Print Network [OSTI]

uniformity degradation, and electromagnetic interference (EMI). The architecture i s capable of driving

156

26.1 / M. Doshi 26.1: Low-Frequency Square-Wave Drive for Large Screen LCD-TV  

E-Print Network [OSTI]

output current PSD to fit within designated FCC chimneys. Index Terms--Electromagnetic interference (EMI

157

Tryst With Excellence Indian Institute of Technology Bombay  

E-Print Network [OSTI]

Power System Analysis & Computation Power System Protection FACTS, HVDC & Power Quality EMI, EMC & EM

Narayanan, H.

158

Performance of Ultra-Scale Applications on Leading Vector and Scalar HPC Platforms  

E-Print Network [OSTI]

material science, astrophysics, and magnetic fu- sion. Wescience (PARATEC), astrophysics (Cactus), and magnetic

2005-01-01T23:59:59.000Z

159

Profit Maximization of Cognitive Virtual Network Operator in A Dynamic Wireless Network  

E-Print Network [OSTI]

the transmission price (deci- sion variable) and market state (exogenous stochastics). · Realistic cognitive radio

Huang, Jianwei

160

Project Summary Report 0-4086-S The University of Texas at Austin  

E-Print Network [OSTI]

ettringite formation (DEF) have been identified as the main causes. These mechanisms lead to expan- sion

Texas at Austin, University of

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Inhibition of Potential Lethal Damage Repair and Related Gene Expression after Carbon-ion Beam Irradiation to Human Lung Cancer Grown in Nude Mice  

Science Journals Connector (OSTI)

......Gy for X-ray and 5 Gy for car- bon-ion beam because each...after exposure to X-ray or car- bon-ion beams was reported...GCAGCCGCTATTACCGTATC TGTGCCAGTGTCATCATCAA Genes defective in diseases associated with...after exposure to X-ray or car- bon-ion beams has been observed......

Tomoyasu Yashiro; Kumiko Koyama-Saegusa; Takashi Imai; Takehiko Fujisawa; Tadaaki Miyamoto

2007-09-01T23:59:59.000Z

162

Souheir Mili et al., International Journal of Advances in Computer Science and Technology, 2(7), July 2013, 115-118 @ 2012, IJACST All Rights Reserved  

E-Print Network [OSTI]

the impact of electromagnetic interference (EMI) on the quality of a Global System for Mobile communications and identification system. Key words : GSM-R, GMSK, electromagnetic interference (EMI), railway, detection. 1

Boyer, Edmond

163

602 ACI Materials Journal/November-December 2010 ACI MATERIALS JOURNAL TECHNICAL PAPER  

E-Print Network [OSTI]

). PAN-based fiber with a diameter of 7 µm is effective for providing electromagnetic interference (EMI the electronics and the radiation sources. Most attention on electromagnetic interference (EMI) shielding

Chung, Deborah D.L.

164

Copyright 2012 IEEE, http://ieeexplore.ieee.org/xpl/articleDetails.jsp?arnumber=6130080 Towards Nonlinearity Measurement and Simulation  

E-Print Network [OSTI]

the immunity of systems to electromagnetic interference (EMI). The integrated circuit immunity model to electromagnetic interference (EMI) in an early stage. Specifically, we would like to be able to predict

Paris-Sud XI, Université de

165

618 IEEE TRANSACTIONS ON INDUSTRIAL ELECTRONICS, VOL. 49, NO. 3, JUNE 2002 A Comparative Study of Carrier-Frequency  

E-Print Network [OSTI]

-frequency modulation (CFM) techniques for the conducted electromagnetic interference (EMI) suppression in pulsewidth. The most direct way of solving electromagnetic interference (EMI) problems is to reduce the emission from

So, Hing-Cheung

166

530 IEEE TRANSACTIONS ON CIRCUITS AND SYSTEMS--I: REGULAR PAPERS, VOL. 57, NO. 3, MARCH 2010 Systematic Design of a Transimpedance Amplifier  

E-Print Network [OSTI]

are in good agreement with theory. Index Terms--Envelope detection, electromagnetic interference (EMI performance due to electromagnetic interference (EMI), EMC should be considered and incorporated in the design

Serdijn, Wouter A.

167

PERGAMON Carbon 39 (2001) 279285 Electromagnetic interference shielding effectiveness of carbon  

E-Print Network [OSTI]

PERGAMON Carbon 39 (2001) 279­285 Review Electromagnetic interference shielding effectiveness materials for electromagnetic interference (EMI) shielding are reviewed. They include composite materials-structural and structural composites, colloi- dal graphite, as well as EMI gasket materials. Electromagnetic interference

Chung, Deborah D.L.

168

Electromagnetic interference shielding using continuous carbon-fiber carbon-matrix and polymer-matrix composites  

E-Print Network [OSTI]

Electromagnetic interference shielding using continuous carbon-fiber carbon-matrix and polymer electromagnetic interference (EMI) shielding material with shielding effectiveness 124 dB, low surface impedance interference shielding 1. Introduction Electromagnetic interference (EMI) shielding is receiv- ing increasing

Chung, Deborah D.L.

169

Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Site for the Web Site for the I I ndirect and ndirect and S S emi emi - - D D irect irect A A erosol erosol C C ampaign ampaign (ISDAC) (ISDAC) Jason Tomlinson Pacific Northwest...

170

Resolution Improvement and Pattern Generator Development for the Maskless Micro-Ion-Beam Reduction Lithography System  

E-Print Network [OSTI]

c). High frequency electromagnetic interference (EMI) can bereducing the electromagnetic interference and cleaning theof the electromagnetic interference. The throughput

Jiang, Ximan

2006-01-01T23:59:59.000Z

171

3. ELECTROMAGNETIC COMPATIBILITY Abstract --The electromagnetic interference between the  

E-Print Network [OSTI]

walls and tubes) and with strong EMI (Electromagnetic Interference). So it is ideal to use the power

Paris-Sud XI, Université de

172

E-Print Network 3.0 - anchored carbon fiber Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

; Activated carbon; Carbon fibers; D. Electrical (electronic) properties Electromagnetic interference (EMI... ) shielding is increas- ... Source: Chung, Deborah D.L. -...

173

LOCOMOTIVE DATA ACQUISITION PACKAGE  

E-Print Network [OSTI]

densities; electromagnetic interference power spectraland vibration; electromagnetic interference; temperature;in the electromagnetic interference (EMI) shielding provided

Abbott, Robert K.

2011-01-01T23:59:59.000Z

174

ANALYSIS AND APPLICATION OF INDUCTANCE IN CLOCK DISTRIBUTION NETWORKS  

E-Print Network [OSTI]

Electromagnetic Interference . . . . . . . . . . . . . . .Systems and Electromagnetic Interference. John Wiley & Sons,A.1 On-chip Electromagnetic Interference EMI generated by

Hu, Xuchu

2012-01-01T23:59:59.000Z

175

Use of fly ash as an admixture for electromagnetic interference shielding Jingyao Cao, D.D.L. Chung*  

E-Print Network [OSTI]

Use of fly ash as an admixture for electromagnetic interference shielding Jingyao Cao, D.D.L. Chung The use of fly ash as an admixture results in enhancement of the electromagnetic interference (EMI of fly ash as an admixture for enhancing the electromagnetic interference (EMI) shielding. EMI shielding

Chung, Deborah D.L.

176

SURVEY OF EXISTING UNDERGROUND OPENINGS FOR IN-SITU EXPERIMENTAL FACILITIES  

E-Print Network [OSTI]

in divei sion tunnel area would requiri ~ 3000 ft of lateralin that area, considerable excavation (about 3000 feet)

Wollenberg, H.

2010-01-01T23:59:59.000Z

177

recruited from other Pediatric Oncology Group (POG) institutions before treatment began. Informed con-  

E-Print Network [OSTI]

at diagnoses, remis- sion, and relapse were compared with normal con- trols by the nonparametric Kruskal­Wallis

Eddy, Sean

178

2462 IEEE TRANSACTIONS ON AUTOMATIC CONTROL, VOL. 56, NO. 10, OCTOBER 2011 Distributed Multi-Actuator Control for Workload  

E-Print Network [OSTI]

, 2011; accepted March 17, 2011. Date of publication August 12, 2011; date of current ver- sion October

Wang, Yu

179

A teaching with technology showcase THINK-IN 2014  

E-Print Network [OSTI]

's, predicting plagiarism, 3D printing, and student feedback. There's more! We have added two panel discus- sions

180

SMOKEY THE BEAR SUTRA Gary Snyder  

E-Print Network [OSTI]

is threatened by advertising, air pollution, televi­ sion, or the police, they should chant SMOKEY THE BEAR

Alexander, Roger K.

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Old Oyo Influences on the Transformation of Lucum Identity in Colonial Cuba  

E-Print Network [OSTI]

The Bon Maroon Wars in Suriname. Leiden: E. J. Brill, 1990.and Musical Transformations in Suriname c. 1775 until afterand Susu Xylophones in Suriname. Paper presented at

Lovejoy, Henry B.

2012-01-01T23:59:59.000Z

182

Download  

Science Journals Connector (OSTI)

Sep 10, 1975 ... cepts radiant energy and uses it to pro- duce new ... Here we present an alternative derivation of Ban- ..... and particulate organic car- bon were...

2000-01-11T23:59:59.000Z

183

tel-00550139,version1-23Dec2010 tel-00550139,version1-23Dec2010  

E-Print Network [OSTI]

'ai eues avec bon nombre de chercheurs du DMSC. Merci à vous Bertrand, Christian, Daniel(s), Françoise

Paris-Sud XI, Université de

184

Download  

Science Journals Connector (OSTI)

Production of chlorinated hydrocarbons and methyl iodide by the red microalga. Porphyridium .... bons were extracted from the water samples by purging and.

1999-05-20T23:59:59.000Z

185

Status of NRC approval of EPRI electromagnetic interference susceptibility testing guidelines for digital equipment  

SciTech Connect (OSTI)

Historically, nuclear power plants installing digital equipment have been required to conduct expensive, site-specific electromagnetic interference (EMI) surveys to demonstrate that EMI will not affect the operation of sensitive electronic equipment. Consequently, EPRI formed a Utility Working Group which developed a set of generic EMI susceptibility testing guidelines, which were published as an EPRI report in September 1994. These guidelines are based upon EMI survey data obtained from several different plants and include criteria for determining their applicability. The Working Group interacted with NRC staff to obtain NRC approval. In April 1996, the NRC issued a Safety Evaluation Report (SER) endorsing the guidelines as a valid means of demonstrating EMI compatibility. The issuance of this SER was conditional on issuing a revision to the EPRI EMI Guidelines. This paper summarizes the guidelines, the NRC SER, and the current status of Revision 1 to the report.

James, R.W. [Electric Power Research Institute, Palo Alto, CA (United States); Shank, J.W. [Public Service Electric & Gas Company, Hancock`s Bridge, NJ (United States); Yoder, C. [Baltimore Gas & Electric, Lusby, MD (United States)

1996-12-31T23:59:59.000Z

186

Assessment and Mitigation of Diagnostic-Generated Electromagnetic Interference at the National Ignition Facility  

SciTech Connect (OSTI)

Electromagnetic interference (EMI) is an ever-present challenge at laser facilities such as the National Ignition Facility (NIF). The major source of EMI at such facilities is laser-target interaction that can generate intense electromagnetic fields within, and outside of, the laser target chamber. In addition, the diagnostics themselves can be a source of EMI, even interfering with themselves. In this paper we describe EMI generated by ARIANE and DIXI, present measurements, and discuss effects of the diagnostic-generated EMI on ARIANE's CCD and on a PMT nearby DIXI. Finally we present some of the efforts we have made to mitigate the effects of diagnostic-generated EMI on NIF diagnostics.

Brown, C G; Ayers, M J; Felker, B; Ferguson, W; Holder, J P; Nagel, S R; Piston, K W; Simanovskaia, N; Throop, A L; Chung, M; Hilsabeck, T

2012-04-20T23:59:59.000Z

187

Multi-Agent Based Techniques for Coordinating the Distribution of Electricity in a Micro-Grid Environment  

E-Print Network [OSTI]

vehicles, to ultra-low carbon vehicles (ULCV) such as hybrids, electric vehicles and hydrogen fuel cell. 2 Background Research To reduce carbon emissions and ensure that the UK low car- bon emissions plan to the current national grid, the in- creasing demand for electricity will only result in more car- bon emissions

Southampton, University of

188

Studies on Biological Effects of Ion Beams on Lethality, Molecular Nature of Mutation, Mutation Rate, and Spectrum of Mutation Phenotype for Mutation Breeding in Higher Plants  

Science Journals Connector (OSTI)

......rearrangements preferably induced by car- bon ions have different molecular...mutant, suv2-1, which is defective in cell-cycle arrest in response...Rearrangement of the DNA in car- bon ion-induced mutants...mutant in Arabidopsis thaliana is defective in the DNA damage response......

Atsushi Tanaka; Naoya Shikazono; Yoshihiro Hase

2010-05-01T23:59:59.000Z

189

Radiation-induced ICAM-1 Expression via TGF-?1 Pathway on Human Umbilical Vein Endothelial Cells; Comparison between X-ray and Carbon-ion Beam Irradiation  

Science Journals Connector (OSTI)

......expression in cells irradiated with car- bon-ion beam and the same...HUVE cells at 48 hours after car- bon beam irradiation. ICAM-1...human lymphoblasts and mice are defective in radiation- induced apoptosis...endothelial growth factor in lung car- cinoma cells. Int J Radiat......

Hiroki Kiyohara; Yasuki Ishizaki; Yoshiyuki Suzuki; Hiroyuki Katoh; Nobuyuki Hamada; Tatsuya Ohno; Takeo Takahashi; Yasuhiko Kobayashi; Takashi Nakano

2011-05-01T23:59:59.000Z

190

PUBLICATIONS, CONFERENCE PRESENTATIONS AND REPORTS Refereed Publications  

E-Print Network [OSTI]

Petroleum Technology, February 2008, Vol. 47, No.2, 52-61. 25. Bon, J., Sarma, H.K., Rodrigues, J.T. and Bon, J.G., "Reservoir Fluid Sampling Revisited - A Practical Perspective", SPE Reservoir Evaluation in SPE News Australasia, October/November 2003, Issue 79. 17. H.K. Sarma, N. Yazawa, R.G. Moore, S

Williams, John M.

191

High-temperature formation of concentric fullerene-like structures within foam-like carbon: Experiment and molecular dynamics simulation  

E-Print Network [OSTI]

car- bon ion implantation,4 and arc discharge from a carbon target in water.5 Onionlike structures of concentric fullerene-like structures, car- bon onions can be formed in a variety of harsh environments laser operating at 532 nm, generating 12 ps pulses at a rep- etition rate of 1.5 MHz, with average power

Powles, Rebecca

192

Estimation of Yields of OH Radicals in Water Irradiated by Ionizing Radiation  

Science Journals Connector (OSTI)

......simulations by Monte Car- lo method have...time being, an alternative approach may still...the spur. The energy Es to form a spur...a function of energy (keV/amu...protons, helium- , car- bon-, neon...Solution with Car- bon- and Nitrogen...Chemistry of High-Energy Carbon, Neon......

Hiroshi Yamaguchi; Yukio Uchihori; Nakahiro Yasuda; Masashi Takada; Hisashi Kitamura

2005-09-01T23:59:59.000Z

193

The relationship between electronmolecule collision cross?sections, experimental Townsend primary and secondary ionization coefficients and constants, electric strength and molecular structure of gaseous hydrocarbons  

Science Journals Connector (OSTI)

...and constants, electric strength and molecular...hydrogen atoms/car- bon{hydrogen...relevant electron energy range being deter...Townsend ionization; electric strength; molecular...length (i.e. car- bon nucleus...the same in the energy range of interest...Lond. A (2000) Electric characteristics...

2000-01-01T23:59:59.000Z

194

SANDAC V computer electromagnetic interface characteristics: Problems and solutions. [Sandia Airborne Computer (SANDAC)  

SciTech Connect (OSTI)

Electromagnetic Interference (EMI) problems have resulted in the redesign of the SANDAC V computer case and shielding of its connecting cables. In this report are detailed discussions on the use of computer models and of the tests performed to solve the EMI problems. Included is documentation on the specific changes made to the SANDAC V computer case and the shielding done on the connecting cables. Also documented are the current EMI capabilities relative to MIL Std. 461.

Russell, G.A.

1991-06-01T23:59:59.000Z

195

Low-Cost and Low-Electromagnetic-Interference Packaging of Optical Transceiver Modules  

Science Journals Connector (OSTI)

The low-cost and low-electromagnetic-interference (EMI) packaging of optical transceiver modules employing housings of plastic composites are developed and fabricated. Optical...

Cheng, Wood-Hi; Hung, Wen-Chi; Lee, Chien-Hui; Hwang, Gan-Lin; Jou, Wern-Shiang; Wu, Tzong-Lin

2004-01-01T23:59:59.000Z

196

E-Print Network 3.0 - acid gd-eob-dtpa-enhanced mri Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1 LSB) DNA Deoxyribonucleic Acid DNR... Factor EEG Electroencephalogram EMI Electromagnetic Interference EPI Echo-Planar ... Source: Boas, David - NMR Athinoula A. Martinos Center,...

197

DOE/ID-Number  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

work order DOE Department of Energy EMC electromagnetic compatibility EMI electromagnetic interference EPRI Electric Power Research Institute eWP electronic work package HVAC...

198

Power Conversion Apparatus and Method for Hybrid Electric and...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

promises a significant reduction in inverter cost and volume, plus lower electromagnetic interference (EMI) noise emissions, increased reliability, a higher constant power speed...

199

Traveler Information (Individual Responsible for the Export) Request Date  

E-Print Network [OSTI]

Televisions, Video Privacy, and Powerline Electromagnetic Interference Miro Enev University that the power supplies of modern TVs produce discernible electromagnetic interference (EMI) signatures

Bordenstein, Seth

200

E-Print Network 3.0 - analog-to-digital converters Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ARCHITECTURE FOR MASKED SUCCESSIVE Summary: performance, low power, and low electromagnetic interference (EMI) analog-to-digital converters (ADCs) has led... and A. Zayegh, "A...

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

E-Print Network 3.0 - asynchronous digital systems Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

where digital and analog circuits cohabit... of this study is to minimize electromagnetic interference (EMI) phenomena in ... Source: Ecole Polytechnique, Centre de...

202

EMG #121471 Electromagnetics, 25:679693, 2005  

E-Print Network [OSTI]

. Keywords electromagnetic compatibility, electromagnetic interference, aperture, cou- pling, finite compatibility (EMC) and electromagnetic interference (EMI) requirements, it is crucial to quantify

Ramahi, Omar

203

E-Print Network 3.0 - active carbon process Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

; Activated carbon; Carbon fibers; D. Electrical (electronic) properties Electromagnetic interference (EMI... in the composites is typically that ... Source: Chung, Deborah D.L....

204

Shielding Effectiveness Density Theory for Carbon Fiber/ Nylon 6,6 Composites  

E-Print Network [OSTI]

applications in electromagnetic interference and radio frequency interference, and is validated here, semiconductive (e.g., fuel gauges, etc.), and electromagnetic interference / radio frequency interference (EMI

Perger, Warren F.

205

E-Print Network 3.0 - activated carbon chemically Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

; Activated carbon; Carbon fibers; D. Electrical (electronic) properties Electromagnetic interference (EMI... in the composites is typically that ... Source: Chung, Deborah D.L....

206

E-Print Network 3.0 - ambient electromagnetic fields Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Analysis Techniques Summary: & Technology Introduction Products fail electromagnetic interference (EMI) tests. This can be a disappointing... , and antenna. No single method...

207

Power Electronics R&D  

Broader source: Energy.gov (indexed) [DOE]

* Reducing capacitance requirements by more than 50% * Reducing levels of electromagnetic interference (EMI) Managed by UT-Battelle for the Department of Energy 2 Responses to...

208

E-Print Network 3.0 - activated carbon treatment Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

; Activated carbon; Carbon fibers; D. Electrical (electronic) properties Electromagnetic interference (EMI... in the composites is typically that ... Source: Chung, Deborah D.L....

209

E-Print Network 3.0 - anti-rabies immunization employing Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

di Torino... @polito.it Abstract - In this paper the high immunity to electromagnetic interference (EMI) of complementary... immunity to radio frequency interference (RFI) is...

210

1. Shielding against Electromagnetic Interference With telecommunication networks connecting wireless devices around the globe, there  

E-Print Network [OSTI]

#12;1. Shielding against Electromagnetic Interference With telecommunication networks connecting electromagnetic interference (EMI) across the airwaves. These communication networks are ubiquitous and dynamic

Rincon-Mora, Gabriel A.

211

Noise Reduction and Design Methodology in Mixed-Signal Systems with Alternating Impedance Electromagnetic Bandgap (AI-EBG)  

E-Print Network [OSTI]

integrity as well as electromagnetic interference (EMI). In this paper, excellent noise suppression with AI, electromagnetic interference. I. INTRODUCTION The integration of wireless technologies in handset and mobile

Swaminathan, Madhavan

212

E-Print Network 3.0 - acid primovist-enhanced mri Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1 LSB) DNA Deoxyribonucleic Acid DNR... Factor EEG Electroencephalogram EMI Electromagnetic Interference EPI Echo-Planar ... Source: Boas, David - NMR Athinoula A. Martinos Center,...

213

Electrical, electromagnetic and structural characteristics of carbon nanotube-polymer nanocomposites  

E-Print Network [OSTI]

Composites for Electromagnetic Interference Shielding. NanoY. Ma, et al. Electromagnetic Interference (EMI) Shieldingof Bonn). Chung DDL. Electromagnetic interference shielding

Park, Sung-Hoon

2009-01-01T23:59:59.000Z

214

Carbon 40 (2002) 445467 Letters to the editor  

E-Print Network [OSTI]

Carbon 40 (2002) 445­467 Letters to the editor Increasing the electromagnetic interference; Activated carbon; Carbon fibers; D. Electrical (electronic) properties Electromagnetic interference (EMI

Chung, Deborah D.L.

215

E-Print Network 3.0 - averaged null energy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

, high density integrated circuits with low energy consumption and low electromagnetic interference (EMI... . In this paper, we propose the use of the NULL Convention Logic...

216

EF: Interference in communication (I) Numerical Simulation of Nonlinear Interference in Radio Systems  

E-Print Network [OSTI]

of inter- and intra-system electromagnetic interference (EMI). Using appropriate analysis and simulation Inter. Confer. on Electromagnetic Interference and Compatibility (INCEMIC'97), Dec. 3-5, Hyderabad

Loyka, Sergey

217

Electromagnetic Interference in Wireless Communications: Behavioral-Level Simulation  

E-Print Network [OSTI]

Electromagnetic Interference in Wireless Communications: Behavioral-Level Simulation Approach in electromagnetic interference (EMI) modeling and simulation for modern and future wireless communication systems

Loyka, Sergey

218

E-Print Network 3.0 - activated carbon particles Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

; Activated carbon; Carbon fibers; D. Electrical (electronic) properties Electromagnetic interference (EMI... in the composites is typically that ... Source: Chung, Deborah D.L....

219

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research  

E-Print Network [OSTI]

material sensing its own condition), electromagnetic interference shielding (blocking radio wave to sense its own condition), electromagnetic interference (EMI) shielding (the ability to block

Chung, Deborah D.L.

220

E-Print Network 3.0 - activated carbon process Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

; Activated carbon; Carbon fibers; D. Electrical (electronic) properties Electromagnetic interference (EMI... in the composites is typically that ... Source: Chung, Deborah D.L....

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Tetrides and Pnictides for Fast-Ion Conductors, Phosphor-Hosts, Structural Materials and Improved Thermoelectrics  

E-Print Network [OSTI]

state metathesis synthesis of metal silicides; reactions of497-501. Properties of Metal Silicides, in EMIS Datareview,and magnesium silicide with metal oxides. Polyhedron, 2002.

Hick, Sandra Marie

2013-01-01T23:59:59.000Z

222

E-Print Network 3.0 - advanced propulsion concepts Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on the field emission principle... advanced technology in power conversion. The main advantages of a propulsion system based on the field emis... AS THRUSTERS FOR ELECTRIC SPACE...

223

ANALYSIS AND APPLICATION OF INDUCTANCE IN CLOCK DISTRIBUTION NETWORKS  

E-Print Network [OSTI]

Distribution Network Background 2.1 Clock Network DesignClock distribution techniques for low-EMI design. Springerclock distribution in high-performance designs due to their

Hu, Xuchu

2012-01-01T23:59:59.000Z

224

Email Template  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Emy Laija, Environmental Protection Agency (EPA) announced that EPA met with the remedy review board regarding leaving Plutonium (Pu) waste on the plateau, and the Hanford...

225

E-Print Network 3.0 - aromatase inhibitor letrozole Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of gonads by the aromatase inhibitor Letrozole (CGS 20267) in Emys orbicularis, a turtle with temperature... . Several studies using treatments with exogenous estro- gens,...

226

Energy Management and Information Systems Study - 2014 BTO Peer...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

systems, including current market offerings, prior research and existing guides, the landscape of utility programs and incentives, and best practices in EMIS use and procurement....

227

Dimming-discrete-multi-tone (DMT) for simultaneous color control and high speed visible light communication  

Science Journals Connector (OSTI)

Visible light communication (VLC) using LEDs has attracted significant attention recently for the future secure, license-free and electromagnetic-interference (EMI)-free optical...

Sung, Jiun-Yu; Chow, Chi-Wai; Yeh, Chien-Hung

2014-01-01T23:59:59.000Z

228

Download  

Science Journals Connector (OSTI)

lowed by darkness (units given in list of symbols). ... the hypothesis lay in the discovery that the ..... scription based upon efficiency of energy conver- sion. J. Mar.

2000-03-10T23:59:59.000Z

229

SPECIAL ISSUE PAPER SESA: an efficient searchable encryption scheme for  

E-Print Network [OSTI]

significant attention in recent years. Smart grid can accelerate the integration of distributed energy suppliers, DERs, and microgrids [3], and thus, it potentially makes power generation, transmis- sion

Shen, Xuemin "Sherman"

230

Jordan-algebraic approach to convexity theorems for quadratic ...  

E-Print Network [OSTI]

We describe a Jordan-algebraic version of results related to convexity ... In section 2 we briefly describe Jordan-algebraic concepts related to our discus- sion.

2005-12-16T23:59:59.000Z

231

NEWGOOGIN2  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

a senior consultant to the Gaseous Diffu- sion Plants, was a senior investigator in the Gas Centrifuge Program, an advisor to the early Plasma Separation and Laser Isotope...

232

E-Print Network 3.0 - attenuating parasympathetic neurotransmission...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

that cotransmis- sion is an integral feature of neurotransmission... . A role for ATP as a cotransmitter in sympathetic, parasympathetic, sensory-motor, and enteric...

233

Inder Monga  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

virtual switch im- plementation managing a small optical transport network for big-data applications is described. With appropriate exten- sions to OpenFlow, we discuss how...

234

Conductance Quantization of Massless Dirac Fermions and the Synthesis, Characterization, and Manipulation of Graphene  

E-Print Network [OSTI]

sion cutting of nanotubes with a low-energy electron beam.energy gap is comparable to that found for similar Al/Pd contacts on nanotubes [

Girit, Caglar

2010-01-01T23:59:59.000Z

235

Robust Unit Commitment Problem with Demand Response and ...  

E-Print Network [OSTI]

Oct 29, 2010 ... sion, both Demand Response (DR) strategy and intermittent renewable ... Key Words: unit commitment, demand response, wind energy, robust...

2010-10-31T23:59:59.000Z

236

E-Print Network 3.0 - acute coronary occlusion Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

for Assessing Myocardial Injury in Rat Heart Summary: - rations of left coronary artery (LCA) occlusion with reperfu- sion using a high-resolution SPECT system... - ferent...

237

US research said to have provided basis of Britain's hydrogen bomb  

Science Journals Connector (OSTI)

... that successive ver-sions of the WE 177 were based on the American B57 and B61 weapons respec-tively. In quantitative terms he estimates

Colin Macilwain

1994-03-24T23:59:59.000Z

238

E-Print Network 3.0 - al complejo mycobacterium Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

- siones de enteros asociadas con complejos simpliciales. La ... Source: Skandera, Mark - Department of Mathematics, Lehigh University Collection: Mathematics 13 248 J La...

239

E-Print Network 3.0 - anti-herpes simplex virus Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

with herpes simplex virus (HSV).Using congenic strains of mice, we found that the lgh... immune factors influence the clinical expres- sion of herpes ... Source: Knipe,...

240

Energy Planning for Progressive Estimation in Multihop Sensor Networks  

E-Print Network [OSTI]

routing tree establishment, transmission energy plan- ninglarge gap of energy between the single-hop tree and therouting tree finding and the transmis- sion energy planning

Huang, Yi; Hua, Yingbo

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Fifth IEEE Workshop on Signal Processing Advances in Wireless Communications, Lisboa, Portugal, July 11-14, 2004 Impact of symbol transition density on timing estimation  

E-Print Network [OSTI]

/Catalan Science and Technology Commis- sions (CICYT/CIRIT): TIC2003-05482, TIC2002-04594, TIC2001- 2356, TIC2000

Riba Sagarra, Jaume

242

Download  

Science Journals Connector (OSTI)

The Washington Department of Wildlife per- mitted access to the Skagit Wildlife Area. K. Maekawa ...... sion and strong waves, winds, and currents. (e.g. Huettel...

1999-12-20T23:59:59.000Z

243

E-Print Network 3.0 - affects life history Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

41 Animal personalities and the divergence of life histories Summary: how life- history decisions that have already been made affect the costs and benefits of deci- sions......

244

E-Print Network 3.0 - advanced multimode radio Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Technologies and Information Sciences 3 Towards Symmetric Multimodality: Fusion and Fis-sion of Speech, Gesture and Facial Expression Summary: and mutual disambiguation of...

245

E-Print Network 3.0 - alters mitochondrial activity Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

is required for fission activity41 . The recruitment of Dnm1 to yeast mitochondrial fis- sion... of dynamics Mitochondrial fusion and fission activities are probably...

246

E-Print Network 3.0 - angulaire des particules Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de fission... distributions de masse et de la distribution angulaire des fragments de fis- sion des noyaux lourds a t... - eurs expriences de la distribution ... Source:...

247

Pipe diffusion at dislocations in UO2  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the fuel grain. Dislo- cations may also provide pathways for enhanced diffusion of fis- sion products, in particular, dislocations pinned to fission product precipitates may...

248

E-Print Network 3.0 - active personnel dosemeters Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Lists of staff... radioactivity 17 3.2. Uptake and loss of certain transuranium-, fis- sion- and activation nuclides by Mytilus Source: Ris National Laboratory Collection:...

249

E-Print Network 3.0 - asymmetric nucleon-induced fission Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

POLONICA B No 4 BIMODAL FISSION Summary: modes allows to describe observed asymmetric fis- sion of 256 Fm, as well as bimodal fission of 258 Fm... fission, respectively....

250

E-Print Network 3.0 - asymmetric mass region Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

mass hexadecapole mo- ments calculated... modes allows to describe observed asymmetric fis- sion of 256 ... Source: Magiera, Andrzej - Instytut Fizyki, Uniwersytet Jagiellonski...

251

E-Print Network 3.0 - asymmetrical fission type Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

POLONICA B No 4 BIMODAL FISSION Summary: modes allows to describe observed asymmetric fis- sion of 256 Fm, as well as bimodal fission of 258 Fm... fission, respectively....

252

E-Print Network 3.0 - activity protects mitochondrial Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

is required for fission activity41 . The recruitment of Dnm1 to yeast mitochondrial fis- sion... of dynamics Mitochondrial fusion and fission activities are probably...

253

E-Print Network 3.0 - activation requires mitochondrial Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

is required for fission activity41 . The recruitment of Dnm1 to yeast mitochondrial fis- sion... . Mitochondrial trans- port is required to distribute mitochondria throughout...

254

E-Print Network 3.0 - ammonia negative ion Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AND INTERSTELLAR ICES Summary: recently, it has been shown that the impact of 252Cf fis- sion fragments on solid ammonia produced negative... dissociative ionization of the...

255

say  

Science Journals Connector (OSTI)

Does resuspen- sion prevent a shift to a clear state in shallow lakes .... VOLLENWEIDER, R. A. 1968. Scientific fundamentals of the eutro- phication of lakes and...

2006-01-09T23:59:59.000Z

256

Sea-Change from Bush to Clinton: Setting a New Course for Offshore Oil Development and U.S. Energy Policy  

E-Print Network [OSTI]

renewable energy, advanced nuclear reactors, fu- sion, coal, natural gas, a natural resource policy, basic science and moderating world population growth." ' '

Wilder, Robert Jay

1993-01-01T23:59:59.000Z

257

E-Print Network 3.0 - autophagy genes protect Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

that starvation induced the tran- scription of several autophagy genes... ). To test whether TFEB regulated the expres- sion of autophagy ... Source: Gleeson, Joseph G. -...

258

E-Print Network 3.0 - af cd fra Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

til det tidligere European Wind Atlas', vil p grund af datamngden udkomme i CD-rom ver- sion... - placerede vindmlleparker af Sten Frandsen og Jrgen Hjstrup 10...

259

Mode Analyses  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

- fu- sion triple product (blue), computer performance (red), and particle accelerator energy (green). Source: Ref. (3) . . . . . . . . . . . . . . 2 1.2 Schematic...

260

High-Performance Wavelet Compression for Mammography ...  

E-Print Network [OSTI]

processing library (XIL; Sun Microsys- tems) and a volume file format (SunVi- sion; Sun Microsystems). A dialog box on a monitor (Sun Microsystems) with a.

2005-11-29T23:59:59.000Z

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

MODELING OF PLANE-WAVE INCIDENCE ON A TWISTED-WIRE PAIR BUNDLE FOR RF INGRESS ESTIMATION IN DIGITAL SUBSCRIBER LINE SYSTEMS  

E-Print Network [OSTI]

is electromagnetic interference (EMI) caused by external radio sources that operate in the same frequency band) system consisting of a bundle of twisted-wire pairs (TWPs) in the presence of electromagnetic interference (EMI) is presented. The objective of such a model is to analyze the susceptibility of TWP bundles

262

The influence of single-walled carbon nanotube structure on the electromagnetic interference shielding  

E-Print Network [OSTI]

The influence of single-walled carbon nanotube structure on the electromagnetic interference.01­15%) have been evaluated for electromagnetic interference (EMI) shielding effectiveness (SE) in the X and aerospace sectors with uses such as electrostatic dissipation, electromagnetic interference (EMI) shielding

Gao, Hongjun

263

Asia Pacific Symposium of Applied Electromagnetics and Mechanics (APSAEM2010) Kuala Lumpur, Malaysia, 28-30th  

E-Print Network [OSTI]

, Malaysia, 28-30th July 2010 Reducing Electromagnetic Interference in Non-Isolated DC to DC Step JAMALUDIN*2 Investigation of the Electromagnetic interference (EMI) is important for design of a good power: electromagnetic interference, power converter, EMI, ohmic heating, high frequency. 1. Introduction In order

Hammerton, James

264

Constitution (1987). Haitian French Creole  

E-Print Network [OSTI]

jistis tout bon vre. 3. Konstitisyon sa a la, pou peyi d Ayiti kanpe solid, pou li kanpe an fm, an pami tout nasyon. Pou li pa restavk okenn lot peyi. Pou li kenbe tou sa ki f Ayisyen, se Ayisyen tout bon, ni nan sa yo mete konfyans yo ladan, ni... nan jan yo viv, ni nan fason youn svi ak 1L 4. Konstitisyon sa a la, pou demokrasi pouse bon rasin nan peyi a. Pou tout moun gen dwa suiv lide yo lib. Pou direksyon peyi a pa toujou rete nan men menm moun ak menm gwoup moun tout tan. Pou psonn...

1994-01-01T23:59:59.000Z

265

MATH 531: Statistical Methods II Spring 2012 Department of Applied Mathematics and Statistics, CSM Syllabus  

E-Print Network [OSTI]

for the development of valid regres- sion models will be covered. Analysis of covariance and one and two: 1. Understand the settings wherein simple linear regression, multiple linear regres- sion software package of your choosing) to perform re- gression analysis of real data sets. #12;Course Outline

266

ACDA: LBJ Supports Agency Plea for Bigger Budget, Longer Life; but Old Problems Still Remain  

Science Journals Connector (OSTI)

...Announcements The U.S. Atomic Energy Commis-sion is soliciting...being accepted for summer internships for graduate stu-dents...propagation. (M. S. Green, Chief, Statistical...The U.S. Atomic Energy Commis-sion has announced...charge. (U.S. Atomic Energy Com-mission, P.O...

Elinor Langer

1965-02-05T23:59:59.000Z

267

A study on control of accumulators in web processing lines Prabhakar R. Pagilla, Inderpal Singh, and Ramamurthy V. Dwivedula  

E-Print Network [OSTI]

that includes accumulator carriage dynamics, average web ten- sion dynamics in accumulator web spans with an observer for web ten- sion is proposed. It is shown that the proposed feedback controller results- tion, a process section, and an exit section. The entry section consists of an unwind stand, a tension

Pagilla, Prabhakar R.

268

Novel Complexes Featuring Unusual Polynuclear Co(III)-Fe(III...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

E.N. Chygorin, O.V. Nesterova, J.A. Rusanova, V.N. Kokozay, V.N. Bon (Kiev University, Ukraine), R. Boa, (Trnava University, Slovakia) Fig. 2. 77 K Mssbauer spectrum of the...

269

PROPOSITION (Allocation de  

E-Print Network [OSTI]

appliquées) avec un gout pour la théorie et des compétences avérées en programmation. Un bon niveau de

Jeanjean, Louis

270

Supercomputer Analysis of Sedimentary Basins  

Science Journals Connector (OSTI)

...expelled from source rocks, hydrocar-bons...accumulate into petroleum reservoirs. Reservoirs may form in rocks that resisted compaction...In Eq. 1, + is porosity, a and, 3 are...kz are directional permeabilities,, u is fluid viscosity...

CRAIG M. BETHKE; STEPHEN P. ALTANER; WENDY J. HARRISON; CRAIG UPSON

1988-01-15T23:59:59.000Z

271

Detecting and quantifying oxygen functional groups on graphite nanofibers by fluorescence labeling  

E-Print Network [OSTI]

as adsorbents for small organic molecules from aqueous streams [5], electrodes for fuel cells [6], hydrogen 0008 that was detected by FLOSS on nitric acid-oxidized GCNFs totaled approximately 2.5% of surface car- bon, present

Borguet, Eric

272

Glucose Fermentation Pathway of Thermoanaerobium brockii  

Science Journals Connector (OSTI)

...the growth phase, cell suspensions were...toluene-treated cell suspensions were...L-lactate, acetate, hydrogen, and car- bon dioxide production...Clostridium pasteurianum. Cell extracts also contained...catabolic amounts of hydrogen- ase, phosphotransacetylase...

R. Lamed; J. G. Zeikus

1980-03-01T23:59:59.000Z

273

Aerosol Science and Technology, 44:11401145, 2010 Copyright American Association for Aerosol Research  

E-Print Network [OSTI]

application in fuel cells and sensors involving adsorp- tion and dissociation of hydrogen, oxygen, and various. Activated carbon, car- bon nanotubes (CNTs), carbon nanosheets, and silica (SiO2) gel have often been

Huang, Jiaxing

274

Investigation into the Effect of Surface Treatment on the Wettability and the Bondability of Low Surface Energy Materials  

Science Journals Connector (OSTI)

An experimental effort has been undertaken to examine the effect of surface treatment on various low surface energy thermoplastic materials to promote wettability and ... measurements were correlated with the bon...

J. P. Jeandrau

1984-01-01T23:59:59.000Z

275

Bibliography and Index of the Literature on Gas Chromatography1964 November 1, 1963 to November 1, 1964  

Science Journals Connector (OSTI)

......Abstract) 941 GAS-SOLID ADSORPTION...HYDROCAR- BONS AND NITROGEN HETEROCYCLES...FRESH - AND SALT WATER ALGAE, Klenk...DEVICE FOR A GAS CHROMATOGRAPH...April 1964) 1080 SOLUBILITY IN WATER OF PARAFFIN...CORRELATION OF GAS CHROMATO- GRAPHIC......

Mignon Gill; Seaton T. Preston; Jr.

1964-12-01T23:59:59.000Z

276

portation and Greenhouse Gas (MUNTAG) model is a macroscopic, highly aggregate model that works at the municipal level and solely  

E-Print Network [OSTI]

identifies the following four sectors: buildings; trans- portation and land use; energy supply; and municipal GHG inventory. This work is part of a project to write a guide called Getting to Car- bon Neutral

Illinois at Chicago, University of

277

Three-dimensional spatial coordinates of individual plankton ...  

Science Journals Connector (OSTI)

A highly unsaturated fatty acid predicts car- bon transfer ... 2,400 ml of water, at 750 mm depth, can be analysed with a resolution ..... power of the technique.

1910-00-71T23:59:59.000Z

278

The Jovian system: the last outpost for life?  

Science Journals Connector (OSTI)

......and other sources of energy. This material accumulated...methane, ammonia and car- bon dioxide. However...time. In addition, energy sources available on...atmosphere interface. An alternative energy source to surface-based......

Julian Hiscox

1999-04-01T23:59:59.000Z

279

POLZ, MARTIN F., JONATHAN J. ROBINSON, COLLEEN M ...  

Science Journals Connector (OSTI)

efficiently the abundant yet ephemeral local energy sources, primarily geothermally .... parative analyses of the ratios of the stable isotopes of car- bon and nitrogen. ..... Our experiments were designed to test the two alternative hypotheses that...

280

Site-specific and ontogenetic variations in nutrition of mussels ...  

Science Journals Connector (OSTI)

a consistent energy source throughout their life or if they switch trophic modes depending on ... a significant contribution of photosynthetically derived car- bon. As postmetamorphic ..... alternative hypothesis is that larval and postlarval carbon

1999-03-11T23:59:59.000Z

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Tumor Induction in Mice Locally Irradiated with Carbon Ions: A Retrospective Analysis  

Science Journals Connector (OSTI)

......dose fractionation nor linear energy transfer affected tumor induction...700 patients by Year 2004. Car- bon ions, high LET (linear energy transfer) radiation, are...penumbra near collimators. Alternative explanation for the linear......

Koichi Ando; Sachiko Koike; Chisa Oohira; Toshiaki Ogiu; Fumio Yatagai

2005-06-01T23:59:59.000Z

282

the page - American Society of Limnology and Oceanography  

Science Journals Connector (OSTI)

May 28, 1981 ... We thank A. F. Carlucci and C. C. Price for providing the cultures and K. J. ..... threne (a fossil fuel aromatic hydrocar- bon) show essentially zero...

2000-02-08T23:59:59.000Z

283

Purification de l'hexafluorure d'uranium.  

E-Print Network [OSTI]

??Lhexafluorure duranium (UF6), est le seul compos utilis ltat gazeux dans les procds denrichissement pour la production du combustible nuclaire. Pour le bon droulement (more)

Benzouaa, Rachid

2014-01-01T23:59:59.000Z

284

Padova, 29 novembre 2010 Arturo Lorenzoni  

E-Print Network [OSTI]

energy technologies have to give proper answers to 2 main challenges in the long term. We need to find the sustainable soluBons to the energy supply conundrum. Most energy companies have very short Bme horizons due to stock

Schenato, Luca

285

fois, ils semblent aussi impliqus dans une tape postrieure l'initiation qui est la promo-  

E-Print Network [OSTI]

E.A. & Recknagel R.O. (1983) Carbon tetrachloride and bromotrichloromethane toxi- city. Dual role.A., Fernan- dez Y. & Mitjavila S. (1986) Radical activation of car- bon tetrachloride in foetal and maternal

Paris-Sud XI, Université de

286

Tribology International 40 (2007) 345349 A comparative study on the structure and hardness enhancement  

E-Print Network [OSTI]

by a combination of soft BON film and hard TiN film using low- (100 kHz) and high (13.56 MHz)-frequency RF plasma) substrate by low and high RF frequency plasma-assisted metal­organic chemical vapor deposition rights reserved. Keywords: Hard coatings; A-BON/nc-TiN bilayers; PAMOCVD; Low- and high-frequency RF

Boo, Jin-Hyo

287

Response of radio frequency superconducting quantum interference devices to electromagnetic interference  

SciTech Connect (OSTI)

A number of applications of high-temperature superconductor radio frequency superconducting quantum interference devices (rf SQUIDs) require a certain immunity of these sensors against electromagnetic interference (EMI). We have investigated effects of electromagnetic radiation in the high-frequency and ultrahigh-frequency range on various types of rf SQUIDs. It has been found that EMI of sufficient field strength reduces the voltage versus flux transfer function, and thus increases the flux noise of the SQUIDs. SQUIDs with a wire wound tank circuit coil have been found to be more sensitive to EMI than SQUIDs integrated into a superconducting microstrip resonator. {copyright} {ital 1995} {ital American} {ital Institute} {ital of} {ital Physics}.

Mueck, M.; Dechert, J.; Gail, J.; Kreutzbruck, M.; Schoene, S.; Weidl, R. [Institut fuer Angewandte Physik, Justus-Liebig-Universitaet Giessen, Heinrich-Buff-Ring 16, 35392 Giessen (Germany)] [Institut fuer Angewandte Physik, Justus-Liebig-Universitaet Giessen, Heinrich-Buff-Ring 16, 35392 Giessen (Germany)

1995-09-01T23:59:59.000Z

288

Characteristics of electromagnetic interference generated during discharge of Mylar samples  

SciTech Connect (OSTI)

This paper discusses the measurements of the electromagnetic interference (EMI) generated during discharges of Mylar samples. The two components of EMI, the conducted emission and the radiated emission, are characterized by the replacement current and the radiated RF spectrum respectively. The measured radiated RF spectra reveal important information on the source of the electromagnetic radiation. The possible sources are the replacement current pulse and the discharged generated plasma. The scaling of the amplitudes of the EMI, as a function of the area of the test sample, is also discussed.

Leung, P.L.

1984-12-01T23:59:59.000Z

289

Epilogue: Rational Exuberance for Renewable Energy  

Science Journals Connector (OSTI)

Ethanol as a fuel/fuel-blend has been a success story in Brazil and select other countries; ethanol is an octane enhancer and fuel-ethanol blends help reduce hydrocarbon, carbon-di-oxide and nitrogen oxide emi...

Srinivasan Sunderasan

2011-01-01T23:59:59.000Z

290

ACEEE Int. J. on Electrical and Power Engineering, Vol. 03, No. 01, Feb2012 DOI:01.IJEPE.03.01.39  

E-Print Network [OSTI]

requirement of loads operating at 50Hz and 400Hz simultaneously. A permanent magnet synchronous alternator [2, Dual Frequency Alternator, EMI Filter, Dual Rotor Shaft, Excitation Rectifier, Weapon system

Paris-Sud XI, Université de

291

MEMORANDUM FOR DISTRIBUTION FROM: SUBJECT:  

Office of Environmental Management (EM)

EE-I Huizenga, David G.; Senior Advisor, Office of Environmental Management, EM-I Smith, Chris; Acting Assistant Secretary, Office of Fossil Energy, FE- I Geiser, David W.;...

292

Life-Cycle GHG Emissions From Conventional IC Engine Vehicles and EVs: A Comparative Assessment  

Science Journals Connector (OSTI)

In the USA, the federal fuel economy standards are set to get tougher by 35 % over the next five years. In July 2009, leaders of the European Union and G8 announced an objective to reduce greenhouse gas (GHG) emi...

Arghya Sardar; Suresh Babu Muttana

2012-12-01T23:59:59.000Z

293

Problematic of estimating GHG emissions in Logistics Company  

Science Journals Connector (OSTI)

According to OECD GHG emission database[2], the transportation sector occupies 13.1% of global GHG emission and 23% of global energy use ... Therefore, logistics companies should absolutely struggle with GHG emis...

YeoJu WON; SeungWoo KANG; SeongIl UM

2012-01-01T23:59:59.000Z

294

Letters to the Editor / Carbon 41 (2003) 13091328 1313 [9] Yamada K, Sawaoka AB. Carbon 1994;32:66573. [13] Weissmantel C, Bewilogua K, Dietrich D, Erler H-J, Hinner-  

E-Print Network [OSTI]

, Sansalone F. J Appl Phys Lett 1976;29:118­20. Improving colloidal graphite for electromagnetic interference and coating (by plating) for electromagnetic interference (EMI) shielding. It is forms [13,14]. Carbon

Chung, Deborah D.L.

295

2338 IEEE TRANSACTIONS ON POWER ELECTRONICS, VOL. 30, NO. 4, APRIL 2015 Optically Switched-Drive-Based Unified Independent  

E-Print Network [OSTI]

as well. Index Terms--Active gate drive, di/dt, dv/dt, electromagnetic interference (EMI), gallium. However, this leads to higher di/dt and dv/dt, which in turn, causes higher electromagnetic interference

Mazumder, Sudip K.

296

JOURNAL DE PHYSIQUE Colloque CZ, supplment au n 12, Tome 43, dcembre 1982 page C3-471  

E-Print Network [OSTI]

performance, low power, and low electromagnetic interference (EMI) analog-to-digital converters (ADCs) has led applications, NCL and other self-timed circuits have shown reduced Electromagnetic Interference effects

Boyer, Edmond

297

40 Gb/s Data Transmission Over a 1 m Long Multimode Polymer Spiral Waveguide for Board-Level Optical Interconnects  

E-Print Network [OSTI]

-based interconnects when operating at high data rates, such as electromagnetic interference (EMI), limited bandwidth and large power consumption, have led to the consideration of the use of optical technologies in high-speed board-level communication links [4...

Bamiedakis, Nikolaos; Chen, Jian; Westbergh, Petter; Gustavsson, Johan S.; Larsson, Anders; Penty, Richard V.; White, Ian H.

2014-11-20T23:59:59.000Z

298

An EM Interference-Aware Routing Algorithm for Wireless Sensor Networks in Clinical Environments Gowdemy Rajalingham, Thanh-Ngon Tran, Quang-Dung Ho, and Tho Le-Ngoc  

E-Print Network [OSTI]

protocol that attempts to reduce electromagnetic interference (EMI) introduced., "Electromagnetic Interference aware Adaptive Routing for Wireless Communication Networks in electromagnetic- interference-sensitive medical environments," Annali dell'Istituto Superiore di

Barthelat, Francois

299

Feasibility and electromagnetic compatibility study of the ClearPEM front-end electronics for simultaneous PET-MR imaging  

E-Print Network [OSTI]

electromagnetic interference (EMI) effects between both systems were evaluated on a 7 T magnet by characterizing. Materials and methods The mutual electromagnetic interference tests between Clear- PEM front-end electronics

Dalang, Robert C.

300

Materials Science and Engineering A 491 (2008) 397411 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

21005-5069, United States c Fraunhofer Ernst-Mach-Institut (EMI), Efringen-Kirchen, Germany a r t i c l Development and Engineering Center in Warren, MI, have Corresponding author at: 241 Engineering Innovation

Grujicic, Mica

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

RAP- Transcribed Flipcharts  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

What is the impact to operations? o Place at end of agenda for flexibility o Jerry Peltier? * Central Plateau White Paper o Open Forum o Emy will send Page 7 October * CP Inner...

302

Technology Alert List From the U.S. Department of State  

E-Print Network [OSTI]

, including gaseous diffusion, centrifuge, aerodynamic, chemical, Electromagnetic Isotopic Separation (EMIS), Laser Isotope Separation (LIS) · Spent fuel reprocessing, plutonium, mixed oxide nuclear research countermeasures and systems · New or novel explosives and formulations · Automated explosive detection methods

Guenther, Frank

303

Advanced Combustion Concepts - Enabling Systems and Solutions...  

Broader source: Energy.gov (indexed) [DOE]

ins talled and vehicle available for application, emis s ion and fuel economy optimization. 5 G as oline S ys tems | 5172013 | 2013 R obert B os ch LLC and affiliates ....

304

Hong Kong, China Employers Perspectives on a Carbon-Constrained Economy and How Technical and Vocational Education and Training Should Respond  

Science Journals Connector (OSTI)

One representative of the electricity-generating sector explained that the governments target of a 25% energy reduction by 2030 could be achieved. For example, fuel consumption could be reduced by 1% per...2 emi...

Rupert Maclean; Eric Tsang; John Fien

2013-01-01T23:59:59.000Z

305

Active carbon filter health condition detection with piezoelectric wafer active sensors  

E-Print Network [OSTI]

Active carbon filter health condition detection with piezoelectric wafer active sensors Jingjing Chemical Biological Center, 5183 Blackhawk Road, APG, MD USA 21010 ABSTRACT The impregnated active carbon in active carbon filters by combining the electromechanical impedance spectroscopy (EMIS

Giurgiutiu, Victor

306

Microsoft Word - 2010_0309_RAP_MeetingSummary_FINAL.doc  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of the CLUP with the WAC code. Emy suggested taking focus off of the CLUP completely. Boyd Hathaway, (DOE-RL), said the CLUP has the authority for DOE because it was created by...

307

An electron source with a multiarc plasma emitter for obtaining submillisecond pulsed megawatt beams  

Science Journals Connector (OSTI)

An electron source with a plasma emitter based on an...2...area. The arc-current amplitude for each cathode amounts to 100300 A. Under the action of a constant accelerating voltage applied between the plasma emi...

M. S. Vorobev; S. A. Gamermaister; V. N. Devyatkov

2014-06-01T23:59:59.000Z

308

Analysis of the electrical noise from the APS kicker magnet power supplies  

SciTech Connect (OSTI)

The APS kicker magnet power supplies deliver damped sinusoidal currents in excess of 2400A peak with a half-period of 300ns to the kicker magnets. Conducted and radiated electromagnetic interference (EMI) is created by this system in the low megahertz range. This interference affects a number of beam diagnostics in the APS injector. The sources and coupling mechanisms for the EMI generated by this system are described and solutions discussed.

Carwardine, J.A.; Wang, J.

1995-07-01T23:59:59.000Z

309

Electromagnetic interference from transmission lines located in central region of Saudi Arabia  

SciTech Connect (OSTI)

This paper discusses the electromagnetic interference (EMI) generated by transmission lines operating in the Central Region of Saudi Arabia. These lines have operating voltages of 132, 230 and 380 kV and are located in a hot, dry arid desert land where precipitaton is very low. Measurements of typical EMI characteristics such as frequency spectrum, lateral profile and statistical variation are performed for each type of line and results are analyzed. It is found that general noise characteristic of these lines are similar to those reported in the literature for other lines which are located in relatively wet environment. The results further show that if operating gradients are low, the increase of EMI due to rain is lower than 20 dB value usually observed. The presence of sand and dust storms does not increase EMI level in any appreciable manner. The fair weather EMI level of these lines can be predicted with reasonable accuracy by using the CIGRE formula. Results are also presented for power line carrier related EMI.

Al-Arainy, A.A.; Malik, N.H.; Abdul-Aal, L.N.

1988-01-01T23:59:59.000Z

310

Electromagnetic interference from transmission lines located in central region of Saudi Arabia  

SciTech Connect (OSTI)

This paper discusses the electromagnetic interference (EMI) generated by transmission lines operating in the Central Region of Saudi Arabia. These lines have operating voltages of 132, 230 and 380 kV and are located in a hot, dry arid desert land where precipitation is very low. Measurements of typical EMI characteristics such as frequency spectrum, lateral profile and statistical variation are performed for each type of line and results are analyzed. It is found that general noise characteristic of these lines are similar to those reported in the literature for other lines which are located in relatively wet environment. The results further show that if operating gradients are low, the increase of EMI due to rain is lower than 20 dB value usually observed. The presence of sand and dust storms does not increase EMI level in any appreciable manner. The fair weather EMI level of these lines can be predicted with reasonable accuracy by using the CIGRE formula. Results are also presented for power line carrier related EMI.

Al-Arainy, A.A.; Malik, N.H.; Abdul-Aal, L.N.

1989-01-01T23:59:59.000Z

311

Donald Frederick, LLNL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Donald Donald Frederick, LLNL - Presented at Supercomputing '11 Lawrence Livermore National Laboratory, P. O. Box 808, Livermore, CA 94551! Case Study: Beyond Homogeneous Decomposition with Qbox Scaling Long-Range Forces on Massively Parallel Systems LLNL---PRES---508651 Case S tudy: O utline * Problem D escripBon * ComputaBonal A pproach * Changes f or S caling LLNL---PRES---508651 Computer s imulaBons o f m aterials Computer s imulaBons a re w idely used t o p redict t he p roperBes o f new m aterials o r u nderstand t he properBes o f e xisBng o nes LLNL---PRES---508651 SimulaBon o f M aterials f rom F irst--- Principles First---principles m ethods: Calculate p roperBes o f a g iven m aterial d irectly f rom fundamental p hysics e quaBons. * No e mpirical p arameters Can m ake p redic-ons a bout c

312

Unique Mechanical Properties of Carbon Nanotube Film-Solid State Interfaces J. R. Gladden1  

E-Print Network [OSTI]

gravitational waves [1] while small quartz resonators are used to keep time in a wrist watch. With the explosion resonators and, as will be discussed later, the preci- sion of these instruments is determined by the quality

Gladden, Josh

313

E-Print Network 3.0 - angiotensin system effects Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sion resulted in a systemic increase of blood... , University of Utah, Salt Lake City, Utah To investigate the local effects of angiotensin II on the heart, we... of this...

314

Influence of embedded-carbon nanotubes on the thermal properties of copper matrix nanocomposites processed  

E-Print Network [OSTI]

-level mix- ing, exhibits CNTs homogeneously dispersed in the Cu matrix. Measured thermal conductivity: Metal matrix composites; Nanocomposite; Carbon and graphite; Thermal conductivity Carbon nanotubes (CNTs management applications, due to their extraordinarily low coefficient of thermal expan- sion (CTE) [1

Hong, Soon Hyung

315

Targeting Tyrosine Kinases and Autophagy in Prostate Cancer  

E-Print Network [OSTI]

kinases and cellular signaling in prostate cancer. In: ChungW, Simons J (eds) Prostate cancer: biology, genetics and theexpres- sion in prostate cancer cells. Endocrinology 142:21

Kung, Hsing-Jien

2011-01-01T23:59:59.000Z

316

Power Control and Transmission Scheduling for Network Utility Maximization in Wireless Networks  

E-Print Network [OSTI]

Power Control and Transmission Scheduling for Network Utility Maximization in Wireless Networks Min power control and transmis- sion scheduling problem in wireless networks with average power constraints. Index Terms--Network utility maximization, power control, transmission scheduling, column generation I

Sharma, Vinod

317

Fusion Prospects  

Science Journals Connector (OSTI)

...Ermesto Mazzucato Princeton Plasma Physics Laboratory, Princeton University, Princeton, NJ 08543, USA E-mail: mazzucato@pppl.gov Several recent letters proclaim once again the superior promise that thermonuclear fu-sion offers for future large-scale...

Ernesto Mazzucato

1996-02-16T23:59:59.000Z

318

Comparing Student Test Scores  

Science Journals Connector (OSTI)

...Ermesto Mazzucato Princeton Plasma Physics Laboratory, Princeton University, Princeton, NJ 08543, USA E-mail: mazzucato@pppl.gov Several recent letters proclaim once again the superior promise that thermonuclear fu-sion offers for future large-scale...

Andrew Ahlgren

1996-02-16T23:59:59.000Z

319

Influence of Affinity and Antigen Internalization on the Uptake and Penetration of Anti-HER2 Antibodies in Solid Tumors  

Science Journals Connector (OSTI)

...the extent of penetration into tissue, and...depends on the rate of drug elimination...increase tissue penetration by synthesizing...MTX dissociation rates. MATERIALS AND...slower diffu sion rate, its penetration distance increased...

Stephen I. Rudnick; Jianlong Lou; Calvin C. Shaller; Yong Tang; Andres J.P. Klein-Szanto; Louis M. Weiner; James D. Marks; and Gregory P. Adams

2011-03-15T23:59:59.000Z

320

Ryder, G., Koeberl, C., and Mojzsis, S.J. (2000) Heavy bombardment of the Earth at -3.85 Ga: The search for petrographic and geochemical evidence, In: Origin of the Earth  

E-Print Network [OSTI]

-elementanalyses(e.g.,Irabun- dance)of theoldestsedimentson Earthcould be usedto indicatepastescalatedinfluxesof to as the HadeanEon (Cloud, 1976, 1988; Harland et al., 1989; Taylor;2000), which is a chronostratic division (Fig divi- sions of Archean Eon and

Mojzsis, Stephen J.

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Environmental Health Policy Decisions: The Role of Uncertainty in  

E-Print Network [OSTI]

1998 Abstract Regulatory reform will increasingly call for more economic analysis in deci- sions about of environmental health. The present article follows this train of thought while noting that regulatory reform

Washington at Seattle, University of

322

GeodynamicsWhere Are We and What Lies Ahead?  

Science Journals Connector (OSTI)

...Iran, Brazil, Peru, New Caledo-nia, Czechoslovakia, Canada, Japan, and the United States. Perhaps the most important...evidence frm geophysics and paleogeophysics, appear likely to leed to healthy discus-sions about the nature of the interior in...

Charles L. Drake; John C. Maxwell

1981-07-03T23:59:59.000Z

323

Closing the Gap: Using the Clean Air Act to Control Lifecycle Greenhouse Gas Emissions from Energy Facilities  

E-Print Network [OSTI]

control technology.1 46 sions from the list of regulated hazardous air pollutantsAir Act includes "only those pollutants subject to a statutory or regulatory provision that requires actual control

Hagan, Colin R.

2012-01-01T23:59:59.000Z

324

Gordon Research Conferences  

Science Journals Connector (OSTI)

...conver-sion ofmethanol to olefin and aromatics." 1 July. Oil shale, shale oil and kerogen (V. Dean Allred, discussion leader...Neto, "Chemistry and geochemistry of Brazilian oil shales"; Francis P. Miknis, 'The nature ofbitumen intermediates...

ALEXANDER M. CRUICKSHANK

1986-03-07T23:59:59.000Z

325

Linear Operators and Their Spectra Web Supplement, version 25  

E-Print Network [OSTI]

Linear Operators and Their Spectra Web Supplement, version 25 E Brian Davies Department, but the author has permis- sion to put a copy on the web, in the hope that some readers may be encouraged to buy

Davies, Brian

326

Linear Operators and Their Spectra Web Supplement, version 32  

E-Print Network [OSTI]

Linear Operators and Their Spectra Web Supplement, version 32 E Brian Davies Department, but the author has permis- sion to put a copy on the web, in the hope that some readers may be encouraged to buy

Davies, Brian

327

SOLAR SYSTEM Lethalbilliards  

E-Print Network [OSTI]

have been produced by a colli- sion within the asteroid belt3 . An asteroid or comet shower has)andChesapeakeBayofftheMary- land coast (around 85 km in diameter). Andwecangoevenfartherbackinrecording periods of heavy

Claeys, Philippe

328

Rationale for cost-effective laboratory medicine.  

Science Journals Connector (OSTI)

...expendi- tures had become an important political issue (6). The conclu- sion had been...based on probability theory, iatrogenic risks, clini- cal decision making, cost...unknown. This can alleviate the premature investment in capital equipment or new personnel...

A Robinson

1994-04-01T23:59:59.000Z

329

Download  

Science Journals Connector (OSTI)

his car to the Yale library. . . . I seem to remcmbcr that I was trying to find ... sions in both time and space are missing from our data. One striking phenomenon that.

2000-02-13T23:59:59.000Z

330

Gordon Research Conferences  

Science Journals Connector (OSTI)

...Process chemistry consider-ations for gold recovery from alkaline cya-nide solutions...membrane reactors"; M. Hoare, "Protein recovery by precipitation/microfiltration...discus-sion leader): Robert Charles Allen, "Water in epoxy resins. Thermodynamics and swell-ing...

ALEXANDER M. CRUICKSHANK

1986-03-07T23:59:59.000Z

331

Gordon Research Conferences  

Science Journals Connector (OSTI)

...New methods of measure-ments of water and water-vapor transmission through fabrics...discus-sion session Sedimentation and condensation: B. Feuerbacher, discussion...models of models?" P. Germann, "Water flow in forest soils at the profile...

Alexander M. Cruickshank

1991-03-01T23:59:59.000Z

332

Sahel Will Suffer Even if Rains Come  

Science Journals Connector (OSTI)

...Carnegie-Mellon University. Eli Reshotko, engineering, Case Western Reserve University; Domi-nick J. Sanchini, Rocketdyne Divi-sion, Rockwell International Corp., Canoga Park, Calif.; John H. Schmertmann, Schmertmann & Crapps, Inc...

JOHN WALSH

1984-05-04T23:59:59.000Z

333

A framework for benchmarking land models  

E-Print Network [OSTI]

their inclu- sion in Earth system models (ESMs). State-of-land models cou- pled to Earth system models should simulateland models within Earth system models, however, can help

2012-01-01T23:59:59.000Z

334

Journal of Biological Dynamics Vol. 3, No. 1, January 2009, 2238  

E-Print Network [OSTI]

infusions, and our numerical simulations provide clinical strategies for insulin­administration practices for the constant glucose exogenous infusion (enteral nutrition or constant infu- sion), f2(G) stands

Kuang, Yang

335

Resolution-Exact Algorithms for Link Robots Zhongdi Luo1  

E-Print Network [OSTI]

Resolution-Exact Algorithms for Link Robots Zhongdi Luo1 , Yi-Jen Chiang2 , Jyh-Ming Lien3 predicates for link robots, a novel "T/R splitting method" for subdivi- sion, and feature-based search

Chiang, Yi-Jen

336

--No Title--  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

in 1962 for the assembly of preci- sion mechanical components. It was then applied to the pharmaceutical in- dustry to manufac- ture safer drugs and to medical industry to...

337

Avian Research at the Savannah River Site: A Model For Integrating Basic Research and Long-Term Management  

E-Print Network [OSTI]

... Savannah River Site: implications for habitat management and nuclear waste site remediation ... I. Lehr Brisbin, Jr., and Robert A. ... The resulting discus- sions improved our collective understanding of the research/management interaction, and even- tually ...

338

Security decision-making among interdependent organizations R. Ann Miura-Ko, Benjamin Yolken, John Mitchell, and Nicholas Bambos  

E-Print Network [OSTI]

the same passwords at several independent web sites, security deci- sions by one organization may have- ments of others. We apply this framework to investigate three examples: web site security with shared

Mitchell, John C.

339

E-Print Network 3.0 - acute suprasystolic occlusion Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

for Assessing Myocardial Injury in Rat Heart Summary: - rations of left coronary artery (LCA) occlusion with reperfu- sion using a high-resolution SPECT system... Tc-GLA. The...

340

E-Print Network 3.0 - acute intercostal artery Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

for Assessing Myocardial Injury in Rat Heart Summary: - rations of left coronary artery (LCA) occlusion with reperfu- sion using a high-resolution SPECT system... Tc-GLA. The...

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Nota Bene ~ News ~ Centenary of the Day Missions Library  

E-Print Network [OSTI]

, periodicals, works pre- pared by missionaries for the use of the peoples of mis- sion fields, and literature for the Library but essential Roman Catholic books and periodica ls \\...,ere also acquired. Because of its early

342

MATERIALS AND MOLECULAR RESEARCH DIVISION. ANNUAL REPORT 1980  

E-Print Network [OSTI]

Conver sion of 1 Vacuum flash pyrolysis, 0.05 torr, quartzother si on of 1 Vacuum flash pyrolysis, 0.05 torr, quartz2i were subjected to flash vacuum pyrolysis at low contact

Searcy, Alan W.

2010-01-01T23:59:59.000Z

343

EROSION-CORROSION-WEAR PROGRAM  

E-Print Network [OSTI]

MD, Oct. 1979. dl. Oil Shale Retort Components" A. Levy andCorrosion of Metals in Oil Shale Retorts,'' AS! v! WESTEC 'of metals in coal and oil shale conver- sion environments

Levy, Alan V.

2013-01-01T23:59:59.000Z

344

The chemical transport model Oslo CTM3  

E-Print Network [OSTI]

sion estimates over South America from 2006 to 2010, J. Geo-biomass burn- ing in South America in 2005 observed duringand overesti- mated in South America, but these biases are

2012-01-01T23:59:59.000Z

345

The Evolution of California State Water Planning 1850-1928  

E-Print Network [OSTI]

sion of Water Ri ghts and State Water Commi ss ion, NovemberNovember Report of the State Water Problems Conference,Le islature of 1931 on State Water Plan, 1930, Division of

Jackson, W. Turrentine; Pisani, Donald J

1983-01-01T23:59:59.000Z

346

Conservation Assessment for the Big Bend-Ro Bravo Region 19 Aquatic and  

E-Print Network [OSTI]

the Sierra Madre Occidental in Chihuahua, Mexico, and provides up to 75 percent of the flow downstream of Pre- sidio, Texas, and Ojinaga, Chihuahua. Dams and diver- sions throughout the basin, in addition

Pasternack, Gregory B.

347

0022-1767/87/13810-3319802.00/0 CopyrightIB 1987by The American As80clatlonof Immunologists  

E-Print Network [OSTI]

with leukocyte adhesion (detected by monoclonal anti- body H4/18),a rapid but sustainedincreased expres- sion for publication February 6. 1987. payment of page charges. This article must therefore be hereby marked The costs

Springer, Timothy A.

348

E-Print Network 3.0 - airway surface dehydration Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

13, 231... history: Accepted 7 May 2008 Keywords: Pulmonary airway closure Liquid lining Surface tension a b s t r... the surface ten- sion of the film and helps the ... Source:...

349

E-Print Network 3.0 - airway surface hydration Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: history: Accepted 7 May 2008 Keywords: Pulmonary airway closure Liquid lining Surface tension a b s t r... the surface ten- sion of the film and helps the fluid to...

350

E-Print Network 3.0 - airway surface liquid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: history: Accepted 7 May 2008 Keywords: Pulmonary airway closure Liquid lining Surface tension a b s t r... the surface ten- sion of the film and helps the fluid to...

351

Modeling  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sion effects. We show the result of a test case, and compare it to the result without surface tension. The model describes droplet formation nicely. Application The ARRA-funded...

352

MATERIALS AND MOLECULAR RESEARCH DIVISION. ANNUAL REPORT 1981  

E-Print Network [OSTI]

and total Immer sion 1n shale oil on the corrosion of steel1013 steel. Exposure to shale oil at 300 C for 100 hoursof Materials in In-situ Oil Shale Retorting Environments,"

Authors, Various

2010-01-01T23:59:59.000Z

353

EROSION-CORROSION-WEAR PROGRAM  

E-Print Network [OSTI]

will also be conducted in shale oil product material. 1979MD, Oct. 1979. dl. Oil Shale Retort Components" A. Levy andof metals in coal and oil shale conver- sion environments

Levy, Alan V.

2013-01-01T23:59:59.000Z

354

Scalable Coordination for Wireless Sensor Networks: Self-Configuring Localization Systems  

E-Print Network [OSTI]

networks: tuning density to trade operational quality against lifetime; using multi- ple sensor modalities, water, soil, chemistry); condition based maintenance; smart spaces; military surveillance; preci- sion or urban locations). The above requirements impose substantial physical constraints at both the node

Heidemann, John

355

Gordon Research Conferences  

Science Journals Connector (OSTI)

...S. Witkowski, "Review of laser fusion research at Garching." Discus-sion...Ahlstrom, "Experiments relevant to laser fusion." Discussion. 20 Auiglust...E. Beckner, "A Comparison of laser fusion and e-beam fusion." Discussion...

Alexander M. Cruickshank

1975-03-14T23:59:59.000Z

356

Physics with Leptons in ATLAS  

Science Journals Connector (OSTI)

......are an important decay mode for a Higgs boson with a mass range Higgs boson. Extending to MSSM, two Higgs...exclu- sion limits for charged Higgs boson pro- duction from top quark decays......

Saminder Dhaliwal

2012-03-01T23:59:59.000Z

357

Optical constants of cosmic carbon analogue grains I. Simulation of clustering by a modified continuous distribution of ellipsoids  

Science Journals Connector (OSTI)

......following condi- tions: (i) arc discharge between amorphous carbon electrodes...mbar (ACAR sample); (ii) arc discharge between the same type of electrodes...unit ten- sion of the applied electric field (Bohren & Huffman 1983......

V. G. Zubko; V. Mennella; L. Colangeli; E. Bussoletti

1996-10-11T23:59:59.000Z

358

Improved Battery Models of an Aggregation of Thermostatically Controlled Loads for Frequency Regulation  

E-Print Network [OSTI]

Integration and Regulating Reserve Service Vast and deep integration of renewable energy resources into the existing power grid is essential in achieving the envi- sioned sustainable energy future. Environmental, stochasticity, and intermittency characteristics of renewable energies, however, present challenges

Sanandaji, Borhan M.

359

COAL LIQUEFACTION STUDIES USING PHOSPHORIC ACID AT MODERATE TEMPERATURES AND PRESSURES  

E-Print Network [OSTI]

the fact that the treated coal ash amount of not present sion-exchange mechanism. the coal ash structure, The sulfursince intimate catalyst and the coal~ash contacting can be

McLean, J.B.

2010-01-01T23:59:59.000Z

360

Megatectonics of the Coast Ranges, California  

Science Journals Connector (OSTI)

...folding is shearing well casings and buckling surface pipelines. There are, however, numer...sions and must be a factor in global tectonics. In the Coast Ranges...San Andreas fault has played in global tectonics. In this paper, an...

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

E-Print Network 3.0 - airborne heavy metals Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

61 Subpart H: National Emission... - sions, and Table 4-1 presents the airborne release data from each of these facilities during 2003... County Article 12, which regulates storage...

362

A review of "Dynasty and Diplomacy in the Court of Savoy." by Toby Osborne  

E-Print Network [OSTI]

notes, did not always work towards obvious goals. Instead, he operated within a developing political culture that prized contacts, friendships, and artistic patronage. Osborne, in this last instance, makes much of the fact that Scaglia commis- sioned...

Michael R. Lynn

2003-01-01T23:59:59.000Z

363

UNDERGRADUATE CATALOG EDITION 137 TEXAS A&MU N I V E R S I T Y  

E-Print Network [OSTI]

and radiological health engineering are accredited by the Engineering Accreditation Commis- sion of ABET, www by the Commission on Dental Ac- creditation (CODA). The nursing degree program is accredited by the Commission

364

PUBLISHED OCCASIONALLY BY THE FRIENDS OF THE BANCROFT LIBRARY UNIVERSITY OF CALIFORNIA, BERKELEY, CALIFORNIA 94720  

E-Print Network [OSTI]

, cases and procedures in the office of the District Attorney of Alameda County, state finance, executive, with the Governor under pressure of deci- sion-making and their ensuing cabbages- and-kings conversations, that mark

California at Berkeley, University of

365

DOE'S ENERGY DATA BASE (EDB) VERSUS OTHER ENERGY-RELATED DATA BASES: A COMPARATIVE ANALYSIS  

E-Print Network [OSTI]

Energy Commis sion. Mien the TIC became part of the Energy27, 1981 EDB sources TIC processes 20,000 DOE reports In JTo supplement its own efforts, TIC contracts with other

Robinson, J.

2010-01-01T23:59:59.000Z

366

S e c t i o n F o u r Information  

E-Print Network [OSTI]

- sions: Biology; Chemistry and Chemical Engineering; Engineering and Applied Science; Geological. Giapis Chemistry Prof. D. Dougherty Civil Engineering Profs. N. Lapusta and T. Heaton Computation biophysics, bioengineering, biology, chemistry, civil engineering, computer science, environmental sci- ence

Greer, Julia R.

367

Rapid Analysis of Lewisite Metabolites in Urine by High-Performance Liquid Chromatography-Inductively Coupled Plasma-Mass Spectrometry  

Science Journals Connector (OSTI)

......six-week period to demonstrate the long-term previ- sion and accuracy of the...chemical weapon becomes hazardous waste. Chem. Eng. Prog. 101: 64...C. Le. Sample preparation and storage can change arsenic spe- ciation......

Rayman D. Stanelle; William J. McShane; Elena N. Dodova; R. Steven Pappas; Robert J. Kobelski

2010-04-01T23:59:59.000Z

368

National Aeronautics and Space Administration,Ames Research Center,Moffett Field,CA www.nasa.gov  

E-Print Network [OSTI]

- Ongoing monthly events Page 15 - Classifieds On the Inside . . . Insulation material named `NASAKay, a Phoenix mis- sion co-investigator who explained to the audience that Phoenix will search the Martian ice

369

Published: January 19, 2011 r 2011 American Chemical Society 1824 dx.doi.org/10.1021/ja107090n |J. Am. Chem. Soc. 2011, 133, 18241831  

E-Print Network [OSTI]

applications in batteries and fuel cells. The consistent direction of orientation of the lamellar oxides for electrochemical energy conver- sion in fuel cells and batteries, which often contain layered com- pounds

370

Zoogeography and systematics of the shallow water echinodermata of Texas  

E-Print Network [OSTI]

, Curacao, Florida, Jamaica, Mexico, sippi, Montserrat, North Carolina, Puerto Rico, South na, St. Thomas, Surinam, Texas, Venezuela, West Africa 15), Bathymetric range - to 80 M, Discus but do sion: This species is not as common as L. clathrata, es...

Pomory, Christopher Mark

2012-06-07T23:59:59.000Z

371

Intraarticular expression of biologically active interleukin 1-receptor-antagonist protein by ex vivo gene transfer  

Science Journals Connector (OSTI)

...indica rejection of Therefore tografted IF noviocytes infected wit contralateral tions, IRAP that the auto ticularly for sion fell...1993) Proc. Natl. Acad. Sci. USA 90, 3539- 3543. 11. Price, J., Turner, D. & Cepko, C. (1987) Proc. Natl. Acad...

G Bandara; G M Mueller; J Galea-Lauri; M H Tindal; H I Georgescu; M K Suchanek; G L Hung; J C Glorioso; P D Robbins; C H Evans

1993-01-01T23:59:59.000Z

372

NSLS-II Achieves First Stored Electron Beam Brookhaven scientists and  

E-Print Network [OSTI]

, design, construction, and commis- sioning of Brookhaven's newest facility by the Photon Sciences staff data from the LHC's ATLAS experiment and presented their results via live videoconference from BNL

373

E-Print Network 3.0 - apomictic brachiaria brizantha Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

This grass was imported as seed and planted to control ero- sion along a new... ). PALAU: Babeldaob I., Aimeliik, 7.4028N, 134.509E, on Brachiaria decumbens, 12 October 2004,...

374

Gordon Research Conferences  

Science Journals Connector (OSTI)

...hydrothermal ore deposits"; Dennis Norton, "Thermal in-duced stresses in hydrothermal ore...Shawhan, discussion lead-er): R. Sudan, "Spectral equations for fully developed...discus-sion leader): M. Tinkham, "Thermal noise, shot noise and chaos in Josephson...

Alexander M. Cruickshank

1985-03-01T23:59:59.000Z

375

Simple Constructive Weak Factorization - Department of ...  

E-Print Network [OSTI]

as the union of open subschemes Vgi. = Ugi . The algebra. K[Vgi ]? = K[V ]? gi. = K[U]gi the localization of K[V ] so there is an open inclu- sion Vg/? ? U/? and...

2008-10-12T23:59:59.000Z

376

Discrimination Between Earthquakes and Underground Explosions Employing an Improved Ms Scale  

Science Journals Connector (OSTI)

......propagation, available Nevada Test Site explosion yields are...in the California-Nevada region, J. geophys...propagation, availableNevada Test Site explosion yields are...Halliday (1970) and Nevada Test Site (NTS) explo- sion......

P. D. Marshall; P. W. Basham

1972-06-01T23:59:59.000Z

377

Gordon Research Conferences  

Science Journals Connector (OSTI)

...adsorp-tion on silicon oxide surfaces...the sintering of silicon carbide"; R...and corrosion of silicon carbide and nitride." Coatings and...Zircaloy oxidation in steam at high-temperature...High-temperature erosion-corro-sion of...

Alexander M. Cruickshank

1977-03-11T23:59:59.000Z

378

E-Print Network 3.0 - asymmetric mass distribution Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the potential energy landscape on the fission dynamics K. Mazurek1,2,a Summary: of the fis- sion valley (red dashed lines in the Fig. 1) is presented in Fig. 2 in the plane q1,...

379

LANL: AOT & LANSCE The Pulse July 2013  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

in nuclear physics from Comenius University, Slovakia. During his PhD he studied ternary fis- sion and heavy ion fusion-fission nuclear reactions leading to superheavy elements....

380

E-Print Network 3.0 - asymmetric fission barriers Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

POLONICA B No 4 BIMODAL FISSION Summary: modes allows to describe observed asymmetric fis- sion of 256 Fm, as well as bimodal fission of 258 Fm... - particle states for the...

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

E-Print Network 3.0 - averts agency funds Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: of the RESTRAT Project FI4P-CT95-0021a (PL 950128) co-funded by the Nuclear Fis- sion Safety Programme... the International Atomic Energy Agency (IAEA) and the...

382

E-Print Network 3.0 - asymmetric scission properties Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of 256 Fm, 258 Fm, and 260 Fm isotopes... modes allows to describe observed asymmetric fis- sion of 256 Fm, as well as bimodal fission ... Source: Magiera, Andrzej - Instytut...

383

E-Print Network 3.0 - actinides fission products Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

fission with a large mass asymmetry within the self-consistent HFB theory. A new fis- sion valley... of this fission mode corresponds to the expected one in cluster...

384

The Future of Atomic Energy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

neu- c':: j,:,; trons will be produced, In .their turn they will give rise to a second fis- sion, and proauee two neutrons each and so ,on; ' , ' then double at each step or...

385

Graphene flakes with defective edge terminations: Universal and topological aspects, and one-dimensional quantum behavior  

E-Print Network [OSTI]

Graphene flakes with defective edge terminations: Universal and topological aspects, and one graphene nanoflakes with reconstructed zigzag edges, where a succes- sion of pentagons and heptagons these spectra. The electronic spectra of trigonal graphene nanoflakes with reczag edge terminations exhibit

Yannouleas, Constantine

386

Autonomy, control, processing and dissemination: getting data to the scientists, affordably  

Science Journals Connector (OSTI)

...ensure success. Geostationary-weather-satellite, space-science and satellite-navigation...ensure success. Geostationary-weather-satellite, space-science and satellite-navigation...operational mis- sions such as weather satellites because of the 24 hours a day...

2003-01-01T23:59:59.000Z

387

Renzo Tomellini, EC Directorate General for Research and innovation...  

Broader source: Energy.gov (indexed) [DOE]

sionA6TzimasECJRC.ppt More Documents & Publications Trans-Atlantic Workshop on Rare Earth Elements and Other Critical Materials for a Clean Energy Future Ideas for...

388

E-Print Network 3.0 - array bido kansoku Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sions are unknown at Delphi compile time, in such a way that an arbitrary element can... -dimensional arrays, these do not interface easily with S; the static version requires that...

389

VOLUME  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

with expectations 5 for stochastic magnetic field diffu- sion, except the electron heat loss in the outer region of the plasma occurs at the ion rate 6. Since tearing...

390

A Discourse Information Radio News Database for Linguistic Analysis  

E-Print Network [OSTI]

of speech; 9 speakers: 5m, 4f), which were annotated for pitch accents and prosodic boundaries following GTo and a slightly deviating written ver- sion. The annotation layers are the results of two different processing

Reyle, Uwe

391

E-Print Network 3.0 - alters bicarbonate transport Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: not exchange readily with atmospheric CO2. Instead, it is transported by water run-off to rivers and... in complete conver- sion of consumed CO2 to bicarbonate in...

392

ELSEVIER JournalofCrystalGrowth166(1996)779-785 ,........ CRYSTAL  

E-Print Network [OSTI]

treatment and solar-energy conver- sion, storage capacitors in DRAMs, insulators in MOS devices. Roshko b J.B. Rothman c G.S. Rohrer d a DuPont Company, Experimental Station, Wilmington, Delaware 19880

Rohrer, Gregory S.

393

Representinga nd Modifying dissertation submitted  

E-Print Network [OSTI]

. European Workshop on Content­Based Multim edia Indexing, CBMI'99, October 1999. Journ al ver­ sion published in Multim edia Tools and Applications,14(3), July 2001. [10] B. Moghaddam, H. Bierman n , D

Mohri, Mehryar

394

Identification of cardioviruses related to Theiler's murine encephalomyelitis virus in human infections  

Science Journals Connector (OSTI)

...the patient and consenting household members were interviewed...affected patient and consenting household members for diagnostic...004) and more likely to be Hispanic (86% vs. 83%, respectively...PK, Parsonnet J (2005) Household transmis-sion of gastroenteritis...

Charles Y. Chiu; Alexander L. Greninger; Kimberly Kanada; Thomas Kwok; Kael F. Fischer; Charles Runckel; Janice K. Louie; Carol A. Glaser; Shigeo Yagi; David P. Schnurr; Tom D. Haggerty; Julie Parsonnet; Don Ganem; Joseph L. DeRisi

2008-01-01T23:59:59.000Z

395

Outside Review of the Doctoral Program of the Department of Chemistry and Biochemistry of Texas Technical University (TTU)  

E-Print Network [OSTI]

observed no desire to remain static. There is also a deci- sion-making process in place to support with the internal and external reviewers present and again on February 6 among internal reviewers. The review team

Rock, Chris

396

Journal of Algebra 285 (2005) 669681 www.elsevier.com/locate/jalgebra  

E-Print Network [OSTI]

-dominant dimension coincides with that of (ordinary) dominant dimen- sion. Tachikawa in [12] showed the following result, which is due to Tachikawa (see [12]). Corollary 1.4. dom.dim() = dom.dim(). Let M

Huang, Zhaoyong

397

Avoiding Maternity: Reproductive Practices in 1930s Rio de Janeiro  

E-Print Network [OSTI]

sion, being put up in 77 Rua da Estrella [sic]. There,acolhida na casa n. 77 da rua da Estrella [sic]. Al [sic],6Z.16784 (1933). todos na rua comen- taram o caso, Rita

Roth, Cassia Paigen

2011-01-01T23:59:59.000Z

398

Cellulose biosynthesis and function in bacteria.  

Science Journals Connector (OSTI)

...for obtaining enhanced or reduced expres- sion by genetic engineering; as mentioned above, the genes for cellulose synthesis reside...food stabilizers (102a), and acoustic diaphragms for audio instruments (80a). Eventually, the wide availability of...

P Ross; R Mayer; M Benziman

1991-03-01T23:59:59.000Z

399

A Comparison of Time-Space Schemes for Graphical Models Robert Mateescu and Rina Dechter  

E-Print Network [OSTI]

models that can accom- modate trade-offs between time and space: 1) AND/OR Adaptive Caching (AOC(i)); 2 show that AOC(i) is better than the vanilla ver- sions of both VEC(i) and TDC(i), and use the guid- ing principles of AOC(i) to improve the other two schemes. Finally, we show that the improved ver- sions of VEC

Dechter, Rina

400

A review of "Elizas Babes: or The Virgins Offering [1652]." by Liam E. Semler, ed.  

E-Print Network [OSTI]

with the works of other women poets?Sidney, Wroth, Lanier, Southwell, Bradstreet, Cavendish, Behn, Phillips, Barker, Chudleigh, Ephelia, and Finch--in any decent undergradu- ate library. Semler?s diligent research facilitates the comprehen- sion of a vanished... with the works of other women poets?Sidney, Wroth, Lanier, Southwell, Bradstreet, Cavendish, Behn, Phillips, Barker, Chudleigh, Ephelia, and Finch--in any decent undergradu- ate library. Semler?s diligent research facilitates the comprehen- sion of a vanished...

Hugh Wilson

2002-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

A review of "Cherished Torment: The Emotional Geography of Lady Mary Wroths Urania." by Sheila T. Cavanagh  

E-Print Network [OSTI]

, Ephelia, and Finch--in any decent undergradu- ate library. Semler?s diligent research facilitates the comprehen- sion of a vanished era. Sheila T. Cavanagh. Cherished Torment: The Emotional Geography of Lady Mary Wroth?s Urania. Pittsburgh: Duquesne..., Ephelia, and Finch--in any decent undergradu- ate library. Semler?s diligent research facilitates the comprehen- sion of a vanished era. Sheila T. Cavanagh. Cherished Torment: The Emotional Geography of Lady Mary Wroth?s Urania. Pittsburgh: Duquesne...

Judith Scherer Herz

2002-01-01T23:59:59.000Z

402

Investigation of Soap Powders  

E-Print Network [OSTI]

in the presence of such a large excess of NajjSO* as is usually present, does not give a sharp end point, but a gradual fading from yellow to pink so that some little practice is necessary before the operator can hit the end point accurately. Practice does... and soap. Bon Ami Manufactured by Bon Ami Company, New York, I. Y. Wt. 10 ounces Price 10 cents. Analysis. Moisture .......... 0.28# Soap 6.54# Albite 93,18# Total 100.00^ IT. B. Albite is an orthoclase of the following composition: Si0 2 68...

Bragg, G.A.

1913-01-01T23:59:59.000Z

403

Ann bay lodyans 5 / se Bryant Freeman ("Tonton Liben") ki pare ti liv sa a  

E-Print Network [OSTI]

genyen. Tijo we yon tig ki te tonbe nan yon gwo twou. Li pa t kapab soti paske twou a fon. Kounye a tig la prizonye. Li di Tijo: "Ou se yon bon ti gason, ede m soti, souple." Tijo reponn: "Si mwen retire ou nan twou a, ou ap manje m." Tig la di: "O... non, bon ti pitit mwen, mwen p ap manje ou. Pa panse sa, non." Tijo mande li: "Eske ou ap pwomet mwen ou p ap manje m?" "Wi, pwomes fet," tig la di I avek gwo vwa li. Tijo ede tig la soti nan twou a. Le tig la fin soti, li vole sou T i j...

Freeman, Bryant C.

2000-01-01T23:59:59.000Z

404

Haitian Creole-English English-Haitian Creole Medical Dictionary  

E-Print Network [OSTI]

; orifice, aperture b * corner of mouth - anba upside down chire, ~ manje sores at comer of mouth - dlo salivation * fann harelip, cleft lip; cleft palate - Il anm, ~ II pa bon, ~ II pa gou to have no appetite ~ Il f dio to make one's mouth...

Freeman, Bryant C.

1992-01-01T23:59:59.000Z

405

Geophysical Research Abstracts Vol. 14, EGU2012-PREVIEW, 2012  

E-Print Network [OSTI]

was monitored to trace the effectiveness of artificial recharge, based on boron isotopes, to better determine (Cape Bon, Tunisia): insights from Boron isotopes. L. Cary (1), J. Casanova (1), A. Mekni (2,3), N. Sodium, potassium and boron were clearly in deficit compared to a mixing line with seawater, whereas

Paris-Sud XI, Université de

406

Glacioeustatic Transgressive Reflux: Stratiform Dolomite in Pennsylvanian Bioherms of the Western Orogrande Basin, New Mexico  

Science Journals Connector (OSTI)

...mound rocks from the Virgilian Panther Seep Formation, Hembrillo Canyon...suggesting that, in general, car-bon in the dolomites was derived...alteration of dolomite: A review: Car-bonates and Evaporites, v...Simo, T., eds., Advances in Car-bonate Sequence Stratigraphy...

Gerilyn S. Soreghan; Michael H. Engel; Roger A. Furley; Katherine A. Giles

407

LATTER-DAY TAXIDERMY  

Science Journals Connector (OSTI)

...supposition that he had obtained a compound of car-bon and alumina he gave it the name...by him. For example, a reclini'ng panther, with young, on the whole a fine piece...staff, at one of the entrances, and a panther, in bronaze, within, are examples of...

Vernon L. Kiellogge

1893-09-15T23:59:59.000Z

408

The Molecular Fossil Record of Oleanane and Its Relation to Angiosperms  

Science Journals Connector (OSTI)

...well-defined, organic-rich, fine-grained sedimentary rocks. Commonly...environments contain organic matter derived from...with total organic car-bon...of thermal maturation are minimized...Magdalena Basin, Co-lombia...material from Illinois, United...

J. Michael Moldowan; Jeremy Dahl; Bradley J. Huizinga; Frederick J. Fago; Leo J. Hickey; Torren M. Peakman; David Winship Taylor

1994-08-05T23:59:59.000Z

409

Substrate Utilization by an Oxalate-Consuming Spirillum Species in Relation to Its Growth in Ozonated Water  

Science Journals Connector (OSTI)

...assimilable organic car- bon compounds (AOC), were calculated from the obtained Nmax values and the Y values for acetate. The AOC concen- trations for both strains were...with each oth- er. In ozonated water, AOC concentrations available for strain NOX...

D. van der Kooij; W. A. M. Hijnen

1984-03-01T23:59:59.000Z

410

O P I N I O N Biogenic vs. geologic carbon emissions and forest  

E-Print Network [OSTI]

greenhouse gas (GHG) accounting of woody biomass energy generation. While there are many other environmental, biogenic carbon, carbon debt, forest biomass, greenhouse gas accounting Received 20 April 2011; revised the amount of car- bon in the cycle'. This view recently has been reiterated by many (e.g. Hale, 2010; Lucier

Vermont, University of

411

RALLYE MATHMATIQUE D'AUVERGNE 2013  

E-Print Network [OSTI]

résoudre. Bon courage à tous ! Françoise Barachet, IA-IPR en mathématiques Jean-Alain Roddier, IA-IPR en posées, l'argumentation, la présentation. Conception et Rédaction : IREM, APMEP, IUFM, IA­IPR de

Sart, Remi

412

Role of PeptidePeptide Interactions in Stabilizing Peptide-Wrapped Single-Walled Carbon Nanotubes: A Molecular Dynamics Study  

E-Print Network [OSTI]

, and energy conservation devices.2 Unfortunately, car- bon nanotubes are extremely hydrophobic which leadsRole of Peptide­Peptide Interactions in Stabilizing Peptide-Wrapped Single-Walled Carbon Nanotubes at biopolymers@wiley. com INTRODUCTION S ingle-walled carbon nanotubes (SWNTs) are hollow cylinders formed

Nielsen, Steven O.

413

Chirality dependence of the density-of-states singularities in carbon nanotubes S. Reich and C. Thomsen  

E-Print Network [OSTI]

approach and yields the energy splitting for an arbitary chiral angle in metallic nanotubes. SemiconductingChirality dependence of the density-of-states singularities in carbon nanotubes S. Reich and C-of-states singularities in single-walled car- bon nanotubes. Our approximation goes beyond the lowest-order, isotropic

Nabben, Reinhard

414

International Journal of Hydrogen Energy 31 (2006) 7792 www.elsevier.com/locate/ijhydene  

E-Print Network [OSTI]

for fueling automotives to reduce car- bon dioxide emissions, limit dependence on imported petroleum-grade crude oils into transport fuels. World oil refineries and chemical plants' demand for hydrogen-free tech- nologies, including either battery- or fuel-cell--operated vehicles. However, the H2 fuel

Yildiz, Bilge

415

Contribution of restricted rotors to quantum sieving of hydrogen isotopes B. C. Hathorn,1  

E-Print Network [OSTI]

have come to the forefront as a possible storage medium for hydrogen for fuel-cell de- vices. A number of isotopically substituted hydrogen molecules adsorbed into single-walled car- bon nanotubes are calculated usingContribution of restricted rotors to quantum sieving of hydrogen isotopes B. C. Hathorn,1 B. G

Hathorn, Bryan C.

416

Raman spectroscopy of amorphous, nanostructured, diamondlike carbon, and nanodiamond  

Science Journals Connector (OSTI)

...possible presence of hydrogen and nitrogen. The...magnetic storage disks, car parts, biomedical...alloys, (a) without hydrogen, (b) with hydrogen...C, sp3 C and N. fuel cells. Nanostructured...classified as stage 2 car- bons with increasing...

2004-01-01T23:59:59.000Z

417

One-Carbon Metabolism in Methanogens: Evidence for Synthesis of a Two-Carbon Cellular Intermediate and Unification of Catabolism and Anabolism in Methanosarcina barkeri  

Science Journals Connector (OSTI)

...or methanol. Cell suspensions synthesized...the absence of hydrogen. Cell extracts catalyzed...carriers (i.e., car- boxydihydromethanopterin...the presence of hydrogen gas. Iodopropane...for analysis. Cell suspensions assimilated...intermediate from one-car- bon compounds...

William R. Kenealy; J. G. Zeikus

1982-08-01T23:59:59.000Z

418

Control-oriented input-delay model of the distributed temperature of a SI engine exhaust  

E-Print Network [OSTI]

shifting [8]. This open-loop technique leads to a faster heating of the catalyst but also yields combustion the combustion: hydrocar- bons HC, carbon monoxide CO and nitrogen oxide NOx. Yet, conversion efficiency Delphine to activate chemical re- actions and the catalyst conversion ratio is poor [18]. Therefore, speed

419

through the digestive tract of patients with a malabsorption syndrome. In addition, our  

E-Print Network [OSTI]

digestibility car- bon from dietary CHO. Effect of algal fibre supplementation (Eucheuma cottonii) on intestinal of their nutritional properties, this work inves- tigated the possible effects of algal polysac- charides sequence of test meals (800 g of maize starch + casein) sup- plemented either with 40 g of algal fibres

Boyer, Edmond

420

Name /css_comb_104895/comb_5d11/Mp_1 09/29/2002 01:05AM Plate # 0 pg 1 # 1 Proceedings of the Combustion Institute, Volume 29, 2002/pp. 000000  

E-Print Network [OSTI]

of the Combustion Institute, Volume 29, 2002/pp. 000­000 DIOXIN AND FURAN FORMATION ON CuCl2 FROM CHLORINATED. Heated nitrogen gas streams containing 7.8% oxygen, 1.7% benzene vapor, and equal amounts of 2], poly- cyclic aromatic hydrocarbons [5], and graphitic car- bon [6]. Formation rates from precursors

Mulholland, James A.

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

ELSEVIER Computational Materials Science 2 (1994) 468-474 Modifying the buckyball  

E-Print Network [OSTI]

of C60- inspired carbon fullerenes. At present, the most intensively investigated systems are multi 1994) Abstract Structural and electronic properties of carbon clusters, in particular the C60 triggered a world-wide interest in this novel form of car- bon. The resulting research effort first concen

422

1932-4510/07/$25.002007IEEE SEPTEMBER 2007 | IEEE NANOTECHNOLOGY MAGAZINE | 13 CHONGWU ZHOU, AKSHAY KUMAR, AND KOUNGMIN RYU  

E-Print Network [OSTI]

. The most commonly used techniques include arc discharge, laser ablation, and chemical vapor deposition (CVD). CNTs were first discovered when Iijima examined the prod- ucts from an arc discharge between two far, car- bon nanotubes (CNTs) stand out due to their remarkable electrical, mechani- cal, optical

Zhou, Chongwu

423

JOURNAL DE PHYSIQUE Colloque C8, Supplhment au no 12, Tome 49, dhcembre 1988  

E-Print Network [OSTI]

JOURNAL DE PHYSIQUE Colloque C8, Supplhment au no 12, Tome 49, dhcembre 1988 NEUTRON SCATTERING a better understanding of the magnetic correlations of FegoZrlo we have performed small angle neutron scattering (SANS) and polarized- beam spin rotation experiments on amorphous rib- bons (approximately 25 prn

Boyer, Edmond

424

Structure and Density of Mo and Acid Sites in Mo-Exchanged H-ZSM5 Catalysts for Nonoxidative Methane Conversion  

E-Print Network [OSTI]

of natural gas to higher hydrocar- bons and aromatics remains an important industrial challenge Methane Conversion Richard W. Borry III, Young Ho Kim, Anne Huffsmith, Jeffrey A. Reimer, and Enrique and gas phase transport, exchange at acid sites, and react to form H2O. The amount of H2O evolved during

Iglesia, Enrique

425

Atomic and molecular adsorption on RhMn alloy surface: A first principles study  

E-Print Network [OSTI]

and hydrogen from reforming of natural gas and coal to hydro- carbon Fishcher-Tropsch synthesis and oxygenates- bon and partial oxidation of methane.15 The importance of Rh catalysts on catalytic reactions molecules in terms of the energetics and site preferences on Rh catalysts as well as the effects of Mn added

Li, Weixue

426

Defective fullerenes and nanotubes as molecular magnets: An ab initio study Yong-Hyun Kim,* Jin Choi, and K. J. Chang  

E-Print Network [OSTI]

Defective fullerenes and nanotubes as molecular magnets: An ab initio study Yong-Hyun Kim,* Jin ordering are not well es- tablished, the experimental evidence for ferromagnetic car- bon nanostructures in the magnetic behavior, and suggested a possible link between magnetism and defects in the pure carbon network

427

/ http://www.sciencemag.org/content/early/recent / 3 April 2014 / Page 1 / 10.1126/science.1252268 The availability of high-quality, large, single-crystal Si wafers is funda-  

E-Print Network [OSTI]

separated by defective grain boundaries that degrade their electri- cal and mechanical properties (8, 9 and coalesce into a uniform sin- gle-crystal layer without grain bounda- ry defects, even if the nucleation and the relatively high car- bon solubility hamper the direct growth of high-quality monolayer graphene on Si (16

Napp, Nils

428

JOURNAL OF BACTERIOLOGY, Dec. 2003, p. 71607168 Vol. 185, No. 24 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.24.71607168.2003  

E-Print Network [OSTI]

are required for growth on C1 substrates; how- ever, mutants defective for the H4MPT pathway reveal a unique characterization of four mutants defective in the H4MPT pathway and place them into three different phenotypic pathway in M. extorquens AM1. Methylotrophic bacteria growing aerobically on single-car- bon (C1

429

Biological Gain of Carbon-ion Radiotherapy for the Early Response of Tumor Growth Delay and against Early Response of Skin Reaction in Mice  

Science Journals Connector (OSTI)

......observed for 77 keV/mm carbon ions. The RBE values of low-LET car- bons (14 and 20 keV/mm) ranged from 1.2 to 1.7, and...T-cells after low-dose gamma-irradiation is not linked with defective Ku86 protein. Int. J. Radiat. Biol. 77: 329339. 27......

Koichi Ando; Sachiko Koike; Akiko Uzawa; Nobuhiko Takai; Takeshi Fukawa; Yoshiya Furusawa; Mizuho Aoki; Yasuyuki Miyato

2005-03-01T23:59:59.000Z

430

ABSTRACTS IN REPORTS CONCERNING ELECTRON MICROSCOPY PUBLISHED IN JAPAN:  

Science Journals Connector (OSTI)

......Thoracic Lymphatics of Living Rabbits and Sites of Escape of Car- bon Particles from the Vessels: Fumihiko KATO (First Dept...deafness. Using light and elect- ron microscopy he studied the defective organ of Corti in Shaker-1 mouse, one strain of congeni......

ABSTRACTS

1967-01-01T23:59:59.000Z

431

POSTER SESSIONS:  

Science Journals Connector (OSTI)

......the other radiosensitive cell lines of SX9 (defective in DNA-PKcs, XRCC7), SX10 (defective in DNA ligase IV) and M10 (XRCC4) were about...Center, Kyoto University. The system includes car- bon K, aluminium K, molybdenum L, iron......

Synchrotron radiation

2002-12-01T23:59:59.000Z

432

ABSTRACTS:  

Science Journals Connector (OSTI)

......central body of the virus vanished or became defective very frequently. 4) In the cytoplasm...The fine structure of martensite in plain car- bon steels has been studied by transmission...around the dislocations and tiny metastable car- bides precipitate in situ. With the......

ABSTRACTS

1965-01-01T23:59:59.000Z

433

THE FORTY-FIRST ANNUAL MEETING OF THE JAPANESE SOCIETY OF ELECTRON MICROSCOPY:  

Science Journals Connector (OSTI)

......000 kV DF is superior to BF up to Ael for gold as well as for car- bon. Despite the larger effect, DF mode at 1,000 kV is...shift in the [TTT] direction. 232 41st Annual Meeting The defective image in the specimen, thinned parallel to the (001) plane......

The Forty-first Annual Meeting of the Japanese Society of Electron Microscopy

1985-01-01T23:59:59.000Z

434

Raman spectroscopy of graphite  

Science Journals Connector (OSTI)

...G for graphite. The other modes are either observed only on defective samples or are very weak in intensity like the G peak that was...al. 2001); a similar behaviour is also observed in other car- bon materials (Ferrari & Robertson 2001; Maultzsch et al...

2004-01-01T23:59:59.000Z

435

Two-Step Mechanism for Low-Temperature Oxidation of Vacancies in Graphene Johan M. Carlsson,1,* Felix Hanke,1  

E-Print Network [OSTI]

for nanoparticles [2]. Controlled oxidation of car- bon materials is also used to add functional oxygen (O) groups (STM) experiments, for instance, demonstrate that the defect-free regions of the basal plane oxygen and attachment of oxygen atoms on defective graphite. However, the main product in these TPD

436

Scanning tunnelling microscopy of carbon nanotubes  

Science Journals Connector (OSTI)

...sheet into a cylinder where the car- bon lattice is joined seamlessly...consist of at least a pair of defective rings, e.g. squares, pentagons...sized (Meunier et al. 1999), defective (Meunier & Lambin 1998, 2000...Blase, X., Devita, A. & Car, R. 1997 Electronic structure...

2004-01-01T23:59:59.000Z

437

Nitrogen Addition Increases Carbon Storage in Soils, But Not in Trees, in  

E-Print Network [OSTI]

nitrogen (N) species and car- bon dioxide (CO2) in the atmosphere globally. Received 18 August 2012Nitrogen Addition Increases Carbon Storage in Soils, But Not in Trees, in an Eastern U.S. Deciduous regions receive elevated rates of atmospheric nitrogen (N) deposition from air pollution. To evalu- ate

Templer, Pamela

438

Introduction: The Ocean's Meridional Overturning Circulation Andreas Schmittner1  

E-Print Network [OSTI]

currents encompassing all ocean basins. It transports large amounts of water, heat, salt, car- bon current (ACC) of the Southern Ocean. There, it mixes with other deep water masses like Pacific Deep WaterIntroduction: The Ocean's Meridional Overturning Circulation Andreas Schmittner1 , John C.H. Chiang

Schmittner, Andreas

439

February 18, 2009 The A Priori  

E-Print Network [OSTI]

about some agent's knowledge, we might say something like `that's a priori for him.' [Kripke, 1980 careless about distinguishing a priority from analyticity and necessity. (Roughly: something is a priori of some fairly specific sort, might be required for that. [BonJour, 2005, p.99] ­ The positive condition

Fitelson, Branden

440

THSE DE DOCTORAT DE L'UNIVERSIT PIERRE ET MARIE CURIE  

E-Print Network [OSTI]

pour leur sympathique contribution au bon déroulement de cette thèse. Merci également à l'ensemble des factor CaMK Ca2+ /calmodulin-dependent protein kinases CCI Chronic constriction injury (ligature lâche du and Statistical Manual of Mental Disorders EGF

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Murchison presolar carbon grains of different density fractions: A Raman spectroscopic perspective  

E-Print Network [OSTI]

for inorganic sp2 -bonded carbon. Based on their D/G intensity ratios, those grains were grouped.1), "glassy carbon" (D/G > 1.1), and "unusual sp2 -bonded graphitic car- bon" (with extremely intense 2ndMurchison presolar carbon grains of different density fractions: A Raman spectroscopic perspective

442

Grid 2020: Toward a Policy of Renewable & Distributed Resources  

E-Print Network [OSTI]

;12 Virtual Power Plant: 2002-2020 Multi-direction and variability of DER power flows drive circuit years, which would make solar power less expensive than retail electricity in roughly 20 states" David, DoE, USCHP #12;6 Wide Area CoordinaBon & Controls Location of Variable Wind, Solar

443

Journal of Power Sources 195 (2010) 18411844 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

to react with oxygen, forming water. Recent advances in MFCs have increased power produc- tion or modifying the car- bon surface. In an MFC with anaerobic sludge as the inoculum, power was increased from 0Journal of Power Sources 195 (2010) 1841­1844 Contents lists available at ScienceDirect Journal

444

Structure and interactions in simple solutions  

Science Journals Connector (OSTI)

...cations have with both water and alcohol molecules...concentration and scattering power of each atom type Phil...ensembles containing 300 water molecules and 6 alcohol...CC, the methyl group car- bon sites C, the methyl...group hydrogen H. The water hydrogen sites are labelled...

2004-01-01T23:59:59.000Z

445

Journal of Power Sources 134 (2004) 16 Synthesis and physical/electrochemical characterization of Pt/C  

E-Print Network [OSTI]

Journal of Power Sources 134 (2004) 1­6 Synthesis and physical/electrochemical characterization Department of Mechanical Engineering, Hong Kong University of Science and Technology, Clear Water Bay alloys on a car- bon support. The high surface area of a Pt and its alloys can be rendered by using

Zhao, Tianshou

446

U.S. JGOFS NEWS U.S. JGOFS: A Component of the U.S. Global Change Research Program  

E-Print Network [OSTI]

Global models of the ocean car- bon cycle have two moving parts. First, a production part is used the sunlit eu- photic zone of the ocean is remineralized at each depth horizon in the water column is a power-law function of depth. This curve is used widely in global simulations to repre- sent

McGillicuddy Jr., Dennis J.

447

-Amino acids, although less abundant than their -analogues, are also present in peptides and other natural  

E-Print Network [OSTI]

Polyhydroxyalkanoates (PHAs) are a family of carbon, energy and/or reducing power storage polymers, which a characteristic pro- ton NMR signal at 3.15 ppm for the hydroxy hydrogen at car- bon 3. In our experimental work was consumed. Compound 2 was reacted with sodium azide in water using hexadecyltributylphosphonium bromide

448

THE IMPORTANCE OF THE GAS-GRAIN INTERACTION T. J. Millar  

E-Print Network [OSTI]

of interstellar grains can be described by a power-law: n(a)da / a 3:5 da and combining the op- tical properties atoms and taking up 10% of the total car- bon budget. These molecules, called polycyclic aromatic of water, but con- tain substantial components of methanol, ca

Millar, Tom

449

Z .Surface and Coatings Technology 127 2000 260 265 Characterization of carbon nitride thin films deposited by  

E-Print Network [OSTI]

-screw adapter and monitored by measuring the back reflection power at the end of a water load. A mixture polycrystalline car- bon nitride films, and the resulting mechanical proper- ties are not as good as predicted a valve between the deposition chamber and the vacuum pumps. The microwave power was adjusted by a four

Gao, Hongjun

450

Increasing Proton Exchange Membrane Fuel Cell Catalyst Effectiveness Through Sputter Deposition  

E-Print Network [OSTI]

, University of South Carolina, Columbia, South Carolina 29208, USA b Plug Power, Incorporated, Latham, New and carbon- supported catalyst.3-6 It is this three-phase interface of catalyst, car- bon, and electrolyte typically Nafion® that allows effective gas and water diffusion and proton transport and electron transport

451

VOLUME 93 NUMBER 23 5 JUNE 2012  

E-Print Network [OSTI]

, rainfall, and the concentration of car- bon dioxide [New et al., 1999; Tans et al., 1996 regional networks together to measure the fluxes of carbon dioxide, water vapor, and sen- sible heat are needed to move air to the sen- sor, have access to a power line. The cur- rent generation of carbon

452

ORIGINAL PAPER Evaluating sedimentary geochemical lake-level tracers  

E-Print Network [OSTI]

Walker Lake has been generated through analysis of total inorganic car- bon (TIC), total organic carbon (TOC), and oxy- gen and carbon isotope ratios (d18 O and d13 C) of both downcore bulk TIC and ostracods in %TIC, %TOC, and d13 C and d18 O of TIC and ostracods are all associated to varying degrees with changes

Linsley, Braddock K.

453

Magnetic Properties and Diffusion of Adatoms on a Graphene Sheet P. O. Lehtinen,1  

E-Print Network [OSTI]

Magnetic Properties and Diffusion of Adatoms on a Graphene Sheet P. O. Lehtinen,1 A. S. Foster,1 A storage in nanotube based batteries [7], catalytic growth [8], junc- tions [9], and quantum dot creation,17] and diffusion [18] of a car- bon adatom on a graphene sheet, yet the results were markedly different, and none

Nordlund, Kai

454

2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim722 wileyonlinelibrary.com  

E-Print Network [OSTI]

and material degradation is crucial for the rational design of high-performance lithium ion batteries (LIBs-layer graphene nanorib- bons remain mechanically robust after lithiation. This distinct contrast manifests. In addition, a new in situ chemical lithiation method is introduced for fast screening of battery materials

Chen, Sow-Hsin

455

JOURNAL OF BACTERIOLOGY, 0021-9193/01/$04.00 0 DOI: 10.1128/JB.183.8.24632475.2001  

E-Print Network [OSTI]

or 1,2-propanediol requires B12 and provides a car- bon and energy source, but growth. The Alternative Electron Acceptor Tetrathionate Supports B12-Dependent Anaerobic Growth of Salmonella enterica of these carbon sources supports anaerobic growth with any of the alternative electron acceptors tested thus far

California at Davis, University of

456

Relationships between Carcinogenicity and Theoretical Reactivity Indices in Polycyclic Aromatic Hydrocarbons  

Science Journals Connector (OSTI)

...usually several alternatives are available for...meso-9,10-car bon atoms of anthracene...molecular orbital energies are , @= a + mj3...de localization energy @Edel@/f3...led us to examine alternative indices. One such...Table 10. Composite Energy Indices Transformation...

Iden A. Smith; Gregory D. Berger; Paul G. Seybold; and M. P. Serv

1978-09-01T23:59:59.000Z

457

Bioreactor Development for Biological Hydrogen Production  

E-Print Network [OSTI]

Huang National Renewable Energy Laboratory 1617 Cole Boulevard, Golden, CO 80401 ed The biologically-mediated water-gas shift reaction, in which carbon monoxide is oxidized to car- bon dioxide while temperature and lack of equilibrium limitation make the biological shift reaction a promising alternative

458

MEDS and PocR are novel domains with a predicted role in sensing simple hydrocarbon derivatives in prokaryotic signal transduction systems  

Science Journals Connector (OSTI)

......genes encoding alternative sigma factors in...1999Aerotaxis and other energy-sensing behavior...dichloromethane as the sole car-bon and energy source, DcmR dissociates...genes encoding alternative sigma factors in...Aerotaxis and other energy-sensing behavior......

Vivek Anantharaman; L. Aravind

2005-06-01T23:59:59.000Z

459

Recent Insights into the Biological Action of Heavy-Ion Radiation  

Science Journals Connector (OSTI)

......exogenous genes.59) An alternative regimen includes the combination...combina- tion with high-energy X-rays, which acted...GJIC contributed to car- bon ion-induced bystander...chemicals such as retinoids, car- otenoids and green tea...X-ray-induced mammary car- cinogenesis in female......

Nobuyuki Hamada

2009-01-01T23:59:59.000Z

460

A&G Volume 54 Issue 1, Full Issue  

Science Journals Connector (OSTI)

......lithoautotrophic means of both energy genera- tion and carbon...render it an available energy source (Weiss et al...subsurface. Finally, an alternative inorganic electron acceptor...some iron reducers is car- bon monoxide (CO...made available as an energy source through downward......

A&G Volume 54 Issue 1; Full Issue

2013-02-01T23:59:59.000Z

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Microdosimetric Approach to NIRS-defined Biological Dose Measurement for Carbon-ion Treatment Beam  

Science Journals Connector (OSTI)

......value into the lineal energy, yi. The Ny value was...function of the linear energy transfer (LET) of mono-energetic...with an initial kinetic energy of 290 MeV/u with a...pulse by defocusing car- bon-ions with electric...low-intensity beam. So, an alternative parallel-plate ionization......

Yuki Kase; Tatsuaki Kanai; Makoto Sakama; Yuji Tameshige; Takeshi Himukai; Hiroyuki Nose; Naruhiro Matsufuji

2011-01-01T23:59:59.000Z

462

Manipulating RuBisCO accumulation in the green alga, Chlamydomonas reinhardtii  

E-Print Network [OSTI]

Manipulating RuBisCO accumulation in the green alga, Chlamydomonas reinhardtii Xenie Johnson photosynthetic car- bon metabolism towards alternative pathways. Keywords RuBisCO � Chloroplast � RNA stability between green algae (Chlamydomonas X. Johnson (&) Centre National de la Recherche Scientifique, Unite

463

American Economic Journal: Economic Policy 2009, 1:1, 106146 http://www.aeaweb.org/articles.php?doi=10.1257/pol.1.1.106  

E-Print Network [OSTI]

- bon emissions rate or, equivalently, the carbon emissions per unit of output, allows fuel producers to achieve a given carbon emissions rate by exibly altering their production of fuels.2 Senators John Mc (e.g., energy versus miles), and how emissions rates are measured (e.g., upstream versus downstream

Rothman, Daniel

464

Route-Specific Passage and Survival of Steelhead Kelts at The Dalles and Bonneville Dams, 2012 - Final Report  

SciTech Connect (OSTI)

This study was mainly focused on evaluating the route-specific passage and migration success of steelhead kelts passing downstream through The Dalles Dam (TDA) and Bonneville Dam (BON) at Columbia River (CR) river kilometers 309 and 234 respectively. Oregon Department of Fish and Wildlife (ODFW) personnel collected, tagged and released out-migrating steelhead kelts in the tributaries of the Deschutes River, 15 Mile Creek and Hood River between April 14 and June 4, 2012. A PIT tag was injected into each kelts dorsal sinus whereas a Juvenile Salmon Acoustic Telemetry System (JSATS) acoustic micro-transmitter was attached to an external FLoy T-bar tag and inserted into the dorsal back musculature using a Floy tagging gun. JSATS cabled arrays were deployed at TDA and BON and autonomous node arrays were deployed near Celilo, Oregon (CR325); the BON forebay (CR236); the BON tailrace (CR233); near Knapp, Washington (CR156); and near Kalama, Washington (CR113) to monitor the kelts movement while passing through the dams and above mentioned river cross-sections.

Rayamajhi, Bishes; Ploskey, Gene R.; Woodley, Christa M.; Weiland, Mark A.; Faber, Derek M.; Kim, Jin A.; Colotelo, Alison HA; Deng, Zhiqun; Fu, Tao

2013-07-31T23:59:59.000Z

465

Impact of a major ice storm on an old-growth hardwood forest  

E-Print Network [OSTI]

forestière, produc- tivité forestière. [Traduit par la Rédaction] Hooper et al. 75 Introduction Ice storms litter produced by ice storms is a substantial, yet little studied, pool of energy, car- bonImpact of a major ice storm on an old-growth hardwood forest Michael C. Hooper, Ken Arii

Lechowicz, Martin J.

466

cDNA Cloning and Characterization of a High Affinity Aryl Hydrocarbon Receptor in a Cetacean, the Beluga, Delphinapterus leucas  

E-Print Network [OSTI]

,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and related PHAHs cause toxicity via activation of the aryl hydrocar- bon receptor demonstrated specific, high-affinity [3 H]TCDD binding. Satura- tion binding analysis was used to compare-expressed AHRs from a dioxin-sensitive mouse strain (Ahb­1 allele) and humans. The beluga AHR bound [3 H

Hahn, Mark E.

467

2,3,7,8-Tetrachlorodibenzo-p-dioxin Induces Premature Activation of the KLF2 Regulon during  

E-Print Network [OSTI]

2,3,7,8-Tetrachlorodibenzo-p-dioxin Induces Premature Activation of the KLF2 Regulon during, Wisconsin 53706 The environmental pollutant 2,3,7,8-tetrachlorodibenzo-p- dioxin (TCDD, dioxin) causes,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)2 is the most toxic congener of a family of halogenated aromatic hydrocar- bons

Bradfield, Christopher A.

468

Introduction Aerial surveys from aircraft are a critical component of many environmental research,  

E-Print Network [OSTI]

. For localized surveys, small Unmanned Air Vehicles (UAVs) equipped with color and near infrared cameras accuracy assessment and improvement of detection probabilities. Autonomous Unmanned Aerial Vehicle (UAV) for Ecological Research Franklin Percival1 , Leonard Pearlstine2 , Bon Dewitt3 , Scot Smith3 , Adam Watts1

Mazzotti, Frank

469

Simulation of Nitrogen Emissions in a Premixed Hydrogen Flame Stabilized on a Low Swirl Burner  

E-Print Network [OSTI]

of fuels such as pure hydrogen and hydrogen-seeded hydrocarbon mixtures. However, many hydrogen-rich fuels in the context of a laboratory-scale low swirl burner fueled with a lean hydrogen-air mixture at atmospheric of burning lean hydrogen or hydrogen-enriched lean hydrocar- bon fuels (e.g., [2­5]). For these fuels

Bell, John B.

470

Atmos. Chem. Phys., 11, 14731490, 2011 www.atmos-chem-phys.net/11/1473/2011/  

E-Print Network [OSTI]

in- duced (fossil fuel combustion, biomass burning) in the car- bon cycle. All these combustion The contribution from both natural and human-induced biomass burning and from fossil fuel combustion to the an of CO2 is the domestic combustion of biomass fuels (Kituyi et al., 2001; Ludwig et al., 2003). Reg

Meskhidze, Nicholas

471

oo Ris Report No. 268 Danish Atomic Energy Commission  

E-Print Network [OSTI]

box calculations to three-dimensional overall cal- culations inclusive of the void and temperature Cell Data Supply for Box Calculations ... 36 5. Fuel Bon Calculations 37 5.1. Description of the Bus Calculation« 36 5.2. Comparisons withOtter Calculations 41 6. Control Rods 56 6.1. Cross Sections for Control

472

arXiv:1002.0679v1[cond-mat.mes-hall]3Feb2010 Theory of resonant photon drag in monolayer graphene  

E-Print Network [OSTI]

distribution in energy. The drag current essentially depends on the polarization of radiation and, in general, is not parallel to q. The perpendicular current component appears if the in-plain electric field is tilted towards. INTRODUCTION Though the theoretical study of two-dimensional car- bon has a long history [1],[2],[3],[4] only

Shepelyansky, Dima

473

Inner-shell excitation of gas phase carbonates and a,c-dicarbonyl compounds  

E-Print Network [OSTI]

correlation of the C 1s ! p? C@O transition energy and the relative oxidation at the carbonyl car- bon and dimethyldicarbonate ­ have been recorded in the gas phase with inner shell electron energy loss spectroscopy in the scattering regime dominated by electric dipole transitions. All spectra are presented on absolute oscillator

Hitchcock, Adam P.

474

1162 IEEE TRANSACTIONS ON CIRCUITS AND SYSTEMS, VOL. CAS-32, NO. 11, NOVEMBER 1985 Transactions Briefs  

E-Print Network [OSTI]

Absfruct -A z-plane continued fraction expansion (CFE) that is related to the first Cauer s-plane CFE via B&on's LDI transformation is consid- ered. Necessary and sufficient conditions are imposed on the CFE for a polynomial to be stable (have all its zeros inside the z-plane unit circle). The implementation of this CFE

Bistritz, Yuval

475

Rfrigration domestique : enqute sur les pratiques des consommateurs et recommandations en matire d'hygine  

E-Print Network [OSTI]

energy consumption and water available for microbial circulation and growth. Thus, an important interrogées. Cette condensation suggère une mauvaise fermeture de la porte avec pour conséquence une plus recommandation importante est donc de vérifier que le joint de porte est en bon état et que la porte ferme bien

Paris-Sud XI, Université de

476

A Comprehensive Two-Dimensional Gas Chromatography Method for Analyzing Extractable Petroleum Hydrocarbons in Water and Soil  

Science Journals Connector (OSTI)

......fuel samples, including gasoline (18,20,21), diesel...temperature of 340 C. Run times were approximately...sample containing C9C36 straight chain aliphatics and...Determination of oxygenates in gasoline by GC GC. J. High Resolut...aromatic hydrocar- bons in gasolines by flow modulated comprehensive......

Stacy K. Seeley; Steven V. Bandurski; Robert G. Brown; James D. McCurry; John V. Seeley

477

3 Carbide Precipitation Carbides are largely responsible for the commercial failure of many of the early  

E-Print Network [OSTI]

.1. Transition carbides, such as and the various orthorhombic forms listed in Table 3.1, only form because Precipitation 64 Table 3.1 Carbides in bainite or in tempered bainite. Fe, M/C is the ratio of metal to car- bon3 Carbide Precipitation Carbides are largely responsible for the commercial failure of many

Cambridge, University of

478

Eos, Vol. 86, No. 42, 18 October 2005 to shed light on poorly understood piercement  

E-Print Network [OSTI]

-term changes in oxygen,car- bon dioxide (CO2 ),and several other measur- able parameters since the last global and Predictability (CLIVAR)/CO2 Repeat Hydrog- raphy component of the Global Earth Observ- ing System of Systems, freshwater,and CO2 .The CLIVAR/CO2 Repeat Hydrography program builds upon earlier programs (e.g.,the World

Talley, Lynne D.

479

TREKiSM Issue 37  

E-Print Network [OSTI]

This is gold. Kirk is perfect, Spock Is bon san d p 0 s tag (~, 0 f course. GET WELL W1Sr-I[S to Lilld(] C. Brown, who's now back clt work folJowj'lg surgcl'y, fucing a...

1984-01-01T23:59:59.000Z

480

IEEE Wireless Communications June 201248 1536-1284/12/$25.00 2012 IEEE RECENT ADVANCES IN  

E-Print Network [OSTI]

, security, reliability and integration of renewable energy. Currently, most of the power grids are based of the electricity capacity from distributed and renewable energy sources. The European Smart Grids Technology and the integration of renewable energy to meet the EU target on car- bon emissions reduction by year 2020 [2

Shihada, Basem

Note: This page contains sample records for the topic "bon emis sions" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Worldwide, accelerating glacier loss provides independent and startling evidence that global warming is occurring1 It is now clear that the Earth is warming rapidly due to man-made emissions of carbon dioxide and other heat-trap-  

E-Print Network [OSTI]

-made emissions of carbon dioxide and other heat-trap- ping gases, which blanket the planet and cause temperatures future limits on carbon emissions. · Electricity consumers should opt for "green power" where imperative that emissions of the main heat-trapping gas, car- bon dioxide (CO2), are significantly reduced

Combes, Stacey A.

482

Generalized Terminal Modeling of Electromagnetic Interference  

SciTech Connect (OSTI)

Terminal models have been used for various applications. In this paper, a three-terminal model is proposed for electromagnetic-interference (EMI) characterization. The model starts with a power electronic system at a particular operating condition and creates a unique linearized equivalent circuit. Impedances and current/voltage sources define the noise throughout the entire EMI frequency spectrum. All parameters needed to create the model are clearly defined to ensure convergence and maximize accuracy. In addition, the accuracy of the model is confirmed up to 100 MHz for a dc-dc boost converter using both simulation and experimental validation.

Baisden, Andrew Carson [IEEE Industrial Applications Society; Boroyevich, Dushan [Virginia Polytechnic Institute and State University (Virginia Tech); Wang, Fei [ORNL

2010-01-01T23:59:59.000Z

483

Reduction of interference on substation low voltage wiring  

SciTech Connect (OSTI)

This paper describes test results and mitigation methods of electromagnetic interference (EMI) on control and low voltage circuits in substations caused by air disconnect switch operation. The tests are focused on a comparison between unshielded and shielded circuits from capacitively coupled voltage transformers (CCVT) and other equipment circuits in the vicinity. New test data are presented comparing unshielded and shielded cables and transient currents on all connections to the CCVT including the pedestal and ground strap. The paper gives a practical and understandable explanation of the causes of EMI in substations and how shielded cable and parallel ground conductors reduce interference. Design guidelines are listed in the Conclusion.

Gavazza, R.J. [Pacific Gas and Electric Co., San Francisco, CA (United States)] [Pacific Gas and Electric Co., San Francisco, CA (United States); Wiggins, C.M. [Carl M. Wiggins and Associates, Friendswood, TX (United States)] [Carl M. Wiggins and Associates, Friendswood, TX (United States)

1996-07-01T23:59:59.000Z

484

Evaluation of the effectiveness of shielding and filtering of HVDC converter stations  

SciTech Connect (OSTI)

The electromagnetic interference (EMI) generated by the periodic turn-on and turn-off of the valves is an important consideration in the design of HVDC converter stations. Remedial measures such as shielding the valve hall and filtering have been used in order to reduce the interference levels to acceptable values. The application of recently-developed Numerical Electromagnetic Code (NEC) to the problem of EMI from HVDC converter stations is investigated in this paper, with particular emphasis on evaluating the effectiveness of valve hall shielding and filtering.

Dallaire, R.D.; Maruvada, P.S.

1989-04-01T23:59:59.000Z

485

Design and Analysis of Salmonid Tagging Studies in the Columbia Basin, Volume XIII; Appraisal of System-Wide Survival Estimation of Snake River Yearling Chinook Salmon Released in 1997 and 1988, Using PIT-Tags Recovered from Caspian Tern and Double-Crested Cormorant Breeding Colonies on Rice Island, 1997-1998 Technical Report.  

SciTech Connect (OSTI)

PIT-tags recovered from tern and cormorant breeding colonies at Rice Island and observations from the interrogation systems at John Day and Bonneville Dams were incorporated into survival analyses. Whether the estimates for the upper reaches of the system, between Lower Granite and McNary Dams were as expected (with weighted averages S{sub LGR-LGS} = 0.996, S{sub LGS-LMN} = 0.837, and S{sub LMN-McN} = 0.941), those for the lower reaches, between John Day and Bonneville Dams, appeared positively biased with survival estimates typically greater than 1. Their weighted averages were S{sub McN-JDA} = 0.707 and S{sub JDA-BON} = 1.792 for 1997 releases. For the 1998 releases, they were S{sub McN-JDA} = 0.795 and S{sub JDA-BON} = 1.312. If the estimates for the lower reaches were biased, the estimates for the whole project would also be biased (S{sub LGR-BON} = 0.819). We determined that bias could have arisen if the terns and cormorants of Rice Island fished for salmon yearlings in waters of the BON-Rice reach at low rates (M{sub BON-Rice} {le} 0.2), and the rates of tag-deposition and tag-detection were low (R{sub D} x R{sub R} {le} 0.4). Moreover, unknown levels of uncensored post-detection mortality and scavenging of previously dead salmon yearlings may have also added to the bias.

Skalski, John R.; Perez-Comas, Jose A. (University of Washington, School of Fisheries, Seattle, WA)

2000-05-01T23:59:59.000Z

486

Identifying and quantifying nonconservative energy production/destruction terms in hydrostatic Boussinesq primitive equation models  

E-Print Network [OSTI]

Boussinesq primitive equation models R�emi Tailleux Department of Meteorology, University of Reading, Earley simple form of the hydrostatic Boussinesq primitive equation used in early versions of OGCMs, for which to be a conservative quantity; 3) the interaction of the Boussinesq approximation with the parameterizations

Tailleux, Remi

487

Solving a Dial-a-Ride Problem with a Hybrid Evolutionary Multi-objective Application to Demand Responsive Transport  

E-Print Network [OSTI]

to Demand Responsive Transport R´emy Chevrier,a , Arnaud Liefoogheb,c , Laetitia Jourdanb,c , Clarisse, 59650 Villeneuve d'Ascq, France Abstract Demand responsive transport allows customers to be carried to improve the quality of service, demand responsive transport needs more flexibility. This paper tries

Boyer, Edmond

488

Recto Running Head 1 Available Potential Energy and Exergy in  

E-Print Network [OSTI]

Recto Running Head 1 Available Potential Energy and Exergy in Stratified Fluids R�emi Tailleux, thermodynamic efficiencies, buoyancy forcing. Abstract Lorenz's theory of available potential energy (APE) remains the main framework for studying the atmospheric and oceanic energy cycles. Because the APE

Tailleux, Remi

489

Several synthetic pathways to cyclohex-5-ene-1R,2S,3R,4R-tetrol (conduritol C) and cyclohex-5-ene-1S,2R,3R,4R-tetrol  

E-Print Network [OSTI]

addi- tional consideration: those byproducts, reagents or solvents that have no known environmental- vents. It follows that nonhazardous solvents should be used in all synthetic ventures to maximize EMY values. Green Chemistry April 1999 57 CG Supplementary data available: effective mass yield calcula

Hudlicky, Tomas

490

Solvation of fluoro and mixed fluoro/chloro complexes of EuIII the [BMI][PF6] room temperature ionic liquid. A theoretical studyw  

E-Print Network [OSTI]

and non-flammability, they appear as ``green solvents'' (see, however, ref. 4) for many applications, strontium and trivalent lanthanides Ln31 in RTILs, comparing the [EMI][TCA] and [BMI][PF6] solvents, both based on imidazolium cations.16­18 The former solvent is water miscible and can be used

Paris-Sud XI, Université de

491

364 IEEE TRANSACTIONS ON INDUSTRY APPLICATIONS, VOL. 34, NO. 2, MARCH/APRIL 1998 Development of an Integrated CAD Tool  

E-Print Network [OSTI]

of an Integrated CAD Tool for Switching Power Supply Design With EMC Performance Evaluation Michael K. W. Wu, C. K EMI, it would be desirable if some tools that incorporate the known design rules can be used to guide, software that achieves this is introduced. The proposed computer-aided design (CAD) tool integrates

Tse, Chi K. "Michael"

492

QnAs with Kirk R. Smith early half of the world's pop-  

E-Print Network [OSTI]

QnAs with Kirk R. Smith N early half of the world's pop- ulation relies on fuels such as wood or dung for cooking and heating. In the 1980s, Kirk R. Smith, a member of the National Acad- emy, ac- cording to Smith. Cleaner alternatives to traditional cook stoves exist, but convinc- ing funding

493

Designing a 3D Navigation System Using Cognitive Factors M. Ali Mirzaei Jean-Remy Chardonnet Christian P`ere Frederic Merienne  

E-Print Network [OSTI]

Designing a 3D Navigation System Using Cognitive Factors M. Ali Mirzaei Jean-R´emy Chardonnet a navigation system based on these parameters. The nausea level due to different ve- locities of a 3D scene, the user head rotation around Yaw, Roll and Pitch axes, the delay between navigation device stimuli

Paris-Sud XI, Université de

494

Values of Stakeholders in the Net Neutrality Debate: Applying Content Analysis to Telecommunications Policy  

E-Print Network [OSTI]

to Telecommunications Policy An-Shou Cheng*, Kenneth R. Fleischmann*, Ping Wang*, Emi Ishita, Douglas W. Oard@surugadai.ac.jp Abstract Net neutrality is an important telecommunications policy debate. This debate is closely tied in telecommunications technology have radically transformed our access to and use of information. Ethics and policy

Oard, Doug

495

Neutron Physics at NIST 8th UCN Workshop  

E-Print Network [OSTI]

Neutron Physics at NIST M. Arif 8th UCN Workshop St. Petersburg ­ Moscow, Russia June 11-21, 2011 #12;NCNR Guide Hall 20 MW Reactor #12;Neutron Physics at the NCNR Beam Flux n cm-2 s-1 Peak Wavelength-6 Experiments Beam Neutron Lifetime Testing Time Reversal Asymmetry (emiT) Testing Parity Violating

Titov, Anatoly

496

132nd AAAS ANNUAL MEETING  

Science Journals Connector (OSTI)

...Waring (Oregon State University). Estimating biomass and productivity in fir-spruce-birch...utilizing the t special EMI CsSb box and grid design. Typical gain of 3 x 106 at 1100...Place gel slab on its side in separating grid (shown below) of EC 730 ELUTION CONVECTION...

1965-12-03T23:59:59.000Z

497

MEMORANDUM FOR JOHN R. ESCHENBERG ASSISTANT MANAGER FOR ENVIRONMENTAL...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

586-5216. cc: P. Bosco, MA-50 D. Chung, EM-2 C. Anderson, EM-3 M. Gilbertson, EM-50 J. Surash, EM-80 T. Hanns, EM-4.1 L. Ely, EM-11 W. Whitley, EM-4.1 R. Rimando, EM-I 0 . . .......

498

MEMORANDUM FOR SCOTI L. SAMUELSON MANAGER OFFICE OF RIVER PROTE...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

cc: P. Bosco, MA-50 D. Chung, EM-2 C. Anderson, EM-3 T. Harms, EM-4.1 W. Whitley, EM-4.1 R. Rimando, EM-I o (Acting) L. Ely, EM-11 T. Johnson, EM-50 (Acting) J. Surash, EM-80 )...

499

Nuclear reactions of medium and heavy target nuclei with high-energy projectiles III. Emission of24Na and28Mg fragments  

Science Journals Connector (OSTI)

The emission of24Na and28Mg fragments in the reaction induced by 365 A GeV12C-ions and 365 GeV protons on Mn, Co, Cu, Ag, Au, and Pb targets has been studied. The experimental ratios of forward-to-backward emis...

P. Kozma

1990-05-01T23:59:59.000Z

500

For a Worldwide Leading Industrial Automation Company, we are looking for : Embedded Software Development Engineer  

E-Print Network [OSTI]

/skill · Heat radiation technology knowledge/skill · EMI suppression knowledge/skill · Safety Standard knowledgeFor a Worldwide Leading Industrial Automation Company, we are looking for : Embedded Software contribution to the complete development process, from concept, planning and embedded software designs

Segatti, Antonio