Powered by Deep Web Technologies
Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


IDE Americas: Innovations in Desalination  

E-Print Network (OSTI)

energy consumption Renewable energy Low chemical footprint Reliance, India 160,000 m3/day MED EPC Global Market Leader 9 #12;Corporate IDE's Green Solutions Reduced Energy Consumption Leading the desalination industry in both thermal & membrane technologies Renewable Energy Desalination solutions

Fay, Noah


Bons Ventos Geradora de Energia S A | Open Energy Information  

Open Energy Info (EERE)

Bons Ventos Geradora de Energia S A Bons Ventos Geradora de Energia S A Jump to: navigation, search Name Bons Ventos Geradora de Energia S.A. Place Fortaleza, Ceara, Brazil Sector Wind energy Product Brazilian-based wind project developer, subsidiary of Grupo Servtec. Coordinates -3.718404°, -38.542924° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-3.718404,"lon":-38.542924,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Bon Homme County, South Dakota: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Bon Homme County, South Dakota: Energy Resources Bon Homme County, South Dakota: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.9814835°, -97.87216° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.9814835,"lon":-97.87216,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Bon Homme Yankton El Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Yankton El Assn, Inc Yankton El Assn, Inc Jump to: navigation, search Name Bon Homme Yankton El Assn, Inc Place South Dakota Utility Id 1898 Utility Location Yes Ownership C NERC Location MRO Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Coincidental Peak Billing Industrial Demand & Energy Billing 75-350 kva Commercial Farm Single-Phase Residential Interruptible Commercial Irrigation Single-Phase Uncontrolled Industrial Irrigation, Off Season Industrial Irrigation, Single-Phase Controlled Industrial Irrigation, Single-Phase Controlled Pivot Energy Only Commercial


Standards for Language Resources Nancy Ide,* Laurent Romary  

E-Print Network (OSTI)

Standards for Language Resources Nancy Ide,* Laurent Romary * Department of Computer Science Vassar for linguistic annotations and its implementation using XML, RDF and related standards; and to outline the work of a newly formed committee of the International Standards Organization (ISO), ISO/TC 37/SC 4 Language

Boyer, Edmond


Semantic mashup with the online IDE WikiNEXT  

Science Journals Connector (OSTI)

The proposed demonstration requests DBPedia.org, gets the results and uses them to populate wiki pages with semantic annotations using RDFaLite. These annotations are persisted in a RDF store and we will show how this data can be reused by other applications, ... Keywords: web based IDE, web of data, wiki

Pavel Arapov; Michel Buffa; Amel Ben Othmane



Microsoft PowerPoint - UTSRWorkshop-Oct2010-Bons.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS FOR DEPOSITION RESISTANCE WITH 1400C COMBUSTOR EXIT TEMPERATURES AND SYNGAS WATER VAPOR LEVELS Ch i S ith B tt B k P h th Sh k Chris Smith, Brett Barker, Prashanth Shankaran Josh Webb, Brian Casaday Dr. Ali Ameri, Dr. Jeffrey Bons "THE" OHIO STATE UNIVERSITY THE OHIO STATE UNIVERSITY Robert Laycock, Dr. Thomas Fletcher "THE" BRIGHAM YOUNG UNIVERSITY "THE" BRIGHAM YOUNG UNIVERSITY (3-year grant awarded Oct 2009) 1 MOTIVATION/NEED * Operational Issues -Fuel flexibility (range of feedstock heat release) y ( g ) -Diluent use (e.g. steam) -Filtration requirements * Technical Challenges - Higher firing temperature I d h t t f ( t dil t) - Increased heat transfer (steam diluent) - Potential for increased levels of airborne contaminants


Group Work Support for the BlueJ IDE Kasper Fisker  

E-Print Network (OSTI)

@deakin.edu.au ABSTRACT Learning to work in teams is essential for every software professional. Developing softwareGroup Work Support for the BlueJ IDE Kasper Fisker fisker@fiskers.org Michael Kölling Computing. Starting effective group work practices early can lead to better acceptance of group work as a standard

Kent, University of


Overexpression of wild-type PKD2 leads to increased proliferation and invasion of BON endocrine cells  

SciTech Connect

Carcinoid tumors are rare neuroendocrine tumors with a predilection for the gastrointestinal tract. Protein kinase D (PKD), a novel serine/threonine protein kinase, has been implicated in the regulation of transport processes in certain cell types. We have reported an important role for PKD in stimulated peptide secretion from a human (BON) carcinoid cell line; however, the role of PKD isoforms, including PKD2, in the proliferation and invasion of carcinoid tumors remains unclear. In the present study, we found that overexpression of PKD2 by stable transfection of BON cells with PKD2-wild type (PKD2{sub WT}) significantly increased proliferation and invasion compared to cells transfected with PKD2-kinase dead (PKD2{sub KD}) or pcDNA3 (control). Similarly, inhibition of PKD2 activity with small interfering RNA (siRNA) significantly decreased proliferation and invasion compared to cells transfected with non-targeting control (NTC) siRNA. These data support an important role for PKD2 in carcinoid tumor progression. Targeted inhibition of the PKD family may prove to be a novel treatment option for patients with carcinoid tumors.

Jackson, Lindsey N. [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Li Jing [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX (United States); Chen, L. Andy [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Townsend, Courtney M. [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Evers, B. Mark [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States) and Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX (United States)]. E-mail: mevers@utmb.edu



GRR/Section 3-ID-e - Term Easement | Open Energy Information  

Open Energy Info (EERE)

e - Term Easement e - Term Easement < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-ID-e - Term Easement 03IDGTermEasement.pdf Click to View Fullscreen Contact Agencies Idaho Department of Lands Regulations & Policies IDPA 20.03.08 Idaho Code 58-603 Triggers None specified Click "Edit With Form" above to add content 03IDGTermEasement.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Idaho Department of Lands (IDL) requires a Term Easement for access across state lands and for right of ways across state lands. Note, an easement is not required for lands covered under a Geothermal Lease.


Use of SiBN and SiBON films prepared by plasma enhanced chemical vapor deposition from borazine as interconnection dielectrics  

SciTech Connect

Thin films of silicon boron nitride (SiBN) of typical composition Si{sub 0.09}B{sub 0.39}N{sub 0.51} and silicon boron oxynitride (SiBON) of typical composition Si{sub 0.16}B{sub 0.29}O{sub 0.41}N{sub 0.14} were prepared by plasma enhanced chemical vapor deposition and the properties of these films were evaluated with respect to their suitability as interconnection dielectrics in microelectronic fabrication. Films were deposited on 125 mm silicon substrates in a parallel-plate reactor at a substrate temperature of 400 C and a plasma power of 0.5 W/cm{sup 2}. Boron nitride, for comparison of electrical properties, was deposited from borazine (B{sub 3}N{sub 3}H{sub 6}); silicon boron nitride was deposited from borazine, disilane (Si{sub 2}H{sub 6}), and ammonia (NH{sub 3}); silicon boron oxynitride was deposited from borazine, disilane, ammonia, and nitrous oxide (N{sub 2}O). Metal-insulator-metal capacitors were fabricated and electrical measurements indicated that all three films had excellent dielectric properties with dielectric constants of 4.1, 4.7, and 3.9 for BN, SiBN, and SiBON, respectively. Tests of conformality indicated that deposition into trenches with an aspect ratio of 4:1 gave conformality greater than 70%. Silicon boron oxynitride was shown to be an excellent barrier to the diffusion of copper. A planar, single level metal-insulator structure was constructed using a SiBN/SiBON insulator with copper metallization.

Kane, W.F.; Cohen, S.A.; Hummel, J.P.; Luther, B. [IBM Research Div., Yorktown Heights, NY (United States). T.J. Watson Research Center; Beach, D.B. [Oak Ridge National Lab., TN (United States). Chemical and Analytical Sciences Div.



Postmortem on Three Mile Island  

Science Journals Connector (OSTI)

...special locker room in the Unit 2 turbine building. Assisted by attendants...200 millirems come from radon gas, according to a recent study...here and there, though the remaining uranium diox-ide must be far...way, I can learn and the frog lives. But that got me into a lot...




Energy-Aware Traffic Engineering Nedeljko Vasic and Dejan Kostic  

E-Print Network (OSTI)

and Communication Sciences, EPFL, Switzerland firstname.lastname@epfl.ch ABSTRACT Energy consumption of the Internet presents Energy-Aware Traffic engineer- ing (EATe), a technique that takes energy consumption into account effect of reduced energy consumption is reduced carbon diox- ide emissions. Cheaper operating costs

Diggavi, Suhas


www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences,  

E-Print Network (OSTI)

considerable attention. Greenhouse Gas Policy While federal legislation governing GHG emissions is being) measures the relative ability of a GHG to trap the sun's energy and warm our atmosphere. Carbon diox- ide the emission of these gases in the first place or by reduc- ing GHGs already in the atmosphere. For example

Liskiewicz, Maciej



E-Print Network (OSTI)

trading framework. The largest GHG market in the world is the European Union-Emissions Trading Scheme' sulfur diox- ide (SO2) emissions trading program Greenhouse Gas Emissions Offsets from Agriculture and states have enacted policies individually or in cooperation to reduce GHG emissions through an emissions


Combining VisNIR hyperspectral imagery and legacy measured soil profiles to map subsurface soil properties in a Mediterranean area (Cap-Bon, Tunisia)  

Science Journals Connector (OSTI)

Abstract Previous studies have demonstrated that Visible Near InfraRed (VisNIR) hyperspectral imagery is a cost-efficient way to map soil properties at fine resolutions (~5m) over large areas. However, such mapping is only feasible for the soil surface because the effective penetration depths of optical sensors do not exceed several millimeters. This study aims to determine how VisNIR hyperspectral imagery can serve to map the subsurface properties at four depth intervals (1530cm, 3060cm, 60100cm and 30100cm) when used with legacy soil profiles and images of parameters derived from digital elevation model (DEM). Two types of surfacesubsurface functions, namely linear models and random forests, that estimate subsurface property values from surface values and landscape covariates were first calibrated over the set of legacy measured profiles. These functions were then applied to map the soil properties using the hyperspectral-derived digital surface soil property maps and the images of landscape covariates as input. Error propagation was addressed using a Monte Carlo approach to estimate the mapping uncertainties. The study was conducted in a pedologically contrasted 300km2-cultivated area located in the Cap Bon region (Northern Tunisia) and tested on three soil surface properties (clay and sand contents and cation exchange capacity). The main results were as follows: i) fairly satisfactory (cross-validation R2 between 0.55 and 0.81) surfacesubsurface functions were obtained for predicting the soil properties at 1530cm and 3060cm, whereas predictions at 60100cm were less accurate (R2 between 0.38 and 0.43); ii) linear models outperformed random-forest models in developing surfacesubsurface functions; iii) due to the error propagations, the final predicted maps of the subsurface soil properties captured from 1/3 to 2/3 of the total variance with a significantly decreasing performance with depth; and iv) these maps brought significant improvements over the existing soil maps of the region and showed soil patterns that largely agreed with the local pedological knowledge. This paper demonstrates the added value of combining modern remote sensing techniques with old legacy soil databases.

Philippe Lagacherie; Anne-Ruth Sneep; Ccile Gomez; Sinan Bacha; Guillaume Coulouma; Mohamed Hdi Hamrouni; Insaf Mekki



What's InsIde?  

NLE Websites -- All DOE Office Websites (Extended Search)

Fossil Energy Techline, "DOE Releases Draft EIS Statement for Fossil Energy Techline, "DOE Releases Draft EIS Statement for FutureGen Project." The US Department of Energy (DOE) has released a Draft Environmental Impact Statement (EIS) for the FutureGen Project, a detailed document describing the potential environmental effects of constructing the state-of-the-art 275-megawatt coal-fired power plant with hydrogen production capabilities. The near zero-emissions plant will use carbon sequestration technology to capture carbon dioxide (CO 2 ) emissions from the plant and pump the gas underground for permanent storage. The draft EIS provides detailed descriptions of the proposed power plant, CO 2 capture and storage methods, monitoring


What's InsIde?  

NLE Websites -- All DOE Office Websites (Extended Search)

Regional Partner Launches Drilling Test in Regional Partner Launches Drilling Test in DOE's Carbon Sequestration Program." The Plains CO 2 Reduction Partnership (PCOR), one of the seven Department of Energy (DOE) Regional Carbon Sequestration Partnerships, has begun a small-scale geologic field test as part of their validation phase efforts which will focus on carbon dioxide (CO 2 ) storage in a lignite seam in Burke County, North Dakota. The PCOR Partnership, managed by the University of North Dakota's Energy and Environmental Research Center, will partner with Eagle Operating Inc. of Kenmare, North Dakota to conduct the two-year, two-phased test. During phase one, data about the coal seam will be collected in order to evaluate the


Journal of Sound and Vibration (2002) 250(4), 649-673 doi:1O.1006/jsvi.2001.3957, available online at http://www.idealibrary.com on IDE~l  

E-Print Network (OSTI)

Journal of Sound and Vibration (2002) 250(4), 649-673 doi:1O.1006/jsvi.2001.3957, available online at http://www.idealibrary.com on IDE~l® FORCED VIBRATIONS OF TRIPLY COUPLED, PERIODICALLY AND ELASTICALLY) An exact analytical method is presented for the analysis of forced vibrations of uniform, open

Yaman, Yavuz


What's InsIde? Announcements  

NLE Websites -- All DOE Office Websites (Extended Search)

July 2013 July 2013 hIghlIghts "MRCSP Begins Field Tests in Michigan" The Midwest Regional Carbon Sequestration Partnership (MRCSP), led by Battelle, announced the beginning of a large-scale carbon dioxide (CO 2 ) injection in Michigan's Northern Reef Trend. The project is designed to inject and monitor at least 1 million metric tons of CO 2 into a series of oil fields that are in different stages of their production life cycles. The first test in the series will inject up to 500,000 metric tons of CO 2 into an oil field that has undergone primary production and enhanced oil recovery (EOR) for several years and is now near the end of its productive life. During the

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Case Study No. 2: Bon Apptit Management Company  

E-Print Network (OSTI)

and hormone use, seafood health and sustainability,began with a sustainable seafood educational tour around thelearning how to make better seafood choices. This effort

Thistlethwaite, Rebecca; Brown, Martha



Notice of Comment Period for the Klondike III/Biglow Canyon Wind Integration EIS (DOE/EIS-0374) (12/06/05)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

635 Federal Register 635 Federal Register / Vol. 70, No. 233 / Tuesday, December 6, 2005 / Notices Program activity Performance goals * Cost Goals * Efficiency Environmental Advanced Power Systems ............. 45-50% higher heating value (HHV) efficiency to electricity by 2010 Multi-product capability (e.g. power and hydrogen) with over 60% efficiency by 2015 Sulfur Dioxide (SO 2 ): >99% removal NO X : < 0.01 lb/million Btu Hg: >90% removal Carbon Diox- ide (CO 2 ) capture: >90% 2012 goal: <10% increase in cost of electricity services in zero emission advanced gasification plants integrated with carbon sequestration. Carbon Sequestration .................... Efficiency of current and new plants consistent with cost of electricity target 90% CO 2 capture and sequestra-


Low Cost Open-Path Instrument for Monitoring Atmospheric Carbon Dioxide at Sequestration Sites  

NLE Websites -- All DOE Office Websites (Extended Search)

Low Cost open-path Instrument for Low Cost open-path Instrument for monItorIng atmospherIC Carbon DIoxIDe at sequestratIon sItes Background Growing concern over the effect on global climate of the buildup of greenhouse gases (GHG), particularly carbon dioxide (CO 2 ), in the atmosphere may lead to the curtailment of CO 2 emissions. One potential course of action by industry to reduce GHG emissions is the subsurface disposal of CO 2 . An important requirement of such disposal is verification that the injected gases remain in place and do not leak to the surface. Perhaps the most direct evidence of a successful sequestration project is the lack of a detectable CO 2 concentration above the background level in the air near the ground. Although measurement of CO 2 concentration can be performed, it is


Notice of Comment Period for the Klondike III/Biglow Canyon Wind Integration EIS (DOE/EIS-0374) (12/06/05)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

635 Federal Register 635 Federal Register / Vol. 70, No. 233 / Tuesday, December 6, 2005 / Notices Program activity Performance goals * Cost Goals * Efficiency Environmental Advanced Power Systems ............. 45-50% higher heating value (HHV) efficiency to electricity by 2010 Multi-product capability (e.g. power and hydrogen) with over 60% efficiency by 2015 Sulfur Dioxide (SO 2 ): >99% removal NO X : < 0.01 lb/million Btu Hg: >90% removal Carbon Diox- ide (CO 2 ) capture: >90% 2012 goal: <10% increase in cost of electricity services in zero emission advanced gasification plants integrated with carbon sequestration. Carbon Sequestration .................... Efficiency of current and new plants consistent with cost of electricity target 90% CO 2 capture and sequestra-


RAPID/Roadmap/8-ID-e | Open Energy Information  

Open Energy Info (EERE)

permanent transmission facility; A description of the proposed right-of-way width for the transmission line, including to what extent a new right-of-way will be required or an...


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

solvents solvents B-6 Pre-Combustion solvents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 Co 2 CaPture from igCC gas streams using aC-abC ProCess primary project goals SRI International is developing, for integrated gasification combined cycle (IGCC)-based power plants, a carbon dioxide (CO 2 ) capture technology based on the use of a high-ca- pacity and low-cost aqueous ammoniated solution containing ammonium carbonate (AC), which reacts with CO 2 to form ammonium bicarbonate (ABC).


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

solvents solvents B-198 Post-Combustion solvents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 DeveloPment anD Demonstration of Waste heat integration With solvent ProCess for more effiCient Co 2 removal from Coal-fireD flue gas primary project goals Southern Company Services is developing viable heat integration methods for the capture of carbon dioxide (CO 2 ) produced from pulverized coal (PC) combustion. The project will quantify energy-efficiency improvements to the CO 2 capture process by utilizing a waste heat recovery technology, High-Efficiency System (HES). technical goals * Reduction of the amount of extraction steam required for sensible heat load in the


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

sorbents sorbents B-302 Post-Combustion sorbents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 benCh-sCale DeveloPment anD testing of raPiD Pressure swing absorPtion for Carbon DioxiDe CaPture primary project goals WR Grace and the University of South Carolina are developing a rapid pressure swing adsorption (PSA) process to evaluate concept cost and performance benefits by testing a bench-scale system using a low-cost, structured adsorbent with low-pressure drop, high mass-transfer rates, high capacity, and high availability that will enable large feed through- puts. technical goals * Develop an attrition-resistant and low-pressure drop structured adsorbent based on a


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

sorbents sorbents B-14 Pre-Combustion sorbents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 aDvanCeD Carbon DioxiDe CaPture teChnology for low-rank Coal integrateD gasifiCation CombineD CyCle (igCC) systems primary project goals TDA will investigate the technical and economic advantages of using an integrated carbon dioxide (CO 2 ) sorbent and water-gas shift (WGS) catalyst system in an integrated gasifi- cation combined cycle (IGCC) power plant, fueled with low-rank coal, and designed to capture more than 90% of the CO 2 emissions. technical goals * TDA will evaluate the physical mix of the sorbent and catalyst pellets within the same


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

AdvAnced compression AdvAnced compression B-540 AdvAnced compression U.s. depArtment of energy AdvAnced cArbon dioxide cAptUre r&d progrAm: technology UpdAte, mAy 2013 novel concepts for the compression of lArge volUmes of co 2 primary project goals Southwest Research Institute (SwRI) is developing novel compression technology concepts to reduce carbon dioxide (CO 2 ) compression power requirements by 10% compared to conventional compressor designs. The basic concept is a semi-isothermal compression pro- cess where the CO 2 is continually cooled using an internal cooling jacket rather than using conventional interstage cooling. The project has completed thermodynamic (Phase I) and prototype testing (Phase II). A full-scale demonstration of a multi-stage, internally cooled


Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

membranes membranes B-370 Post-Combustion membranes u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 eleCtroChemiCal membrane for Carbon DioxiDe CaPture & Power generation primary project goals FuelCell Energy, Inc. (FCE) is developing an electrochemical membrane (ECM)-based Combined Electric Power and Carbon Dioxide Separation (CEPACS) system for carbon dioxide (CO 2 ) capture that also provides additional electrical power generation. The project includes bench-scale testing of an 11.7 m 2 -area ECM (molten carbonate fuel cell) system for CO 2 capture, purification, and compression. technical goals * Perform contaminant effect testing to establish maximum permissible concentrations of


E-Print Network 3.0 - activities bon voyage Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

that Voyager is seeing activity upstream of the shock... Relation between the solar wind dynamic pressure at Voyager 2 and the energetic particle events... at Voyager 1...


Donald Frederick, LLNL  

NLE Websites -- All DOE Office Websites (Extended Search)

Donald Donald Frederick, LLNL - Presented at Supercomputing '11 Lawrence Livermore National Laboratory, P. O. Box 808, Livermore, CA 94551! Case Study: Beyond Homogeneous Decomposition with Qbox Scaling Long-Range Forces on Massively Parallel Systems LLNL---PRES---508651 Case S tudy: O utline * Problem D escripBon * ComputaBonal A pproach * Changes f or S caling LLNL---PRES---508651 Computer s imulaBons o f m aterials Computer s imulaBons a re w idely used t o p redict t he p roperBes o f new m aterials o r u nderstand t he properBes o f e xisBng o nes LLNL---PRES---508651 SimulaBon o f M aterials f rom F irst--- Principles First---principles m ethods: Calculate p roperBes o f a g iven m aterial d irectly f rom fundamental p hysics e quaBons. * No e mpirical p arameters Can m ake p redic-ons a bout c


International Energy Outlook 2007  

Gasoline and Diesel Fuel Update (EIA)

2004, non-OECD emissions of carbon dioxide were greater than OECD emissions 2004, non-OECD emissions of carbon dioxide were greater than OECD emissions for the first time. In 2030, carbon dioxide emissions from the non-OECD countries are projected to exceed those from the OECD countries by 57 percent. Carbon dioxide is the most abundant anthropogenic (human-caused) greenhouse gas in the atmosphere. In recent years, atmospheric concentrations of carbon diox- ide have been rising at a rate of about 0.5 percent per year, and because anthropogenic emissions of carbon dioxide result primarily from the combustion of fossil fuels for energy, world energy use has emerged at the center of the climate change debate. In the IEO2007 refer- ence case, world carbon dioxide emissions are projected to rise from 26.9 billion metric tons in 2004 to 33.9 billion metric tons in 2015 and 42.9 billion metric tons in 2030. 17 From 2003 to 2004,


Appendix B: CArBon dioxide CApture teChnology SheetS R&D CollaboRations  

NLE Websites -- All DOE Office Websites (Extended Search)

R&D CollaboRations R&D CollaboRations B-556 R&D CollaboRations U.s. DepaRtment of eneRgy aDvanCeD CaRbon DioxiDe CaptURe R&D pRogRam: teChnology UpDate, may 2013 paRtneRship foR Co 2 CaptURe primary project goals The University of North Dakota Energy and Environmental Research Center (UNDEERC) is conducting pilot-scale testing to demonstrate and evaluate a range of carbon dioxide (CO 2 ) capture technologies to develop key technical and economic information that can be used to examine the feasibility of capture technologies as a function of fuel type and system configuration. technical goals * Integrate a high-efficiency flexible capture system with existing pilot-scale combustion


Appendix B: CArBon dioxide CApture teChnology SheetS Oxy-COmbustiOn  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxy-COmbustiOn Oxy-COmbustiOn B-424 Oxy-COmbustiOn u.s. Department Of energy aDvanCeD CarbOn DiOxiDe Capture r&D prOgram: teChnOlOgy upDate, may 2013 Oxygen transpOrt membranes fOr inDustrial appliCatiOns primary project goals Praxair is optimizing oxygen transport membrane (OTM) performance, materials, and process configurations leading to subsequent development-scale testing of OTM technology for synthesis gas (syngas) production applications, providing valuable experience needed to develop commercial OTM technology in industrial applications and future utility-scale


Appendix B: CArBon dioxide CApture teChnology SheetS Oxygen PrOductiOn  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxygen PrOductiOn Oxygen PrOductiOn B-500 Oxygen PrOductiOn u.S. dePartment Of energy advanced carbOn diOxide caPture r&d PrOgram: technOlOgy uPdate, may 2013 itm Oxygen technOlOgy fOr integratiOn in igcc and Other advanced POwer generatiOn SyStemS primary project goals Air Products and Chemicals set out to design and develop an ion transport membrane (ITM) based on ceramics that selectively transport oxygen (O 2 ) ions when operated at high temperature. This high-temperature process may be integrated with advanced power genera- tion processes that require O 2 as a feedstock, such as integrated gasification combined cycle (IGCC) and other clean energy and industrial applications. technical goals * Design, construct, and operate a 0.1-ton/day (TPD) technology development unit


Berlin, le 25 janvier 2007 Evaluation et politiques: Y a-t-il de bons indicateurs pour la recherche?  

E-Print Network (OSTI)

(derived from the works of Amartya Sen). Then I try to apply these conceptions towards research evaluation

Paris-Sud XI, Université de


Combining boron isotopes and carbamazepine to trace sewage in salinized groundwater: a case study in Cap Bon, Tunisia  

E-Print Network (OSTI)

treatment and so recognized as a pertinent tracer of wastewater contamination. The system equilibrium of Research in Rural Engineering of Water and Forestry), rue Hédi Karray, B.P.10- 2080 Ariana, Tunisia based on a managed aquifer recharge with treated wastewater. Water quality monitoring was implemented

Paris-Sud XI, Université de


The Regional Watershed Spreadsheet Model (RWSM)  

E-Print Network (OSTI)

WI Presenting on work developed by: The Small Tributaries Loading Strategy Workgroup BASMAA * SFEI Estimates #12;10. Improved Loads Estimates Small Tribs Small Tribs In-Bay Erosion Large Rivers PCBs Loads of this plan... Hydro Sed Cu Hg PCB Se Diox PBDE OC Pest Hydro Sed Cu Hg PCB Se Diox PBDE OC PestStep 1 2 3 4 5

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - avec les idees Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

x 1 et trouver deux familles ... Source: Pujo-Menjouet, Laurent - Institut Camille Jordan, Universit Claude Bernard Lyon-I Collection: Mathematics ; Biology and Medicine 4 M1...


LABORATOIRE LETTRES IDEES ET SAVOIRS (LIS) Spcialit : Langues et Littratures trangres  

E-Print Network (OSTI)

, Maître de conférences à l'université Omar Bongo (Gabon) Rapporteur : M. Steeve R. Renombo, Maître de conférences à l'Université Omar Bongo (Gabon) Directeur de Thèse : M. Papa Samba DIOP, Professeur de : M. Nicolas MBA ZUE, Maître de conférences à l'université Omar Bongo (Gabon) Rapporteur : M. Steeve R

Paris-Sud XI, Université de


US Army Corps of Engineers Portland District  

E-Print Network (OSTI)

) 1,200 Steelhead Kelt passage at BON Passage behavior to inform decision on BON powerhouse priority


IOP PUBLISHING NANOTECHNOLOGY Nanotechnology 20 (2009) 115705 (5pp) doi:10.1088/0957-4484/20/11/115705  

E-Print Network (OSTI)

O2 NWs and their response towards gaseous species such as water, carbon monoxide and nitrogen diox crystalline tin oxide NWs were grown at 45 from a titanium dioxide substrate. Their elastic properties were


The Darlington Centre and Forum Restaurant 174 City Road, Darlington NSW 2008 Ph: 9351 4664 Email: forum.restaurant@sydney.edu.au Bon Appetite!  

E-Print Network (OSTI)

and crafted so you can eat fresh, seasonal produce sourced from ethical and sustainable suppliers. #12;The with a shot of Pedro Jimenez Sherry and 9 a shot of Black Rose tea COFFEE & TEA Toby's Estate: Latte Paraguay and real cola nut grown by the Mende & Temne people of Sierra Leone. Lemmy Lemonade: Give your

Viglas, Anastasios


Motion plan n in g for m ulti-robot assem bly M . BON ER T, L. H. SHU and B. BEN H ABIB  

E-Print Network (OSTI)

-type optim ization problem s. H owever, in these augm ented TSPs (TSP+) , both the `sales- person' (a robot, Euclidean, Ch ebysh ev, prize collectin g an d tim e-depen - den t TSP variation s ( Dubowsky an d Blubaugh

Shu, Lily H.


This article was downloaded by: [b-on: Biblioteca do conhecimento online ISPA] On: 15 January 2013, At: 09:17  

E-Print Network (OSTI)

-401, Coimbra, Portugal b Eco-Ethology Research Unit & Centro de Biociências, ISPA, Rua Jardim do Tabaco 34, 1149-041, Lisboa, Portugal c ICNB ­ DGACZH, Reserva Natural do Paul de Arzila, Rua do Bairro 1, 3045 do Porto, Campus Agrário de Vairão, Rua Padre Armando Quintas, P-4485-661, Vairão, Portugal e


time left page StorySlugS: SEQuENCE: DESIgNEr: guIDE#: rEMArKS  

E-Print Network (OSTI)

created a huge increase in CO2 in the atmosphere by burning coal and oil. that man-made climate change emerge over time. publicpolicyismorecomplicatedthan clean and controlled experiments, Space and technology in the Rayburn House Office Building. as i looked over the heads of the seated

Holton, Gerald


Institut Farman : Appel projets 2014 Les projets peuvent prendre plusieurs formes : jeunes chercheurs, lancement d'une nouvelle ide,  

E-Print Network (OSTI)

Institut Farman : Appel à projets 2014 Les projets peuvent prendre plusieurs formes : jeunes). - Version « Industrielle » (1 labo/1 industriel) : projet impliquant un laboratoire Farman et un partenaire que le(s) laboratoire(s) Farman participant. La durée typique des projets est de deux ans (à compter


Institut Farman : Appel projets 2013 Les projets peuvent prendre plusieurs formes : jeunes chercheurs, lancement d'une nouvelle ide,  

E-Print Network (OSTI)

Institut Farman : Appel à projets 2013 Les projets peuvent prendre plusieurs formes : jeunes). - Version « Industrielle » (1 labo/1 industriel) : projet impliquant un laboratoire Farman et un partenaire que le(s) laboratoire(s) Farman participant. La durée typique des projets est de deux ans (à compter


CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network (OSTI)

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005. The contribution will be organised as a poster and will present illustrations of the way student teachers meet

Spagnolo, Filippo


CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network (OSTI)

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005 Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005

Spagnolo, Filippo


CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network (OSTI)

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005. Kiliskiego 12, piotr@wlodkowic.pl The poster is to present the first results of research made among teachers

Spagnolo, Filippo


CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network (OSTI)

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005 Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005

Spagnolo, Filippo


CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network (OSTI)

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23

Spagnolo, Filippo


CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network (OSTI)

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005 with his education. In this poster, we study the students' personal school-routes as a variable

Spagnolo, Filippo


CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network (OSTI)

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005: Solution 2: #12;CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum

Spagnolo, Filippo


CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network (OSTI)

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005 will have a format of a poster. It will focus on the illustrations of the above goals. Problems from

Spagnolo, Filippo


Advanced Design and Commissioning Tools for Energy-Efficient Building Technologies  

E-Print Network (OSTI)

energy building was achieved through an integrated design2. Integrated Design Associates, Inc. (IDeAs) Building, Santhe Integrated Design Associates, Inc. (IDeAs) Building, San

Bauman, Fred; Webster, Tom; Zhang, Hui; Arens, Ed



Biological Control 21, 230-248 (2001) doi:1O.1006/bcon.2001.0938, available online at http.Zwww.idealibrary.com on IDE ~L  

E-Print Network (OSTI)

of application, increased environmental persistence, and longer shelf life; (5) better understanding of how virus), a fungus (Entomophaga maim- aiga), and a nematode (Deladenus siricidicola) as in- noculatively. Most examples of microbial control involve inundative application of entomopatbogens, The most widely

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


L'utilisation de la mythologie dans le Contre Rufin de Que le recours la mythologie soit indissociable de l'ide mme que les Latins  

E-Print Network (OSTI)

. 3-100. 3 Voir au sujet du métamythe proserpinien les suggestions de Duffey 1985. 4 Voir évidemment Manuscrit auteur, publié dans "La poétique, théorie et pratique (2006) 683-699" #12;reconstitution des faits

Paris-Sud XI, Université de


Votre t petit prix !!! Depuis 60 ans au service des vacances familles et enfants, Vacances Pour Tous propose une autre ide des vacances !  

E-Print Network (OSTI)

4 Mai 2012 Votre été à petit prix !!! Depuis 60 ans au service des vacances familles et enfants, Vacances Pour Tous propose une autre idée des vacances ! Nos équipes vous proposent des vacances en villages vacances, locations, campings en France et à l'étranger mais aussi le plus grand choix de

Arleo, Angelo


UNIVERSIT DEGLI STUDI DI CATANIA Protocollo Generale Albo Ufficiale  

E-Print Network (OSTI)

, Avviso per la presentazione di idee progettuali per "Smart cities and communities and social innovation

Bella, Giampaolo


The VBA Integrated Development Environment (VBAIDE)  

Science Journals Connector (OSTI)

Within AutoCAD..., you develop VBA programs in the Visual Basic for Applications (VBA) Integrated Development Environment (IDE). Like the Visual LISP IDE, Autodesk provides the VBAIDE as an integral ...

Joe Sutphin



Inhibition of Potential Lethal Damage Repair and Related Gene Expression after Carbon-ion Beam Irradiation to Human Lung Cancer Grown in Nude Mice  

Science Journals Connector (OSTI)

......Gy for X-ray and 5 Gy for car- bon-ion beam because each...after exposure to X-ray or car- bon-ion beams was reported...GCAGCCGCTATTACCGTATC TGTGCCAGTGTCATCATCAA Genes defective in diseases associated with...after exposure to X-ray or car- bon-ion beams has been observed......

Tomoyasu Yashiro; Kumiko Koyama-Saegusa; Takashi Imai; Takehiko Fujisawa; Tadaaki Miyamoto



VISUAl IDeNtItY & BRAND USAge the logo Y E A R O F T H E A RTS AT DA RT M O U T H the logo  

E-Print Network (OSTI)

the ICoN: Custom mark spacing n the logotYPe construct is centered below the ICoN. n the width of the ICoN matches the width of the logotYPe construct. n the measurement from ICoN to logotYPe is the height

Myers, Lawrence C.


National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network (OSTI)

, CO, CO2 , N2 O, PM, heavy metals, dioxin, PAH, green- house gas Layout: Ann-Katrine Holme Greenhouse gas emission 33 5.1 CO2 35 5.2 CH4 39 5.3 N2 O 41 6 SO2 , NOX , NMVOC and CO 43 6.1 SO2 43 6.2 NOX , NMVOC, CH4 , CO, CO2 , N2 O, particulate matter, heavy metals, diox- ins and PAH. Since 1990 the fuel


Old Oyo Influences on the Transformation of Lucum Identity in Colonial Cuba  

E-Print Network (OSTI)

The Bon Maroon Wars in Suriname. Leiden: E. J. Brill, 1990.and Musical Transformations in Suriname c. 1775 until afterand Susu Xylophones in Suriname. Paper presented at

Lovejoy, Henry B.




Science Journals Connector (OSTI)

Sep 10, 1975 ... cepts radiant energy and uses it to pro- duce new ... Here we present an alternative derivation of Ban- ..... and particulate organic car- bon were...



tel-00550139,version1-23Dec2010 tel-00550139,version1-23Dec2010  

E-Print Network (OSTI)

'ai eues avec bon nombre de chercheurs du DMSC. Merci à vous Bertrand, Christian, Daniel(s), Françoise

Paris-Sud XI, Université de



Science Journals Connector (OSTI)

Production of chlorinated hydrocarbons and methyl iodide by the red microalga. Porphyridium .... bons were extracted from the water samples by purging and.



Universit de Rouen cole Doctorale Savoirs Critique Expertises (ED 350)  

E-Print Network (OSTI)

, Himanshu, Girish Kumar, Loraine Kennedy et Marie-Hélène Zérah. Aux collègues de l'UMR IDEES, merci pour vos

Paris-Sud XI, Université de


ber verstehende Anthropologie  

Science Journals Connector (OSTI)

Die nachfolgende Darstellung einer verstehenden Anthropologie ist notwendig skizzenhaft. Das ist bescheiden und anspruchsvoll zugleich. Denn: In einer guten Skizze mu die Idee des Ganzen zwar nicht expliziert...

Jrg Zutt



E-Print Network 3.0 - argonne tandem-line accelerator Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

Accelerator System (ATLAS) facility at Argonne. Pure samples of neptunium, americium and curium... InsIde ArgonneDirector:Americaneedstoreigniteinnovationecology'-Page2 ......


E-Print Network 3.0 - argonne wakefield accelerator Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Accelerator System (ATLAS) facility at Argonne. Pure samples of neptunium, americium and curium... InsIde ArgonneDirector:Americaneedstoreigniteinnovationecology'-Page2 ......


Direktmethanol-Brennstoffzelle (DMFC)  

Science Journals Connector (OSTI)

Seit ber fnfzig Jahren verfolgen Brennstoffzellenforscher die elektrochemische Direktverstromung von Methanol und anderen Alkoholen eine faszinierende Idee! Direktbrennstoffzellen wandeln die chemische Energi...

Peter Kurzweil



Measurements of reactive trace gases and variable O3 formation rates in some South Carolina biomass burning plumes  

E-Print Network (OSTI)

nitric ox- ide (NO), nitrogen dioxide (NO 2 ), ammonia (NHNitric Oxide (NO) Nitrogen Dioxide (NO 2 ) Nitrogen Oxides (Nitric Oxide (NO) Nitrogen Dioxide (NO 2 ) Nitrogen Oxides (



Building Technologies Program - 1995 Annual Report  

E-Print Network (OSTI)

WI. Also ide Films for Electrochromic Devices," published as1) (1995). posited Electrochromic Coatings," nology: 1973-37747, July 1995. Use of Electrochromic Windows," Ther- LBL

Selkowitz, S.E.



The Language Application Grid , James Pustejovsky, Christopher Cieri, Eric Nyberg  

E-Print Network (OSTI)

The Language Application Grid Nancy Ide , James Pustejovsky, Christopher Cieri, Eric Nyberg , Denise DiPersio, Chunqi Shi, Keith Suderman , Marc Verhagen, Di Wang , Jonathan Wright Vassar College

Ide, Nancy


Oil recovery by carbon dioxide injection into consolidated and unconsolidated sandstone  

E-Print Network (OSTI)

dioxide dis- Oiateme t s, that it e tr tts tighter hye ot hoes from the crude oil and this light liquid forms a bank ahead of the free carbon diox1de pushing the . oi-l-, For this reason, a portion of the oil produced was observed to be light oil.... The purpose of this research was to study experimentally the miscibility of carbon dioxide and Nillican crude oil in a consolidated sandstone core and an unconsolidated sand pack. A 15-ft. -long consolidated core was made by joining three indivi- dual 5-ft...

Lin, Fwu-Jin Frank


Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Multi-Agent Based Techniques for Coordinating the Distribution of Electricity in a Micro-Grid Environment  

E-Print Network (OSTI)

vehicles, to ultra-low carbon vehicles (ULCV) such as hybrids, electric vehicles and hydrogen fuel cell. 2 Background Research To reduce carbon emissions and ensure that the UK low car- bon emissions plan to the current national grid, the in- creasing demand for electricity will only result in more car- bon emissions

Southampton, University of


Studies on Biological Effects of Ion Beams on Lethality, Molecular Nature of Mutation, Mutation Rate, and Spectrum of Mutation Phenotype for Mutation Breeding in Higher Plants  

Science Journals Connector (OSTI)

......rearrangements preferably induced by car- bon ions have different molecular...mutant, suv2-1, which is defective in cell-cycle arrest in response...Rearrangement of the DNA in car- bon ion-induced mutants...mutant in Arabidopsis thaliana is defective in the DNA damage response......

Atsushi Tanaka; Naoya Shikazono; Yoshihiro Hase



Radiation-induced ICAM-1 Expression via TGF-?1 Pathway on Human Umbilical Vein Endothelial Cells; Comparison between X-ray and Carbon-ion Beam Irradiation  

Science Journals Connector (OSTI)

......expression in cells irradiated with car- bon-ion beam and the same...HUVE cells at 48 hours after car- bon beam irradiation. ICAM-1...human lymphoblasts and mice are defective in radiation- induced apoptosis...endothelial growth factor in lung car- cinoma cells. Int J Radiat......

Hiroki Kiyohara; Yasuki Ishizaki; Yoshiyuki Suzuki; Hiroyuki Katoh; Nobuyuki Hamada; Tatsuya Ohno; Takeo Takahashi; Yasuhiko Kobayashi; Takashi Nakano




E-Print Network (OSTI)

Petroleum Technology, February 2008, Vol. 47, No.2, 52-61. 25. Bon, J., Sarma, H.K., Rodrigues, J.T. and Bon, J.G., "Reservoir Fluid Sampling Revisited - A Practical Perspective", SPE Reservoir Evaluation in SPE News Australasia, October/November 2003, Issue 79. 17. H.K. Sarma, N. Yazawa, R.G. Moore, S

Williams, John M.


High-temperature formation of concentric fullerene-like structures within foam-like carbon: Experiment and molecular dynamics simulation  

E-Print Network (OSTI)

car- bon ion implantation,4 and arc discharge from a carbon target in water.5 Onionlike structures of concentric fullerene-like structures, car- bon onions can be formed in a variety of harsh environments laser operating at 532 nm, generating 12 ps pulses at a rep- etition rate of 1.5 MHz, with average power

Powles, Rebecca


Estimation of Yields of OH Radicals in Water Irradiated by Ionizing Radiation  

Science Journals Connector (OSTI)

......simulations by Monte Car- lo method have...time being, an alternative approach may still...the spur. The energy Es to form a spur...a function of energy (keV/amu...protons, helium- , car- bon-, neon...Solution with Car- bon- and Nitrogen...Chemistry of High-Energy Carbon, Neon......

Hiroshi Yamaguchi; Yukio Uchihori; Nakahiro Yasuda; Masashi Takada; Hisashi Kitamura



The relationship between electronmolecule collision cross?sections, experimental Townsend primary and secondary ionization coefficients and constants, electric strength and molecular structure of gaseous hydrocarbons  

Science Journals Connector (OSTI)

...and constants, electric strength and molecular...hydrogen atoms/car- bon{hydrogen...relevant electron energy range being deter...Townsend ionization; electric strength; molecular...length (i.e. car- bon nucleus...the same in the energy range of interest...Lond. A (2000) Electric characteristics...



1) Under the tool bar has a  

E-Print Network (OSTI)

xcel is old) projects with of different ke Alt + F11 gure 1 - Acce ual Basic to Basic Editor ment Envir different fo must know xcel: select A IDE from t the View/To in the middl IDE) w to use the ach compone Editor xcel. When t gure 2). creating you ffice suite o programming oject. ssed this an access the (as

Boisvert, Jeff


Hai un'idea di impresa? La Regione Veneto ti aiuta a realizzarla La Direzione Lavoro della Regione Veneto partecipa al progetto I. E. SMART -Smart Training  

E-Print Network (OSTI)

Veneto partecipa al progetto I. E. SMART - Smart Training Network for Innovation and Entrepreneurship Competition è un concorso di idee che si svolge in più fasi: dal 1° agosto al 30 ottobre 2013 si raccolgono le idee presentate tramite il formulario on line che trovi collegandoti al seguente link: http

Romeo, Alessandro


Is Conflict of Interest Becoming a Challenge for Institution-Based Institutional Review Boards?  

Science Journals Connector (OSTI)

...treatment. We also discuss the process involved in the first review...into the protocol development process are presented. Clin Cancer...why sale does not constitute commercialization 10. Please note that an environmental...pertinent to the pre-IDE and IDE process. Figure 2. Comparison of...

Ralph S. Freedman and Ross McKinney, Jr




E-Print Network (OSTI)

Assessments, MTBI and SVII: $50 each - including required interpretation session (membership required) EVANSTON PUBLIC LIBRARY 1703 Orrington Ave. 60201 847-448-8600 www.epl.org Career Counselling on the second-NET CENTER, EVANSTON 1615 Oak Street Evanston, IL 60201 IDES: 1-888-367-4382. http://www.ides.state.il.us/general

Shull, Kenneth R.


Constitution (1987). Haitian French Creole  

E-Print Network (OSTI)

jistis tout bon vre. 3. Konstitisyon sa a la, pou peyi d Ayiti kanpe solid, pou li kanpe an fm, an pami tout nasyon. Pou li pa restavk okenn lot peyi. Pou li kenbe tou sa ki f Ayisyen, se Ayisyen tout bon, ni nan sa yo mete konfyans yo ladan, ni... nan jan yo viv, ni nan fason youn svi ak 1L 4. Konstitisyon sa a la, pou demokrasi pouse bon rasin nan peyi a. Pou tout moun gen dwa suiv lide yo lib. Pou direksyon peyi a pa toujou rete nan men menm moun ak menm gwoup moun tout tan. Pou psonn...



Novel Complexes Featuring Unusual Polynuclear Co(III)-Fe(III...  

NLE Websites -- All DOE Office Websites (Extended Search)

E.N. Chygorin, O.V. Nesterova, J.A. Rusanova, V.N. Kokozay, V.N. Bon (Kiev University, Ukraine), R. Boa, (Trnava University, Slovakia) Fig. 2. 77 K Mssbauer spectrum of the...


PROPOSITION (Allocation de  

E-Print Network (OSTI)

appliquées) avec un gout pour la théorie et des compétences avérées en programmation. Un bon niveau de

Jeanjean, Louis


Supercomputer Analysis of Sedimentary Basins  

Science Journals Connector (OSTI)

...expelled from source rocks, hydrocar-bons...accumulate into petroleum reservoirs. Reservoirs may form in rocks that resisted compaction...In Eq. 1, + is porosity, a and, 3 are...kz are directional permeabilities,, u is fluid viscosity...




Detecting and quantifying oxygen functional groups on graphite nanofibers by fluorescence labeling  

E-Print Network (OSTI)

as adsorbents for small organic molecules from aqueous streams [5], electrodes for fuel cells [6], hydrogen 0008 that was detected by FLOSS on nitric acid-oxidized GCNFs totaled approximately 2.5% of surface car- bon, present

Borguet, Eric


Glucose Fermentation Pathway of Thermoanaerobium brockii  

Science Journals Connector (OSTI)

...the growth phase, cell suspensions were...toluene-treated cell suspensions were...L-lactate, acetate, hydrogen, and car- bon dioxide production...Clostridium pasteurianum. Cell extracts also contained...catabolic amounts of hydrogen- ase, phosphotransacetylase...

R. Lamed; J. G. Zeikus



Aerosol Science and Technology, 44:11401145, 2010 Copyright American Association for Aerosol Research  

E-Print Network (OSTI)

application in fuel cells and sensors involving adsorp- tion and dissociation of hydrogen, oxygen, and various. Activated carbon, car- bon nanotubes (CNTs), carbon nanosheets, and silica (SiO2) gel have often been

Huang, Jiaxing


Investigation into the Effect of Surface Treatment on the Wettability and the Bondability of Low Surface Energy Materials  

Science Journals Connector (OSTI)

An experimental effort has been undertaken to examine the effect of surface treatment on various low surface energy thermoplastic materials to promote wettability and ... measurements were correlated with the bon...

J. P. Jeandrau



Bibliography and Index of the Literature on Gas Chromatography1964 November 1, 1963 to November 1, 1964  

Science Journals Connector (OSTI)


Mignon Gill; Seaton T. Preston; Jr.


Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


portation and Greenhouse Gas (MUNTAG) model is a macroscopic, highly aggregate model that works at the municipal level and solely  

E-Print Network (OSTI)

identifies the following four sectors: buildings; trans- portation and land use; energy supply; and municipal GHG inventory. This work is part of a project to write a guide called Getting to Car- bon Neutral

Illinois at Chicago, University of


Three-dimensional spatial coordinates of individual plankton ...  

Science Journals Connector (OSTI)

A highly unsaturated fatty acid predicts car- bon transfer ... 2,400 ml of water, at 750 mm depth, can be analysed with a resolution ..... power of the technique.



The Jovian system: the last outpost for life?  

Science Journals Connector (OSTI)

......and other sources of energy. This material accumulated...methane, ammonia and car- bon dioxide. However...time. In addition, energy sources available on...atmosphere interface. An alternative energy source to surface-based......

Julian Hiscox




Science Journals Connector (OSTI)

efficiently the abundant yet ephemeral local energy sources, primarily geothermally .... parative analyses of the ratios of the stable isotopes of car- bon and nitrogen. ..... Our experiments were designed to test the two alternative hypotheses that...


Site-specific and ontogenetic variations in nutrition of mussels ...  

Science Journals Connector (OSTI)

a consistent energy source throughout their life or if they switch trophic modes depending on ... a significant contribution of photosynthetically derived car- bon. As postmetamorphic ..... alternative hypothesis is that larval and postlarval carbon



Tumor Induction in Mice Locally Irradiated with Carbon Ions: A Retrospective Analysis  

Science Journals Connector (OSTI)

......dose fractionation nor linear energy transfer affected tumor induction...700 patients by Year 2004. Car- bon ions, high LET (linear energy transfer) radiation, are...penumbra near collimators. Alternative explanation for the linear......

Koichi Ando; Sachiko Koike; Chisa Oohira; Toshiaki Ogiu; Fumio Yatagai



the page - American Society of Limnology and Oceanography  

Science Journals Connector (OSTI)

May 28, 1981 ... We thank A. F. Carlucci and C. C. Price for providing the cultures and K. J. ..... threne (a fossil fuel aromatic hydrocar- bon) show essentially zero...



Purification de l'hexafluorure d'uranium.  

E-Print Network (OSTI)

??Lhexafluorure duranium (UF6), est le seul compos utilis ltat gazeux dans les procds denrichissement pour la production du combustible nuclaire. Pour le bon droulement (more)

Benzouaa, Rachid



Padova, 29 novembre 2010 Arturo Lorenzoni  

E-Print Network (OSTI)

energy technologies have to give proper answers to 2 main challenges in the long term. We need to find the sustainable soluBons to the energy supply conundrum. Most energy companies have very short Bme horizons due to stock

Schenato, Luca


fois, ils semblent aussi impliqus dans une tape postrieure l'initiation qui est la promo-  

E-Print Network (OSTI)

E.A. & Recknagel R.O. (1983) Carbon tetrachloride and bromotrichloromethane toxi- city. Dual role.A., Fernan- dez Y. & Mitjavila S. (1986) Radical activation of car- bon tetrachloride in foetal and maternal

Paris-Sud XI, Université de


Tribology International 40 (2007) 345349 A comparative study on the structure and hardness enhancement  

E-Print Network (OSTI)

by a combination of soft BON film and hard TiN film using low- (100 kHz) and high (13.56 MHz)-frequency RF plasma) substrate by low and high RF frequency plasma-assisted metal­organic chemical vapor deposition rights reserved. Keywords: Hard coatings; A-BON/nc-TiN bilayers; PAMOCVD; Low- and high-frequency RF

Boo, Jin-Hyo



Office of Legacy Management (LM)

Ra In the bui Idings then there should be an elevation of the Rn and its daughter products. Air samples were taken ou 1 stde the building and In the various rooms found...


Venture Capital in den USA und der Bundesrepublik  

Science Journals Connector (OSTI)

Der Begriff Venture Capital wird oft mit der Lsung technisch-wirtschaftlicher Problemstellungen der 80er Jahre verbunden. Auch deutsche Politiker und Medien entdeckten 1983 diese Idee. Sie waren von den jen...

Werner Quillmann



Stable, inducible thermoacidophilic alpha-amylase from Bacillus acidocaldarius.  

Science Journals Connector (OSTI)

...thermoacidophilic a-amylase. This paper...potato starch amylopectin, and amylose were obtained...ide, and a-amylase-free barley...acidocaldarius amylase was able to hy- drolyze starch, amylose, amylopectin, and gly- cogen...

V Buonocore; C Caporale; M De Rosa; A Gambacorta



Exploration de la notion de ressemblance  

E-Print Network (OSTI)

no Narihira. Anthologie de la po'esie japonaise classique. G. Renondeau (Ed. et trad.). Gallimard, 1971. Ce. La premi`ere s'attache `a fournir une id'ee intuitive de comment 'evaluer la ressemblance d

Sagot, Marie-France


Electronic, thermal and mechanical properties of carbon nanotubes  

Science Journals Connector (OSTI)

...This has led to the prediction that these defective nanotubes behave as the desired nanoscale...Haeckel (1862). These `ide- ally' defective tubes exhibit intriguing electronic properties...dt car- boncarbon energy overlap integral of...



Rechnerarchitekturen und Betriebssysteme (CS201)  

E-Print Network (OSTI)

, funktioniert unter Wine C-Compiler, IDE: Ubuntu: sudo apt-get install arduino Ubuntu: sudo apt-get install gcc-avr http://www.nongnu.org/avr-libc/ Tutorial: http://arduino.cc/en/Guide/HomePage http

Vetter, Thomas


MDCF Tutorial Device Interface and App Development  

E-Print Network (OSTI)

-generated Device Interface (ICE Device Model) Vision: IDE for Driver Development & Validation Vision: IntegratedMDCF Tutorial Device Interface and App Development Acknowledgements: Funding provided by US National Science Foundation awards 0734204, 0930647 Clinical documentation and hardware provided by CIMIT

Huth, Michael


Human soluble epoxide hydrolase: Structural basis of inhibition by  

E-Print Network (OSTI)

-bearing substrates. The catalytic mechanism proceeds via an SN2-type reaction mecha- nism in which the epoxide hydrolase (mEH) and soluble epox- ide hydrolase (sEH) catalyze the oxirane ring opening reaction on epoxide

Hammock, Bruce D.


E-Print Network 3.0 - azolla caroliniana willd Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

43 A Look InsIde At the Center page 2 Summary: CAROLINIANA Author: BULTEMEIER, B., NETHERLAND, M.D., FERRELL, J., HALLER, W.T. Date: 2010 Citation: INVASIVE... Pistia as perhaps...

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A DevOps framework to shorten delivery time for cloud applications  

Science Journals Connector (OSTI)

This paper proposes DevOps platforms for cloud applications, integrating both the development and operation environment seamlessly. It consists of the client-side integrated development environment (IDE), and the server-side service portfolio and cloud controller. The IDE has requirement definition, architecture design and application prototyping tools, and it can simulate execution of large-scale applications in developers' PCs. The service portfolio incorporates data from these tools and enables automatic data sharing between them, thereby avoiding setback and redundancy. To deploy the applications in the cloud, the cloud controller utilises the resource structures designed in the IDE and generates virtual machines (VMs) from templates, in which a verified OS and middleware for large-scale data processing are packaged. The behaviour of applications and VMs will be automatically monitored and catalogued as feedbacks for the developers. With these comprehensive approaches, the system integration methods can be streamlined and the acceleration of development can be easily demonstrated.

Shigeru Hosono



Investigation of Soap Powders  

E-Print Network (OSTI)

in the presence of such a large excess of NajjSO* as is usually present, does not give a sharp end point, but a gradual fading from yellow to pink so that some little practice is necessary before the operator can hit the end point accurately. Practice does... and soap. Bon Ami Manufactured by Bon Ami Company, New York, I. Y. Wt. 10 ounces Price 10 cents. Analysis. Moisture .......... 0.28# Soap 6.54# Albite 93,18# Total 100.00^ IT. B. Albite is an orthoclase of the following composition: Si0 2 68...

Bragg, G.A.



Ann bay lodyans 5 / se Bryant Freeman ("Tonton Liben") ki pare ti liv sa a  

E-Print Network (OSTI)

genyen. Tijo we yon tig ki te tonbe nan yon gwo twou. Li pa t kapab soti paske twou a fon. Kounye a tig la prizonye. Li di Tijo: "Ou se yon bon ti gason, ede m soti, souple." Tijo reponn: "Si mwen retire ou nan twou a, ou ap manje m." Tig la di: "O... non, bon ti pitit mwen, mwen p ap manje ou. Pa panse sa, non." Tijo mande li: "Eske ou ap pwomet mwen ou p ap manje m?" "Wi, pwomes fet," tig la di I avek gwo vwa li. Tijo ede tig la soti nan twou a. Le tig la fin soti, li vole sou T i j...

Freeman, Bryant C.



A study of zooplankton in the Corpus Christi ship channel area near Ingleside, Texas  

E-Print Network (OSTI)

. The study is a part of environmental assessment of the area where the Natural Gas Pipeline Company of America (NGPL) proposes to construct a liquid natural gas (LNG) facility. The site is located on the Corpus Christi Ship Channel at Port Ingle. ". ide.... The study is a part of environmental assessment of the area where the Natural Gas Pipeline Company of America (NGPL) proposes to construct a liquid natural gas (LNG) facility. The site is located on the Corpus Christi Ship Channel at Port Ingle. ". ide...

Ansari, Fahmida



Haitian Creole-English English-Haitian Creole Medical Dictionary  

E-Print Network (OSTI)

; orifice, aperture b * corner of mouth - anba upside down chire, ~ manje sores at comer of mouth - dlo salivation * fann harelip, cleft lip; cleft palate - Il anm, ~ II pa bon, ~ II pa gou to have no appetite ~ Il f dio to make one's mouth...

Freeman, Bryant C.



Geophysical Research Abstracts Vol. 14, EGU2012-PREVIEW, 2012  

E-Print Network (OSTI)

was monitored to trace the effectiveness of artificial recharge, based on boron isotopes, to better determine (Cape Bon, Tunisia): insights from Boron isotopes. L. Cary (1), J. Casanova (1), A. Mekni (2,3), N. Sodium, potassium and boron were clearly in deficit compared to a mixing line with seawater, whereas

Paris-Sud XI, Université de


Glacioeustatic Transgressive Reflux: Stratiform Dolomite in Pennsylvanian Bioherms of the Western Orogrande Basin, New Mexico  

Science Journals Connector (OSTI)

...mound rocks from the Virgilian Panther Seep Formation, Hembrillo Canyon...suggesting that, in general, car-bon in the dolomites was derived...alteration of dolomite: A review: Car-bonates and Evaporites, v...Simo, T., eds., Advances in Car-bonate Sequence Stratigraphy...

Gerilyn S. Soreghan; Michael H. Engel; Roger A. Furley; Katherine A. Giles



Science Journals Connector (OSTI)

...supposition that he had obtained a compound of car-bon and alumina he gave it the name...by him. For example, a reclini'ng panther, with young, on the whole a fine piece...staff, at one of the entrances, and a panther, in bronaze, within, are examples of...

Vernon L. Kiellogge



The Molecular Fossil Record of Oleanane and Its Relation to Angiosperms  

Science Journals Connector (OSTI)

...well-defined, organic-rich, fine-grained sedimentary rocks. Commonly...environments contain organic matter derived from...with total organic car-bon...of thermal maturation are minimized...Magdalena Basin, Co-lombia...material from Illinois, United...

J. Michael Moldowan; Jeremy Dahl; Bradley J. Huizinga; Frederick J. Fago; Leo J. Hickey; Torren M. Peakman; David Winship Taylor



Substrate Utilization by an Oxalate-Consuming Spirillum Species in Relation to Its Growth in Ozonated Water  

Science Journals Connector (OSTI)

...assimilable organic car- bon compounds (AOC), were calculated from the obtained Nmax values and the Y values for acetate. The AOC concen- trations for both strains were...with each oth- er. In ozonated water, AOC concentrations available for strain NOX...

D. van der Kooij; W. A. M. Hijnen



O P I N I O N Biogenic vs. geologic carbon emissions and forest  

E-Print Network (OSTI)

greenhouse gas (GHG) accounting of woody biomass energy generation. While there are many other environmental, biogenic carbon, carbon debt, forest biomass, greenhouse gas accounting Received 20 April 2011; revised the amount of car- bon in the cycle'. This view recently has been reiterated by many (e.g. Hale, 2010; Lucier

Vermont, University of



E-Print Network (OSTI)

résoudre. Bon courage à tous ! Françoise Barachet, IA-IPR en mathématiques Jean-Alain Roddier, IA-IPR en posées, l'argumentation, la présentation. Conception et Rédaction : IREM, APMEP, IUFM, IA­IPR de

Sart, Remi


Role of PeptidePeptide Interactions in Stabilizing Peptide-Wrapped Single-Walled Carbon Nanotubes: A Molecular Dynamics Study  

E-Print Network (OSTI)

, and energy conservation devices.2 Unfortunately, car- bon nanotubes are extremely hydrophobic which leadsRole of Peptide­Peptide Interactions in Stabilizing Peptide-Wrapped Single-Walled Carbon Nanotubes at biopolymers@wiley. com INTRODUCTION S ingle-walled carbon nanotubes (SWNTs) are hollow cylinders formed

Nielsen, Steven O.


Chirality dependence of the density-of-states singularities in carbon nanotubes S. Reich and C. Thomsen  

E-Print Network (OSTI)

approach and yields the energy splitting for an arbitary chiral angle in metallic nanotubes. SemiconductingChirality dependence of the density-of-states singularities in carbon nanotubes S. Reich and C-of-states singularities in single-walled car- bon nanotubes. Our approximation goes beyond the lowest-order, isotropic

Nabben, Reinhard


International Journal of Hydrogen Energy 31 (2006) 7792 www.elsevier.com/locate/ijhydene  

E-Print Network (OSTI)

for fueling automotives to reduce car- bon dioxide emissions, limit dependence on imported petroleum-grade crude oils into transport fuels. World oil refineries and chemical plants' demand for hydrogen-free tech- nologies, including either battery- or fuel-cell--operated vehicles. However, the H2 fuel

Yildiz, Bilge


Contribution of restricted rotors to quantum sieving of hydrogen isotopes B. C. Hathorn,1  

E-Print Network (OSTI)

have come to the forefront as a possible storage medium for hydrogen for fuel-cell de- vices. A number of isotopically substituted hydrogen molecules adsorbed into single-walled car- bon nanotubes are calculated usingContribution of restricted rotors to quantum sieving of hydrogen isotopes B. C. Hathorn,1 B. G

Hathorn, Bryan C.


Raman spectroscopy of amorphous, nanostructured, diamondlike carbon, and nanodiamond  

Science Journals Connector (OSTI)

...possible presence of hydrogen and nitrogen. The...magnetic storage disks, car parts, biomedical...alloys, (a) without hydrogen, (b) with hydrogen...C, sp3 C and N. fuel cells. Nanostructured...classified as stage 2 car- bons with increasing...



One-Carbon Metabolism in Methanogens: Evidence for Synthesis of a Two-Carbon Cellular Intermediate and Unification of Catabolism and Anabolism in Methanosarcina barkeri  

Science Journals Connector (OSTI)

...or methanol. Cell suspensions synthesized...the absence of hydrogen. Cell extracts catalyzed...carriers (i.e., car- boxydihydromethanopterin...the presence of hydrogen gas. Iodopropane...for analysis. Cell suspensions assimilated...intermediate from one-car- bon compounds...

William R. Kenealy; J. G. Zeikus



Control-oriented input-delay model of the distributed temperature of a SI engine exhaust  

E-Print Network (OSTI)

shifting [8]. This open-loop technique leads to a faster heating of the catalyst but also yields combustion the combustion: hydrocar- bons HC, carbon monoxide CO and nitrogen oxide NOx. Yet, conversion efficiency Delphine to activate chemical re- actions and the catalyst conversion ratio is poor [18]. Therefore, speed


through the digestive tract of patients with a malabsorption syndrome. In addition, our  

E-Print Network (OSTI)

digestibility car- bon from dietary CHO. Effect of algal fibre supplementation (Eucheuma cottonii) on intestinal of their nutritional properties, this work inves- tigated the possible effects of algal polysac- charides sequence of test meals (800 g of maize starch + casein) sup- plemented either with 40 g of algal fibres

Boyer, Edmond

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Name /css_comb_104895/comb_5d11/Mp_1 09/29/2002 01:05AM Plate # 0 pg 1 # 1 Proceedings of the Combustion Institute, Volume 29, 2002/pp. 000000  

E-Print Network (OSTI)

of the Combustion Institute, Volume 29, 2002/pp. 000­000 DIOXIN AND FURAN FORMATION ON CuCl2 FROM CHLORINATED. Heated nitrogen gas streams containing 7.8% oxygen, 1.7% benzene vapor, and equal amounts of 2], poly- cyclic aromatic hydrocarbons [5], and graphitic car- bon [6]. Formation rates from precursors

Mulholland, James A.


ELSEVIER Computational Materials Science 2 (1994) 468-474 Modifying the buckyball  

E-Print Network (OSTI)

of C60- inspired carbon fullerenes. At present, the most intensively investigated systems are multi 1994) Abstract Structural and electronic properties of carbon clusters, in particular the C60 triggered a world-wide interest in this novel form of car- bon. The resulting research effort first concen



E-Print Network (OSTI)

. The most commonly used techniques include arc discharge, laser ablation, and chemical vapor deposition (CVD). CNTs were first discovered when Iijima examined the prod- ucts from an arc discharge between two far, car- bon nanotubes (CNTs) stand out due to their remarkable electrical, mechani- cal, optical

Zhou, Chongwu


JOURNAL DE PHYSIQUE Colloque C8, Supplhment au no 12, Tome 49, dhcembre 1988  

E-Print Network (OSTI)

JOURNAL DE PHYSIQUE Colloque C8, Supplhment au no 12, Tome 49, dhcembre 1988 NEUTRON SCATTERING a better understanding of the magnetic correlations of FegoZrlo we have performed small angle neutron scattering (SANS) and polarized- beam spin rotation experiments on amorphous rib- bons (approximately 25 prn

Boyer, Edmond


Structure and Density of Mo and Acid Sites in Mo-Exchanged H-ZSM5 Catalysts for Nonoxidative Methane Conversion  

E-Print Network (OSTI)

of natural gas to higher hydrocar- bons and aromatics remains an important industrial challenge Methane Conversion Richard W. Borry III, Young Ho Kim, Anne Huffsmith, Jeffrey A. Reimer, and Enrique and gas phase transport, exchange at acid sites, and react to form H2O. The amount of H2O evolved during

Iglesia, Enrique


Atomic and molecular adsorption on RhMn alloy surface: A first principles study  

E-Print Network (OSTI)

and hydrogen from reforming of natural gas and coal to hydro- carbon Fishcher-Tropsch synthesis and oxygenates- bon and partial oxidation of methane.15 The importance of Rh catalysts on catalytic reactions molecules in terms of the energetics and site preferences on Rh catalysts as well as the effects of Mn added

Li, Weixue


Defective fullerenes and nanotubes as molecular magnets: An ab initio study Yong-Hyun Kim,* Jin Choi, and K. J. Chang  

E-Print Network (OSTI)

Defective fullerenes and nanotubes as molecular magnets: An ab initio study Yong-Hyun Kim,* Jin ordering are not well es- tablished, the experimental evidence for ferromagnetic car- bon nanostructures in the magnetic behavior, and suggested a possible link between magnetism and defects in the pure carbon network


/ http://www.sciencemag.org/content/early/recent / 3 April 2014 / Page 1 / 10.1126/science.1252268 The availability of high-quality, large, single-crystal Si wafers is funda-  

E-Print Network (OSTI)

separated by defective grain boundaries that degrade their electri- cal and mechanical properties (8, 9 and coalesce into a uniform sin- gle-crystal layer without grain bounda- ry defects, even if the nucleation and the relatively high car- bon solubility hamper the direct growth of high-quality monolayer graphene on Si (16

Napp, Nils


JOURNAL OF BACTERIOLOGY, Dec. 2003, p. 71607168 Vol. 185, No. 24 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.24.71607168.2003  

E-Print Network (OSTI)

are required for growth on C1 substrates; how- ever, mutants defective for the H4MPT pathway reveal a unique characterization of four mutants defective in the H4MPT pathway and place them into three different phenotypic pathway in M. extorquens AM1. Methylotrophic bacteria growing aerobically on single-car- bon (C1


Biological Gain of Carbon-ion Radiotherapy for the Early Response of Tumor Growth Delay and against Early Response of Skin Reaction in Mice  

Science Journals Connector (OSTI)

......observed for 77 keV/mm carbon ions. The RBE values of low-LET car- bons (14 and 20 keV/mm) ranged from 1.2 to 1.7, and...T-cells after low-dose gamma-irradiation is not linked with defective Ku86 protein. Int. J. Radiat. Biol. 77: 329339. 27......

Koichi Ando; Sachiko Koike; Akiko Uzawa; Nobuhiko Takai; Takeshi Fukawa; Yoshiya Furusawa; Mizuho Aoki; Yasuyuki Miyato




Science Journals Connector (OSTI)

......Thoracic Lymphatics of Living Rabbits and Sites of Escape of Car- bon Particles from the Vessels: Fumihiko KATO (First Dept...deafness. Using light and elect- ron microscopy he studied the defective organ of Corti in Shaker-1 mouse, one strain of congeni......





Science Journals Connector (OSTI)

......the other radiosensitive cell lines of SX9 (defective in DNA-PKcs, XRCC7), SX10 (defective in DNA ligase IV) and M10 (XRCC4) were about...Center, Kyoto University. The system includes car- bon K, aluminium K, molybdenum L, iron......

Synchrotron radiation




Science Journals Connector (OSTI)

......central body of the virus vanished or became defective very frequently. 4) In the cytoplasm...The fine structure of martensite in plain car- bon steels has been studied by transmission...around the dislocations and tiny metastable car- bides precipitate in situ. With the......





Science Journals Connector (OSTI)

......000 kV DF is superior to BF up to Ael for gold as well as for car- bon. Despite the larger effect, DF mode at 1,000 kV is...shift in the [TTT] direction. 232 41st Annual Meeting The defective image in the specimen, thinned parallel to the (001) plane......

The Forty-first Annual Meeting of the Japanese Society of Electron Microscopy



Raman spectroscopy of graphite  

Science Journals Connector (OSTI)

...G for graphite. The other modes are either observed only on defective samples or are very weak in intensity like the G peak that was...al. 2001); a similar behaviour is also observed in other car- bon materials (Ferrari & Robertson 2001; Maultzsch et al...



Two-Step Mechanism for Low-Temperature Oxidation of Vacancies in Graphene Johan M. Carlsson,1,* Felix Hanke,1  

E-Print Network (OSTI)

for nanoparticles [2]. Controlled oxidation of car- bon materials is also used to add functional oxygen (O) groups (STM) experiments, for instance, demonstrate that the defect-free regions of the basal plane oxygen and attachment of oxygen atoms on defective graphite. However, the main product in these TPD


Scanning tunnelling microscopy of carbon nanotubes  

Science Journals Connector (OSTI)

...sheet into a cylinder where the car- bon lattice is joined seamlessly...consist of at least a pair of defective rings, e.g. squares, pentagons...sized (Meunier et al. 1999), defective (Meunier & Lambin 1998, 2000...Blase, X., Devita, A. & Car, R. 1997 Electronic structure...



Nitrogen Addition Increases Carbon Storage in Soils, But Not in Trees, in  

E-Print Network (OSTI)

nitrogen (N) species and car- bon dioxide (CO2) in the atmosphere globally. Received 18 August 2012Nitrogen Addition Increases Carbon Storage in Soils, But Not in Trees, in an Eastern U.S. Deciduous regions receive elevated rates of atmospheric nitrogen (N) deposition from air pollution. To evalu- ate

Templer, Pamela


Introduction: The Ocean's Meridional Overturning Circulation Andreas Schmittner1  

E-Print Network (OSTI)

currents encompassing all ocean basins. It transports large amounts of water, heat, salt, car- bon current (ACC) of the Southern Ocean. There, it mixes with other deep water masses like Pacific Deep WaterIntroduction: The Ocean's Meridional Overturning Circulation Andreas Schmittner1 , John C.H. Chiang

Schmittner, Andreas


February 18, 2009 The A Priori  

E-Print Network (OSTI)

about some agent's knowledge, we might say something like `that's a priori for him.' [Kripke, 1980 careless about distinguishing a priority from analyticity and necessity. (Roughly: something is a priori of some fairly specific sort, might be required for that. [BonJour, 2005, p.99] ­ The positive condition

Fitelson, Branden

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

pour leur sympathique contribution au bon déroulement de cette thèse. Merci également à l'ensemble des factor CaMK Ca2+ /calmodulin-dependent protein kinases CCI Chronic constriction injury (ligature lâche du and Statistical Manual of Mental Disorders EGF

Paris-Sud XI, Université de


Murchison presolar carbon grains of different density fractions: A Raman spectroscopic perspective  

E-Print Network (OSTI)

for inorganic sp2 -bonded carbon. Based on their D/G intensity ratios, those grains were grouped.1), "glassy carbon" (D/G > 1.1), and "unusual sp2 -bonded graphitic car- bon" (with extremely intense 2ndMurchison presolar carbon grains of different density fractions: A Raman spectroscopic perspective


Grid 2020: Toward a Policy of Renewable & Distributed Resources  

E-Print Network (OSTI)

;12 Virtual Power Plant: 2002-2020 Multi-direction and variability of DER power flows drive circuit years, which would make solar power less expensive than retail electricity in roughly 20 states" David, DoE, USCHP #12;6 Wide Area CoordinaBon & Controls Location of Variable Wind, Solar


Journal of Power Sources 195 (2010) 18411844 Contents lists available at ScienceDirect  

E-Print Network (OSTI)

to react with oxygen, forming water. Recent advances in MFCs have increased power produc- tion or modifying the car- bon surface. In an MFC with anaerobic sludge as the inoculum, power was increased from 0Journal of Power Sources 195 (2010) 1841­1844 Contents lists available at ScienceDirect Journal


Structure and interactions in simple solutions  

Science Journals Connector (OSTI)

...cations have with both water and alcohol molecules...concentration and scattering power of each atom type Phil...ensembles containing 300 water molecules and 6 alcohol...CC, the methyl group car- bon sites C, the methyl...group hydrogen H. The water hydrogen sites are labelled...



Journal of Power Sources 134 (2004) 16 Synthesis and physical/electrochemical characterization of Pt/C  

E-Print Network (OSTI)

Journal of Power Sources 134 (2004) 1­6 Synthesis and physical/electrochemical characterization Department of Mechanical Engineering, Hong Kong University of Science and Technology, Clear Water Bay alloys on a car- bon support. The high surface area of a Pt and its alloys can be rendered by using

Zhao, Tianshou


U.S. JGOFS NEWS U.S. JGOFS: A Component of the U.S. Global Change Research Program  

E-Print Network (OSTI)

Global models of the ocean car- bon cycle have two moving parts. First, a production part is used the sunlit eu- photic zone of the ocean is remineralized at each depth horizon in the water column is a power-law function of depth. This curve is used widely in global simulations to repre- sent

McGillicuddy Jr., Dennis J.


-Amino acids, although less abundant than their -analogues, are also present in peptides and other natural  

E-Print Network (OSTI)

Polyhydroxyalkanoates (PHAs) are a family of carbon, energy and/or reducing power storage polymers, which a characteristic pro- ton NMR signal at 3.15 ppm for the hydroxy hydrogen at car- bon 3. In our experimental work was consumed. Compound 2 was reacted with sodium azide in water using hexadecyltributylphosphonium bromide



E-Print Network (OSTI)

of interstellar grains can be described by a power-law: n(a)da / a 3:5 da and combining the op- tical properties atoms and taking up 10% of the total car- bon budget. These molecules, called polycyclic aromatic of water, but con- tain substantial components of methanol, ca

Millar, Tom


Z .Surface and Coatings Technology 127 2000 260 265 Characterization of carbon nitride thin films deposited by  

E-Print Network (OSTI)

-screw adapter and monitored by measuring the back reflection power at the end of a water load. A mixture polycrystalline car- bon nitride films, and the resulting mechanical proper- ties are not as good as predicted a valve between the deposition chamber and the vacuum pumps. The microwave power was adjusted by a four

Gao, Hongjun


Increasing Proton Exchange Membrane Fuel Cell Catalyst Effectiveness Through Sputter Deposition  

E-Print Network (OSTI)

, University of South Carolina, Columbia, South Carolina 29208, USA b Plug Power, Incorporated, Latham, New and carbon- supported catalyst.3-6 It is this three-phase interface of catalyst, car- bon, and electrolyte typically Nafion® that allows effective gas and water diffusion and proton transport and electron transport


VOLUME 93 NUMBER 23 5 JUNE 2012  

E-Print Network (OSTI)

, rainfall, and the concentration of car- bon dioxide [New et al., 1999; Tans et al., 1996 regional networks together to measure the fluxes of carbon dioxide, water vapor, and sen- sible heat are needed to move air to the sen- sor, have access to a power line. The cur- rent generation of carbon


ORIGINAL PAPER Evaluating sedimentary geochemical lake-level tracers  

E-Print Network (OSTI)

Walker Lake has been generated through analysis of total inorganic car- bon (TIC), total organic carbon (TOC), and oxy- gen and carbon isotope ratios (d18 O and d13 C) of both downcore bulk TIC and ostracods in %TIC, %TOC, and d13 C and d18 O of TIC and ostracods are all associated to varying degrees with changes

Linsley, Braddock K.


Magnetic Properties and Diffusion of Adatoms on a Graphene Sheet P. O. Lehtinen,1  

E-Print Network (OSTI)

Magnetic Properties and Diffusion of Adatoms on a Graphene Sheet P. O. Lehtinen,1 A. S. Foster,1 A storage in nanotube based batteries [7], catalytic growth [8], junc- tions [9], and quantum dot creation,17] and diffusion [18] of a car- bon adatom on a graphene sheet, yet the results were markedly different, and none

Nordlund, Kai


2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim722 wileyonlinelibrary.com  

E-Print Network (OSTI)

and material degradation is crucial for the rational design of high-performance lithium ion batteries (LIBs-layer graphene nanorib- bons remain mechanically robust after lithiation. This distinct contrast manifests. In addition, a new in situ chemical lithiation method is introduced for fast screening of battery materials

Chen, Sow-Hsin


JOURNAL OF BACTERIOLOGY, 0021-9193/01/$04.00 0 DOI: 10.1128/JB.183.8.24632475.2001  

E-Print Network (OSTI)

or 1,2-propanediol requires B12 and provides a car- bon and energy source, but growth. The Alternative Electron Acceptor Tetrathionate Supports B12-Dependent Anaerobic Growth of Salmonella enterica of these carbon sources supports anaerobic growth with any of the alternative electron acceptors tested thus far

California at Davis, University of


Relationships between Carcinogenicity and Theoretical Reactivity Indices in Polycyclic Aromatic Hydrocarbons  

Science Journals Connector (OSTI)

...usually several alternatives are available for...meso-9,10-car bon atoms of anthracene...molecular orbital energies are , @= a + mj3...de localization energy @Edel@/f3...led us to examine alternative indices. One such...Table 10. Composite Energy Indices Transformation...

Iden A. Smith; Gregory D. Berger; Paul G. Seybold; and M. P. Serv



Bioreactor Development for Biological Hydrogen Production  

E-Print Network (OSTI)

Huang National Renewable Energy Laboratory 1617 Cole Boulevard, Golden, CO 80401 ed The biologically-mediated water-gas shift reaction, in which carbon monoxide is oxidized to car- bon dioxide while temperature and lack of equilibrium limitation make the biological shift reaction a promising alternative


MEDS and PocR are novel domains with a predicted role in sensing simple hydrocarbon derivatives in prokaryotic signal transduction systems  

Science Journals Connector (OSTI)

......genes encoding alternative sigma factors in...1999Aerotaxis and other energy-sensing behavior...dichloromethane as the sole car-bon and energy source, DcmR dissociates...genes encoding alternative sigma factors in...Aerotaxis and other energy-sensing behavior......

Vivek Anantharaman; L. Aravind



Recent Insights into the Biological Action of Heavy-Ion Radiation  

Science Journals Connector (OSTI)

......exogenous genes.59) An alternative regimen includes the combination...combina- tion with high-energy X-rays, which acted...GJIC contributed to car- bon ion-induced bystander...chemicals such as retinoids, car- otenoids and green tea...X-ray-induced mammary car- cinogenesis in female......

Nobuyuki Hamada


Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A&G Volume 54 Issue 1, Full Issue  

Science Journals Connector (OSTI)

......lithoautotrophic means of both energy genera- tion and carbon...render it an available energy source (Weiss et al...subsurface. Finally, an alternative inorganic electron acceptor...some iron reducers is car- bon monoxide (CO...made available as an energy source through downward......

A&G Volume 54 Issue 1; Full Issue



Microdosimetric Approach to NIRS-defined Biological Dose Measurement for Carbon-ion Treatment Beam  

Science Journals Connector (OSTI)

......value into the lineal energy, yi. The Ny value was...function of the linear energy transfer (LET) of mono-energetic...with an initial kinetic energy of 290 MeV/u with a...pulse by defocusing car- bon-ions with electric...low-intensity beam. So, an alternative parallel-plate ionization......

Yuki Kase; Tatsuaki Kanai; Makoto Sakama; Yuji Tameshige; Takeshi Himukai; Hiroyuki Nose; Naruhiro Matsufuji



Manipulating RuBisCO accumulation in the green alga, Chlamydomonas reinhardtii  

E-Print Network (OSTI)

Manipulating RuBisCO accumulation in the green alga, Chlamydomonas reinhardtii Xenie Johnson photosynthetic car- bon metabolism towards alternative pathways. Keywords RuBisCO � Chloroplast � RNA stability between green algae (Chlamydomonas X. Johnson (&) Centre National de la Recherche Scientifique, Unite


American Economic Journal: Economic Policy 2009, 1:1, 106146 http://www.aeaweb.org/articles.php?doi=10.1257/pol.1.1.106  

E-Print Network (OSTI)

- bon emissions rate or, equivalently, the carbon emissions per unit of output, allows fuel producers to achieve a given carbon emissions rate by exibly altering their production of fuels.2 Senators John Mc (e.g., energy versus miles), and how emissions rates are measured (e.g., upstream versus downstream

Rothman, Daniel


Route-Specific Passage and Survival of Steelhead Kelts at The Dalles and Bonneville Dams, 2012 - Final Report  

SciTech Connect

This study was mainly focused on evaluating the route-specific passage and migration success of steelhead kelts passing downstream through The Dalles Dam (TDA) and Bonneville Dam (BON) at Columbia River (CR) river kilometers 309 and 234 respectively. Oregon Department of Fish and Wildlife (ODFW) personnel collected, tagged and released out-migrating steelhead kelts in the tributaries of the Deschutes River, 15 Mile Creek and Hood River between April 14 and June 4, 2012. A PIT tag was injected into each kelts dorsal sinus whereas a Juvenile Salmon Acoustic Telemetry System (JSATS) acoustic micro-transmitter was attached to an external FLoy T-bar tag and inserted into the dorsal back musculature using a Floy tagging gun. JSATS cabled arrays were deployed at TDA and BON and autonomous node arrays were deployed near Celilo, Oregon (CR325); the BON forebay (CR236); the BON tailrace (CR233); near Knapp, Washington (CR156); and near Kalama, Washington (CR113) to monitor the kelts movement while passing through the dams and above mentioned river cross-sections.

Rayamajhi, Bishes; Ploskey, Gene R.; Woodley, Christa M.; Weiland, Mark A.; Faber, Derek M.; Kim, Jin A.; Colotelo, Alison HA; Deng, Zhiqun; Fu, Tao



Impact of a major ice storm on an old-growth hardwood forest  

E-Print Network (OSTI)

forestière, produc- tivité forestière. [Traduit par la Rédaction] Hooper et al. 75 Introduction Ice storms litter produced by ice storms is a substantial, yet little studied, pool of energy, car- bonImpact of a major ice storm on an old-growth hardwood forest Michael C. Hooper, Ken Arii

Lechowicz, Martin J.


cDNA Cloning and Characterization of a High Affinity Aryl Hydrocarbon Receptor in a Cetacean, the Beluga, Delphinapterus leucas  

E-Print Network (OSTI)

,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and related PHAHs cause toxicity via activation of the aryl hydrocar- bon receptor demonstrated specific, high-affinity [3 H]TCDD binding. Satura- tion binding analysis was used to compare-expressed AHRs from a dioxin-sensitive mouse strain (Ahb­1 allele) and humans. The beluga AHR bound [3 H

Hahn, Mark E.


2,3,7,8-Tetrachlorodibenzo-p-dioxin Induces Premature Activation of the KLF2 Regulon during  

E-Print Network (OSTI)

2,3,7,8-Tetrachlorodibenzo-p-dioxin Induces Premature Activation of the KLF2 Regulon during, Wisconsin 53706 The environmental pollutant 2,3,7,8-tetrachlorodibenzo-p- dioxin (TCDD, dioxin) causes,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)2 is the most toxic congener of a family of halogenated aromatic hydrocar- bons

Bradfield, Christopher A.


Introduction Aerial surveys from aircraft are a critical component of many environmental research,  

E-Print Network (OSTI)

. For localized surveys, small Unmanned Air Vehicles (UAVs) equipped with color and near infrared cameras accuracy assessment and improvement of detection probabilities. Autonomous Unmanned Aerial Vehicle (UAV) for Ecological Research Franklin Percival1 , Leonard Pearlstine2 , Bon Dewitt3 , Scot Smith3 , Adam Watts1

Mazzotti, Frank


Simulation of Nitrogen Emissions in a Premixed Hydrogen Flame Stabilized on a Low Swirl Burner  

E-Print Network (OSTI)

of fuels such as pure hydrogen and hydrogen-seeded hydrocarbon mixtures. However, many hydrogen-rich fuels in the context of a laboratory-scale low swirl burner fueled with a lean hydrogen-air mixture at atmospheric of burning lean hydrogen or hydrogen-enriched lean hydrocar- bon fuels (e.g., [2­5]). For these fuels

Bell, John B.


Atmos. Chem. Phys., 11, 14731490, 2011 www.atmos-chem-phys.net/11/1473/2011/  

E-Print Network (OSTI)

in- duced (fossil fuel combustion, biomass burning) in the car- bon cycle. All these combustion The contribution from both natural and human-induced biomass burning and from fossil fuel combustion to the an of CO2 is the domestic combustion of biomass fuels (Kituyi et al., 2001; Ludwig et al., 2003). Reg

Meskhidze, Nicholas


oo Ris Report No. 268 Danish Atomic Energy Commission  

E-Print Network (OSTI)

box calculations to three-dimensional overall cal- culations inclusive of the void and temperature Cell Data Supply for Box Calculations ... 36 5. Fuel Bon Calculations 37 5.1. Description of the Bus Calculation« 36 5.2. Comparisons withOtter Calculations 41 6. Control Rods 56 6.1. Cross Sections for Control


arXiv:1002.0679v1[cond-mat.mes-hall]3Feb2010 Theory of resonant photon drag in monolayer graphene  

E-Print Network (OSTI)

distribution in energy. The drag current essentially depends on the polarization of radiation and, in general, is not parallel to q. The perpendicular current component appears if the in-plain electric field is tilted towards. INTRODUCTION Though the theoretical study of two-dimensional car- bon has a long history [1],[2],[3],[4] only

Shepelyansky, Dima


Inner-shell excitation of gas phase carbonates and a,c-dicarbonyl compounds  

E-Print Network (OSTI)

correlation of the C 1s ! p? C@O transition energy and the relative oxidation at the carbonyl car- bon and dimethyldicarbonate ­ have been recorded in the gas phase with inner shell electron energy loss spectroscopy in the scattering regime dominated by electric dipole transitions. All spectra are presented on absolute oscillator

Hitchcock, Adam P.



E-Print Network (OSTI)

Absfruct -A z-plane continued fraction expansion (CFE) that is related to the first Cauer s-plane CFE via B&on's LDI transformation is consid- ered. Necessary and sufficient conditions are imposed on the CFE for a polynomial to be stable (have all its zeros inside the z-plane unit circle). The implementation of this CFE

Bistritz, Yuval


Rfrigration domestique : enqute sur les pratiques des consommateurs et recommandations en matire d'hygine  

E-Print Network (OSTI)

energy consumption and water available for microbial circulation and growth. Thus, an important interrogées. Cette condensation suggère une mauvaise fermeture de la porte avec pour conséquence une plus recommandation importante est donc de vérifier que le joint de porte est en bon état et que la porte ferme bien

Paris-Sud XI, Université de


A Comprehensive Two-Dimensional Gas Chromatography Method for Analyzing Extractable Petroleum Hydrocarbons in Water and Soil  

Science Journals Connector (OSTI)

......fuel samples, including gasoline (18,20,21), diesel...temperature of 340 C. Run times were approximately...sample containing C9C36 straight chain aliphatics and...Determination of oxygenates in gasoline by GC GC. J. High Resolut...aromatic hydrocar- bons in gasolines by flow modulated comprehensive......

Stacy K. Seeley; Steven V. Bandurski; Robert G. Brown; James D. McCurry; John V. Seeley


3 Carbide Precipitation Carbides are largely responsible for the commercial failure of many of the early  

E-Print Network (OSTI)

.1. Transition carbides, such as and the various orthorhombic forms listed in Table 3.1, only form because Precipitation 64 Table 3.1 Carbides in bainite or in tempered bainite. Fe, M/C is the ratio of metal to car- bon3 Carbide Precipitation Carbides are largely responsible for the commercial failure of many

Cambridge, University of


Eos, Vol. 86, No. 42, 18 October 2005 to shed light on poorly understood piercement  

E-Print Network (OSTI)

-term changes in oxygen,car- bon dioxide (CO2 ),and several other measur- able parameters since the last global and Predictability (CLIVAR)/CO2 Repeat Hydrog- raphy component of the Global Earth Observ- ing System of Systems, freshwater,and CO2 .The CLIVAR/CO2 Repeat Hydrography program builds upon earlier programs (e.g.,the World

Talley, Lynne D.


TREKiSM Issue 37  

E-Print Network (OSTI)

This is gold. Kirk is perfect, Spock Is bon san d p 0 s tag (~, 0 f course. GET WELL W1Sr-I[S to Lilld(] C. Brown, who's now back clt work folJowj'lg surgcl'y, fucing a...


Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


IEEE Wireless Communications June 201248 1536-1284/12/$25.00 2012 IEEE RECENT ADVANCES IN  

E-Print Network (OSTI)

, security, reliability and integration of renewable energy. Currently, most of the power grids are based of the electricity capacity from distributed and renewable energy sources. The European Smart Grids Technology and the integration of renewable energy to meet the EU target on car- bon emissions reduction by year 2020 [2

Shihada, Basem


Worldwide, accelerating glacier loss provides independent and startling evidence that global warming is occurring1 It is now clear that the Earth is warming rapidly due to man-made emissions of carbon dioxide and other heat-trap-  

E-Print Network (OSTI)

-made emissions of carbon dioxide and other heat-trap- ping gases, which blanket the planet and cause temperatures future limits on carbon emissions. · Electricity consumers should opt for "green power" where imperative that emissions of the main heat-trapping gas, car- bon dioxide (CO2), are significantly reduced

Combes, Stacey A.


Measuring Asphaltenes and Resins, and Dipole Moment in Petroleum Fluids  

E-Print Network (OSTI)

Measuring Asphaltenes and Resins, and Dipole Moment in Petroleum Fluids Lamia Goual Earth Science, Palo Alto, CA 94306 A petroleum fluid can be di®ided into three types of species: asphaltenes, resins or mildly polar. The interaction among these species strongly affect asphaltene precipitation from petroleum

Firoozabadi, Abbas


Princeton Plasma Physics laboratory weekly  

E-Print Network (OSTI)

At PPPL This Week Princeton Plasma Physics laboratory weekly DECEMBER 9, 2013 continued on page 2 ......... page 6 Cafe@PPPL Menu ... page 7 INsIde... page 1 of 7 MONDAY, DEC. 9MONDAY, DEC. 9 Group Photo for holiday card 9:45 a.m. Meet in LsB Lobby All Employees TUESDAY, DEC. 10TUESDAY, DEC. 10 PPPl colloquium


radionuclides was very small and often below the detectable limits (see table I).  

E-Print Network (OSTI)

the con- sumption of the honey from the mining area is not dangerous for humans. Contamination du miel par des radionu- cléides naturels dans l'ancienne région minière d'uranium de Wismut/Thuringe La

Paris-Sud XI, Université de


dases de la salive d'abeille. La structure de L1 et de L2 n'a pas pu tre dtermine si  

E-Print Network (OSTI)

) The pollution of honeys from the uranium mining area in Thuringia with the natural radionuclides 235U, 238U, 226. The pollution of honey with natural radionuclides in the area of former ura- nium mines in Thuringia (Wismut the mining area is not dangerous for humans. Contamination du miel par des radionu- cléides naturels dans l

Paris-Sud XI, Université de


The American Cancer Society and Cancer Research Origins and Organization: 19131943  

Science Journals Connector (OSTI)

...ects. Nevertheless, this sizable investment, in the Society's view, did not override...assistance than the massive confrontation on political and military grounds with alien ide...fate nor inclined to worry about the risks of life, regarding it as at best a dangerous...

Victor A. Triolo and Michael B. Shimkin



Neural correlates of the psychedelic state as determined by fMRI studies with psilocybin  

Science Journals Connector (OSTI)

...transformed into MNI space and voxel-wise paired t tests were performed between the...156 . 7 Murphy K Harris AD Wise RG ( 2011 ) Robustly measuring...Neuroimage 31 : 1536 1548 . 50 Wise RG Ide K Poulin MJ Tracey I...1664 . The authors thank Alison Diaper, Ann Rich, Sue Wilson...

Robin L. Carhart-Harris; David Erritzoe; Tim Williams; James M. Stone; Laurence J. Reed; Alessandro Colasanti; Robin J. Tyacke; Robert Leech; Andrea L. Malizia; Kevin Murphy; Peter Hobden; John Evans; Amanda Feilding; Richard G. Wise; David J. Nutt



Page 1 of 6 Issuing Department: Human Subjects Protection Office  

E-Print Network (OSTI)

agreement, the investigational plan, applicable regulatory requirements, or other applicable FDA regulations exemption (IDE) and 2) to set forth the requirements that PIs, sponsors and Institutional Review Boards (IRB it may commence. SR devices studies require review of the convened IRB. Unless otherwise notified NSR

Oliver, Douglas L.


cOiridered to replace test fishing at the mouth of ri ver~ in Cook Inlet to more  

E-Print Network (OSTI)

the department to order another ide sca nner for applica- tion in Cook Inl et and elsewhere in th e state. Thi and subsequentl y \\~ould be brought to Cook Inl et for u e in counting adu lt a lmon escapements. Based


Sent: Friday, October 11, 2002 3:33 PM To: Administrator Wright  

E-Print Network (OSTI)

Power Administration PO Box 12999 Portland, OR 97208 Dear Administrator Wright, The Bonneville Power Energy Proposal October 11, 2002 Stephen Wright Administrator and Chief Executive Officer Bonneville energy future. Bonneville Power is ide~~~y suited to lead the region in conservation and renewables


CCSF Lunch Summary Distributed Energy Systems Research for a Low Carbon Economy  

E-Print Network (OSTI)

CCSF Lunch Summary Distributed Energy Systems Research for a Low Carbon Economy December 15, 2008 of intelligent distributed energy systems (iDES) by Tim Mount. Then Max Zhang elaborated the components within studies on infrastructure planning for the smart grids, linkage between the agricultural, the electric

Angenent, Lars T.


Computermathematik Einfuhrung in MATLAB  

E-Print Network (OSTI)

Computermathematik Einf¨uhrung in MATLAB Winfried Auzinger Dirk Praetorius Di. 13:15 - 14:45, FH HS, Beenden von Matlab Matlab Online-Hilfe m-Files Aufbau einer Matlab-Funktion Kommentarzeilen function % help 1 Was ist MATLAB? MATLAB = Matrix Laboratory IDE (Integrated development environment) 1970

Auzinger, Winfried


Compiling MATLAB Arun Chauhan  

E-Print Network (OSTI)

Compiling MATLAB Arun Chauhan Indiana University #12;2005 OSC Review, Compiling MATLAB Arun Chauhan;2005 OSC Review, Compiling MATLAB Arun Chauhan, Indiana University Overview #12;2005 OSC Review, Compiling MATLAB Arun Chauhan, Indiana University MATLAB IDE #12;2005 OSC Review, Compiling MATLAB Arun Chauhan

Chauhan, Arun


Solar Energy Utilization by Physical Methods  

Science Journals Connector (OSTI)

...thait prtos ided bs electric po(Wcrand...ice the ptresent costs oft as. Ttiese S...At present, the cost of electric power...power from fossil or nuclear power plants. Photovoltaic...Sagan, "Human Costs of Nu-clear Power...Institutions and Nuclear Energy," 177...

Martin Wolf




Science Journals Connector (OSTI)

...Institute in Pittsburgh. He will work on crude petroleum. Miss KATHERINE MARDEN, assistant bacteriol-ogist in the Massachusetts State...a professor will be proceeded with. PRESIDENT BENJAMIN IDE WHEELER, of the University of California, has again asked for an...



A voice-activated syntax-directed editor for manually disabled programmers  

Science Journals Connector (OSTI)

This paper discusses a research project targeted at the design and implementation of an interface intended to allow manually disabled people to more easily perform the task of programming. It proposes a Speech User Interface (SUI) targeted for this task. ... Keywords: IDE, programming by voice, speech user interface, syntax directed

Thomas J. Hubbell; David D. Langan; Thomas F. Hain



Atmos. Chem. Phys., 12, 62756289, 2012 www.atmos-chem-phys.net/12/6275/2012/  

E-Print Network (OSTI)

), and the key combustion parameters carbon monox- ide (CO), carbon dioxide (CO2), and methane (CH4) were from coal combustion are unknown. For residen- tial (domestic) emissions, which are likely dominated- sulting global biomass burning H2 emissions agree well with published global H2 emissions, suggesting

Meskhidze, Nicholas


6, 93159349, 2006 Seasonality of O3  

E-Print Network (OSTI)

(nitrogen oxide (NO) + nitrogen dioxide (NO2)=NOx) oxidized to NOz (total reac- tive nitrogen (NOy (EN), defined as the net number of ozone molecules produced per molecule of nitrogen ox- ides.s.l. This dataset is a unique long-term data series of nitrogen levels in the free troposphere over Central Europe

Paris-Sud XI, Université de



NLE Websites -- All DOE Office Websites (Extended Search)

of * bonl ide ctlllac'Jve barql1nl:19 19:1'ell'ent providinq (::It I d1HerOnt Ilr>eUI"'. or the .::cnlhi ot eon tnry attitive prf IS to the actull COSt). relab.:: .. e...

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Standards for Language Resources Department of Computer Science  

E-Print Network (OSTI)

Standards for Language Resources Nancy IDE Department of Computer Science Vassar College an abstract data model for linguistic annotations and its implementation using XML, RDF and related standards; and to outline the work of a newly formed committee of the International Standards Organization (ISO), ISO/TC 37

Ide, Nancy


The ProxyGator Server-side Wireless Toolkit Dushiant Kochhar and Abdelsalam (Sumi) Helal  

E-Print Network (OSTI)

The ProxyGator ­ Server-side Wireless Toolkit Dushiant Kochhar and Abdelsalam (Sumi) Helal Computer significantly. To reduce the development time, we are introducing the ProxyGator toolkit. It is a server infrastructure is built within Visual C++ 6.0 IDE. We present the ProxyGator Toolkit and give an analysis to show

Helal, Abdelsalam



Science Journals Connector (OSTI)

...Warnerke had tried adding bichromate of potash to his emuilsion. The addition of brom-ide of silver iat the case of a carbon print was supposed to increase its sensitiveness, but whether it did so hie cotdld not say. Mr. Warnerke in the course...



Mechanism of Acylation of Lithium Phenylacetylide with a Weinreb Amide  

E-Print Network (OSTI)

with the excess lithium acetylide and a 1:3 (alkox- ide-rich) mixed tetramer. The stabilities of the mixedMechanism of Acylation of Lithium Phenylacetylide with a Weinreb Amide Bo Qu and David B. CollumVersity, Ithaca, New York 14853-1301 dbc6@cornell.edu ReceiVed June 14, 2006 Additions of lithium phenylacetylide

Collum, David B.


DOI 10.1007/s11081-013-9226-6 A mixed-integer nonlinear program for the optimal  

E-Print Network (OSTI)

of the building heating and cooling demands. In addition to generation, DG systems can include electric the system include lead-acid batteries, photovoltaic cells, solid ox- ide fuel cells, heat exchangers purchasing electricity from a centralized utility, a building owner can invest in an on-site system to supply


TCOM/CFRS 661 Sec 001 Digital Media Forensics Department of Electrical and Computer Engineering  

E-Print Network (OSTI)

TCOM/CFRS 661 Sec 001 ­Digital Media Forensics Department of Electrical and Computer Engineering to purchase a USB 2.0 to IDE & SATA cable kit. These can be obtained on line, at Microcenter or through use either the software provided or go to the software manufacturer's site and download the current


Low-level variability support for web-based software product lines  

Science Journals Connector (OSTI)

The Web systems domain has faced an increasing number of devices, browsers, and platforms to cope with, driving software systems to be more flexible to accomodate them. Software product line (SPL) engineering can be used as a strategy to implement systems ... Keywords: Eclipse plugin, FeatureIDE, feature composition, feature oriented software development, software product line engineering, web systems domain

Ivan do Carmo Machado; Alcemir Rodrigues Santos; Yguarat Cerqueira Cavalcanti; Eduardo Gomes Trzan; Marcio Magalhes de Souza; Eduardo Santana de Almeida



The Concept Maps Method as a Tool to Evaluate the Usability of APIs  

E-Print Network (OSTI)

The Concept Maps Method as a Tool to Evaluate the Usability of APIs Jens Gerken, Hans, Germany {firstname.lastname}@uni-konstanz.de ABSTRACT Application programming interfaces (APIs HCI have limitations in grasping the interaction between developer and API as most IDEs (essentially

Reiterer, Harald


Optimal experimental protocol for identification of dissolution and kinetics  

E-Print Network (OSTI)

- ide (S12) and methanol (E). The hydroxide (S12) saponifies the ester (C), producing carboxylic ion (S as solid particles. The reaction leads to a formation of carbanion (A1) and methanol (E). In the second- and enol- forms yielding the product diketone (D) and methanol. More details are found in [1]. In addition

Bardsley, John


SMACC : Gestion des risques dans les projets de construction par simulation multi-agent  

E-Print Network (OSTI)

Université de Bordeaux, France bUMR IDEES - MTG, Université de Rouen, France Résumé Ces dernières années ont of a multi-criteria decision making process (via ELECTRE III) aiming at helping decision makers to choose

Paris-Sud XI, Université de


Multi-Criteria Diagnosis of Control Knowledge for Cartographic Generalisation  

E-Print Network (OSTI)

1, 2 , Franck Taillandier3 1 MTG Lab., UMR-IDEES 6228, 1, rue Thomas Becket, 76821 Mont. The generalisation process, which aims at decreasing the level of details of geographic data in order to produce process consists in using a heuristic tree-search strategy. This type of strategy requires having high

Paris-Sud XI, Université de



E-Print Network (OSTI)

.ghnemat@litislab.eu, cyrille.bertelle@litislab.eu (2) IDEES - MTG (UMR 6228) - University of Rouen, rue Lavoisier, 76821 Mont-systems included in a hierarchical process. Two complementary methodologies can be used for that and we detail them-modelling, consists to complete the previous approach based on simulation, by introducing some computational processes

Boyer, Edmond


. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ii 1.1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1  

E-Print Network (OSTI)

.1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14 5.2 Arduino . . . . . . . . . . . . . . . 14 6 17 6++ Microsoft Visual Studio 2010 PC USB Arduino Uno LED 1 Arduino Arduino IDE 5.1 5.2 5.2 Arduino Arduino Arduino 0 255 2 http://arduino.cc/en/Main/arduinoBoardUno 14 #12;5.1: 5.2: 15 #12;0 255 Arduino Arduino

Tanaka, Jiro


1. Draw a basic finite state machine, with input, output, combinational logic, and storage elements. You might want to look at page 71.  

E-Print Network (OSTI)

there? 22.To return from a subroutine, you would use a ________ instruction. 23.What type of Arduino do as _____________________. 30.On the Arduino, the built-in LED light that you can blink is connected to pin __________. (Check the "Blink" sketch in the Arduino IDE). 31.When you played a melody on your Arduino, you connected a speaker

Madden, Patrick H.


Log in to the lab machines, or use your own laptop. The Arduino development environment should be available on the lab machines (if not, it's a quick download to get  

E-Print Network (OSTI)

Log in to the lab machines, or use your own laptop. The Arduino development environment should the Arduino tools, hook up your Arduino using a USB cable (there's one that goes to monitor on the lab machines if you don't have one handy). 2) On the Arduino IDE, select File

Madden, Patrick H.


A framework for fast 3D solid model exchange in integrated design environment  

Science Journals Connector (OSTI)

Exchanging 3D solid models across engineering applications has become increasingly important to integrated design environments (IDEs). However, transferring models among distributed locations via computer networks usually consumes large amounts of network ... Keywords: Incremental editing, Integrated design environment, Progressive streaming, Solid model

Di Wu; Radha Sarma




E-Print Network (OSTI)

ATOMIC-LAYER-DEPOSITED ALUMINUM OXIDE FOR THE SURFACE PASSIVATION OF HIGH-EFFICIENCY SILICON SOLAR to those measured on reference cells passivated by an aluminum-annealed thermal SiO2, while those of the Al of aluminum ox- ide (Al2O3) grown by atomic layer deposition (ALD) pro- vide an excellent level of sur


CX-011861: Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE))

Easts Ide Renovation Project Zone 1-Revision (T-1-11) CX(s) Applied: B2.5, B5.2, B5.4, B5.5 Date: 03/13/2014 Location(s): Wyoming Offices(s): RMOTC


CX-011863: Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE))

Easts Ide Renovation Project Zone 1-Revision (T-1-11) CX(s) Applied: B2.5, B5.2, B5.4, B5.5 Date: 03/13/2014 Location(s): Wyoming Offices(s): RMOTC


Theme : Knowledge and Data Representation and Management INSTITUT NATIONAL DE RECHERCHE EN INFORMATIQUE ET EN AUTOMATIQUE  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 6.1. Static Analysis Techniques for XML Processing 7 6.1.1. An IDE for XQuery 7 6.1.2. Schema RECHERCHE EN INFORMATIQUE ET EN AUTOMATIQUE Project-Team WAM Web, Adaptation and Multimedia Grenoble - Rhône-Alpes #12;#12;Table of contents 1. Team

Joseph Fourier Grenoble-I, Université

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Oxygen and Nitroaen Contamination During Submerged Arc Wel ding of Titanium  

E-Print Network (OSTI)

) ) ) ··- -~ Oxygen and Nitroaen Contamination During Submerged Arc Wel ding of Titanium T· \\v· Eagar* The oxygen content of ti tanium submerged arc wel ~ metal is primaril y derendent uron the purity of the fluo1~ ide fluxes, but it is shown here that the oxygen content of the weld metal may be affected

Eagar, Thomas W.


A novel hand reconstruction approach and its application to vulnerability assessment  

E-Print Network (OSTI)

Comunicaciones (IDeTIC), Universidad de Las Palmas de Gran Canaria, Campus de Tafira s/n, E35017 Las Palmas de Gran Canaria, Spain a r t i c l e i n f o Article history: Available online xxxx Keywords: Biometric

Autonoma de Madrid, Universidad


2, 21512165, 2002 Intercontinental NO2  

E-Print Network (OSTI)

Screen / Esc Print Version Interactive Discussion c EGU 2002 Abstract We describe the first satellite observation of intercontinental transport of nitrogen ox- ides emitted by power plants, verified as the ocean5 they traverse due to nitrogen fertilization. This kind of monitoring became possible by applying

Boyer, Edmond


Design and Analysis of Salmonid Tagging Studies in the Columbia Basin, Volume XIII; Appraisal of System-Wide Survival Estimation of Snake River Yearling Chinook Salmon Released in 1997 and 1988, Using PIT-Tags Recovered from Caspian Tern and Double-Crested Cormorant Breeding Colonies on Rice Island, 1997-1998 Technical Report.  

SciTech Connect

PIT-tags recovered from tern and cormorant breeding colonies at Rice Island and observations from the interrogation systems at John Day and Bonneville Dams were incorporated into survival analyses. Whether the estimates for the upper reaches of the system, between Lower Granite and McNary Dams were as expected (with weighted averages S{sub LGR-LGS} = 0.996, S{sub LGS-LMN} = 0.837, and S{sub LMN-McN} = 0.941), those for the lower reaches, between John Day and Bonneville Dams, appeared positively biased with survival estimates typically greater than 1. Their weighted averages were S{sub McN-JDA} = 0.707 and S{sub JDA-BON} = 1.792 for 1997 releases. For the 1998 releases, they were S{sub McN-JDA} = 0.795 and S{sub JDA-BON} = 1.312. If the estimates for the lower reaches were biased, the estimates for the whole project would also be biased (S{sub LGR-BON} = 0.819). We determined that bias could have arisen if the terns and cormorants of Rice Island fished for salmon yearlings in waters of the BON-Rice reach at low rates (M{sub BON-Rice} {le} 0.2), and the rates of tag-deposition and tag-detection were low (R{sub D} x R{sub R} {le} 0.4). Moreover, unknown levels of uncensored post-detection mortality and scavenging of previously dead salmon yearlings may have also added to the bias.

Skalski, John R.; Perez-Comas, Jose A. (University of Washington, School of Fisheries, Seattle, WA)



Turbine Surface Degradation with Service and Its Effects on Performance  

NLE Websites -- All DOE Office Websites (Extended Search)

Jeffrey Bons Jeffrey Bons Co-PIs: Iowa State University - Drs. Tom Shih and ZJ Wang University of Cincinnati - Drs. Tafi Hamed and Widen Tabakoff Air Force Research Lab - Dr. Richard Rivir SCIES Project 02- 01- SR104 DOE COOPERATIVE AGREEMENT DE-FC26-02NT41431 Tom J. George, Program Manager, DOE/NETL Richard Wenglarz, Manager of Research, SCIES Project Awarded (06/01/02, 36 Month Duration) $563,712 Total Contract Value Turbine Surface Degradation with Service and Its Effects on Performance Brigham Young University JPB/BYU/29Oct2003 BYU-UTSR-Oct03, 29 Oct 2003, JPB The Gas Turbine Community NEEDS adequate tools to estimate the associated loss in engine performance with service time. ROUGH! ARE TURBINES Surface Degradation - Increases Heat Transfer - Reduces Efficiency GAS TURBINE NEED


Carbon Capture Innovation: Making an IMPACCT on Coal | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal February 16, 2012 - 4:48pm Addthis The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs Over the past 20 years, nearly three-fourths of human-caused emissions came


Carbon Capture Innovation: Making an IMPACCT on Coal | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal February 16, 2012 - 4:48pm Addthis The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs Over the past 20 years, nearly three-fourths of human-caused emissions came


Turbine Surface Degradation with Service and Its Effects on Performance  

NLE Websites -- All DOE Office Websites (Extended Search)

Peer Review Workshop III Peer Review Workshop III 18-20 October 2005 Jeffrey Bons BYU Z.J. Wang (3-D) Tom Shih (2-D) Iowa State University IOWA STATE UNIVERSITY Aerospace Engineering Turbine Surface Degradation with Service and Its Effects on Performance - 2-D/3-D CFD Simulations of Rough Surfaces- * Perform detailed CFD simulations to generate understanding of flow and heat transfer phenomena over rough surfaces. * Use understanding generated to develop engineering models to predict heat transfer and friction on rough surfaces. Objectives IOWA STATE UNIVERSITY Aerospace Engineering Accomplishments * Performed 2-D and 3-D CFD simulations. * Generated a preliminary engineering model. 3-D CFD: Z.J. Wang * 1/6 -1/3 of the span (from Jeffrey Bons' experiment) selected for the computational domain; * 2 mm, 1 mm and 0.5 mm resolutions for coarse, medium and


Tunisia's production peaks, exploration busy  

SciTech Connect

This paper reports on the oil and gas exploration industry in Tunisia which is continuing to experience an almost unprecedented boom as the effects of the favorable fiscal and legislative regime work through the recent discoveries come on stream. Perhaps the most significant of the new discoveries is 1 Belli on Cap Bon, which Marathon tested at a rate of 6,800 b/d of oil with reported potential of as much as 15,000 b/d.

Mrad, R.; M'Rabet, A.; Chine, N. (Enterprise Tunisienne d'Activites Petrolieres (TN)); Davies, W.C.



Haitian-English Dictionary  

E-Print Network (OSTI)

, Uberleben auf Kreolisch. Port-au-Prince: La Presse Evangelique, 1990. Bryant C. Freeman, Haitian-English English-Haitian Medical Dictionary, with Glossary of Food and Drink. Port-au-Prince: La Presse Evangelique, 1992. Seconded., 1997, Third ed., 1999.... Bryant C. Freeman, ed. Ann Bay Lodyans [Haitian Folktales in Haitian]. Lawrence: Uni versity of Kansas Institute of Haitian Studies; Port-au-Prince: Bon Nouvel, 1996- 1997. 2 e ed., 2000. 16 volumes. Bryant C. Freeman, Haitian Creole for Peace Support...

Freeman, Bryant C.; Laguerre, Jowel C.



Z .Diamond and Related Materials 10 2001 364 369 Experimental data vs. 3-D model calculations of HFCVD  

E-Print Network (OSTI)

rH and3 4 2 C H rH process gas mixtures and to examine in detail the process of C lC inter-conversion between C and C hydrocar-2 1 bon species in the gas phase. Another important con- Zsideration in the gas phase. It has been2 2 2 2 1 shown that cooler regions distant from the filament need

Bristol, University of


Universite de Toulon Th`ese de doctorat  

E-Print Network (OSTI)

'oeuvre dans la g´en´eration des vaguelettes par le vent, sans m^eme parler de ph´enom`enes comme les vagues sc`etres `a prendre en compte. La compr´ehension des interactions entre les ondes ´electromagn´etiques et la d'antennes radar [4]. Un bon exemple d'interaction complexe en incidence rasante ayant des cons

Boyer, Edmond


Supplementary information Figure S1: Left: Comparison of PM2.5 levels measured with one of the optical  

E-Print Network (OSTI)

Palau Reial L3 87 24 21 6 Bon Pastor L9 145 98 46 28 Sagrera L9 180 53 59 19 Mean Mean in trains PM10 PM10 std PM2.5 std 5min 1.20 0.22 0.43 0.10 Fontana L3 0.49 0.10 0.15 0.05 Palau Reial L3 0.30 0.08 0

Meskhidze, Nicholas


Deux soeurs et Jsus, quel enseignement? (Luc Ce rcit se situe dans le cadre large de la monte vers Jrusalem (9,51-19,28), la  

E-Print Network (OSTI)

François Bovon.3 L'amour du prochain étant illustré par la parabole du bon Samaritain, l'amour de Dieu est normative, et vise à "encourager à opter pour une certaine attitude de foi". (François BOVON, L Verlagsanstalt, 1987, p. 212. 3 François BOVON, L'Evangile selon St Luc, 1996, p. 82. 4 Charles Talbert juge

Paris-Sud XI, Université de


Private development of artificial reefs  

E-Print Network (OSTI)

when compared with terestrial ecosystems. Recent studies at Woods Hole Oceanographic Institution emphasized that the oceans are far from an unlimited resource. The net pro- duction of the open ocean is about 50 grams of fixed car- bon per square... enhanced already existing fisheries. The continental shelf of the Gulf of Mexico is an expanse of shallow ocean bottom, and is the area inhabited by the majority of the commercially valuable reef fishes. Much of the shelf area, however, is r...

Burns, Arthur Allen



Vers une adoption de la France ? Hugh Clout1  

E-Print Network (OSTI)

sur la nécessité d'acquérir une connaissance des langues étrangères, de Cole Harris sur l sont vraiment intéressants. Au contraire, il y a un petit article de la plume de William Mead, publié en 1963 et intitulé « The adoption of other lands », qui me semble plein de bon sens. Mead était, et

Paris-Sud XI, Université de



E-Print Network (OSTI)

65 LA REVUE DE L'EPI N° 85 DES CD-ROM POUR L'?COLE PRIMAIRE DES CD-ROM POUR L'?COLE PRIMAIRE Jacques B?ZIAT EDUCAMPA COMMENT ENRICHIR SA BO?TE ? OUTILS SCOLAIRE ET P?DAGOGIQUE L'EPI diffuse le CD-Rom EDUCAMPA 1 (voir bon de commande page 236 de cette revue). Avec ce CD-Rom, Jean Marc Campaner nous livre

Paris-Sud XI, Université de



E-Print Network (OSTI)

réactions de production de dileptons en collision proton-proton avec HADES Soutenue publiquement le 28 mars les membres de la collaboration HADES avec qui j'ai échangé de bons moments. Je remercie les membres-00297939,version1-16Jul2008 #12;Table des matières 1 Motivations physiques de l'expérience HADES 7 1.1 La

Paris-Sud XI, Université de



NLE Websites -- All DOE Office Websites (Extended Search)

Right: Images Right: Images from the stud- ies carried out on APS beam- line 2-ID-E. a) X-ray fluo- rescence maps of a cell trans- fected with "free" titanium oxide (Ti) crys- tals, showing that most of the Ti nanoparticles (green) are located outside the cells. b) X-ray fluorescence maps of a cell transfected with titanium oxide nanocomposites, showing introduction of the nanocompos- ites in the cell. Inset: The hard x- ray microscope at 2-ID-E. The specimen is located inside the orange enclosure. A novel, light-activated hybrid "nanodevice" composed of titani- um oxide nanocrystals and carefully selected segments of DNA could one day be used to target the defective genes that play a role in can- cer, neurological diseases, and other conditions. The work that has


Browse by Discipline -- E-print Network Subject Pathways: Biotechnology --  

Office of Scientific and Technical Information (OSTI)

J K L M N O P Q R S J K L M N O P Q R S T U V W X Y Z Ide, Kayo (Kayo Ide) - Department of Atmospheric and Oceanic Sciences, University of California at Los Angeles Ingólfsson, Ólafur (Ólafur Ingólfsson) - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland Innanen, Kristopher A. (Kristopher A. Innanen) - Department of Physics, University of Houston Ito, Garrett (Garrett Ito) - Department of Geology and Geophysics, University of Hawai'i at Manoa Iwata, Naoyoshi (Naoyoshi Iwata) - Department of Earth and Environmental Sciences, Yamagata University Go back to Individual Researchers Collections: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Illinois State Geological Survey, Oil and Gas Section

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Browse by Discipline -- E-print Network Subject Pathways: Materials Science  

Office of Scientific and Technical Information (OSTI)

J K L M N O P Q R S J K L M N O P Q R S T U V W X Y Z Iacono, John (John Iacono) - Department of Computer Science and Engineering, Polytechnic Institute of New York University Iamnitchi, Adriana (Adriana Iamnitchi) - Computer Science and Engineering, University of South Florida Iannone, Luigi (Luigi Iannone) - Institut Deutsche Telekom Laboratories, Technische Universität Berlin Ìayr, Richard (Richard Ìayr) - School of Informatics, University of Edinburgh Ibarra, Louis (Louis Ibarra) - School of Computer Science, Telecommunications and Information Systems, DePaul University Ichimura, Naoyuki (Naoyuki Ichimura) - Neuroscience Research Institute, National Institute of Advanced Industrial Science and Technology (AIST) Ide, Nancy (Nancy Ide) - Department of Computer Science, Vassar


Overstory/understory relationships in old growth Grand fir habitat types of northeast Oregon  

E-Print Network (OSTI)

limber ol Ides I I PIPOIPHD Numbsf ol sitils 182A 21D 85C 140E 32E 158 51E Sdl Type 182A 21D 85C 86C 1828 ID7D 78D Scil Type 85C 1528 Swl Type I 82A ISD 312D 31 3E Scil Type 51E TamaraSyrupcresk conlplex, 0 lo 15 pwcent... limber ol Ides I I PIPOIPHD Numbsf ol sitils 182A 21D 85C 140E 32E 158 51E Sdl Type 182A 21D 85C 86C 1828 ID7D 78D Scil Type 85C 1528 Swl Type I 82A ISD 312D 31 3E Scil Type 51E TamaraSyrupcresk conlplex, 0 lo 15 pwcent...

Schreder, Peter Todd



Ir I L  

Office of Legacy Management (LM)

*- -I ..' -I I... "- II .- (1 "^ 1 6 7 8 9 10 11 LIST O F FIGURES General location of the Granite City Steel Facility , Granite City , Illinois . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9 View of the betatron building, look ing south . . . . . . . . . . . . . . . . . . . 10 View of the betatron building, look ing west . . . . . . . . . . . . . . . . . . . . . 11 Diagram of the ground floor of the betatron building . . . . . . . . . . . . . . 12 Photo showing the larger of the two betatrons (no. 1, Fig. 4) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13 View of transformer s torage area ins ide the betatron building . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .


InsideIllinoisFeb. 20, 2014 Vol. 33, No. 15  

E-Print Network (OSTI)

InsideIllinoisFeb. 20, 2014 Vol. 33, No. 15 F o r F a c u l t y a n d S t a f f , U n i v e r s i s . e d u / i i InThisIssue InsIde IllInoIs onlIne: news.illinois.edu/ii/ · To subscrIbe: go.illinois, researchers report. The conversion produces significantly more energy than it requires and results

Lewis, Jennifer


TH`ESE de DOCTORAT l'Universite Pierre & Marie Curie  

E-Print Network (OSTI)

probl`eme de la synth`ese par la commande d'ac- tivit´es motrices pour des syst`emes contraints par syst`emes humano¨ides pour la r´ealisation d'activit´es motrices n´ecessitant la coordination t´epertoire de coordinations motrices, 3) la planification et l'adapta- tion des activit´es ´el´ementaires dans l


Alternate Fuels: Is Your Waste Stream a Fuel Source?  

E-Print Network (OSTI)

in their boiler systems. And, the trend toward using Process Gases, Flammable Liquids, and Volatile Organic Compounds (\\iDe's), to supplement fossil fuels, will be considered a key element of the management strategy for industrial power plants. The increase...ALTERNATE FUELS: IS YOUR WASTE STREAM A FUEL SOURCE? PHn, COERPER. MANAGER ALTERNATE FUEL SYSTEMS. CLEAVER-BROOKS. Mn,WAUKEE. WI ABSTRACT Before the year 2000. more than one quarter of u.s. businesses will be firing Alternate Fuels...

Coerper, P.


Proceedings of the Workshop on Open Infrastructures and Analysis Frameworks for HLT, pages 3443, Dublin, Ireland, August 23rd 2014.  

E-Print Network (OSTI)

representation formats (e.g., ISO LAF/GrAF (Ide and Suderman, 2014; ISO-24612, 2012), NLP Interchange Format (NIF.g., ISOCat3, OLiA4, various repositories for UIMA type systems5, GOLD6, NIF Core Ontology7) have been://www.julielab.de/Resources/Software/UIMA+type+system-p-91.html 6 http://linguistics-ontology.org 7 http://persistence.uni-leipzig.org/nlp2rdf/ontologies/nif-core/nif


The Language Application Grid Web Service Exchange Vocabulary Department of Computer Science  

E-Print Network (OSTI)

formats (e.g., ISO LAF/GrAF (Ide and Suderman, 2014; ISO-24612, 2012), NLP Interchange Format (NIF.g., ISOCat3, OLiA4, various repositories for UIMA type systems5, GOLD6, NIF Core Ontology7) have been://www.julielab.de/Resources/Software/UIMA+type+system-p-91.html 6 http://linguistics-ontology.org 7 http://persistence.uni-leipzig.org/nlp2rdf/ontologies/nif-core/nif

Ide, Nancy


Beamline Phone Numbers| Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

Interactive Map Interactive Map Beamlines Map Beamlines Directory Techniques Directory Sectors Directory Beamline Phone Numbers Status and Schedule Beamline Phone Numbers From on-site, dial 2, then a number listed below. From off-site, dial 630-252 and a number listed below. Sector 1 1-BM-A: 1701 1-BM-C: 5468 1-ID: 1801 Sector 2 2-BM: 1702 2-ID-B: 1628 2-ID-D: 1802 2-ID-E: 3711 Sector 3 3-ID: 1803 Sector 4 4-ID-C: 1704 4-ID-D: 1804 Sector 5 5-BM: 1705 5-ID: 1805 Sector 6 6-ID-B: 1806 6-ID-C: 1406 6-ID-D: 1606 Sector 7 7-ID-B: 1607 7-ID-C: 1707 7-ID-D: 1807 7-ID-E: 1207 Sector 8 8-ID-E: 1908 8-ID-I: 1808 Sector 9 9-BM-B: 1709 9-ID-B: 0349 9-ID-C: 1809 Column 95: 4705 Sector 10 10-BM-B: 6792 10-ID-B: 1710 Sector 11 11-BM-B: 5877 11-ID-B: 1711 11-ID-C: 1711 11-ID-D: 2162 Laser lab: 0379 Sector 12 12-BM-B: 0378 12-ID-B,C: 1712


Development of a modular CdTe detector plane for gamma-ray burst detection below 100 keV  

E-Print Network (OSTI)

We report on the development of an innovative CdTe detector plane (DPIX) optimized for the detection and localization of gamma-ray bursts in the X-ray band (below 100 keV). DPIX is part of an R&D program funded by the French Space Agency (CNES). DPIX builds upon the heritage of the ISGRI instrument, currently operating with great success on the ESA INTEGRAL mission. DPIX is an assembly of 200 elementary modules (XRDPIX) equipped with 32 CdTe Schottky detectors (4x4 mm2, 1 mm thickness) produced by ACRORAD Co. LTD. in Japan. These detectors offer good energy response up to 100 keV. Each XRDPIX is readout by the very low noise front-end electronics chip IDeF-X, currently under development at CEA/DSM/DAPNIA. In this paper, we describe the design of XRDPIX, the main features of the IDeF-X chip, and will present preliminary results of the reading out of one CdTe Schottky detector by the IDeF-X V1.0 chip. A low-energy threshold around 2.7 keV has been measured. This is to be compared with the 12-15 keV threshol...

Ehanno, M; Barret, D; Lacombe, K; Pons, R; Rouaix, G; Gevin, O; Limousin, O; Lugiez, F; Bardoux, A; Penquer, A



Development of a modular CdTe detector plane for gamma-ray burst detection below 100 keV  

E-Print Network (OSTI)

We report on the development of an innovative CdTe detector plane (DPIX) optimized for the detection and localization of gamma-ray bursts in the X-ray band (below 100 keV). DPIX is part of an R&D program funded by the French Space Agency (CNES). DPIX builds upon the heritage of the ISGRI instrument, currently operating with great success on the ESA INTEGRAL mission. DPIX is an assembly of 200 elementary modules (XRDPIX) equipped with 32 CdTe Schottky detectors (4x4 mm2, 1 mm thickness) produced by ACRORAD Co. LTD. in Japan. These detectors offer good energy response up to 100 keV. Each XRDPIX is readout by the very low noise front-end electronics chip IDeF-X, currently under development at CEA/DSM/DAPNIA. In this paper, we describe the design of XRDPIX, the main features of the IDeF-X chip, and will present preliminary results of the reading out of one CdTe Schottky detector by the IDeF-X V1.0 chip. A low-energy threshold around 2.7 keV has been measured. This is to be compared with the 12-15 keV threshold of the ISGRI-INTEGRAL and BAT-SWIFT instruments, which both use similar detector material.

M. Ehanno; C. Amoros; D. Barret; K. Lacombe; R. Pons; G. Rouaix; O. Gevin; O. Limousin; F. Lugiez; A. Bardoux; A. Penquer



Impacts of different SNLS3 light-curve fitters on cosmological consequences of interacting dark energy models  

E-Print Network (OSTI)

Aims: We explore the cosmological consequences of interacting dark energy (IDE) models using the Supernova Legacy Survey three-year (SNLS3) data sets. In particular, we focus on the impacts of different SNLS3 light-curve fitters (LCF) (corresponding to the "SALT2", the "SiFTO", and the "Combined" supernova sample). Methods: Firstly, making use of the three SNLS3 data sets, as well as the observational data from the cosmic microwave background (CMB), the galaxy clustering (GC) and the direct measurement of Hubble constant $H_0$, we constrain the parameter spaces of three IDE models. Then, we plot the cosmic evolutions of Hubble diagram $H(z)$, deceleration diagram $q(z)$ and statefinder hierarchy $\\{S^{(1)}_3, S^{(1)}_4\\}$, and check whether or not these dark energy (DE) diagnosis can distinguish the differences among the results of different LCF. At last, we perform high-redshift cosmic age test using three old high redshift objects (OHRO), and explore the fate of the Universe. Results: For all the IDE models...

Hu, Yazhou; Li, Nan; Wang, Shuang



Restavk: yon ti esklav ann Ayiti tounen yon Ameriken ki pwofes lekl  

E-Print Network (OSTI)

an, tande, ba 1 kichoy pou 1 manje." Anjela pran m. 2 Li mande: "Ki non 1 genyen?" Florans fe yon ti grate tet epi 1 di: "Bobi." Florans pa t bezwen yon lot timoun, men, kondisyon lajan Filip pase ave 1 la te two bon pou 1 ta di non. Chak swa... kado nan men tonton Nwel epi ki nan fete fet yo, se timoun ki gen manman ak papa toutbon. 11 Chapit 2 - Lekol Chak samdi maten, Florans chita chita 1 nan dodin li, anba gwo pyebwa ki nan lakou devan an. L ap tann pratik li pase vin vann vyann...

Cadet, Jean Robert; Kadè , Jan Wobè



Transit La Runion / Crozet du 2 au 7 Dcembre Prparation du mouillage KER12 cage aluminium compacte flottabilit intgre  

E-Print Network (OSTI)

bouée Panther Remarques : Les largueurs sont retenus par un bout à la structure pour éviter qu'ils ne se lieu de 90°. Ce n'est pas dramatique car l'élingue en chaîne de ce mouillage est très courte et devrait seront pas bonnes car ce n'est pas le bon numéro de série du radar, les données affichées sur le radar ne


Carbon Dioxide Emission Factors for U.S. Coal by Origin and Destination  

Science Journals Connector (OSTI)

In-ground coal quality data, including C, S, ash, fixed carbon, and heating values, are from COALQUAL (11), IGS (12), and Keystone (13, 14). ... For example, examination of 2082 bituminous Kentucky coals led Sakulpitakphon et al. (28) to reject the notion that a single CO2 emission factor can be used as typical for any given rank of coal. ... Quick, J. C.; Tabet, D. E.; Wakefield, S.; Bon, R. L. Optimizing Technology to Reduce Mercury and Acid Gas Emissions from Electric Power Plants: A GIS Study of Coal Chemistry, ...

Jeffrey C. Quick



Measurement of routinely encountered neutron field doses using portable survey instruments and a Bonner multisphere system  

E-Print Network (OSTI)

against two 10 Ci PuBe neutron sources. Measurements were m de at a research reactor facility and a cyclotron facility using a Victoreen 4BBA portable survey instrument, a Ludlum Mode1 15 portable survey instrument and a Bonner multisphere system. Data... Detector Response as a Function of Neutron Energy Page Figure 2. Plot of BON25G Spectral Output Figure 3, Flux-to-Dose Rate Conversion Factors for Neutrons . . . . 8 Figure 4. Data Measurement Locations at NSC 13 Figure 5. Data Measurement Locations...

Davis, Donald Reed



Survival Rates of Juvenile Salmonids Passing Through the Bonneville Dam and Spillway in 2008  

SciTech Connect

This report describes a 2008 acoustic telemetry survival study conducted by the Pacific Northwest National Laboratory for the Portland District of the U.S. Army Corps of Engineers. The study estimated the survival of juvenile Chinook salmon and steelhead passing Bonneville Dam (BON) and its spillway. Of particular interest was the relative survival of smolts detected passing through end spill bays 1-3 and 16-18, which had deep flow deflectors immediately downstream of spill gates, versus survival of smolts passing middle spill bays 4-15, which had shallow flow deflectors.

Ploskey, Gene R.; Weiland, Mark A.; Faber, Derrek M.; Deng, Zhiqun; Johnson, Gary E.; Hughes, James S.; Zimmerman, Shon A.; Monter, Tyrell J.; Cushing, Aaron W.; Wilberding, Matthew C.; Durham, Robin E.; Townsend, R. L.; Skalski, J. R.; Buchanan, Rebecca A.; Kim, Jina; Fischer, Eric S.; Meyer, Matthew M.; McComas, Roy L.; Everett, Jason



Ann bay lodyans 12 / Se Bryant Freeman ("Tonton Liben") ki pare ti liv sa a  

E-Print Network (OSTI)

a, Bondye fe yon bon ti melanj: li pran bwode ki gen nan pan, di ki gen nan woch, fines ki gen nan ke zwazo, douse ki gen nan siwo myel, mechanste ki gen nan tig, chale ki gen nan dife, fredi ki gen nan lanej. Bondye kontwole yo, sa pa ase.... Yo te viv ansanm pandan kek tan konsa. Men yon jou, msye a al devan Bondye ansanm ak fi a. Li pote I remet Bondye. Li di konsa: "Bondye, m pa kapab viv ak zanmi ou ban mwen an. Li pale san rete, li fatige m twop, menm yon ti poze m pa kab fe. Sa...

Freeman, Bryant C.



APS User News-at-a-Glance, Issue 45  

NLE Websites -- All DOE Office Websites (Extended Search)

5: November 30, 2007 5: November 30, 2007 Advanced Photon Source Argonne National Laboratory www.aps.anl.gov ============================================ CONTENTS MESSAGE FROM MURRAY --Extensive U of C Review Completed SCIENCE NEWS 1. HOLD THE DATE: Upgrade Workshop October 20-21, 2008 2. Featured Beamline: GISAXS at 8-ID-E, Focusing on Nanoscience USER MATTERS 3. Ten Tips for an Easy ESAF FACILITY NEWS 4. Update on XOR Beamline Upgrades 5. APS Response to Violations of APS and Argonne Policies by Users BRIEFLY NOTED -- FY2008 Schedule Posted -- Laboratory Closed for Holidays ---------------------------------------------------------------------------------------------- Instructions for subscribing, unsubscribing, and submitting info: http://www.aps.anl.gov/Users/Communications/User_News/


The Influence of Availability Costs on Optimal Heat Exchanger Size  

E-Print Network (OSTI)

the ide.. proposed by London and Shah. EVALUATING IRREVERSIBILITY COSTS To illustr.te how to evaluate irrever sibility costs for a particular system, let us pick a condensing heater system that uses condening steam as the hot, "pur chased" stream....84/10 9 J(oules), and whose efficiency is 80~. It is further assumed that the condensate from the heater' is fed into a condensate system that even tually feeds a collection main at P3 = 0.1014 MPa (14.7 psia), as shown on Figure 1. Even though...

Witte, L. C.

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The thermodynamic properties of mixtures of normal hexane and branched paraffin hydrocarbons  

E-Print Network (OSTI)

In the mid fifties, Myers (22) studied the vapor-liq- uid equilibria of eighteen binary mixtures of paraffins, naphthenes and aromatics by employing a equilibrium-still (14) of the vapor-recirculating type at an absolute pres- sure of 760 mm. Hg. Activity... for these mixtures indicate that in general, mixtures of paraf- fins and aromatics show the greatest deviations from ide- ality. For the five paraffin-aromatic systems studied, terminal activity coefficients range from about 1. 3 to 1. 8. For naphthene...

Ho, Chun Leung



Mass transfer rates in osmotic membranes with application to desalination  

E-Print Network (OSTI)

snd content by: 7 ! f'e be r JJember December 1970 ABSTRACT Mass Transfer Rates in Osmotio Membranes With Application to Desalination. (December 1970) Joseph Charles Drummond, II, B. S. , Texas ARM University Directed by: Dr. Richard Read... Osmotic Pressures of !JaC1-?~ster Solutions . 28 O:mot'c Pressure of I'sSOl -?~ster Solutions . 29 6. Osmotic Eouilibrium of Polyamine Chloride Solutions and NaCI Solutions 31 7. 'l'he Coeff icient, 8, as a Function of Poly- smine Chio. ide !Jcight...

Drummond, Joseph Charles



SGang steng Catalogue  

E-Print Network (OSTI)

Revue d'Etudes Tibtaines16 sGang steng Catalogue By Cathy Cantwell, Rob Mayer,Michael Kowalewski & Jean-Luc Achard ATIYOGA SECTION Volume 1 (Ka) 1. Chos thams cad rdzogs pa chen po byang chub kyi sems kun byedrgyal po/ 001-062 (1b-91b... o// /di khams lugs kyi rgyud gsang basgron mai gzhug la bris shig//. Volume 2 (Kha) 46. rDo rje sems dpa' nam mkha'i mtha' dang mnyam pa'i rgyud chenpo/ 001-085 (1b-128a)Colophon : //das pa dang/ ma byon pa dang/ da ltar phyogs bcu dus bzhiide bzhin...

Cathy Cantwell; Mayer, Rob; Kowalewski, Michael; Achard, Jean-Luc



A simple and low-cost measurement system for switched reluctance motor drive  

Science Journals Connector (OSTI)

This paper describes a low cost digital measurement system for measuring the voltage, current and flux linkage and rotor position of switched reluctance motor (SRM) drive. The digital measurement scheme was developed using a eZdsp TMS320F2812 board along with CCS-IDE environment. The graphical window allows plotting the current, voltage, flux linkage and rotor position waveforms of SRM with a high degree of accuracy and presentation of results. The complete digital measurement scheme of the SRM incorporating the magnetic characteristics implementation algorithm is experimentally implemented and validated using a digital signal processor board TMS320F2812 for SRM drive.

M. Marsaline Beno; N.S. Marimuthu



Colorimetric microanalysis of several organic feed additives  

E-Print Network (OSTI)

, 5 - d in itrobenzam ide, cadm ium anthranilate, p ip eraz in e and santoquin, w ere s e le c ted fo r study, with the intention o f develop ing a new and usable m ethod o f ana lysis fo r each . Each drug was investigated individually... itro fu razone in a m ixtu re o f a lcoh o l and N, N -d im eth y lfo rm am id e . An adaptation o f the Janovsky rea ction fo r d in itrobenzene c om ? pounds has been found and is p resen ted h ere fo r the determ ination o f m ic ro g...

Beckman, Herman F.



F. Scott Fitzgerald's "Top Girl": a study of his women characters in three major novels  

E-Print Network (OSTI)

of mentioning sex and against, the attitudes of parent, s who oh)ected to seventeen-year-old girls drinking and smoking all night at speakeasies and. coming home the next mox ning in evening dresses. Although the casual nrinhina ana yeccfna c ccrc'h n..., was revolting against mox'al restrictions and responsibilities. 3F. Scott, Fitsgerald, This ide of Paradise (New York, l920), p. 6/x all subsequent, page rexerences Co t, he novel in my text, will be recorded in parenCheses after Chc quotation and will refer...

Klug, Jack B



The effects of bus transportation on grades, attendance records, and participation in extra-curricular activities of high school students in Tyler County, Texas, 1953  

E-Print Network (OSTI)

stated in the introductory section Prom the information ob- tained through the use of questionnaires~ the students were divided into the following four groupsz (1) boys who do not z ide a bus to school) (2) boys who ride a bus to school each day) (3..., 0 miles and over. Table I was prepared to show the distribution of students in each group mentioned, Of the f74 students included in this study, 2Q were boys who attended high school in Tyler County. Of this group, + percent commuted to school...

McEntire, Gerald



Babies Touch, Taste, and Learn: A Guide for Parents.  

E-Print Network (OSTI)

TOoe . ZTA245 07 8873 , ~O.I2."~ ) B - 1269 -~abies Touch, .. Taste, and Learn 0') A Gu ide for Parents TEXAS A&M UNIVERSITY TEXAS AGRICULTURAL EXTENSION SERVICE Daniel C. Pfannstiel, Director, College Station, Texas A baby learns from... touching you Hold him close to your body. Stroke his cheek Rub his body when you : bathe him. ~dby needs things he can grasp Things he can hold Things he can drop Babies learn by tasting Give babies toys that are safe They will put them...




Reseeding trials with seedhay material of little bluestem in western Williamson County, Texas  

E-Print Network (OSTI)

total for the plot. This total was used as a '~e to compute the percentage composition of each speoiss for t. &e plot, The number of weed and forb plants per acre was recorded by actual stem count on a three inch belt on one ide of each line...?f established seedlings of little blusstem found within the three inch belt transsot wss recorded in the fall readings. To arrive at an indication of vigor in the established seedlings& biseote were made of average siaed seedlings. T? obtaining a bisect a...

Yarlett, Lewis L



Distribution of phyllosoma lobster larvae (Crustacea: Decapoda: Reptantia: Scyllaridea) in the Gulf of Mexico in relation to currents and recruitment potential  

E-Print Network (OSTI)

' 8, 28662 Adult specimens are reported from the Florida Keys (Stimpson 1866, 1871), Cuba (Von Martens 1878), Bezmuda (Verril 1922), the Gulf of Mexico (Springer and Bullis 1956), and Surinam (Holthuis 1959). According to Williams (1965... the Seven and One-Half Fathom Reef in the northwestern Gulf of Mexico off Padre Island. 341 Sexi ': ides dal:os I Ho itiyu's, I 960 Adults are taken off the coast of Guiana and Surinam, and from the northeastern coast of South America (Holthuis 1960...

Hammer, Richard Melvin



Mu suM national d'Histoire naturelle 57 rue Cuvier -75005 Paris -+33 (0)1 40 79 56 01 / 54 79 -www.mnhn.fr  

E-Print Network (OSTI)

- www.mnhn.fr 26 Hectares of galleries, greenHouses, laboratories, learning facilities and a zoo GrandeColoGy, sustainable develoPment and enerGy Cover Photos: Cypraea sp Or «COWZry», raDIOGrapHy © asT-rX/MNHN VIGNeNCHOT/MNHN. LarGe INsIDe pHOTOs LeFT TO rIGHT: Lys © MNHN ; BuTTerFLy arGeMa MIMOsae, MOZaMBIQue © XaVIer Des


Outside heat transfer coefficients for atmospheric coolers  

E-Print Network (OSTI)

in unit time, then Oq (23 ) Subtracting Equation 20 from Equation 22 gives f =D ), ' - Z))~ q(~W) (@) c I Wg C (25) then = C5('at) (26 ) Eliminating Dq from Equation l8 and Equation 26 gives B Clq (~f) (27) taking limit DA ~0 g(~y) = Bg (ai...'bo cr'oss-socti &nal area, s rare feet Surface area for '&oat r'ansfor& square feet I& g moan to"!;orat' re differs;ico, degrees . 'ai, ronho i t 97. 83 77. 5'. 102. 96 18l!. , 27li. ~ 3. 17 O. O177 l!9 7l!. 1$. 38 Tube ". ide rate, ' Ur por...

George, David Mark



Germination of Cottonseed as Affected by Soil Disturbance and Machine Placement of Fertilizer.  

E-Print Network (OSTI)

. The fertilizer was so close - -- Bolo~ Belw %lor pch side .idm ~ch ~Ida Ona ride mead seed sed l* belor a* below 3" belor I* below wed lev01 see& leml lam1 88.d 18~al Fsrt1lLz.r pleaamon$ ad soil dirturbanao pi~nvn 2. Graph showing percentage... directly below the seed. The four roots on the right are from unfertilized test having the same soil disturbance as those on the left. hlor Below -lor lkch side pa .ide Each #id. One mid- amd aed mead 1" below pn blow 3- belo. an belor med levml level...

Morris, H. F. (Harry Forrest); Byrom, Mills H. (Mills Herbert); Smith, H. P. (Harris Pearson)



Studies on the metabolism of juvenile hormone in the adult male Hyalophora cecropia (L.) (Lepidoptera, Saturniidae)  

E-Print Network (OSTI)

-DNPH 9 standard. All fractions containing the C -DNPH plus one 9 fraction prior and two fractions following wer e combined as FrA. The recovery in FrA was measured by weighing after the solvent was removed in a rotary evaporator at room tempera tur... omatographg (HPLC) HPLC on EM Gel: FrA was resolved by HPLC with a model ALC 202 chr omatograph (Waters Associates Inc. , Milford, Mass. ) on a 0. 303 in. x 2 ft. EM Gel Si 150 (E. Merck, Darmstadt, Germany) column in degassed methylene chlor ide...

Shirk, Paul David



Performance based evaluation of the seismic resistance of structures with concrete diaphragms  

E-Print Network (OSTI)

. . . . 2. 2. 4 I:6 Scaled Shaking Table Models. 2. 3 Analytical Research 2. 3. 1 Button et al. (1984). 2. 3. 2 Roper and Iding (1984). . 2. 3. 3 Jain and Jennmgs (1984, 1985) . 2. 3. 4 Boppana and Nactm (1985). 2. 3. 5 Syramakezis and Chronopoulos... (1986, 1989). . . . . 2. 3. 6 Kunnath et al. (1991) . . 2. 3. 7 Dolce (1992) . 2. 3. 8 Kang (1993) 2. 3. 9 Lopez et al. (1994) . . 8 8 9 ll 13 14 18 19 20 23 25 27 29 32 33 35 Page 3. CASE STUDY BUILDINGS AND MODELING CRITERIA...

Barron, Joel Martin



Particle size effects of methylcyclopentane hydrogenolysis and SMSI in lanthanide oxide-supported 1%-platinum metal catalysts  

E-Print Network (OSTI)

hydrogen- olysis at 250'C and 300'C on 1%-Pt/La 0 catalysts as a function of hydrogen reduction temperature. 105 LIST OF FIGURES Figure Page 1 Recirculation ? batch reactor. . . . . . . . . . 30 2 Rates of ethylene hydrogenation on various catalysts... for calculations. The computer was inter- faced to a Micro-Term Co. ACT-5A display terminal, Digital Equipment Co. Model II DEC writer and two flexible disk drives. 4. Adsor tion S stem. Hydrogen and carbon monox- ide single point adsorptions were obtained...

Terhune, Kyte Hamilton



Data:3a32114d-1809-4573-8a7c-a2a0230d041c | Open Energy Information  

Open Energy Info (EERE)

d-1809-4573-8a7c-a2a0230d041c d-1809-4573-8a7c-a2a0230d041c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Single-Phase Controlled Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>



NLE Websites -- All DOE Office Websites (Extended Search)

UNIVERSIT UNIVERSIT Y OF CALIFORNIA Lawrence Radiation Laboratory Berkeley, California Contract No. W -740S-eng -48 UCRL-9966 I THE PATH OF CARBON IN PHOTOSYNTHESIS Melvin Calvin Nobel Prize Lecture December 11, 1961 ) Nobel Prize Lecture December 11, 1961 UCRL-9966 THE PATH OF Ck'1BON IN PHOI'CBYHTHESIS Melvin Calvin Department of Chemistry and Lawrence Radiation Laboratory University of California, Berkeley 4, California ll'JTRODUCTION It is almost sixty years since Emil Fischer was describing on 8 platform such as this one some of the work Which led to the basic know- ledge of the structure of glucose and its relatives. l Today we "ill be concerned ,.itha description of the experiments "lhich have led to a know- ledge of the principal reactions by which those carbohydrate structures are created by photos~rnthetic organisms from carbon dioxide and water,


Data:37c6cd1a-15f1-407a-ac2c-4d3136741f29 | Open Energy Information  

Open Energy Info (EERE)

a-15f1-407a-ac2c-4d3136741f29 a-15f1-407a-ac2c-4d3136741f29 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Rural Residential Single-Phase Sector: Residential Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>


degj0196 19..34  

NLE Websites -- All DOE Office Websites (Extended Search)

critical critical role of monitoring, verification, and accounting for geologic carbon dioxide storage projects Sean I. Plasynski, John T. Litynski, Howard G. McIlvried, Derek M. Vikara, and Rameshwar D. Srivastava A B S T R A C T A growing concern that increasing levels of greenhouse gases in the atmosphere are contributing to global climate change has led to a search for economical and environmentally sound ways to reduce car- bon dioxide (CO 2 ) emissions. One promising approach is CO 2 cap- ture and permanent storage in deep geologic formations, such as depleted oil and gas reservoirs, unminable coal seams, and deep brine-containing (saline) formations. However, successful implemen- tation of geologic storage projects will require robust monitoring, veri- fication, and accounting (MVA) tools. This article deals with all aspects of MVA activities associated with such geologic CO 2 storage

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - 2006FactSR120.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Deposition of Alternative (Syngas) Fuels on Turbine Blades with Film Cooling Deposition of Alternative (Syngas) Fuels on Turbine Blades with Film Cooling FACT SHEET I. PROJECT PARTICIPANTS Drs. Jeffrey Bons and Thomas Fletcher, Brigham Young University, 435 CTB, PO Box 24201, Provo, Utah 84602 (801) 422-8036 jbons@byu.edu Tom George, National Energy Technology Laboratory, P O Box 880, 3610 Collins Ferry Rd, Morgantown, WV 26507-0880 (304) 285-4825 tgeorg@netl.doe.gov Richard Wenglarz, South Carolina Institute for Energy Studies, 386-2 College Ave., Clemson, SC 29634 (864) 656-2267 rwnglrz@clemson.edu II. PROJECT DESCRIPTION A. Objectives This effort will address three critical technical issues associated with syngas use in gas turbines: (1) The effects of syngas deposition, erosion, and corrosion at elevated temperatures


Deposition of Alternative (Syngas) Fuels on Turbine Blades with Film Cooling  

NLE Websites -- All DOE Office Websites (Extended Search)

ACERC ACERC Dr. Jeffrey Bons and Dr. Thomas Fletcher BRIGHAM YOUNG UNIVERSITY SCIES Project 05-01-SR-120 with support from General Electric, Siemens-Westinghouse, Solar Turbines, Praxair UTSR Peer Workshop III, Clemson University, SC Oct. 18-20, 2005 Deposition of Alternative ( Deposition of Alternative ( Syngas Syngas ) Fuels on ) Fuels on Turbine Blades with Film Cooling Turbine Blades with Film Cooling Alternate fuels (e.g. coal, petcoke, and biomass) are being cons Alternate fuels (e.g. coal, petcoke, and biomass) are being cons idered to idered to produce produce syngas syngas fuels to replace natural gas in power turbines fuels to replace natural gas in power turbines Despite gas cleanup, small levels of airborne particulate (e.g. Despite gas cleanup, small levels of airborne particulate (e.g. 0.1 0.1 ppmw


Data:E18d89b7-56cd-42d4-91fa-8327da7d25ba | Open Energy Information  

Open Energy Info (EERE)

b7-56cd-42d4-91fa-8327da7d25ba b7-56cd-42d4-91fa-8327da7d25ba No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Farm Single-Phase Sector: Residential Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous



NLE Websites -- All DOE Office Websites (Extended Search)

Alternate Operations Study Alternate Operations Study 2013 Meeting Comments A F N Aces Flandreau Municipal Electric Northwest Iowa Power Cooperative Argus Media H O B Heartland Consumers Power District Otter Tail Power Company Basin Electric Cooperative Otter Tail Power Company 2 Basin Electric Cooperative 2 I Bon Homme Yankton Electric Assoc Irrigation & Electrical Districts Association S Sanborn Electric C L Sioux Valley Energy Central Iowa Power Cooperative L & O Power Cooperative South Dakota Municipal League Central Power Electric Cooperative Lake Region Electric South Dakota Municipal League 2 City of Beresford Lyon Rural Electric Cooperative South Eastern Electric Coop City of Cavalier Lyon-Lincoln Elect Coop City of Henning T City of Laurel M Town of Pickstown City of Melrose Marshall Municipal


Microsoft PowerPoint - UTSR-2010-Pennst-UNDOSU-comb.ppt [Compatibility Mode]  

NLE Websites -- All DOE Office Websites (Extended Search)

Workshop - Aerodynamics/Heat Transfer Breakout Workshop - Aerodynamics/Heat Transfer Breakout Oct 20 2010 Oct. 20,2010 Forrest Ames, UND Jeffrey Bons, OSU Motivation ot at o Turbine design considerations: Ash Deposition on F-100 Vane Leading Edge - Higher T T4 - LE Clogging Potential C b g (Ref: Kim et al., 1993) - Combustors: - High turbulence levels - Non-uniformities - Non uniformities - Film cooling - Larger leading edge diam. g g g - Better TBC coatings Ash Deposition on Better tools for turbine vane LE heat l d li i d 2 p CFM56-5B Vane Leading Edge (Ref: Smith et al., 2010) load, cooling requirements, and potential for deposition??? Critical Unanswered Questions Critical Unanswered Questions  What is the effect of increased LE radius on d iti ? deposition?  What is the effect of increased inlet turbulence on


Data:945188fc-2394-46e9-b4e0-471f63d3fed5 | Open Energy Information  

Open Energy Info (EERE)

fc-2394-46e9-b4e0-471f63d3fed5 fc-2394-46e9-b4e0-471f63d3fed5 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation Single-Phase Uncontrolled Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>


Academic Advisory Board Activities and Perspectives  

NLE Websites -- All DOE Office Websites (Extended Search)

Advisory Board Advisory Board Activities and Perspectives Karen A. Thole, Chair Academic Advisory Board Virginia Tech, Mechanical Engineering Department Peer Review Workshop October 20, 2005 * Review of the Academic Advisory Board * Activities since 2004 Peer Review Workshop * Open discussion Discussion Topics Chair: Karen Thole, Virginia Tech Co-Chair: Tim Lieuwen, Georgia Tech Secretary: Vince McDonell, U of California-Irvine Education: Yongho Sohn, U of Central Florida Combustion: Dom Santavicca, Penn State Materials: Eric Jordan, U of Connecticut Aero / Ht Transfer: Jeffrey Bons, Brigham Young Diagnostics: Scott Sanders, U. of Wisconsin Academic Advisory Board (AAB) Contact any of us with your concerns/issues!!! Goals for the AAB * Provide guidance to the UTSR Program


Data:6793dbb6-203f-4fec-b734-2aebaee98017 | Open Energy Information  

Open Energy Info (EERE)

dbb6-203f-4fec-b734-2aebaee98017 dbb6-203f-4fec-b734-2aebaee98017 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Small Commercial Single-Phase Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>


Data:68947f56-5be5-474a-9246-2dca88e83a7d | Open Energy Information  

Open Energy Info (EERE)

-5be5-474a-9246-2dca88e83a7d -5be5-474a-9246-2dca88e83a7d No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Demand & Energy Billing 75-350 kva Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>


Contribution of organic carbon to wood smoke particulate matter absorption  

NLE Websites -- All DOE Office Websites (Extended Search)

Contribution of organic carbon to wood smoke particulate matter absorption Contribution of organic carbon to wood smoke particulate matter absorption of solar radiation Title Contribution of organic carbon to wood smoke particulate matter absorption of solar radiation Publication Type Journal Article Year of Publication 2012 Authors Kirchstetter, Thomas W., and Tracy L. Thatcher Journal Atmospheric Chemistry and Physics Volume 12 Pagination 6067-6072 Abstract A spectroscopic analysis of 115 wintertime partic- ulate matter samples collected in rural California shows that wood smoke absorbs solar radiation with a strong spectral se- lectivity. This is consistent with prior work that has demon- strated that organic carbon (OC), in addition to black car- bon (BC), appreciably absorbs solar radiation in the visible and ultraviolet spectral regions. We apportion light absorp-


DOE/EIS-0397: Lyle Falls Fish Passage Project Final Environmental Impact Statement (November 2008)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Lyle Falls Fish Passage Project Lyle Falls Fish Passage Project Final Environmental Impact Statement DOE/EIS-0397 November 2008 B O N N E V I L L E P O W E R A D M I N I S T R A T I O N BON N E V I L L E POW E R AD M I N I S T R A T I O N DOE/BP-3957 November 2008 Lyle Falls Fish Passage Facility Lyle Falls Fish Passage Project Final Environmental Impact Statement Bonneville Power Administration Confederated Tribes and Bands of the Yakama Nation Washington Department of Fish and Wildlife U.S.D.A. Forest Service November 2008 Lyle Falls Fish Passage Facility Lyle Falls Fish Passage Project Final Environmental Impact Statement (EIS) DOE/EIS-0397


Data:D4b211c5-938e-45ab-a5b8-edc53ed137e1 | Open Energy Information  

Open Energy Info (EERE)

c5-938e-45ab-a5b8-edc53ed137e1 c5-938e-45ab-a5b8-edc53ed137e1 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Three-Phase Controlled Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>


Data:350aa617-2f1b-4069-907e-0c40fe10a1e3 | Open Energy Information  

Open Energy Info (EERE)

17-2f1b-4069-907e-0c40fe10a1e3 17-2f1b-4069-907e-0c40fe10a1e3 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Single-Phase Controlled Pivot Energy Only Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous


Regmi Research Series ,Year 3, December 1, 1971  

E-Print Network (OSTI)

!t the tlinrcrorf, l re4tionshipl1 bctl:eon the kine; and Kn-.til-.'olti would rot last long' and th,:t oither the Icing or tIc qtl()cn '1o!}ld dio 5oon. 6 At the 5EUOO tilOO J they spr.:l~d the rwoor that Girvanyuddha Dir Bitty'am Stah would dio of sll... in Octoh::r 1642: t" , -, , Kiq; Rajondra then besan to dance t o tho tune of the Junior Quwn, Rajyalaxmi Dlvi. Previously, Rajyaln;ani O(ni had felt afraid that th: eyv~ of her. infant 'Bons, Rapandra Bikram and Birendra nikr

Regmi, Mahesh C



Data:A1033a3d-3ede-44fd-b543-8d8c7d856c76 | Open Energy Information  

Open Energy Info (EERE)

a3d-3ede-44fd-b543-8d8c7d856c76 a3d-3ede-44fd-b543-8d8c7d856c76 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Coincidental Peak Billing Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous


Data:44fb2115-d097-4078-b11e-cde48f1f7da9 | Open Energy Information  

Open Energy Info (EERE)

fb2115-d097-4078-b11e-cde48f1f7da9 fb2115-d097-4078-b11e-cde48f1f7da9 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Large Load 350-1500kva Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous


Data:D9dbd362-cb4e-4007-91f7-9fd58ec6182c | Open Energy Information  

Open Energy Info (EERE)

dbd362-cb4e-4007-91f7-9fd58ec6182c dbd362-cb4e-4007-91f7-9fd58ec6182c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Town Residential Single-Phase Sector: Residential Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>


Di?partment o  

Office of Legacy Management (LM)

,Di?partment o f E n e r g y ' ' ' : . ' ~' Washington, DC 20585 ., .* -,, : ', ," FEE 17.,1995' , :' ' , ,,- ',/ 'he Honorable Larry.Guidt ' ' : X 1455 W., 126th Street lawthorne; California 90250 1 _. _ tear.Mayor Guidi: ; ..,, _ ietretary of Energy Hazel O'Leary,has announced a new approach to openness.in :he Department .of Energy (DOE) and its communications wifh,the public: In ; - upport of thts initiative, we are ,p;T.eased to forward the enclosed,,information .,~ -elated to the former Northrop Corp. site 'in your jurisdiction that performed rork for'DOE',s predecessor agencies. This information is prov:ided for,your nformation, use, and retention. lOE% Formerly Utilized SitesRemedial Action Program (FUSRAP) is responsible 'oridentification of sites, used.by DOE's .predecessor agencies, determining :


Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

7, 2008 7, 2008 Subscribe | Contact Fermilab Today | Archive | Classifieds Search GO Furlough Information Reminder: An IDES representative will conduct the final on-site group meetings at 11 a.m. and noon in the Wilson Hall One West conference room on Friday, March 28. New furlough information, including an up-to-date Q&A section, appears on the furlough Web pages daily. Layoff Information New information on Fermilab layoffs, including an up-to-date Q&A section, appears on the layoff Web pages daily. Calendar Thursday, March 27 10 a.m. Presentations to the Physics Advisory Committee - Curia II 1 p.m. Physics and Detector Seminar - West Wing, WH10NW Speaker: G. Mavromanolakis, University of Cambridge Title: CALICE Update THERE WILL BE NO THEORETICAL PHYSICS SEMINAR THIS WEEK


Nanobio Interfaces: From Materials Design to Complex Systems  

NLE Websites -- All DOE Office Websites (Extended Search)

CNM Workshop 7: NanoBio Interfaces: From Materials Design to Complex Systems CNM Workshop 7: NanoBio Interfaces: From Materials Design to Complex Systems Organizers: C hristopher F ry ( CNM) a nd E lena R ozhkova ( CNM) Nature possesses the ability to design highly functioning, regenerative materials that cover every imaginable process and physical characteristic desired in modern materials. Energy production and storage, mechanics, and catalysis are but a few of these processes that nature handles well. This workshop i dentified m any o verlapping t hemes a t t he N anoBio i nterface t hat c ontinue t o p roduce a w ide spectrum of materials attributing their functional inspiration from nature. The eight invited speakers highlighted their current research regarding the biological systems they use or have been inspired by in producing new

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


VIA EMAIL Ms. Mariah Steele ENERQY STAR Program· U.S. Environmental Protection Agency  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENERQY STAR Program· ENERQY STAR Program· U.S. Environmental Protection Agency 1200 Pennsylvania Avenue, NW Room62023 · Washington, DC 20460 Dear Ms. Steele: May 10, 2013 · The _D.S. Department of Energy ("DOE") selected a Kenmore-brand dehumidifier, mpde] 90701:, for testing as part ofDOE's ENERGY STAR® Verification Testing Program. On March 18, · 2013, DOE notified the manufacturer of this model, , that the model did not meet the minimum energy factor required for a model of its capacity according to the applicable. ENERGY STAR specification. . .. 11111 replied to,' and later spoke with, DOE representatives abqut DOE's results. - also . provided test d~t_a from previous testing of this model; the test da~a prov_ided.documented a higher energy factor than that observed in the DOE testing. -


Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

28, 2008 28, 2008 Subscribe | Contact Fermilab Today | Archive | Classifieds Search GO Furlough Information Reminder: An IDES representative will conduct small group meetings every 30 minutes in the Wilson Hall Atrium Dining Room (SW corner) each Friday from 11 a.m. to 1:30 p.m. from tomorrow through the end of March. New furlough information, including an up-to-date Q&A section, appears on the furlough Web pages daily. Calendar Thursday, Feb. 28 THERE WILL BE NO PHYSICS AND DETECTOR SEMINAR THIS WEEK 2 p.m. Computing Techniques Seminar - FCC1 Speaker: S. Timm, Fermilab Title: FermiGrid Virtualization and Xen 2:30 p.m. Theoretical Physics Seminar - Curia II Speaker: Y. Bai, Fermilab Title: Minimal Little Higgs Model and Dark Matter 3:30 p.m. DIRECTOR'S COFFEE BREAK - 2nd Flr X-Over



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CORPORATION, FOR AN ADVANCED CORPORATION, FOR AN ADVANCED WAIVER OF DOMESTIC AND FOREIGN PATENT RIGHTS UNDER COOPERATIVE AGREEMENT NO. IDE-FC02-00CH11060; W(A)-00-037; CH-1051 The Petitioner, United Technologies Corporation (hereinafter "United Technologies"), has requested a waiver of domestic and foreign patent rights for all subject inventions arising from its participation under the above referenced cooperative agreement entitled "Cooperative Research and Development for Advanced Microturbine Systems." This cooperative agreement pertains to a program to identify, develop and demonstrate new technologies that will substantially increase the performance and reduce the cost and emissions of microturbines for electric power generation. The specific objective of this cooperative agreement is to meet or exceed U.S.


All Other Edi~ims Arc Obolete United States Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

9-0s) 9-0s) All Other Edi~ims Arc Obolete United States Department of Energy E n e r g Finance and account in^ Sen'ice Center Travel Authorization and Program Manager Signature Card Name: Date: Position Title: Routing Symbol: BuiIding: Phone: Reporting EntityFund Code: Signature: Typcs of Documents Authorized (please check box) Approved Funding Program Change Request Procurement Authorization (PRs, direct chargebacks. etc.) Claim for Reimbursement for Espenditwre on Official Business (Local Travel) Travel Authorizations and Nodi fications Travel Vouchers Training Authorizations Training Invoice Payments Invoice Payment Approval Travel Authorizations and Modifications (actual expenses) Other (speci fyS - I certifL to the signature and authority of the above individual for the document noted.


Synthesis and Analysis of TiO2-Oligonucleotide Hybrid Nanoparticles  

NLE Websites -- All DOE Office Websites (Extended Search)

Synthesis and Analysis of TiO2-Oligonucleotide Hybrid Nanoparticles Synthesis and Analysis of TiO2-Oligonucleotide Hybrid Nanoparticles New developments in nanotechnology offer the creation of chemical-biological hybrid nanocomposites, which can be introduced into cells to initiate intracellular processes or biochemical reactions. Researchers from Northwestern University Medical Center (Chicago, IL) and Argonne National Laboratory synthesized TiO2-oligonucleotide nanocomposites made of DNA oligonucleotides attached to 45-Å TiO2 nanoparticles and tested them by using the 2-ID-E x-ray beamline at the X-ray Operations and Research sector 2 of the APS. A key benefit of nanocomposites is that they could advance medical biotechnology and open new doors in chemistry and materials sciences. Scan of a 21 x 21-m area with a single nucleus containing 3.6 x 106 nanoparticles.


Delaware State University | .EDUconnections  

Office of Scientific and Technical Information (OSTI)

Delaware State University Delaware State University Research Office of the Associate Provost for Research General Research Capability Center for Integrated Biological & Environmental Research Experimental Program to Stimulate Competitive Research Delaware IDeA Network of Biomedical Research Excellence Faculty Research DSU Leads the Way in Better Buildings DSU is one of the first university partners in the US to join the Department of Energy's Better Buildings inititative to reduce its carbon footprint by 25% by 2015. Secretary of Energy Chu participated in the DSU kick-off program to commemorate the school's efforts in July 2012. Read more about this showcase project. Search this site: Search Prestigious research projects underway by Delaware State University (DSU) serve to enhance DSU's land-grant mission and its contributions to the


Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

6, 2008 6, 2008 Subscribe | Contact Fermilab Today | Archive | Classifieds Search GO Furlough Information Reminder: An IDES representative will conduct small group meetings every 30 minutes in the Wilson Hall Atrium Dining Room (SW corner) each Friday from 11 a.m. to 1:30 p.m. from tomorrow through the end of March. New furlough information, including an up-to-date Q&A section, appears on the furlough Web pages daily. Layoff Information New information on Fermilab layoffs, including an up-to-date Q&A section, appears on the layoff Web pages daily. Calendar Thursday, March 6 12 p.m. Grid School Brown Bag Seminar - Curia II Speaker: K. Chadwick, Fermilab Title: FermiGrid 101 - FermiGrid Introduction and Overview THERE WILL BE NO PHYSICS AND DETECTOR SEMINAR THIS WEEK


Introduction Sitewide Categorical Exclusion for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7 SWCX for Disconnection of Utilities- 7 SWCX for Disconnection of Utilities- Revision 0 Introduction Sitewide Categorical Exclusion for Disconnection of Utilities As defined in the U.S. Department of Energy's (DOE) Richland Operations Office Integrated Management System Procedure, NEPA Analysis at Harford, a sitewide categorical exclusion is: An application of DOE categorical exclusions described in 10 CFR 1021, Appendices A and B, which may apply to Hanford Site proposed actions (activities) that are "sitewide" in nature and extent, which the cognizant DOE Hanford NCO has determined fit within the scope (i.e., same nature and intent, and of the same or lesser scope) of DOE categorical exclusions described in 10 CFR 1021 P.1..ppendices A and B. The cognizant DOE Hanford NCO may issue specific sitev1ide


Roadmap to Secure Control Systems in the Energy Sector  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Roadmap Roadmap to Secure Control Systems in the Energy Sector -  - Foreword T his document, the Roadmap to Secure Control Systems in the Energy Sector, outlines a coherent plan for improing cyber security in the energy sector. It is the result of an unprecedented collaboration between the energy sector and goernment to identify concrete steps to secure control systems used in the electricity, oil, and natural gas sectors oer the next ten years. The Roadmap proides a strategic framework for guiding industry and goernment efforts based on a clear ision supported by goals and time-based milestones. It addresses the energy sector's most urgent challenges as well as longer-term needs and practices. A distinctie feature of this collaboratie effort is the actie inolement and leadership of energy asset


Lamp Divisions  

Office of Legacy Management (LM)

--- --- /A;; i :' r%i;in~house ilEc;' i:Z3:~cra:ion Lamp Divisions , _.. (I +i. 0 :,,,rg. . I . . -= i?e p/q! qe)-' &se pw E.rcale?l iev, Je!sey 07m March 20, 1 gs? ::r . J. A. Jones I ti. 5. Muclear Regulatory Commission .> = ..- haterials Licensing Branch -s - ,.I, - - Division of Fuel Cycle and hateri al Safety LY. , $2 - _ . ' -' . 3 _- - Yeshington, C. C. 2@555 - :_ :--, =-- -- .-?J -.: y...., : :- 7 Dear Mr. Jones : y-- --, ? . *I 2=15 2 r; X -P The following is our final report of the decontamination efZor?s takz in our Bui Iding 7 basement and wi 11 also serve to update our report i& November 12, 1980. As stated in NRC' s report of December 22, 1983, two closeout inspect ions were conducted by your King of Prussia off i ce on November 21 and December 2,


PAD, a computer-aided molecular model building system utilizing two-dimensional graphical input  

E-Print Network (OSTI)

(IP)= (TX-1000) "32+1 P (IP+1) = (IY-1000) + 2+2 P (IP+2) =7 TF( ICIJT. EQ. 1. 0R. QBREAK)P (IP+2) ="17 P( P+ )="014 P (I P+4 ) = "?nn00 TP=IF+2 QBREAK=. FALSE. GO TO 100 IDE 1!TIF TC A TTOI'I NCDULE CALL CIC( "2400, 6) Pc J UW '7'7 45 101..., GT. 9)GC TO 1166 A )QCHEY=. TPUE. FLAG CHECK IF(QPEN. AND. B(1 1) . EQ. F1)G TC 1055 IF(QPEN. A", ID. B( 1 1 ) . FQ. FC)QPEN=. FAL. E. IF( B(11 ) . EC. F1)G TC' 1051 IF( X. GE. 1 "2 . OR. IY. GE. 1025)GO TO 1C14 IF(IX. LE. 1JO. CR. IY. LE. 100)GO...

White, William Gerald



Net energy for production of feed mixtures containing various levels of cottonseed hulls and coastal bermudagrass hay  

E-Print Network (OSTI)

!'er 16&]966) I3zeT(s'1! 2d I' f. lect r I !, cve1 o Cotto'i. ee ' Hu]! I r v!1s on Dai ly Yr'crl In I ai:u (d!i . 13 t o 0c tone 10 & 19r&6) Br. e&r le, Te;ras ?5 fir:eac ariel Cl aclraLic Ile irr . sion for id!e Ef tc;!ts of travel of li &ur&hage re...!ci sc o&1s 'or tji. 6 f -;!! s of (oas! r!I Be& ai!d; . ass Bay I rvel or! Inc. gy 6 . i! Cos Treat&!, ent Gi oiips (du e 13 ? Ceto! er . ' 6. 1966 ? Ber v' i Le) . B5 IC! I&i!se!r e&nr! Clued&cetic Renre. , sions fo" tlie Eff acts of Cot& t...

Mark, William Howard



Short time proton dynamics in bulk ice and in porous anode solid oxide fuel cell materials  

SciTech Connect

Oxygen reduction and incorporation into solid electrolytes and the reverse reaction of oxygen evolution play a cru-cial role in Solid Oxide Fuel Cell (SOFC) applications. However a detailed un derstanding of the kinetics of the cor-responding reactions, i.e. on reaction mechanisms, rate limiting steps, reaction paths, electrocatalytic role of materials, is still missing. These include a thorough characterization of the binding potentials experienced by protons in the lattice. We report results of Inelastic Neutron Scattering (INS) measurements of the vibrational state of the protons in Ni- YSZ highly porous composites (75% to 90% ), a ceramic-metal material showing a high electrical conductivity and ther mal stability, which is known to be most effectively used as anodes for solid ox ide fuel cells. The results are compared with INS and Deep Inelastic Neutron Scattering (DINS) experiments on the proton binding states in bulk ice.

Basoli, Francesco [Universit degli Studi di Roma Tor Vergata, Italy] [Universit degli Studi di Roma Tor Vergata, Italy; Senesi, Roberto [ORNL] [ORNL; Kolesnikov, Alexander I [ORNL] [ORNL; Licoccia, Silvia [NAST Center, University of Roma "Tor Vergata"] [NAST Center, University of Roma "Tor Vergata"



Multi-dimensional Exploration of API Usage  

E-Print Network (OSTI)

AbstractThis paper is concerned with understanding API usage in a systematic, explorative manner for the benefit of both API developers and API users. There exist complementary, less explorative methods, e.g., based on code search, code completion, or API documentation. In contrast, our approach is highly interactive and can be seen as an extension of what IDEs readily provide today. Exploration is based on multiple dimensions: i) the hierarchically organized scopes of projects and APIs; ii) metrics of API usage (e.g., number of project classes extending API classes); iii) metadata for APIs; iv) project- versus API-centric views. We also provide the QUAATLAS corpus of Java projects which enhances the existing QUALITAS corpus to enable APIusage analysis. We implemented the exploration approach in an

Coen De Roover; Ralf Lmmel; Ekaterina Pek


Two?photon dissociation of vibrationally excited HD+: The inhomogeneous differential equation approach  

E-Print Network (OSTI)

Dalgamo and Lewis,6 we write S2(kj /J,v j jj) = (,6kh(1su) I,uTlx~,i), (21) and S3(kj /J,v j j;) = (,6kh(2pu) I~D Ix~,i), where (22) (,6Vj (2pu) I~T l(,6v) (Isu X(T)(R) - '" ' , . A.. (2:pu) v,j, - ~ EVj (2pu) - Ev,j, (Isu) _ fIm '{'vj (23...( )(R) - '" ' , . A.. (1su) v,j, - ~ EVj (Isu) - Evd, (Isu) _ fIm '('vj , (25) so that SI(kj/J,v j j;) = (,6kh(1su)I,uDlx~~:(R and S4(kj/J,vj j;) = (,6kjf(2pu)I,uTlx~~:(R, where X~~: (R) satisfies the IDE: {~_ j(j+ I) dR 2 R2 + 2: [EVd, + f...

Chu, Shih-I; Laughlin, Cecil; Datta, Krishna K.



U.S. Department of Energy Categorical Exclusion Detennination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

~ ~ U.S. Department of Energy Categorical Exclusion Detennination Form ®~ .. * > * , Program of Field Office: Sandia Site Office Project Title- I'cnclrator Testing wilh Mobile Gas Guns and Mobile Davis Guns (E MRTC and WSMR) Location ' Socorro, NM Proposed Action or Project Description' Ame rican Recoyery and Reinyestment Act: r SandiD National Laboratories/New Mexico (SN IJNM) proposes to pro~ide pcnclralor testing suppon using SNIJNM mobile gas guns and mobile Davis guns alike Energetic Materials Research and Testing Center (EMRTC) and White Sands Missile Range (WSMR). These guns include a 6-inch (in.) bore pressurized gas gun (air or helium for propulsion, nitrogen for valve operation); 8-il'l., 12-io., and 16·;n,·OOre Davis guns: and l&.in,·


Tucson, AZ  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0 0 Tucson, AZ New coal technologies could lower utility costs By Richaed T. Newesnb lee uf( Engineerlng, and the national posslblity orst lest doubllng the with Its reactor safty and wast dis tility deregulallun hls laborstorlee, such as Los Alasn, net efficiency of cool-bMed power towal problemas. ralied public concerns conlinr the easiteoce of Innovative generetion while at the ame time The mpUctlons In all ofthis for bhout meneng the demunds solutlon in the form of low- and producing a ream of carbon dior- Arlaoes are tignlfcant. Our state for electricity t remaonable cot In zero emlsslon dclan coal (ZEC) tch- Ide that can be aely and poertu has both a wU-elenblhd coal growing states such Arizona with- nolngle. nently sequestered urndrgrouwmL ndustry and a reputatlon for clean


Grad student is officially a GEMS  

NLE Websites -- All DOE Office Websites (Extended Search)

NIU physicist Susan Mini lands NSF grant for APS beamline upgrades NIU physicist Susan Mini lands NSF grant for APS beamline upgrades Argonne's Campuzano Honored by Hispanic Engineering Bugs in the News An R&D-100 Award for a New Mammography System Putnam recognized for outstanding service APS News Archives: 2012 | 2011 | 2010 | 2009 2008 | 2007 | 2006 | 2005 2004 | 2003 | 2002 | 2001 2000 Subscribe to APS News rss feed Grad student is officially a GEMS OCTOBER 18, 2007 Bookmark and Share Tao Sun (Northwestern University) in the X-ray Operations and Research beamline 8-ID-E enclosure Tao Sun, a third-year graduate student from Professor Dravid Vinayak's group at Northwestern University who is currently doing his thesis research at the Advanced Photon Source at the U.S. Department of Energy's Argonne National Laboratory, has been awarded one of three Graduate Excellence in


Photon Sciences Worksheet 09-01 HX Microprobe HX Microprobe  

NLE Websites -- All DOE Office Websites (Extended Search)

9-01 HX Microprobe 9-01 HX Microprobe HX Microprobe Resources Available - BE Mid 2012 Mid 2014 Mid 2016 Beamline X-ray Source Total Total Total NSLS 2 2 0 X26A Bend 1 1 0 X27A Bend 1 1 0 APS 3.05 3.95 3.95 2-ID-D Undulator 0.5 0.5 0.5 2-ID-E Undulator 1 1 1 8-BM-B Bend 0.5 1 1 10-ID-B Undulator 0 0 13-ID-E Undulator 0.3 0.5 0.5 18-ID-D Undulator 0 0 0 20-ID-B a Undulator 0.25 0.25 0.25 20-BM-B a Bend 0 0 0 21-ID-D g Undulator 0 0.2 0.2 26-ID-C f Undulator 0.5 0.5 0.5 ALS 0.2 0 0 10.3.1 Bend 0.2 0 0 10.3.2 b Bend 0 0 0 SSRL 1 1 2 BL2-3 Bend 1 1 1 BL2-2 e Bend 0 0 1 NSLS-II 0 0 3 SRX c Undulator 0 0 1 HXN c Undulator 0 0 1 XFM 3P Wiggler 0 0 1 Total 6.25 6.95 8.95 XRF only XRF, XAFS XRF, XAFS, XRD or XRF, XRD, FCMT XRF, XAFS, XRD, FCMT Boldface = oversubscribed Footnotes: b = Assumes termination of 10.3.2 microprobe studies c = Commissioning in 2014 e= Proposed retrofitting of current white light beamline



NLE Websites -- All DOE Office Websites (Extended Search)

G - COMPRESSED NATURAL GAS SYSTEM OPERATIONS G - COMPRESSED NATURAL GAS SYSTEM OPERATIONS Rev. 0, July 9, 2001 G.1 NORMAL STARTUP To conduct normal startup, proceed as follows: 1. Open the supply from Southwest Gas (V-101) and activate AOV-102. a. Open one filter (V-105/V-108 or V-109/V-112), with the other filter line closed and filter drains closed. b. Verify that the SWG supply pressure is 30 psi (PI 104 and PI 118). c. Verify that the blowdown filter is set to drain. 2. Open the by-pass supply to Gemini V-119 and V-18. 3. Gemini discharge valve configuration: a. Open V-19, -20, -20A. b. Valve into operation one set of coalescening filters: Open V-21 and V-22 and Close V-23 and V-24 Or Close V-21 and V-22 and Open V-23 and V-24. 4. Open V-25 at fill and dispenser cabinet 1. 5. Optional the booster blower or Hy-Bon compressor:

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Data:7b859fcd-47b5-4102-ab05-3fe1364c5be5 | Open Energy Information  

Open Energy Info (EERE)

fcd-47b5-4102-ab05-3fe1364c5be5 fcd-47b5-4102-ab05-3fe1364c5be5 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Large Farm, Single-Phase Sector: Residential Description: * Applicable to large farm and rural residential 37.5 to 100kva. Additional transformer fee 37.5 kva $2.75/month. Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage


SWERA borrador051110  

Open Energy Info (EERE)

informe nacional informe nacional GEF MEM DGE Preparado por: Ing. Norbert Bons Borrador 14-11-05 SWERA borrador 14-11-2005 1 2 MEM DGE - Fundación Solar Contenido Prefacio 5 Resumen ejecutivo 6 Introducción 7 Datos socioeconómicos 7 Geografía y clima de Guatemala 7 Las energías renovables en Guatemala 9 La situación energética del país 13 Balance de energía de Guatemala 13 Marco institucional del sub-sector eléctrico 14 Ministerio de Energía y Minas 14 Comisión Nacional de Energía 15 Administrador del Mercado Mayorista 15 Autoridad designada para los créditos de carbono 16 Marco regulatorio del sub-sector eléctrico 16 Ley general de electricidad 17 Ley de incentivos para el desarrollo de proyectos de energía renovable 17 Sistema eléctrico 17 Generación 17 Transporte 18 Distribución 19 Mercado eléctrico


Data:776691a8-8f15-4a1d-8750-9fc4b3d9132c | Open Energy Information  

Open Energy Info (EERE)

91a8-8f15-4a1d-8750-9fc4b3d9132c 91a8-8f15-4a1d-8750-9fc4b3d9132c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Off Season Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous


Data:02c3db94-dc82-47c7-8f9d-d4c57e9fc8ae | Open Energy Information  

Open Energy Info (EERE)

4-dc82-47c7-8f9d-d4c57e9fc8ae 4-dc82-47c7-8f9d-d4c57e9fc8ae No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Large Load Voluntary Load Control Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>


Shane Canon, David Skinner and Jay Srinivasan! NUG2013  

NLE Websites -- All DOE Office Websites (Extended Search)

Canon, David Skinner and Canon, David Skinner and Jay Srinivasan! NUG2013 NERSC and HTC --- 1 --- February 1 2, 2 013 Science Strategies @ NERSC Science at Scale P etascale t o E xascale Science through Volume Thousands t o M illions o f S imula6ons Science in Data Petabytes t o Exabytes 2 3 Materials (Genome) Project * Need to gather slides 4 5 Common T hemes * Throughput O riented / E mbarrassingly p arallel * Rapidly I ncreasing d emand f or c omputaBon (outpacing M oore's L aw) * OIen D ata I ntensive * Scaling f rom d esktop o r m id---range s ystems t o HPC c lass s ystems Approaches * Throughput Q ueues * Private/User A llocaFon - Task F armer ( NERSC D eveloped o r C ray P rovided) - MyHadoop - MySGE * Shared - CCM/Torque * Hybrid? - High---Throughput Q ueue S ystems 6 Throughput Queues * Serial Q ueue o n C


Data:F56db83d-b034-41af-a4da-a91d395f7fdf | Open Energy Information  

Open Energy Info (EERE)

db83d-b034-41af-a4da-a91d395f7fdf db83d-b034-41af-a4da-a91d395f7fdf No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Interruptible Sector: Commercial Description: * Coincident demand is $ 17.80. Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous


Preliminary consideration of selected chemical and oceanographic factors influential in the formation of the alumino-silicate fraction of some recent sediments  

E-Print Network (OSTI)


Whitehouse, Ulysses Grant



Acoustic Telemetry Studies of Juvenile Chinook Salmon Survival at the Lower Columbia Projects in 2006  

SciTech Connect

The Portland District of the U.S. Army Corps of Engineers contracted with the Pacific Northwest National Laboratory (PNNL) to conduct three studies using acoustic telemetry to estimate detection probabilities and survival of juvenile Chinook salmon at three hydropower projects on the lower Columbia River. The primary goals were to estimate detection and survival probabilities based on sampling with JSATS equipment, assess the feasibility of using JSATS for survival studies, and estimate sample sizes needed to obtain a desired level of precision in future studies. The 2006 JSATS arrays usually performed as well or better than radio telemetry arrays in the JDA and TDA tailwaters, and underperformed radio arrays in the BON tailwater, particularly in spring. Most of the probabilities of detection on at least one of all arrays in a tailwater exceeded 80% for each method, which was sufficient to provide confidence in survival estimates. The probability of detection on one of three arrays includes survival and detection probabilities because fish may die or pass all three arrays undetected but alive.

Ploskey, Gene R.; Weiland, Mark A.; Hughes, James S.; Zimmerman, Shon A.; Durham, Robin E.; Fischer, Eric S.; Kim, Jina; Townsend, Richard L.; Skalski, John R.; McComas, Roy L.



Data:43b429eb-2d1c-4b3f-91e7-f5a71dda9dae | Open Energy Information  

Open Energy Info (EERE)

9eb-2d1c-4b3f-91e7-f5a71dda9dae 9eb-2d1c-4b3f-91e7-f5a71dda9dae No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Small Commercial, Single-Phase Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>


WSU report12  

NLE Websites -- All DOE Office Websites (Extended Search)

Wayne Wayne S tate U niversity, 7 th y ear i n Q uarkNet Mentors: P rofs. Robert H arr a nd P aul K archin In 2 012, t he W SU QuarkNet center ran a Masterclass, a nd a s ummer r esearch program. T he M asterclass w as h eld on Saturday, March 1 0, a nd h ad 3 t eachers a nd about 2 0 s tudents i n a ttendance. T he students received an introduction to particle physics a nd a nalyzed C MS d ata. T he d ay w as c apped o ff w ith a v ideoconference where t heir r esults w ere d iscussed. The H igh S chool S tudent S ummer R esearch P rogram r an o ver 6 w eeks f rom J une 2 2 to A ugust 1 0, 2 012. T he p rogram w as o rganized a s 3 s essions, e ach w ith 4 s tudents and l asting f or 2 w eeks. T his e nables u s t o s elect 1 2 s tudents f rom a w ide r ange o f backgrounds f or t he p rogram. W e h ad a bout 8 0 a pplicants f or t hese 1 2 p ositions,



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

C01 SIDER.!;.TIONS C01 SIDER.!;.TIONS RE Q UE ST BY INVENTOR FOR THE WAIVER OF DOMESTIC AN D FOREIGN RTGHTS TO AN IDE. TIFIED [NVEN'fl0'\1 ENTiTLED "RESONANT-CAVITY APPA.RATUS FOR CYTOM.GTRY OR PARTICLE ANA L'YS iS'' US P 5,793,485, DEVELOPI·:D UNDER DOE CONTRACT NO. DE-AC04-94AL85000; DOE r:\"VENTfON DISCLOSU RE NO. S-85,819 (SD-5797 ); DOE WAIV ER NO. V.l ( ) 201 l-oo_,; rv3 The Petitioner, Paul L. Gourley (Inventor), has requested a \\'aive of the Government's domestic and fo eign patent rights in a subject invention entitled "Resonant-Cavi ty Apparatus for Cytome ry or Particle Analy·sis." The invention v,·as conceived by the inventor while an employee of the Sandia Corporation (Sandia). ,'andia is the M&O contractor for the Sandia a ional Laboratories (S L), a government-0\vned, contracto


DOE Commercial Building Energy Asset Score: Software Development for Phase II Building Types  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

To estim assumpt to unders tables pr These ta but a bui even by s the Asse year, dep in the ap To get an tables. F Operat Schedu School Office Retail Warehou Hotel Apartme Courthou Library 1 Operatio Standard 9 are added be modifie 2 Closing ti purposes. DOE C Softwar Oper ate a buildin ions concern stand how w rovide a simp bles reflect t lding's level season in ca et Scoring To pending on e pendix at the n overall ide or a more gr tional As ules of Op Occu Sche (hrs 41 48 46 use 1 nt 1 use 4 4 nal assumption 90.1 Prototype to the Asset Sc ed to better ref mes reflect tho Commer re Devel rational a ng's energy u ning how the well these as plified list of the full-time of operation ases such as ool applies a each building e end of this a of the ass ranular unde sumption peration upancy



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

St St at ement of Co nside ration s RE QU EST BY MOSSE Y CREE K ENERGY FOR DO MESTIC A ND FOREI GN RIGHTS IN SU BJECT INVENTIONS S-124, 118 AND S- 124,156 M ADE IN THE CO URS E OF OR U ND ER UT-BATTELLE PRIME CONTRACT NO . DE-AC05 -000 R227 2 5; DO E WAIVER DOCKETS: W (l ) 2011-009 AND W(l) 2011-010 {COMBIN ED) Mossey Creek Energy (Pet itioner) has m ade a tim ely req uest for a waiver t o wo rldw ide undivided rights in two subject invent ions (th e subject inve ntio ns) made in the cou rs e of or und er UT-Battel le, Prime Contract No . DE-AC05-000R22725 . The fir st invention ( S-12 4,118) is entitled, "Therma lly Conducti ve Electri cally Insulati ng Sil icon Cont ain ing Ep oxy Mo ld ing Compound.'' The secon d invention (S-124, 156) is "Si nt ered Po lycrystalline Sili con Base d Ther rn oe lectric


Douglas Jacobsen! NERSC User Services Group  

NLE Websites -- All DOE Office Websites (Extended Search)

Services Group Services Group Using Modules at NERSC --- 1 --- September 10, 2013 NERSC Supported Software * NERSC p rovides a w ide r ange o f s cien=fic a nd c omputer programming s o@ware t o u sers - Scien)fic A pplica)ons: V ASP, A mber, N AMD, ABySS, ... - Compilers: p gi, i ntel, g cc, c ray - Scrip)ng L anguages: perl, p ython, R * and p ackages f or e ach! - SoIware L ibraries: b las/lapack ( MKL), b oost, h df5, n etcdf, ... - U)li)es: gnuplot, g it, m ercurial, 7 zip, c make, . .. - Debuggers & P rofilers: C rayPat, D DT, TotalView, g db, M AP, darshan - Visualiza)on: V isit, P araView, V MD, ... * See complete list: - hVp://www.nersc.gov/users/soIware/ --- 2 --- Software is Managed by Modules * NERSC p rovides m any v ersions o f m any s o@ware packages - To s upport d iverse w orkload o n s ystems * Maintaining


Sector 7  

NLE Websites -- All DOE Office Websites (Extended Search)

Overview and History Overview and History Sector 7 consists of two APS beamlines: 7-ID: an insertion device beamline based on an APS Type-A Undulator 7-BM: a bend magnet beam line for time-resolved radiography (currently being commissioned) Overview of 7-ID 7-ID comprises four large experimental enclosures designated A, B, C, and D. In 2004, a laser enclosure was also added (7ID-E). Enclosure 7-ID-A is the first optics enclosure and houses a polished Be window, an empty x-ray filter unit, a pair of white beam slits, a water-cooled double crystal diamond monochromator (Kohzu HLD4), and a P4 mode shutter. The beamline vertical offset is 35 mm. Enclosure 7-ID-B is a white-, or monochromatic-beam experimental enclosure. It is equipped with two precision motorized table for alignment and positioning of experimental equipment. This station is used for white-beam imaging or microdiffraction experiments.



NLE Websites -- All DOE Office Websites (Extended Search)

I mpact o n Developing C ountries 2012 INTERNATIONAL OPEN G OVERNMENT D ATA CONFERENCE Moderator: F ernando P erini, I DRC(Canada ) Jose M . A lonso, W orld W ide W eb F oundaCon Tim D avies, P racCcal P arCcipaCon; ( U.K.) Bjorn---Soren G igler, W orld B ank I nsCtute ( World B ank) Dorothy G ordon, K ofi A nnan C enter o f E xcellency i n I CT ( Ghana) William T evie, N aConal I nformaCon T echnology A gency ( Ghana) Organized b y t he W orld B ank a nd D ata.gov 2012 INTERNATIONAL O PEN G OVERNMENT D ATA C ONFERENCE Exploring t he I mpacts O f Open D ata i n t he S outh "EXPLORING T HE E MERGING I MPACTS O F O PEN D ATA I N T HE SOUTH" Call f or C oncept N otes --- O pen u nCl 1 0 September 2 012 * InsCtuCons i n d eveloping c ountries ( UniversiCes, N GOs, t hink--- tanks) * Research g rants b etween U SD25k


FRPC User Guidance -for FY2006  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

10 GUIDANCE FOR 10 GUIDANCE FOR REAL PROPERTY INVENTORY REPORTING I S S U E D A T E : O C T O B E R 2 5 , 2 0 1 0 GS A Office of Governmentw ide Policy F E D E R A L R E A L P R O P E R T Y C O U N C I L Federal Real Property Council Real Property Inventory - User Guidance for FY 2010 Reporting October 25, 2010 Page 2 T a b l e o f C o n t e n t s A . B A C K G R O U N D : E X E C U T I V E O R D E R 1 3 3 2 7 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 B . F R P C I N V E N T O R Y D A T A E L E M E N T S & D E S C R I P T I O N S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 1. Real Property Type ...................................................................................................................................................................... 5 2. Real Property Use ........................................................................................................................................................................ 5



NLE Websites -- All DOE Office Websites (Extended Search)

March March 1 9, 2 013 NERSC Overview --- 2 --- NERSC History 1974 Founded a t L ivermore t o s upport f usion research w ith a C DC s ystem 1978 Cray 1 i nstalled 1983 Expanded t o s upport t oday's D OE O ffice of S cience 1986 ESnet e stablished a t N ERSC 1994 Cray T 3D M PP t estbed 1994 --- 2000 TransiOoned u sers f rom v ector processing t o M PP 1996 Moved t o B erkeley L ab 1996 PDSF d ata i ntensive c ompuOng s ystem for n uclear a nd h igh e nergy p hysics 1999 HPSS b ecomes m ass s torage p laTorm 2006 Facility w ide filesystem 2010 CollaboraOon w ith J GI --- 3 --- Cray 1 --- 1 978 Cray 2 - 1 985 Cray T 3E M curie --- 1 996 IBM P ower3 S eaborg --- 2 001 NERSC collaborates with computer companies to deploy advanced HPC and data resources --- 4 --- We e mploy e xperts i n h igh p erformance c ompu


400A Construction Schedule | Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

27-ID and 35-ID 27-ID and 35-ID Past 27-ID and 35-ID Long Range Schedule (pdf) 27-ID and 35-ID Past Construction Past 27-ID and 35-ID Construction Day Activity Impact Week of 06.11.13 35-ID-D panels arrive, 35-ID-C panel installation complete. Start installation of 35-ID-D. -/- Week of 06.13.13 DCS/RIXS Construction Progress Meeting, LOM 438-C010, 9AM -/- Week of 06.18.13 27-ID-A panels arrive -/- Week of 06.25.13 first shipment of 35-ID-E panels arrives -/- Week of 06.03.13 continue installation of 35-ID-C panels, doors, roof and floor trim Low Week of 05.20.13 35-ID-C panels arrive begin installation of 35-ID-C wall and roof panels Low Week of 05.13.13 completion of 35-ID-B roof panels, installation of lead trim, steel capping and door installation. Low Tuesday - 03.05.13


NERSC Schedule.xlsx  

NLE Websites -- All DOE Office Websites (Extended Search)

:00---9:30 :00---9:30 Registration a nd l aptop s et---up 9:30---9:45 Introductions 9:45---10:45 Chapter 1 . W hy o bject---oriented p rogramming ( OOP)? 10:45---11:00 Break 11:00---11:30 Example: F ireworks s imulation v ia p rocedural p rogramming 11:30---12:00 Section 2 .1 N omenclature, S ection 2 .2 O bject---Oriented A nalysis a nd D esign 12:00---1:00 Lunch B reak 1:00---1:30 Section 2 .3 E ncapsulation a nd I nformation H iding , S ection 2 .4 W rapping L egacy S oftware 1:30---2:00 Section 2 .5 C omposition, A ggregation a nd I nheritance, S ection 2 .6 S tatic a nd D ynamic P olymorphism 2:00---2:30 Student E xercise 2 .1. F ireworks s imulation v ia O OP. 2:30---2:45 Break 2:45---3:15 Student E xercise 2 .2. C olored f ireworks v ia i nheritance. 3:15---3:45 Student E xercise 2 .3. M ulticolored f ireworks v ia c omposition. 3:15---3:45

Note: This page contains sample records for the topic "bon diox ide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Caliste 64, a new CdTe micro-camera for hard X-ray spectro-imaging  

Science Journals Connector (OSTI)

In the frame of the Simbol-X mission of hard X-ray astrophysics, a prototype of micro-camera with 64 pixels called Caliste 64 has been designed and several samples have been tested. The device integrates ultra-low-noise IDeF-X V1.1 \\{ASICs\\} from CEA and a 1cm2 Al Schottky CdTe detector from Acrorad because of its high uniformity and spectroscopic performance. The process of hybridization, mastered by the 3D Plus company, respects space applications standards. The camera is a spectro-imager with time-tagging capability. Each photon interacting in the semiconductor is tagged with a time, a position and an energy. Time resolution is better than 100ns rms for energy deposits greater than 20keV, taking into account electronic noise and technological dispersal of the front-end electronics. The spectrum summed across the 64 pixels results in an energy resolution of 664eV fwhm at 13.94keV and 842eV fwhm at 59.54keV, when the detector is cooled down to ?10C and biased at ?500V.

A. Meuris; O. Limousin; F. Lugiez; O. Gevin; C. Blondel; F. Pinsard; M.C. Vassal; F. Soufflet; I. Le Mer



2013 R&D 100 Award: Movie-mode electron microscope captures nanoscale  

ScienceCinema (OSTI)

A new instrument developed by LLNL scientists and engineers, the Movie Mode Dynamic Transmission Electron Microscope (MM-DTEM), captures billionth-of-a-meter-scale images with frame rates more than 100,000 times faster than those of conventional techniques. The work was done in collaboration with a Pleasanton-based company, Integrated Dynamic Electron Solutions (IDES) Inc. Using this revolutionary imaging technique, a range of fundamental and technologically important material and biological processes can be captured in action, in complete billionth-of-a-meter detail, for the first time. The primary application of MM-DTEM is the direct observation of fast processes, including microstructural changes, phase transformations and chemical reactions, that shape real-world performance of nanostructured materials and potentially biological entities. The instrument could prove especially valuable in the direct observation of macromolecular interactions, such as protein-protein binding and host-pathogen interactions. While an earlier version of the technology, Single Shot-DTEM, could capture a single snapshot of a rapid process, MM-DTEM captures a multiframe movie that reveals complex sequences of events in detail. It is the only existing technology that can capture multiple electron microscopy images in the span of a single microsecond.

Lagrange, Thomas; Reed, Bryan



2013 R&D 100 Award: Movie-mode electron microscope captures nanoscale  

SciTech Connect

A new instrument developed by LLNL scientists and engineers, the Movie Mode Dynamic Transmission Electron Microscope (MM-DTEM), captures billionth-of-a-meter-scale images with frame rates more than 100,000 times faster than those of conventional techniques. The work was done in collaboration with a Pleasanton-based company, Integrated Dynamic Electron Solutions (IDES) Inc. Using this revolutionary imaging technique, a range of fundamental and technologically important material and biological processes can be captured in action, in complete billionth-of-a-meter detail, for the first time. The primary application of MM-DTEM is the direct observation of fast processes, including microstructural changes, phase transformations and chemical reactions, that shape real-world performance of nanostructured materials and potentially biological entities. The instrument could prove especially valuable in the direct observation of macromolecular interactions, such as protein-protein binding and host-pathogen interactions. While an earlier version of the technology, Single Shot-DTEM, could capture a single snapshot of a rapid process, MM-DTEM captures a multiframe movie that reveals complex sequences of events in detail. It is the only existing technology that can capture multiple electron microscopy images in the span of a single microsecond.

Lagrange, Thomas; Reed, Bryan



Aquatic Ecosystem Enhancement at Mountaintop Mining Sites Symposium  

SciTech Connect

Welcome to this symposium which is part of the ongoing effort to prepare an Environmental Impact Statement (EIS) regarding mountaintop mining and valley fills. The EIS is being prepared by the U.S. Environmental Protection Agency, U.S. Army Corps of Engineers, U.S. Office of Surface Mining, and U.S. Fish and Wildlife Service, in cooperation with the State of West Virginia. Aquatic Ecosystem Enhancement (AEE) at mountaintop mining sites is one of fourteen technical areas identified for study by the EIS Interagency Steering Committee. Three goals were identified in the AEE Work Plan: 1. Assess mining and reclamation practices to show how mining operations might be carried out in a way that minimizes adverse impacts to streams and other environmental resources and to local communities. Clarify economic and technical constraints and benefits. 2. Help citizens clarify choices by showing whether there are affordable ways to enhance existing mining, reclamation, mitigation processes and/or procedures. 3. Ide identify data needed to improve environmental evaluation and design of mining projects to protect the environment. Todays symposium was proposed in the AEE Team Work Plans but coordinated planning for the event began September 15, 1999 when representatives from coal industry, environmental groups and government regulators met in Morgantown. The meeting participants worked with a facilitator from the Canaan Valley Institute to outline plans for the symposium. Several teams were formed to carry out the plans we outlined in the meeting.

Black, D. Courtney; Lawson, Peter; Morgan, John; Maggard, Randy; Schor, Horst; Powell, Rocky; Kirk, Ed. J.



Effects of time-varying $\\beta$ in SNLS3 on constraining interacting dark energy models  

E-Print Network (OSTI)

It has been found that, for the Supernova Legacy Survey three-year (SNLS3) data, there is strong evidence for the redshift-evolution of color-luminosity parameter $\\beta$. In this paper, adopting the $w$-cold-dark-matter ($w$CDM) model and considering its interacting extensions (with three kinds of interaction between dark sectors), we explore the evolution of $\\beta$ and its effects on parameter estimation. In addition to the SNLS3 data, we also take into account the Planck distance priors data of the cosmic microwave background (CMB), the galaxy clustering (GC) data extracted from SDSS DR7 and BOSS, as well as the direct measurement of Hubble constant from the Hubble Space Telescope (HST) observation. We find that, for all the interacting dark energy (IDE) models, adding a parameter of $\\beta$ can reduce $\\chi^2$ by $\\sim$ 34, indicating that $\\beta_1 = 0$ is ruled out at 5.8$\\sigma$ confidence level (CL). Furthermore, it is found that varying $\\beta$ can significantly change the fitting results of various ...

Wang, Shuang; Geng, Jia-Jia; Zhang, Xin



Sudip Dosanjh! Director  

NLE Websites -- All DOE Office Websites (Extended Search)

NERSC Today and NERSC Today and over the next Ten Years --- 1 --- February 1 3, 2 013 NERSC's Mission * Accelerate s cien5fic d iscovery a t t he D OE O ffice o f Science through high performance compu5ng and extreme d ata a nalysis --- 2 --- NERSC History 1974 F ounded a t L ivermore t o s upport f usion research w ith a C DC s ystem 1978 Cray 1 i nstalled 1983 Expanded t o s upport t oday's D OE O ffice of S cience 1986 ESnet e stablished a t N ERSC 1994 Cray T 3D M PP t estbed 1994 --- 2000 TransiOoned u sers f rom v ector processing t o M PP 1996 Moved t o B erkeley L ab 1996 PDSF d ata i ntensive c ompuOng s ystem for n uclear a nd h igh e nergy p hysics 1999 HPSS b ecomes m ass s torage p laTorm 2005 Facility w ide filesystem 2010 CollaboraOon w ith J GI --- 3 --- Cray 1 --- 1 978 Cray 2 - 1 985 Cray T 3E M curie --- 1 996 IBM



U.S. Energy Information Administration (EIA) Indexed Site

E/EIA E/EIA -0278 U.S. Depa rtme nt of Energ y Energ y Inform ation Admi nistra tion Assis tant Admi nistra tor for Progr am Deve lopme nt Office of the Cons umpt ion Data Syste m June 1981 01377 9 = 4530 : FED Non res ide ntia l Bui ldin gs u/w & Ene rgy Con sum ptio n Sur vey : Fu el Ch ara cte ris tic s an d Co ns erv ati on Pra cti ces Prepared by: Lynn D. Patinkin, Phillip Windell, Dwight: K. French, Leigh Carleton, Lynda T. Carlson, Kenneth A. Vagts, Leslie Whitaker, Tom Woteki, Wilbert Laird, and Laura Wong. IMPORTANT NOTICE As required by government regulation, EIA will conduct the annual review of our mailing list during the next several weeks. If you are on the mailing list, you will soon receive a post card listing your name and address as they appear on our files. If you wish to continue to receive our publications, you must mail



Office of Legacy Management (LM)

. . Ltig (-L.- - I T & c ? I /-- P R E L IM I N A R Y S U R V E Y O F JO S L Y N S T A I N L E S S S T E E L C O M P A N Y F O R T W A Y N E , INDIANA W o r k p e r fo r m e d b y th e H e a l th a n d S a fe ty R e s e a r c h Division O a k R i d g e N a ti o n a l L a b o r a tory O a k R i d g e , T e n n e s s e e 3 7 8 3 0 M a r c h 1 9 8 0 O A K R IDG E N A T IO N A L L A B O R A T O R Y o p e r a te d b y U N IO N C A R B IDE C O R P O R A T IO N fo r th e D E P A R T M E N T O F E N E R G Y a s p a r t o f th e F o r m e r l y U tilized S ites-- R e m e d i a l A c ticn P r o g r a m : . --- -_ -_.._.. .-. .- " _-I.. . , . JOSLYN STAINLESS STEEL COMPANY Fort Wayne, Indiana At the request of the Department of Energy (DOE, then ERDA), a preliminary survey was performed at the Joslyn Stainless Steel Company in Fort Wayne, Indiana (see Fig. l), on October 23, 1976, to assess the radiological status of those facilities utilized under MED/AEC contract


Background Measurements from Balloon-Borne CZT Detectors  

E-Print Network (OSTI)

We report detector characteristics and background measurements from two prototype imaging CZT detectors flown on a scientific balloon payload in May 2001. The detectors are both platinum-contact 10mm x 10mm x 5mm CZT crystals, each with a 4 $\\times$ 4 array of pixels tiling the anode. One is made from IMARAD horizontal Bridgman CZT, the other from eV Products high-pressure Bridgman material. Both detectors were mounted side-by-side in a flip-chip configuration and read out by a 32-channel IDE VA/TA ASIC preamp/shaper. We enclosed the detectors in the same 40deg field-of-view collimator (comprisinga graded passive shield and plastic scintillator) used in our previously-reported September 2000 flight. I-V curves for the detectors are diode-like, and we find that the platinum contacts adhere significantly better to the CZT surfaces than gold to previous detectors. The detectors and instrumentation performed well in a 20-hour balloon flight on 23/24 May 2001. Although we discovered a significant instrumental background component in flight, it was possible to measure and subtract this component from the spectra. The resulting IMARAD detector background spectrum (from 30 keV to ~450 keV) reaches ~5 x 10^{-3}$ counts/cm^2 -sec-keV at 100 keV and has a power-law index of ~2 at high energies. The eV Products detector has a similar spectrum, although there is more uncertainty in the energy scale because of calibration complications.

Johnathan A Jenkins; Tomohiko Narita; Jonathan E. Grindlay; Peter F. Bloser; Carl Stahle; Brad Parker; Scott Barthelmy




Office of Legacy Management (LM)

I I , l ' I *; g j q / q / p - ; a _ . . . .o . P R E L IM I N A R Y S U R V E Y O F T H E F O R M E R G R A S S E L L I - R E S E A R C H L A B O R A T O R Y O F E .I. D U P O N T D E N E M O U R S A N D C O M P A N Y Cleveland, O h io W o rk p e r f o r m e d b y th e Health a n d S a fe ty R e s e a r c h Division O a k R i d g e N a tio n a l L a b o r a tory O a k R i d g e , T e n n e s s e e 3 7 8 3 0 M a r c h 1 9 8 0 O A K R I D G E N A T IO N A L L A B O R A T O R Y o p e r a te d b y U N IO N C A R B IDE C O R P O R A T IO N for th e D E P A R T M E N T O F E N E R G Y a s part o f th e F'ormerly U tilized S ites-- R e m e d i a l A c tio n P r o g r a m .- ,s , L _ _ . j . % $ 3 . FORMER GRASSELLI RESEARCH LABORATORY E.I. DUPONT DE NEMOURS AND COMPANY Cleveland, Ohio At the request of the Department of Energy (DOE, then ERDA), a preliminary survey was performed at a building now owned by Staodard Oil Company of Ohio and located at 3092 Broadway Avenue in Cleveland, Ohio


Transuranic (Tru) waste volume reduction operations at a plutonium facility  

SciTech Connect

Programmatic operations at the Los Alamos National Laboratory Plutonium Facility (TA 55) involve working with various amounts of plutonium and other highly toxic, alpha-emitting materials. The spread of radiological contamination on surfaces, airborne contamination, and excursions of contaminants into the operator's breathing zone are prevented through use of a variety of gloveboxes (the glovebox, coupled with an adequate negative pressure gradient, provides primary confinement). Size-reduction operations on glovebox equipment are a common activity when a process has been discontinued and the room is being modified to support a new customer. The Actin ide Processing Group at TA-55 uses one-meter-long glass columns to process plutonium. Disposal of used columns is a challenge, since they must be size-reduced to get them out of the glovebox. The task is a high-risk operation because the glass shards that are generated can puncture the bag-out bags, leather protectors, glovebox gloves, and the worker's skin when completing the task. One of the Lessons Learned from these operations is that Laboratory management should critically evaluate each hazard and provide more effective measures to prevent personnel injury. A bag made of puncture-resistant material was one of these enhanced controls. We have investigated the effectiveness of these bags and have found that they safely and effectively permit glass objects to be reduced to small pieces with a plastic or rubber mallet; the waste can then be easily poured into a container for removal from the glove box as non-compactable transuranic (TRU) waste. This size-reduction operation reduces solid TRU waste generation by almost 2% times. Replacing one-time-use bag-out bags with multiple-use glass crushing bags also contributes to reducing generated waste. In addition, significant costs from contamination, cleanup, and preparation of incident documentation are avoided. This effort contributes to the Los Alamos National Laboratory Continuous Improvement Program by improving the efficiency, cost-effectiveness, and formality of glovebox operations. In this report, the technical issues, associated with implementing this process improvement are addressed, the results discussed, effectiveness of Lessons Learned evaluated, and waste savings presented.

Cournoyer, Michael E [Los Alamos National Laboratory; Nixon, Archie E [Los Alamos National Laboratory; Dodge, Robert L [Los Alamos National Laboratory; Fife, Keith W [Los Alamos National Laboratory; Sandoval, Arnold M [Los Alamos National Laboratory; Garcia, Vincent E [Los Alamos National Laboratory
