National Library of Energy BETA

Sample records for biosensor-guided synthetic evolution

  1. The formation and evolution of synthetic jets Barton L. Smitha)

    E-Print Network [OSTI]

    Smith, Barton L.

    The formation and evolution of synthetic jets Barton L. Smitha) and Ari Glezer Woodruff School 1997; accepted 6 May 1998 A nominally plane turbulent jet is synthesized by the interactions of a train of a flexible diaphragm in a sealed cavity. Even though the jet is formed without net mass injection

  2. Design and Optimization of a Biochemical Production Platform...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Review Eric J. Steen, Ph.D. Lygos, Inc. DESIGN & OPTIMIZATION OF A BIOCHEMICAL PRODUCTION PLATFORM WITH BIOSENSOR-GUIDED SYNTHETIC EVOLUTION 2 CELLULOSIC SUGARS MALONYL-COA...

  3. Synthetic Biology: Engineering, Evolution and Design (SEED) Conference 2014

    SciTech Connect (OSTI)

    Voigt, Christopher

    2014-07-01

    SEED2014 focused on advances in the science and technology emerging from the field of synthetic biology. We broadly define this as technologies that accelerate the process of genetic engineering. It highlighted new tool development, as well as the application of these tools to diverse problems in biotechnology, including therapeutics, industrial chemicals and fuels, natural products, and agriculture. Systems spanned from in vitro experiments and viruses, through diverse bacteria, to eukaryotes (yeast, mammalian cells, plants).

  4. Biogeography and Evolution of the Araneae: A Synthetic Approach

    E-Print Network [OSTI]

    Saupe, Erin E.

    2010-04-18

    Various methods are used to study the evolution and biogeography of the Araneae through time. Two new fossil spider species were described from Miocene Dominican amber and French Cretaceous amber. A preliminary biogeographic analysis was performed...

  5. Characterization of phase evolution during lead immobilization by synthetic hydroxyapatite

    SciTech Connect (OSTI)

    Mavropoulos, Elena [CBPF, Rio de Janeiro (Brazil); Rocha, Nilce C.C. [IQ/UFRJ, Rio de Janeiro (Brazil); Moreira, Josino C. [ENSP/FIOCRUZ, Rio de Janeiro (Brazil); Rossi, Alexandre M. [CBPF, Rio de Janeiro (Brazil); Soares, Gloria A. [Metallurgical and Materials Engineering Department, Federal University of Rio de Janeiro, P.O. Box 68505, Rio de Janeiro, 21941-972, RJ (Brazil)]. E-mail: Gloria@ufrj.br

    2004-09-15

    Immobilization of toxic metals by calcium phosphates is a promising technology for treating contaminated soil, water and wastes. A detailed study on the mechanisms of lead immobilization by hydroxyapatite has been carried out using scanning electron microscopy (SEM), transmission electron microscopy (TEM) and X-ray diffraction (XRD). For this, synthetic hydroxyapatite powder were submitted to a sorption process through exposure to an aqueous solution containing 917 mg L{sup -1} of lead for times that varied from 3 min to 54 h. The results obtained reinforce the hypothesis that hydroxypyromorphite formation is the end of a kinetic process in which the hydroxyapatite crystals are continuously dissolved and recrystallized in order to form more stable structures with higher lead content. Consequently, the use of calcium phosphates to immobilize lead ions seems to be technically viable.

  6. CX-010216: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Design and Optimization of a Biochemical Production Platform with Biosensor-guided Synthetic Evolution CX(s) Applied: A9, B3.6 Date: 02/28/2013 Location(s): California Offices(s): Golden Field Office

  7. Tools and reference standards supporting the engineering and evolution of synthetic biological systems

    E-Print Network [OSTI]

    Kelly, Jason R. (Jason Robert)

    2008-01-01

    Biological engineers have constructed a number of multi-part synthetic biological systems that conduct logical operations on input signals, produce oscillatory output signals, store memory, or produce desired products. ...

  8. Dartmouth Stellar Evolution Database and the ACS Survey of Galactic Globular Clusters II. Stellar Evolution Tracks, Isochrones, Luminosity Functions, and Synthetic Horizontal-Branch Models

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Dotter, A; Chaboyer, B; Jevremovic, D; Kostov, V; Baron, E; Ferguson, J; Sarajedini, A; Anderson, J

    Web tools are also available at the home page (http://stellar.dartmouth.edu/~models/index.html). These tools allow users to create isochrones and convert them to luminosity functions or create synthetic horizontal branch models.

  9. Synthetic and Mechanistic Chemistry

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    isotopes for biological applications Aaron S. Anderson: Synthetic chemistry of biosensors Andrew M. Dattelbaum: Synthetic chemistry and nanoparticles Sponsors, Funding...

  10. Synthetic guide star generation

    DOE Patents [OSTI]

    Payne, Stephen A. (Castro Valley, CA) [Castro Valley, CA; Page, Ralph H. (Castro Valley, CA) [Castro Valley, CA; Ebbers, Christopher A. (Livermore, CA) [Livermore, CA; Beach, Raymond J. (Livermore, CA) [Livermore, CA

    2008-06-10

    A system for assisting in observing a celestial object and providing synthetic guide star generation. A lasing system provides radiation at a frequency at or near 938 nm and radiation at a frequency at or near 1583 nm. The lasing system includes a fiber laser operating between 880 nm and 960 nm and a fiber laser operating between 1524 nm and 1650 nm. A frequency-conversion system mixes the radiation and generates light at a frequency at or near 589 nm. A system directs the light at a frequency at or near 589 nm toward the celestial object and provides synthetic guide star generation.

  11. Synthetic guide star generation

    SciTech Connect (OSTI)

    Payne, Stephen A.; Page, Ralph H.; Ebbers, Christopher A.; Beach, Raymond J.

    2004-03-09

    A system for assisting in observing a celestial object and providing synthetic guide star generation. A lasing system provides radiation at a frequency at or near 938 nm and radiation at a frequency at or near 1583 nm. The lasing system includes a fiber laser operating between 880 nm and 960 nm and a fiber laser operating between 1524 nm and 1650 nm. A frequency-conversion system mixes the radiation and generates light at a frequency at or near 589 nm. A system directs the light at a frequency at or near 589 nm toward the celestial object and provides synthetic guide star generation.

  12. Biodegradable synthetic bone composites

    DOE Patents [OSTI]

    Liu, Gao; Zhao, Dacheng; Saiz, Eduardo; Tomsia, Antoni P.

    2013-01-01

    The invention provides for a biodegradable synthetic bone composition comprising a biodegradable hydrogel polymer scaffold comprising a plurality of hydrolytically unstable linkages, and an inorganic component; such as a biodegradable poly(hydroxyethylmethacrylate)/hydroxyapatite (pHEMA/HA) hydrogel composite possessing mineral content approximately that of human bone.

  13. Synthetic and Mechanistic Chemistry

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With LivermoreSustainable Land LabEnergyNationalScience BeatSynthetic

  14. Research Councils UK Synthetic biology

    E-Print Network [OSTI]

    Crowther, Paul

    Research Councils UK Synthetic biology #12;Synthetic biology Research funded by the Research a variety of approaches to support innovation and deliver impact from research, including the development of collaborative research programmes, investment in major research capabilities, such as national research

  15. Plant evolution The Evolution

    E-Print Network [OSTI]

    Rieseberg, Loren

    Plant evolution The Evolution of Plants by Kathy J. Willis and Jenny C. McElwain. Oxford University Press, 2002. $40.00/£22.99 pbk (378 pages) ISBN 0 19 850065 3 Developmental Genetics and Plant Evolution is observed for treatments of evolution and development. Titles of major monographs on the subject imply

  16. Synthesizing Law for Synthetic Biology

    E-Print Network [OSTI]

    Torrance, Andrew W.

    2010-01-01

    , metabolic pathways, cells, viruses, and whole organisms rapidly, inexpensively, and easily. Already, a number of institutions have helped synthetic biology achieve considerable success, both in terms of science and public awareness. The BioBricks Foundation...

  17. Synthetic biology and crop engineering

    Broader source: Energy.gov [DOE]

    Breakout Session 2: Frontiers and Horizons Session 2-A: Synthetic Biology and the Promise of Biofuels Jonathan Burbaum, Program Director, Department of Energy, Office of Science, ARPA–E

  18. SYNTHETIC SLING FAILURE - EVALUATIONS & RECOMMENDATIONS

    SciTech Connect (OSTI)

    MACKEY TC; HENDERSON CS

    2009-10-26

    The information and evaluations provided in this report were compiled to address the recurring problem of synthetic sling failure. As safety is the number one priority in all work aspects, a solution must be devised to prevent accidents from occurring. A total of thirteen cases regarding synthetic sling failure were evaluated in order to determine their causes, effects, and preventative measures. From the collected data, it was found that all cases in which the synthetic sling contacted the edge of its load resulted in sling failure. It is required that adequate synthetic sling protection devices be used to protect slings in any lift where the sling comes in direct contact with the edge or corner of its load. However, there are no consensus codes or standards stating the type, material, or purpose of the type of protective device used to protect the sling from being cut. Numerous industry standards and codes provide vague descriptions on how to protect synthetic slings. Without a clear, concise statement of how to protect synthetic slings, it is common for inadequate materials and sling protection devices to be used in an attempt to meet the intent of these requirements. The use of an inadequate sling protection device is the main cause of synthetic sling failure in all researched cases. Commercial sling protection devices come in many shapes and sizes, and have a variety of names, as well as advertised uses. 'Abrasion pads' and 'wear protectors' are two different names for products with the same intended purpose. There is no distinguishable way to determine the extent of sling protection which these devices will provide, or what specific scenarios they are made for. This creates room for error in a field where error is unacceptable. This report provides a recommended action for hoisting and rigging activities which require synthetic slings to contact a load, as well as recommended changes to industry standards which will benefit overall industry safety.

  19. Future Prospects of Synthetic Fuels 

    E-Print Network [OSTI]

    Fryback, M. G.

    1982-01-01

    It is important for the future of this nation to reach the goal of demonstrated definition and quantification of the parameters which influence the ability to use this country's vast resources of coal and oil shale for production of synthetic fuels...

  20. Synthetic substrates for enzyme analysis

    DOE Patents [OSTI]

    Bissell, Eugene R. (Alamo, CA); Mitchell, Alexander R. (Livermore, CA); Pearson, Karen W. (Livermore, CA); Smith, Robert E. (Livermore, CA)

    1983-01-01

    Synthetic substrates are provided which may be represented as A-D. The A moiety thereof includes an amino acid, polypeptide, or derivative thereof. The D moiety thereof includes 7-amino coumarin derivatives having an electron withdrawing substituent group at the 3 position carbon or fused between the 3 and 4 position carbons.

  1. Synthetic substrates for enzyme analysis

    DOE Patents [OSTI]

    Bissell, E.R.; Mitchell, A.R.; Pearson, K.W.; Smith, R.E.

    1983-06-14

    Synthetic substrates are provided which may be represented as A-D. The A moiety includes an amino acid, polypeptide, or derivative. The D moiety includes 7-amino coumarin derivatives having an electron withdrawing substituent group at the 3 position carbon or fused between the 3 and 4 position carbons. No Drawings

  2. Objective methods for evaluating synthetic intonation. 

    E-Print Network [OSTI]

    Clark, Robert A J; Dusterhoff, Kurt E

    1999-01-01

    This paper describes the development and evaluation of objective methods for testing synthetic intonation. While subjective methods are available for assessing the quality of synthetic intonation, such tests consume ...

  3. Synthetic LDL as targeted drug delivery vehicle

    DOE Patents [OSTI]

    Forte, Trudy M. (Berkeley, CA); Nikanjam, Mina (Richmond, CA)

    2012-08-28

    The present invention provides a synthetic LDL nanoparticle comprising a lipid moiety and a synthetic chimeric peptide so as to be capable of binding the LDL receptor. The synthetic LDL nanoparticle of the present invention is capable of incorporating and targeting therapeutics to cells expressing the LDL receptor for diseases associated with the expression of the LDL receptor such as central nervous system diseases. The invention further provides methods of using such synthetic LDL nanoparticles.

  4. Synthetic thermoelectric materials comprising phononic crystals

    DOE Patents [OSTI]

    El-Kady, Ihab F; Olsson, Roy H; Hopkins, Patrick; Reinke, Charles; Kim, Bongsang

    2013-08-13

    Synthetic thermoelectric materials comprising phononic crystals can simultaneously have a large Seebeck coefficient, high electrical conductivity, and low thermal conductivity. Such synthetic thermoelectric materials can enable improved thermoelectric devices, such as thermoelectric generators and coolers, with improved performance. Such synthetic thermoelectric materials and devices can be fabricated using techniques that are compatible with standard microelectronics.

  5. Synthetic carbonaceous fuels and feedstocks

    DOE Patents [OSTI]

    Steinberg, Meyer (Huntington Station, NY)

    1980-01-01

    This invention relates to the use of a three compartment electrolytic cell in the production of synthetic carbonaceous fuels and chemical feedstocks such as gasoline, methane and methanol by electrolyzing an aqueous sodium carbonate/bicarbonate solution, obtained from scrubbing atmospheric carbon dioxide with an aqueous sodium hydroxide solution, whereby the hydrogen generated at the cathode and the carbon dioxide liberated in the center compartment are combined thermocatalytically into methanol and gasoline blends. The oxygen generated at the anode is preferably vented into the atmosphere, and the regenerated sodium hydroxide produced at the cathode is reused for scrubbing the CO.sub.2 from the atmosphere.

  6. Entraining synthetic genetic oscillators Alexandre Wagemakers,1

    E-Print Network [OSTI]

    Rey Juan Carlos, Universidad

    Entraining synthetic genetic oscillators Alexandre Wagemakers,1 Javier M. Buldú,2 Miguel A. F genetic oscillators, which consists in the entrainment of a colony of repressilators by external

  7. Computational Modelling in Systems and Synthetic Biology

    E-Print Network [OSTI]

    Romero-Campero, Francisco J.

    modules Networks Cells Colonies Systems Biology and Synthetic Biology #12;Stochasticity is important processes. Executable semantics. o Modularity in cellular systems, especially in gene regulatory networks been successfully applied. Monika Heiner, David Gilbert, Robin Donaldson. Petri Nets for Systems

  8. Synthetic analogs of bacterial quorum sensors

    DOE Patents [OSTI]

    Iyer, Rashi S.; Ganguly, Kumkum; Silks, Louis A.

    2013-01-08

    Bacterial quorum-sensing molecule analogs having the following structures: ##STR00001## and methods of reducing bacterial pathogenicity, comprising providing a biological system comprising pathogenic bacteria which produce natural quorum-sensing molecule; providing a synthetic bacterial quorum-sensing molecule having the above structures and introducing the synthetic quorum-sensing molecule into the biological system comprising pathogenic bacteria. Further is provided a method of targeted delivery of an antibiotic, comprising providing a synthetic quorum-sensing molecule; chemically linking the synthetic quorum-sensing molecule to an antibiotic to produce a quorum-sensing molecule-antibiotic conjugate; and introducing the conjugate into a biological system comprising pathogenic bacteria susceptible to the antibiotic.

  9. Synthetic analogs of bacterial quorum sensors

    DOE Patents [OSTI]

    Iyer, Rashi (Los Alamos, NM); Ganguly, Kumkum (Los Alamos, NM); Silks, Louis A. (Los Alamos, NM)

    2011-12-06

    Bacterial quorum-sensing molecule analogs having the following structures: ##STR00001## and methods of reducing bacterial pathogenicity, comprising providing a biological system comprising pathogenic bacteria which produce natural quorum-sensing molecule; providing a synthetic bacterial quorum-sensing molecule having the above structures and introducing the synthetic quorum-sensing molecule into the biological system comprising pathogenic bacteria. Further is provided a method of targeted delivery of an antibiotic, comprising providing a synthetic quorum-sensing molecule; chemically linking the synthetic quorum-sensing molecule to an antibiotic to produce a quorum-sensing molecule-antibiotic conjugate; and introducing the conjugate into a biological system comprising pathogenic bacteria susceptible to the antibiotic.

  10. Authentic teaching and learning through synthetic biology

    E-Print Network [OSTI]

    Kuldell, Natalie

    Synthetic biology is an emerging engineering discipline that, if successful, will allow well-characterized biological components to be predictably and reliably built into robust organisms that achieve specific functions. ...

  11. Foundational platform for mammalian synthetic biology

    E-Print Network [OSTI]

    Davidsohn, Noah (Noah Justin)

    2013-01-01

    The emergent field of synthetic biology is different from many other biological engineering efforts, in that its roots, design principles, and forward engineering perspective have been adopted from electrical engineering ...

  12. Synthetic CO.sub.2 acceptor

    DOE Patents [OSTI]

    Lancet, Michael S. (Pittsburgh, PA); Curran, George P. (Pittsburgh, PA)

    1981-08-18

    A synthetic CO.sub.2 acceptor consisting essentially of at least one compound selected from the group consisting of calcium oxide and calcium carbonate supported in a refractory carrier matrix, the carrier having the general formula Ca.sub.5 (SiO.sub.4).sub.2 CO.sub.3. A method for producing the synthetic CO.sub.2 acceptor is also disclosed.

  13. Synthetic heparin-binding growth factor analogs

    DOE Patents [OSTI]

    Pena, Louis A.; Zamora, Paul; Lin, Xinhua; Glass, John D.

    2007-01-23

    The invention provides synthetic heparin-binding growth factor analogs having at least one peptide chain that binds a heparin-binding growth factor receptor, covalently bound to a hydrophobic linker, which is in turn covalently bound to a non-signaling peptide that includes a heparin-binding domain. The synthetic heparin-binding growth factor analogs are useful as soluble biologics or as surface coatings for medical devices.

  14. Flow control via synthetic jet actuation 

    E-Print Network [OSTI]

    Miller, Adam Cole

    2005-02-17

    -1 FLOW CONTROL VIA SYNTHETIC JET ACTUATION A Thesis by ADAM COLE MILLER Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE December... 2004 Major Subject: Aerospace Engineering FLOW CONTROL VIA SYNTHETIC JET ACTUATION A Thesis by ADAM COLE MILLER Submitted to Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE...

  15. Towards a library of synthetic galaxy spectra and preliminary results of classification and parametrization of unresolved galaxies for Gaia

    E-Print Network [OSTI]

    Tsalmantza, P; Bailer-Jones, C A L; Rocca-Volmerange, B; Korakitis, R; Kontizas, E; Livanou, E; Dapergolas, A; Bellas-Velidis, I; Vallenari, A; Fioc, M

    2007-01-01

    Aims:The Gaia astrometric survey mission will, as a consequence of its scanning law, obtain low resolution optical (3300-1000 nm) spectrophotometry of several million unresolved galaxies brighter than V=22. We present the first steps in a project to design and implement a classification system for these data. The goal is both to determine morphological classes and to estimate intrinsic astrophysical parameters via synthetic templates. Here we describe (1) a new library of synthetic galaxy spectra, and (2) first results of classification and parametrization experiments using simulated Gaia spectrophotometry of this library. Methods:We have created a large grid of synthetic galaxy spectra using the PEGASE.2 code, which is based on galaxy evolution models that take into account metallicity evolution, extinction correction, emission lines (with stellar spectra based on the BaSeL library). Our classification and regression models are Support Vector Machines (SVMs), which are kernel-based nonlinear estimators. Resu...

  16. Towards a library of synthetic galaxy spectra and preliminary results of classification and parametrization of unresolved galaxies for Gaia - II

    E-Print Network [OSTI]

    Tsalmantza, P; Rocca-Volmerange, B; Bailer-Jones, C A L; Kontizas, E; Bellas-Velidis, I; Livanou, E; Korakitis, R; Dapergolas, A; Vallenari, A; Fioc, M

    2009-01-01

    This paper is the second in a series, implementing a classification system for Gaia observations of unresolved galaxies. Our goals are to determine spectral classes and estimate intrinsic astrophysical parameters via synthetic templates. Here we describe (1) a new extended library of synthetic galaxy spectra, (2) its comparison with various observations, and (3) first results of classification and parametrization experiments using simulated Gaia spectrophotometry of this library. Using the PEGASE.2 code, based on galaxy evolution models that take account of metallicity evolution, extinction correction, and emission lines (with stellar spectra based on the BaSeL library), we improved our first library and extended it to cover the domain of most of the SDSS catalogue. We produce an extended library of 28885 synthetic galaxy spectra at zero redshift covering four general Hubble types of galaxies, over the wavelength range between 250 and 1050 nm at a sampling of 1 nm or less. The library is also produced for 4 r...

  17. Synthetic Spectra from PIC Simulations of Relativistic Collisionless Shocks

    E-Print Network [OSTI]

    Sironi, Lorenzo

    2009-01-01

    We extract synthetic photon spectra from first-principles particle-in-cell simulations of relativistic shocks propagating in unmagnetized pair plasmas. The two basic ingredients for the radiation, namely accelerated particles and magnetic fields, are produced self-consistently as part of the shock evolution. We use the method of Hededal & Nordlund (2005) and compute the photon spectrum via Fourier transform of the electric far-field from a large number of particles, sampled directly from the simulation. We find that the spectrum from relativistic collisionless shocks is entirely consistent with synchrotron radiation in the magnetic fields generated by Weibel instability. We can recover the so-called "jitter'' regime only if we artificially reduce the strength of the electromagnetic fields, such that the wiggler parameter K = qB lambda/mc^2 becomes much smaller than unity ("B" and "lambda" are the strength and scale of the magnetic turbulence, respectively). These findings may place constraints on the orig...

  18. New Synthetic Methods for Hypericum Natural Products

    SciTech Connect (OSTI)

    Insik Jeon

    2006-12-12

    Organic chemistry has served as a solid foundation for interdisciplinary research areas, such as molecular biology and medicinal chemistry. An understanding of the biological activities and structural elucidations of natural products can lead to the development of clinically valuable therapeutic options. The advancements of modern synthetic methodologies allow for more elaborate and concise natural product syntheses. The theme of this study centers on the synthesis of natural products with particularly challenging structures and interesting biological activities. The synthetic expertise developed here will be applicable to analog syntheses and to other research problems.

  19. Synthetic heparin-binding factor analogs

    DOE Patents [OSTI]

    Pena, Louis A. (Poquott, NY); Zamora, Paul O. (Gaithersburg, MD); Lin, Xinhua (Plainview, NY); Glass, John D. (Shoreham, NY)

    2010-04-20

    The invention provides synthetic heparin-binding growth factor analogs having at least one peptide chain, and preferably two peptide chains branched from a dipeptide branch moiety composed of two trifunctional amino acid residues, which peptide chain or chains bind a heparin-binding growth factor receptor and are covalently bound to a non-signaling peptide that includes a heparin-binding domain, preferably by a linker, which may be a hydrophobic linker. The synthetic heparin-binding growth factor analogs are useful as pharmaceutical agents, soluble biologics or as surface coatings for medical devices.

  20. Immobilization of radioiodine in synthetic boracite

    DOE Patents [OSTI]

    Babad, H.; Strachan, D.M.

    1982-09-23

    A nuclear waste storage product is disclosed in which radioiodine is incorporated in a synthetic boracite. The boracite may be prepared by reacting a transition metal iodide with an alkali horate under mild hydrothermal conditions, drying the reaction product, and then hot pressing.

  1. A modelling framework for Synthetic Biology

    E-Print Network [OSTI]

    in large gene compositions. Keywords: Synthetic biology; Gene regulated networks; Stochastic simulation; Petri net modelling; Genetic design automation; Genetic logic synthesis #12;ii #12;Summary (Danish gensammensætninger. Nøgleord: Syntesebiologi; Genregulerede netværk; Stokastisk simulering; Petri net mo- dellering

  2. Coal based synthetic fuel technology assessment guides

    SciTech Connect (OSTI)

    Not Available

    1981-09-01

    Seventeen synthetic fuel processes are described in detail and compared on a uniform basis. This work was supported by the Energy Information Administration for the purpose of technology assessment of the processes, their efficiency, the capitalized and operating cost of plants of similar size, possible constraints, possible siting problems, regional effects, pollution control, etc. (LTN)

  3. Cellular CSK resembles natural and synthetic materials

    E-Print Network [OSTI]

    Sniadecki, Nathan J.

    Theory Pinned-pinned, three-point bending Es is modulus of elasticity for beam (F-actin GPa) d 3 48 s F l E ISession 15 #12;2 Cellular CSK resembles natural and synthetic materials Felt Paper Cotton NASA r r #12;6 (a/k/a Second Moment of Area) Geometric resistance of a beam to bending 2 2

  4. Synthetic Biology for Therapeutic Applications Zhanar Abil,

    E-Print Network [OSTI]

    Zhao, Huimin

    Synthetic Biology for Therapeutic Applications Zhanar Abil, Xiong Xiong, and Huimin Zhao of Bioengineering, Department of Chemistry, Center for Biophysics and Computational Biology and Institute for Genomic Biology, University of Illinois at Urbana-Champaign, 600 South Mathews Avenue, Urbana, Illinois

  5. CO2 Capture with Enzyme Synthetic Analogue

    SciTech Connect (OSTI)

    Harry Cordatos

    2010-11-08

    Overview of an ongoing, 2 year research project partially funded by APRA-E to create a novel, synthetic analogue of carbonic anhydrase and incorporate it into a membrane for removal of CO2 from flue gas in coal power plants. Mechanism background, preliminary feasibility study results, molecular modeling of analogue-CO2 interaction, and program timeline are provided.

  6. Requirements Evolution Empirical Analyses

    E-Print Network [OSTI]

    Felici, Massimo

    Requirements Evolution Empirical Analyses Massimo Felici 18 July 2001, ITC-IRST/ARS, Trento, Italy Massimo Felici Requirements Evolution ITC-IRST/ARS #12;Requirements Evolution 1 Overview · Why Requirements Evolution? · Empirical Requirements Evolution: Two Industrial Case Studies · Discussion

  7. Feedback control of flow separation using synthetic jets 

    E-Print Network [OSTI]

    Kim, Kihwan

    2006-04-12

    The primary goal of this research is to assess the effect of synthetic jets on flow separation and provide a feedback control strategy for flow separation using synthetic jets. The feedback control synthesis is conducted based upon CFD simulation...

  8. Active flow separation control using synthetic jet actuators 

    E-Print Network [OSTI]

    Rao, Preetham P

    2000-01-01

    The use of synthetic jet actuators for controlling the boundary layer flow and flow separation over a wing is investigated. A theory for the optimum design of actuators using motors is developed. A motor driven synthetic jet actuator is built...

  9. Aspects of the political economy of development and synthetic biology

    E-Print Network [OSTI]

    Wellhausen, Rachel

    What implications might synthetic biology’s potential as a wholly new method of production have for the world economy, particularly developing countries? Theories of political economy predict that synthetic biology can ...

  10. Axisymmetric Synthetic Jets: An Experimental and Theoretical Examination

    E-Print Network [OSTI]

    Mohseni, Kamran

    Axisymmetric Synthetic Jets: An Experimental and Theoretical Examination Gopi Krishnan and Kamran synthetic jet driven by a piezoelectric membrane issuing into a quiescent environment is studied in this paper. The self-similar behavior exhibited by both synthetic and continuous turbulent jets leads

  11. Cellular CSK resembles natural and synthetic materials

    E-Print Network [OSTI]

    Sniadecki, Nathan J.

    -pinned, three-point bending 7 Es is modulus of elasticity for beam (F-actin GPa) 3 48 s F l E I = #12;StressSession 15 #12;Cellular CSK resembles natural and synthetic materials Felt Paper Cotton 2 Cotton = #12;(a/k/a Second Moment of Area) Geometric resistance of a beam to bending 2 x A I y dA= y 6 2 4 4 4

  12. Chemical Evolution

    E-Print Network [OSTI]

    Francesca Matteucci

    2007-04-05

    In this series of lectures we first describe the basic ingredients of galactic chemical evolution and discuss both analytical and numerical models. Then we compare model results for the Milky Way, Dwarf Irregulars, Quasars and the Intra-Cluster- Medium with abundances derived from emission lines. These comparisons allow us to put strong constraints on the stellar nucleosynthesis and the mechanisms of galaxy formation.

  13. Cross-linked structure of network evolution

    SciTech Connect (OSTI)

    Bassett, Danielle S.; Wymbs, Nicholas F.; Grafton, Scott T.; Porter, Mason A.; CABDyN Complexity Centre, University of Oxford, Oxford, OX1 1HP ; Mucha, Peter J.; Department of Applied Physical Sciences, University of North Carolina, Chapel Hill, North Carolina 27599

    2014-03-15

    We study the temporal co-variation of network co-evolution via the cross-link structure of networks, for which we take advantage of the formalism of hypergraphs to map cross-link structures back to network nodes. We investigate two sets of temporal network data in detail. In a network of coupled nonlinear oscillators, hyperedges that consist of network edges with temporally co-varying weights uncover the driving co-evolution patterns of edge weight dynamics both within and between oscillator communities. In the human brain, networks that represent temporal changes in brain activity during learning exhibit early co-evolution that then settles down with practice. Subsequent decreases in hyperedge size are consistent with emergence of an autonomous subgraph whose dynamics no longer depends on other parts of the network. Our results on real and synthetic networks give a poignant demonstration of the ability of cross-link structure to uncover unexpected co-evolution attributes in both real and synthetic dynamical systems. This, in turn, illustrates the utility of analyzing cross-links for investigating the structure of temporal networks.

  14. Micro/nanofabricated environments for synthetic biology

    SciTech Connect (OSTI)

    Collier, Pat [ORNL; Simpson, Michael L [ORNL

    2011-01-01

    A better understanding of how confinement, crowding and reduced dimensionality modulate reactivity and reaction dynamics will aid in the rational and systematic discovery of functionality in complex biological systems. Artificial micro- and nanofabricated structures have helped elucidate the effects of nanoscale spatial confinement and segregation on biological behavior, particularly when integrated with microfluidics, through precise control in both space and time of diffusible signals and binding interactions. Examples of nanostructured interfaces for synthetic biology include the development of cell-like compartments for encapsulating biochemical reactions, nanostructured environments for fundamental studies of diffusion, molecular transport and biochemical reaction kinetics, and regulation of biomolecular interactions as functions of micro- and nanofabricated topological constraints.

  15. Chemistry in Motion: Tiny Synthetic Motors

    E-Print Network [OSTI]

    Peter H. Colberg; Shang Yik Reigh; Bryan Robertson; Raymond Kapral

    2014-11-03

    In this Account, we describe how synthetic motors that operate by self-diffusiophoresis make use of a self-generated concentration gradient to drive motor motion. A description of propulsion by self-diffusiophoresis is presented for Janus particle motors comprising catalytic and noncatalytic faces. The properties of the dynamics of chemically powered motors are illustrated by presenting the results of particle-based simulations of sphere-dimer motors constructed from linked catalytic and noncatalytic spheres. The geometries of both Janus and sphere-dimer motors with asymmetric catalytic activity support the formation of concentration gradients around the motors. Because directed motion can occur only when the system is not in equilibrium, the nature of the environment and the role it plays in motor dynamics are described. Rotational Brownian motion also acts to limit directed motion, and it has especially strong effects for very small motors. We address the following question: how small can motors be and still exhibit effects due to propulsion, even if only to enhance diffusion? Synthetic motors have the potential to transform the manner in which chemical dynamical processes are carried out for a wide range of applications.

  16. Lecture 25: Evolution & Human-caused evolution

    E-Print Network [OSTI]

    Lecture 25: Evolution & Humans · Human-caused evolution · Global climate change · Exploitation:1786 Final, 14 Dec, 8-10 Review session, 13 Dec, Wednesday, 11am, 201 Abelson Evolution ­ relevance? A better populations ­ Conservation of biodiversity ­ Pests ­ Diseases Global warming and evolution · Moderation

  17. Wave Evolution On the Evolution of Curvelets

    E-Print Network [OSTI]

    Smith, Hart F.

    Curvelets Wave Evolution On the Evolution of Curvelets by the Wave Equation Hart F. Smith Department of Mathematics University of Washington, Seattle 1st PRIMA Congress Hart F. Smith On the Evolution(x) = c (x) c = f(x) (x) dx Hart F. Smith On the Evolution of Curvelets by the Wave Equation #12;Curvelets

  18. A model for improving microbial biofuel production using a synthetic...

    Office of Scientific and Technical Information (OSTI)

    loop Cells use feedback to implement a diverse range of regulatory functions. Building synthetic feedback control systems may yield insight into the roles that feedback can...

  19. Synthetic nanotubes lay foundation for new technology: Artificial...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Synthetic nanotubes lay foundation for new technology: Artificial pores mimic key features of natural pores By Tona Kunz * July 17, 2012 Tweet EmailPrint Scientists have overcome...

  20. Molecular Recognition by Synthetic Receptors in Biomimetic and Cellular Systems

    E-Print Network [OSTI]

    Ghang, Yoo-Jin

    2015-01-01

    Synthetic Glycopolymers into Cellular Membranes. ” J. Am.between siRNA Localization, Cellular Uptake, and RNAi inas an Anti-Tumor Drig: Cellular Mechanisms of Activity, Drug

  1. Copy of Synthetic Biology of Novel Thermophilic Bacteria for...

    Office of Scientific and Technical Information (OSTI)

    Copy of Synthetic Biology of Novel Thermophilic Bacteria for Enhanced Production of Ethanol from 5-Carbon Sugars (LDRD %23 105944). Citation Details In-Document Search Title: Copy...

  2. Development of a removable conformal coating through the synthetic...

    Office of Scientific and Technical Information (OSTI)

    Conference: Development of a removable conformal coating through the synthetic incorporation of Diels-Adler thermally reversible adducts into an epoxy resin. Citation Details...

  3. Inversion of synthetic aperture radar interferograms for sources...

    Open Energy Info (EERE)

    Inversion of synthetic aperture radar interferograms for sources of production-related subsidence at the Dixie Valley geothermal field Jump to: navigation, search OpenEI Reference...

  4. Synthetic magnetoelectric coupling in a nanocomposite multiferroic

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jain, P.; Wang, Q.; Roldan, M.; Glavic, A.; Lauter, V.; Urban, C.; Bi, Z.; Ahmed, T.; Zhu, J.; Varela, M.; et al

    2015-03-13

    Given the paucity of single phase multiferroic materials (with large ferromagnetic moment), composite systems seem an attractive solution to realize magnetoelectric coupling between ferromagnetic and ferroelectric order parameters. Despite having antiferromagnetic order, BiFeO? (BFO) has nevertheless been a key material due to excellent ferroelectric properties at room temperature. We studied a superlattice composed of 8 repetitions of 6 unit cells of La?.?Sr?.?MnO? (LSMO) grown on 5 unit cells of BFO. Significant net uncompensated magnetization in BFO, an insulating superlattice, is demonstrated using polarized neutron reflectometry. Remarkably, the magnetization enables magnetic field to change the dielectric properties of the superlattice, whichmore »we cite as an example of synthetic magnetoelectric coupling. Importantly, controlled creation of magnetic moment in BFO is a much needed path toward design and implementation of integrated oxide devices for next generation magnetoelectric data storage platforms.« less

  5. Environmental data energy technology characterizations: synthetic fuels

    SciTech Connect (OSTI)

    Not Available

    1980-04-01

    Environmental Data Energy Technology Characterizations are publications which are intended to provide policy analysts and technical analysts with basic environmental data associated with key energy technologies. This publication provides documentation on synthetic fuels (coal-derived and oil shale). The transformation of the energy in coal and oil shale into a more useful form is described in this publication in terms of major activity areas in the synthetic fuel cycles, that is, in terms of activities which produce either an energy product or a fuel leading to the production of an energy product in a different form. The activities discussed in this document are coal liquefaction, coal gasification, in-situ gasification, and oil shales. These activities represent both well-documented and advanced activity areas. The former activities are characterized in terms of actual operating data with allowance for future modification where appropriate. Emissions are assumed to conform to environmental standards. The advanced activity areas examined are those like coal liquefaction and in-situ retorting of oil shale. For these areas, data from pilot or demonstration plants were used where available; otherwise, engineering studies provided the data. The organization of the chapters in this volume is designed to support the tabular presentation in the summary volume. Each chapter begins with a brief description of the activity under consideration. The standard characteristics, size, availability, mode of functioning and place in the fuel cycle are presented. Next, major legislative and/or technological factors influencing the commercial operation of the activity are offered. Discussions of resources consumed, residuals produced, and economics follow. To aid in comparing and linking the different activity areas, data for each area are normalized to 10/sup 12/ Btu of energy output from the activity.

  6. Controlled polymer synthesis--from biomimicry towards synthetic biology

    E-Print Network [OSTI]

    Davis, Ben G.

    Controlled polymer synthesis--from biomimicry towards synthetic biology George Pasparakis assembly of synthetic polymer structures is now possible with an unprecedented range of functional groups). Introduction Life depends on polymers, and the adage `the whole is greater than the sum of the parts

  7. FOREST ENTOMOLOGY Blending Synthetic Pheromones of Cerambycid Beetles to Develop

    E-Print Network [OSTI]

    Hanks, Lawrence M.

    (F.),Neoclytusmucronatus(F.),andXylotrechuscolonus(F.).Beetlesofthesespecieswere signiÞcantly attracted to synthetic blends that contained their pheromone components (isomers of 3FOREST ENTOMOLOGY Blending Synthetic Pheromones of Cerambycid Beetles to Develop Trap Lures.1603/EC11434 ABSTRACT We evaluated attraction of cerambycid beetle species to blends of known cerambycid

  8. The Evolution of Creationist Movements

    E-Print Network [OSTI]

    Matzke, Nicholas J.

    2010-01-01

    P. Living with Darwin: evolution, design, and the future ofover creation and evolution. New York: Oxford Universityexample of darwinian evolution in action. Evolution:

  9. Target Discrimination in Synthetic Aperture Radar (SAR) using Artificial Neural Networks 1 TargetDiscriminationinSyntheticApertureRadar(SAR)

    E-Print Network [OSTI]

    Slatton, Clint

    Target Discrimination in Synthetic Aperture Radar (SAR) using Artificial Neural Networks 1 Target principe@cnel.ufl.edu Abstract: This paper addresses target discrimination in synthetic aperture radar (SAR classification but here the goal is discrimination. We will show that the two applications require different cost

  10. Motion Measurement for Synthetic Aperture Radar.

    SciTech Connect (OSTI)

    Doerry, Armin W.

    2015-01-01

    Synthetic Aperture Radar (SAR) measures radar soundings from a set of locations typically along the flight path of a radar platform vehicle. Optimal focusing requires precise knowledge of the sounding source locations in 3 - D space with respect to the target scene. Even data driven focusing techniques (i.e. autofocus) requires some degree of initial fidelity in the measurements of the motion of the radar. These requirements may be quite stringent especially for fine resolution, long ranges, and low velocities. The principal instrument for measuring motion is typically an Inertial Measurement Unit (IMU), but these instruments have inherent limi ted precision and accuracy. The question is %22How good does an IMU need to be for a SAR across its performance space?%22 This report analytically relates IMU specifications to parametric requirements for SAR. - 4 - Acknowledgements Th e preparation of this report is the result of a n unfunded research and development activity . Although this report is an independent effort, it draws heavily from limited - release documentation generated under a CRADA with General Atomics - Aeronautical System, Inc. (GA - ASI), and under the Joint DoD/DOE Munitions Program Memorandum of Understanding. Sandia National Laboratories is a multi - program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of En ergy's National Nuclear Security Administration under contract DE - AC04 - 94AL85000.

  11. Naphthene upgrading with pillared synthetic clay catalysts

    SciTech Connect (OSTI)

    Sharma, R.K.; Olson, E.S. [Univ. of North Dakota, Grand Forks, ND (United States)

    1995-12-31

    Catalytic hydrotreatment of methylcyclohexane was investigated to model upgrading of coal-derived naphthenes. Nickel-substituted synthetic mica montmorillonite (NiSMM), alumina-pillared NiSMM and Zirconia-pillared NiSMM were prepared and tested for hydrocracking and hydroisomerization of methylcyclohexane. Infrared and thermal desorption studies of the pyridine-adsorbed catalysts indicated the presence of Lewis and Bronsted acid sites. Total acidity and surface area increased with pillaring of NiSMM with polyoxy aluminum and polyoxy zirconium cations. Methylcyclohexane was reacted with these catalysts under a variety of conditions. Pillared clays gave higher gas yields and higher hydrocracking but lower hydroisomerization activity than nonpillared clay. The majority of the products were branched alkanes (isoparaffinic). These catalysts effectively use hydrogen as indicated by the minimal formation of aromatic hydrocarbons, coke, or other oligomeric materials. The effect of various operating conditions, i.e., reaction temperature, contact time, H{sub 2} pressure, and catalyst, on the product distribution will be described.

  12. Towards a library of synthetic galaxy spectra and preliminary results of classification and parametrization of unresolved galaxies for Gaia

    E-Print Network [OSTI]

    P. Tsalmantza; M. Kontizas; C. A. L. Bailer-Jones; B. Rocca-Volmerange; R. Korakitis; E. Kontizas; E. Livanou; A. Dapergolas; I. Bellas-Velidis; A. Vallenari; M. Fioc

    2007-06-14

    Aims:The Gaia astrometric survey mission will, as a consequence of its scanning law, obtain low resolution optical (330-1000 nm) spectrophotometry of several million unresolved galaxies brighter than V=22. We present the first steps in a project to design and implement a classification system for these data. The goal is both to determine morphological classes and to estimate intrinsic astrophysical parameters via synthetic templates. Here we describe (1) a new library of synthetic galaxy spectra, and (2) first results of classification and parametrization experiments using simulated Gaia spectrophotometry of this library. Methods:We have created a large grid of synthetic galaxy spectra using the PEGASE.2 code, which is based on galaxy evolution models that take into account metallicity evolution, extinction correction, emission lines (with stellar spectra based on the BaSeL library). Our classification and regression models are Support Vector Machines (SVMs), which are kernel-based nonlinear estimators. Results:We produce a basic library of about 4000 zero redshift galaxy spectra covering the main Hubble types over wavelength range 250 to 1050 nm at a sampling of 1 nm or less. It is computed on a regular grid of four key astrophysical parameters for each type and for intermediate random values of the same parameters. An extended library reproduces this at a series of redshifts. Initial results from the SVM classifiers and parametrizers are promising, indicating that Hubble types can be reliably predicted and several parameters estimated with low bias and variance. Comparing the colours of our synthetic library with Sloan Digital Sky Survey (SDSS) spectra we find good agreement over the full range of Hubble types and parameters.

  13. THE EVOLUTION OF RECOMBINATION

    E-Print Network [OSTI]

    Johnston, Mark

    CHAPTER 7 THE EVOLUTION OF RECOMBINATION J. Maynard Smith INTRODUcnON Recombination depends responsible for the evolution of these genes? Typically, population geneticists explain the evolution the fitness (survival and fecundity) of that individual. Can the evolution of recombination genes be explained

  14. Earth's Mineral Evolution

    E-Print Network [OSTI]

    Downs, Robert T.

    Earth's Mineral Evolution :: Astrobiology Magazine - earth science - evol...rth science evolution Extreme Life Mars Life Outer Planets Earth's Mineral Evolution Summary (Nov 14, 2008): New research. Display Options: Earth's Mineral Evolution Based on a CIW news release Mineral Kingdom Has Co

  15. Computational optimization of synthetic water channels.

    SciTech Connect (OSTI)

    Rogers, David Michael; Rempe, Susan L. B.

    2012-12-01

    Membranes for liquid and gas separations and ion transport are critical to water purification, osmotic energy generation, fuel cells, batteries, supercapacitors, and catalysis. Often these membranes lack pore uniformity and robustness under operating conditions, which can lead to a decrease in performance. The lack of uniformity means that many pores are non-functional. Traditional membranes overcome these limitations by using thick membrane materials that impede transport and selectivity, which results in decreased performance and increased operating costs. For example, limitations in membrane performance demand high applied pressures to deionize water using reverse osmosis. In contrast, cellular membranes combine high flux and selective transport using membrane-bound protein channels operating at small pressure differences. Pore size and chemistry in the cellular channels is defined uniformly and with sub-nanometer precision through protein folding. The thickness of these cellular membranes is limited to that of the cellular membrane bilayer, about 4 nm thick, which enhances transport. Pores in the cellular membranes are robust under operating conditions in the body. Recent efforts to mimic cellular water channels for efficient water deionization produced a significant advance in membrane function. The novel biomimetic design achieved a 10-fold increase in membrane permeability to water flow compared to commercial membranes and still maintained high salt rejection. Despite this success, there is a lack of understanding about why this membrane performs so well. To address this lack of knowledge, we used highperformance computing to interrogate the structural and chemical environments experienced by water and electrolytes in the newly created biomimetic membranes. We also compared the solvation environments between the biomimetic membrane and cellular water channels. These results will help inform future efforts to optimize and tune the performance of synthetic biomimetic membranes for applications in water purification, energy, and catalysis.

  16. Synthetic strategies for the design of platinum anticancer drug candidates

    E-Print Network [OSTI]

    Wilson, Justin Jeff

    2013-01-01

    Chapter 1. The Synthetic Chemistry of Platinum Anticancer Agents Since the inception of cisplatin as a clinically approved anticancer agent, a large number of platinum compounds have been synthesized with the aim of finding ...

  17. A Transport Synthetic Acceleration method for transport iterations 

    E-Print Network [OSTI]

    Ramone, Gilles Lionel

    1996-01-01

    We present a family of Transport Synthetic Acceleration (TSA) methods to iteratively solve within-group scattering problems. A single iteration in these schemes consists of a transport sweep followed by a low-order calculation ...

  18. Microwave-induced thermoacoustic tomography: reconstruction by synthetic aperture 

    E-Print Network [OSTI]

    Feng, Dazi

    2001-01-01

    We have applied the synthetic-aperture method to linear-scanning microwave-induced thermoacoustic tomography in biological tissues. A non-focused ultrasonic transducer was used to receive thermoacoustic signals, to which the delay-and-sum algorithm...

  19. Synthetic scaffolds and protein assemblies for engineering applications

    E-Print Network [OSTI]

    Norville, Julie Erin, 1980-

    2004-01-01

    S-layer proteins, which naturally self-assemble on the exterior of cells, provide an interesting basis for the creation of synthetic scaffolds. In this thesis, I created a plasmid which produces a recombinant form of a ...

  20. Amino : a domestic system for synthetic biology and continuous culturing

    E-Print Network [OSTI]

    Legault, Julie, S.M. Massachusetts Institute of Technology

    2015-01-01

    With the ability to transfer a trait from one creature to another purposefully, synthetic biology is advancing across unforeseen domains. From algae cells that convert carbon dioxide to fuel, biocementation bacteria to ...

  1. What rough beast? Synthetic Biology and the Future of Biosecurity

    E-Print Network [OSTI]

    Mohr, Scott C.

    Synthetic biology seeks to create modular biological parts that can be assembled into useful devices, allowing the modification of biological systems with greater reliability, at lower cost, with greater speed, and by a ...

  2. Development of a synthetic phase contrast imaging diagnostic

    E-Print Network [OSTI]

    Rost, Jon C.

    A “synthetic diagnostic” has been developed to calculate the expected experimental response of phase contrast imaging (PCI), a scattering diagnostic used to measure density fluctuations in laboratory plasmas, to a tokamak ...

  3. Expansion of Automotive Industries to Boost the Global Synthetic...

    Open Energy Info (EERE)

    on the key players in the global synthetic and bio-based lubricants market such as BP plc, Chevron, and Exxon Mobil Corporation, including financial overview, data gained from...

  4. Defossiling Fuel: How Synthetic Biology Can Transform Biofuel Production

    E-Print Network [OSTI]

    Defossiling Fuel: How Synthetic Biology Can Transform Biofuel Production David F. Savage , Jeffrey through natural intermediates to final molecule is long, and biofuel production is perhaps the ultimate engineering, economic, political, and environmental realities. Are biofuels sustainable? Consider U

  5. Recent and future trends in synthetic greenhouse gas radiative forcing

    E-Print Network [OSTI]

    O'Doherty, S.

    Atmospheric measurements show that emissions of hydrofluorocarbons (HFCs) and hydrochlorofluorocarbons are now the primary drivers of the positive growth in synthetic greenhouse gas (SGHG) radiative forcing. We infer recent ...

  6. Synthetic reverberating activity patterns embedded in networks of cortical neurons

    E-Print Network [OSTI]

    Roni Vardi; Avner Wallach; Evi Kopelowitz; Moshe Abeles; Shimon Marom; Ido Kanter

    2012-03-26

    Synthetic reverberating activity patterns are experimentally generated by stimulation of a subset of neurons embedded in a spontaneously active network of cortical cells in-vitro. The neurons are artificially connected by means of conditional stimulation matrix, forming a synthetic local circuit with a predefined programmable connectivity and time-delays. Possible uses of this experimental design are demonstrated, analyzing the sensitivity of these deterministic activity patterns to transmission delays and to the nature of ongoing network dynamics.

  7. The Evolution of Human Cooperation

    E-Print Network [OSTI]

    Gintis, Herbert; Doebeli, Michael; Flack, Jessica

    2012-01-01

    684 Gintis, H. 2011. The Evolution of Human Cooperation.misunderstandings about cultural evolution. Human Nat. 19,Feldman, M. , 1981. Cultural Evolution. Princeton University

  8. SIMULATING EVOLUTION OF TECHNOLOGY

    E-Print Network [OSTI]

    SIMULATING EVOLUTION OF TECHNOLOGY: AN AID TO ENERGY POLICY ANALYSIS A CASE STUDY OF STRATEGIES Approval Name: John Nyboer Degree: Doctor of Philosophy Title of Thesis: Simulating Evolution of Technology

  9. Apparatus, systems, and methods for ultrasound synthetic aperature focusing

    DOE Patents [OSTI]

    Schuster, George J.; Crawford, Susan L.; Doctor, Steven R.; Harris, Robert V.

    2005-04-12

    One form of the present invention is a technique for interrogating a sample with ultrasound which includes: generating ultrasonic energy data corresponding to a volume of a sample and performing a synthetic aperture focusing technique on the ultrasonic energy data. The synthetic aperture focusing technique includes: defining a number of hyperbolic surfaces which extend through the volume at different depths and a corresponding number of multiple element accumulation vectors, performing a focused element calculation procedure for a group of vectors which are representative of the interior of a designated aperture, performing another focused element calculation procedure for vectors corresponding to the boundary of the aperture, and providing an image corresponding to features of the sample in accordance with the synthetic aperture focusing technique.

  10. Kapitza problem for the magnetic moments of synthetic antiferromagnetic systems

    SciTech Connect (OSTI)

    Dzhezherya, Yu. I.; Demishev, K. O.; Korenivskii, V. N.

    2012-08-15

    The dynamics of magnetization in synthetic antiferromagnetic systems with the magnetic dipole coupling in a rapidly oscillating field has been examined. It has been revealed that the system can behave similar to the Kapitza pendulum. It has been shown that an alternating magnetic field can be efficiently used to control the magnetic state of a cell of a synthetic antiferromagnet. Analytical relations have been obtained between the parameters of such an antiferromagnet and an external magnetic field at which certain quasistationary states are implemented.

  11. Dual chain synthetic heparin-binding growth factor analogs

    DOE Patents [OSTI]

    Zamora, Paul O. (Gaithersburg, MD); Pena, Louis A. (Poquott, NY); Lin, Xinhua (Plainview, NY)

    2012-04-24

    The invention provides synthetic heparin-binding growth factor analogs having two peptide chains each branched from a branch moiety, such as trifunctional amino acid residues, the branch moieties separated by a first linker of from 3 to about 20 backbone atoms, which peptide chains bind a heparin-binding growth factor receptor and are covalently bound to a non-signaling peptide that includes a heparin-binding domain, preferably by a second linker, which may be a hydrophobic second linker. The synthetic heparin-binding growth factor analogs are useful as pharmaceutical agents, soluble biologics or as surface coatings for medical devices.

  12. Dual chain synthetic heparin-binding growth factor analogs

    DOE Patents [OSTI]

    Zamora, Paul O. (Gaithersburg, MD); Pena, Louis A. (Poquott, NY); Lin, Xinhua (Plainview, NY)

    2009-10-06

    The invention provides synthetic heparin-binding growth factor analogs having two peptide chains each branched from a branch moiety, such as trifunctional amino acid residues, the branch moieties separated by a first linker of from 3 to about 20 backbone atoms, which peptide chains bind a heparin-binding growth factor receptor and are covalently bound to a non-signaling peptide that includes a heparin-binding domain, preferably by a second linker, which may be a hydrophobic second linker. The synthetic heparin-binding growth factor analogs are useful as pharmaceutical agents, soluble biologics or as surface coatings for medical devices.

  13. Resolution and synthetic aperture characterization of sparse radar arrays

    E-Print Network [OSTI]

    Stiles, James Marion; Goodman, N. A.

    2003-07-01

    : RESOLUTION AND SYNTHETIC APERTURE CHARACTERIZATION 923 position in each of three spatial directions. These are, by definition, the spatial frequencies k x (x), k y (x), and k z (x) of the wave scattered from a target at x. Likewise, the fourth term provides..., the transmitting antenna can be focused on the mean scatterer location ¯ x by forcing a phase taper of ª a (l)=#0;?(k 0 l ) † ¢l: (24) Then, the transmit pattern is g(x)= #0;= S A #0;Mw l (l)#0;Mexp(#0;?j¢x † ¤ l ¢l)dl: (25) B. Synthetic Aperture Interpretation...

  14. Factors Contributing to Petroleum Foaming. 2. Synthetic Crude Oil Systems

    E-Print Network [OSTI]

    Kilpatrick, Peter K.

    Factors Contributing to Petroleum Foaming. 2. Synthetic Crude Oil Systems Nael N. Zaki, Michael K to the petroleum industry. Nonaqueous foams occur in the production of and refining of crude oil. Crude oil foams can pose major problems for operators of gas/oil separation plants, causing a loss of crude

  15. Co-transport of H+ by a synthetic prodigiosin mimic{

    E-Print Network [OSTI]

    Smith, Bradley D.

    Co-transport of H+ /Cl2 by a synthetic prodigiosin mimic{ Philip A. Gale,*a Mark E. Light,a Beth Mc.1039/b503906a An amidopyrrole with appended imidazole group can bind and co-transport H+ /Cl2 across of the weak bases are compounds that act as H+ /Cl2 co-transporters. The best known examples

  16. SPE-163690-MS Synthetic, Geomechanical Logs for Marcellus Shale

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    SPE-163690-MS Synthetic, Geomechanical Logs for Marcellus Shale M. O. Eshkalak, SPE, S. D of hydrocarbons from the reservoirs, notably shale, is attributed to realizing the key fundamentals of reservoir and mineralogy is crucial in order to identify the "right" pay-zone intervals for shale gas production. Also

  17. Library of libraries: A novel approach in synthetic combinatorial libraries

    E-Print Network [OSTI]

    Lam, Kit S.

    are defined. In other words, the first step of the iterative process consists of screening libraries with veryLibrary of libraries: A novel approach in synthetic combinatorial libraries Nikolai F. Sepetov peptide libraries for pharmacological purposes is not necessarily to find the most active peptide

  18. New synthetic derivatives of triterpenoids in the treatment of cancer 

    E-Print Network [OSTI]

    Papineni, Sabitha

    2009-05-15

    Methyl 2-cyano-3,11-dioxo-18?-olean-1,12-dien-30-oate (?-CDODA-Me) and methyl 2-cyano-3,11-dioxo-18?-olean-1,12-dien-30-oate (?-CDODA-Me ) isomers are synthetic analogs of the naturally occurring triterpenoid glycyrrhetinic ...

  19. HIGH SCHOOL PHYSICS PATHWAY: TEACHERS HELPING TEACHERS THROUGH SYNTHETIC INTERVIEWS*

    E-Print Network [OSTI]

    , physics pedagogy, physics education 1. INTRODUCTION Physics Teaching Web Advisory (Pathway) is a researchHIGH SCHOOL PHYSICS PATHWAY: TEACHERS HELPING TEACHERS THROUGH SYNTHETIC INTERVIEWS* *Published the iterative development of a dynamic web environment for exploring physics pedagogy: the Physics Teaching Web

  20. Electricity Generation from Synthetic Acid-Mine Drainage (AMD) Water

    E-Print Network [OSTI]

    Electricity Generation from Synthetic Acid-Mine Drainage (AMD) Water using Fuel Cell Technologies, 2007. Acid-mine drainage (AMD) is difficult and costly to treat. We investigated a new approach to AMD and systems suitable for scale-up. Introduction Acid-mine drainage (AMD) is a serious environmental problem

  1. Passive Synthetic Aperture Radar Imaging of Ground Moving Targets

    E-Print Network [OSTI]

    Yazici, Birsen

    waves due to illuminating sources of opportunity such as commercial television, radio, and cell phone of opportunity such as radio, cell phone, and television transmission towers. The absence of active signal synthetic aperture radar. A passive radar imaging system uses small, mobile receivers that do not radiate

  2. Synthetic aperture design for increased SAR image rate

    DOE Patents [OSTI]

    Bielek, Timothy P. (Albuquerque, NM); Thompson, Douglas G. (Albuqerque, NM); Walker, Bruce C. (Albuquerque, NM)

    2009-03-03

    High resolution SAR images of a target scene at near video rates can be produced by using overlapped, but nevertheless, full-size synthetic apertures. The SAR images, which respectively correspond to the apertures, can be analyzed in sequence to permit detection of movement in the target scene.

  3. Tunable Signal Processing in Synthetic MAP Kinase Cascades

    E-Print Network [OSTI]

    Collins, James J.

    Tunable Signal Processing in Synthetic MAP Kinase Cascades Ellen C. O'Shaughnessy,1 Santhosh Palani profiles. This work demonstrates that tunable signal processing is inherent to minimal MAPK modules are ubiquitous, versatile signaling modules found in all eukaryotic cells. They transmit and process signals

  4. Microwave-induced thermoacoustic tomography: Reconstruction by synthetic aperture

    E-Print Network [OSTI]

    Wang, Lihong

    Microwave-induced thermoacoustic tomography: Reconstruction by synthetic aperture Dazi Feng, Yuan thermoacoustic signals, to which the delay-and-sum algorithm was applied for image reconstruc- tion. We greatly-induced thermoacoustic tomography based on focused transducers. Two mi- crowave sources, which had frequencies of 9 and 3

  5. Magnetic characterization of synthetic titanomagnetites: Quantifying the recording

    E-Print Network [OSTI]

    Dunin-Borkowski, Rafal E.

    Kasama Centre for Electron Nanoscopy, Technical University of Denmark, Kongens Lyngby, Denmark Rafal, and transmission electron microscopy (TEM) demonstrate the reaction product composition consisted of mainly Fe3- x for visualization of the magnetic behavior of the synthetic Fe3-xTixO4 grains. Energy dispersive X-ray analysis

  6. Entrainment of a Population of Synthetic Genetic Oscillators

    E-Print Network [OSTI]

    Tsimring, Lev S.

    Entrainment of a Population of Synthetic Genetic Oscillators Octavio Mondragón-Palomino,1 Tal-sustained oscillators that adjust their phase to the daily environmental cycles in a process known as entrainment, but quantitative insights on the entrainment of clocks are relatively sparse. We simultaneously tracked the phases

  7. Matching a Human Walking Sequence with a VRML Synthetic Model

    E-Print Network [OSTI]

    Buades Rubio, Jose María

    animation, computer vision, medical rehabilitation, virtual reality and entertainment. There is a greatMatching a Human Walking Sequence with a VRML Synthetic Model J. M. Buades, Ramon Mas and Francisco University of the Balearic Islands 07071 Palma de Mallorca, SPAIN {josemaria,ramon,paco}@anim.uib.es Abstract

  8. A Protophenomenological Analysis of Synthetic Emotion in Robots

    E-Print Network [OSTI]

    MacLennan, Bruce

    J. MacLennan* Department of Electrical Engineering & Computer Science University of Tennessee?" (a chapter submitted for the Handbook of Research on Synthetic Emotions and Sociable Robotics: New a renaissance in the scientific investigation of consciousness, but a fundamental issue has been neglected

  9. What determines galactic evolution?

    E-Print Network [OSTI]

    Francesca Matteucci

    2002-10-24

    We are briefly introducing the most important ingredients to study galactic evolution. In particular the roles of star formation, nucleosynthesis and gas flows. Then we are discussing the two different approaches to galactic evolution: the stellar population approach (chemical evolution models) and the hierarchical clustering scenario for galaxy formation. It is shown that there are still some controversial points in the two approaches, as evident in the brief summary of the discussion.

  10. Quantum Evolution and Anticipation

    E-Print Network [OSTI]

    Hans-Rudolf Thomann

    2010-03-04

    In a previous paper we have investigated quantum states evolving into mutually orthogonal states at equidistant times, and the quantum anticipation effect exhibited by measurements at one half step. Here we extend our analyzes of quantum anticipation to general type quantum evolutions and spectral measures and prove that quantum evolutions possessing an embedded orthogonal evolution are characterized by positive joint spectral measure. Furthermore, we categorize quantum evolution, assess anticipation strength and provide a framework of analytic tools and results, thus preparing for further investigation and experimental verification of anticipation in concrete physical situations such as the H-atom, which we have found to exhibit anticipation.

  11. QCD Evolution Workshop: Introduction

    E-Print Network [OSTI]

    Alexei Prokudin

    2012-10-15

    The introduction talk given at the beginning of QCD Evolution workshop held in Thomas Jefferson National Accelerator Facility (Jefferson Lab) on May 14 -17, 2012.

  12. The Evolution Matrix: Recovering Software Evolution using Software Visualization Techniques

    E-Print Network [OSTI]

    Lanza, Michele

    The Evolution Matrix: Recovering Software Evolution using Software Visualization Techniques Michele - ABSTRACT One of the major problems in software evolution is coping with the complexity which stems from and effective way to visualize the evolution of software systems which helps to recover the evolution of object

  13. Cultural evolution is not equivalent to Darwinian evolution

    E-Print Network [OSTI]

    Reader, Simon

    Cultural evolution is not equivalent to Darwinian evolution Dwight W. Read Department://www.sscnet.ucla.edu/anthro/faculty/read/ Abstract: Darwinian evolution, defined as evolution arising from selection based directly on the properties. The difficulty with linking Darwinian evolution to structural properties of cultural constructs is exemplified

  14. The evolution of hod mice The evolution of hod mice

    E-Print Network [OSTI]

    Koellner, Peter

    The evolution of hod mice The evolution of hod mice Grigor Sargsyan UCLA Harvard Mamls February 20, 2011 Cambridge, Massachusetts The evolution of hod mice Grigor Sargsyan #12;The evolution of hod mice The beginnings CH in HOD Theorem (Harrington-Kechris) Assume V = L(R) + AD. Then HOD CH. The evolution of hod

  15. Safe, secure and ethical? : assessing and regulating risks associated with synthetic biology

    E-Print Network [OSTI]

    Regårdh, Pernilla C. (Pernilla Christina)

    2011-01-01

    Synthetic biology is an emerging field, with a rapidly developing academic-industrial base and the promise of extensive product launches over the next few years. An intense debate over the risks and benefits of synthetic ...

  16. Method and apparatus for removing heat from electronic devices using synthetic jets

    DOE Patents [OSTI]

    Sharma, Rajdeep; Weaver, Jr., Stanton Earl; Seeley, Charles Erklin; Arik, Mehmet; Icoz, Tunc; Wolfe, Jr., Charles Franklin; Utturkar, Yogen Vishwas

    2014-04-15

    An apparatus for removing heat comprises a heat sink having a cavity, and a synthetic jet stack comprising at least one synthetic jet mounted within the cavity. At least one rod and at least one engaging structure to provide a rigid positioning of the at least one synthetic jet with respect to the at least one rod. The synthetic jet comprises at least one orifice through which a fluid is ejected.

  17. Evolution: a brief Autumn 2014

    E-Print Network [OSTI]

    Brown, Sally

    9/28/14 1 ESRM 350 Evolution: a brief review Autumn 2014 Nothing in biology makes sense except in the light of evolution. - Theodosius Dobzhansky, 1973 #12;9/28/14 2 What is Evolution? What is Evolution *Darwin (1859) On the Origin of Species #12;9/28/14 3 What is Evolution? · Modification through descent

  18. Synthetic Lung Tumor Data Sets for Comparison of Volumetric Algorithms1

    E-Print Network [OSTI]

    Bernal, Javier

    Synthetic Lung Tumor Data Sets for Comparison of Volumetric Algorithms1 Adele P. Peskin of synthetic lung tumor data in which synthetic tumors of known volume are embedded in clinical lung computerized tomographic (CT) data in different background settings in the lung. Because the change

  19. A comparison between synthetic jets and continuous jets B.L. Smith, G.W. Swift

    E-Print Network [OSTI]

    Smith, Barton L.

    A comparison between synthetic jets and continuous jets B.L. Smith, G.W. Swift Abstract Experimental measurements and flow visualiza- tion of synthetic jets and continuous jets with matched Reynolds numbers are described. Although they have the same profile shape, synthetic jets are wider and slower than

  20. Cultural evolution is not equivalent to Darwinian evolution

    E-Print Network [OSTI]

    Read, Dwight W

    2006-01-01

    rounds of microevolution. Evolution & Development, 2(2), 78-An assessment of cul- tural evolution and a new synthesis.variation, and the evolution of culture” by D. Rindos.

  1. Renewable Energy from Synthetic Biology (LBNL Science at the Theater)

    ScienceCinema (OSTI)

    Keasling, Jay

    2011-04-28

    Jay Keasling, co-leader of Berkeley Lab's Helios Project, is a groundbreaking researcher in the new scientific field of synthetic biology. In Helios, he directs the biology program, incorporating a range of approaches to increasing the efficacy and economy of plants and cellulose-degrading microbes to make solar-based fuels. He is a UC Berkeley professor of Chemical and Bioengineering, and founder of Amyris Biotechnologies, a company that was honored as a Technology Pioneer for 2006 by the World Economic Forum. Keasling has succeeded in using synthetic biology to develop a yeast-based production scheme for precursors of the antimalarial drug artemisinin in work funded by the Bill & Melinda Gates Foundation.

  2. Synthetic aperture integration (SAI) algorithm for SAR imaging

    DOE Patents [OSTI]

    Chambers, David H; Mast, Jeffrey E; Paglieroni, David W; Beer, N. Reginald

    2013-07-09

    A method and system for detecting the presence of subsurface objects within a medium is provided. In some embodiments, the imaging and detection system operates in a multistatic mode to collect radar return signals generated by an array of transceiver antenna pairs that is positioned across the surface and that travels down the surface. The imaging and detection system pre-processes the return signal to suppress certain undesirable effects. The imaging and detection system then generates synthetic aperture radar images from real aperture radar images generated from the pre-processed return signal. The imaging and detection system then post-processes the synthetic aperture radar images to improve detection of subsurface objects. The imaging and detection system identifies peaks in the energy levels of the post-processed image frame, which indicates the presence of a subsurface object.

  3. Pentavalent Uranium Chemistry - Synthetic Pursuit Of A Rare Oxidation State

    SciTech Connect (OSTI)

    Graves, Christopher R; Kiplinger, Jaqueline L

    2009-01-01

    This feature article presents a comprehensive overview of pentavalent uranium systems in non-aqueous solution with a focus on the various synthetic avenues employed to access this unusual and very important oxidation state. Selected characterization data and theoretical aspects are also included. The purpose is to provide a perspective on this rapidly evolving field and identify new possibilities for future developments in pentavalent uranium chemistry.

  4. CO2 Removal using a Synthetic Analogue of Carbonic Anhydrase

    SciTech Connect (OSTI)

    Harry Cordatos

    2010-09-14

    Project attempts to develop a synthetic analogue for carbonic anhydrase and incorporate it in a membrane for separation of CO2 from coal power plant flue gas. Conference poster presents result of first 9 months of project progress including concept, basic system architecture and membrane properties target, results of molecular modeling for analogue - CO2 interaction, and next steps of testing analogue resistance to flue gas contaminants.

  5. Evolution of ageing since Darwin

    E-Print Network [OSTI]

    Rose, Michael R; Burke, Molly K; Shahrestani, Parvin; Mueller, Laurence D

    2008-01-01

    S. 1932 The causes of evolution. Longmans, London. HaldaneL. and Rose M. R. 2007 An evolution- ary heterogeneity modelDrosophila melanogaster. Evolution 46, 76–91. Pletcher S. D.

  6. Phylogenetic Models: Algebra and Evolution

    E-Print Network [OSTI]

    Allman, Elizabeth S.

    Phylogenetic Models: Algebra and Evolution Elizabeth S. Allman Dept. of Mathematics and Statistics evolutionary tree 2. sequence evolution probabilistic models on trees 3. phylogenetic ideals and varieties history. IMA -- Phylogenetic Models: Algebra and Evolution Slide 1 #12;For phylogenetic inference

  7. Method for producing and regenerating a synthetic CO[sub 2] acceptor

    DOE Patents [OSTI]

    Lancet, M. S.; Curran, G. P.; Gorin, E.

    1982-05-18

    A method is described for producing a synthetic CO[sub 2] acceptor by feeding a mixture of finely divided silica and at least one finely divided calcium compound selected from the group consisting of calcium oxide and calcium carbonate to a fluidized bed; operating the fluidized bed at suitable conditions to produce pellets of synthetic CO[sub 2] acceptor and recovering the pellets of synthetic CO[sub 2] acceptor from the fluidized bed. Optionally, spent synthetic CO[sub 2] acceptor can be charged to the fluidized bed to produce regenerated pellets of synthetic CO[sub 2] acceptor. 1 fig.

  8. Method for producing and regenerating a synthetic CO.sub.2 acceptor

    DOE Patents [OSTI]

    Lancet, Michael S. (Pittsburgh, PA); Curran, George P. (Pittsburgh, PA); Gorin, Everett (San Rafael, CA)

    1982-01-01

    A method for producing a synthetic CO.sub.2 acceptor by feeding a mixture of finely divided silica and at least one finely divided calcium compound selected from the group consisting of calcium oxide and calcium carbonate to a fluidized bed; operating the fluidized bed at suitable conditions to produce pellets of synthetic CO.sub.2 acceptor and recovering the pellets of synthetic CO.sub.2 acceptor from the fluidized bed. Optionally, spent synthetic CO.sub.2 acceptor can be charged to the fluidized bed to produce regenerated pellets of synthetic CO.sub.2 acceptor.

  9. The time as an emergent property of quantum mechanics, a synthetic description of a first experimental approach

    E-Print Network [OSTI]

    E Moreva; G Brida; M Gramegna; V Giovannetti; L Maccone; M Genovese

    2015-02-11

    The "problem of time" in present physics substantially consists in the fact that a straightforward quantization of the general relativistic evolution equation and constraints generates for the Universe wave function the Wheeler-De Witt equation, which describes a static Universe. Page and Wootters considered the fact that there exist states of a system composed by entangled subsystems that are stationary, but one can interpret the component subsystems as evolving: this leads them to suppose that the global state of the universe can be envisaged as one of this static entangled state, whereas the state of the subsystems can evolve. Here we synthetically present an experiment, based on PDC polarization entangled photons, that allows showing with a practical example a situation where this idea works, i.e. a subsystem of an entangled state works as a "clock" of another subsystem.

  10. Patenting Human Evolution

    E-Print Network [OSTI]

    Torrance, Andrew W.

    2008-06-01

    to thorough analysis and debate prior to the imminent arrival of human genetic enhancement technologies. Otherwise, patent law may drive human evolution in directions either unplanned - or worse - undesired....

  11. Stochastic evolution inclusions 

    E-Print Network [OSTI]

    Bocharov, Boris

    2010-01-01

    This work is concerned with an evolution inclusion of a form, in a triple of spaces \\V -> H -> V*", where U is a continuous non-decreasing process, M is a locally square-integrable martingale and the operators A ...

  12. Representing Small Group Evolution

    E-Print Network [OSTI]

    Wormald, Nicholas

    2009-03-30

    Understanding the dynamics of network evolution rests in part on the representation chosen to characterize the evolutionary process. We offer a simple, three-parameter representation based on subgraphs that capture three ...

  13. The Evolution of War

    E-Print Network [OSTI]

    Morris, Ian

    2012-01-01

    Viking. Keeley, Lawrence. 1996. War Before Civilization. NewSocieties and the Origins of War. Ann Arbor: University ofPress. Morris: Evolution of War. Cliodynamics (2012) Vol. 3,

  14. Characteristic Evolution and Matching

    E-Print Network [OSTI]

    Jeffrey Winicour

    2005-12-08

    I review the development of numerical evolution codes for general relativity based upon the characteristic initial value problem. Progress is traced from the early stage of 1D feasibility studies to 2D axisymmetric codes that accurately simulate the oscillations and gravitational collapse of relativistic stars and to current 3D codes that provide pieces of a binary black spacetime. A prime application of characteristic evolution is to compute waveforms via Cauchy-characteristic matching, which is also reviewed.

  15. Black Holes and Galaxy Evolution

    E-Print Network [OSTI]

    David Merritt

    1999-10-29

    Supermassive binary black holes and their influence on the structure and evolution of galaxies is reviewed.

  16. Master programme in Ecology & Evolution

    E-Print Network [OSTI]

    Richner, Heinz

    of Ecology and Evolution, Baltzerstrasse 6, CH-3012 Bern save form print form #12;Master programme in Ecology of Ecology and Evolution, Baltzerstrasse 6, CH-3012 Bern #12;Master programme in Ecology & Evolution Jointly, Baltzerstrasse 6, CH-3012 Bern #12;Master programme in Ecology & Evolution Jointly organized by the Institute

  17. Apodized RFI filtering of synthetic aperture radar images.

    SciTech Connect (OSTI)

    Doerry, Armin Walter

    2014-02-01

    Fine resolution Synthetic Aperture Radar (SAR) systems necessarily require wide bandwidths that often overlap spectrum utilized by other wireless services. These other emitters pose a source of Radio Frequency Interference (RFI) to the SAR echo signals that degrades SAR image quality. Filtering, or excising, the offending spectral contaminants will mitigate the interference, but at a cost of often degrading the SAR image in other ways, notably by raising offensive sidelobe levels. This report proposes borrowing an idea from nonlinear sidelobe apodization techniques to suppress interference without the attendant increase in sidelobe levels. The simple post-processing technique is termed Apodized RFI Filtering (ARF).

  18. Fate of Mercury in Synthetic Gypsum Used for Wallboard Production

    SciTech Connect (OSTI)

    Jessica Sanderson

    2007-12-31

    This report presents and discusses results from the project 'Fate of Mercury in Synthetic Gypsum Used for Wallboard Production', performed at five different full-scale commercial wallboard plants. Synthetic gypsum produced by wet flue gas desulfurization (FGD) systems on coal-fired power plants is commonly used in the manufacture of wallboard. This practice has long benefited the environment by recycling the FGD gypsum byproduct, which is becoming available in increasing quantities, decreasing the need to landfill this material, and increasing the sustainable design of the wallboard product. However, new concerns have arisen as recent mercury control strategies involve the capture of mercury in FGD systems. The objective of this study has been to determine whether any mercury is released into the atmosphere at wallboard manufacturing plants when the synthetic gypsum material is used as a feedstock for wallboard production. The project has been co-funded by the U.S. DOE National Energy Technology Laboratory (Cooperative Agreement DE-FC26-04NT42080), USG Corporation, and EPRI. USG Corporation is the prime contractor, and URS Group is a subcontractor. The project scope included seven discrete tasks, each including a test conducted at various USG wallboard plants using synthetic gypsum from different wet FGD systems. The project was originally composed of five tasks, which were to include (1) a base-case test, then variations representing differing power plant: (2) emissions control configurations, (3) treatment of fine gypsum particles, (4) coal types, and (5) FGD reagent types. However, Task 5,could not be conducted as planned and instead was conducted at conditions similar to Task 3. Subsequently an opportunity arose to test gypsum produced from the Task 5 FGD system, but with an additive expected to impact the stability of mercury, so Task 6 was added to the project. Finally, Task 7 was added to evaluate synthetic gypsum produced at a power plant from an additional coal type. In the project, process stacks in the wallboard plant were sampled using the Ontario Hydro method. In every task, the stack locations sampled included a gypsum dryer and a gypsum calciner. In Tasks 1 and 4 through 7, the stack of the dryer for the wet wallboard product was also tested. Also at each site, in-stream process samples were collected and analyzed for mercury concentration before and after each significant step in wallboard production. These results and process data were used to construct mercury mass balances across the wallboard plants. The results from the project showed a wide range of percentage mercury losses from the synthetic gypsum feedstocks as measured by the Ontario Hydro method at the process stacks, ranging from 2% to 55% of the mercury in the gypsum feedstock. For the tasks exceeding 10% mercury loss across the wallboard plant, most of the loss occurred across the gypsum calciner. When total wallboard emissions remained below 10%, the primary emission location varied with a much less pronounced difference in emission between the gypsum dryer, calciner and board dryer. For all seven tasks, the majority of the mercury emissions were measured to be in the elemental form (Hg{sup 0}). Overall, the measured mercury loss mass rates ranged from 0.01 to 0.17 grams of mercury per dry ton of synthetic gypsum processed, or 0.01 to 0.4 pounds of mercury released per million square feet of wallboard produced from synthetic gypsum. The Coal Combustion Product Production and Use Survey from the American Coal Ash Association (ACAA) indicate that 7,579,187 short tons of synthetic gypsum were used for wallboard production in 2006. Extrapolating the results of this study to the ACAA industry usage rate, we estimate that mercury releases from wallboard production plants in 2006 ranged between 150 to 3000 pounds for the entire U.S. wallboard industry. With only seven sets of wallboard plant measurements, it is difficult to draw firm conclusions about what variables impact the mercury loss percentages across the wallboard plants. One significant o

  19. Phase correction system for automatic focusing of synthetic aperture radar

    DOE Patents [OSTI]

    Eichel, Paul H. (Albuquerque, NM); Ghiglia, Dennis C. (Placitas, NM); Jakowatz, Jr., Charles V. (Albuquerque, NM)

    1990-01-01

    A phase gradient autofocus system for use in synthetic aperture imaging accurately compensates for arbitrary phase errors in each imaged frame by locating highlighted areas and determining the phase disturbance or image spread associated with each of these highlight areas. An estimate of the image spread for each highlighted area in a line in the case of one dimensional processing or in a sector, in the case of two-dimensional processing, is determined. The phase error is determined using phase gradient processing. The phase error is then removed from the uncorrected image and the process is iteratively performed to substantially eliminate phase errors which can degrade the image.

  20. Synthetic fuel concept to steal CO2 from air

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With LivermoreSustainable Land LabEnergyNationalScienceSynthetic fuel

  1. Synthetic limbs: Rasmussen's lifelong quest | Princeton Plasma Physics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With LivermoreSustainable Land LabEnergyNationalScienceSynthetic

  2. Synthetic muscle developed with PPPL scientists' help launches | Princeton

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With LivermoreSustainable Land LabEnergyNationalScienceSyntheticPlasma

  3. Sandia National Laboratories: Synthetic Aperture Radar (SAR) Imagery

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation ofAlbuquerque AlbuquerqueCybernetics:Defense Systems &Vision,Synthetic

  4. Characteristic Evolution and Matching

    E-Print Network [OSTI]

    Jeffrey Winicour

    2012-01-12

    I review the development of numerical evolution codes for general relativity based upon the characteristic initial value problem. Progress in characteristic evolution is traced from the early stage of 1D feasibility studies to 2D axisymmetric codes that accurately simulate the oscillations and gravitational collapse of relativistic stars and to current 3D codes that provide pieces of a binary black hole spacetime. Cauchy codes have now been successful at simulating all aspects of the binary black hole problem inside an artificially constructed outer boundary. A prime application of characteristic evolution is to extend such simulations to null infinity where the waveform from the binary inspiral and merger can be unambiguously computed. This has now been accomplished by Cauchy-characteristic extraction, where data for the characteristic evolution is supplied by Cauchy data on an extraction worldtube inside the artificial outer boundary. The ultimate application of characteristic evolution is to eliminate the role of this outer boundary by constructing a global solution via Cauchy-characteristic matching. Progress in this direction is discussed.

  5. Quantum evolution across singularities

    E-Print Network [OSTI]

    Ben Craps; Oleg Evnin

    2008-01-21

    Attempts to consider evolution across space-time singularities often lead to quantum systems with time-dependent Hamiltonians developing an isolated singularity as a function of time. Examples include matrix theory in certain singular time-dependent backgounds and free quantum fields on the two-dimensional compactified Milne universe. Due to the presence of the singularities in the time dependence, the conventional quantum-mechanical evolution is not well-defined for such systems. We propose a natural way, mathematically analogous to renormalization in conventional quantum field theory, to construct unitary quantum evolution across the singularity. We carry out this procedure explicitly for free fields on the compactified Milne universe and compare our results with the matching conditions considered in earlier work (which were based on the covering Minkowski space).

  6. Secular evolution in galaxies

    E-Print Network [OSTI]

    F. Combes

    2006-08-29

    New observations in favour of a significant role of secular evolution are reviewed: central star formation boosted in pseudo-bulge barred galaxies, relations between bulge and disk, evidence for rejuvenated bulges. Numerical simulations have shown that secular evolution can occur through a cycle of bar formation and destruction, in which the gas plays a major role. Since bars are weakened or destroyed in gaseous disks, the high frequency of bars observed today requires external cold gas accretion, to replenish the disk and allow a new bar formation. The rate of gas accretion from external filaments is compatible with what is observed in cosmological simulations.

  7. Molecular Interactions of Plutonium(VI) with Synthetic Manganese-Substituted Goethite

    E-Print Network [OSTI]

    Hu, Yung-Jin

    2011-01-01

    VI) with the Iron Oxide Goethite, University of California,Values for Synthetic Goethite and Pyrolusite" submitted tothe two Mn-substituted goethite minerals used in this study.

  8. Molecular Interactions of Plutonium(VI) with Synthetic Manganese-Substituted Goethite

    E-Print Network [OSTI]

    Hu, Yung-Jin

    2011-01-01

    E. , Thesis, Reactions of Plutonium(VI) with the Iron Oxideof Uranium, Neptunium, Plutonium, Americium and Technetium;Molecular Interactions of Plutonium(VI) with Synthetic

  9. Uncertainty in synthetic biology for release and possibilities for regulation under the Toxic Substances Control Act

    E-Print Network [OSTI]

    Lightfoot, Shlomiya

    2014-01-01

    The emerging field of synthetic biology is developing rapidly and promises diverse applications. Many anticipated applications, particularly those involving release of engineered microbes into the environment or human ...

  10. Fate of Mercury in Synthetic Gypsum Used for Wallboard Production

    SciTech Connect (OSTI)

    Jessica Sanderson; Gary M. Blythe; Mandi Richardson

    2006-12-01

    This report presents and discusses results from Task 6 of the study 'Fate of Mercury in Synthetic Gypsum Used for Wallboard Production,' performed at a full-scale commercial wallboard plant. Synthetic gypsum produced by wet flue gas desulfurization (FGD) systems on coal-fired power plants is commonly used in the manufacture of wallboard. This practice has long benefited the environment by recycling the FGD gypsum byproduct, which is becoming available in increasing quantities, decreasing the need to landfill this material, and increasing the sustainable design of the wallboard product. However, new concerns have arisen as recent mercury control strategies involve the capture of mercury in FGD systems. The objective of this study is to determine whether any mercury is released into the atmosphere when the synthetic gypsum material is used as a feedstock for wallboard production. The project is being co-funded by the U.S. DOE National Energy Technology Laboratory (Cooperative Agreement DE-FC26-04NT42080), USG Corporation, and EPRI. USG Corporation is the prime contractor, and URS Group is a subcontractor. The project scope now includes six discrete tasks, each conducted at various USG wallboard plants using synthetic gypsum from different FGD systems. The project was originally composed of five tasks, which were to include (1) a baseline test, then variations representing differing power plant: (2) emissions control configurations, (3) treatment of fine gypsum particles, (4) coal types, and (5) FGD reagent types. However, Task 5, which was to include testing with an alternate FGD reagent, could not be conducted as planned. Instead, Task 5 was conducted at conditions similar to Task 3, although with gypsum from an alternate FGD system. Subsequent to conducting Task 5 under these revised conditions, an opportunity arose to test gypsum produced at the same FGD system, but with an additive (Degussa Corporation's TMT-15) being used in the FGD system. TMT-15 was expected to impact the stability of mercury in synthetic gypsum used to produce wallboard, so Task 6 was added to the project to test this theory. In this project, process stacks in the wallboard plant have been sampled using the Ontario Hydro method. For every task, the stack locations sampled have included a dryer for the wet gypsum as it enters the plant and a gypsum calciner. For Tasks 1, 4, 5 and 6, the stack of the dryer for the wet wallboard product was also tested. Also at each site, in-stream process samples were collected and analyzed for mercury concentration before and after each significant step in wallboard production. The Ontario Hydro results, process sample mercury concentration data, and process data were used to construct mercury mass balances across the wallboard plants. Task 6 was conducted at a wallboard plant processing synthetic gypsum from a power plant that fires Eastern bituminous coal. The power plant has a single-loop, open spray tower limestone forced oxidation FGD system, with the forced oxidation conducted in the reaction tank integral with the FGD absorber. The FGD system has gypsum fines blow down as part of the dewatering step. The power plant is equipped with a selective catalytic reduction (SCR) system for NOX emissions control, and the SCR was in service during the time period the gypsum tested was produced. Also, as mentioned above, Degussa additive TMT-15 was being added to the FGD system when this gypsum was produced. The results of the Task 6 stack testing, as measured by the Ontario Hydro method, detected that an average of 55% of the incoming mercury was emitted during wallboard production. These losses were distributed as about 4% across the dryer mill, 6% across the board dryer kiln, and 45% across the kettle calciner. Emissions were similar to what Task 5 results showed on a percentage basis, but about 30% lower on a mass basis. The same power plant FGD system produced the synthetic gypsum used in Task 5 (with no use of TMT-15) and in Task 6 (with TMT-15 added to the FGD system). The lower emissions on a mass basis appeared

  11. Communicating Evolution as Science

    E-Print Network [OSTI]

    Thanukos, Anastasia

    2010-01-01

    JA. The locus of evolution: evo devo and the genetics ofEvo Edu Outreach (2010) 3:254–260 DOI 10.1007/s12052-010-around the sorts of things Evo Edu Outreach (2010) 3:254–260

  12. Alien Physiology, Convergent Evolution,

    E-Print Network [OSTI]

    Walter, Frederick M.

    Alien Physiology, Convergent Evolution, and fc #12;N = N* fs fGHZ fp nH fl fJ ffEufm fi fc L/T ·N Intelligent Aliens be Humanoids? #12;What might a Martian look like? Let's build an alien... #12;If we expect

  13. X-ray Moiré deflectometry using synthetic reference images

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Stutman, Dan; Valdivia, Maria Pia; Finkenthal, Michael

    2015-06-25

    Moiré fringe deflectometry with grating interferometers is a technique that enables refraction-based x-ray imaging using a single exposure of an object. To obtain the refraction image, the method requires a reference fringe pattern (without the object). Our study shows that, in order to avoid artifacts, the reference pattern must be exactly matched in phase with the object fringe pattern. In experiments, however, it is difficult to produce a perfectly matched reference pattern due to unavoidable interferometer drifts. We present a simple method to obtain matched reference patterns using a phase-scan procedure to generate synthetic Moiré images. As a result, themore »method will enable deflectometric diagnostics of transient phenomena such as laser-produced plasmas and could improve the sensitivity and accuracy of medical phase-contrast imaging.« less

  14. Time-frequency analysis of synthetic aperture radar signals

    SciTech Connect (OSTI)

    Johnston, B.

    1996-08-01

    Synthetic aperture radar (SAR) has become an important tool for remote sensing of the environment. SAR is a set of digital signal processing algorithms that are used to focus the signal returned to the radar because radar systems in themselves cannot produce the high resolution images required in remote sensing applications. To reconstruct an image, several parameters must be estimated and the quality of output image depends on the degree of accuracy of these parameters. In this thesis, we derive the fundamental SAR algorithms and concentrate on the estimation of one of its critical parameters. We show that the common technique for estimating this particular parameter can sometimes lead to erroneous results and reduced quality images. We also employ time-frequency analysis techniques to examine variations in the radar signals caused by platform motion and show how these results can be used to improve output image quality.

  15. Synthetic thrombus model for in vitro studies of laser thrombolysis

    SciTech Connect (OSTI)

    Hermes, R.E.; Trajkovska, K.

    1998-07-01

    Laser thrombolysis is the controlled ablation of a thrombus (blood clot) blockage in a living arterial system. Theoretical modeling of the interaction of laser light with thrombi relies on the ability to perform in vitro experiments with well characterized surrogate materials. A synthetic thrombus formulation may offer more accurate results when compared to in vivo clinical experiments. The authors describe the development of new surrogate materials based on formulations incorporating chick egg, guar gum, modified food starch, and a laser light absorbing dye. The sound speed and physical consistency of the materials were very close to porcine (arterial) and human (venous) thrombi. Photographic and videotape recordings of pulsed dye laser ablation experiments under various experimental conditions were used to evaluate the new material as compared to in vitro tests with human (venous) thrombus. The characteristics of ablation and mass removal were similar to that of real thrombi, and therefore provide a more realistic model for in vitro laser thrombolysis when compared to gelatin.

  16. Cadherin evolution and the origin of animals

    E-Print Network [OSTI]

    Abedin, Monika

    2010-01-01

    of Opisthokonta and the evolution of multicellularity and2000). Origin and evolution of the colonial volvocales (King, N. , (2006). Early evolution of animal cell signaling

  17. A Historical Database of Sociocultural Evolution

    E-Print Network [OSTI]

    Turchin, Peter; Whitehouse, Harvey; Francois, Pieter; Slingerland, Edward; Collard, Mark

    2012-01-01

    Historical Database of Sociocultural Evolution Peter TurchinThe Historical Database of Sociocultural Evolution, which weHistorical Database of Sociocultural Evolution. Cliodynamics

  18. Evolution of ageing since Darwin

    E-Print Network [OSTI]

    Rose, Michael R; Burke, Molly K; Shahrestani, Parvin; Mueller, Laurence D

    2008-01-01

    evolution of aging. World Scientific Publishing, Singapore.M. Matos), pp. 237–448. World Scientific Publishing, Sin-

  19. Catalyst for splitting water &Catalyst for splitting water & Synthetic Modeling of InorganicSynthetic Modeling of Inorganic

    E-Print Network [OSTI]

    Petta, Jason

    Importance Hydrogen technology in fuel cellsHydrogen technology in fuel cells As a combustion fuel, it produces of evolution ·Optimized catalyst for water splitting in all oxygenic phototrophs S0 S4 S1 S2 S3 O2 2 H O2 e- e

  20. THREE-DIMENSIONAL LONGWAVE INFRARED (LWIR) SYNTHETIC IMAGE GENERATION INCORPORATING ANGULAR EMJSSWITY EFFECTS USING RAY-

    E-Print Network [OSTI]

    Salvaggio, Carl

    . These routines require a sequence of images to evaluate tracking algorithms. The evaluation of sensor performanceTHREE-DIMENSIONAL LONGWAVE INFRARED (LWIR) SYNTHETIC IMAGE GENERATION INCORPORATING ANGULAR Memorial Drive Rochester, New York 14623-0887 ABSTRAO A technique for longwave infrared (LWIR) synthetic

  1. Monitoring of SAGD Process: Seismic Interpretation of Ray+Born Synthetic 4D Data

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Monitoring of SAGD Process: Seismic Interpretation of Ray+Born Synthetic 4D Data C. Joseph1, G ­ Monitoring of SAGD Process: Seismic Interpretation of Ray+Born Synthetic 4D Data ­ The objective of this study is to evaluate which production information can be deduced from a 4D seismic survey during

  2. Computational Study of the Effect of Slot Orientation on Synthetic Jet-Based

    E-Print Network [OSTI]

    Mittal, Rajat

    -space average of jet exit velocity during the expulsion phase, m/sec vJ = jet exit velocity, m/sec v = cross-stream1 Computational Study of the Effect of Slot Orientation on Synthetic Jet-Based Separation Control, MD-21218 Abstract A computational study is conducted to explore the effect of synthetic jet

  3. Simultaneous Inversion of Production Data and Seismic Attributes: Application to a Synthetic

    E-Print Network [OSTI]

    Boyer, Edmond

    Simultaneous Inversion of Production Data and Seismic Attributes: Application to a Synthetic SAGD and Seismic Attributes: Application to a Synthetic SAGD Produced Field Case -- The joint use of production such as facies, porosity and permeability into reservoirs from production data and seismic attributes

  4. Numerical Study of Large Aspect-Ratio Synthetic Jets B. R. Ravi*

    E-Print Network [OSTI]

    Mittal, Rajat

    Numerical Study of Large Aspect-Ratio Synthetic Jets B. R. Ravi* and R. Mittal Department jets. A rectangular synthetic jet of aspect-ratio (AR) 8.0 issuing into quiescent air at jet Reynolds number of 300 and Stokes numbers of 6.84 and a jet of infinite aspect ratio with jet Reynolds number 200

  5. The Evolutionary Systems Biology Team Synthetic Biology/Citizen Science Post-doctoral position

    E-Print Network [OSTI]

    The Evolutionary Systems Biology Team Synthetic Biology/Citizen Science Post-doctoral position We in citizen science projects.The post-doc will join the extended CRI lab that includes synthetic and systems-sourcing, DIY approaches and gamification as part of a new European- funded project, Citizen CyberLab - a three

  6. Facilitated Phospholipid Flip-Flop Using Synthetic Steroid-Derived Translocases

    E-Print Network [OSTI]

    Smith, Bradley D.

    Facilitated Phospholipid Flip-Flop Using Synthetic Steroid-Derived Translocases Timothy N. Lambert research.4 Previously, we have reported that tris(2-aminoethyl)amine (tren)-derived translocases can of significantly more active synthetic translocases derived from cholic acid.6 Cholate derivatives 1-5 were

  7. Evolution equation for quantum entanglement

    E-Print Network [OSTI]

    Loss, Daniel

    LETTERS Evolution equation for quantum entanglement THOMAS KONRAD1 , FERNANDO DE MELO2,3 , MARKUS of the time evolution of this resource under realistic conditions--that is, when corrupted by environment describes the time evolution of entanglement on passage of either component through an arbitrary noisy

  8. Evolving Evolution Steven P. Reiss

    E-Print Network [OSTI]

    Reiss, Steven P.

    Evolving Evolution Steven P. Reiss Brown University Providence, RI 02912 401-863-7641, spr@cs.brown.edu Abstract Software is changing and software evolution is going to change with it. In considering software and the problems of software evolution today we make the tacit assumption that we control the software and hence

  9. Evolution of the Macondo Well Blowout: Simulating the Effects of the Circulation and Synthetic Dispersants on the Subsea Oil

    E-Print Network [OSTI]

    Paris-Limouzy, Claire B.

    Dispersants on the Subsea Oil Transport Claire B. Paris,*, Matthieu Le Henaff,, Zachary M. Aman,§ Ajit incident, crude oil flowed into the Gulf of Mexico from 1522 m underwater. In an effort to prevent the oil in the formation of oil droplets and difficulties in measuring their size in the water column, complicated further

  10. Environment and Protostellar Evolution

    E-Print Network [OSTI]

    Zhang, Yichen

    2014-01-01

    Even today in our Galaxy, stars form from gas cores in a variety of environments, which may affect the properties of resulting star and planetary systems. Here we study the role of pressure, parameterized via ambient clump mass surface density, on protostellar evolution and appearance, focussing on low-mass, Sun-like stars and considering a range of conditions from relatively low pressure filaments in Taurus, to intermediate pressures of cluster-forming clumps like the Orion Nebula Cluster (ONC), to very high pressures that may be found in the densest Infrared Dark Clouds (IRDCs) or in the Galactic Center (GC). We present unified analytic and numerical models for collapse of prestellar cores, accretion disks, protostellar evolution and bipolar outflows, coupled to radiative transfer (RT) calculations and a simple astrochemical model to predict CO gas phase abundances. Prestellar cores in high pressure environments are smaller and denser and thus collapse with higher accretion rates and efficiencies, resulting...

  11. Fate of Mercury in Synthetic Gypsum Used for Wallboard Production

    SciTech Connect (OSTI)

    Jessica Marshall Sanderson

    2006-06-01

    This report presents and discusses results from Task 5 of the study ''Fate of Mercury in Synthetic Gypsum Used for Wallboard Production,'' performed at a full-scale commercial wallboard plant. Synthetic gypsum produced by wet flue gas desulfurization (FGD) systems on coal-fired power plants is commonly used in the manufacture of wallboard. The FGD process is used to control the sulfur dioxide emissions which would result in acid rain if not controlled. This practice has long benefited the environment by recycling the FGD gypsum byproduct, which is becoming available in increasing quantities, decreasing the need to landfill this material, and increasing the sustainable design of the wallboard product. However, new concerns have arisen as recent mercury control strategies developed for power plants involve the capture of mercury in FGD systems. The objective of this study is to determine whether any mercury is released into the atmosphere when the synthetic gypsum material is used as a feedstock for wallboard production. The project is being co-funded by the U.S. DOE National Energy Technology Laboratory (Cooperative Agreement DE-FC26-04NT42080), USG Corporation, and EPRI. USG Corporation is the prime contractor, and URS Group is a subcontractor. The project scope includes five discrete tasks, each conducted at various USG wallboard plants using synthetic gypsum from different FGD systems. The five tasks were to include (1) a baseline test, then variations representing differing power plant (2) emissions control configurations, (3) treatment of fine gypsum particles, (4) coal types, and (5) FGD reagent types. However, Task 5, which was to evaluate gypsum produced from an alternate FGD reagent, could not be conducted as planned. Instead, Task 5 was conducted at conditions similar to a previous task, Task 3, although with gypsum from an alternate FGD system. In this project, process stacks in the wallboard plant have been sampled using the Ontario Hydro method. The stack locations sampled for each task include a dryer for the wet gypsum as it enters the plant and a gypsum calciner. The stack of the dryer for the wet wallboard product was also tested as part of this task, and was tested as part of Tasks 1 and 4. Also at each site, in-stream process samples were collected and analyzed for mercury concentration before and after each significant step in wallboard production. The Ontario Hydro results, process sample mercury concentration data, and process data were used to construct mercury mass balances across the wallboard plants. Task 5 was conducted at a wallboard plant processing synthetic gypsum from a power plant that fires Eastern bituminous coal. The power plant is equipped with a selective catalytic reduction (SCR) system for NOX emissions control, but the SCR was bypassed during the time period the gypsum tested was produced. The power plant has a single-loop, open spray tower, limestone reagent FGD system, with forced oxidation conducted in a reaction tank integral with the FGD absorber. The FGD system has gypsum fines blow down as part of the dewatering step. Gypsum fines blow down is believed to be an important variable that impacts the amount of mercury in the gypsum byproduct and possibly its stability during the wallboard process. The results of the Task 5 stack testing, as measured by the Ontario Hydro method, detected that an average of 51% of the incoming mercury in the FGD gypsum was emitted during wallboard production. These losses were distributed as 2% or less each across the wet gypsum dryer and product wallboard dryer, and about 50% across the gypsum calciner. Emissions were similar to what Task 3 results showed, on both a percentage and a mass basis, for gypsum produced by a power plant firing bituminous coal and also having gypsum fines blow down as part of the FGD dewatering scheme. As was seen in the Task 1 through 4 results, most of the mercury detected in the stack testing on the wet gypsum dryer and kettle calciner was in the form of elemental mercury. In the wallboard dryer kiln, a more signific

  12. Lynx: A High-Resolution Synthetic Aperture Radar

    SciTech Connect (OSTI)

    Doerry, A.W.; Hensley, W.H.; Pace, F.; Stence, J.; Tsunoda, S.I.; Walker, B.C.; Woodring, M.

    1999-03-08

    Lynx is a high resolution, synthetic aperture radar (SAR) that has been designed and built by Sandia National Laboratories in collaboration with General Atomics (GA). Although Lynx may be operated on a wide variety of manned and unmanned platforms, it is primarily intended to be fielded on unmanned aerial vehicles. In particular, it may be operated on the Predator, I-GNAT, or Prowler II platforms manufactured by GA Aeronautical Systems, Inc. The Lynx production weight is less than 120 lb. and has a slant range of 30 km (in 4 mm/hr rain). It has operator selectable resolution and is capable of 0.1 m resolution in spotlight mode and 0.3 m resolution in stripmap mode. In ground moving target indicator mode, the minimum detectable velocity is 6 knots with a minimum target cross-section of 10 dBsm. In coherent change detection mode, Lynx makes registered, complex image comparisons either of 0.1 m resolution (minimum) spotlight images or of 0.3 m resolution (minimum) strip images. The Lynx user interface features a view manager that allows it to pan and zoom like a video camera. Lynx was developed under corporate finding from GA and will be manufactured by GA for both military and commercial applications. The Lynx system architecture will be presented and some of its unique features will be described. Imagery at the finest resolutions in both spotlight and strip modes have been obtained and will also be presented.

  13. Setting the stellar evolution clock for intermediate age populations

    E-Print Network [OSTI]

    R. Jimenez

    1999-06-04

    In this invited talk I show how the reddest and rarest galaxies at high redshift ($z \\simeq 1.5$) can be used to set the stellar evolution clock. I argue that one can confidently compute the collapse redshift of these objects. This yields to a high collapse redshift ($z>6$) and therefore their age is well constrained (in all cosmologies) between 3 and 4 Gyr. I also show that this is, indeed, the age derived using a variety of synthetic stellar population models when proper statistical tools are used to analyse their observed spectral energy distribution. This allows me to conclude that all stellar population models yield to the same consistent age for these galaxies, i.e. about 3.5 Gyr and that the stellar clock is properly set. Low ages are therefore excluded with high confidence.

  14. Experimental Study on Shear Fatigue Behavior and Stiffness Performance of Warm Mix Asphalt by adding Synthetic Wax

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    by adding Synthetic Wax C. Petita , A. Milliena , F. Canestrarib , V. Pannunziob , A. Virgilib a Université.petit@unilim.fr , Phone : +33555934519 Abstract Synthetic waxes produced by standard and registered processes may be used. The present article serves to compare the mechanical performance of a WMA produced by adding synthetic wax

  15. Jet Quenching with Parton evolution

    E-Print Network [OSTI]

    Luan Cheng; Enke Wang

    2009-10-08

    We report the evolution effects on jet energy loss with detailed balance. The initial conditions and parton evolution based on perturbative QCD in the chemical non-equilibrated medium and Bjorken expanding medium at RHIC are determined. The parton evolution affect the jet energy loss evidently. This will increase the energy and propagating distance dependence of the parton energy loss and will affect the shape of suppression of moderately high P_{T} hadron spectra.

  16. Experimental Demonstration of a Synthetic Lorentz Force by Using Radiation Pressure

    E-Print Network [OSTI]

    Šanti?, N; Aumiler, D; Buljan, H; Ban, T

    2015-01-01

    Synthetic magnetism in cold atomic gases opened the doors to many exciting novel physical systems and phenomena. Ubiquitous are the methods used for the creation of synthetic magnetic fields. They include rapidly rotating Bose-Einstein condensates employing the analogy between the Coriolis and the Lorentz force, and laser-atom interactions employing the analogy between the Berry phase and the Aharonov-Bohm phase. Interestingly, radiation pressure - being one of the most common forces induced by light - has not yet been used for synthetic magnetism. We experimentally demonstrate a synthetic Lorentz force, based on the radiation pressure and the Doppler effect, by observing the centre-of-mass motion of a cold atomic cloud. The force is perpendicular to the velocity of the cold atomic cloud, and zero for the cloud at rest. Our novel concept is straightforward to implement in a large volume, for a broad range of velocities, and can be extended to different geometries.

  17. Syntrophic exchange in synthetic microbial communities Michael T. Meea,b

    E-Print Network [OSTI]

    Collins, James J.

    modeling Microbes are abundantly found in almost every part of the world, living in communities synthetic microbiomes for various biotechnological applications (1­3). Numerous such examples have been

  18. Revisiting the security of speaker verification systems against imposture using synthetic speech 

    E-Print Network [OSTI]

    De Leon, P. L.; Apsingekar, V. R.; Pucher, M.; Yamagishi, Junichi

    2010-01-01

    In this paper, we investigate imposture using synthetic speech. Although this problem was first examined over a decade ago, dramatic improvements in both speaker verification (SV) and speech synthesis have renewed ...

  19. Global Synthetic & Bio-Based Lubricants Market | OpenEI Community

    Open Energy Info (EERE)

    picture Submitted by John55364(100) Contributor 14 May, 2015 - 05:53 Expansion of Automotive Industries to Boost the Global Synthetic and Bio-Based Lubricants Market Global...

  20. Identification of conserved chromatin-regulatory complexes among the class B synthetic multivulva proteins

    E-Print Network [OSTI]

    Harrison, Melissa M

    2006-01-01

    The class A, B, and C synthetic Multivulva (synMuv) genes act redundantly to antagonize Ras-mediated vulval induction in C. elegans. Many of these genes encode proteins that are likely to function in transcriptional ...

  1. A portable RNA sequence whose recognition by a synthetic antibody facilitates structural determination

    E-Print Network [OSTI]

    Koldobskaya, Yelena

    RNA crystallization and phasing represent major bottlenecks in RNA structure determination. Seeking to exploit antibody fragments as RNA crystallization chaperones, we have used an arginine-enriched synthetic Fab library ...

  2. High-field remanence properties of synthetic and natural submicrometre haematites and goethites: significance

    E-Print Network [OSTI]

    High-field remanence properties of synthetic and natural submicrometre haematites and goethites September 2004 Editor: V. Courtillot Abstract Haematite and goethite are significant magnetic components both of marine and terrestrial sediments. Variable magnetic behaviour in haematite and goethite has

  3. Landauer in the age of synthetic biology: energy consumption and information processing in biochemical networks

    E-Print Network [OSTI]

    Mehta, Pankaj; Schwab, David J

    2015-01-01

    A central goal of synthetic biology is to design sophisticated synthetic cellular circuits that can perform complex computations and information processing tasks in response to specific inputs. The tremendous advances in our ability to understand and manipulate cellular information processing networks raises several fundamental physics questions: How do the molecular components of cellular circuits exploit energy consumption to improve information processing? Can one utilize ideas from thermodynamics to improve the design of synthetic cellular circuits and modules? Here, we summarize recent theoretical work addressing these questions. Energy consumption in cellular circuits serves five basic purposes: (1) increasing specificity, (2) manipulating dynamics, (3) reducing variability, (4) amplifying signal, and (5) erasing memory. We demonstrate these ideas using several simple examples and discuss the implications of these theoretical ideas for the emerging field of synthetic biology. We conclude by discussing h...

  4. Synthetic hepcidin causes rapid dose-dependent hypoferremia and is concentrated in ferroportin-containing organs

    E-Print Network [OSTI]

    Rivera, Seth; Nemeth, E; Gabayan, V; Lopez, M A; Farshidi, D; Ganz, T

    2005-01-01

    M). 8 Figure 1. Hepcidin causes a dose-dependent fall inNUMBER 6 Figure 3. Hepcidin causes a rapid, sustained fallRED CELLS Synthetic hepcidin causes rapid dose-dependent

  5. Structural Analysis of Human and Bovine Bone for Development of Synthetic Materials 

    E-Print Network [OSTI]

    Jang, Eunhwa

    2012-10-19

    With increasing demands in bone repair and replacement, this research investigates the microstructure, properties and performance of bovine bone, human bone, and synthetic materials. Doing so, experimental approaches were used to exam and compare...

  6. Synthetic mimics of mammalian cell surface receptors: prosthetic molecules that augment living cells

    E-Print Network [OSTI]

    Peterson, Blake R.

    2005-09-08

    -alkyl derivatives of 3?-cholesterylamine linked to motifs that bind cell-impermeable ligands. When added to living mammalian cells, these synthetic receptors insert into cellular plasma membranes, project ligand-binding small molecules or peptides from the cell...

  7. Volumetric analysis of fish swimming hydrodynamics using synthetic aperture particle image velocimetry

    E-Print Network [OSTI]

    Mendelson, Leah Rose

    2013-01-01

    Abstract This thesis details the implementation of a three-dimensional PIV system to study the hydrodynamics of freely swimming Giant Danio (Danio aequipinnatus). Volumetric particle fields are reconstructed using synthetic ...

  8. New target detector based on geometrical perturbation filters for polarimetric Synthetic Aperture Radar (POL-SAR) 

    E-Print Network [OSTI]

    Marino, Armando

    2010-01-01

    Synthetic Aperture Radar (SAR) is an active microwave remote sensing system able to acquire high resolution images of the scattering behaviour of an observed scene. The contribution of SAR polarimetry (POLSAR) in detection ...

  9. Strategies for designing, testing and demonstrating safety : what synthetic biology can learn from retrospective cases

    E-Print Network [OSTI]

    Yeddanapudi, Neelima, 1976-

    2009-01-01

    Synthetic biology is an emerging technology field within the realm of genetic engineering, differing from traditional genetic engineering in that it focuses on the modularization of genetic parts and the creation of de ...

  10. Modeling of D/C motor driven synthetic jet acutators for flow separation control 

    E-Print Network [OSTI]

    Balasubramanian, Ashwin Kumar

    2004-11-15

    The objective of this research is to present a theoretical study of the compressibility effects on the performance of an electric D/C motor driven synthetic jet actuator for flow separation control. Hot wire anemometer experiments were conducted...

  11. Ribozyme-based insulator parts buffer synthetic circuits from genetic context

    E-Print Network [OSTI]

    Lou, Chunbo

    Synthetic genetic programs are built from circuits that integrate sensors and implement temporal control of gene expression. Transcriptional circuits are layered by using promoters to carry the signal between circuits. In ...

  12. Interbilayer-crosslinked multilamellar vesicles as synthetic vaccines for potent humoral and cellular immune responses

    E-Print Network [OSTI]

    Moon, James J.

    Vaccines based on recombinant proteins avoid the toxicity and antivector immunity associated with live vaccine (for example, viral) vectors, but their immunogenicity is poor, particularly for CD8+ T-cell responses. Synthetic ...

  13. Focused synthetic aperture radar processing of ice-sounder data collected over the Greenland ice sheet

    E-Print Network [OSTI]

    Legarsky, J.; Gogineni, Sivaprasad; Akins, T. L.

    2001-10-01

    We developed a synthetic aperture radar (SAR) processing algorithm for airborne/spaceborne ice-sounding radar systems and applied it to data collected in Greenland. By using focused SAR (phase-corrected coherent averaging), we improved along...

  14. Procedure for matching synfuel users with potential suppliers. Appendix B. Proposed and ongoing synthetic fuel production projects

    SciTech Connect (OSTI)

    1981-08-07

    To assist the Department of Energy, Office of Fuels Conversion (OFC), in implementing the synthetic fuel exemption under the Powerplant and Industrial Fuel Use Act (FUA) of 1978, Resource Consulting Group, Inc. (RCG), has developed a procedure for matching prospective users and producers of synthetic fuel. The matching procedure, which involves a hierarchical screening process, is designed to assist OFC in: locating a supplier for a firm that wishes to obtain a synthetic fuel exemption; determining whether the fuel supplier proposed by a petitioner is technically and economically capable of meeting the petitioner's needs; and assisting the Synthetic Fuels Corporation or a synthetic fuel supplier in evaluating potential markets for synthetic fuel production. A data base is provided in this appendix on proposed and ongoing synthetic fuel production projects to be used in applying the screening procedure. The data base encompasses a total of 212 projects in the seven production technologies.

  15. Process for gasification using a synthetic CO.sub.2 acceptor

    DOE Patents [OSTI]

    Lancet, Michael S. (Pittsburgh, PA); Curran, George P. (Pittsburgh, PA)

    1980-01-01

    A gasification process is disclosed using a synthetic CO.sub.2 acceptor consisting essentially of at least one compound selected from the group consisting of calcium oxide and calcium carbonate supported in a refractory carrier matrix, the carrier having the general formula Ca.sub.5 (SiO.sub.4).sub.2 CO.sub.3. A method for producing the synthetic CO.sub.2 acceptor is also disclosed.

  16. Lighting system with thermal management system having point contact synthetic jets

    DOE Patents [OSTI]

    Arik, Mehmet; Weaver, Stanton Earl; Kuenzler, Glenn Howard; Wolfe, Jr., Charles Franklin; Sharma, Rajdeep

    2013-12-10

    Lighting system having unique configurations are provided. For instance, the lighting system may include a light source, a thermal management system and driver electronics, each contained within a housing structure. The light source is configured to provide illumination visible through an opening in the housing structure. The thermal management system includes a plurality of synthetic jets. The synthetic jets are arranged within the lighting system such that they are secured at contact points.

  17. Muffle furnace evaluation of FGD sludge-coal-clay mixtures as potential synthetic aggregates 

    E-Print Network [OSTI]

    Pettit, Jesse William

    1978-01-01

    MUFFLE FURNACE EVALUATION OF FGD SLUDGE-COAL-CLAY MIXTURES AS POTENTIAL SYNTHETIC AGGREGATES A Thesis JESSE WILLIAM PETTIT Submitted to the Graduate College of Texas ASM University in Partial fulfillment of the requirement for the degree... of MASTER OF SCIENCE December 1978 Major Suoject: Civil Engineering MUFFLE FURNACE EVALUATION OF FGD SLUDGE-COAL-CLAY MIXTURES AS POTENTIAL SYNTHETIC AGGREGATES A Theseus by JESSE WILLIAM PETTIT Approved as to style and content by: r n of Commi tee...

  18. Interactions of Jet Fuels with Nitrile O-Rings: Petroleum-Derived versus Synthetic Fuels

    SciTech Connect (OSTI)

    Gormley, R.J.; Link, D.D.; Baltrus, J.P.; Zandhuis, P.H.

    2008-01-01

    A transition from petroleum-derived jet fuels to blends with Fischer-Tropsch (F-T) fuels, and ultimately fully synthetic hydro-isomerized F-T fuels has raised concern about the fate of plasticizers in nitrile-butadiene rubber o-rings that are contacted by the fuels as this transition occurs. The partitioning of plasticizers and fuel molecules between nitrile o-rings and petroleum-derived, synthetic, and additized-synthetic jet fuels has been measured. Thermal desorption of o-rings soaked in the various jet fuels followed by gas chromatographic analysis with a mass spectrometric detector showed many of the plasticizer and stabilizer compounds were removed from the o-rings regardless of the contact fuel. Fuel molecules were observed to migrate into the o-rings for the petroleum-derived fuel as did both the fuel and additive for a synthetic F-T jet fuel additized with benzyl alcohol, but less for the unadditized synthetic fuel. The specific compounds or classes of compounds involved in the partitioning were identified and a semiquantitative comparison of relative partitioning of the compounds of interest was made. The results provide another step forward in improving the confidence level of using additized, fuIly synthetic jet fuel in the place of petroleum-derived fueL

  19. Interactions of Jet Fuels with Nitrile O-Rings: Petroleum-Derived versus Synthetic Fuels

    SciTech Connect (OSTI)

    Gormley, R.J.; Link, D.D.; Baltrus, J.P.; Zandhuis, P.H.

    2009-01-01

    A transition from petroleum-derived jet fuels to blends with Fischer-Tropsch (F-T) fuels, and ultimately fully synthetic hydro-isomerized F-T fuels has raised concern about the fate of plasticizers in nitrile-butadiene rubber a-rings that are contacted by the fuels as this transition occurs. The partitioning of plasticizers and fuel molecules between nitrile a-rings and petroleum-derived, synthetic, and additized-synthetic jet fuels has been measured. Thermal desorption of o-rings soaked in the various jet fuels followed by gas chromatographic analysis with a mass spectrometric detector showed many of the plasticizer and stabilizer compounds were removed from the o-rings regardless of the contact fuel. Fuel molecules were observed to migrate into the o-rings for the petroleum-derived fuel as did both the fuel and additive for a synthetic F-T jet fuel additized with benzyl alcohol, but less for the unadditized synthetic fuel. The specific compounds or classes of compounds involved in the partitioning were identified and a semiquantitative comparison of relative partitioning of the compounds of interest was made. The results provide another step forward in improving the confidence level of using additized, fully synthetic jet fuel in the place of petroleum-derived fuel.

  20. Lecture 26: Evolution & Exploitation of

    E-Print Network [OSTI]

    on Reverse Transcriptase Fig. 1.9 Resistance to AZT Figure 1.6 Evolution of antibiotic resistance · Bacteria of pathogens: resistance, virulence · Adaptations to disease: fever? Evolution of resistance: HIV AZT breaks down reverse transcriptase step Figure 1.3 #12;AZT Therapy Fig. 1.5 Resistance to AZT: Selection

  1. SELECTION EXPERIMENTS AND EXPERIMENTAL EVOLUTION

    E-Print Network [OSTI]

    Saltzman, Wendy

    EVOLUTION OF MICE IN DIFFERENT THERMAL ENVIRONMENTS WIND TUNNEL FLIGHT IN DROSOPHILA ENDURANCE RUNNING OF THE RATE OF ENERGY METABOLISM IN RODENTS Selection on Basal Metabolic Rate Selection on Heat Loss Rate STRAINS OF MICE AND BREEDS OF DOG CONCLUSION Experimental Evolution: Concepts, Methods, and Applications

  2. Thermal Evolution of Strange Stars

    E-Print Network [OSTI]

    Zhou Xia; Wang Lingzhi; Zhou Aizhi

    2007-09-03

    We investigated the thermal evolution of rotating strange stars with the deconfinement heating due to magnetic braking. We consider the stars consisting of either normal quark matter or color-flavor-locked phase. Combining deconfinement heating with magnetic field decay, we find that the thermal evolution curves are identical to pulsar data.

  3. Design with Uncertain Technology Evolution 

    E-Print Network [OSTI]

    Arendt, Jonathan Lee

    2012-10-19

    of technology. Techniques for modeling evolution of a technology that has multiple performance attributes are developed. An S-curve technology evolution model is used. The performance of a technology develops slowly at first, quickly during heavy R&D effort...

  4. Uppsala University Museum of Evolution

    E-Print Network [OSTI]

    Uppsala Universitet

    Uppsala University Museum of Evolution Zoology section Catalogue of type specimens. 1. C. P. Thunberg (1743-1828), Insecta #12;1 UPPSALA UNIVERSITY, MUSEUM OF EVOLUTION, ZOOLOGY SECTION (UUZM and they can be searched in the database and the printed catalogue of that collection. CONTENTS: · Introductory

  5. Chemical Evolution in Omega Centauri

    E-Print Network [OSTI]

    Verne V. Smith

    2003-10-22

    The globular cluster Omega Centauri displays evidence of a complex star formation history and peculiar internal chemical evolution, setting it apart from essentially all other globular clusters of the Milky Way. In this review we discuss the nature of the chemical evolution that has occurred within Omega Cen and attempt to construct a simple scenario to explain its chemistry.

  6. Designer synthetic media for studying microbial-catalyzed biofuel production

    SciTech Connect (OSTI)

    Tang, Xiaoyu [Biogas Inst. of Ministry of Agriculture, Chengdu (China); da Costa Sousa, Leonardo [Michigan State Univ., East Lansing, MI (United States); Jin, Mingjie [Michigan State Univ., East Lansing, MI (United States); Chundawat, Shishir [Michigan State Univ., East Lansing, MI (United States); State Univ. of New Jersey, Piscataway, NJ (United States); Chambliss, Charles [Baylor Univ., Waco, TX (United States); Lau, Ming W [Michigan State Univ., East Lansing, MI (United States); Xiao, Zeyi [Sichuan Univ., Chengdu (China); Dale, Bruce E [Michigan State Univ., East Lansing, MI (United States); Balan, Venkatesh [Michigan State Univ., East Lansing, MI (United States)

    2015-01-01

    Background: The fermentation inhibition of yeast or bacteria by lignocellulose-derived degradation products, during hexose/pentose co-fermentation, is a major bottleneck for cost-effective lignocellulosic biorefineries. To engineer microbial strains for improved performance, it is critical to understand the mechanisms of inhibition that affect fermentative organisms in the presence of major components of a lignocellulosic hydrolysate. The development of a synthetic lignocellulosic hydrolysate (SH) media with a composition similar to the actual biomass hydrolysate will be an important advancement to facilitate these studies. In this work, we characterized the nutrients and plant-derived decomposition products present in AFEX™ pretreated corn stover hydrolysate (ACH). The SH was formulated based on the ACH composition and was further used to evaluate the inhibitory effects of various families of decomposition products during Saccharomyces cerevisiae 424A (LNH-ST) fermentation. Results: The ACH contained high levels of nitrogenous compounds, notably amides, pyrazines, and imidazoles. In contrast, a relatively low content of furans and aromatic and aliphatic acids were found in the ACH. Though most of the families of decomposition products were inhibitory to xylose fermentation, due to their abundance, the nitrogenous compounds showed the most inhibition. From these compounds, amides (products of the ammonolysis reaction) contributed the most to the reduction of the fermentation performance. However, this result is associated to a concentration effect, as the corresponding carboxylic acids (products of hydrolysis) promoted greater inhibition when present at the same molar concentration as the amides. Due to its complexity, the formulated SH did not perfectly match the fermentation profile of the actual hydrolysate, especially the growth curve. However, the SH formulation was effective for studying the inhibitory effect of various compounds on yeast fermentation. Conclusions: The formulation of SHs is an important advancement for future multi-omics studies and for better understanding the mechanisms of fermentation inhibition in lignocellulosic hydrolysates. The SH formulated in this work was instrumental for defining the most important inhibitors in the ACH. Major AFEX decomposition products are less inhibitory to yeast fermentation than the products of dilute acid or steam explosion pretreatments; thus, ACH is readily fermentable by yeast without any detoxification.

  7. Designer synthetic media for studying microbial-catalyzed biofuel production

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Tang, Xiaoyu; da Costa Sousa, Leonardo; Jin, Mingjie; Chundawat, Shishir; Chambliss, Charles; Lau, Ming W; Xiao, Zeyi; Dale, Bruce E; Balan, Venkatesh

    2015-01-01

    Background: The fermentation inhibition of yeast or bacteria by lignocellulose-derived degradation products, during hexose/pentose co-fermentation, is a major bottleneck for cost-effective lignocellulosic biorefineries. To engineer microbial strains for improved performance, it is critical to understand the mechanisms of inhibition that affect fermentative organisms in the presence of major components of a lignocellulosic hydrolysate. The development of a synthetic lignocellulosic hydrolysate (SH) media with a composition similar to the actual biomass hydrolysate will be an important advancement to facilitate these studies. In this work, we characterized the nutrients and plant-derived decomposition products present in AFEX™ pretreated corn stover hydrolysate (ACH). Themore »SH was formulated based on the ACH composition and was further used to evaluate the inhibitory effects of various families of decomposition products during Saccharomyces cerevisiae 424A (LNH-ST) fermentation. Results: The ACH contained high levels of nitrogenous compounds, notably amides, pyrazines, and imidazoles. In contrast, a relatively low content of furans and aromatic and aliphatic acids were found in the ACH. Though most of the families of decomposition products were inhibitory to xylose fermentation, due to their abundance, the nitrogenous compounds showed the most inhibition. From these compounds, amides (products of the ammonolysis reaction) contributed the most to the reduction of the fermentation performance. However, this result is associated to a concentration effect, as the corresponding carboxylic acids (products of hydrolysis) promoted greater inhibition when present at the same molar concentration as the amides. Due to its complexity, the formulated SH did not perfectly match the fermentation profile of the actual hydrolysate, especially the growth curve. However, the SH formulation was effective for studying the inhibitory effect of various compounds on yeast fermentation. Conclusions: The formulation of SHs is an important advancement for future multi-omics studies and for better understanding the mechanisms of fermentation inhibition in lignocellulosic hydrolysates. The SH formulated in this work was instrumental for defining the most important inhibitors in the ACH. Major AFEX decomposition products are less inhibitory to yeast fermentation than the products of dilute acid or steam explosion pretreatments; thus, ACH is readily fermentable by yeast without any detoxification.« less

  8. Planet Formation: Planet Formation: Evolution of The Solar NebulaEvolution of The Solar Nebula

    E-Print Network [OSTI]

    Herrick, Robert R.

    Planet Formation: Planet Formation: Evolution of The Solar NebulaEvolution of The Solar Nebula #12;Evolution of the Solar NebulaEvolution of the Solar Nebula 1.1. Nebula collapses into a disk 2000 KTemperatures near the Sun reach 2000 K #12;Evolution of the Solar NebulaEvolution of the Solar

  9. Space Science: Atmospheres Evolution of planets

    E-Print Network [OSTI]

    Johnson, Robert E.

    ;Atmospheres / Evolution Heat Sources Compressional Energy Trapped Radioactive Material Tidal InteractionsSpace Science: Atmospheres Part- 7a Evolution of planets Out-Gassing/ Volcanoes Evolution Initial Species Solar abundance Solar wind composition? Carbonaceous chondrites? Variables Early sun

  10. Evolution of Eukaryotic Transfer Ribonucleic Acid

    E-Print Network [OSTI]

    Phillips, Julie Baker

    2013-01-01

    2.2.4. Evolution of Class Informative2.3.2. Patterns of Evolution in Class InformativeEarly studies in tRNA evolution . . . . . . . . 1.5. tRNA

  11. Modeling Solar Energy Technology Evolution breakout session

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Technology Evolution What is a question we could ask about technology evolution, which when answered could yield deep insight into how to spur innovation? Introductory question...

  12. Modeling Solar Energy Technology Evolution breakout session ...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Modeling Solar Energy Technology Evolution breakout session Modeling Solar Energy Technology Evolution breakout session This presentation summarizes the information given on the...

  13. NLO evolution of color dipoles

    E-Print Network [OSTI]

    Ian Balitsky; Giovanni A. Chirilli

    2007-10-23

    The small-$x$ deep inelastic scattering in the saturation region is governed by the non-linear evolution of Wilson-line operators. In the leading logarithmic approximation it is given by the BK equation for the evolution of color dipoles. In the next-to-leading order the BK equation gets contributions from quark and gluon loops as well as from the tree gluon diagrams with quadratic and cubic nonlinearities. We calculate the gluon contribution to small-x evolution of Wilson lines (the quark part was obtained earlier).

  14. NLO evolution of color dipoles

    SciTech Connect (OSTI)

    Ian Balitsky; Giovanni Chirilli

    2008-01-01

    The small-x deep inelastic scattering in the saturation region is governed by the non-linear evolution of Wilson-lines operators. In the leading logarithmic approximation it is given by the BK equation for the evolution of color dipoles. In the next-to-leaing order the BK equation gets contributions from quark and gluon loops as well as from the tree gluon diagrams with quadratic and cubic nonlinearities. We calculate the gluon contribution to small-x evolution of Wilson lines (the quark part was obtained earlier).

  15. Social evolution of pragmatic behaviour 

    E-Print Network [OSTI]

    Scott?Phillips, Thomas C.

    2009-01-01

    Pragmatics is the branch of linguistics that addresses the relationship between language and its external environment – in particular the communicative context. Social evolution (or sociobiology) is the branch of the ...

  16. Optimisation of Quantum Evolution Algorithms

    E-Print Network [OSTI]

    Apoorva Patel

    2015-03-04

    Given a quantum Hamiltonian and its evolution time, the corresponding unitary evolution operator can be constructed in many different ways, corresponding to different trajectories between the desired end-points. A choice among these trajectories can then be made to obtain the best computational complexity and control over errors. As an explicit example, Grover's quantum search algorithm is described as a Hamiltonian evolution problem. It is shown that the computational complexity has a power-law dependence on error when a straightforward Lie-Trotter discretisation formula is used, and it becomes logarithmic in error when reflection operators are used. The exponential change in error control is striking, and can be used to improve many importance sampling methods. The key concept is to make the evolution steps as large as possible while obeying the constraints of the problem. In particular, we can understand why overrelaxation algorithms are superior to small step size algorithms.

  17. Convergent Evolution in Livebearing Fishes 

    E-Print Network [OSTI]

    Troendle, Nicholas

    2012-07-16

    The directionality and consistency of evolution has long been a subject of contention among evolutionary biologists since the days of Darwin. However, it is unknown how much can be quantified and how much results from more complex variables...

  18. The mystery of language evolution

    E-Print Network [OSTI]

    Hauser, Marc D.

    Understanding the evolution of language requires evidence regarding origins and processes that led to change. In the last 40 years, there has been an explosion of research on this problem as well as a sense that considerable ...

  19. CCFM Evolution with Unitarity Corrections

    E-Print Network [OSTI]

    Emil Avsar; Edmond Iancu

    2009-09-21

    We considerably extend our previous analysis of the implementation of an absorptive boundary condition, which mimics saturation effects, on the linear CCFM evolution. We present detailed results for the evolution of the unintegrated gluon density in the presence of saturation and extract the energy dependence of the emerging saturation momentum. We show that CCFM and BFKL evolution lead to almost identical predictions after including the effects of gluon saturation and of the running of the coupling. We moreover elucidate several important and subtle aspects of the CCFM formalism, such as its relation to BFKL, the structure of the angular ordered cascade, and the derivation of more inclusive versions of CCFM. We also propose non--leading modifications of the standard CCFM evolution which may play an important role for phenomenological studies.

  20. Stromswold, Evolution & Genetics of Language 1 Genetics and the Evolution of Language: What genetic studies reveal about the evolution

    E-Print Network [OSTI]

    Stromswold, Karin

    Stromswold, Evolution & Genetics of Language 1 Genetics and the Evolution of Language: What genetic studies reveal about the evolution of language Karin Stromswold Rutgers University ­ New Brunswick Abstract. In this paper I argue that genetic studies of language provide insights about the evolution

  1. Effect of 1-hydroxyethane-1,1-diphosphonic acid (HEDPA) on Partitioning of Np and Pu to Synthetic Boehmite

    E-Print Network [OSTI]

    Powell, Brian A.

    2010-01-01

    of plutonium IV and V on goethite. Geochim. Cosmo. Acta,reduction on synthetic goethite (?-FeOOH) and hematite (?-Fe

  2. Vehicle Technologies Office Merit Review 2014: Synthetic Solutions for Correcting Voltage Fade in LMR-NMC Cathodes

    Broader source: Energy.gov [DOE]

    Presentation given by Argonne National Laboratory at 2014 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Office Annual Merit Review and Peer Evaluation Meeting about synthetic...

  3. A bio-synthetic interface for discovery of viral entry mechanisms.

    SciTech Connect (OSTI)

    Gutzler, Mike; Maar, Dianna; Negrete, Oscar; Hayden, Carl C.; Sasaki, Darryl Yoshio; Stachowiak, Jeanne C.; Wang, Julia

    2010-09-01

    Understanding and defending against pathogenic viruses is an important public health and biodefense challenge. The focus of our LDRD project has been to uncover the mechanisms enveloped viruses use to identify and invade host cells. We have constructed interfaces between viral particles and synthetic lipid bilayers. This approach provides a minimal setting for investigating the initial events of host-virus interaction - (i) recognition of, and (ii) entry into the host via membrane fusion. This understanding could enable rational design of therapeutics that block viral entry as well as future construction of synthetic, non-proliferating sensors that detect live virus in the environment. We have observed fusion between synthetic lipid vesicles and Vesicular Stomatitis virus particles, and we have observed interactions between Nipah virus-like particles and supported lipid bilayers and giant unilamellar vesicles.

  4. Emissions from Buses with DDC 6V92 Engines Using Synthetic Diesel Fuel

    SciTech Connect (OSTI)

    Paul Norton; Keith Vertin; Nigel N. Clark; Donald W. Lyons; Mridul Gautam; Stephen Goguen; James Eberhardt

    1999-05-03

    Synthetic diesel fuel can be made from a variety of feedstocks, including coal, natural gas and biomass. Synthetic diesel fuels can have very low sulfur and aromatic content, and excellent autoignition characteristics. Moreover, synthetic diesel fuels may also economically competitive with California diesel fuel if .roduced in large volumes. Previous engine laboratory and field tests using a heavy-duty chassis dynamometer indicate that synthetic diesel fuel made using the Fischer-Tropsch (F-T) catalytic conversion process is a promising alternative fuel, because it can be used in unmodified diesel engines, and can reduce exhaust emissions substantially. The objective of this study was a preliminary assessment of the emissions from older model transit operated on Mossgas synthetic diesel fuel. The study compared emissions from transit buses operating on Federal no. 2 Diesel fuel, Mossgas synthetic diesel (MGSD), and a 50/50 blend of the two fuels. The buses were equipped with unmodified Detroit Diesel 6V92 2-stroke diesel engines. Six 40-foot buses were tested. Three of the buses had recently rebuilt engines and were equipped with an oxidation catalytic converter. Vehicle emissions measurements were performed using West Virginia University's unique transportable chassis dynamometer. The emissions were measured over the Central Business District (CBD) driving cycle. The buses performed well on both neat and blended MGSD fuel. Three buses without catalytic converters were tested. Compared to their emissions when operating on Federal no. 2 diesel fuel, these buses emitted an average of 5% lower oxides of nitrogen (NOx) and 20% lower particulate matter (PM) when operating on neat MGSD fuel. Catalyst equipped buses emitted an average of 8% lower NOx and 31% lower PM when operating on MGSD than when operating on Federal no. 2 diesel fuel.

  5. Evolution of biological complexity Christoph Adami*

    E-Print Network [OSTI]

    Ofria, Charles A.

    Evolution of biological complexity Christoph Adami* , Charles Ofria§ , and Travis C. Collier, Pasadena, CA 91125; and ¶Division of Organismic Biology, Ecology, and Evolution, University of California in the evolution of complexity in biological evolution, complexity needs to be both rigorously defined

  6. Evolution towards, in, and beyond Object Databases

    E-Print Network [OSTI]

    Scholl, Marc H.

    Evolution towards, in, and beyond Object Databases Marc H. Scholl and Markus Tresch Faculty ``evolution'' in the database arena. This paper tries to categorize some of these into a unique framework of evolution that are addressed in the title: -- Evolution towards object databases: Here we address

  7. Synthetic Hexaploid Wheat as a Source of Improvement for Winter Wheat (Triticum aestivum L.) in Texas 

    E-Print Network [OSTI]

    Cooper, Jessica Kay

    2012-02-14

    backcrosses to spring wheats show improvement over recurrent parents (del Blanco et al., 2000; Lage et al., 2004a; Mujeeb-Kazi et al., 2008; Villareal et al., 1994) but evidence of the benefits of synthetic backcrosses to winter wheat is meager... drought stress, a common problem in Texas High Plains, as well as heat stress, a common problem in South Texas (del Blanco et al., 2000; Reynolds et al., 2007; Trethowanand Mujeeb-Kazi, 2008). Reynolds et al. attributed synthetic lines to be better...

  8. Synthetic peptides that cause F-actin bundling and block actin depolymerization

    DOE Patents [OSTI]

    Sederoff, Heike (Raleigh, NC); Huber, Steven C (Savoy, IL); Larabell, Carolyn A (Berkeley, CA)

    2011-10-18

    Synthetic peptides derived from sucrose synthase, and having homology to actin and actin-related proteins, sharing a common motif, useful for causing acting bundling and preventing actin depolymerization. Peptides exhibiting the common motif are described, as well as specific synthetic peptides which caused bundled actin and inhibit actin depolymerization. These peptides can be useful for treating a subject suffering from a disease characterized by cells having neoplastic growth, for anti-cancer therapeutics, delivered to subjects solely, or concomitantly or sequentially with other known cancer therapeutics. These peptides can also be used for stabilizing microfilaments in living cells and inhibiting growth of cells.

  9. Evolution of transcription networks in response to temporal fluctuations

    E-Print Network [OSTI]

    Hespanha, João Pedro

    Evolution of transcription networks in response to temporal fluctuations Journal: Evolution, Evolution & Marine Biology Keywords: Population Genetics, Epistasis, Genetic Networks, Transcription Evolution: For Review Only #12;EVOLUTION OF TRANSCRIPTION NETWORKS IN RESPONSE TO TEMPORAL FLUCTUATIONS

  10. WHO IS ANTI-EVOLUTION? 1. Who is anti-evolution?

    E-Print Network [OSTI]

    King, Bethia H.

    WHO IS ANTI-EVOLUTION? 1. Who is anti-evolution? a. Although creationists and intelligent design theorists accept much of evolution, they repeatedly attack evolution. They are usually fundamentalists who%) of scientists 2. What is evolution? A change in the proportion of different genetic traits over time

  11. The Dartmouth Stellar Evolution Database

    E-Print Network [OSTI]

    Aaron Dotter; Brian Chaboyer; Darko Jevremovic; Veselin Kostov; E. Baron; J. W. Ferguson

    2008-04-28

    The ever-expanding depth and quality of photometric and spectroscopic observations of stellar populations increase the need for theoretical models in regions of age-composition parameter space that are largely unexplored at present. Stellar evolution models that employ the most advanced physics and cover a wide range of compositions are needed to extract the most information from current observations of both resolved and unresolved stellar populations. The Dartmouth Stellar Evolution Database is a collection of stellar evolution tracks and isochrones that spans a range of [Fe/H] from -2.5 to +0.5, [alpha/Fe] from -0.2 to +0.8 (for [Fe/H] 0), and initial He mass fractions from Y=0.245 to 0.40. Stellar evolution tracks were computed for masses between 0.1 and 4 Msun, allowing isochrones to be generated for ages as young as 250 Myr. For the range in masses where the core He flash occurs, separate He-burning tracks were computed starting from the zero age horizontal branch. The tracks and isochrones have been transformed to the observational plane in a variety of photometric systems including standard UBV(RI)c, Stromgren uvby, SDSS ugriz, 2MASS JHKs, and HST ACS-WFC and WFPC2. The Dartmouth Stellar Evolution Database is accessible through a website at http://stellar.dartmouth.edu/~models/ where all tracks, isochrones, and additional files can be downloaded.

  12. A Synthetic Carotenoid Pathway We designed a 8400 nucleotide DNA sequence to encode the seven crt enzymes

    E-Print Network [OSTI]

    Maranas, Costas

    RNA to the free energy change Gtot according to: Predictive Design of Synthetic Microbes 1Pennsylvania State a synthetic gene network that combines cell-to-cell communication with logical cellular computing to execute into a microbial host enables the production of fuels, specialty chemicals, and drugs from renewable feedstocks

  13. 57106 Federal Register / Vol. 78, No. 180 / Tuesday, September 17, 2013 / Proposed Rules for lead in synthetic iron oxide for

    E-Print Network [OSTI]

    proposes to lower the specification limit for lead in synthetic iron oxide for human food use from 1057106 Federal Register / Vol. 78, No. 180 / Tuesday, September 17, 2013 / Proposed Rules for lead in synthetic iron oxide for human food use. DATES: The color additive petition was filed on July 16, 2013

  14. Active control of passive acoustic fields: Passive synthetic apertureDoppler beamforming with data from an autonomous

    E-Print Network [OSTI]

    Smith, Jerome A.

    Active control of passive acoustic fields: Passive synthetic apertureÕDoppler beamforming with data without the use of an active source under control by the receiver. In this passive case, the properties interest. Passive synthetic aperture sonar has no ana- log in the radar community. In contrast

  15. Analyzing Chinese Synthetic Words with Tree-based Information and a Survey on Chinese Morphologically Derived Words

    E-Print Network [OSTI]

    Analyzing Chinese Synthetic Words with Tree-based Information and a Survey on Chinese and Technology matsu@is.naist.jp Abstract The lack of internal information of Chinese synthetic words has become a crucial prob- lem for Chinese morphological analysis sys- tems which will face various needs of seg

  16. A thin layer of phytoplankton observed in the Philippine Sea with a synthetic moored array of autonomous gliders

    E-Print Network [OSTI]

    Fratantoni, David

    A thin layer of phytoplankton observed in the Philippine Sea with a synthetic moored array and phytoplankton distribution in a 100 km  100 km domain in the Philippine Sea east of Luzon Strait for 10 days), A thin layer of phytoplankton observed in the Philippine Sea with a synthetic moored array of autonomous

  17. Ion-beam and electron-beam irradiation of synthetic britholite S. Utsunomiya a

    E-Print Network [OSTI]

    Utsunomiya, Satoshi

    Ion-beam and electron-beam irradiation of synthetic britholite S. Utsunomiya a , S. Yudintsev b , L ). The sequence of increasing Tc correlates with the mass of the incident ion; whereas, the ratio of electronic to nuclear stopping power (ENSP) is inversely correlated with Tc. Electron irradiations were conducted

  18. Basics of Polar-Format algorithm for processing Synthetic Aperture Radar images.

    SciTech Connect (OSTI)

    Doerry, Armin Walter

    2012-05-01

    The purpose of this report is to provide a background to Synthetic Aperture Radar (SAR) image formation using the Polar Format (PFA) processing algorithm. This is meant to be an aid to those tasked to implement real-time image formation using the Polar Format processing algorithm.

  19. Modeling Wildland Fire Radiance in Synthetic Remote Sensing B.S. Beijing Institute of Technology, 1996

    E-Print Network [OSTI]

    Salvaggio, Carl

    efforts in phenomenology studies, algorithm development, and sensor evaluation. Synthetic scenes are also and op- tical properties of wildfire and burn area in an infrared remote sensing system will assist look like as seen by the airborne sensor. Radiance scene rendering of the 3D flame iv #12;v includes 2D

  20. Ris-PhD-27(EN) Wind Energy Applications of Synthetic

    E-Print Network [OSTI]

    winds in offshore wind resource assessment. Firstly, wind wakes behind two large offshore wind farms farming 3 2.1 Horns Rev and Nysted offshore wind farms 4 3 Synthetic aperture radar 6 3.1 Imaging geometry in offshore wind energy planning as a supplement to on site measurements, which are costly and sparse

  1. Seasonal subsidence and rebound in Las Vegas Valley, Nevada, observed by synthetic aperture radar interferometry

    E-Print Network [OSTI]

    Amelung, Falk

    Seasonal subsidence and rebound in Las Vegas Valley, Nevada, observed by synthetic aperture radar in the subsidence and rebound occurring over stressed aquifer systems, in conjunction with measurements, generally permanent aquifer system compaction and land subsidence at yearly and longer timescales, caused

  2. Synthetic Humans in Emergency Response Drills Daniel Massaguer, Vidhya Balasubramanian, Sharad Mehrotra, and Nalini Venkatasubramanian

    E-Print Network [OSTI]

    Venkatasubramanian, Nalini

    Synthetic Humans in Emergency Response Drills Daniel Massaguer, Vidhya Balasubramanian, Sharad demonstrates a concrete model for evacuations integrated with an emergency drill simulation environment this information to make decisions. The decision-making model is tested and calibrated with an emergency drill

  3. Laminar Flame Speed Measurments of Synthetic Gas Blends with Hydrocarbon Impurities 

    E-Print Network [OSTI]

    Keesee, Charles Lewis

    2015-04-09

    New laminar flame speed measurements have been taken for a wide range of synthetic gas, or syngas, mixtures. These experiments began with two baseline mixtures. The first of these baseline mixtures was a bio-syngas surrogate with a 50/50 H2/CO split...

  4. SYNTHETIC APERTURE INVERSION FOR NON-FLAT TOPOGRAPHY C. J. Nolan *

    E-Print Network [OSTI]

    Cheney, Margaret

    SYNTHETIC APERTURE INVERSION FOR NON-FLAT TOPOGRAPHY C. J. Nolan * , M. Cheney ** * Department topography is known but not necessarily flat. We consider two cases, corresponding to the degree and the topography to avoid artifacts. We show that the algorithm correctly reproduces certain features of the scene

  5. Ion Irradiation Effects in Synthetic Garnets Incorporating Actinides Satoshi Utsunomiya1

    E-Print Network [OSTI]

    Utsunomiya, Satoshi

    Ion Irradiation Effects in Synthetic Garnets Incorporating Actinides Satoshi Utsunomiya1 , Lu.0 MeV Kr2+ irradiation with in situ transmission electron microscopy over the temperature range of 50 the long term radiation effects due to radioactive decay can be simulated in short term with heavy ion-irradiation

  6. Intelligent Agents for the Synthetic Battlefield: A Company of Rotary Wing Aircraft

    E-Print Network [OSTI]

    Gratch, Jonathan

    agents that perform the tasks of an attack helicopter company for a synthetic battlefield environment to develop: (1) pilot agents for a company of helicopters, (2) a command agent that makes decisions and plans for the helicopter company, and (3) an approach to teamwork that enables the pilot agents to coordinate

  7. Challenges and opportunities in synthetic biology for chemical engineers Yunzi Luo a

    E-Print Network [OSTI]

    Zhao, Huimin

    Challenges and opportunities in synthetic biology for chemical engineers Yunzi Luo a , Jung-Kul Lee c , Huimin Zhao a,b,n a Department of Chemical and Biomolecular Engineering, University of Illinois, United States c Department of Chemical Engineering, Konkuk University, Seoul 143-701, South Korea H I G H

  8. Stochastic Generation of Synthetic Precipitation Time Series with High Temporal and Spatial Resolution for Engineering Practice

    E-Print Network [OSTI]

    Cirpka, Olaf Arie

    Stochastic Generation of Synthetic Precipitation Time Series with High Temporal and Spatial.Brommundt@iws.uni-stuttgart.de Introduction The stochastic precipitation time series generator, NiedSim, has been developed and installed been generated. In the year 2004 NiedSim was set up for Hessen and Rheinland-Pfalz. The total project

  9. Bioinspired Fabrication and Characterization of a Synthetic Fish Skin for the Protection of Soft Materials

    E-Print Network [OSTI]

    Barthelat, Francois

    -performance natural armor that represents a source of inspiration for novel engineering designs. In this paper, we consists of a low-modulus elastic mesh or "dermis" layer that holds rigid, plastic scales. The mechanics of the synthetic material is characterized under in-plane, bending, and indentation modes of deformation

  10. Hydrogen and minor element incorporation in synthetic rutile G. D. BROMILEY

    E-Print Network [OSTI]

    Hydrogen and minor element incorporation in synthetic rutile G. D. BROMILEY 1,2, * AND N. HILAIRET from substitutional defects. KEYWORDS: rutile, hydrogen, substitution, solubility, spectroscopy of lower- valence cations may be charge-balanced by incorporation of hydrogen in the rutile structure

  11. Monoclonal antibodies to synthetic pyrethroids and method for detecting the same

    DOE Patents [OSTI]

    Stanker, L.H.; Vanderlaan, M.; Watkins, B.E.; Van Emon, J.M.; Bigbee, C.L.

    1992-04-28

    Methods are described for making specific monoclonal antibodies which may be used in a sensitive immunoassay for detection of synthetic pyrethroids in foods and environmental samples. Appropriate sample preparation and enzyme amplification of the immunoassay for this widely-used class of pesticides permits detection at low levels in laboratory and field tested samples. 6 figs.

  12. MAximum Multicore POwer (MAMPO) -An Automatic Multithreaded Synthetic Power Virus Generation

    E-Print Network [OSTI]

    John, Lizy Kurian

    and cooling issues along with a world-wide initiative towards green computing, power consump- tion is a firstMAximum Multicore POwer (MAMPO) - An Automatic Multithreaded Synthetic Power Virus Generation worst case power consumption for a com- puter system is a significant design parameter and it is a very

  13. SYNTHETIC SPECTRA AND COLORS OF YOUNG GIANT PLANET ATMOSPHERES: EFFECTS OF INITIAL CONDITIONS AND ATMOSPHERIC METALLICITY

    E-Print Network [OSTI]

    , as giant planets should be warmest, largest, and brightest when they are young, but will cool, contractSYNTHETIC SPECTRA AND COLORS OF YOUNG GIANT PLANET ATMOSPHERES: EFFECTS OF INITIAL CONDITIONS 2008 March 17; accepted 2008 May 7 ABSTRACT We examine the spectra and infrared colors of the cool

  14. A Synthetic Reaction Network: Chemical Amplification Using Nonequilibrium Autocatalytic Reactions Coupled in Time

    E-Print Network [OSTI]

    Ismagilov, Rustem F.

    A Synthetic Reaction Network: Chemical Amplification Using Nonequilibrium Autocatalytic Reactions reaction network synthesized in a microfluidic device. This chemical network performs chemical 5000-fold by a reaction autocatalytic in Co2+ . The microfluidic network is used to maintain the two chemical reactions

  15. Transport of conservative solutes in simulated fracture networks: 1. Synthetic data generation

    E-Print Network [OSTI]

    Meerschaert, Mark M.

    including high- level radioactive waste. Fractures can serve as primary pathways for fluid flow and wasteTransport of conservative solutes in simulated fracture networks: 1. Synthetic data generation. If this statistical model applies to transport in fractured media, then an ensemble plume in a fractured rock domain

  16. DETECTION OF SYNTHETIC SPEECH FOR THE PROBLEM OF IMPOSTURE Phillip L. De Leon

    E-Print Network [OSTI]

    De Leon, Phillip

    DETECTION OF SYNTHETIC SPEECH FOR THE PROBLEM OF IMPOSTURE Phillip L. De Leon New Mexico State University Klipsch School Elect. & Comp. Eng. Las Cruces, New Mexico USA pdeleon@nmsu.edu Inma Hernaez, Ibon of the Internet. The fact that small amounts of non-ideal training data can be used to construct high

  17. Super-resolution in incoherent optical imaging using synthetic aperture with Fresnel elements

    E-Print Network [OSTI]

    Rosen, Joseph

    Super-resolution in incoherent optical imaging using synthetic aperture with Fresnel elements Barak the Rayleigh limit of the system is obtained by tiling digitally several Fresnel holographic elements into a complete Fresnel hologram of the observed object. Each element is acquired by the limited-aperture system

  18. AIAA 2001-3030 Synthetic Jets at Large Reynolds Number and Comparison to

    E-Print Network [OSTI]

    Smith, Barton L.

    AIAA 2001-3030 Synthetic Jets at Large Reynolds Number and Comparison to Continuous Jets Barton L ABSTRACT: Experimental measurements and flow visualization of syn- thetic jets and similar continuous jets are described. The dimensionless stroke length necessary to form a 2-D syn- thetic jet is between 5 and 10

  19. Journal of Chemical Ecology, Vol. 28, No. 5, May 2002 (C 2002) EVALUATION OF SYNTHETIC HYDROCARBONS

    E-Print Network [OSTI]

    Hanks, Lawrence M.

    Journal of Chemical Ecology, Vol. 28, No. 5, May 2002 (C 2002) EVALUATION OF SYNTHETIC HYDROCARBONS of five straight-chain hydrocarbons (C24, C25, C26, C28, C30) to detached elytra of the red milkweed, and placed them in an exposed location outdoors. The amount of hydrocarbons on the elytra did not change over

  20. Glasma Evolution in Partonic Medium

    E-Print Network [OSTI]

    A. V. Nazarenko

    2010-11-23

    We examine a scenario of the abelianized Glasma evolution with accounting for back-reaction of partonic medium in ultrarelativistic heavy-ion collisions. We announce that such a generalization leads to the instabilities and the presence of negative color conductivity in the system.

  1. Geometric Differential Evolution Alberto Moraglio

    E-Print Network [OSTI]

    Togelius, Julian

    formal generalization of traditional Par- ticle Swarm Optimization (PSO) that applies naturally to both continuous and combinatorial spaces. Differential Evo- lution (DE) is similar to PSO but it uses different for the traditional PSO algorithm. Using this formal algorithm, Geometric Differential Evolution (GDE), we formally

  2. Cloud Formation, Evolution and Destruction

    E-Print Network [OSTI]

    Estalella, Robert

    Chapter 4 Cloud Formation, Evolution and Destruction We now begin to trace the journey towards a star. How long does this take? The answer is surprisingly short: a good many clouds already contain new stars and these stars tend to be young. The typical cloud cannot spend long, if any time at all

  3. Evolution of reproductive proteins in deer mice (Peromyscus)

    E-Print Network [OSTI]

    Turner, Leslie McCue

    2007-01-01

    Reproductive protein evolution. Annu. Rev. Ecol. Syst. 33:Pervasive adaptive evolution in mammalian fertilizationreveals rapid adaptive evolution. Am. J. Hum. Genet. 79:820-

  4. Evolution of the boxfish carapace: functional consequences of shape

    E-Print Network [OSTI]

    Marcroft, Tina Ashley

    2015-01-01

    order Tetraodontiformes). ” Evolution 61 (9): 2104–26. doi:Start Curvature, and the Evolution of Mechanical Defenses inof Spontaneous Hybrids. ” Evolution 35 (3): 543–56. Castro,

  5. Reconstructing the Evolution of Vertebrate Sex Chromosomes

    E-Print Network [OSTI]

    Bellott, Daniel W.

    Sex chromosomes and their evolution have captivated researchers since their discovery. For more than 100 years, the dominant model of sex chromosome evolution has held that differentiated sex chromosomes, such as the X and ...

  6. EVOLUTIONARY CHANGE the evolution of change management

    E-Print Network [OSTI]

    Emmerich, Michael

    page 1 EVOLUTIONARY CHANGE the evolution of change management by Jeroen van der Zon University, evolutionary change is studied by describing the evolution of Change Manage- ment (CM). CM is one . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 3 Modelling Change Management

  7. The Evolution and Development of the Universe

    E-Print Network [OSTI]

    Clement Vidal; Charles Auffray; Alex H. Blin; Jean Chaline; Louis Crane; Thomas Durt; Borje Ekstig; Horace Fairlamb; Jan Greben; Rob Hengeveld; Francis Heylighen; Gerard Jagers op Akkerhuis; Giuseppe Longo; Nicolas F. Lori; Denis Noble; Laurent Nottale; Franc Rottiers; Stanley Salthe; John Stewart; Ruediger Vaas; Gertrudis Van de Vijver; Nico M. van Straalen

    2010-01-04

    This document is the Special Issue of the First International Conference on the Evolution and Development of the Universe (EDU 2008). Please refer to the preface and introduction for more details on the contributions. Keywords: acceleration, artificial cosmogenesis, artificial life, Big Bang, Big History, biological evolution, biological universe, biology, causality, classical vacuum energy, complex systems, complexity, computational universe, conscious evolution, cosmological artificial selection, cosmological natural selection, cosmology, critique, cultural evolution, dark energy, dark matter, development of the universe, development, emergence, evolution of the universe evolution, exobiology, extinction, fine-tuning, fractal space-time, fractal, information, initial conditions, intentional evolution, linear expansion of the universe, log-periodic laws, macroevolution, materialism, meduso-anthropic principle, multiple worlds, natural sciences, Nature, ontology, order, origin of the universe, particle hierarchy, philosophy, physical constants, quantum darwinism, reduction, role of intelligent life, scale relativity, scientific evolution, self-organization, speciation, specification hierarchy, thermodynamics, time, universe, vagueness.

  8. Intermediate evolution using SNIa, and BAO

    E-Print Network [OSTI]

    Cardenas, V H

    2015-01-01

    We study the intermediate evolution model and show that, compared with the recent study of a power-law evolution, the intermediate evolution is a better description of the low-redshift regime supported by observations from type Ia supernovae and BAO. We found also that recent data suggest that the intermediate evolution is as good a fit to this redshift range as the $\\Lambda$CDM model.

  9. Evolution of curvature invariants and lifting integrability

    E-Print Network [OSTI]

    Kamp, Peter H. van der

    Evolution of curvature invariants and lifting integrability Elizabeth L. Mansfield and Peter H. van. These define the curvature and evolution invariants that are associated to curves moving in the given geometry. The syzygy between the curvature and evolution invariants is obtained as a zero curvature relation

  10. Chemical Evolution of Galaxies: a problem of

    E-Print Network [OSTI]

    ?umer, Slobodan

    Chemical Evolution of Galaxies: a problem of Astroarchaelogy Francesca Matteucci, Trieste University Lubljana, February 24, 2014 #12;Chemical Evolution of Galaxies Beatrice Tinsley (27 January 1941- 23 March 1981) She started the field of galactic chemical evolution #12;Collaborators: #12;Outline

  11. Evolution Lab with Drosophila Mark Salata

    E-Print Network [OSTI]

    Antonovics, Janis

    Evolution Lab with Drosophila Mark Salata Gordon College Division of Mathematics and Natural: (770) 358-5365 Abstract: In order to demonstrate certain aspects of evolution, a hands-on laboratory dynamics. Keywords: evolution, Drosophila, laboratory exercise INTRODUCTION Students tend to learn about

  12. Evolution of Cyclone Characteristics The composite evolution of west and east Atlantic cyclone is likely to

    E-Print Network [OSTI]

    Dacre, Helen

    Evolution of Cyclone Characteristics The composite evolution of west and east Atlantic cyclone. The spatial distribution and evolution characteristics of North Atlantic cyclones. Mon. Wea. Rev. 137, 99 characteristics and the evolution of these characteristics are calculated in composite cyclones. Method · Cyclones

  13. EVOLUTION SEMIGROUPS AND ROBUST STABILITY OF EVOLUTION OPERATORS ON BANACH SPACES

    E-Print Network [OSTI]

    EVOLUTION SEMIGROUPS AND ROBUST STABILITY OF EVOLUTION OPERATORS ON BANACH SPACES Y. LATUSHKIN, S. MONTGOMERY­SMITH, AND T. RANDOLPH Abstract. Using the theory of evolution semigroups, this paper investigates­mapping theo­ rem for evolution semigroups acting on vector­valued functions on [0; 1) is proven first

  14. Evolution of language The interest of the Pragmatics and cognition team for the evolution of language

    E-Print Network [OSTI]

    Institut des Sciences Cognitives, CNRS

    Evolution of language The interest of the Pragmatics and cognition team for the evolution of the evolution of language wetted our apetites and some members of the team (i.e. Anne Reboul) are still actively engaged in research on the evolution of language. The well-known difficulties regarding this domain

  15. Evolution styles: using architectural knowledge as an evolution driver Carlos E. Cuesta1

    E-Print Network [OSTI]

    Perry, Dewayne E.

    Evolution styles: using architectural knowledge as an evolution driver Carlos E. Cuesta1 , Elena+D, 02006, Albacete, Spain ABSTRACT Software evolution is an increasingly challenging and compelling concern software evolution is carried out, software architecture emerges as one of the cornerstones that should

  16. Method for forming a layer of synthetic corrosion products on tubing surfaces

    DOE Patents [OSTI]

    Lane, Michael H. (Clifton Park, NY); Salamon, Eugene J. M. (Clifton Park, NY)

    1996-01-01

    A method is provided for forming a synthetic corrosion product layer on tube surfaces. The method utilizes two dissimilar materials with different coefficients of thermal expansion. An object tube and sacrificial tube are positioned one inside the other such that an annular region is created between the two tubes' surfaces. A slurry of synthetic corrosion products is injected into this annular region and the assembly is heat treated. This heat causes the tubes to expand, the inner tube with the higher coefficient of expansion expanding more than the outer tube, thereby creating internal pressures which consolidate the corrosion products and adhere the corrosion products to the tubing surfaces. The sacrificial tube may then be removed by conventional chemical etching or mechanical methods.

  17. Secondary emission from synthetic opal infiltrated by colloidal gold and glycine

    E-Print Network [OSTI]

    Dovbeshko, G; Boyko, V; Romanyuk, V; Gorelik, V; Moiseyenko, V; Sobolev, V; Shvalagin, V

    2012-01-01

    A comparison of the secondary emission (photoluminescence) and Bragg reflection spectra of photonic crystals (PC), namely, synthetic opals, opals infiltrated by colloidal gold, glycine, and a complex of colloidal gold with glycine is performed. The infiltration of colloidal gold and a complex of colloidal gold with glycine into the pores of PC causes a short-wavelength shift (about 5-15 nm) of the Bragg reflection and increases the intensity of this band by 1.5-3 times. In photoluminescence, the infiltration of PC by colloidal gold and colloidal gold with glycine suppresses the PC emission band near 375-450 nm and enhances the shoulder of the stop-zone band of PC in the region of 470-510 nm. The shape of the observed PC emission band connected with defects in synthetic opal is determined by the type of infiltrates and the excitation wavelength. Possible mechanisms of the effects are discussed.

  18. Impact of petroleum, synthetic and cryogenic fuels on civil aviation. Final report

    SciTech Connect (OSTI)

    Blake, C.L.

    1982-06-01

    Partial contents of this report are: World and Long-Term Energy View; U.S. Aviation in the Fuel Market; U.S. Petroleum Forecasting; Enhanced Oil Recovery (EOR); Petroleum Refining and Aviation Fuels; Natural Gas; Synthetic Fuels for Aviation; Cryogenic Fuels and Other; Aviation Propulsion; Alternative Ground Fuels and Energy Sources; Fuel Conservation in Aviation and Disruption of U.S. Crude Oil Imports.

  19. Synthetic fuels and the environment: an environmental and regulatory impacts analysis

    SciTech Connect (OSTI)

    1980-06-01

    Since July 1979 when DOE/EV-0044 report Environmental Analysis of Synthetic Liquid fuels was published the synthetic fuels program proposals of the Administration have undergone significant modifications. The program year for which the development goal of 1.5 million barrels per day is to be reached has been changed from 1990 to 1995. The program plan is now proposed to have two stages to ensure, among other things, better environmental protection: an initial stage emphasizing applied research and development (R and D), including environmental research, followed by a second stage that would accelerate deployment of those synthetic fuel technologies then judged most ready for rapid deployment and economic operation within the environmental protection requirements. These program changes have significantly expanded the scope of technologies to be considered in this environmental analysis and have increased the likelihood that accelerated environmental R and D efforts will be successful in solving principal environmental and worker safety concerns for most technologies prior to the initiation of the second stage of the accelerated deployment plan. Information is presented under the following section headings: summary; study description; the technologies and their environmental concerns (including, coal liquefaction and gasification, oil shale production, biomass and urban waste conversion); regulatory and institutional analyses; and environmental impacts analysis (including air and water quaility analyses, impacts of carbon dioxide and acid rain, water availability, solid and hazardous wastes, coal mining environmental impacts, transportation issues, community growth and change, and regional impacts). Additional information is presented in seventeen appendixes. (JGB)

  20. A new extensive library of PHOENIX stellar atmospheres and synthetic spectra

    E-Print Network [OSTI]

    Husser, Tim-Oliver; Dreizler, Stefan; Homeier, Derek; Reiners, Ansgar; Barman, Travis; Hauschildt, Peter H

    2013-01-01

    We present a new library of high-resolution synthetic spectra based on the stellar atmosphere code PHOENIX that can be used for a wide range of applications of spectral analysis and stellar parameter synthesis. The spherical mode of PHOENIX was used to create model atmospheres and to derive detailed synthetic stellar spectra from them. We present a new self-consistent way of describing micro-turbulence for our model atmospheres. The synthetic spectra cover the wavelength range from 500AA to 50.000AA with resolutions of R=500.000 in the optical and near IR, R=100.000 in the IR and a step size of 0.1AA in the UV. The parameter space covers 2.300K<=Teff<=12.000K, 0.0<=log(g)<=+6.0, -4.0<=[Fe/H]<=+1.0, and -0.2<=[alpha/Fe]<=+1.2. The library is a work in progress and we expect to extend it up to Teff=25.000 K.

  1. Evolution of high-redshift quasars Xiaohui Fan

    E-Print Network [OSTI]

    Colorado at Boulder, University of

    Evolution of high-redshift quasars Xiaohui Fan Steward Observatory, The University of Arizona redshift quasars, including the evolution of quasar density and luminosity function, the evolution. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 666 3. Evolution of quasar density and luminosity function at high

  2. Wind anisotropy and stellar evolution

    E-Print Network [OSTI]

    Cyril Georgy; Georges Meynet; André Maeder

    2008-07-31

    Mass loss is a determinant factor which strongly affects the evolution and the fate of massive stars. At low metallicity, stars are supposed to rotate faster than at the solar one. This favors the existence of stars near the critical velocity. In this rotation regime, the deformation of the stellar surface becomes important, and wind anisotropy develops. Polar winds are expected to be dominant for fast rotating hot stars. These polar winds allow the star to lose large quantities of mass and still retain a high angular momentum, and they modifie the evolution of the surface velocity and the final angular momentum kept in the star's core. We show here how these winds affect the final stages of massive stars, according to our knowledge about Gamma Ray Bursts. Computation of theoretical Gamma Ray Bursts rate indicates that our models have too fast rotating cores, and that we need to include an additional effect to spin them down. Magnetic fields in stars act in this direction, and we show how they modify the evolution of massive star up to the final stages.

  3. Study of a Synthetic Human Olfactory Receptor 17-4: Expression and Purification from an Inducible Mammalian Cell Line

    E-Print Network [OSTI]

    Zhang, Shuguang

    In order to begin to study the structural and functional mechanisms of olfactory receptors, methods for milligram-scale purification are required. Here we demonstrate the production and expression of a synthetically ...

  4. Stratigraphic forward modelling & synthetic seismic images of carbonate Prof. Peter Burgess & Dr. Dave Waltham, Royal Holloway, University of London

    E-Print Network [OSTI]

    Royal Holloway, University of London

    of reservoir heterogeneities, allowing the seismic interpreter to make better-informed interpretation of reservoir intervals imaged on seismic data. The project will assess Stratigraphic forward modelling & synthetic seismic images of carbonate

  5. Part Mining for Synthetic Biology (2013 DOE JGI Genomics of Energy and Environment 8th Annual User Meeting)

    SciTech Connect (OSTI)

    Voigt, Chris [MIT

    2013-03-01

    Chris Voigt from MIT delivers the opening keynote on "Part Mining for Synthetic Biology" at the 8th Annual Genomics of Energy & Environment Meeting on March 26, 2013 in Walnut Creek, Calif.

  6. Bridging gaps in synthetic biology oversight : iGEM as a testbed for proactive, adaptive risk management

    E-Print Network [OSTI]

    McNamara, Julie H. (Julie Hutton)

    2014-01-01

    On the surface, the emerging field of synthetic biology looks highly similar to that of genetic engineering. However, the two fields are based upon divergent underlying logic structures. Whereas genetic engineering affects ...

  7. Synthetic Fuel

    ScienceCinema (OSTI)

    Idaho National Laboratory - Steve Herring, Jim O'Brien, Carl Stoots

    2010-01-08

    Two global energy priorities today are finding environmentally friendly alternatives to fossil fuels, and reducing greenhouse gass Two global energy priorities today are finding environmentally friendly alternatives to fossil fuels, and reducing greenhous

  8. Chemical evolution of protoplanetary disks - the effects of viscous accretion, turbulent mixing and disk winds

    E-Print Network [OSTI]

    Heinzeller, Dominikus; Walsh, Catherine; Millar, Tom J

    2011-01-01

    We calculate the chemical evolution of protoplanetary disks considering radial viscous accretion, vertical turbulent mixing and vertical disk winds. We study the effects on the disk chemical structure when different models for the formation of molecular hydrogen on dust grains are adopted. Our gas-phase chemistry is extracted from the UMIST Database for Astrochemistry (Rate06) to which we have added detailed gas-grain interactions. We use our chemical model results to generate synthetic near- and mid-infrared LTE line emission spectra and compare these with recent Spitzer observations. Our results show that if H2 formation on warm grains is taken into consideration, the H2O and OH abundances in the disk surface increase significantly. We find the radial accretion flow strongly influences the molecular abundances, with those in the cold midplane layers particularly affected. On the other hand, we show that diffusive turbulent mixing affects the disk chemistry in the warm molecular layers, influencing the line ...

  9. Evolution of games microbes play

    E-Print Network [OSTI]

    Schossau, Jory; Adami, Christoph

    2012-01-01

    When microbes compete for limited resources, they often engage in chemical warfare using bacterial toxins. This competition can be understood in terms of evolutionary game theory (EGT). We study the predictions of EGT for the bacterial "suicide bomber" game with two and three strategies, to simulations of these competitions with finite population sizes, but also allowing for probabilistic rather than pure strategies, as well as Darwinian adaptation. We find that Darwinian evolution of probabilistic strategies stabilizes games of the rock-paper-scissors type that emerge for parameters describing realistic bacterial populations, and points to ways in which the evolutionary stable strategy can be selected by changing those parameters.

  10. Predicting Community Evolution in Social Networks

    E-Print Network [OSTI]

    Saganowski, Stanis?aw; Bródka, Piotr; Zygmunt, Anna; Kazienko, Przemys?aw; Ko?lak, Jaros?aw

    2015-01-01

    Nowadays, sustained development of different social media can be observed worldwide. One of the relevant research domains intensively explored recently is analysis of social communities existing in social media as well as prediction of their future evolution taking into account collected historical evolution chains. These evolution chains proposed in the paper contain group states in the previous time frames and its historical transitions that were identified using one out of two methods: Stable Group Changes Identification (SGCI) and Group Evolution Discovery (GED). Based on the observed evolution chains of various length, structural network features are extracted, validated and selected as well as used to learn classification models. The experimental studies were performed on three real datasets with different profile: DBLP, Facebook and Polish blogosphere. The process of group prediction was analysed with respect to different classifiers as well as various descriptive feature sets extracted from evolution ...

  11. Synthetic Biology and the U.S. Biotechnology Regulatory System: Challenges and Options

    SciTech Connect (OSTI)

    Carter, Sarah R.; Rodemeyer, Michael; Garfinkel, Michele S.; Friedman, Robert M

    2014-05-01

    Synthetic Biology and the U.S. Biotechnology Regulatory System: Challenges and Options Sarah R. Carter, Ph.D., J. Craig Venter Institute; Michael Rodemeyer, J.D., University of Virginia; Michele S. Garfinkel, Ph.D., EMBO; Robert M. Friedman, Ph.D., J. Craig Venter Institute In recent years, a range of genetic engineering techniques referred to as “synthetic biology” has significantly expanded the tool kit available to scientists and engineers, providing them with far greater capabilities to engineer organisms than previous techniques allowed. The field of synthetic biology includes the relatively new ability to synthesize long pieces of DNA from chemicals, as well as improved methods for genetic manipulation and design of genetic pathways to achieve more precise control of biological systems. These advances will help usher in a new generation of genetically engineered microbes, plants, and animals. The JCVI Policy Center team, along with researchers at the University of Virginia and EMBO, examined how well the current U.S. regulatory system for genetically engineered products will handle the near-term introduction of organisms engineered using synthetic biology. In particular, the focus was on those organisms intended to be used or grown directly in the environment, outside of a contained facility. The study concludes that the U.S. regulatory agencies have adequate legal authority to address most, but not all, potential environmental, health and safety concerns posed by these organisms. Such near-term products are likely to represent incremental changes rather than a marked departure from previous genetically engineered organisms. However, the study also identified two key challenges for the regulatory system, which are detailed in the report. First, USDA’s authority over genetically engineered plants depends on the use of an older engineering technique that is no longer necessary for many applications. The shift to synthetic biology and other newer genetic engineering techniques will leave many engineered plants without any pre-market regulatory review. Second, the number and diversity of engineered microbes for commercial use will increase in the near future, challenging EPA’s resources, expertise, and perhaps authority to regulate them. For each of these challenges, the report sets out a series of options, including an analysis of the advantages and disadvantages of each option from a variety of perspectives, for policy makers to consider. Policy responses will depend on the trade-offs chosen among competing considerations. This report, funded by the Department of Energy with additional funds from the Alfred P. Sloan Foundation, is the result of a two-year process that included interviews, commissioned background papers, discussions, and two workshops that sought input from a wide range of experts, including U.S. federal agency regulators, legal and science policy experts, representatives from the biotechnology indus¬try, and non-governmental organiza¬tions. This cross-section of views informed this report, but the conclusions are solely those of the authors. An Executive Summary, full Report, and background papers are available at: http://www.jcvi.org/cms/research/projects/synthetic-biology-and-the-us-biotechnology-regulatory-system/overview/

  12. Jet Quenching from QCD Evolution

    E-Print Network [OSTI]

    Chien, Yang-Ting; Kang, Zhong-Bo; Ovanesyan, Grigory; Vitev, Ivan

    2015-01-01

    Recent advances in soft-collinear effective theory with Glauber gluons have led to the development of a new method that gives a unified description of inclusive hadron production in reactions with nucleons and heavy nuclei. We show how this approach, based on the generalization of the DGLAP evolution equations to include final-state medium-induced parton showers, can be combined with initial-state effects for applications to jet quenching phenomenology. We demonstrate that the traditional parton energy loss calculations can be regarded as a special soft-gluon emission limit of the general QCD evolution framework. We present phenomenological comparison of the SCET$_{\\rm G}$-based results on the suppression of inclusive charged hadron and neutral pion production in $\\sqrt{s_{NN}}=2.76$ TeV lead-lead collisions at the Large Hadron Collider to experimental data. We also show theoretical predictions for the upcoming $\\sqrt{s_{NN}} \\simeq 5.1$ TeV Pb+Pb run at the LHC.

  13. Lithium-Beryllium-Boron : Origin and Evolution

    E-Print Network [OSTI]

    Elisabeth Vangioni-Flam; Michel Casse; Jean Audouze

    1999-07-13

    The origin and evolution of Lithium-Beryllium-Boron is a crossing point between different astrophysical fields : optical and gamma spectroscopy, non thermal nucleosynthesis, Big Bang and stellar nucleosynthesis and finally galactic evolution. We describe the production and the evolution of Lithium-Beryllium-Boron from Big Bang up to now through the interaction of the Standard Galactic Cosmic Rays with the interstellar medium, supernova neutrino spallation and a low energy component related to supernova explosions in galactic superbubbles.

  14. A Study of Synthetic and Observed H_alpha Spectra of TT Hydrae

    E-Print Network [OSTI]

    Jan Budaj; Mercedes T. Richards; Brendan Miller

    2005-01-07

    The formation and properties of accretion discs and circumstellar material in Algol-type systems is not very well understood. In order to study the underlying physics of these structures, we have calculated synthetic Halpha spectra of TT Hya, which is an Algol-type eclipsing binary with an accretion disc. Both the primary and secondary stars were considered in the calculations as well as a disc surrounding the primary. The Roche model for the secondary star was assumed. The synthetic spectra cover all the phases including primary eclipse and are compared with the observed spectra. The influence of various effects and free parameters of the disc on the emerging spectrum was studied. This enabled us to put some constraints on the geometry, temperature, density and velocity fields within the disc. Differences found between the observed and synthetic spectra unravel the existence of a gas stream as well as a hotter disc-gas interaction region. An additional cooler circumstellar region between the C1 and C2 Roche surfaces is suggested to account for various observed effects. A new computer code called {\\sc{shellspec}} was created for this purpose and is briefly described in this work as well. It is designed to solve simple radiative transfer along the line of sight in 3D moving media. The scattered light from a central object is taken into account assuming an optically thin environment. Output intensities are then integrated through the 2D projection surface of a 3D object. The assumptions of the code include LTE and optional known state quantities and velocity fields in 3D.

  15. Relative performance of rotary and piston engines on synthetic coal-derived gasoline

    SciTech Connect (OSTI)

    Kappos, C.; Rajan, S.

    1989-01-01

    The paper compares the overall power and emissions features and in-cylinder combustion characteristics of a two-rotor Wankel engine and those of a four-cylinder piston engine, with particular reference to thermal efficiency, oxides of nitrogen, unburnt hydrocarbons, exhaust temperature, ignition delay and combustion interval. The study provides insight into the similarities and differences in the mechanisms of pollutant formation and combustion characteristics of rotary and piston engines, while operating on a synthetic coal-derived gasoline. In particular, the shorter ignition delay and longer combustion interval of the rotary engine indicates its suitability for use with lower quality fuels.

  16. Anisotropic evolution of a D-brane

    E-Print Network [OSTI]

    Pawel Gusin

    2009-05-06

    The evolution of a probe D-brane in the p-brane background has been considered. The anisotropic evolution of the world-volume of the D-brane with a given topology of a world-volume in a form of a direct product of a n-dimensional flat space and (3-n)-dimensional sphere has been obtained. In this case the anisotropy is described with the aid of two parameters (Hubble parameters). The special case of this evolution, namely the isotropic evolution corresponds to equality of these two parameters. In the latter case the masses and charges of the background p-branes have been derived.

  17. Comparative economics: evolution and the modern economy

    E-Print Network [OSTI]

    Vermeij, Geerat J.

    2009-01-01

    foundations of economics (pp. 367–390). Cambridge, UK:Press. Comparative economics: evolution and the modernPress. Hirshleifer, J. (1977). Economics from a biological

  18. Comparative economics: evolution and the modern economy

    E-Print Network [OSTI]

    Vermeij, Geerat J.

    2009-01-01

    A comparison of primate economies. Journal of Bioeconomics,1999). Complexity and the economy. Science, 284, 107–109.evolution and the modern economy Ghabrial, A. S. , &

  19. Amilcar Cabral: Evolution of Revolutionary Thought

    E-Print Network [OSTI]

    Magubane, Bernard

    1971-01-01

    AMILCAR CABRAL: EVOLUTION OF REVOLUTIONARY THOUGHT byto attempt to kill Amilcar Cabral, the leader of the Partidoof the situation. Amilcar Cabral has provided in the book

  20. Evolution on a Restless Planet: Were Environmental Variability and Environmental Change Major Drivers of Human Evolution?

    E-Print Network [OSTI]

    Richerson, Peter J.

    223 7 Evolution on a Restless Planet: Were Environmental Variability and Environmental Change Major Drivers of Human Evolution? Peter J. Richerson, Robert L. Bettinger, and Robert Boyd 7.1 Introduction Two kinds of factors set the tempo and direction of organic and cultural evolution, those external to biotic

  1. Evolution-cast: Temporal Evolution in Wireless Social Networks and Its Impact on Capacity

    E-Print Network [OSTI]

    Wang, Xinbing

    1 Evolution-cast: Temporal Evolution in Wireless Social Networks and Its Impact on Capacity Luoyi, the corresponding capacity is significantly impacted by both social relations and network evolution. In particular with each other through social relations but employ transmission via wireless communications. The network

  2. In the light of directed evolution: Pathways of adaptive protein evolution

    E-Print Network [OSTI]

    Arnold, Frances H.

    In the light of directed evolution: Pathways of adaptive protein evolution Jesse D. Blooma- erties such as catalytic activity or stability and that adaptation can often occur through pathways subsequently become the starting points for the adaptive evolution of new functions. These lessons about

  3. FILAMENTARY STAR FORMATION: OBSERVING THE EVOLUTION TOWARD FLATTENED ENVELOPES

    SciTech Connect (OSTI)

    Lee, Katherine; Looney, Leslie; Johnstone, Doug; Tobin, John E-mail: lwl@illinois.edu E-mail: jtobin@nrao.edu

    2012-12-20

    Filamentary structures are ubiquitous from large-scale molecular clouds (a few parsecs) to small-scale circumstellar envelopes around Class 0 sources ({approx}1000 AU to {approx}0.1 pc). In particular, recent observations with the Herschel Space Observatory emphasize the importance of large-scale filaments (a few parsecs) and star formation. The small-scale flattened envelopes around Class 0 sources are reminiscent of the large-scale filaments. We propose an observationally derived scenario for filamentary star formation that describes the evolution of filaments as part of the process for formation of cores and circumstellar envelopes. If such a scenario is correct, small-scale filamentary structures (0.1 pc in length) with higher densities embedded in starless cores should exist, although to date almost all the interferometers have failed to observe such structures. We perform synthetic observations of filaments at the prestellar stage by modeling the known Class 0 flattened envelope in L1157 using both the Combined Array for Research in Millimeter-wave Astronomy (CARMA) and the Atacama Large Millimeter/Submillimeter Array (ALMA). We show that with reasonable estimates for the column density through the flattened envelope, the CARMA D array at 3 mm wavelengths is not able to detect such filamentary structure, so previous studies would not have detected them. However, the substructures may be detected with the CARMA D+E array at 3 mm and the CARMA E array at 1 mm as a result of more appropriate resolution and sensitivity. ALMA is also capable of detecting the substructures and showing the structures in detail compared to the CARMA results with its unprecedented sensitivity. Such detection will confirm the new proposed paradigm of non-spherical star formation.

  4. Passive Evolution of Galaxy Clustering

    E-Print Network [OSTI]

    Hee-Jong Seo; Daniel J. Eisenstein; Idit Zehavi

    2007-12-11

    We present a numerical study of the evolution of galaxy clustering when galaxies flow passively from high redshift, respecting the continuity equation throughout. While passive flow is a special case of galaxy evolution, it allows a well-defined study of galaxy ancestry and serves as an interesting limit to be compared to non-passive cases. We use dissipationless N-body simulations, assign galaxies to massive halos at z=1 and z=2 using various HOD models, and trace these galaxy particles to lower redshift while conserving their number. We find that passive flow results in an asymptotic convergence at low redshift in the HOD and in galaxy clustering on scales above ~3Mpc/h for a wide range of initial HODs. As galaxies become less biased with respect to mass asymptotically with time, the HOD parameters evolve such that M1/Mm decreases while alpha converges toward unity, where Mm is the characteristic halo mass to host a central galaxy, M1 is the halo mass to host one satellite galaxy, and alpha is the power-law index in the halo-mass dependence of the average number of satellites per halo. The satellite populations converge toward the Poisson distribution at low redshift. The convergence is robust for different number densities and is enhanced when galaxies evolve from higher redshift. We compare our results with the observed LRG sample from Sloan Digital Sky Survey that has the same number density. We claim that if LRGs have experienced a strict passive flow, their should be close to a power law with an index of unity in halo mass. Discrepancies could be due to dry galaxy merging or new members arising between the initial and the final redshifts. The spatial distribution of passively flowing galaxies within halos appears on average more concentrated than the halo mass profile at low redshift. (abridged)

  5. Original article PROFESS: a PROtein Function, Evolution,

    E-Print Network [OSTI]

    Powers, Robert

    Original article PROFESS: a PROtein Function, Evolution, Structure and Sequence database Thomas introduce the PROFESS (PROtein Function, Evolution, Structure and Sequence) database. Our database the creation of the database. The utility of PROFESS is demonstrated by the analysis of the structural drift

  6. Atmospheric evolution on Venus Bruce Fegley, Jr.

    E-Print Network [OSTI]

    1 Atmospheric evolution on Venus Bruce Fegley, Jr. Planetary Chemistry Laboratory Department by Hunten et al. (1983), of Magellan results by Bougher et al. (1997), and atmospheric chemistry on Venus and Ancient Environments Edited by Vivien Gornitz January 2004 #12;2 ATMOSPHERIC EVOLUTION ON VENUS Overview

  7. Evolution equations in QCD and QED

    E-Print Network [OSTI]

    M. Slawinska

    2008-05-12

    Evolution equations of YFS and DGLAP types in leading order are considered. They are compared in terms of mathematical properties and solutions. In particular, it is discussed how the properties of evolution kernels affect solutions. Finally, comparison of solutions obtained numerically are presented.

  8. Scale evolution of double parton correlations

    E-Print Network [OSTI]

    Tomas Kasemets

    2014-11-17

    We review the effect of scale evolution on a number of different correlations in double parton scattering (DPS). The strength of the correlations generally decreases with the scale but at a rate which greatly varies between different types. Through studies of the evolution, an understanding of which correlations can be of experimental relevance in different processes and kinematical regions is obtained.

  9. Passive Scalar Evolution in Peripheral Region

    E-Print Network [OSTI]

    Fominov, Yakov

    Passive Scalar Evolution in Peripheral Region V. V. Lebedev Landau Institute for Theoretical investigate the passive scalar (concentration of pollutants or temperature) evolution in the random (turbulent stages of the passive scalar homogenization (decay). There are some peculiarities of the decay related

  10. Robotics and Vision Scientist Evolution Robotics

    E-Print Network [OSTI]

    Plotkin, Joshua B.

    91106 (626) 993-3300 09 May 2011 Evolution Robotics Employment Opportunity Profile · Title: Robotics and Vision Scientist · Reports to: VP of Research and Development The Company: Evolution Robotics, Inc. The recent convergence of low-cost mobile comput- ing, wireless communication, and sensing technologies has

  11. Evolution of Complex Hierarchical Peter Turchin

    E-Print Network [OSTI]

    Gavrilets, Sergey

    Evolution of Complex Hierarchical Societies Peter Turchin University of Connecticut Sergey investigated with mathematical models, and its predictions were tested empirically by constructing a database encompassing hundreds of millions (and in one case, over a bil- lion) of humans. Social Evolution & History

  12. Brain Evolution Relevant to P. Thomas Schoenemann

    E-Print Network [OSTI]

    Schoenemann, P. Thomas

    Brain Evolution Relevant to Language P. Thomas Schoenemann James Madison University 1. Introduction The evolution of language obviously presupposes a brain that made language possible. At the same time, given of the human brain must have been language. Given that language is at least as much a cultural

  13. Virus Evolution: Insights from an Experimental

    E-Print Network [OSTI]

    Elena, Santiago F.

    Virus Evolution: Insights from an Experimental Approach Santiago F. Elena and Rafael Sanju Viruses represent a serious problem faced by human and veterinary medicine and agronomy. New viruses indicates that the evolution of viruses is determined mainly by key features such as their small genomes

  14. Supplying Synthetic Crude Oil from Canadian Oil Sands: A Comparative Study of the Costs and CO2 Emissions of Mining and In-Situ Recovery

    E-Print Network [OSTI]

    Méjean, A.; Hope, Chris

    Aurélie Méjean and Chris Hope High crude oil prices and the eventual decline of conventional oil production raise the issue of alternative fuels such as non-conventional oil. The paper describes a simple probabilistic model of the costs of synthetic... and production constraints on the costs of supplying synthetic crude oil from Canadian bitumen deposits. The results show the uncertainties associated with the future costs of synthetic crude oil. Carbon costs have a large impact of the total costs...

  15. Cytotoxicity of synthetic cannabinoids on primary neuronal cells of the forebrain: the involvement of cannabinoid CB{sub 1} receptors and apoptotic cell death

    SciTech Connect (OSTI)

    Tomiyama, Ken-ichi; Funada, Masahiko

    2014-01-01

    The abuse of herbal products containing synthetic cannabinoids has become an issue of public concern. The purpose of this paper was to evaluate the acute cytotoxicity of synthetic cannabinoids on mouse brain neuronal cells. Cytotoxicity induced by synthetic cannabinoid (CP-55,940, CP-47,497, CP-47,497-C8, HU-210, JWH-018, JWH-210, AM-2201, and MAM-2201) was examined using forebrain neuronal cultures. These synthetic cannabinoids induced cytotoxicity in the forebrain cultures in a concentration-dependent manner. The cytotoxicity was suppressed by preincubation with the selective CB{sub 1} receptor antagonist AM251, but not with the selective CB{sub 2} receptor antagonist AM630. Furthermore, annexin-V-positive cells were found among the treated forebrain cells. Synthetic cannabinoid treatment induced the activation of caspase-3, and preincubation with a caspase-3 inhibitor significantly suppressed the cytotoxicity. These synthetic cannabinoids induced apoptosis through a caspase-3-dependent mechanism in the forebrain cultures. Our results indicate that the cytotoxicity of synthetic cannabinoids towards primary neuronal cells is mediated by the CB{sub 1} receptor, but not by the CB{sub 2} receptor, and further suggest that caspase cascades may play an important role in the apoptosis induced by these synthetic cannabinoids. In conclusion, excessive synthetic cannabinoid abuse may present a serious acute health concern due to neuronal damage or deficits in the brain. - Highlights: • Synthetic cannabinoids (classical cannabinoids, non-classical cannabinoids, and aminoalkylindole derivatives) induce cytotoxicity in mouse forebrain cultures. • Synthetic cannabinoid-induced cytotoxicity towards forebrain cultures is mediated by the CB{sub 1} receptor, but not by the CB{sub 2} receptor, and involves caspase-dependent apoptosis. • A high concentration of synthetic cannabinoids may be toxic to neuronal cells that express CB{sub 1} receptors.

  16. SURFACE RECONSTRUCTION AND CHEMICAL EVOLUTION OF STOICHIOMETRIC LAYERED CATHODE MATERIALS FOR LITHIUM-ION BATTERIES

    E-Print Network [OSTI]

    Lin, Feng

    2014-01-01

    RECONSTRUCTION AND CHEMICAL EVOLUTION OF STOICHIOMETRICreconstruction and chemical evolution in NMC materials andsurface reconstruction and chemical evolution herein refer

  17. Angular correlations and high energy evolution

    SciTech Connect (OSTI)

    Kovner, Alex; Lublinsky, Michael

    2011-11-01

    We address the question of to what extent JIMWLK evolution is capable of taking into account angular correlations in a high energy hadronic wave function. Our conclusion is that angular (and indeed other) correlations in the wave function cannot be reliably calculated without taking into account Pomeron loops in the evolution. As an example we study numerically the energy evolution of angular correlations between dipole scattering amplitudes in the framework of the large N{sub c} approximation to JIMWLK evolution (the 'projectile dipole model'). Target correlations are introduced via averaging over an (isotropic) ensemble of anisotropic initial conditions. We find that correlations disappear very quickly with rapidity even inside the saturation radius. This is in accordance with our physical picture of JIMWLK evolution. The actual correlations inside the saturation radius in the target QCD wave function, on the other hand, should remain sizable at any rapidity.

  18. US Synthetic Corp (TRL 4 Component)- The Development of Open, Water Lubricated Polycrystalline Diamond Thrust Bearings for use in Marine Hydrokinetic (MHK) Energy Machines

    Broader source: Energy.gov [DOE]

    US Synthetic Corp (TRL 4 Component) - The Development of Open, Water Lubricated Polycrystalline Diamond Thrust Bearings for use in Marine Hydrokinetic (MHK) Energy Machines

  19. Evolution, 49(5), 1995, pp. 848-863 EVOLUTION OF SPRINT SPEED IN LACERTID LIZARDS: MORPHOLOGICAL, PHYSIOLOGICAL,

    E-Print Network [OSTI]

    Saltzman, Wendy

    Evolution, 49(5), 1995, pp. 848-863 EVOLUTION OF SPRINT SPEED IN LACERTID LIZARDS: MORPHOLOGICAL@reks.uia.ac.be Abstract.-Organismal performance abilities occupy a central position in phenotypic evolution are achieved during evolution are therefore fundamentally important for understanding correlated evolution

  20. Experimental Study on Shear Fatigue Behavior and Stiffness Performance of Warm Mix Asphalt by adding Synthetic Wax

    E-Print Network [OSTI]

    Petit, Christophe; Canestrari, Francesco; Pannunzio, Valter; Virgili, Amadeo

    2012-01-01

    Synthetic waxes produced by standard and registered processes may be used to manufacture Warm Mix Asphalt (WMA), which is a modified asphalt concrete produced, applied and compacted at temperatures below those typically required. This feature leads to environmental benefits, such as reduced energy consumption, gas and fume emissions, as well as to economic/operational advantages, such as lower production costs and greater hauling distances for extended construction seasons with tighter schedules. The present article serves to compare the mechanical performance of a WMA produced by adding synthetic wax with a traditional Hot Mix Asphalt (HMA) specimen, in terms of shear fatigue response and both complex and stiffness moduli. The experimental results and related modeling work demonstrate that adding synthetic wax into the WMA composition does not hinder either the destructive or non-destructive performance of an HMA, and this finding is corroborated by respectively measuring fatigue life and stiffness.

  1. Experimental Study on Shear Fatigue Behavior and Stiffness Performance of Warm Mix Asphalt by adding Synthetic Wax

    E-Print Network [OSTI]

    Christophe Petit; Anne Millien; Francesco Canestrari; Valter Pannunzio; Amadeo Virgili

    2012-03-13

    Synthetic waxes produced by standard and registered processes may be used to manufacture Warm Mix Asphalt (WMA), which is a modified asphalt concrete produced, applied and compacted at temperatures below those typically required. This feature leads to environmental benefits, such as reduced energy consumption, gas and fume emissions, as well as to economic/operational advantages, such as lower production costs and greater hauling distances for extended construction seasons with tighter schedules. The present article serves to compare the mechanical performance of a WMA produced by adding synthetic wax with a traditional Hot Mix Asphalt (HMA) specimen, in terms of shear fatigue response and both complex and stiffness moduli. The experimental results and related modeling work demonstrate that adding synthetic wax into the WMA composition does not hinder either the destructive or non-destructive performance of an HMA, and this finding is corroborated by respectively measuring fatigue life and stiffness.

  2. Gas-to-liquids synthetic fuels for use in fuel cells : reformability, energy density, and infrastructure compatibility.

    SciTech Connect (OSTI)

    Ahmed, S.; Kopasz, J. P.; Russell, B. J.; Tomlinson, H. L.

    1999-09-08

    The fuel cell has many potential applications, from power sources for electric hybrid vehicles to small power plants for commercial buildings. The choice of fuel will be critical to the pace of its commercialization. This paper reviews the various liquid fuels being considered as an alternative to direct hydrogen gas for the fuel cell application, presents calculations of the hydrogen and carbon dioxide yields from autothermal reforming of candidate liquid fuels, and reports the product gas composition measured from the autothermal reforming of a synthetic fuel in a micro-reactor. The hydrogen yield for a synthetic paraffin fuel produced by a cobalt-based Fischer-Tropsch process was found to be similar to that of retail gasoline. The advantages of the synthetic fuel are that it contains no contaminants that would poison the fuel cell catalyst, is relatively benign to the environment, and could be transported in the existing fuel distribution system.

  3. Evolution of Middle Eastern Social Structures: a new model

    E-Print Network [OSTI]

    White, Douglas R.

    Evolution of Middle Eastern Social Structures: a new model Abstract The desert is small relative: evolution, endogamy, population, raiding, Bedouin,] #12;2 Evolution of Middle Eastern Social Structures

  4. Evolution of gluon TMD at low and moderate x

    E-Print Network [OSTI]

    I. Balitsky; A. Tarasov

    2014-11-05

    We study how the rapidity evolution of gluon transverse momentum dependent distribution changes from nonlinear evolution at small $x\\ll 1$ to linear double-logarithmic evolution at moderate $x\\sim 1$.

  5. The Evolution of a High Copy Gene Array in Arabidopsis

    E-Print Network [OSTI]

    Kane, Joshua; Freeling, Michael; Lyons, Eric

    2010-01-01

    48:597–604 Zhang J (2003) Evolution by gene duplication: an10.1007/s00239-010-9350-2 The Evolution of a High Copy Genein understanding the evolution of genomes and their host

  6. Rapidity evolution of gluon TMD from low to moderate x

    E-Print Network [OSTI]

    I. Balitsky; A. Tarasov

    2015-09-29

    We study how the rapidity evolution of gluon transverse momentum dependent distribution changes from nonlinear evolution at small $x \\ll 1$ to linear evolution at moderate $x \\sim 1$.

  7. Rapidity evolution of gluon TMD from low to moderate x

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Balitsky, Ian; Tarasov, A.

    2015-10-05

    In this article, we study how the rapidity evolution of gluon transverse momentum dependent distribution changes from nonlinear evolution at small $x \\ll 1$ to linear evolution at moderate $x \\sim 1$.

  8. CHOP: Performance Optimization for Batched Schema Evolution 1

    E-Print Network [OSTI]

    Claypool, Kajal

    of schema evolution primitives as well as for the merging of database modifications of primitivesCHOP: Performance Optimization for Batched Schema Evolution 1 Kajal T. Claypool, Elke A on Schema Evolution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 1.2 Our Proposed

  9. Evolution of Nuclear Star Clusters

    E-Print Network [OSTI]

    David Merritt

    2009-01-05

    Two-body relaxation times of nuclear star clusters are short enough that gravitational encounters should substantially affect their structure in 10 Gyr or less. In nuclear star clusters without massive black holes, dynamical evolution is a competition between core collapse, which causes densities to increase, and heat input from the surrounding galaxy, which causes densities to decrease. The maximum extent of a nucleus that can resist expansion is derived numerically for a wide range of initial conditions; observed nuclei are shown to be compact enough to resist expansion, although there may have been an earlier generation of low-density nuclei that were dissolved. An evolutionary model for NGC 205 is presented which suggests that the nucleus of this galaxy has already undergone core collapse. Adding a massive black hole to a nucleus inhibits core collapse, and nuclear star clusters with black holes always expand, due primarily to heat input from the galaxy and secondarily to heating from stellar disruptions. The expansion rate is smaller for larger black holes due to the smaller temperature difference between galaxy and nucleus when the black hole is large. The rate of stellar tidal disruptions and its variation with time are computed for a variety of initial models. The disruption rate generally decreases with time due to the evolving nuclear density, particularly in the faintest galaxies, assuming that scaling relations derived for luminous galaxies can be extended to low luminosities.

  10. THE REDSHIFT EVOLUTION OF THE RELATION BETWEEN STELLAR MASS,...

    Office of Scientific and Technical Information (OSTI)

    THE REDSHIFT EVOLUTION OF THE RELATION BETWEEN STELLAR MASS, STAR FORMATION RATE, AND GAS METALLICITY OF GALAXIES Citation Details In-Document Search Title: THE REDSHIFT EVOLUTION...

  11. Beneath the Surface of Giant Planets: Evolution, Structure, and Composition

    E-Print Network [OSTI]

    Kelly Miller, Neil L.

    2013-01-01

    larger. 2. Tidal evolution deposits energy into the planetin combination with tidal dissipation to deposit energy intothe tidal-thermal evolution model, including energy-limited

  12. Evolution of quasiparticle states with and without a Zn impurity...

    Office of Scientific and Technical Information (OSTI)

    Evolution of quasiparticle states with and without a Zn impurity in doped 122 iron pnictides Citation Details In-Document Search Title: Evolution of quasiparticle states with and...

  13. HIV virus spread and evolution studied through computer modeling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    HIV and evolution studied through computer modeling HIV virus spread and evolution studied through computer modeling This approach distinguishes between susceptible and infected...

  14. HyDIVE (Hydrogen Dynamic Infrastructure and Vehicle Evolution...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    HyDIVE (Hydrogen Dynamic Infrastructure and Vehicle Evolution) Model Analysis HyDIVE (Hydrogen Dynamic Infrastructure and Vehicle Evolution) Model Analysis Presentation by NREL's...

  15. Evolution of extreme resistance to ionizing radiation via genetic...

    Office of Scientific and Technical Information (OSTI)

    DOE PAGES Search Results Published Article: Evolution of extreme resistance to ionizing radiation via genetic adaptation of DNA repair Title: Evolution of extreme resistance to...

  16. The Evolution in Pu Nanocluster Electronic Structure: from Atomicity...

    Office of Scientific and Technical Information (OSTI)

    The Evolution in Pu Nanocluster Electronic Structure: from Atomicity to Three Dimensionality Citation Details In-Document Search Title: The Evolution in Pu Nanocluster Electronic...

  17. Chemical and Morphological Evolution of Nanoporous Pd/Rh Alloy...

    Office of Scientific and Technical Information (OSTI)

    Chemical and Morphological Evolution of Nanoporous PdRh Alloy Particles for Hydrogen Storage. Citation Details In-Document Search Title: Chemical and Morphological Evolution of...

  18. Synthetic and Thermodynamic Investigations of Ancillary Ligand Influence on Catalytic Organometallic Systems. Final Report

    SciTech Connect (OSTI)

    Nolan, Steven

    2003-03-20

    During the grant period we have been involved in synthesizing and experimentally determining solution enthalpy values associated with partially fluorinated ligands. This has lead to the publication of manuscripts dealing with synthetic, calorimetric and catalytic behavior of partially fluorinated ligands. The collaboration with Los Alamos researchers has lead to the publication of catalytic results in sc CO{sub 2} which have proven very interesting. Furthermore, we have also examined ligands that behave as phosphine mimics. The N-heterocyclic carbenes have been explored as alternatives for tertiary phosphines and have resulted in the design and construction of efficient palladium and nickel system capable of performing C-C and C-N cross coupling reactions. The initial studies in this areas were made possible by exploratory work conducted under the DOE/EPSCoR grant.

  19. Metabolic engineering of microorganisms for biofuels production: from bugs to synthetic biology to fuels

    SciTech Connect (OSTI)

    Kuk Lee, Sung; Chou, Howard; Ham, Timothy S.; Soon Lee, Taek; Keasling, Jay D.

    2009-12-02

    The ability to generate microorganisms that can produce biofuels similar to petroleum-based transportation fuels would allow the use of existing engines and infrastructure and would save an enormous amount of capital required for replacing the current infrastructure to accommodate biofuels that have properties significantly different from petroleum-based fuels. Several groups have demonstrated the feasibility of manipulating microbes to produce molecules similar to petroleum-derived products, albeit at relatively low productivity (e.g. maximum butanol production is around 20 g/L). For cost-effective production of biofuels, the fuel-producing hosts and pathways must be engineered and optimized. Advances in metabolic engineering and synthetic biology will provide new tools for metabolic engineers to better understand how to rewire the cell in order to create the desired phenotypes for the production of economically viable biofuels.

  20. Environmentally based siting assessment for synthetic-liquid-fuels facilities. Final report

    SciTech Connect (OSTI)

    1980-01-01

    A detailed assessment of the major environmental constraints to siting a synthetic fuels industry and the results of that assessment are used to determine on a regional basis the potential for development of such an industry with minimal environmental conflicts. Secondly, the ability to mitigate some of the constraining impacts through alternative institutional arrangements, especially in areas that are judged to have a low development potential is also assessed. Limitations of the study are delineated, but specifically, the study is limited geographically to well-defined boundaries that include the prime coal and oil shale resource areas. The critical factors used in developing the framework are air quality, water availability, socioeconomic capacity, ecological sensitivity, environmental health, and the management of Federally owned lands. (MCW)

  1. Gamma-Ray Burst Synthetic Spectra from Collisionless Shock PIC Simulations

    E-Print Network [OSTI]

    Christian Busk Hededal; Åke Nordlund

    2005-11-23

    The radiation from afterglows of gamma-ray bursts is generated in the collisionless plasma shock interface between a relativistic outflow and a quiescent circum-burst medium. The two main ingredients responsible for the radiation are high-energy, non-thermal electrons and a strong magnetic field. In this Letter we present, for the first time, synthetic spectra extracted directly from first principles particle-in-cell simulations of relativist collisionless plasma shocks. The spectra are generated by a numerical Fourier transformation of the electrical far-field from each of a large number of particles, sampled directly from the particle-in-cell simulations. Both the electromagnetic field and the non-thermal particle acceleration are self-consistent products of the Weibel two-stream instability. We find that the radiation spectrum from a $\\Gamma=15$ shock simulation show great resemblance with observed GRB spectra -- we compare specifically with that of GRB000301C.

  2. Critical analysis on nanostructured CoFeB synthetic orthogonal ferrimagnet

    SciTech Connect (OSTI)

    Chen, Y. S.; Lin, J. G., E-mail: jglin@ntu.edu.tw [Center for Condensed Matter Sciences, National Taiwan University, Taipei 10617, Taiwan (China); Cheng, Chih-Wei; Chern, G. [Department of Physics, National Chung Cheng University, Chia-Yi 621, Taiwan (China)

    2014-09-21

    Critical analysis on the magnetic properties of synthetic ferrimagnet (SyF), Ta/MgO/CoFeB/Ru/CoFeB/MgO/Ta, is demonstrated via both static and dynamic techniques. With the Ru thickness being 2.3 nm, the coupling between two CoFeB layers becomes orthogonal, which can be used for spin-transfer-torque nano-oscillator (STNO). The fitting of angular dependent ferromagnetic resonance (FMR) allows the precise determination of magnetic anisotropy of each CoFeB layer, the relative magnetizations and the exchange field near the frequency of STNO applications. In addition, the mechanism of resonance broadening at out-of-plane direction is identified to be magnetic inhomogeneity by fitting the angular dependent linewidth of FMR spectra, which provides indispensable information for the future design of STNO devices.

  3. Synthetic Catalysts for CO2 Storage: Catalytic Improvement of Solvent Capture Systems

    SciTech Connect (OSTI)

    None

    2010-08-15

    IMPACCT Project: LLNL is designing a process to pull CO2 out of the exhaust gas of coal-fired power plants so it can be transported, stored, or utilized elsewhere. Human lungs rely on an enzyme known as carbonic anhydrase to help separate CO2 from our blood and tissue as part of the normal breathing process. LLNL is designing a synthetic catalyst with the same function as this enzyme. The catalyst can be used to quickly capture CO2 from coal exhaust, just as the natural enzyme does in our lungs. LLNL is also developing a method of encapsulating chemical solvents in permeable microspheres that will greatly increase the speed of binding of CO2. The goal of the project is an industry-ready chemical vehicle that can withstand the harsh environments found in exhaust gas and enable new, simple process designs requiring less capital investment.

  4. Synthetic fuel aromaticity and staged combustion. First quarterly technical progress report, September 23-December 31, 1980

    SciTech Connect (OSTI)

    Levy, Arthur; Longanbach, James R.; Chan, Lisa K.

    1981-01-28

    Synthetic liquid fuels, otherwise referred to as synfuels or coal-derived liquids, are probably best characterized from a combustion-environmental point of view as low in hydrogen, low in sulfur, high in nitrogen, and high in aromatics. As a consequence two of the more critical problems in synfuel combustion are NO/sub x/ formation and soot formation (and polycyclic organic matter). This program is directed to these two issues. At first hand the solutions to burning synfuels high in aromatics and fuel-bound nitrogen are diametrically opposed, i.e., high temperature and excess air keep soot levels down, low temperatures and vitiated air keep nitrogen oxide levels down. Staged combustion however offers a logical solution to the above. This program separates and analyzes the synfuel combustion problem via its component parts and then puts them together again phenomenologically via the stage combustion process.

  5. Synthetic graph generation for data-intensive HPC benchmarking: Scalability, analysis and real-world application

    SciTech Connect (OSTI)

    Powers, Sarah S.; Lothian, Joshua

    2014-12-01

    The benchmarking effort within the Extreme Scale Systems Center at Oak Ridge National Laboratory seeks to provide High Performance Computing benchmarks and test suites of interest to the DoD sponsor. The work described in this report is a part of the effort focusing on graph generation. A previously developed benchmark, SystemBurn, allows the emulation of a broad spectrum of application behavior profiles within a single framework. To complement this effort, similar capabilities are desired for graph-centric problems. This report described the in-depth analysis of the generated synthetic graphs' properties at a variety of scales using different generator implementations and examines their applicability to replicating real world datasets.

  6. The evolution of very massive stars

    E-Print Network [OSTI]

    H. Belkus; J. Van Bever; D. Vanbeveren

    2007-01-11

    Core collapse of dense massive star clusters is unavoidable and this leads to the formation of massive objects, with a mass up to 1000 $\\msun$ and even larger. When these objects become stars, stellar wind mass loss determines their evolution and final fate, and decides upon whether they form black holes (with normal mass or with intermediate mass) or explode as a pair instability supernova. In the present paper, we discuss the evolution of very massive stars and we present a convenient evolution recipe that can be implemented in a gravitational N-body code to study the dynamics of dense massive clusters.

  7. HDS and deep HDS activity of Co/Mo/S-mesostructured synthetic clays.

    SciTech Connect (OSTI)

    Carrado, K. A.; Song, C.; Kim, J. H.; Castagnola, N.; Fernandez-Saavedra, R.; Marshall, C. L.; Schwartz, M. M.; Penn State Univ.; ICMM-CSIC

    2006-01-01

    The goal of this work is to identify more promising supports from synthetic clay materials to advance hydrotreating catalyst development. Silica sol can be used as the silicon-containing starting material when creating nanoporous layered silicate catalysts with a certain portion of unreacted sol particles incorporated into the final matrix. The resulting structure then has mesoporosity and a unique morphology. Hectorite-based clays have been prepared using different silica sols in order to ascertain the importance of sol characteristics on the final matrix. Several techniques have been applied to characterize the materials, including XRD, TGA, N2 porosimetry, and TEM. For hydrodesulfurization (HDS), the conversion of dibenzothiophene (DBT) to biphenyl was examined at 400 degrees C using CoMoS-loaded mesostructured clay supports. No hydrogenation or hydrocracking was observed with any of the clay supports. The most active clay was derived from Ludox silica sol AS-30 with an activity of 65% DBT conversion and 100% selectivity to biphenyl (BP). For comparison, a reference commercial catalyst displayed 94% BP selectivity. For deep HDS, the conversion of 4,6-dimethyldibenzothiophene was tested at 325 and 350 degrees C. At 325 degrees C, conversions are 92% of commercial catalysts for a CoMoS-loaded mesostructured clay derived from Ludox AM-30 silica sol. A commercially available synthetic hectorite called laponite has very low activity, indicating that the unique morphology of the mesostructured clays is important. Hydrogenolysis vs. hydrogenation pathways are compared for the deep HDS reaction. HR-TEM of the most active deep HDS catalyst revealed a multilayered MoS2 morphology.

  8. Galaxy Evolution in Abell 2390

    E-Print Network [OSTI]

    R. G. Abraham; T. A. Smecker-Hane; J. B. Hutchings; R. G. Carlberg; H. K. C. Yee; E. Ellingson; S. Morris; J. B. Oke; M. Rigler

    1996-05-23

    The galaxy population in the intermediate-redshift ($z=0.228$) rich cluster Abell 2390 is investigated. We present velocities, colors, and morphological information for an exceptionally large sample of 323 galaxies (216 cluster members) in a 46$^\\prime \\times 7^\\prime$ (6 $h^{-1}$ Mpc $\\times$ 1 $h^{-1}$ Mpc) strip centered on the cD galaxy. This sample of confirmed cluster members is second only to that for the Coma cluster in terms of sample size and spatial coverage in the cluster rest frame, and is the first to trace the transition between a rich cluster and the field at intermediate redshift. The galaxy population in the cluster changes gradually from a very evolved, early-type population in the inner 0.4 \\hmpc\\ of the cluster to a progressively later-type population in the extensive outer envelope of the cluster from 1 to 3 \\hmpc\\/ in radius. Radial gradients in galaxy $g-r$ color, 4000 \\AA\\/ break, H$\\delta$ and [O II] line strengths and morphology are seen in the cluster, and are investigated by comparing the data to models computed with the GISSEL spectral synthesis package. The results suggest that the cluster has been gradually built up by the infall of field galaxies over $\\sim 8$ Gyr and that star formation has been truncated in infalling galaxies during the accretion process. The morphological composition of the cluster is shown to be consistent with such a scenario. If true for other clusters, infall-truncated star formation as seen in Abell 2390 may explain both the Butcher-Oemler effect and the large fraction of S0 galaxies in clusters. Only $\\simlt$5\\% of the galaxies observed in Abell 2390 exhibit evidence for star formation at levels stronger than those seen in typical late-type systems. This suggests that starbursts do not play a major role in driving cluster galaxy evolution at the redshift of

  9. |Research Focus Statistical decision theory and evolution

    E-Print Network [OSTI]

    Maloney, Laurence T.

    |Research Focus Statistical decision theory and evolution Laurence T. Maloney Department recent articles by Geisler and Diehl use Bayesian statistical decision theory to model the co, an advantage that ultimately translates into `reproductive success'. The balance between predator and prey

  10. Evolution of symbolic communication : an embodied perspective 

    E-Print Network [OSTI]

    Brown, Jessica Erin

    2012-11-28

    This thesis investigates the emergence in human evolution of communication through symbols, or conventional, arbitrary signs. Previous work has argued that symbolic speech was preceded by communication through nonarbitrary ...

  11. Erratum: Evolution of antiferromagnetic susceptibility under...

    Office of Scientific and Technical Information (OSTI)

    susceptibility under uniaxial pressure inBa(Fe1-xCox)2As2Phys. Rev. B89, 214404 (2014) Citation Details In-Document Search Title: Erratum: Evolution of antiferromagnetic...

  12. Big data : evolution, components, challenges and opportunities

    E-Print Network [OSTI]

    Zarate Santovena, Alejandro

    2013-01-01

    This work reviews the evolution and current state of the "Big Data" industry, and to understand the key components, challenges and opportunities of Big Data and analytics face in today business environment, this is analyzed ...

  13. Perturbative QCD Evolution and Color Dipole Picture

    E-Print Network [OSTI]

    Dieter Schildknecht

    2011-04-05

    The proton structure function in the diffraction region of small Bjorken-$x$ and $10 {\\rm GeV}^2 \\le Q^2 \\le 100 {\\rm GeV}^2$ behaves as $F_2 (x, Q^2) = F_2 (W^2) = f_0 \\cdot (W^2)^{C_2}$, where $x = Q^2 / W^2$. The exponent $C_2$ of the $\\gamma^* p$ center-of-mass energy squared, $W^2$, is predicted from evolution of the flavor-singlet quark distribution, $C_2 = 0.29$, and the only free parameter, the normalization $f_0 = 0.063$, is fitted. The evolution of the gluon density multiplied by $\\alpha_s (Q^2)$ is dentical to the evolution of the flavor-singlet quark density. This simple picture is at variance with the standard approach to evolution based on the coupled equations of flavor-singlet and gluon density.

  14. Evolution and statistics of biological regulatory networks

    E-Print Network [OSTI]

    Chandalia, Juhi Kiran, 1979-

    2005-01-01

    In this thesis, I study the process of evolution of the gene regulatory network in Escherichia coli. First, I characterize the portion of the network that has been documented, and then I simulate growth of the network. In ...

  15. Metromorphosis : evolution on the urban island

    E-Print Network [OSTI]

    Vezina, Kenrick (Kenrick Freitas)

    2011-01-01

    Cities are very much alive. Like islands, they provide a natural testing ground for evolution. With more than half of the world's population living in urban areas now, the influence cities have on the planet's life is ...

  16. Modelling the Evolution of Communication Systems 

    E-Print Network [OSTI]

    Spike, Matthew John

    2012-11-28

    An framework using exemplar theory is used to recreate a number of published models of the evolution of communication. This is then used to examine the mechanics behind models of observational, feedback and reinforcement ...

  17. future science group 9ISSN 1759-726910.4155/BFS.11.151 2012 Future Science Ltd Synthetic biology approaches to biofuel production

    E-Print Network [OSTI]

    Hasty, Jeff

    approaches to biofuel production Editorial Biofuels (2012) 3(1), 9­12 "...it is important for synthetic will focus on the use of synthetic biology to engineer organisms for the more efficient production of biofuel over the current production level of about 13 billion gallons [1]. Given the expanding mar- ket

  18. REDUCTION OF VIBRATION-INDUCED ARTIFACTS IN SYNTHETIC-APERTURE-RADAR IMAGERY USING THE FRACTIONAL FOURIER TRANSFORM

    E-Print Network [OSTI]

    Santhanam, Balu

    REDUCTION OF VIBRATION-INDUCED ARTIFACTS IN SYNTHETIC-APERTURE-RADAR IMAGERY USING THE FRACTIONAL of objects exhibit- ing low-level vibrations are accompanied by localized arti- facts, or ghost targets to the non-stationary nature of the returned signals from vibrating objects. Re- cently, a method based

  19. A synthetic example of anisotropic P-wave processing for a model from the Gulf of Mexico

    E-Print Network [OSTI]

    Tsvankin, Ilya

    A synthetic example of anisotropic P-wave processing for a model from the Gulf of Mexico Baoniu Han, typical for the Gulf of Mexico, has a moderate structural complexity and includes a salt body elastic properties of shale formations and thin-bed sedimentary sequences (Thomsen, 1986; Sayers, 1994

  20. BIOL/MATH 393 Synthetic Biology Professors: Dr. Kristin O'Brien, kmobrien@alaska.edu, 474-5311

    E-Print Network [OSTI]

    Ickert-Bond, Steffi

    : Microbes that convert corn into plastic; a microbial fuel cell that generates electricity; E. coli bacteria that synthesize hemoglobin used for blood transfusions; E. coli that sense and destroy cancer cells- all. They will work together to design a synthetic microbe, construct the microbe and present results to the class

  1. Crystalline guanine adducts of natural and synthetic trioxacarcins suggest a common biological mechanism and reveal a basis

    E-Print Network [OSTI]

    Crystalline guanine adducts of natural and synthetic trioxacarcins suggest a common biological effects, with the self-complimentary duplex oligonucleotide d(AACCGGTT) led to production of a crystalline-red crystalline guanine adduct (7) from incubation of trioxacarcin A itself with the self- complimentary duplex

  2. McMillan, Frank M. The Chain Straighteners: Fruitful Innovation; The Discovery of Linear and Stereoregular Synthetic

    E-Print Network [OSTI]

    Conrad, Clint

    for the History of Chemistry, 1986. Mossman, Susan. ``Perspectives on the History and Technology of Plastics and Stereoregular Synthetic Polymers. London: Macmillan Press, 1979. Meikle, Jeffrey L. American Plastic: A Cultural: A Popular History of the Science and Technology of Large Molecules. Philadelphia: Beckman Center

  3. Metabolic Engineering and Synthetic Biology in Strain Development Every year, we consume about 27 billion barrels of fossil oil.

    E-Print Network [OSTI]

    Metabolic Engineering and Synthetic Biology in Strain Development Every year, we consume about 27, such as shale gas, are becoming available as new energy and chemical sources, these fossil resources will not be available in the future, simply because we consume them at a much higher rate than the rate at which

  4. Biological Hydrogen Production Using Synthetic Wastewater Biotin and glutamic acid are not required for biological hydrogen production.

    E-Print Network [OSTI]

    Barthelat, Francois

    Biological Hydrogen Production Using Synthetic Wastewater Conclusion ·Biotin and glutamic acid are not required for biological hydrogen production. ·MgSO4 .7H2O is a required nutrient, but hydrogen production work should focus on minimizing the lag time in biological hydrogen production, by varying nutrient

  5. Efficient recovery of nano-sized iron oxide particles from synthetic acid-mine drainage (AMD) water using fuel cell

    E-Print Network [OSTI]

    Efficient recovery of nano-sized iron oxide particles from synthetic acid-mine drainage (AMD) water 2010 Keywords: AMD Energy Iron oxide Microbial fuel cell Particles a b s t r a c t Acid mine drainage rights reserved. 1. Introduction Acid-mine drainage (AMD) and acid rock drainage (ARD) are caused

  6. Atomic Layer Deposition of In2O3 Using Cyclopentadienyl Indium: A New Synthetic Route to Transparent Conducting Oxide Films

    E-Print Network [OSTI]

    Atomic Layer Deposition of In2O3 Using Cyclopentadienyl Indium: A New Synthetic Route we present a new method for depositing In2O3 thin films by atomic layer deposition (ALD) using-15 and atomic layer deposition (ALD).16-20 Of these techniques, ALD shows significant promise as this method

  7. Evaluation of and Suggested Improvements to the WSM6 Microphysics in WRF- ARW Using Synthetic and Observed GOES-13 Imagery

    SciTech Connect (OSTI)

    Grasso, Lewis; Lindsey, Daniel T.; Lim, Kyo-Sun; Clark, Adam; Bikos, Dan; Dembek, Scott R.

    2014-10-01

    Synthetic satellite imagery can be employed to evaluate simulated cloud fields. Past studies have revealed that the Weather Research and Forecasting (WRF) WRF Single-Moment 6-class (WSM6) microphysics in WRF-ARW produces less upper level ice clouds within synthetic images compared to observations. Synthetic Geostationary Operational Environmental Satellite (GOES)-13 imagery at 10.7 ?m of simulated cloud fields from the 4 km National Severe Storms Laboratory (NSSL) WRF-ARW is compared to observed GOES-13 imagery. Histograms suggest that too few points contain upper level simulated ice clouds. In particular, side-by-side examples are shown of synthetic and observed convective anvils. Such images illustrate the lack of anvil cloud associated with convection produced by the NSSL WRF-ARW. A vertical profile of simulated hydrometeors suggests that too much cloud water mass may be converted into graupel mass, effectively reducing the main source of ice mass in a simulated anvil. Further, excessive accretion of ice by snow removes ice from an anvil by precipitation settling. Idealized sensitivity tests reveal that a 50% reduction of the conversion of cloud water mass to graupel and a 50% reduction of the accretion rate of ice by snow results in a significant increase in anvil ice of a simulated storm. Such results provide guidance as to which conversions could be reformulated, in a more physical manner, to increase simulated ice mass in the upper troposphere.

  8. Chemistry Major's Guide FA12/SP13 (Revised 5/14/12) 7 Recommended Academic Plan Synthetic/Biological Concentration

    E-Print Network [OSTI]

    Babu, G. Jogesh

    Chemistry Major's Guide FA12/SP13 (Revised 5/14/12) 7 Recommended Academic Plan ­ Synthetic/Biological Concentration Semester 1 Credits Semester 2 Credits PSU 16 Freshman Seminar in Chemistry 1 CHEM 112(H) Chemical Principles II (GN) 3 CHEM 110(H) Chemical Principles I (GN) 3 CHEM 113 Experimental Chemistry II

  9. On the virtual aeroshaping effect of synthetic jets Department of Mechanical and Aerospace Engineering, The George Washington University,

    E-Print Network [OSTI]

    Mittal, Rajat

    On the virtual aeroshaping effect of synthetic jets R. Mittal Department of Mechanical and Aerospace Engineering, The George Washington University, Washington, DC 20052 P. Rampunggoon Department of Mechanical Engineering, University of Florida, Gainesville, Florida 32611 Received 9 October 2001; accepted 3

  10. Fast Synthetic Vision, Memory, and Learning Models for Virtual Humans James J. Kuffner, Jr JeanClaude Latombe

    E-Print Network [OSTI]

    Pratt, Vaughan

    Fast Synthetic Vision, Memory, and Learning Models for Virtual Humans James J. Kuffner, Jr Jean, and learning for au­ tonomous animated characters in real­time virtual environ­ ments. The model is efficient of quickly synthesizing from navigation goals the collision­free mo­ tions for animated human figures

  11. Commuting Matrix Solutions of PQCD Evolution Equations

    E-Print Network [OSTI]

    Mehrdad Goshtasbpour; Seyed Ali Shafiei

    2013-03-16

    A method of obtaining parton distributions directly from data is revealed in this series. In the process, the first step would be developing appropriate matrix solutions of the evolution equations in $x$ space. A division into commuting and non-commuting matrix solutions has been made. Here, well-developed commuting matrix solutions are presented. Results for finite LO evolution match those of standard LO sets. There is a real potential of doing non-parametric data analysis.

  12. Goals: Understand how evolution works through gradual changes over time. Correlate DNA sequence conservation with evolution.

    E-Print Network [OSTI]

    Campbell, A. Malcolm

    understanding of evolution of species? 5) Genomics and Human Genome Project What is a genome? What is the human genome project? Mystery Sequences 1 ­ 18 #1 GCTTACGACCATATCACGTTGAATGCACGCCATCCCGTCCGATCTGGCAAGTTAAGCAAC

  13. Database of Geneva stellar evolution tracks and isochrones for UBVRIJHKLL'M, HST-WFPC2, Geneva and Washington photometric systems

    E-Print Network [OSTI]

    Thibault Lejeune; Daniel Schaerer

    2000-11-27

    We have used an updated version of the empirically and semi-empirically calibrated BaSeL library of synthetic stellar spectra of Lejeune et al. (1997, 1998) and Westera et al. (1999) to calculate synthetic photometry in the UBVRIJHKLL'M, HST-WFPC2, Geneva, and Washington systems for the entire set of non-rotating Geneva stellar evolution models covering masses from 0.4-0.8 to 120-150 Msun and metallicities Z=0.0004 (1/50 Zsun) to 0.1 (5 Zsun). The results are provided in a database which includes all individual stellar tracks and the corresponding isochrones covering ages from 10^3 yr to 16--20 Gyr in time steps of Delta(log t)= 0.05 dex. The database also includes a new grid of stellar tracks of very metal-poor stars (Z=0.0004) from 0.8 - 150 Msun calculated with the Geneva stellar evolution code. The full database will be available in electronic form at the CDS (http://cdsweb.u-strasbg.fr/cgi-bin/qcat?J/A+A/(vol)/(page)) and at http://webast.ast.obs-mip.fr/stellar/.

  14. Facilitating System-of-Systems Evolution With Architecture Support

    E-Print Network [OSTI]

    Han, Jun

    Facilitating System-of-Systems Evolution With Architecture Support Pin Chen DSTO C3 Research Centre The evolution of system-of-systems (SOS) is an emerging challenge and requires systematic architecture, Architecture Evolution Environment, to facilitate the evolution. We argue that an architecture solution

  15. Evolution as Computation Evolutionary Theory (accepted for publication)

    E-Print Network [OSTI]

    Mayfield, John

    1/21/05 1 Evolution as Computation Evolutionary Theory (accepted for publication) By: John E: jemayf@iastate.edu Key words: Evolution, Computation, Complexity, Depth Running head: Evolution of evolution must include life and also non-living processes that change over time in a manner similar

  16. Evolution Styles -Formal foundations and tool support for

    E-Print Network [OSTI]

    Evolution Styles - Formal foundations and tool support for software architecture evolution David-3890 Abstract Architecture evolution is a central feature of virtually all software systems. As new market almost no assistance in reasoning about questions such as: How should we stage the evolution to achieve

  17. Evolution of the layers in a subsumption architecture robot controller

    E-Print Network [OSTI]

    Togelius, Julian

    Evolution of the layers in a subsumption architecture robot controller Julian Togelius Dissertation julian@togelius.com +46-705-192088 #12;2 Abstract An approach to robotics called layered evolution. The evolvability and performance of layered evolution on this task is compared to (standard) monolithic evolution

  18. Evolution of a Subsumption Architecture Neurocontroller Julian Togelius

    E-Print Network [OSTI]

    Togelius, Julian

    Evolution of a Subsumption Architecture Neurocontroller Julian Togelius Mäster Nilsgatan 2 211 26 evolution and merging features from the subsumption architecture into evolutionary robotics is presented and performance of layered evolution on this task is compared to (standard) monolithic evolution, incremental

  19. Evolution Patterns of Open-Source Software Systems and Communities

    E-Print Network [OSTI]

    Nakakoji, Kumiyo

    Evolution Patterns of Open-Source Software Systems and Communities Kumiyo Nakakoji1,2,3 Yasuhiro product evolution". To understand how this "natural product evolution" happens, we have conducted a case study of four typical OSS projects. Unlike most previous studies on software evolution that focus

  20. Multimodel inference in ecology and evolution: challenges and solutions

    E-Print Network [OSTI]

    Jamieson, Ian

    landscape ecol- ogy, behavioural ecology, life history evolution, phylog- enetics and population genetics

  1. Efficien and Scalable Data Evolution with Column Oriented Databases

    E-Print Network [OSTI]

    Chen, Yi

    Efficien and Scalable Data Evolution with Column Oriented Databases Ziyang Liu1 , Bin He2 , Hui@us.ibm.com, hhsiao@almaden.ibm.com, yi@asu.edu ABSTRACT Database evolution is the process of updating the schema of a database or data warehouse (schema evolution) and e- volving the data to the updated schema (data evolution

  2. Automating Database Schema Evolution in Information System Upgrades

    E-Print Network [OSTI]

    Zaniolo, Carlo

    Automating Database Schema Evolution in Information System Upgrades Carlo Curino Hyun J. Moon Carlo, and down-time currently created by the database schema evolution process is the source of incessant prob and historical queries for database archives under schema evolution. Keywords Schema Evolution, Database Design

  3. Predictive Database Schema Evolution Hassina BOUNIF, Stefano SPACCAPIETRA

    E-Print Network [OSTI]

    Madiraju, Praveen

    Predictive Database Schema Evolution Hassina BOUNIF, Stefano SPACCAPIETRA Database Laboratory (LBD.spaccapietra@epfl.ch Abstract: This paper proposes a new approach for organizing the evolution of existing database system and easy-to-evolve database schema. Evolution algorithms are tailored to choose the best evolution

  4. Engineering a highly enantioselective horseradish peroxidase by directed evolution

    E-Print Network [OSTI]

    Antipov, Eugene

    2009-01-01

    There is an ever-growing demand for enantiopure chemical compounds, particularly new pharmaceuticals. Enzymes, as natural biocatalysts, possess many appealing properties as robust asymmetric catalysts for synthetic chemistry. ...

  5. Evolution, Antibiotics, and Algorithms Understanding the dynamics of microbial evolution has emerged as a central challenge in

    E-Print Network [OSTI]

    Lynch, Nancy

    Evolution, Antibiotics, and Algorithms Understanding the dynamics of microbial evolution has as to our capacity to fully realize the technological potential of the microbial world. Microbial evolution experimental apparatus to study bacterial evolution in spatially structured environments. Using it, we have

  6. Prepared for the 4th Biennial CALFED Science Conference 2006: Making Sense of Complexity: Science for a Changing Environment, October 23-25, 2006, Sacramento, CA. Synthetic runoff test

    E-Print Network [OSTI]

    Virginia Tech

    for a Changing Environment, October 23-25, 2006, Sacramento, CA. RESULTS Synthetic runoff test Total nitrogen

  7. Paper-Based Synthetic Gene Networks Keith Pardee,1,2 Alexander A. Green,1,2 Tom Ferrante,1 D. Ewen Cameron,2,3 Ajay DaleyKeyser,1 Peng Yin,1

    E-Print Network [OSTI]

    Polz, Martin

    created whole-cell biosensors (Ko- bayashi et al., 2004; Kotula et al., 2014), synthetic probiotics, new

  8. QCD evolution in the fully unintegrated form

    E-Print Network [OSTI]

    S. Jadach; M. Skrzypek

    2009-05-09

    The next-to-leading order (NLO) evolution of the parton distribution functions (PDF's) in QCD is the "industry standard" in the lepton-hadron and hadron-hadron collider data analysis. The standard NLO DGLAP evolution is formulated for inclusive (integrated) PDFs and is done using inclusive NLO kernels. We report here on the ongoing project, called KRKMC, in which NLO DGLAP evolution is performed for the exclusive multiparton (fully unintegrated) distributions (ePDF's) with the help of the exclusive kernels. These kernels are calculated within the two-parton phase space for bremsstrahlung subset of the Feynman diagrams of the non-singlet evolution, using Curci-Furmanski-Petronzio factorization scheme. The multiparton distribution with multiple use of the exclusive NLO kernels is implemented in the Monte Carlo program simulating multi-gluon emission from single quark emitter. With high statistics tests ($\\sim 10^{9}$ events) it is shown that the new scheme works perfectly well in practice and is equivalent at the inclusive level with the traditional inclusive NLO DGLAP evolution. Once completed, this Monte Carlo module is aimed as a building block for the NLO parton shower Monte Carlo, for W/Z production at LHC and for ep scattering, as well as a starting point for other perturbative QCD based Monte Carlo projects.

  9. The evolution of oscillator wave functions

    E-Print Network [OSTI]

    Mark Andrews

    2015-09-20

    We consider some of the methods that can be used to reveal the general features of how wave functions evolve with time in the harmonic oscillator. We first review the periodicity properties over each multiple of a quarter of the classical period of oscillation. Then we show that any wave function can be simply transformed so that its centroid, defined by the expectation values of position and momentum, remains at rest at the center of the oscillator. This implies that we need only consider the evolution of this restricted class of wave functions; the evolution of all others can be reduced to these. The evolution of the spread in position $\\Delta_x$ and momentum $\\Delta_p$ throws light on energy and uncertainty and on squeezed and coherent states. Finally we show that any wave function can be transformed so that $\\Delta_x$ and $\\Delta_p$ do not change with time and that the evolution of all wave functions can easily be found from the evolution of those at rest at the origin with unchanging $\\Delta_x$ and $\\Delta_p$.

  10. Component evolution in general random intersection graphs

    SciTech Connect (OSTI)

    Bradonjic, Milan [Los Alamos National Laboratory; Hagberg, Aric [Los Alamos National Laboratory; Hengartner, Nick [Los Alamos National Laboratory; Percus, Allon G [CLAREMONT GRADUATE UNIV.

    2010-01-01

    We analyze component evolution in general random intersection graphs (RIGs) and give conditions on existence and uniqueness of the giant component. Our techniques generalize the existing methods for analysis on component evolution in RIGs. That is, we analyze survival and extinction properties of a dependent, inhomogeneous Galton-Watson branching process on general RIGs. Our analysis relies on bounding the branching processes and inherits the fundamental concepts from the study on component evolution in Erdos-Renyi graphs. The main challenge becomes from the underlying structure of RIGs, when the number of offsprings follows a binomial distribution with a different number of nodes and different rate at each step during the evolution. RIGs can be interpreted as a model for large randomly formed non-metric data sets. Besides the mathematical analysis on component evolution, which we provide in this work, we perceive RIGs as an important random structure which has already found applications in social networks, epidemic networks, blog readership, or wireless sensor networks.

  11. A grid of synthetic ionizing spectra for very hot compact stars from NLTE model atmospheres

    E-Print Network [OSTI]

    Thomas Rauch

    2003-03-20

    The precise analysis of properties of planetary nebulae is strongly dependent on good models for the stellar ionizing spectrum. Observations in the UV - X-ray wavelength range as well as NLTE model atmosphere calculations of spectra of their exciting stars have shown that neither blackbody fluxes nor "standard" NLTE atmosphere models which are composed out of hydrogen and helium only are good approximations. Strong differences between synthetic spectra from these compared to observed spectra at energies higher than 54 eV (He II ground state) can be ascribed to the neglect of metal-line blanketing. Realistic modeling of the emergent fluxes of hot stars in the UV - X-ray wavelength range requires metal-line blanketed NLTE model atmospheres which include all elements from hydrogen up to the iron-group. For this purpose, we present a grid (solar and halo abundance ratios) of metal-line blanketed NLTE model atmosphere fluxes which covers the parameter range of central stars of planetary nebulae.

  12. Behavior of Concrete Panels Reinforced with Synthetic Fibers, Mild Steel, and GFRP Composites Subjected to Blasts

    SciTech Connect (OSTI)

    C. P. Pantelides; T. T. Garfield; W. D. Richins; T. K. Larson; J. E. Blakeley

    2012-03-01

    The paper presents experimental data generated for calibrating finite element models to predict the performance of reinforced concrete panels with a wide range of construction details under blast loading. The specimens were 1.2 m square panels constructed using Normal Weight Concrete (NWC) or Fiber Reinforced Concrete (FRC). FRC consisted of macro-synthetic fibers dispersed in NWC. Five types of panels were tested: NWC panels with steel bars; FRC panels without additional reinforcement; FRC panels with steel bars; NWC panels with glass fiber reinforced polymer (GFRP) bars; and NWC panels reinforced with steel bars and external GFRP laminates on both faces. Each panel type was constructed with three thicknesses: 152 mm, 254 mm, and 356 mm. FRC panels with steel bars had the best performance for new construction. NWC panels reinforced with steel bars and external GFRP laminates on both faces had the best performance for strengthening or rehabilitation of existing structures. The performance of NWC panels with GFRP bars was strongly influenced by the bar spacing. The behavior of the panels is classified in terms of damage using immediate occupancy, life safety, and near collapse performance levels. Preliminary dynamic simulations are compared to the experimental results.

  13. From Clarkia to Escherichia and Janus: the physics of natural and synthetic active colloids

    E-Print Network [OSTI]

    W C K Poon

    2013-06-20

    An active colloid is a suspension of particles that transduce free energy from their environment and use the energy to engage in intrinsically non-equilibrium activities such as growth, replication and self-propelled motility. An obvious example of active colloids is a suspension of bacteria such as Escherichia coli, their physical dimensions being almost invariably in the colloidal range. Synthetic self-propelled particles have also become available recently, such as two-faced, or Janus, particles propelled by differential chemical reactions on their surfaces driving a self-phoretic motion. In these lectures, I give a pedagogical introduction to the physics of single-particle and collective properties of active colloids, focussing on self propulsion. I will compare and contrast phenomena in suspensions of `swimmers' with the behaviour of suspensions of passive particles, where only Brownian motion (discovered by Robert Brown in granules from the pollen of the wild flower {\\it Clarkia pulchella}) is relevant. I will pay particular attention to issues that pertain to performing experiments using these active particle suspensions, such as how to characterise the suspension's swimming speed distribution, and include an appendix to guide physicists wanting to start culturing motile bacteria.

  14. Transport of synthetic colloids through single saturated fractures: A literature review

    SciTech Connect (OSTI)

    Reimus, P.W.

    1995-07-01

    Colloids having the same surface charge sign as the bulk of the geologic media in a groundwater system may be able to travel through the system faster than soluble species because they will follow fluid streamlines more closely and they should have less tendency to diffuse into pores or dead spaces in the media than soluble species. Synthetic colloids with uniform, controlled properties may be ideal for serving as {open_quotes}worst-case{close_quotes} tracers that provide lower-bound estimates of contaminant travel times in hydrologic systems. This report discusses a review of the literature pertaining to colloid transport in single saturated natural fractures. After a brief background discussion to put the literature review in perspective, the phenomenon of colloid transport in saturated fractures is divided into three major topics, each of which is reviewed in detail: (1) saturated fluid flow through fractures; (2) colloid transport by convection, diffusion, and force fields; and (3) colloid interactions with surfaces. It is suggested that these phenomena be accounted for in colloid transport models by using (1) lubrication theory to describe water flow through fractures, (2) particle tracking methods to describe colloid transport in fractures, and (3) a kinetic boundary layer approximation to describe colloid interactions with fracture walls. These methods offer better computational efficiency and better experimental accessibility to model parameters than rigorously solving the complete governing equations.

  15. Large Hybrid Energy Systems for Making Low CO2 Load-Following Power and Synthetic Fuel

    SciTech Connect (OSTI)

    Robert S. Cherry; Richard D. Boardman; Steven Aumeier

    2012-02-01

    Hybrid energy systems using nuclear heat sources can economically produce load-following electrical power by exploiting the surplus generation capacity available at night or seasonally to make synthetic fuel. Vehicle fuel is the only current energy use large enough to absorb all the energy capacity that might be diverted from the power industry, and its ease of storage obviates problems with discontinuous synfuel production. The potential benefits and challenges of synfuels integration are illustrated by the production of methanol from natural gas (as a source of carbon) using steam from a light water nuclear power reactor which is assumed to be available in accord with a year's worth of power demand data. Methanol's synthesis process is easily adapted to using 300 C heat from a light water reactor and this simple compound can be further processed into gasoline, biodiesel, or dimethyl ether, fuels which can be used with the current vehicle fleet. A supplemental feed to the methanol process of natural gas (for energy) allows operation at constant full rate when the nuclear heat is being used to produce electrical power. The higher capital costs of such a system are offset by a lower cost of heat and power production from a large base load type of plant and by reduced costs associated with much lower CO2 emissions. Other less tangible economic benefits of this and similar hybrid systems include better use of natural resource for fuels and greater energy services security from the domestic production of vehicle fuel.

  16. Method and apparatus for reducing range ambiguity in synthetic aperture radar

    DOE Patents [OSTI]

    Kare, Jordin T. (San Ramon, CA)

    1999-10-26

    A modified Synthetic Aperture Radar (SAR) system with reduced sensitivity to range ambiguities, and which uses secondary receiver channels to detect the range ambiguous signals and subtract them from the signal received by the main channel. Both desired and range ambiguous signals are detected by a main receiver and by one or more identical secondary receivers. All receivers are connected to a common antenna with two or more feed systems offset in elevation (e.g., a reflector antenna with multiple feed horns or a phased array with multiple phase shift networks. The secondary receiver output(s) is (are) then subtracted from the main receiver output in such a way as to cancel the ambiguous signals while only slightly attenuating the desired signal and slightly increasing the noise in the main channel, and thus does not significantly affect the desired signal. This subtraction may be done in real time, or the outputs of the receivers may be recorded separately and combined during signal processing.

  17. On the detection of crevasses in glacial ice with synthetic-aperture radar.

    SciTech Connect (OSTI)

    Brock, Billy C.

    2010-02-01

    The intent of this study is to provide an analysis of the scattering from a crevasse in Antarctic ice, utilizing a physics-based model for the scattering process. Of primary interest is a crevasse covered with a snow bridge, which makes the crevasse undetectable in visible-light images. It is demonstrated that a crevasse covered with a snow bridge can be visible in synthetic-aperture-radar (SAR) images. The model of the crevasse and snow bridge incorporates a complex dielectric permittivity model for dry snow and ice that takes into account the density profile of the glacier. The surface structure is based on a fractal model that can produce sastrugi-like features found on the surface of Antarctic glaciers. Simulated phase histories, computed with the Shooting and Bouncing Ray (SBR) method, are processed into SAR images. The viability of the SBR method for predicting scattering from a crevasse covered with a snow bridge is demonstrated. Some suggestions for improving the model are given.

  18. The Elephant in the Room: Dealing with Carbon Emissions from Synthetic Transportation Fuels Production

    SciTech Connect (OSTI)

    Parker, Graham B.; Dahowski, Robert T.

    2007-07-11

    Carbon dioxide (CO2), produced by conversion of hydrocarbons to energy, primarily via fossil fuel combustion, is one of the most ubiquitous and significant greenhouse gases (GHGs). Concerns over climate change precipitated by rising atmospheric GHG concentrations have prompted many industrialized nations to begin adopting limits on emissions to inhibit increases in atmospheric CO2 levels. The United Nations Framework Convention on Climate Change states as a key goal the stabilization of atmospheric CO2 at a level that prevents “dangerous anthropogenic interference” with the planet’s climate systems. This will require sharply reducing emissions growth rates in developing nations, and reducing CO2 emissions in the industrialized world to half current rates in the next 50 years. And ultimately, stabilization will require that annual emissions drop to almost zero.Recently, there has been interest in producing synthetic transportation fuels via coal-to-liquids (CTL) production, particularly in countries where there is an abundant supply of domestic coal, including the United States. This paper provides an overview of the current state of CTL technologies and deployment, a discussion of costs and technical requirements for mitigating the CO2 impacts associated with a CTL facility, and the challenges facing the CTL industry as it moves toward maturity.

  19. A High Resolution, Light-Weight, Synthetic Aperture Radar for UAV Application

    SciTech Connect (OSTI)

    Doerry, A.W.; Hensley, W.H.; Stence, J.; Tsunoda, S.I. Pace, F.; Walker, B,C.; Woodring, M.

    1999-05-27

    (U) Sandia National Laboratories in collaboration with General Atomics (GA) has designed and built a high resolution, light-weight, Ku-band Synthetic Aperture Radar (SAR) known as "Lynx". Although Lynx can be operated on a wide variety of manned and unmanned platforms, its design is optimized for use on medium altitude Unmanned Aerial Vehicles (UAVS). In particular, it can be operated on the Predator, I-GNAT, and Prowler II platforms manufactured by GA. (U) The radar production weight is less than 120 lb and operates within a 3 GHz band from 15.2 GHz to 18.2 GHz with a peak output power of 320 W. Operating range is resolution and mode dependent but can exceed 45 km in adverse weather (4 mm/hr rain). Lynx has operator selectable resolution and is capable of 0.1 m resolution in spotlight mode and 0.3 m resolution in stripmap mode, over substantial depression angles (5 to 60 deg) and squint angles (broadside ±45 deg). Real-time Motion Compensation is implemented to allow high-quality image formation even during vehicle turns and other maneuvers.

  20. Calibrating spectral estimation for the LISA Technology Package with multichannel synthetic noise generation

    SciTech Connect (OSTI)

    Ferraioli, Luigi; Hueller, Mauro; Vitale, Stefano; Heinzel, Gerhard; Hewitson, Martin; Monsky, Anneke; Nofrarias, Miquel

    2010-08-15

    The scientific objectives of the LISA Technology Package experiment on board of the LISA Pathfinder mission demand accurate calibration and validation of the data analysis tools in advance of the mission launch. The level of confidence required in the mission outcomes can be reached only by intensively testing the tools on synthetically generated data. A flexible procedure allowing the generation of a cross-correlated stationary noise time series was set up. A multichannel time series with the desired cross-correlation behavior can be generated once a model for a multichannel cross-spectral matrix is provided. The core of the procedure comprises a noise coloring, multichannel filter designed via a frequency-by-frequency eigendecomposition of the model cross-spectral matrix and a subsequent fit in the Z domain. The common problem of initial transients in a filtered time series is solved with a proper initialization of the filter recursion equations. The noise generator performance was tested in a two-dimensional case study of the closed-loop LISA Technology Package dynamics along the two principal degrees of freedom.

  1. Digital analogue of quantum adiabatic evolution

    E-Print Network [OSTI]

    Avatar Tulsi

    2015-08-10

    A quantum system can be evolved from the ground state of an initial Hamiltonian to that of a final Hamiltonian by adiabatically changing the Hamiltonian with respect to time. The system remains in the ground-state of time-changing Hamiltonian provided the change is slow enough. Quantum adiabatic evolution is a continuous time (analog) process and it is desirable to have a discrete time (digital) process which can simulate it. Here, we show that using discrete time quantum algorithms of fixed-point quantum search and phase estimation, it is possible to simulate quantum adiabatic evolution without any significant compromise with the running time.

  2. Evolution of entanglement under echo dynamics

    SciTech Connect (OSTI)

    Prosen, Tomaz; Znidaric, Marko [Physics Department, FMF, University of Ljubljana, Ljubljana (Slovenia); Seligman, Thomas H. [Centro de Ciencias Fisicas, University of Mexico (UNAM), Cuernavaca (Mexico)

    2003-04-01

    Echo dynamics and fidelity are often used to discuss stability in quantum-information processing and quantum chaos. Yet fidelity yields no information about entanglement, the characteristic property of quantum mechanics. We study the evolution of entanglement in echo dynamics. We find qualitatively different behavior between integrable and chaotic systems on one hand and between random and coherent initial states for integrable systems on the other. For the latter the evolution of entanglement is given by a classical time scale. Analytic results are illustrated numerically in a Jaynes-Cummings model.

  3. Moving system with speeded-up evolution

    E-Print Network [OSTI]

    M. I. Shirokov

    2008-02-29

    In the classical (non-quantum) relativity theory the course of the moving clock is dilated as compared to the course of the clock at rest (the Einstein dilation). Any unstable system may be regarded as a clock. The time evolution (e.g., the decay) of a uniformly moving physical system is considered using the relativistic quantum theory. The example of a moving system is given whose evolution turns out to be speeded-up instead of being dilated. A discussion of this paradoxical result is presented.

  4. Evolution of perturbed accelerating relativistic shock waves

    E-Print Network [OSTI]

    G. Palma; A. Mignone; M. Vietri; L. Del Zanna

    2008-07-01

    We study the evolution of an accelerating hyperrelativistic shock under the presence of upstream inhomogeneities wrinkling the discontinuity surface. The investigation is conducted by means of numerical simulations using the PLUTO code for astrophysical fluid dynamics. The reliability and robustness of the code are demonstrated against well known results coming from the linear perturbation theory. We then follow the nonlinear evolution of two classes of perturbing upstream atmospheres and conclude that no lasting wrinkle can be preserved indefinitely by the flow. Finally we derive analytically a description of the geometrical effects of a turbulent upstream ambient on the discontinuity surface.

  5. C H A P T E R F O U R T E E N Microfluidics for Synthetic Biology

    E-Print Network [OSTI]

    Hasty, Jeff

    C H A P T E R F O U R T E E N Microfluidics for Synthetic Biology: From Design to Execution M. S of a microfluidic chip 298 1.2. A parallel DAW device 322 1.3. Cell tracking 326 1.4. DAW hardware and software 334. coli 358 3.2. Method to set up a MDAW microfluidic experiment 364 Acknowledgments 371 References 371

  6. Integrated Operation of INL HYTEST System and High-Temperature Steam Electrolysis for Synthetic Natural Gas Production

    SciTech Connect (OSTI)

    Carl Marcel Stoots; Lee Shunn; James O'Brien

    2010-06-01

    The primary feedstock for synthetic fuel production is syngas, a mixture of carbon monoxide and hydrogen. Current hydrogen production technologies rely upon fossil fuels and produce significant quantities of greenhouse gases as a byproduct. This is not a sustainable means of satisfying future hydrogen demands, given the current projections for conventional world oil production and future targets for carbon emissions. For the past six years, the Idaho National Laboratory has been investigating the use of high-temperature steam electrolysis (HTSE) to produce the hydrogen feedstock required for synthetic fuel production. High-temperature electrolysis water-splitting technology, combined with non-carbon-emitting energy sources, can provide a sustainable, environmentally-friendly means of large-scale hydrogen production. Additionally, laboratory facilities are being developed at the INL for testing hybrid energy systems composed of several tightly-coupled chemical processes (HYTEST program). The first such test involved the coupling of HTSE, CO2 separation membrane, reverse shift reaction, and methanation reaction to demonstrate synthetic natural gas production from a feedstock of water and either CO or a simulated flue gas containing CO2. This paper will introduce the initial HTSE and HYTEST testing facilities, overall coupling of the technologies, testing results, and future plans.

  7. The electrorheology of suspensions consisting of Na-Fluorohectorite synthetic clay particles in silicon oil

    E-Print Network [OSTI]

    Y. Méheust; K. P. S. Parmar; B. Schjelderupsen; J. O. Fossum

    2010-02-01

    Under application of an electric field greater than a triggering electric field $E_c \\sim 0.4$ kV/mm, suspensions obtained by dispersing particles of the synthetic clay fluoro-hectorite in a silicon oil, aggregate into chain- and/or column-like structures parallel to the applied electric field. This micro-structuring results in a transition in the suspensions' rheological behavior, from a Newtonian-like behavior to a shear-thinning rheology with a significant yield stress. This behavior is studied as a function of particle volume fraction and strength of the applied electric field, $E$. The steady shear flow curves are observed to scale onto a master curve with respect to $E$, in a manner similar to what was recently found for suspensions of laponite clay [42]. In the case of Na-fluorohectorite, the corresponding dynamic yield stress is demonstrated to scale with respect to $E$ as a power law with an exponent $\\alpha \\sim 1.93$, while the static yield stress inferred from constant shear stress tests exhibits a similar behavior with $\\alpha \\sim 1.58$. The suspensions are also studied in the framework of thixotropic fluids: the bifurcation in the rheology behavior when letting the system flow and evolve under a constant applied shear stress is characterized, and a bifurcation yield stress, estimated as the applied shear stress at which viscosity bifurcation occurs, is measured to scale as $E^\\alpha$ with $\\alpha \\sim 0.5$ to 0.6. All measured yield stresses increase with the particle fraction $\\Phi$ of the suspension. For the static yield stress, a scaling law $\\Phi^\\beta$, with $\\beta = 0.54$, is found. The results are found to be reasonably consistent with each other. Their similarities with-, and discrepancies to- results obtained on laponite-oil suspensions are discussed.

  8. Leading Edge Bacterial Genomics and Pathogen Evolution

    E-Print Network [OSTI]

    Mekalanos, John

    Leading Edge Review Bacterial Genomics and Pathogen Evolution David M. Raskin,1 Rekha Seshadri,2 Medical School, Boston, MA 02115, USA 2 The Institute for Genomic Research, 9712 Medical Center Drive.02.002 The availability of hundreds of bacterial genome sequences has altered the study of bacte- rial pathogenesis

  9. ScheduleDay 1: Molecular Evolution Introduction

    E-Print Network [OSTI]

    Goldschmidt, Christina

    -Cantor Model Do Exercise Read Ponting, study slides from day 3 and find questions. Day 3: Comparative Genomics Lecture: Comparative Genomics Prepare Projects Practical: Models of Sequence Evolution Read HSW1, study questions. Day 10: Projects Project 1 ­ Population Genomics: Selective Sweeps Project 2 ­ Molecular

  10. Multitasking without Compromise: a Virtual Machine Evolution

    E-Print Network [OSTI]

    Baumgartner, Gerald

    Multitasking without Compromise: a Virtual Machine Evolution Grzegorz Czajkowski Laurent Daynès Sun grzegorz.czajkowski@sun.com laurent.daynes@sun.com ABSTRACT The Multitasking Virtual Machine (called from collector to provide best-effort management of a portion of the heap space, and a transparent and automated

  11. THE KUIPER BELT AND THE PRIMORDIAL EVOLUTION

    E-Print Network [OSTI]

    Brown, Michael E.

    THE KUIPER BELT AND THE PRIMORDIAL EVOLUTION OF THE SOLAR SYSTEM A. MORBIDELLI Observatoire de la C. Morbidelli & Brown Abstract. We discuss the structure of the Kuiper belt as it can be inferred from the #12 inclinations and colors{ which clearly show that the belt has lost its pristine structure of a dynamically cold

  12. Aesthetics, Art, Evolution Jon McCormack

    E-Print Network [OSTI]

    McCormack, Jon

    Aesthetics, Art, Evolution Jon McCormack Centre for Electronic Media Art Monash University issues in evolutionary art related to Art Theory and Aesthetics with a view to better understanding how they might contribute to both research and practice. Aesthetics is a term often used in evolutionary art

  13. Supporting Database Provenance under Schema Evolution

    E-Print Network [OSTI]

    Zaniolo, Carlo

    Supporting Database Provenance under Schema Evolution Shi Gao and Carlo Zaniolo University of California, Los Angeles {gaoshi, zaniolo}@cs.ucla.edu Abstract. Database schema upgrades are common in modern to explain the provenance of contents generated by the database conversion that is part of such upgrades

  14. The Evolution of Compact Binary Star Systems

    E-Print Network [OSTI]

    Konstantin Postnov; Lev Yungelson

    2014-03-21

    We review the formation and evolution of compact binary stars consisting of white dwarfs (WDs), neutron stars (NSs), and black holes (BHs). Mergings of compact binary stars are expected to be the most important sources for the forthcoming gravitational-wave (GW) astronomy. In the first part of the review, we discuss observational manifestations of close binary stars with NS and/or black components and their merger rate, crucial points in the formation and evolution of compact stars in binary systems, including the treatment of the natal kicks which NSs and BHs acquire during the core collapse of massive stars and the common envelope phase of binary evolution, which are most relevant to the merging rates of NS-NS, NS-BH and BH-BH binaries. The second part of the review is devoted mainly to formation and evolution of binary WDs and their observational manifestations, including their role as progenitors of cosmologically important thermonuclear SN Ia. We also consider AM CVn-stars which are thought to be the best verification binary GW sources for future low-frequency GW space interferometers.

  15. Microfluidic Large-Scale Integration: The Evolution

    E-Print Network [OSTI]

    Quake, Stephen R.

    Microfluidic Large-Scale Integration: The Evolution of Design Rules for Biological Automation, polydimethylsiloxane Abstract Microfluidic large-scale integration (mLSI) refers to the develop- ment of microfluidic, are discussed. Several microfluidic components used as building blocks to create effective, complex, and highly

  16. Hominid/Human Evolution Geology 331

    E-Print Network [OSTI]

    Kammer, Thomas

    baby chimps more than adult chimps. Humans are said to be paedomorphic. #12;Neoteny in Human Evolution. Humans resemble baby apes more than adult apes. Humans are said to be paedomorphic. Chimp Gorilla #12 fossils #12;A Hominid Jawbone in Ethiopia #12;Sahelanthropus tchadensis, 6.5 MY old #12;Sahelanthropus

  17. Embodied Evolution: Distributing an Evolutionary Algorithm

    E-Print Network [OSTI]

    Meeden, Lisa A.

    The vision of embodied evolution described above is largely inspired by ex­ periments in Artificial Li, which makes it an interesting platform for future work in collective robotics and Artificial Life. We. Key words: Evolutionary Robotics, Artificial Life, Evolutionary Algorithms, Distributed Learning

  18. Hydrogen Evolution on Hydrophobic Aligned Carbon Nanotube

    E-Print Network [OSTI]

    Daraio, Chiara

    Hydrogen Evolution on Hydrophobic Aligned Carbon Nanotube Arrays Abha Misra, Jyotsnendu Giri wall CNTs11 and aligned multiwall CNTs12 have been suggested as viable systems for hydrogen storage-decomposition of water using carbon electrodes has been pro- posed as a method for electrochemical storage of hydrogen.14

  19. Microscale Evolution of Web Pages Carrie Grimes

    E-Print Network [OSTI]

    Cortes, Corinna

    Microscale Evolution of Web Pages Carrie Grimes Google 345 Spear St San Francisco, CA 94105 cgrimes set of "rapidly" changing web pages and examine the assumption that the arrival of content changes in the behavior of pages that can be exploited to maintain freshness in a web corpus. Categories and Subject

  20. COURSE INFORMATION Plant Diversity and Evolution

    E-Print Network [OSTI]

    Chen, Kuang-Yu

    and experimental tools used to understand plant diversity. 4. "Vocabulary" of plant description (see list list) 7. Distinctive features of land plant diversity 8. The history of land plants through time #12COURSE INFORMATION Fall 2009 Plant Diversity and Evolution (11:704:411) and Advanced Plant

  1. 1 Internet Basics evolution of the web

    E-Print Network [OSTI]

    Verschelde, Jan

    Outline 1 Internet Basics evolution of the web IP addresses and URLs client/server and HTTP 2 and the internet L-18 23 February 2015 1 / 29 #12;networking and the internet markup languages 1 Internet Basics in browser 5 Summary + Assignments Intro to Computer Science (MCS 260) networking and the internet L-18 23

  2. Workshop Reports Understanding Paleoclimate and Human Evolution

    E-Print Network [OSTI]

    Reiners, Peter W.

    (DSDP) drill cores collected in the Gulf of Aden. This paper, as well as subsequent ones (de and Paleolakes Drilling Project byAndrewCohen,RamonArrowsmith,AnnaK.Behrensmeyer,ChristopherCampisano, Craig.10.2009 60 Scientific Drilling, No. 8, September 2009 Workshop Reports Understanding the evolution of humans

  3. Design by Directed Evolution FRANCES H. ARNOLD*

    E-Print Network [OSTI]

    Haile, Sossina M.

    Design by Directed Evolution FRANCES H. ARNOLD* Division of Chemistry and Chemical Engineering 210 to "Irrational" Design The stunning array of features and functions exhibited by proteins in nature should convince most scientists of the power of evolutionary design processes. Natural selection acting

  4. Nucleomorph genomes: structure, function, origin and evolution

    E-Print Network [OSTI]

    Archibald, John

    Nucleomorph genomes: structure, function, origin and evolution John M. Archibald Summary and four genomes--two nuclear genomes, an endosymbiont- derived plastid genome and a mitochondrial genome derived from the host cell. Like mitochondrial and plastid genomes, the genome of the endosymbiont nucleus

  5. Permeability Evolution during Deformation of Siliciclastic Sandstones

    E-Print Network [OSTI]

    Permeability Evolution during Deformation of Siliciclastic Sandstones from Moab, Utah O. Kwon1 Core; 0.33-ft)- diameter cores of four sandstones from the Moab area to investigate the effect of total. Sandstones with low bulk porosities (Dewey Bridge and Slickrock Subkha) exhibited an increase in permeability

  6. The evolution of the cosmic SN rate

    E-Print Network [OSTI]

    Enrico Cappellaro; Maria Teresa Botticella; Laura Greggio

    2007-06-09

    We briefly review the contribution of SN rate measurements to the debate on SN progenitor scenarios. We find that core collapse rates confirms the rapid evolution of the star formation rate with redshift. After accounting for the dispersion of SN Ia measurements and uncertainty of the star formation history, the standard scenarios for SN Ia progenitors appear consistent with all observational constraints.

  7. Gas Feedback on Stellar Bar Evolution

    E-Print Network [OSTI]

    Ingo Berentzen; Isaac Shlosman; Inma Martinez-Valpuesta; Clayton Heller

    2007-05-27

    We analyze evolution of live disk-halo systems in the presence of various gas fractions, f_gas less than 8% in the disk. We addressed the issue of angular momentum (J) transfer from the gas to the bar and its effect on the bar evolution. We find that the weakening of the bar, reported in the literature, is not related to the J-exchange with the gas, but is caused by the vertical buckling instability in the gas-poor disks and by a steep heating of a stellar velocity dispersion by the central mass concentration (CMC) in the gas-rich disks. The gas has a profound effect on the onset of the buckling -- larger f_gas brings it forth due to the more massive CMCs. The former process leads to the well-known formation of the peanut-shaped bulges, while the latter results in the formation of progressively more elliptical bulges, for larger f_gas. The subsequent (secular) evolution of the bar differs -- the gas-poor models exhibit a growing bar while gas-rich models show a declining bar whose vertical swelling is driven by a secular resonance heating. The border line between the gas-poor and -rich models lies at f_gas ~ 3% in our models, but is model-dependent and will be affected by additional processes, like star formation and feedback from stellar evolution. The overall effect of the gas on the evolution of the bar is not in a direct J transfer to the stars, but in the loss of J by the gas and its influx to the center that increases the CMC. The more massive CMC damps the vertical buckling instability and depopulates orbits responsible for the appearance of peanut-shaped bulges. The action of resonant and non-resonant processes in gas-poor and gas-rich disks leads to a converging evolution in the vertical extent of the bar and its stellar dispersion velocities, and to a diverging evolution in the bulge properties.

  8. Development of a Sorption Enhanced Steam Hydrogasification Process for In-situ Carbon Dioxide (CO2) Removal and Enhanced Synthetic Fuel Production

    E-Print Network [OSTI]

    Liu, Zhongzhe

    2013-01-01

    2 capture-a review. Energ Fuel. 2012; 26: 2751-7. 14. Yongfor CO 2 sequestration. Fuel Process Technol. 2005; 86:http://en.wikipedia.org/wiki/Synthetic_fuel 20. Phillips J.

  9. Synthetic Metagenomics: Converting digital information back to Biology (2013 DOE JGI Genomics of Energy and Environment 8th Annual User Meeting)

    SciTech Connect (OSTI)

    Deutsch, Sam [DOE Joint Genome Institute

    2013-03-01

    Sam Deutsch of the DOE JGI on "Synthetic Metagenomics: Converting digital information back to Biology" at the 8th Annual Genomics of Energy & Environment Meeting in Walnut Creek, Calif.

  10. The C. elegans class A synthetic multivulva genes inhibit ectopic RAS-mediated vulval development by tightly restricting expression of lin-3 EGF

    E-Print Network [OSTI]

    Saffer, Adam M

    2011-01-01

    The class A and B synthetic multivulva (synMuv) genes of C. elegans redundantly antagonize an EGF/Ras pathway to prevent ectopic vulval induction. The class B synMuv genes encode many proteins known to remodel chromatin ...

  11. Development of a Sorption Enhanced Steam Hydrogasification Process for In-situ Carbon Dioxide (CO2) Removal and Enhanced Synthetic Fuel Production

    E-Print Network [OSTI]

    Liu, Zhongzhe

    2013-01-01

    economic evaluation of coal-to-liquids (CTL) plants withis referred to as CTL (Coal-to-Liquids), BTL (Biomass-to-The synthetic liquid fuel production from coal, biomass, and

  12. Galaxy Evolution, Deep Galaxy Counts and the Near-IR Cosmic Infrared Background

    E-Print Network [OSTI]

    R. Jimenez; A. Kashlinsky

    1998-09-15

    Accurate synthetic models of stellar populations are constructed and used in evolutionary models of stellar populations in forming galaxies. Following their formation, the late type galaxies are assumed to follow the Schmidt law for star formation, while early type galaxies are normalized to the present-day fundamental plane relations assumed to mimic the metallicity variations along their luminosity sequence. We then compute predictions of these models for the observational data at early epochs for various cosmological parameters $\\Omega, \\Omega_\\Lambda$ and $H_0$. We find good match to the metallicity data from the damped $L_\\alpha$ systems and the evolution of the luminosity density out to $z\\simeq 1$. Likewise, our models provide good fits for low values of $\\Omega$ to the deep number counts of galaxies in all bands where data is available; this is done without assuming existence of extra populations of galaxies at high $z$. Our models also match the data on the redshift distribution of galaxy counts in $B$ and $K$ bands. We compute the predicted mean levels and angular distribution of the cosmic infrared background produced from the early evolution of galaxies. The predicted fluxes and fluctuations are still below the current observational limits, but not by a large factor. Finally, we find that the recent detection of the diffuse extragalactic light in the visible bands requires for our models high redshift of galaxy formation, $z_f \\geq$(3-4); otherwise the produced flux of the extragalactic light at optical bands exceeds the current observational limits.

  13. Supernova progenitors and iron density evolution from SN rate evolution measurements

    E-Print Network [OSTI]

    Guillaume Blanc; Laura Greggio

    2008-03-28

    Using an extensive compilation of literature supernova rate data we study to which extent its evolution constrains the star formation history, the distribution of the type Ia supernova (SNIa) progenitor's lifetime, the mass range of core-collapse supernova (CCSN) progenitors, and the evolution of the iron density in the field. We find that the diagnostic power of the cosmic SNIa rate on their progenitor model is relatively weak. More promising is the use of the evolution of the SNIa rate in galaxy clusters. We find that the CCSN rate is compatible with a Salpeter IMF, with a minimum mass for their progenitors > 10 Msun. We estimate the evolution in the field of the iron density released by SNe and find that in the local universe the iron abundance should be ~ 0.1 solar. We discuss the difference between this value and the iron abundance in clusters.

  14. Alien Species and Evolution: The Evolutionary Ecology of Exotic Plants, Animals, Microbes and Interacting Native Species

    E-Print Network [OSTI]

    Nehrbass, Nana

    2005-01-01

    Review: Alien Species and Evolution: The EvolutionaryGermany George W. Cox. Alien Species and Evolution: TheRecycled, acid-free paper. Alien Species and Evolution leads

  15. Evolution of Male Coloration in The Wild: The Role of Sex Linkage and Selection

    E-Print Network [OSTI]

    Gordon, Swanne Pamela

    2011-01-01

    and heritability limits evolution. PLOS (Public Library ofand J. Parsch. 2007. The evolution of sex-biased genes andPoecilia reticulata. Evolution Endler, J. A. 1986. Natural

  16. Accounting for Dependent Evolution Among Sites: Phylogenetic and Population Genetic Approaches

    E-Print Network [OSTI]

    Nasrallah, Chris Anthony

    2012-01-01

    Compensatory Evolution Accounting ulation Genetic DynamicsAccounting for Dependent Evolution Among Sites: PhylogeneticIan Holmes Fall 2012 Accounting for Dependent Evolution

  17. Change Management for Metadata Evolution Diana Maynard1

    E-Print Network [OSTI]

    Maynard, Diana

    Change Management for Metadata Evolution Diana Maynard1 , Wim Peters1 , Mathieu d'Aquin2 for metadata evolution becomes extremely important in a distributed, dynamic environment. Change management

  18. Evolution of quantum correlations in a two-atom system

    E-Print Network [OSTI]

    Ryszard Tana?

    2012-10-22

    We discuss the evolution of quantum correlations for a system of two two-level atoms interacting with a common reservoir. The Markovian master equation is used to describe the evolution of various measures of quantum correlations.

  19. Modeling Solar Activity Bayesian Analysis of Stellar Evolution

    E-Print Network [OSTI]

    Wolfe, Patrick J.

    Modeling Solar Activity Bayesian Analysis of Stellar Evolution Astrostatistical Analysis in Solar, David Astrostatistical Analysis in Solar and Stellar Physics #12;Modeling Solar Activity Bayesian Analysis of Stellar Evolution Outline 1 Modeling Solar Activity Background Morphological Feature Extraction

  20. Structural Evolution of Colloidal Crystals with Increasing Ionic Strength

    E-Print Network [OSTI]

    Braun, Paul

    Structural Evolution of Colloidal Crystals with Increasing Ionic Strength Michael A. Bevan. In Final Form: June 5, 2004 We have directly observed the structural evolution of colloidal crystals colloidal crystals were shear melted and then evolved

  1. On admissible memory kernels for random unitary qubit evolution

    E-Print Network [OSTI]

    Filip A. Wudarski; Pawe? Nale?yty; Gniewomir Sarbicki; Dariusz Chru?ci?ski

    2015-04-12

    We analyze random unitary evolution of the qubit within memory kernel approach. We provide su?cient conditions which guarantee that the corresponding memory kernel generates physically legitimate quantum evolution. Interestingly, we are able to recover several well known examples and generate new classes of nontrivial qubit evolution. Surprisingly, it turns out that quantum evolution with memory kernel generated by our approach gives rise to vanishing non-Markovianity measure based on the distinguishability of quantum states.

  2. Discordant molecular and morphological evolution in buffalofishes (Actinopterygii: Catostomidae)

    E-Print Network [OSTI]

    Piller, Kyle R.

    Discordant molecular and morphological evolution in buffalofishes (Actinopterygii: Catostomidae 2010 Keywords: Hybridization Introgression Gene flow Ictiobus North America Catostomidae Cypriniformes

  3. Life-History Evolution --General Info Spring 1997

    E-Print Network [OSTI]

    Janzen, Fredric

    Life-History Evolution -- General Info Spring 1997 333 Science II Instructors: Dr. Fredric J@iastate.edu Office Hours: by appt.!! Texts: Roff, D. A. 1992. The evolution of life histories: theory and analysis. Chapman and Hall, NY. Stearns, S. C. 1992. The evolution of life histories. Oxford University Press, NY

  4. Evolution of Surname Distribution under Gender-Equality Measures

    E-Print Network [OSTI]

    Toral, Raúl

    Evolution of Surname Distribution under Gender- Equality Measures Luis F. Lafuerza, Raul Toral Mallorca, Spain Abstract We consider a model for the evolution of surname distribution under a gender, Toral R (2011) Evolution of Surname Distribution under Gender-Equality Measures. PLoS ONE 6(4): e18105

  5. Evolution Galerkin methods for hyperbolic systems in two space dimensions

    E-Print Network [OSTI]

    Magdeburg, Universität

    Evolution Galerkin methods for hyperbolic systems in two space Abstract The subject of the paper is the analysis of three new evolution Galerkin s* *chemes of bicharacteristics. The main idea of the * *evolution Galerkin methods is the following. The initial function

  6. Evolution towards Symmetry Ferdinand Verhulst and Richard Huveneers

    E-Print Network [OSTI]

    Verhulst, Ferdinand

    Evolution towards Symmetry Ferdinand Verhulst and Richard Huveneers Mathematisch Instituut those of today and will the laws of tomorrow still be the same? Henri Poincar´e in `The evolution of the laws', Derni`eres Pens´ees. Abstract The dynamics of time-dependent evolution towards symmetry

  7. Evolution and Usage of the Portal Data Archive

    E-Print Network [OSTI]

    Bertini, Robert L.

    + Evolution and Usage of the Portal Data Archive: A Ten-Year Retrospective Kristin Tufte,Robert L Page today... Portal's Own Map! Vancouver,WA New Sensors & New Data Feed #12;+ Home Page ­ Evolution - Two Quantities -Updated technology -Data download #12;+ Timeseries Plot ­ Evolution ! Updated

  8. Evolution by gene duplication: an update Jianzhi Zhang

    E-Print Network [OSTI]

    Zhang, Jianzhi

    Evolution by gene duplication: an update Jianzhi Zhang Department of Ecology and Evolutionary The importance of gene duplication in supplying raw genetic material to biological evolution has been recog- tions, and what role does gene duplication play in the evolution of genomes and organisms? Detailed

  9. The Evolution of Structure in Clusters of Galaxies

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    The Evolution of Structure in Clusters of Galaxies with C. Canizares, M. Bautz, and D. Buote · The observed evolution of cluster morphology ­ Introduction: cosmology with clusters cluster mergers. · Constrain m and 8 from evolution in cluster number density and cluster baryon fraction. #12;· High

  10. Evolution of the Bohemian Massif: Insights from numerical modeling

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    Evolution of the Bohemian Massif: Insights from numerical modeling Petra Maierová Supervisor: Doc of Geophysics Faculty of Mathematics and Physics Charles University in Prague #12;February 4, 2013Evolution Conclusions Outline #12;February 4, 2013Evolution of the Bohemian Massif: Insights from numerical modeling 3

  11. Evolution of Morality1 By Edouard Machery and Ron Mallon

    E-Print Network [OSTI]

    Machery, Edouard

    1 Evolution of Morality1 By Edouard Machery and Ron Mallon Biology provides a broad source the process of organic evolution that gave rise to all forms of life has been left out of the discussions to evolution of morality (e.g., Spencer, 1892; Richards, 1986, 1989; Rottschaefer & Martinsen, 1990

  12. Meta Object Management and its Application to Database Evolution ?

    E-Print Network [OSTI]

    Scholl, Marc H.

    Meta Object Management and its Application to Database Evolution ? Markus Tresch and Marc H. Scholl evolution, that is, realizing incremental changes to the database schema and their propagation to data objects, and how this approach can be used to build a complete tool for database evolution. 1 Introduction

  13. How to integrate Schema Evolution into the Persistent Garbage Collection

    E-Print Network [OSTI]

    Mössenböck, Hanspeter

    ) knasmueller@bmd.at Abstract. Schema evolution is a very important functionality in object­oriented database shall not require sophisticated schema­evolution capabilities in an object database management systemHow to integrate Schema Evolution into the Persistent Garbage Collection Markus Knasmüller BMD

  14. Requirements Ontology and Multirepresentation Strategy for Database Schema Evolution 1

    E-Print Network [OSTI]

    Pottinger, Rachel

    Requirements Ontology and Multirepresentation Strategy for Database Schema Evolution 1 Hassina important utilization field of ontology related to database schemas and which is schema evolution topic and which is related to information systems. That is database schema evolution, an important, complex

  15. Evolutionary Biology Bioscene 3 Evolution Kills: A Web Resource for

    E-Print Network [OSTI]

    Antonovics, Janis

    of the course materials, a database of other articles describing laboratory and field exercises in evolutionEvolutionary Biology Bioscene 3 Evolution Kills: A Web Resource for Instructors of Evolutionary that demonstrates how evolution can be taught as a participatory, investigative science at the undergraduate college

  16. Schema Evolution and Versioning: a Logical and Computational Characterisation

    E-Print Network [OSTI]

    Franconi, Enrico

    Schema evolution and versioning problems have been considered in the context of long­lived database]. According to the definitions given in a consensual glossary [21], a database supports schema evolutionSchema Evolution and Versioning: a Logical and Computational Characterisation Enrico Franconi 1

  17. Quantum search by local adiabatic evolution Jeremie Roland1

    E-Print Network [OSTI]

    Cerf, Nicolas

    item in an unstructured database. We find that by adjusting the evolution rate of the Hamiltonian soQuantum search by local adiabatic evolution Je´re´mie Roland1 and Nicolas J. Cerf1,2 1 Ecole as to keep the evolution adiabatic on each infinitesimal time interval, the total running time is of order N

  18. A Query Answering System for Data with Evolution Relationships

    E-Print Network [OSTI]

    Velegrakis, Yannis

    for exploiting the evolution relationships between the structures in the database. In particular, our system]: Miscellaneous General Terms Algorithms, Performance Keywords Data evolution, Probabilistic databases, GraphA Query Answering System for Data with Evolution Relationships Siarhei Bykau University of Trento

  19. A Framework for Schema Evolution by Meta Object Manipulation \\Lambda

    E-Print Network [OSTI]

    Scholl, Marc H.

    . Most currently available database prototypes either completely lack schema evolution facilities schema evolution. 1 Introduction The logical structure of the data stored in a database is defined summarize in the term schema evolution several types of possible changes to the logical database schema

  20. WPICSTR9906 March 1999 Optimizatizing the Performance of Schema Evolution

    E-Print Network [OSTI]

    for the iterative elimination and cancellation of schema evolution primitives as well as for the merging of database optimization technique over previous solutions. Keywords: Schema Evolution, Object­Oriented Databases, Deferred.1 Background on Schema Evolution Not only is it difficult to pre­determine the database schema for many complex

  1. A Model for Compound Type Changes Encountered in Schema Evolution

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    in relational database systems, making schema evolution a more difficult problem. With persistent programmingA Model for Compound Type Changes Encountered in Schema Evolution Barbara Staudt Lerner Computer Science Department University of Massachusetts, Amherst June 12, 1996 Abstract Schema evolution

  2. Towards a Taxonomy of Software Evolution Tom Mens Jim Buckley

    E-Print Network [OSTI]

    Zenger, Matthias

    Towards a Taxonomy of Software Evolution Tom Mens Jim Buckley Vrije Universiteit Brussel Pleinlaan taxonomies of software evolution have focused on the purpose of the change (i.e., the why) rather than the underlying mechanisms. This paper proposes a taxonomy of software evolution based on the characterizing

  3. Evaluation of Environmental Quality and Evolution in Urban Soils of

    E-Print Network [OSTI]

    Report on Evaluation of Environmental Quality and Evolution in Urban Soils of Qingdao City Y. Cai and Evolution in Urban Soils of Qingdao City ­ p. 0/2 #12;1. Problems Report on Evaluation of Environmental Quality and Evolution in Urban Soils of Qingdao City ­ p. 1/2 #12;1. Problems What we know about

  4. Summary report : direct approaches for recycling carbon dioxide into synthetic fuel.

    SciTech Connect (OSTI)

    Allendorf, Mark D.; Ambrosini, Andrea; Diver, Richard B., Jr.; Siegel, Nathan Phillip; Miller, James Edward; Gelbard, Fred; Evans, Lindsey R.

    2009-01-01

    The consumption of petroleum by the transportation sector in the United States is roughly equivalent to petroleum imports into the country, which have totaled over 12 million barrels a day every year since 2004. This reliance on foreign oil is a strategic vulnerability for the economy and national security. Further, the effect of unmitigated CO{sub 2} releases on the global climate is a growing concern both here and abroad. Independence from problematic oil producers can be achieved to a great degree through the utilization of non-conventional hydrocarbon resources such as coal, oil-shale and tarsands. However, tapping into and converting these resources into liquid fuels exacerbates green house gas (GHG) emissions as they are carbon rich, but hydrogen deficient. Revolutionary thinking about energy and fuels must be adopted. We must recognize that hydrocarbon fuels are ideal energy carriers, but not primary energy sources. The energy stored in a chemical fuel is released for utilization by oxidation. In the case of hydrogen fuel the chemical product is water; in the case of a hydrocarbon fuel, water and carbon dioxide are produced. The hydrogen economy envisions a cycle in which H{sub 2}O is re-energized by splitting water into H{sub 2} and O{sub 2}, by electrolysis for example. We envision a hydrocarbon analogy in which both carbon dioxide and water are re-energized through the application of a persistent energy source (e.g. solar or nuclear). This is of course essentially what the process of photosynthesis accomplishes, albeit with a relatively low sunlight-to-hydrocarbon efficiency. The goal of this project then was the creation of a direct and efficient process for the solar or nuclear driven thermochemical conversion of CO{sub 2} to CO (and O{sub 2}), one of the basic building blocks of synthetic fuels. This process would potentially provide the basis for an alternate hydrocarbon economy that is carbon neutral, provides a pathway to energy independence, and is compatible with much of the existing fuel infrastructure.

  5. Long Time Evolution of Phase Oscillator Systems

    E-Print Network [OSTI]

    Edward Ott; Thomas M. Antonsen

    2009-04-16

    It is shown, under weak conditions, that the dynamical evolution of an important class of large systems of globally coupled, heterogeneous frequency, phase oscillators is, in an appropriate physical sense, time-asymptotically attracted toward a reduced manifold of system states. This manifold, which is invariant under the system evolution, was previously known and used to facilitate the discovery of attractors and bifurcations of such systems. The result of this paper establishes that attractors for the order parameter dynamics obtained by restriction to this reduced manifold are, in fact, the only such attractors of the full system. Thus all long time dynamical behavior of the order parameters of these systems can be obtained by restriction to the reduced manifold.

  6. Directed evolution tools in bioproduct and bioprocess development 49 Chapter 3. Directed Evolution Tools in Bioproduct and

    E-Print Network [OSTI]

    Zhao, Huimin

    Directed evolution tools in bioproduct and bioprocess development 49 Chapter 3. Directed Evolution Tools in Bioproduct and Bioprocess Development Sheryl B. Rubin-Pitela , Catherine M-H. Chob , Wilfred process conditions and customize the reactions they catalyze. Directed evolution tools have been used

  7. Die Evolution gilt auch fr den modernen Homo sapiens hat sich ber die Evolution erhoben -das zumindest glaubt er

    E-Print Network [OSTI]

    Lummaa, Virpi

    ANZEIGE Auslese Die Evolution gilt auch für den modernen Menschen Homo sapiens hat sich über die Evolution erhoben - das zumindest glaubt er gern. Doch laut einer neuen Studie schützen soziale und die Menschheit, zumindest nicht jenen Teil, der in den Genuss moderner Medizin kommt. Die Evolution

  8. 2001 The Society for the Study of Evolution. All rights reserved. Evolution, 55(9), 2001, pp. 19071908

    E-Print Network [OSTI]

    Badyaev, Alex

    1907 2001 The Society for the Study of Evolution. All rights reserved. Evolution, 55(9), 2001, pp. 1907­1908 ANNOUNCEMENTS THE SOCIETY FOR THE STUDY OF EVOLUTION THE DOBZHANSKY PRIZE 2001 The Dobzhansky promise of an outstanding young evolutionary biologist. Alexander Badyaev is the re- cipient of the 2001

  9. Optimal Control of Evolution Mixed Variational Inclusions

    SciTech Connect (OSTI)

    Alduncin, Gonzalo, E-mail: alduncin@geofisica.unam.mx [Universidad Nacional Autónoma de México, Departamento de Recursos Naturales, Instituto de Geofísica (Mexico)

    2013-12-15

    Optimal control problems of primal and dual evolution mixed variational inclusions, in reflexive Banach spaces, are studied. The solvability analysis of the mixed state systems is established via duality principles. The optimality analysis is performed in terms of perturbation conjugate duality methods, and proximation penalty-duality algorithms to mixed optimality conditions are further presented. Applications to nonlinear diffusion constrained problems as well as quasistatic elastoviscoplastic bilateral contact problems exemplify the theory.

  10. Anatomy and evolution of chirocentrid fishes

    E-Print Network [OSTI]

    Bardack, David

    1965-12-01

    was demonstrated by RAYNER (1948), but it is the opinion of these authors that not all clupeiform fishes are derived from leptolepids. Instead, evolution of early clupeiforms progressed along at least two lines, one derived from pholidophorids, the other from... of Canada; Dr. BOBB SCHAEFFER, American Museum of Natural His- tory; Dr. ELvirvx SIMONS, Peabody Museum, Yale University; Mr. MYRL V. WALKER, Fort Hays State College Museum; and Dr. Joint A. WILSON, University Of Texas. Mr. GEORGE F. STERNBERG Of Hays...

  11. THERMAL AND CHEMICAL EVOLUTION OF COLLAPSING FILAMENTS

    SciTech Connect (OSTI)

    Gray, William J.; Scannapieco, Evan

    2013-05-10

    Intergalactic filaments form the foundation of the cosmic web that connect galaxies together, and provide an important reservoir of gas for galaxy growth and accretion. Here we present very high resolution two-dimensional simulations of the thermal and chemical evolution of such filaments, making use of a 32 species chemistry network that tracks the evolution of key molecules formed from hydrogen, oxygen, and carbon. We study the evolution of filaments over a wide range of parameters including the initial density, initial temperature, strength of the dissociating UV background, and metallicity. In low-redshift, Z Almost-Equal-To 0.1 Z{sub Sun} filaments, the evolution is determined completely by the initial cooling time. If this is sufficiently short, the center of the filament always collapses to form a dense, cold core containing a substantial fraction of molecules. In high-redshift, Z = 10{sup -3} Z{sub Sun} filaments, the collapse proceeds much more slowly. This is mostly due to the lower initial temperatures, which lead to a much more modest increase in density before the atomic cooling limit is reached, making subsequent molecular cooling much less efficient. Finally, we study how the gravitational potential from a nearby dwarf galaxy affects the collapse of the filament and compare this to NGC 5253, a nearby starbursting dwarf galaxy thought to be fueled by the accretion of filament gas. In contrast to our fiducial case, a substantial density peak forms at the center of the potential. This peak evolves faster than the rest of the filament due to the increased rate at which chemical species form and cooling occurs. We find that we achieve similar accretion rates as NGC 5253 but our two-dimensional simulations do not recover the formation of the giant molecular clouds that are seen in radio observations.

  12. On some operations suggested by genome evolution

    SciTech Connect (OSTI)

    Dassow, J.; Mitrana, V.

    1996-12-31

    Three operations involved in the genome evolution namely, inversion, transposition and duplication, are considered as operations on strings and languages. We show that, for any pair of these operations, there is a language family which is closed under one of the operations and not closed under the second one; however, under some mild conditions the closure of a language family under one of the operations implies that it also closed with respect to another one. 15 refs.

  13. Origin and evolution of the light nuclides

    E-Print Network [OSTI]

    Nikos Prantzos

    2007-02-02

    After a short historical (and highly subjective) introduction to the field, I discuss our current understanding of the origin and evolution of the light nuclides D, He-3, He-4, Li-6, Li-7, Be-9, B-10 and B-11. Despite considerable observational and theoretical progress, important uncertainties still persist for each and every one of those nuclides. The present-day abundance of D in the local interstellar medium is currently uncertain, making it difficult to infer the recent chemical evolution of the solar neighborhood. To account for the observed quasi-constancy of He-3 abundance from the Big Bang to our days, the stellar production of that nuclide must be negligible; however, the scarce observations of its abundance in planetary nebulae seem to contradict this idea. The observed Be and B evolution as primaries suggests that the source composition of cosmic rays has remained quasi-constant since the early days of the Galaxy, a suggestion with far reaching implications for the origin of cosmic rays; however, the main idea proposed to account for that constancy, namely that superbubbles are at the source of cosmic rays, encounters some serious difficulties. The best explanation for the mismatch between primordial Li and the observed "Spite-plateau" in halo stars appears to be depletion of Li in stellar envelopes, by some yet poorly understood mechanism. But this explanation impacts on the level of the recently discovered early ``Li-6 plateau'', which (if confirmed), seriously challenges current ideas of cosmic ray nucleosynthesis.

  14. Spectral energy distribution, polarization, and synthetic radio maps of Cygnus X-1: a lepto-hadronic jet model

    E-Print Network [OSTI]

    Pepe, C; Romero, G E

    2015-01-01

    In this work we combine SEDs, radio maps and polarization observations to understand the emission mechanisms in Cygnus X-1. Our radiative model indicates that the MeV emission originates in the jet and that all the very high-energy emission is from hadronic origin. We also performed a synthetic radio map that suggests that our description of the magnetic field should be improved, since it leads to a very compact emission region. In order to choose the most suitable magnetic field geometry, we investigated the polarization in X-rays and we found that very simple geometries can explain the high levels of polarization reported by other authors.

  15. An assessment of the usefulness of 5 new synthetic pyrethroids in IPM programs for tobacco budworm control in cotton 

    E-Print Network [OSTI]

    Rajakulendran, Sinnappu Victor

    1981-01-01

    New Synthetic Pyrethroids in IPM Programs for Tobacco Budworm Control in Cotton. (Mlay 1981) Sinnappu Victor Rajakulendran, B. Sc. (Agri. ) University of Sri Lanka Chairman of Advisory Committee: Dr. F. W. Plapp, Jr. Toxicity measurements were...-methyl ethyl) benzene acetate) and fluvalinate. Toxicity was de- termined to larvae of the tobacco budworm Heliothis (P. ), t d lt 1 *f 't p 't, ~tl t' sonorensis (Carlson), and to larvae of its predator, C~t * ddt pl ). Al*, ll d' f t t d as a...

  16. The Expression of Gender in Synthetic Actors: Modeling and Motion Control Over Invariant Perceptual Cues Leading to Gender Recognition 

    E-Print Network [OSTI]

    McLaughlin, Timothy David

    1994-01-01

    -1 THE EXPRESSION OF GENDER IN SYNTHETIC ACTORS: MODELING AND MOTION CONTROL OVER INVARIANT PERCEPTUAL CUES LEADING TO GENDER RECOGNITION A Thesis by TIMOTHY DAVID MCLAUGHLIN Submitted to the Office of Graduate Studies of Texas A&M University in partial... Submitted to Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Approved as to style and content by: 7fa //Ik Louis G. Tassinary (Co-Chair of Committee) Tarek Alameldin (Member) Susan Van Baerle (Co...

  17. Textural properties of synthetic nano-calcite produced by hydrothermal carbonation of calcium hydroxide

    E-Print Network [OSTI]

    Montes-Hernandez, German; Charlet, L; Tisserand, Delphine; Renard, F

    2008-01-01

    The hydrothermal carbonation of calcium hydroxide (Ca(OH)2) at high pressure of CO2 (initial PCO2 1/4 55 bar) and moderate to high temperature (30 and 90 1C) was used to synthesize fine particles of calcite. This method allows a high carbonation efficiency (about 95% of Ca(OH)2-CaCO3 conversion), a significant production rate (48 kg/m3 h) and high purity of product (about 96%). However, the various initial physicochemical conditions have a strong influence on the crystal size and surface area of the synthesized calcite crystals. The present study is focused on the estimation of the textural properties of synthesized calcite (morphology, specific surface area, average particle size, particle size distribution and particle size evolution with reaction time), using Rietveld refinements of X-ray diffraction (XRD) spectra, Brunauer-Emmett-Teller (BET) measurements, and scanning electron microscope (SEM) and transmission electron microscope (TEM) observations. This study demonstrate that the pressure, the temperatu...

  18. A solenoidal synthetic field and the non-Abelian Aharonov-Bohm effects in neutral atoms

    E-Print Network [OSTI]

    Ming-Xia Huo; Nie Wei; David A. W. Hutchinson; Leong Chuan Kwek

    2014-08-11

    Cold neutral atoms provide a versatile and controllable platform for emulating various quantum systems. Despite efforts to develop artificial gauge fields in these systems, realizing a unique ideal-solenoid-shaped magnetic field within the quantum domain in any real-world physical system remains elusive. Here we propose a scheme to generate a "hairline" solenoid with an extremely small size around 1 micrometer which is smaller than the typical coherence length in cold atoms. Correspondingly, interference effects will play a role in transport. Despite the small size, the magnetic flux imposed on the atoms is very large thanks to the very strong field generated inside the solenoid. By arranging different sets of Laguerre-Gauss (LG) lasers, the generation of Abelian and non-Abelian SU(2) lattice gauge fields is proposed for neutral atoms in ring- and square-shaped optical lattices. As an application, interference patterns of the magnetic type-I Aharonov-Bohm (AB) effect are obtained by evolving atoms along a circle over several tens of lattice cells. During the evolution, the quantum coherence is maintained and the atoms are exposed to a large magnetic flux. The scheme requires only standard optical access, and is robust to weak particle interactions.

  19. Effects of Water in Synthetic Lubricant Systems and Clathrate Formation: A Literature Search and Review

    SciTech Connect (OSTI)

    Rohatgi, Ngoc Dung T.

    2001-08-08

    An extensive literature search and a confidential survey were critically analyzed to determine the effects of water on the stability of hydrofluorocarbon/synthetic lubricant systems and to identify key areas requiring further investigation. Following are highlights from the analysis: Clathrate hydrates are solid solutions formed when water molecules are linked through hydrogen bonding creating cavities that can enclose various guest molecules from hydrate formers, such as hydrofluorocarbons R-32, R-125, R-134a, R-407C and R-410A. The four methods for preventing clathrate formation were drying the gas, heating it, reducing its pressure, or using inhibitors. The hydrolysis of polyolester lubricants was mostly acid-catalyzed and its reaction rate constant typically followed the Arrhenius equation of an activated process. Hydrolytic stability improved with hindered molecular structures, and with the presence of acid catcher additives and desiccants. Water vapor can effect the adsorption of long-chain fatty acids and the chemistry of formation of protective oxide film. However, these effects on lubrication can be either positive or negative. Fifty to sixty percent of the moisture injected into an air-conditioning system remained in the refrigerant and the rest mixed with the compressor oil. In an automotive air-conditioning system using R-134a, ice would form at 0 C evaporating temperature when the water content in the vapor refrigerant on the low-pressure side was more than 350 ppm. Moisture would cause the embrittlement of polyethylene terephthalate and the hydrolysis of polyesters, but would reduce the effect of amine additives on fluoroelastomer rubbers. The reactions of water with refrigerants and lubricants would cause formicary and large-pit corrosion in copper tubes, as well as copper plating and sludge formation. Moreover, blockage of capillary tubes increased rapidly in the presence of water. Twenty-four companies responded to the survey. From the responses, the water concentrations specified and expected for different refrigerant/lubricant systems varied depending on the products, their capacities and applications, and also on the companies. Among the problems associated with high moisture level, lubricant breakdown was of greatest concern, followed by acid formation, compressor failure and expansion valve sticking. The following research topics are suggested: 1. The air-conditioning and refrigeration industry needs to measure and record the water content and total acid number of the lubricant of newly installed systems as well as operating systems that are shutdown for service or repair. The reason for the shutdown needs to be documented. A database can then be established to correlate water content with type and cause of breakdown. 2. Detailed studies on the distribution of water in refrigeration and air-conditioning systems should be conducted to pinpoint problem areas associated with free water. 3. Research is needed to validate the current theories and mechanisms of formicary corrosion. Corrosion inhibitors need to be developed. 4. The conditions for clathrate formation and decomposition of other alternative refrigerants, such as R-23, R-41, R-116, R-125, R-143a, R-404A and R-507C, and water should be determined to avoid possible problems associated with tube plugging. The mechanism by which water facilitates or hinders lubrication needs to be studied.

  20. Massive star evolution in close binaries:conditions for homogeneous chemical evolution

    E-Print Network [OSTI]

    Song, H F; Maeder, A; Ekstrom, S; Eggenberger, P

    2015-01-01

    We investigate the impact of tidal interactions, before any mass transfer, on various properties of the stellar models. We study the conditions for obtaining homogeneous evolution triggered by tidal interactions, and for avoiding any Roche lobe overflow during the Main-Sequence phase. We consider the case of rotating stars computed with a strong coupling mediated by an interior magnetic field. In models without any tidal interaction (single stars and wide binaries), homogeneous evolution in solid body rotating models is obtained when two conditions are realized: the initial rotation must be high enough, the loss of angular momentum by stellar winds should be modest. This last point favors metal-poor fast rotating stars. In models with tidal interactions, homogeneous evolution is obtained when rotation imposed by synchronization is high enough (typically a time-averaged surface velocities during the Main-Sequence phase above 250 km s$^{-1}$), whatever the mass losses. In close binaries, mixing is stronger at h...

  1. Separation of americium, curium, and rare earths from high-level wastes by oxalate precipitation: experiments with synthetic waste solutions

    SciTech Connect (OSTI)

    Forsberg, C.W.

    1980-01-01

    The separation of trivalent actinides and rare earths from other fission products in high-level nuclear wastes by oxalate precipitation followed by ion exchange (OPIX) was experimentally investigated using synthetic wastes and a small-scale, continuous-flow oxalic acid precipitation and solid-liquid separation system. Trivalent actinide and rare earth oxalates are relatively insoluble in 0.5 to 1.0 M HNO/sub 3/ whereas other fission product oxalates are not. The continuous-flow system consisted of one or two stirred-tank reactors in series for crystal growth. Oxalic acid and waste solutions were mixed in the first tank, with the product solid-liquid slurry leaving the second tank. Solid-liquid separation was tested by filters and by a gravity settler. The experiments determined the fraction of rare earths precipitated and separated from synthetic waste streams as a function of number of reactors, system temperature, oxalic acid concentration, liquid residence time in the process, power input to the stirred-tank reactors, and method of solid-liquid separation. The crystalline precipitate was characterized with respect to form, size, and chemical composition. These experiments are only the first step in converting a proposed chemical flowsheet into a process flowsheet suitable for large-scale remote operations at high activity levels.

  2. Human immunodeficiency virus contains an epitope immunoreactive with thymosin. cap alpha. /sub 1/ and the 30-amino acid synthetic p17 group-specific antigen peptide HGP-30

    SciTech Connect (OSTI)

    Naylor, P.H.; Naylor, C.W.; Badamchian, M.; Wada, S.; Goldstein, A.L.; Wang, S.S.; Sun, D.K.; Thornton, A.H.; Sarin, P.S.

    1987-05-01

    The authors have reported that an antiserum prepared against thymosin ..cap alpha../sub 1/ (which shares a region of homology with the p17 protein of the acquired immunodeficiency syndrome (AIDS)-associated human immunodeficiency virus) effectively neutralized the AIDs virus and prevented its replication in H9 cells. Using HPLC and immunoblot analysis, they have identified from a clone B, type III human T-lymphotropic virus (HTLV-IIIB) extracts a protein with a molecular weight of 17,000 that is immunoreactive with thymosin ..cap alpha../sub 1/. In contrast, no immunoreactivity was found in retroviral extracts from a number of nonhuman species including feline, bovine, simian, gibbon, and murine retroviruses. Heterologous antiserum prepared against a 30-amino acid synthetic peptide analogue (HGP-30) does not cross-react with thymosin ..cap alpha../sub 1/ but does react specifically with the p17 protein of the AIDS virus in a manner identical to that seen with an HTLV-IIIB p17-specific monoclonal antibody. The demonstration that this synthetic analogue is immunogenic and that antibodies to HGP-30 cross-react not only with synthetic peptide but also with the HTLV-IIIB p17 viral protein provides an additional, and potentially more specific, candidate for development of a synthetic peptide vaccine for AIDS. In addition, the p17 synthetic peptide (HGP-3) may prove to be useful in a diagnostic assay for the detection of AIDS virus infection in seronegative individuals.

  3. INTRODUCTION For years, studies on the classification, evolution and

    E-Print Network [OSTI]

    Olmstead, Richard

    , and there is a marked deficiency in similar stud- ies for plant groups. For instance, in the proceedings of a symposium in his cladistic methods. A synthetic compilation on West Indian Bio- geography (Woods, 1989) includes 32 available on other groups" (Woods, 1989). Those "other groups" mentioned by Woods are primarily verte

  4. The orbital evolution of planets in disks

    E-Print Network [OSTI]

    Wilhelm Kley

    2000-04-04

    The orbital parameters of the observed extrasolar planets differ strongly from those of our own solar system. The differences include planets with high masses, small semi-major axis and large eccentricities. We performed numerical computations of embedded planets in disks and follow their mass growth and orbital evolution over several thousand periods. We find that planets do migrate inwards on timescales of about $10^5$ years on nearly circular orbits, during which they may grow up to about 5 Jupiter masses. The interaction of the disk with several planets may halt the migration process and lead to a system similar to the solar planetary system.

  5. Stochastic evolution equations with random generators

    E-Print Network [OSTI]

    Leon, Jorge A.; Nualart, David

    1998-05-01

    maximal inequality for the Skorohod integral deduced from the It ˆ o’s formula for this anticipating stochastic integral. 1. Introduction. In this paper we study nonlinear stochastic evolution equations of the form X t = ? + ? t 0 #3;A#3;s#4;X s +F#3;s#7;X.... The functions F#3;s#7;?#7; x#4; and B#3;s#7;?#7; x#4; are predictable processes satisfying suitable Lipschitz–type conditions and taking values in H and L 2 #3;U#7;H#4;, respectively. We will assume that A#3;s#7;?#4; is a random family of unbounded operators...

  6. The HOPPET NNLO parton evolution package

    E-Print Network [OSTI]

    Gavin Salam; Juan Rojo

    2008-07-01

    This contribution describes the HOPPET Fortran~95 package for carrying out DGLAP evolution and other common manipulations of PDFs. The PDFs are represented on a grid in $x$-space so as to avoid limitations on the functional form of input distributions. Good speed and accuracy are obtained through the representation of splitting functions in terms of their convolution with a set of piecewise polynomial basis functions. We briefly describe the structure of the code and discuss its quantitative performance. Finally we comment of future directions for the program's development.

  7. Binary Evolution in World Wide Web

    E-Print Network [OSTI]

    S. N. Nazin; V. M. Lipunov; I. E. Panchenko; K. A. Postnov; M. E. Prokhorov; S. B. Popov

    1996-05-29

    We present a WWW-version of the {\\it Scenario Machine} - a computer code designed to calculate the evolution of close binary stellar systems. The Internet users can directly access to the code and calculate binary evolutionary tracks with parameters at the user's will. The program is running on the {\\it Pentium} server of the Division of the Relativistic Astrophysics of the Sternberg Astronimical Institute (http://xray.sai.msu.su/ ). The results are presented both in the form of tables and graphic diagrams. The work is always in progress. More possibilities for Internet users are intended to become available in the near future.

  8. Antibody evolution could guide HIV vaccine development

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News Publications TraditionalWith PropaneNaturalTestAnAlexAnnualSRSPublicAntibody evolution

  9. Nucleosynthesis Supernova Explosions Final Stages of Stellar Evolution For Take Away Final Stages of Stellar Evolution

    E-Print Network [OSTI]

    Hörandel, Jörg R.

    Nucleosynthesis Supernova Explosions Final Stages of Stellar Evolution For Take Away Final Stages.XII.2006 Seminar on Astroparticle Physics - Cosmic Rays #12;Nucleosynthesis Supernova Explosions Final are supernova explosions and which different types exist? Where do heavy elements come from? #12;Nucleosynthesis

  10. Observational Tests and Predictive Stellar Evolution

    E-Print Network [OSTI]

    P. A. Young; E. E. Mamajek; David Arnett; James Liebert

    2001-03-23

    We compare eighteen binary systems with precisely determined radii and masses from 23 to 1.1 M_sol, and stellar evolution models produced with our newly revised code TYCHO. ``Overshooting'' and rotational mixing were suppressed in order to establish a baseline for isolating these and other hydrodynamic effects. Acceptable coeval fits are found for sixteen pairs without optimizing for heavy element or helium abundance. The precision of these tests is limited by the accuracies of the observed effective temperatures. High dispersion spectra and detailed atmospheric modeling should give more accurate effective temperatures and heavy element abundances. PV Cas, a peculiar early A system, EK Cep B, a known post-T Tauri star, and RS Cha, a member of a young OB association, are matched by pre-main sequence models. Predicted mass loss agrees with upper limits from IUE for CW Cep A and B. Relatively poor fits are obtained for binaries having at least one component in the mass range 1.7 < M/M_sol <2.6, whose evolution is sensitive to mixing. These discrepancies are robust and consistent with additional mixing in real stars. The predicted apsidal motion implies that massive star models are systematically less centrally condensed than the real stars. If these effects are due to overshooting, then the overshooting parameter alpha_OV increases with stellar mass. The apsidal motion constants are controlled by radiative opacity under conditions close to those directly measured in laser experiments, making this test more stringent than possible before.

  11. Evolution of star clusters on eccentric orbits

    E-Print Network [OSTI]

    Cai, Maxwell Xu; Heggie, Douglas C; Varri, Anna Lisa

    2015-01-01

    We study the evolution of star clusters on circular and eccentric orbits using direct $N$-body simulations. We model clusters with initially $N=8{\\rm k}$ and $N=16{\\rm k}$ single stars of the same mass, orbiting around a point-mass galaxy. For each orbital eccentricity that we consider, we find the apogalactic radius at which the cluster has the same lifetime as the cluster with the same $N$ on a circular orbit. We show that then, the evolution of bound particle number and half-mass radius is approximately independent of eccentricity. Secondly, when we scale our results to orbits with the same semi-major axis, we find that the lifetimes are, to first order, independent of eccentricity. When the results of Baumgardt and Makino for a singular isothermal halo are scaled in the same way, the lifetime is again independent of eccentricity to first order, suggesting that this result is independent of the Galactic mass profile. From both sets of simulations we empirically derive the higher order dependence of the lif...

  12. Galactic and Magellanic Evolution with the SKA

    E-Print Network [OSTI]

    McClure-Griffiths, Naomi M; Murray, Claire E; Li, Di; Dickey, John M; Vazquez-Semadeni, Enrique; Peek, Josh E G; Putman, Mary; Clark, Susan E; Miville-Deschenes, Marc-Antoine; Bland-Hawthorn, Joss; Staveley-Smith, Lister

    2015-01-01

    As we strive to understand how galaxies evolve it is crucial that we resolve physical processes and test emerging theories in nearby systems that we can observe in great detail. Our own Galaxy, the Milky Way, and the nearby Magellanic Clouds provide unique windows into the evolution of galaxies, each with its own metallicity and star formation rate. These laboratories allow us to study with more detail than anywhere else in the Universe how galaxies acquire fresh gas to fuel their continuing star formation, how they exchange gas with the surrounding intergalactic medium, and turn warm, diffuse gas into molecular clouds and ultimately stars. The $\\lambda$21-cm line of atomic hydrogen (HI) is an excellent tracer of these physical processes. With the SKA we will finally have the combination of surface brightness sensitivity, point source sensitivity and angular resolution to transform our understanding of the evolution of gas in the Milky Way, all the way from the halo down to the formation of individual molecul...

  13. Uncertainties in Galactic Chemical Evolution Models

    E-Print Network [OSTI]

    Côté, Benoit; O'Shea, Brian W; Herwig, Falk; Pignatari, Marco; Jones, Samuel; Fryer, Chris

    2015-01-01

    We use a simple one-zone galactic chemical evolution model to quantify the uncertainties generated by the input parameters in numerical predictions, for a galaxy with properties similar to those of the Milky Way. We compiled several studies from the literature to gather the current constraints for our simulations regarding the typical value and uncertainty of seven basic parameters, which are: the lower and upper mass limit of the stellar initial mass function (IMF), the slope of the high-mass end of the stellar IMF, the slope of the delay-time distribution function of Type Ia supernovae (SNe Ia), the number of SNe Ia per solar mass formed, the total stellar mass formed, and the initial mass of gas of the galaxy. We derived a probability distribution function to express the range of likely values for every parameter, which were then included in a Monte Carlo code to run several hundred simulations with randomly selected input parameters. This approach enables us to analyze the predicted chemical evolution of ...

  14. NLO Evolution of Color Dipoles in N = 4 SYM

    E-Print Network [OSTI]

    Giovanni A. Chirilli

    2008-11-21

    The small-$x_B$ deep inelastic scattering in the saturation region is governed by the non-linear evolution of Wilson-line operators. In the leading logarithmic approximation it is given by the BK equation for the evolution of color dipoles. I discuss recent calculation of the next-to-leading order evolution of color dipoles in QCD and ${\\cal N}=4$ SYM.

  15. Domain architecture evolution of pattern-recognition receptors

    E-Print Network [OSTI]

    Zhang, Qing; Zmasek, Christian M.; Godzik, Adam

    2010-01-01

    1 ORIGINAL PAPER Domain architecture evolution of pattern-in the same domain architectures evolving independentlythe choices of domain architectures for new members in the

  16. Artificial neural networks in models of specialization, guild evolution

    E-Print Network [OSTI]

    Getz, Wayne M.

    Artificial neural networks in models of specialization, guild evolution and sympatric speciation on host choice, employing artificial neural networks as models for the host recognition system

  17. Investigation of Microscale Damage Evolution in High-Strength...

    Office of Scientific and Technical Information (OSTI)

    Alloy. Citation Details In-Document Search Title: Investigation of Microscale Damage Evolution in High-Strength Al Alloy. Authors: Jin, Huiqing ; Lu, Wei-Yang ; Mota, Alejandro ;...

  18. Evolution equation for 3-quark Wilson loop operator

    E-Print Network [OSTI]

    R. E. Gerasimov; A. V. Grabovsky

    2012-12-07

    The evolution equation for the 3 quark Wilson loop operator has been derived in the leading logarithm approximation within Balitsky high energy operator expansion.

  19. Investigation of Microscale Damage Evolution in High Strength...

    Office of Scientific and Technical Information (OSTI)

    Alloy. Citation Details In-Document Search Title: Investigation of Microscale Damage Evolution in High Strength A1 Alloy. Authors: Jin, Huiqing ; Lu, Wei-Yang ; Mota, Alejandro ;...

  20. Evaluation of Thermal Evolution Profiles and Estimation of Kinetic...

    Office of Scientific and Technical Information (OSTI)

    Evaluation of Thermal Evolution Profiles and Estimation of Kinetic Parameters for Pyrolysis of CoalCorn Stover Blends Using Thermogravimetric Analysis Citation Details...