Powered by Deep Web Technologies
Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


City of Battle Creek, Nebraska (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

City of Battle Creek City of Battle Creek Place Nebraska Utility Id 1346 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png City Accounts Commercial Commercial All Electric Commercial Commercial- Single Phase Commercial Commercial- Three Phase Commercial Commercial- Three Phase School Commercial Farm- Three Phase Commercial Large Commercial Electric Heating Commercial Large Power Industrial Residential Residential Residential All Electric Residential Rural Residential Residential


The battle of Sailor's Creek: a study in leadership  

E-Print Network (OSTI)

The Battle of Sailor's Creek, 6 April 1865, has been overshadowed by Lee's surrender at Appomattox Court House several days later, yet it is an example of the Union military war machine reaching its apex of war making ability during the Civil War. Through Ulysses S. Grant's leadership and that of his subordinates, the Union armies, specifically that of the Army of the Potomac, had been transformed into a highly motivated, organized and responsive tool of war, led by confident leaders who understood their commander's intent and were able to execute on that intent with audacious initiative in the absence of further orders. After Robert E. Lee's Army of Northern Virginia escaped from Petersburg and Richmond on 2 April 1865, Grant's forces chased after Lee's forces with the intent of destroying the mighty and once feared protector of the Confederate States in the hopes of bringing a swift end to the long war. At Sailor's Creek, Phil Sheridan, Grant's cavalry commander was able to put his forces south and west of Lee's Army trapping it between Sheridan's cavalry and George Meade's Army of the Potomac. After fighting a brutal, close quarters engagement, Union forces captured or killed the majority of two of Lee's corps, commanded by Richard H. Anderson and Richard S. Ewell, and severely attrited a third corps under John B. Gordon, leaving Lee only James Longstreet's corps intact to continue the struggle.

Smith, Cloyd Allen, Jr.



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


BLM Battle Mountain District Office | Open Energy Information  

Open Energy Info (EERE)

Battle Mountain District Office Jump to: navigation, search Logo: BLM Battle Mountain District Office Name BLM Battle Mountain District Office Short Name Battle Mountain Parent...


--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...


Steel Creek primary producers: Periphyton and seston, L-Lake/Steel Creek Biological Monitoring Program, January 1986--December 1991  

Science Conference Proceedings (OSTI)

The Savannah River Site (SRS) encompasses 300 sq mi of the Atlantic Coastal Plain in west-central South Carolina. Five major tributaries of the Savannah River -- Upper Three Runs Creek, Four Mile Creek, Pen Branch, Steel Creek, and Lower Three Runs Creek -- drain the site. In 1985, L Lake, a 400-hectare cooling reservoir, was built on the upper reaches of Steel Creek to receive effluent from the restart of L-Reactor and to protect the lower reaches from thermal impacts. The Steel Creek Biological Monitoring Program was designed to assess various components of the system and identify and changes due to the operation of L-Reactor or discharge from L Lake. An intensive ecological assessment program prior to the construction of the lake provided baseline data with which to compare data accumulated after the lake was filled and began discharging into the creek. The Department of Energy must demonstrate that the operation of L-Reactor will not significantly alter the established aquatic ecosystems. This report summarizes the results of six years` data from Steel Creek under the L-Lake/Steel Creek Monitoring Program. L Lake is discussed separately from Steel Creek in Volumes NAI-SR-138 through NAI-SR-143.

Bowers, J.A. [Westinghouse Savannah River Co., Aiken, SC (United States); Toole, M.A.; van Duyn, Y. [Normandeau Associates Inc., New Ellenton, SC (United States)



Edison vs. Tesla: The Battle of the Energy Inventors | Department...  

NLE Websites -- All DOE Office Websites (Extended Search)

Edison vs. Tesla: The Battle of the Energy Inventors Edison vs. Tesla: The Battle of the Energy Inventors November 21, 2013 - 2:36pm Addthis Our panel of experts answers your...


The Efficacy of Aerial Search During the Battle of Midway  

Science Conference Proceedings (OSTI)

The Battle of Midway (June 4-6, 1942) is considered one of the pivotal naval encounters of the Second World War. The battle has been examined in detail within both popular and scholarly literature, and a common opinion found in virtually all of these ... Keywords: Aerial Search, Battle of Midway, Monte Carlo Simulation, Viewsheds, World War II

Denis J. Dean



Scarboro Creek Wetland  

NLE Websites -- All DOE Office Websites (Extended Search)

Plant Management: Scarboro Creek Wetland * Purple loosestrife was treated with foliar spray of Accord (glyphosphate) by ESD in 2007. Photos by Harry Quarles Invasive Non-native...


Battling bird flu by the numbers  

NLE Websites -- All DOE Office Websites (Extended Search)

May » May » Battling bird flu by the numbers Battling bird flu by the numbers Lab theorists have developed a mathematical tool that could help health experts and crisis managers determine in real time whether an emerging infectious disease such as avian influenza H5N1 is poised to spread globally. May 27, 2008 Los Alamos National Laboratory sits on top of a once-remote mesa in northern New Mexico with the Jemez mountains as a backdrop to research and innovation covering multi-disciplines from bioscience, sustainable energy sources, to plasma physics and new materials. Los Alamos National Laboratory sits on top of a once-remote mesa in northern New Mexico with the Jemez mountains as a backdrop to research and innovation covering multi-disciplines from bioscience, sustainable energy


Battle Ground, Indiana: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

with form History Share this page on Facebook icon Twitter icon Battle Ground, Indiana: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates...


Salt Creek Student Homepage  

NLE Websites -- All DOE Office Websites (Extended Search)

Salt Creek Investigation Salt Creek Investigation</2> "Whales Dying in the Pacific Ocean" "Fish Dying in Lake Michigan" Recent headlines remind us of environmental problems near and far away. Scientists have been wondering if these problems could be due to the warmer temperatures this past spring and summer or could there be other reasons? Lack of rain and near drought conditions have forced many areas to restrict water use. We know from past history that pollution affects our drinking water and marine life. Remember what we read about Lake Erie and from reading A River Ran Wild by Lynne Cherry. There are many factors affecting the environment around us . . . even in Salt Creek which runs through our area. We may not be able to investigate the Pacific Ocean and Lake Michigan


Salt Creek Scenario  

NLE Websites -- All DOE Office Websites (Extended Search)

Scenario Scenario HELP Index Summary Scenario References Student Pages Two branches of Salt Creek run through the city of Rolling Meadows, Illinois, not far from our school. Five members of our team of eighth grade teachers from different subject areas (science, language arts, bilingual education and special education), decided to develop an interdisciplinary study of Salt Creek as a way of giving our students authentic experiences in environmental studies. The unit begins when students enter school in August, running through the third week of September, and resuming for three weeks in October. Extension activities based on using the data gathered at the creek continue throughout the school year, culminating in a presentation at a city council meeting in the spring.


First Impressions Stafford Creek Correctional  

E-Print Network (OSTI)

First Impressions Stafford Creek Correctional Center in Washington state participates Project In July 2010, I found myself at the gates of Stafford Creek Corrections Center, turning over my. The program engages scientists in a medium and activity that may be unfamiliar--presenting Stafford Creek

LeRoy, Carri J.


Science Bowl 2012: A Long, Hard-Fought Battle for First | Department...  

NLE Websites -- All DOE Office Websites (Extended Search)

Science Bowl 2012: A Long, Hard-Fought Battle for First Science Bowl 2012: A Long, Hard-Fought Battle for First May 1, 2012 - 5:53pm Addthis Zaroug Jafeel, Mathew Arbesfeld, Julia...


Battle of the Buildings EPA National Building Competition  

NLE Websites -- All DOE Office Websites (Extended Search)

WRAP-UP REPORT WRAP-UP REPORT EPA's NATIONAL BUILDING COMPETITION Learn more about EPA's National Building Competition at energystar.gov/BattleOfTheBuildings 2 Battle to the Finish 3 And the Winner Is... 4 Stories Behind the Battle Demarest Elementary School 5 AAFES Ft. Hood Warrior Way Express Store B85001 6 Toms River Verizon Wireless 7 SHAMROCK SPRINGS ELEMENTARY SCHOOL 8 City of Atlanta's Hemphill Water Treatment Plant 9 Kmart 4863 - Gillette, WY 10 Martin Luther King, Jr. Courthouse 11 Bloomfield Middle School 12 North Carolina Area Health Education Center Building 13 Walsh & Associates, Inc. Warehouse 14 Kmart 9348 15 Kmart 7499 Mount Vernon 16 Vons Credit Union 17 Dee Events Center 18 Elk County Jail 19 Bryce Building 20 High Springs Community School 21


Interior Bureau of Land Management Battle Mountain District Office  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

United States Department of the United States Department of the Interior Bureau of Land Management Battle Mountain District Office Battle Mountain Nevada November 19, 2010 Tonopah Field Office Tonopah, Nevada FES-10-57 N-86292 DOI-BLM-NVB020-2009-0104-EIS Tonopah Solar Energy, LLC Crescent Dunes Solar Energy Project Final Environmental Impact Statement Proposed Crescent Dunes Solar Energy Project: Final EIS| ii BLM Mission Statement It is the mission of the Bureau of Land Management to sustain the health, diversity, and productivity of the public lands for the use and enjoyment of present and future generations. BLM/NV/BM/EIS/10/30+1793 DOI No. FES 10-57 http://www.blm.gov/nv/stlenlfo/battle_mountain_field.html In Reply Refer To: N-86292 DOI-BLM-NVBO2O-2009-0 1 04-EIS 2800 (NVB0200) Dear


Panther Creek | Open Energy Information  

Open Energy Info (EERE)

Creek Creek Jump to: navigation, search Name Panther Creek Facility Panther Creek Sector Wind energy Facility Type Commercial Scale Wind Facility Status Under Construction Owner Affinity Wind/Suzlon Energy Limited Developer Surity Wind Location Pike County IL Coordinates 39.607275°, -90.85556° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.607275,"lon":-90.85556,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Pigeon Creek | Open Energy Information  

Open Energy Info (EERE)

Pigeon Creek Pigeon Creek Jump to: navigation, search Name Pigeon Creek Facility Pigeon Creek Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Adams Electric Cooperative Developer Adams Electric Cooperative Energy Purchaser Adams Electric Cooperative Location Near Payson IL Coordinates 39.83328984°, -91.19227409° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.83328984,"lon":-91.19227409,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Bennett Creek | Open Energy Information  

Open Energy Info (EERE)

Creek Creek Jump to: navigation, search Name Bennett Creek Facility Bennett Creek Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Idaho Windfarms / John Deere Developer Idaho Windfarms Location Elmore County ID Coordinates 43.0466399°, -115.485481° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.0466399,"lon":-115.485481,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Meadow Creek | Open Energy Information  

Open Energy Info (EERE)

Meadow Creek Meadow Creek Jump to: navigation, search Name Meadow Creek Facility Meadow Creek Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Ridgeline Energy Developer Ridgeline Energy Energy Purchaser PacifiCorp (Rocky Mountain Power) Location Idaho Falls ID Coordinates 43.50492362°, -111.8366146° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.50492362,"lon":-111.8366146,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Microsoft Word - Vehicle Battery Final EA_Toda 3-19-10.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4 4 Environmental Assessment for Toda America, Incorporated Electric Drive Vehicle Battery and Component Manufacturing Initiative Project Battle Creek, MI March 2010 Prepared for: Department of Energy National Energy Technology Laboratory Environmental Assessment and Finding of No Significant Impact DOE/EA-1714 Toda America, Incorporated, Battle Creek, MI March 2010 National Environmental Policy Act (NEPA) Compliance Cover Sheet Proposed Action: The U.S. Department of Energy (DOE) proposes, through a cooperative agreement with Toda America, Incorporated (Toda) to partially fund the construction of a manufacturing plant to produce oxide materials for cathodes for lithium-ion batteries. The plant would be constructed within an existing industrial park in Battle Creek,


Big Bayou Creek and Little Bayou Creek Watershed Monitoring Program  

SciTech Connect

Biological monitoring of Little Bayou and Big Bayou creeks, which border the Paducah Site, has been conducted since 1987. Biological monitoring was conducted by University of Kentucky from 1987 to 1991 and by staff of the Environmental Sciences Division (ESD) at Oak Ridge National Laboratory (ORNL) from 1991 through March 1999. In March 1998, renewed Kentucky Pollutant Discharge Elimination System (KPDES) permits were issued to the US Department of Energy (DOE) and US Enrichment Corporation. The renewed DOE permit requires that a watershed monitoring program be developed for the Paducah Site within 90 days of the effective date of the renewed permit. This plan outlines the sampling and analysis that will be conducted for the watershed monitoring program. The objectives of the watershed monitoring are to (1) determine whether discharges from the Paducah Site and the Solid Waste Management Units (SWMUs) associated with the Paducah Site are adversely affecting instream fauna, (2) assess the ecological health of Little Bayou and Big Bayou creeks, (3) assess the degree to which abatement actions ecologically benefit Big Bayou Creek and Little Bayou Creek, (4) provide guidance for remediation, (5) provide an evaluation of changes in potential human health concerns, and (6) provide data which could be used to assess the impact of inadvertent spills or fish kill. According to the cleanup will result in these watersheds [Big Bayou and Little Bayou creeks] achieving compliance with the applicable water quality criteria.

Kszos, L.A.; Peterson, M.J.; Ryon; Smith, J.G.



Asotin Creek Model Watershed Plan  

DOE Green Energy (OSTI)

The Asotin Creek Model Watershed Plan is the first to be developed in Washington State which is specifically concerned with habitat protection and restoration for salmon and trout. The plan is consistent with the habitat element of the ``Strategy for Salmon``. Asotin Creek is similar in many ways to other salmon-bearing streams in the Snake River system. Its watershed has been significantly impacted by human activities and catastrophic natural events, such as floods and droughts. It supports only remnant salmon and trout populations compared to earlier years. It will require protection and restoration of its fish habitat and riparian corridor in order to increase its salmonid productivity. The watershed coordinator for the Asotin County Conservation District led a locally based process that combined local concerns and knowledge with technology from several agencies to produce the Asotin Creek Model Watershed Plan.

Browne, D.; Holzmiller, J.; Koch, F.; Polumsky, S.; Schlee, D.; Thiessen, G.; Johnson, C.



Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Kansas Nuclear Profile - Wolf Creek Generating Station  

U.S. Energy Information Administration (EIA) Indexed Site

April 2012" "Next Release Date: February 2013" "Wolf Creek Generating Station" "Unit","Summer capacity (mw)","Net generation (thousand mwh)","Summer capacity factor...


New Jersey Nuclear Profile - Oyster Creek  

U.S. Energy Information Administration (EIA) Indexed Site

Oyster Creek" "Unit","Summer capacity (mw)","Net generation (thousand mwh)","Summer capacity factor (percent)","Type","Commercial operation date","License expiration date"...



E-Print Network (OSTI)

Commission (NRC) staff and representatives of Lost Creek ISR, LLC (LCI) was held to discuss LCIs application for a license to construct and operate a uranium in situ recovery facility (ISR) in Wyoming. The NRC staff had completed its review of LCIs application and prepared an internal draft of the Safety Evaluation Report (SER). The conference call was held as a follow-up to the conference call between the NRC and LCI on September 25, 2009 (ML093130083) to discuss open issues that NRC staff identified in preparing the draft SER. A summary of the meeting is enclosed. Within 30 days of receipt of this letter, please either provide the information identified in the meeting summary or inform us of the date you expect to provide the information. At this point in the review process, NRC staff has presented all open issues to LCI regarding the Lost Creek facility SER. The staff previously provided written discussions of incomplete responses and open issues on April 23, 2009 and November 9, 2009. The staff is therefore curtailing any further work until resolution of the open issues. Note that a delay in providing information may result in a delay in NRC staffs completion of the SER. If you have any questions regarding this letter or the enclosed meeting summary, please contact me at (301) 415-6142, or by email at

Mr. Wayne; W. Heili



Post-project appraisal of Martin Canyon Creek restoration  

E-Print Network (OSTI)

Haltiner, Jeffery. 1997. Martin Canyon Stream Stabilization:Williams & Associates, Ltd. 1999. Martin Canyon Creek StreamPost-Project Appraisal of Martin Canyon Creek Restoration

Wagner, Wayne; Roseman, Jesse



EA-1219: Hoe Creek Underground Coal Gasification Test Site Remediation...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

9: Hoe Creek Underground Coal Gasification Test Site Remediation, Campbell County, Wyoming EA-1219: Hoe Creek Underground Coal Gasification Test Site Remediation, Campbell County,...


DOE - Office of Legacy Management -- Hoe Creek Underground Coal...  

Office of Legacy Management (LM)

Hoe Creek Underground Coal Gasification Site - 045 FUSRAP Considered Sites Site: Hoe Creek Underground Coal Gasification Site (045) Designated Name: Alternate Name: Location:...


Preparing for Decommissioning: The Oyster Creek Experience  

Science Conference Proceedings (OSTI)

This report chronicles the process of preparing GPU Nuclear's Oyster Creek Nuclear Generating Station for early retirement and decommissioning. The Oyster Creek experience has great relevance to the nuclear industry, as future decommissioning projects will benefit from the comprehensive preplanning work performed there.



Cobb Creek Geothermal Facility | Open Energy Information  

Open Energy Info (EERE)

Cobb Creek Geothermal Facility Cobb Creek Geothermal Facility Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Cobb Creek Geothermal Facility General Information Name Cobb Creek Geothermal Facility Facility Cobb Creek Sector Geothermal energy Location Information Location The Geysers, Californi Coordinates 38.804734473609°, -122.78414726257° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.804734473609,"lon":-122.78414726257,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Quantifying the Main Battle Tank's architectural trade space using Bayesian Belief Network  

E-Print Network (OSTI)

The design and development of a Main Battle Tank can be characterized as a technically challenging and organizationally complex project. These projects are driven not only by the essential engineering and logistic tasks; ...

Lee, Keen Sing, 1972-



Toms Creek IGCC Demonstration Project  

SciTech Connect

The Toms Creek Integrated Gasification Combined Cycle (IGCC) Demonstration Project was selected by DOE in September 1991 to participate in Round Four of the Clean Coal Technology Demonstration Program. The project will demonstrate a simplified IGCC process consisting of an air-blown, fluidized-bed gasifier (Tampella U-Gas), a gas cooler/steam generator, and a hot gas cleanup system in combination with a gas turbine modified for use with a low-Btu content fuel and a conventional steam bottoming cycle. The demonstration plant will be located at the Toms Creek coal mine near Coeburn, Wise County, Virginia. Participants in the project are Tampella Power Corporation and Coastal Power Production Company. The plant will use 430 tons per day of locally mined bituminous coal to produce 55 MW of power from the gasification section of the project. A modern pulverized coal fired unit will be located adjacent to the Demonstration Project producing an additional 150 MW. A total 190 MW of power will be delivered to the electric grid at the completion of the project. In addition, 50,000 pounds per hour of steam will be exported to be used in the nearby coal preparation plant. Dolomite is used for in-bed gasifier sulfur capture and downs cleanup is accomplished in a fluidized-bed of regenerative zinc titanate. Particulate clean-up, before the gas turbine, will be performed by high temperature candle filters (1020{degree}F). The demonstration plant heat rate is estimated to be 8,700 Btu/kWh. The design of the project goes through mid 1995, with site construction activities commencing late in 1995 and leading to commissioning and start-up by the end of 1997. This is followed by a three year demonstration period.

Virr, M.J.



Toms Creek IGCC Demonstration Project  

SciTech Connect

The Toms Creek Integrated Gasification Combined Cycle (IGCC) Demonstration Project was selected by DOE in September 1991 to participate in Round Four of the Clean Coal Technology Demonstration Program. The project will demonstrate a simplified IGCC process consisting of an air-blown, fluidized-bed gasifier (Tampella U-Gas), a gas cooler/steam generator, and a hot gas cleanup system in combination with a gas turbine modified for use with a low-Btu content fuel and a conventional steam bottoming cycle. The demonstration plant will be located at the Toms Creek coal mine near Coeburn, Wise County, Virginia. Participants in the project are Tampella Power Corporation and Coastal Power Production Company. The plant will use 430 tons per day of locally mined bituminous coal to produce 55 MW of power from the gasification section of the project. A modern pulverized coal fired unit will be located adjacent to the Demonstration Project producing an additional 150 MW. A total 190 MW of power will be delivered to the electric grid at the completion of the project. In addition, 50,000 pounds per hour of steam will be exported to be used in the nearby coal preparation plant. Dolomite is used for in-bed gasifier sulfur capture and downs cleanup is accomplished in a fluidized-bed of regenerative zinc titanate. Particulate clean-up, before the gas turbine, will be performed by high temperature candle filters (1020[degree]F). The demonstration plant heat rate is estimated to be 8,700 Btu/kWh. The design of the project goes through mid 1995, with site construction activities commencing late in 1995 and leading to commissioning and start-up by the end of 1997. This is followed by a three year demonstration period.

Virr, M.J.



Salmon Creek Project Draft Environmental Impact Statement  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

AUGUST 2004 AUGUST 2004 SALMON CREEK PROJECT Draft Environmental Impact Statement DOE/EIS-0346 Lead Agency U.S. Dept of Energy, Bonneville Power Administration Cooperating Agencies U.S. Dept of Interior, Bureau of Reclamation Confederated Tribes of the Colville Reservation Okanogan Irrigation District Salmon Creek Project Draft Environmental Impact Statement (DOE/EIS-0346) Responsible Agency: Bonneville Power Administration (BPA), U.S. Department of Energy (DOE) Cooperating Agencies: U.S. Department of Interior, Bureau of Reclamation, Confederated Tribes of the Colville Reservation, Okanogan Irrigation District. County and State Involved: Okanogan County, Washington Abstract: BPA proposes to fund activities that would restore sufficient water flows to Salmon Creek and

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Panther Creek, Idaho, Habitat Rehabilitation, Final Report.  

SciTech Connect

The purpose of the project was to achieve full chinook salmon and steelhead trout production in the Panther Creek, Idaho, basin. Plans were developed to eliminate the sources of toxic effluent entering Panther Creek. Operation of a cobalt-copper mine since the 1930's has resulted in acid, metal-bearing drainage entering the watershed from underground workings and tailings piles. The report discusses plans for eliminating and/or treating the effluent to rehabilitate the water quality of Panther Creek and allow the reestablishment of salmon and trout spawning runs. (ACR)

Reiser, Dudley W.



Reintroduction of Native FishReintroduction of Native Fish Species to Coal CreekSpecies to Coal Creek  

E-Print Network (OSTI)

1 Reintroduction of Native FishReintroduction of Native Fish Species to Coal CreekSpecies to Coal Control and Reclamation ActSurface Mining Control and Reclamation Act of 1977of 1977 Coal Creek Watershed Foundation (2000)Coal Creek Watershed Foundation (2000) BackgroundBackground Fish populations in Coal Creek

Gray, Matthew


Elbow Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Elbow Creek Wind Farm Elbow Creek Wind Farm Jump to: navigation, search Name Elbow Creek Wind Farm Facility Elbow Creek Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Padoma Developer Padoma Location Howard County TX Coordinates 32.133515°, -101.415676° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.133515,"lon":-101.415676,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wolverine Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wolverine Creek Wind Farm Wolverine Creek Wind Farm Jump to: navigation, search Name Wolverine Creek Wind Farm Facility Wolverine Creek Wind Energy Project Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Invenergy Developer Invenergy Energy Purchaser PacifiCorp Location East of ID Falls ID Coordinates 43.422203°, -111.83439° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.422203,"lon":-111.83439,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Elm Creek II | Open Energy Information  

Open Energy Info (EERE)

Elm Creek II Elm Creek II Jump to: navigation, search Name Elm Creek II Facility Elm Creek II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Iberdrola Renewables Developer Iberdrola Renewables Location Jackson and Martin County MN Coordinates 43.756372°, -94.956014° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.756372,"lon":-94.956014,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Elm Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Elm Creek Wind Farm Elm Creek Wind Farm Jump to: navigation, search Name Elm Creek Wind Farm Facility Elm Creek Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Iberdrola Renewables Developer Iberdrola Renewables Energy Purchaser Great River Energy Location MN Coordinates 43.780285°, -94.845586° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.780285,"lon":-94.845586,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Bull Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Bull Creek Wind Farm Bull Creek Wind Farm Jump to: navigation, search Name Bull Creek Wind Farm Facility Bull Creek Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Eurus Developer Eurus Energy Purchaser Market Location Near Gail TX Coordinates 32.933099°, -101.584425° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.933099,"lon":-101.584425,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Tributary Fluxes into Brush Creek Valley  

Science Conference Proceedings (OSTI)

Measurements in a tributary to Brush Creek Valley during the September and October 1984 ASCOT campaign with laser anemometers, tethersondes, a minisodar, and smoke release were used to calculate the contribution by tributaries to nocturnal ...

R. L. Coulter; Monte Orgill; William Porch



Kansas Nuclear Profile - Wolf Creek Generating Station  

U.S. Energy Information Administration (EIA)

snpt3ks210 1,160 9,556 94.0 PWR Wolf Creek Generating Station Unit Type Data for 2010 PWR = Pressurized Light Water Reactor. Note: Totals may not ...


Twin Creeks Technologies | Open Energy Information  

Open Energy Info (EERE)

Technologies Place San Jose, California Zip 95134 Product California-based silicon-based thin-film PV startup in stealth mode. References Twin Creeks Technologies1 LinkedIn...


Bear Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Bear Creek Wind Farm Bear Creek Wind Farm Facility Bear Creek Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Babcock & Brown owns majority Developer CEI Iberdrola Energy Purchaser PPL Corp. Location Near Bear Creek Village PA Coordinates 41.1801°, -75.7216° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.1801,"lon":-75.7216,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Edison vs. Tesla: The Battle of the Energy Inventors | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Edison vs. Tesla: The Battle of the Energy Inventors Edison vs. Tesla: The Battle of the Energy Inventors Edison vs. Tesla: The Battle of the Energy Inventors November 21, 2013 - 2:36pm Addthis Our panel of experts answers your questions about two of the greatest energy inventors, Thomas Edison and Nikola Tesla. Rebecca Matulka Rebecca Matulka Digital Communications Specialist, Office of Public Affairs How can I participate? Who was the better inventor: Thomas Edison or Nikola Tesla? Vote now for your favorite energy inventor. Join the conversation on Twitter using #EdisonvsTesla. Editor's Note: Thanks to everyone who participated in our lively discussion about Thomas Edison and Nikola Tesla! Our panel of experts answered your questions on everything from alternating vs. direct current and how we are wirelessly transmitting energy today to Tesla's heroes and whether Edison


Edison vs. Tesla: The Battle of the Energy Inventors | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Edison vs. Tesla: The Battle of the Energy Inventors Edison vs. Tesla: The Battle of the Energy Inventors Edison vs. Tesla: The Battle of the Energy Inventors November 21, 2013 - 2:36pm Addthis Our panel of experts answers your questions about two of the greatest energy inventors, Thomas Edison and Nikola Tesla. Rebecca Matulka Rebecca Matulka Digital Communications Specialist, Office of Public Affairs How can I participate? Who was the better inventor: Thomas Edison or Nikola Tesla? Vote now for your favorite energy inventor. Join the conversation on Twitter using #EdisonvsTesla. Editor's Note: Thanks to everyone who participated in our lively discussion about Thomas Edison and Nikola Tesla! Our panel of experts answered your questions on everything from alternating vs. direct current and how we are wirelessly transmitting energy today to Tesla's heroes and whether Edison


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Battle Creek MI-City-Battle Creek Location: City Battle Creek MI American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Fire station lighting retrofits and HVAC upgrades, 2) transit buildings lighting retrofits and HVAC upgrades, 3) replace/upgrades to well pump motors at Verona Water Treatment Plant, and 4) lighting retrofits and HVAC upgrades to Verona Water Treatment Plant Conditions: None Categorical Exclusion(s) Applied: B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health, including DOE and/or Executive Orders; require siting, construction, or major expansion of waste storage, disposal, recovery, or



SciTech Connect

The Fiddler Creek field is in Weston County, Wyoming, and was discovered in 1948. Secondary waterflooding recovery was started in 1955 and terminated in the mid-1980s with a fieldwide recovery of approximately 40%. The West Fiddler Creek Unit, the focus of this project, had a lower recovery and therefore has the most remaining oil. Before the project this unit was producing approximately 85 bbl of oil per day from 20 pumping wells and 17 swab wells. The recovery process planned for this project involved adapting two independent processes, the injection of polymer as a channel blocker or as a deep-penetrating permeability modifier, and the stabilization of clays and reduction of the residual oil saturation in the near-wellbore area around the injection wells. Clay stabilization was not conducted because long-term fresh water injection had not severely reduced the injectivity. It was determined that future polymer injection would not be affected by the clay. For the project, two adjoining project patterns were selected on the basis of prior reservoir studies and current well availability and production. The primary injection well of Pattern 1 was treated with a small batch of MARCIT gel to create channel blocking. The long-term test was designed for three phases: (1) 77 days of injection of a 300-mg/l cationic polyacrylamide, (2) 15 days of injection of a 300-mg/l anionic polymer to ensure injectivity of the polymer, and (3) 369 days of injection of the 300-mg/l anionic polymer and a 30:1 mix of the crosslinker. Phases 1 and 2 were conducted as planned. Phase 3 was started in late March 1999 and terminated in May 2001. In this phase, a crosslinker was added with the anionic polymer. Total injection for Phase 3 was 709,064 bbl. To maintain the desired injection rate, the injection pressure was slowly increased from 1,400 psig to 2,100 psig. Early in the application of the polymer, it appeared that the sweep improvement program was having a positive effect on Pattern 1 with lesser effects in Pattern 2. These early observations did not continue to develop. The oil production for both patterns remained fairly constant to the rates established by the restart of waterflooding. The water production declined but stabilized in both patterns. The stabilization of the oil at prepolymer rates and water production at the lower rates can be attributed to the polymer injection, but the effect was not as great as originally predicted. The sweep improvement for the patterns appeared to be negatively impacted by extended shutdowns in the injection and production systems. Such problems as those experienced in this project can be expected when long-term polymer injection is started in old waterflood fields. To prevent these problems, new injection and production tubulars and pumps would be required at a cost prohibitive to the present, independent operators. Unless the future results from the continued waterflood show positive effects of the long-term polymer injection, it appears that the batch-type polymer treatment may have more promise than the long-term treatment and should be more cost effective.

Lyle A. Johnson, Jr.



Dow Chemical Company-Oyster Creek VIII | Open Energy Information  

Open Energy Info (EERE)

Company-Oyster Creek VIII Jump to: navigation, search Name Dow Chemical Company-Oyster Creek VIII Place Texas Utility Id 5374 References EIA Form EIA-861 Final Data File for 2010 -...


Crane Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Crane Creek Wind Farm Crane Creek Wind Farm Facility Crane Creek Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner EnXco Developer EnXco Energy Purchaser Wisconsin P ublic Service Group Location Northeast of Riceville IA Coordinates 43.410108°, -92.51652° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.410108,"lon":-92.51652,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Crane Creek Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Crane Creek Geothermal Area Crane Creek Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Crane Creek Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (1) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.3064,"lon":-116.7447,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Edwards Creek Geothermal Project | Open Energy Information  

Open Energy Info (EERE)

Edwards Creek Geothermal Project Edwards Creek Geothermal Project Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Development Project: Edwards Creek Geothermal Project Project Location Information Coordinates 39.617222222222°, -117.67166666667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.617222222222,"lon":-117.67166666667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Reedy Creek Improvement Dist | Open Energy Information  

Open Energy Info (EERE)

Reedy Creek Improvement Dist Reedy Creek Improvement Dist Jump to: navigation, search Name Reedy Creek Improvement Dist Place Florida Utility Id 15776 Utility Location Yes Ownership M NERC Location FRCC NERC FRCC Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png GS General Service GSD General Service Demand RS Residential Service Residential Average Rates Residential: $0.1240/kWh Commercial: $0.1130/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"


Separation Creek Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Separation Creek Geothermal Area Separation Creek Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Separation Creek Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (1) 10 References Area Overview Geothermal Area Profile Location: Oregon Exploration Region: Cascades GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant Developing Power Projects: 0


Cherry Creek Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Cherry Creek Geothermal Area Cherry Creek Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Cherry Creek Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.85,"lon":-114.905,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Willow Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Willow Creek Wind Farm Willow Creek Wind Farm Facility Willow Creek Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Invenergy Developer Invenergy Location Morrow County OR Coordinates 45.828458°, -119.795537° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.828458,"lon":-119.795537,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Lava Creek Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Lava Creek Geothermal Area Lava Creek Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Lava Creek Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":65.2283,"lon":-162.894,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Papalote Creek II | Open Energy Information  

Open Energy Info (EERE)

Papalote Creek II Papalote Creek II Jump to: navigation, search Name Papalote Creek II Facility Papalote Creek II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner E.ON Climate & Renewables North America Developer E.ON Climate & Renewables North America Energy Purchaser Lower Colorado River Authority Location 30 miles north of Corpus Christi in San Patricio County TX Coordinates 28.254569°, -97.40015° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":28.254569,"lon":-97.40015,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Stony Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Stony Creek Wind Farm Stony Creek Wind Farm Jump to: navigation, search Name Stony Creek Wind Farm Facility Stony Creek Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner E.ON Climate and Renewables Developer E.ON Climate and Renewables Location Somerset County PA Coordinates 40.039256°, -78.781979° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.039256,"lon":-78.781979,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Eva Creek Wind Project | Open Energy Information  

Open Energy Info (EERE)

Eva Creek Wind Project Eva Creek Wind Project Jump to: navigation, search Name Eva Creek Wind Project Facility Eva Creek Wind Project Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Golden Valley Electric Association Developer Golden Valley Electric Association Energy Purchaser Golden Valley Electric Association Location NE corner of Denali Natl Park AK Coordinates 64.0602°, -148.9054° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":64.0602,"lon":-148.9054,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Lost Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Lost Creek Wind Farm Lost Creek Wind Farm Jump to: navigation, search Name Lost Creek Wind Farm Facility Lost Creek Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Wind Capital Group Developer Wind Capital Group Energy Purchaser Associated Electric Cooperative Location DeKalb County MO Coordinates 39.98080324°, -94.55009937° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.98080324,"lon":-94.55009937,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Papalote Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Papalote Creek Wind Farm Papalote Creek Wind Farm Jump to: navigation, search Name Papalote Creek Wind Farm Facility Papalote Creek Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner E.On Climate & Renewables Developer E.On Climate & Renewables Energy Purchaser CPS San Antonio Location San Patricio County TX Coordinates 27.925458°, -97.394686° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":27.925458,"lon":-97.394686,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Forest Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Creek Wind Farm Creek Wind Farm Jump to: navigation, search Name Forest Creek Wind Farm Facility Forest Creek Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner E.On Climate & Renewables Developer E.On Climate & Renewables/RGI Energy Purchaser Luminant Location Glasscock and Sterling Counties TX Coordinates 31.937348°, -101.312513° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.937348,"lon":-101.312513,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Prairie Creek Ethanol LLC | Open Energy Information  

Open Energy Info (EERE)

Creek Ethanol LLC Creek Ethanol LLC Jump to: navigation, search Name Prairie Creek Ethanol LLC Place Goldfield, Iowa Zip 50542 Product Prairie Creek Ethanol, LLC had planned to build a 55m gallon (208m litre) per year ethanol plant in Wesley, Iowa, but, as of 23 May 2008, the board of directors voted to recommend to the members of the company to dissolve the company as soon as possible. Coordinates 37.707559°, -117.233459° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.707559,"lon":-117.233459,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


Microsoft Word - Coyote Creek CX.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3, 2013 3, 2013 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Dorie Welch Project Manager - KEWM-4 Proposed Action: Provision of funds to acquire a conservation easement over the 310-acre Coyote Creek property. Fish and Wildlife Project No.: 2011-003-00, Contract # BPA-006468 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.25 Real Property transfers for cultural protection, habitat preservation and wildlife management. Location: Veneta and West Eugene quadrangles, in Lane County, Oregon (near Eugene, Oregon). Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: The BPA is proposing to fund The Nature Conservancy's (Conservancy) purchase of the Coyote Creek property, a 310-acre parcel of land located just west of the


Blue Creek Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Farm Farm Jump to: navigation, search Name Blue Creek Wind Farm Facility Blue Creek Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Iberdrola Renewables Developer Iberdrola Renewables Energy Purchaser First Energy Solutions Location Van Wert County OH Coordinates 41.018286°, -84.615355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.018286,"lon":-84.615355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Microsoft Word - Soos_Creek_CX.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Timothy Wicks Timothy Wicks Realty Specialist - TERR-COVINGTON Proposed Action: Soos Creek Water & Sewer District Land Use Review Request Case No. 20120040 Budget Information: 184006 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B 4.9 - Multiple use of powerline rights-of-way Location: Covington, King County, Washington Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA proposes to approve a land use review request from Soos Creek Water & Sewer District (District) to construct a new sewer line that would cross under an existing road on BPA fee-owned property near structures 1/2 and 1/3 of the Covington-Maple Valley No. 2 230-kilovolt (kV) transmission line. The proposed sewer line

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Trout Creek Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Trout Creek Geothermal Area Trout Creek Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Trout Creek Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.18822,"lon":-118.37756,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE - Office of Legacy Management -- Hoe Creek Underground Coal  

NLE Websites -- All DOE Office Websites (Extended Search)

Hoe Creek Underground Coal Hoe Creek Underground Coal Gasification Site - 045 FUSRAP Considered Sites Site: Hoe Creek Underground Coal Gasification Site (045) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: The Hoe Creek Underground Gasification site occupies 80 acres of land located in Campbell County, Wyoming. The site was used to investigate the process and environmental parameters of underground coal gasification technologies in the 1970s. The Department of Energy¿s (DOE) current mission is limited to completing environmental remediation activities at the site. This property is owned by the Bureau of Land Management (BLM),


Post Project Appraisal of Cerrito Creek at El Cerrito Plaza  

E-Print Network (OSTI)

Works 5/15/03. (Sheets L1-L8) Friends of Five Creeks website: http://www.fivecreeks.org/ (November 10, 2005) Hanford

Berndt, Sarah; Smith, Fran



Thermal Gradient Holes At Upper Hot Creek Ranch Area (Benoit...  

Open Energy Info (EERE)

Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Thermal Gradient Holes At Upper Hot Creek Ranch Area (Benoit & Blackwell, 2006) Exploration...


New Jersey Nuclear Profile - PSEG Hope Creek Generating Station  

U.S. Energy Information Administration (EIA) Indexed Site

PSEG Hope Creek Generating Station" "Unit","Summer capacity (mw)","Net generation (thousand mwh)","Summer capacity factor (percent)","Type","Commercial operation date","License...


Field Algae Measurements Using Empirical Correlations at Deer Creek Reservoir.  

E-Print Network (OSTI)

??Deer Creek Reservoir in Utah has a history of high algae concentrations. Despite recent nutrient reduction efforts, seasonal algae continue to present problems. Cost effective, (more)

Stephens, Ryan A



Exploration Of The Upper Hot Creek Ranch Geothermal Resource...  

Open Energy Info (EERE)

Nye County, Nevada Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Report: Exploration Of The Upper Hot Creek Ranch Geothermal Resource, Nye County, Nevada...


Mercury distribution in Poplar Creek, Oak Ridge, Tennessee, USA  

SciTech Connect

As a result of the lithium-isotope separation process used in the production of thermonuclear fusion weapons during the mid-1950s and early 1960s. 150 t of mercury were released into Poplar Creek (via East Fork Poplar Creek) in Oak Ridge, Tennessee, USA. This project was performed as part of a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) remedial investigation to define the nature and extent of mercury contamination in Poplar Creek. Ultraclean sampling techniques and ultrasensitive analytical methods were used to determine methylmercury and inorganic mercury concentrations in surface water, sediment, and pore water from Poplar Creek. Total methylmercury and inorganic mercury concentrations in surface water from reaches downstream from the East Fork Poplar Creek confluence were significantly higher (p < 0.05) than the upstream reference reach. Concentrations in surface water increased with distance downstream from the source (East Fork Poplar Creek), which was opposite of expected results. Sediment methylmercury and inorganic mercury concentrations also increased with the distance downstream from the source and were highest near the mouth of Poplar Creek (1.0--12 ng/g and 630--140,000 ng/g, respectively). High concentrations in surface water and sediment near the mouth of Poplar Creek appear to be a result of sediment deposition and resuspension, apparently caused by the stronger Clinch River current acting as a barrier and its backflow into Poplar Creek as a result of hydropower operations.

Campbell, K.R. [SENES Oak Ridge, Inc., TN (United States). Center for Risk Analysis; Ford, C.J. [Highlands Soil and Water Conservation District, Sebring, FL (United States); Levine, D.A. [Univ. of Tennessee, Knoxville, TN (United States)]|[Oak Ridge National Lab., TN (United States)



Mantle Helium And Carbon Isotopes In Separation Creek Geothermal...  

Open Energy Info (EERE)

Mantle Helium And Carbon Isotopes In Separation Creek Geothermal Springs, Three Sisters Area, Central Oregon- Evidence For Renewed Volcanic Activity Or A Long Term Steady State...


Big Creek, Mississippi: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Congressional Districts by Places. Retrieved from "http:en.openei.orgwindex.php?titleBigCreek,Mississippi&oldid227750" Categories: Places Stubs Cities What links here...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


Big Canyon Creek Ecological Restoration Strategy.  

DOE Green Energy (OSTI)

He-yey, Nez Perce for steelhead or rainbow trout (Oncorhynchus mykiss), are a culturally and ecologically significant resource within the Big Canyon Creek watershed; they are also part of the federally listed Snake River Basin Steelhead DPS. The majority of the Big Canyon Creek drainage is considered critical habitat for that DPS as well as for the federally listed Snake River fall chinook (Oncorhynchus tshawytscha) ESU. The Nez Perce Soil and Water Conservation District (District) and the Nez Perce Tribe Department of Fisheries Resources Management-Watershed (Tribe), in an effort to support the continued existence of these and other aquatic species, have developed this document to direct funding toward priority restoration projects in priority areas for the Big Canyon Creek watershed. In order to achieve this, the District and the Tribe: (1) Developed a working group and technical team composed of managers from a variety of stakeholders within the basin; (2) Established geographically distinct sub-watershed areas called Assessment Units (AUs); (3) Created a prioritization framework for the AUs and prioritized them; and (4) Developed treatment strategies to utilize within the prioritized AUs. Assessment Units were delineated by significant shifts in sampled juvenile O. mykiss (steelhead/rainbow trout) densities, which were found to fall at fish passage barriers. The prioritization framework considered four aspects critical to determining the relative importance of performing restoration in a certain area: density of critical fish species, physical condition of the AU, water quantity, and water quality. It was established, through vigorous data analysis within these four areas, that the geographic priority areas for restoration within the Big Canyon Creek watershed are Big Canyon Creek from stream km 45.5 to the headwaters, Little Canyon from km 15 to 30, the mainstem corridors of Big Canyon (mouth to 7km) and Little Canyon (mouth to 7km). The District and the Tribe then used data collected from the District's stream assessment and inventory, utilizing the Stream Visual Assessment Protocol (SVAP), to determine treatment necessary to bring 90% of reaches ranked Poor or Fair through the SVAP up to good or excellent. In 10 year's time, all reaches that were previously evaluated with SVAP will be reevaluated to determine progress and to adapt methods for continued success. Over 400 miles of stream need treatment in order to meet identified restoration goals. Treatments include practices which result in riparian habitat improvements, nutrient reductions, channel condition improvements, fish habitat improvements, invasive species control, water withdrawal reductions, improved hydrologic alterations, upland sediment reductions, and passage barrier removal. The Nez Perce Soil and Water Conservation District (District) and the Nez Perce Tribe Department of Fisheries Resource Management Watershed Division (Tribe) developed this document to guide restoration activities within the Big Canyon Creek watershed for the period of 2008-2018. This plan was created to demonstrate the ongoing need and potential for anadromous fish habitat restoration within the watershed and to ensure continued implementation of restoration actions and activities. It was developed not only to guide the District and the Tribe, but also to encourage cooperation among all stakeholders, including landowners, government agencies, private organizations, tribal governments, and elected officials. Through sharing information, skills, and resources in an active, cooperative relationships, all concerned parties will have the opportunity to join together to strengthen and maintain a sustainable natural resource base for present and future generations within the watershed. The primary goal of the strategy is to address aquatic habitat restoration needs on a watershed level for resident and anadromous fish species, promoting quality habitat within a self-sustaining watershed. Seven objectives have been developed to support this goal: (1) Identify factors limiting quality

Rasmussen, Lynn; Richardson, Shannon



Big Canyon Creek Ecological Restoration Strategy.  

Science Conference Proceedings (OSTI)

He-yey, Nez Perce for steelhead or rainbow trout (Oncorhynchus mykiss), are a culturally and ecologically significant resource within the Big Canyon Creek watershed; they are also part of the federally listed Snake River Basin Steelhead DPS. The majority of the Big Canyon Creek drainage is considered critical habitat for that DPS as well as for the federally listed Snake River fall chinook (Oncorhynchus tshawytscha) ESU. The Nez Perce Soil and Water Conservation District (District) and the Nez Perce Tribe Department of Fisheries Resources Management-Watershed (Tribe), in an effort to support the continued existence of these and other aquatic species, have developed this document to direct funding toward priority restoration projects in priority areas for the Big Canyon Creek watershed. In order to achieve this, the District and the Tribe: (1) Developed a working group and technical team composed of managers from a variety of stakeholders within the basin; (2) Established geographically distinct sub-watershed areas called Assessment Units (AUs); (3) Created a prioritization framework for the AUs and prioritized them; and (4) Developed treatment strategies to utilize within the prioritized AUs. Assessment Units were delineated by significant shifts in sampled juvenile O. mykiss (steelhead/rainbow trout) densities, which were found to fall at fish passage barriers. The prioritization framework considered four aspects critical to determining the relative importance of performing restoration in a certain area: density of critical fish species, physical condition of the AU, water quantity, and water quality. It was established, through vigorous data analysis within these four areas, that the geographic priority areas for restoration within the Big Canyon Creek watershed are Big Canyon Creek from stream km 45.5 to the headwaters, Little Canyon from km 15 to 30, the mainstem corridors of Big Canyon (mouth to 7km) and Little Canyon (mouth to 7km). The District and the Tribe then used data collected from the District's stream assessment and inventory, utilizing the Stream Visual Assessment Protocol (SVAP), to determine treatment necessary to bring 90% of reaches ranked Poor or Fair through the SVAP up to good or excellent. In 10 year's time, all reaches that were previously evaluated with SVAP will be reevaluated to determine progress and to adapt methods for continued success. Over 400 miles of stream need treatment in order to meet identified restoration goals. Treatments include practices which result in riparian habitat improvements, nutrient reductions, channel condition improvements, fish habitat improvements, invasive species control, water withdrawal reductions, improved hydrologic alterations, upland sediment reductions, and passage barrier removal. The Nez Perce Soil and Water Conservation District (District) and the Nez Perce Tribe Department of Fisheries Resource Management Watershed Division (Tribe) developed this document to guide restoration activities within the Big Canyon Creek watershed for the period of 2008-2018. This plan was created to demonstrate the ongoing need and potential for anadromous fish habitat restoration within the watershed and to ensure continued implementation of restoration actions and activities. It was developed not only to guide the District and the Tribe, but also to encourage cooperation among all stakeholders, including landowners, government agencies, private organizations, tribal governments, and elected officials. Through sharing information, skills, and resources in an active, cooperative relationships, all concerned parties will have the opportunity to join together to strengthen and maintain a sustainable natural resource base for present and future generations within the watershed. The primary goal of the strategy is to address aquatic habitat restoration needs on a watershed level for resident and anadromous fish species, promoting quality habitat within a self-sustaining watershed. Seven objectives have been developed to support this goal: (1) Identify factors limiting quality

Rasmussen, Lynn; Richardson, Shannon



DOE/EA-1967: Hills Creek-Lookout Point Transmission Line Rebuild...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOEEA-1967: Hills Creek-Lookout Point Transmission Line Rebuild, Lane County, Oregon DOEEA-1967: Hills Creek-Lookout Point Transmission Line Rebuild, Lane County, Oregon Summary...


Pataha Creek Model Watershed : 1998 Habitat Conservation Projects.  

Science Conference Proceedings (OSTI)

The projects outlined in detail on the attached project reports are a few of the many projects implemented in the Pataha Creek Model Watershed since it was selected as a model in 1993. 1998 was a year where a focused effort was made to work on the upland conservation practices to reduce the sedimentation into Pataha Creek.

Bartels, Duane G.



Tons of Heavy Metals in Mill Creek Sediments Heather Freeman  

E-Print Network (OSTI)

with industries. Paper, woolen, flour, and cotton mills, starch factories, slaughterhouses, distilleriesTons of Heavy Metals in Mill Creek Sediments Heather Freeman 8/30/99 Geology Department Advisors: Dr. Kees DeJong Dr. Barry Manyard Dr. David Nash #12;Tons of heavy metals in Mill Creek sediments

Maynard, J. Barry

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Clear Creek Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Geothermal Area Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Clear Creek Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":64.85,"lon":-162.3,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Smith Creek Geothermal Project | Open Energy Information  

Open Energy Info (EERE)

Geothermal Project Geothermal Project Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Development Project: Smith Creek Geothermal Project Project Location Information Coordinates 39.311388888889°, -117.55083333333° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.311388888889,"lon":-117.55083333333,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Granite Creek Geothermal Project | Open Energy Information  

Open Energy Info (EERE)

Geothermal Project Geothermal Project Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Development Project: Granite Creek Geothermal Project Project Location Information Coordinates 41.058611111111°, -117.22777777778° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.058611111111,"lon":-117.22777777778,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wind power for the Creek Nation. Final report  

SciTech Connect

An Enertech 1800 horizontal-axis wind powered electric generator was purchased and interphased with the electric utility system provided to the Creek Nation by the Public Service Company of Oklahoma. Objectives of the work include: to determine the economic feasibility of wind power for the Creek Nation region; to educate the Creek Nation and other Indian tribes about the potential use of wind power; and to accumulate valuable climatic data through an on-site wind survey at a height of 60' over a long period of time. (LEW)

Not Available



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Great Historical Events That Were Significantly Affected by the Weather. Part 11: Meteorological Aspects of the Battle of Waterloo  

Science Conference Proceedings (OSTI)

The Waterloo Campaign extended from 15 to 18 June 1815, with the decisive Battle of Waterloo taking place on the 18th. The campaign involved the Army of the North of Napoleon on the one hand, and the Anglo-Dutch and Prussian armies on the ...

J. Neumann



Shepherdstown's "Battle of the Cedars" Alan R. Biggs, Ph.D.; Professor of Plant Pathology and Extension Specialist  

E-Print Network (OSTI)

Shepherdstown's "Battle of the Cedars" Alan R. Biggs, Ph.D.; Professor of Plant Pathology" because of the reddish-yellow color they display on their plant hosts during their parasitic phase. You-virginianae, like many rusts, is heteroecious, meaning that it spends part of its life cycle on one plant, a red

Mohaghegh, Shahab


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Birch Creek Village Elec Util | Open Energy Information  

Open Energy Info (EERE)

Birch Creek Village Elec Util Birch Creek Village Elec Util Jump to: navigation, search Name Birch Creek Village Elec Util Place Alaska Utility Id 1747 Utility Location Yes Ownership M NERC Location AK Operates Generating Plant Yes Activity Generation Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.6070/kWh Commercial: $0.6150/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Birch_Creek_Village_Elec_Util&oldid=409048" Categories:


Upper Hot Creek Ranch Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Upper Hot Creek Ranch Geothermal Area Upper Hot Creek Ranch Geothermal Area (Redirected from Upper Hot Creek Ranch Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Upper Hot Creek Ranch Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (2) 10 References Area Overview Geothermal Area Profile Location: Nevada Exploration Region: Northern Basin and Range Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure


Ophir Creek Space Heating Low Temperature Geothermal Facility | Open Energy  

Open Energy Info (EERE)

Ophir Creek Space Heating Low Temperature Geothermal Facility Ophir Creek Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Ophir Creek Space Heating Low Temperature Geothermal Facility Facility Ophir Creek Sector Geothermal energy Type Space Heating Location SW, Alaska Coordinates Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Silver Creek Farms Aquaculture Low Temperature Geothermal Facility | Open  

Open Energy Info (EERE)

Creek Farms Aquaculture Low Temperature Geothermal Facility Creek Farms Aquaculture Low Temperature Geothermal Facility Jump to: navigation, search Name Silver Creek Farms Aquaculture Low Temperature Geothermal Facility Facility Silver Creek Farms Sector Geothermal energy Type Aquaculture Location Twin Falls, Idaho Coordinates 42.5629668°, -114.4608711° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


RFC Sand Creek Development LLC | Open Energy Information  

Open Energy Info (EERE)

RFC Sand Creek Development LLC RFC Sand Creek Development LLC Jump to: navigation, search Name RFC Sand Creek Development LLC Place Aurora, Colorado Zip 80014 Product Subsidiary of Republic Financial Corporation set up to invest in Sand Creek Energy LLC, a planned gas to liquid facility. Coordinates 39.325162°, -79.54975° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.325162,"lon":-79.54975,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Hot Creek Hatchery Aquaculture Low Temperature Geothermal Facility | Open  

Open Energy Info (EERE)

Hot Creek Hatchery Aquaculture Low Temperature Geothermal Facility Hot Creek Hatchery Aquaculture Low Temperature Geothermal Facility Jump to: navigation, search Name Hot Creek Hatchery Aquaculture Low Temperature Geothermal Facility Facility Hot Creek Hatchery Sector Geothermal energy Type Aquaculture Location Mammoth Lakes, California Coordinates 37.648546°, -118.972079° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Mantle Helium And Carbon Isotopes In Separation Creek Geothermal Springs,  

Open Energy Info (EERE)

Mantle Helium And Carbon Isotopes In Separation Creek Geothermal Springs, Mantle Helium And Carbon Isotopes In Separation Creek Geothermal Springs, Three Sisters Area, Central Oregon- Evidence For Renewed Volcanic Activity Or A Long Term Steady State System(Question) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Paper: Mantle Helium And Carbon Isotopes In Separation Creek Geothermal Springs, Three Sisters Area, Central Oregon- Evidence For Renewed Volcanic Activity Or A Long Term Steady State System(Question) Details Activities (1) Areas (1) Regions (0) Abstract: Here we present the helium and carbon isotope results from the initial study of a fluid chemistry-monitoring program started in the summer of 2001 near the South Sister volcano in central Oregon. The Separation Creek area which is several miles due west of the volcano is the locus of


Floodplain and wetlands assessment of the White Oak Creek Embayment  

SciTech Connect

This report describes the proposed methods for dealing with contaminants that have accumulated in White Oak Creek, White Oak Lake, and the White Oak Creek Embayment as a result of process releases and discharges from the Oak Ridge National Laboratory. Alternative methods of cleaning up the area which were considered in accordance with regulatory guidelines are listed, and information supporting the selected methods is provided. Also included are results of a site survey conducted at the White Oak Creek Embayment and the expected effects of the proposed control structures on the floodplain and wetlands. The appendix contains figures showing the nine cross-sections of the stream channel surveyed during studies of the White Oak Creek area.



Panther Creek III Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Panther Creek III Wind Farm Panther Creek III Wind Farm Jump to: navigation, search Name Panther Creek III Wind Farm Facility Panther Creek III Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner E.On Climate & Renewables Developer E.On Climate & Renewables Location TX Coordinates 31.9685988°, -99.9018131° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.9685988,"lon":-99.9018131,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fourche Creek Wastewater Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Fourche Creek Wastewater Biomass Facility Fourche Creek Wastewater Biomass Facility Jump to: navigation, search Name Fourche Creek Wastewater Biomass Facility Facility Fourche Creek Wastewater Sector Biomass Facility Type Non-Fossil Waste Location Pulaski County, Arkansas Coordinates 34.7538615°, -92.2236667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.7538615,"lon":-92.2236667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Panther Creek I Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Panther Creek I Wind Farm Panther Creek I Wind Farm Jump to: navigation, search Name Panther Creek I Wind Farm Facility Panther Creek I Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner E.On Climate & Renewables Developer E.On Climate & Renewables Location TX Coordinates 32.201592°, -101.406391° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.201592,"lon":-101.406391,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Tuttle Creek Hydroelectric Project feasibility assessment report  

DOE Green Energy (OSTI)

The results are presented of a feasibility assessment study to determine if hydroelectric generation could be developed economically at the Corps of Engineers' Tuttle Creek Dam, an existing flood control structure on the Big Blue River near Manhattan, Kansas. The studies and investigations included site reconnaissance, system load characteristics, site hydrology, conceptual project arrangements and layouts, power studies, estimates of construction costs, development of capital costs, economic feasibility, development of a design and construction schedule and preliminary environmental review of the proposed Project. The dependable capacity of the Project as delivered into the existing transmission and distribution network is 12,290 kW and the average annual energy is 56,690 MWh. For the scheduled on-line date of July 1984, the Project is estimated to have a Total Investment Cost of $19,662,000 (equal to $1333/kW installed at that time frame) with an estimated annual cost for the first year of operation of $2,696,000, assuming REA financing at 9.5% interest rate. The Project is considered technically feasible and without any major environmental issues. It shows economic feasibility providing satisfactory financing terms are available. (LCL)




Wolf Creek Nuclear Operating Corporation | Open Energy Information  

Open Energy Info (EERE)

Wolf Creek Nuclear Operating Corporation Wolf Creek Nuclear Operating Corporation Jump to: navigation, search Name Wolf Creek Nuclear Operating Corporation Place Burlington, Kansas Zip 66839-0411 Product Wolf Creek Nuclear Operating Corporation operates the Wolf Creek Generating Station, Kansas' first nuclear power generating station, for three utility owners in Kansas and Missouri. Coordinates 44.446275°, -108.431704° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.446275,"lon":-108.431704,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Recurrent faulting and petroleum accumulation, Cat Creek Anticline, central Montana  

SciTech Connect

The Cat Creek anticline, scene of central Montana's first significant oil discovery, is underlain by a south-dipping high-angle fault (Cat Creek fault) that has undergone several episodes of movement with opposite sense of displacement. Borehole data suggest that the Cat Creek fault originated as a normal fault during Proterozoic rifting concurrent with deposition of the Belt Supergroup. Reverse faulting took place in Late Cambrian time, and again near the end of the Devonian Period. The Devonian episode, coeval with the Antler orogeny, raised the southern block several hundred feet. The southern block remained high through Meramecian time, then began to subside. Post-Atokan, pre-Middle Jurassic normal faulting lowered the southern block as much as 1,500 ft. During the Laramide orogeny (latest Cretaceous-Eocene) the Cat Creek fault underwent as much as 4,000 ft of reverse displacement and a comparable amount of left-lateral displacement. The Cat Creek anticline is a fault-propagation fold; en echelon domes and listric normal faults developed along its crest in response to wrenching. Oil was generated mainly in organic-rich shales of the Heath Formation (upper Chesterian Series) and migrated upward along tectonic fractures into Pennsylvanian, Jurassic, and Cretaceous reservoir rocks in structural traps in en echelon domes. Production has been achieved only from those domes where structural closure was retained from Jurassic through Holocene time.

Nelson, W.J. (Illinois State Geological Survey, Champaign (United States))



Scotch Creek Wildlife Area 2007-2008 Annual Report.  

DOE Green Energy (OSTI)

The Scotch Creek Wildlife Area is a complex of 6 separate management units located in Okanogan County in North-central Washington State. The project is located within the Columbia Cascade Province (Okanogan sub-basin) and partially addresses adverse impacts caused by the construction of Chief Joseph and Grand Coulee hydroelectric dams. With the acquisition of the Eder unit in 2007, the total size of the wildlife area is now 19,860 acres. The Scotch Creek Wildlife Area was approved as a wildlife mitigation project in 1996 and habitat enhancement efforts to meet mitigation objectives have been underway since the spring of 1997 on Scotch Creek. Continuing efforts to monitor the threatened Sharp-tailed grouse population on the Scotch Creek unit are encouraging. The past two spring seasons were unseasonably cold and wet, a dangerous time for the young of the year. This past spring, Scotch Creek had a cold snap with snow on June 10th, a critical period for young chicks just hatched. Still, adult numbers on the leks have remained stable the past two years. Maintenance of BPA funded enhancements is necessary to protect and enhance shrub-steppe and to recover and sustain populations of Sharp-tailed grouse and other obligate species.

Olson, Jim [Washington Department of Fish and Wildlife



Mass and Momentum Balance in the Brush Creek Drainage Flow Determined from Single-Profile Data  

Science Conference Proceedings (OSTI)

Fluxes and flux-divergences of mass and momentum in Brush Creek Valley, computed from measurements taken by Tethersondes and Doppler sodars in the 1984 ASCOT experiment, are presented. Estimates of mass influx from open sidewalls in Brush Creek, ...

Ronald J. Dobosy; K. Shankar Rao; John W. Przybylowicz; Richard M. Eckman; Rayford P. Hosker Jr.



EA-1219: Hoe Creek Underground Coal Gasification Test Site Remediation, Campbell County, Wyoming  

Energy.gov (U.S. Department of Energy (DOE))

This EA evaluates the environmental impacts for the proposed Hoe Creek Underground Coal Gasification Test Site Remediation that would be performed at the Hoe Creek site in Campbell County, Wyoming.


Town of Oak Creek, Colorado (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Creek Creek Place Colorado Utility Id 14054 Utility Location Yes Ownership M NERC Location WECC NERC SPP Yes NERC WECC Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Rate 101: Residential Residential Rate 110: Commercial Commercial Rate 202: General Service Three Phase Commercial Average Rates Residential: $0.0965/kWh Commercial: $0.0842/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Town_of_Oak_Creek,_Colorado_(Utility_Company)&oldid=411791


Oak Creek Energy Systems Wind Farm I | Open Energy Information  

Open Energy Info (EERE)

I I Facility Oak Creek Energy Systems Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Oak Creek Energy Systems Developer Oak Creek Energy Systems Energy Purchaser Southern California Edison Co Location Tehachapi CA Coordinates 35.07665°, -118.25529° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.07665,"lon":-118.25529,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE - Office of Legacy Management -- Lost Creek - WY 01  

Office of Legacy Management (LM)

Lost Creek - WY 01 Lost Creek - WY 01 FUSRAP Considered Sites Site: Lost Creek (WY.01 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to


Panther Creek II Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Creek II Wind Farm Creek II Wind Farm Facility Panther Creek II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner E.On Climate & Renewables Developer E.On Climate & Renewables Energy Purchaser N/a Location TX Coordinates 32.201592°, -101.406391° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.201592,"lon":-101.406391,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Oak Creek Energy Systems Wind Farm III | Open Energy Information  

Open Energy Info (EERE)

III III Facility Oak Creek Energy Systems Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Oak Creek Energy Systems Developer Oak Creek Energy Systems Energy Purchaser Southern California Edison Co Location Tehachapi CA Coordinates 35.07665°, -118.25529° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.07665,"lon":-118.25529,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Oak Creek Energy Systems Wind Farm II | Open Energy Information  

Open Energy Info (EERE)

II II Facility Oak Creek Energy Systems Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Oak Creek Energy Systems Developer Oak Creek Energy Systems Energy Purchaser Southern California Edison Co Location Tehachapi CA Coordinates 35.07665°, -118.25529° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.07665,"lon":-118.25529,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Upper Hot Creek Ranch Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Upper Hot Creek Ranch Geothermal Area Upper Hot Creek Ranch Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Upper Hot Creek Ranch Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (2) 10 References Area Overview Geothermal Area Profile Location: Nevada Exploration Region: Northern Basin and Range Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.


Microsoft Word - SilverCreek-Fiber-CX.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

John Brank John Brank Customer Service Engineer - TPC-OLYMPIA Proposed Action: Silver Creek Substation fiber project Budget Information: Work Order 253198, Task 03 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B4.7 Adding fiber optic cable to transmission structures or burying fiber optic cable in existing transmission line rights of way. Locations: Silver Creek Substation, Lewis County, Washington (T12N R2E SEC17) Proposed by: Bonneville Power Administration (BPA) and Lewis County Public Utility District (PUD) Description of the Proposed Action: BPA proposes to connect a fiber optic cable from an existing Lewis County PUD transmission line into the BPA Silver Creek Substation in Lewis County, Washington. The fiber project is needed to increase transmission system


White Creek Wind Power Project | Open Energy Information  

Open Energy Info (EERE)

White Creek Wind Power Project White Creek Wind Power Project Facility White Creek Wind Power Project Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Last Mile Electric Cooperative Developer Last Mile Electric Cooperative Energy Purchaser Last Mile Electric Cooperative Location Klickitat County Coordinates 45.853153°, -120.289578° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.853153,"lon":-120.289578,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Protect and Restore Lolo Creek Watershed : Annual Report CY 2005.  

DOE Green Energy (OSTI)

The Nez Perce Tribe Department of Fisheries Resource Management, Watershed Division approaches watershed restoration with a ridge-top to ridge-top approach. Watershed restoration projects within the Lolo Creek watershed are coordinated with the Clearwater National Forest and Potlatch Corporation. The Nez Perce Tribe began watershed restoration projects within the Lolo Creek watershed of the Clearwater River in 1996. Fencing to exclude cattle for stream banks, stream bank stabilization, decommissioning roads, and upgrading culverts are the primary focuses of this effort. The successful completion of the replacement and removal of several passage blocking culverts represent a major improvement to the watershed. These projects, coupled with other recently completed projects and those anticipated in the future, are a significant step in improving habitat conditions in Lolo Creek.

McRoberts, Heidi


Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fast-growing willow shrub named `Fish Creek`  

DOE Patents (OSTI)

A distinct male cultivar of Salix purpurea named `Fish Creek`, characterized by rapid stem growth producing greater than 30% more woody biomass than either of its parents (`94001` and `94006`) and 20% more biomass than a current production cultivar (`SV1`). `Fish Creek` can be planted from dormant stem cuttings, produces multiple stems after coppice, and the stem biomass can be harvested when the plant is dormant. In the spring following harvest, the plant will re-sprout very vigorously, producing new stems that can be harvested after two to four years of growth. This harvest cycle can be repeated several times. The stem biomass can be chipped and burned as a source of renewable energy, generating heat and/or electricity. `Fish Creek` displays a low incidence of rust disease or damage by beetles or sawflies.

Abrahamson, Lawrence P. (Marcellus, NY); Kopp, Richard F. (Marietta, NY); Smart, Lawrence B. (Geneva, NY); Volk, Timothy A. (Syracuse, NY)



Proposed Flyers Creek Wind Farm, Blayney Local Government Area  

E-Print Network (OSTI)

Application reference: MP 08_0252 The Flyers Creek Wind Turbine Awareness Group Inc. (FCWTAG) is comprised of a large group of concerned residents of the Blayney Local Government Area. We object to the Proposed Flyers Creek Wind Farm (the proposal) in the strongest possible terms. We believe this development is totally inappropriate. This submission details our objections. The FCWTAG requests that representatives of the group be given the opportunity to speak at the Planning Assessment Commission hearing related to this proposal. Yours faithfully,

Major Development Assessment; Sydney Nsw; Dr. Colleen; J Watts Oam



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


AB-Net Method of Protection from Projectiles (city, military base, battle-front, etc.)  

E-Print Network (OSTI)

The author suggests a low cost special AB-Net from artificial fiber, which may protect cities and important objects from rockets, artillery and mortar shells, projectiles, bullets, and strategic weapons. The idea is as follows: The offered AB-Net joins an incoming projectile to a small braking parachute and this incoming projectile loses speed by air braking after a drag distance of 50 - 150 meters. A following interception net after the first may serve to collect the slowed projectiles and their fragments or bomblets so that they do not reach the aimpoint. The author offers the design of AB-Net, a developed theory of snagging with a small braking parachute by AB-Net; and sample computations. These nets may be used for defense of a town, city, military base, battle-front line, road (from terrorists), or any important objects or installations (for example nuclear electric station, government buildings, etc.). Computed projects are: Net to counter small rockets (for example, from Qassam), net to counter artillery projectile (caliber 76 mm), net to counter bullets (caliber 7.6 mm). The offered method is cheaper by thousands of times than protection of a city by current anti-rocket systems. Discussion and results are at the end of the article. Key words: Protection from missile and projectile weapons, mortar, rocket, AB-Net, Qassam defense, incoming defense, armor.

Alexander Bolonkin



AB-Net Method of Protection from Projectiles (city, military base, battle-front, etc.)  

E-Print Network (OSTI)

The author suggests a low cost special AB-Net from artificial fiber, which may protect cities and important objects from rockets, artillery and mortar shells, projectiles, bullets, and strategic weapons. The idea is as follows: The offered AB-Net joins an incoming projectile to a small braking parachute and this incoming projectile loses speed by air braking after a drag distance of 50 - 150 meters. A following interception net after the first may serve to collect the slowed projectiles and their fragments or bomblets so that they do not reach the aimpoint. The author offers the design of AB-Net, a developed theory of snagging with a small braking parachute by AB-Net; and sample computations. These nets may be used for defense of a town, city, military base, battle-front line, road (from terrorists), or any important objects or installations (for example nuclear electric station, government buildings, etc.). Computed projects are: Net to counter small rockets (for example, from Qassam), net to counter artille...

Bolonkin, Alexander



Cedar Creek Wind Farm II (GE) | Open Energy Information  

Open Energy Info (EERE)

Cedar Creek Wind Farm II (GE) Cedar Creek Wind Farm II (GE) Jump to: navigation, search Name Cedar Creek Wind Farm II (GE) Facility Cedar Creek II (GE) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner BP Wind Energy Developer BP Wind Energy Energy Purchaser Xcel Energy Location Weld County CO Coordinates 40.868652°, -104.092398° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.868652,"lon":-104.092398,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Oak Creek - Phase 2A | Open Energy Information  

Open Energy Info (EERE)

Phase 2A Phase 2A Jump to: navigation, search Name Oak Creek - Phase 2A Facility Oak Creek - Phase 2A Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Oak Creek Energy Systems Developer M&N Wind Power/Oak Creek Energy Systems Energy Purchaser Southern California Edison Co Location Tehachapi CA Coordinates 35.07665°, -118.25529° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.07665,"lon":-118.25529,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Oak Creek Phase I Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wind Farm Wind Farm Jump to: navigation, search Name Oak Creek Phase I Wind Farm Facility Oak Creek Phase I Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Nichimen America/Oak Creek Energy Systems Developer M&N Wind Power/Oak Creek Energy Systems Energy Purchaser Southern California Edison Co Location Tehachapi CA Coordinates 35.07665°, -118.25529° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.07665,"lon":-118.25529,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ventilation planning at Energy West's Deer Creek mine  

SciTech Connect

In 2004 ventilation planning was initiated to exploit a remote area of Deer Creek mine's reserve (near Huntington, Utah), the Mill Fork Area, located under a mountain. A push-pull ventilation system was selected. This article details the design process of the ventilation system upgrade, the procurement process for the new fans, and the new fan startup testing. 5 figs., 1 photo.

Tonc, L.; Prosser, B.; Gamble, G. [Pacific Corp., Huntington, UT (United States)



Pataha Creek Model Watershed : 1999 Habitat Conservation Projects.  

Science Conference Proceedings (OSTI)

The projects outlined in detail on the attached project reports are a summary of the many projects implemented in the Pataha Creek Model Watershed since it was selected as a model in 1993. Up until last year, demonstration sites using riparian fencing, off site watering facilities, tree and shrub plantings and upland conservation practices were used for information and education and was the main focus of the implementation phase of the watershed plan. These practices are the main focus of the watershed plan to reduce the majority of the sediment entering the stream. However, the watershed stream evaluation team used in the watershed analysis determined that there were problems along the Pataha Creek that needed to be addressed that would add further protection to the banks and therefore a further reduction of sedimentation into the stream. 1999 was a year where a focused effort was made to work on the upland conservation practices to reduce the sedimentation into Pataha Creek. Over 95% of the sediment entering the stream can be tied directly to the upland and riparian areas of the watershed. In stream work was not addressed this year because of the costs associated with these projects and the low impact of the sediment issue concerning Pataha Creeks impact on Chinook Salmon in the Tucannon River.

Bartels, Duane G.



Okanogan Focus Watershed Salmon Creek : Annual Report 1999.  

DOE Green Energy (OSTI)

During FY 1999 the Colville Tribes and the Okanogan Irrigation District (OID) agreed to study the feasibility of restoring and enhancing anadromous fish populations in Salmon Creek while maintaining the ability of the district to continue full water service delivery to it members.

Lyman, Hilary



Tillman Creek Mitigation Site As-Build Report.  

DOE Green Energy (OSTI)

This as-built report describes site conditions at the Tillman Creek mitigation site in South Cle Elum, Washington. This mitigation site was constructed in 2006-2007 to compensate for wetland impacts from the Yakama Nation hatchery. This as-built report provides information on the construction sequence, as-built survey, and establishment of baseline monitoring stations.

Gresham, Doug [Otak, Inc.



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Mesquite Creek, Arizona: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Mesquite Creek, Arizona: Energy Resources Mesquite Creek, Arizona: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 34.9666691°, -114.568575° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.9666691,"lon":-114.568575,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Microsoft Word - CX-Wautoma-Rock Creek_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3, 2010 3, 2010 REPLY TO ATTN OF: KEP-4 SUBJECT: Environmental Clearance Memorandum Corinn Castro Project Manager - TELM-TPP-3 Proposed Action: Replace spacer dampers along the Wautoma-Rock Creek No. 1 500-kV Transmission Line. Budget Information: Work Order # 00234527 PP&A Project No.: PP&A 1507 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3, Routine maintenance activities...for structures, rights-of-way, infrastructures such as roads, equipment...routine maintenance activities, corrective....are required to maintain... infrastructures...in a condition suitable for a facility to be used for its designed purpose. Location: Wautoma-Rock Creek No. 1 500-kV Transmission Line. The proposed project is


Microsoft Word - CLT_Tide_Creek_Land_Acquisition_CX.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Jason Karnezis Jason Karnezis Project Manager - KEWL-4 Proposed Action: Tide Creek Property Funding Fish and Wildlife Project No. & Contract No.: 2010-073-00, BPA-006247 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.25 Real property transfers for cultural resources protection, habitat preservation, and wildlife management Location: T6N, R2W, S25 in Columbia County, Oregon Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA proposes to fund Columbia Land Trust (CLT) for the purchase of approximately 41 acres of historic Columbia River floodplain in Columbia County, Oregon. The CLT will own and manage the Tide Creek property for fish and wildlife conservation purposes and BPA will receive a conservation easement to ensure that the habitat


Cave Creek, Arizona: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Cave Creek, Arizona: Energy Resources Cave Creek, Arizona: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 33.8333716°, -111.9507042° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.8333716,"lon":-111.9507042,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Cedar Creek Wind Farm I (Mitsubishi) | Open Energy Information  

Open Energy Info (EERE)

Mitsubishi) Mitsubishi) Jump to: navigation, search Name Cedar Creek Wind Farm I (Mitsubishi) Facility Cedar Creek Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Babcock & Brown/BP America Developer Babcock & Brown/BP America Energy Purchaser Xcel Energy Location Weld County east of Grover CO Coordinates 40.873578°, -104.07825° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.873578,"lon":-104.07825,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Cedar Creek Wind Farm I (GE) | Open Energy Information  

Open Energy Info (EERE)

GE) GE) Jump to: navigation, search Name Cedar Creek Wind Farm I (GE) Facility Cedar Creek Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Babcock & Brown/BP America Developer Babcock & Brown/BP America Energy Purchaser Xcel Energy Location Weld County east of Grover CO Coordinates 40.873578°, -104.07825° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.873578,"lon":-104.07825,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Cedar Creek Wind Farm II (Nordex) | Open Energy Information  

Open Energy Info (EERE)

Farm II (Nordex) Farm II (Nordex) Jump to: navigation, search Name Cedar Creek Wind Farm II (Nordex) Facility Cedar Creek II (Nordex) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner BP Wind Energy Developer BP Wind Energy Energy Purchaser Xcel Energy Location Weld County CO Coordinates 40.874623°, -104.092569° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.874623,"lon":-104.092569,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Coconut Creek, Florida: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Coconut Creek, Florida: Energy Resources Coconut Creek, Florida: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 26.2517482°, -80.1789351° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":26.2517482,"lon":-80.1789351,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Blue Creek Winter Range: Wildlife Mitigation Project Final Environmental Assessment  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Creek Winter Range: Creek Winter Range: Wildlife Mitigation Project Final Environmental Assessment I F 8 - Spokane Tribe of Indians Bonneville POWER ADMINISTRATION B r n u r r o N aF THIS D O C ~ I H ~ E E 1% utifi_;'iUzi: w DOVEA-0939 November1 994 Bureay of Indian Affairs DISCLAIMER Portions of this document may be illegible in electronic image products. Images are produced from the best available original document. DISCLAIMER This report was .prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, make any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or


Ballenger Creek, Maryland: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Ballenger Creek, Maryland: Energy Resources Ballenger Creek, Maryland: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.3726022°, -77.4352636° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.3726022,"lon":-77.4352636,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Grape Creek, Texas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Grape Creek, Texas: Energy Resources Grape Creek, Texas: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 31.5793231°, -100.5475979° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.5793231,"lon":-100.5475979,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fritz Creek, Alaska: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Fritz Creek, Alaska: Energy Resources Fritz Creek, Alaska: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 59.7361111°, -151.2952778° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":59.7361111,"lon":-151.2952778,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Burnt Creek-Riverview, North Dakota: Energy Resources | Open Energy  

Open Energy Info (EERE)

Burnt Creek-Riverview, North Dakota: Energy Resources Burnt Creek-Riverview, North Dakota: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 46.9583751°, -100.7982422° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.9583751,"lon":-100.7982422,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Cantua Creek, California: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Cantua Creek, California: Energy Resources Cantua Creek, California: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 36.50134°, -120.3162666° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.50134,"lon":-120.3162666,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Projects/Coal Creek Project | Open Energy Information  

Open Energy Info (EERE)

Creek Project Creek Project < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.3617,"lon":-101.094,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}


Two Creeks, Wisconsin: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Creeks, Wisconsin: Energy Resources Creeks, Wisconsin: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 44.3022186°, -87.5631378° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.3022186,"lon":-87.5631378,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Microsoft Word - Delrio_ChiefJo_FosterCreek_CX.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6, 2012 6, 2012 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Ben Deschuytter Project Manager -TEP-CSB-1 Proposed Action: D Analog Communications Retirement at Del Rio, Chief Joseph, and Foster Creek Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.19 Microwave, meteorological, and radio towers Location: Douglas County, Washington Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA proposes to upgrade communication equipment at three existing facilities in Douglas County, Washington. The work would occur at two of BPA's substations, Del Rio and Chief Joseph, and at BPA's Foster Creek radio site. Activities at these sites are in connection with the retirement of BPA's D analog communication system. At Del Rio, activities would


Willow Creek Wildlife Mitigation- Project Final Environmental Assessment  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Willow Creek Wildlife Mitigation- Project Willow Creek Wildlife Mitigation- Project Final Environmental Assessment DOE-EA-1 023 Bonneville POWER ADMINISTRATION April 1995 DISCLAIMER This report w a s prepared a s an account of work sponsored by an agency of t h e United States Government. Neither t h e United States Government nor any agency thereof, nor any of their employees, make any warranty, express or implied, or a s s u m e s any legal liability or responsibility for t h e accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents t h a t its use would not infringe privately owned rights. Reference herein to any specific commercial, product, process, or service by trade name, trademark, manufacturer, or otherwise d o e s not necessarily constitute or imply its


Francis Creek, Wisconsin: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Creek, Wisconsin: Energy Resources Creek, Wisconsin: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 44.199439°, -87.7214755° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.199439,"lon":-87.7214755,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


White Oak Creek embayment sediment retention structure design and construction  

SciTech Connect

White Oak Creek is the major surface water drainage throughout the Department of Energy (DOE) Oak Ridge National Laboratory (ORNL). Samples taken from the lower portion of the creek revealed high levels of Cesium 137 and lower level of Cobalt 60 in near surface sediment. Other contaminants present in the sediment included: lead, mercury, chromium, and PCBs. In October 1990, DOE, US Environmental Protection Agency (EPA), and Tennessee Department of Environment and Conservation (TDEC) agreed to initiate a time critical removal action in accordance with the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) to prevent the transport of the contaminated sediments into the Clinch River system. This paper discusses the environmental, regulatory, design, and construction issues that were encountered in conducting the remediation work.

Van Hoesen, S.D.; Kimmell, B.L. [Oak Ridge National Lab., TN (United States); Page, D.G.; Wilkerson, R.B. [MK-Ferguson of Oak Ridge Co., TN (United States); Hudson, G.R. [USDOE Oak Ridge Field Office, TN (United States); Kauschinger, J.L. [Ground Engineering Services, Alpharetta, GA (United States); Zocolla, M. [Nashville District, US Army Corps of Engineers, Nashville, TN (United States)



Swartz Creek, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Swartz Creek, Michigan: Energy Resources Swartz Creek, Michigan: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.9572508°, -83.8305144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.9572508,"lon":-83.8305144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Clear Creek County, Colorado: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Clear Creek County, Colorado: Energy Resources Clear Creek County, Colorado: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.6904464°, -105.6412527° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.6904464,"lon":-105.6412527,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Process concept of retorting of Julia Creek oil shale  

SciTech Connect

A process is proposed for the above ground retorting of the Julia Creek oil shale in Queensland. The oil shale characteristics, process description, chemical reactions of the oil shale components, and the effects of variable and operating conditions on process performance are discussed. The process contains a fluidized bed combustor which performs both as a combustor of the spent shales and as a heat carrier generator for the pyrolysis step. 12 references, 5 figures, 5 tables.

Sitnai, O.



Post Irradiation Evaluation of BWR Fuel From Hope Creek Reactor  

Science Conference Proceedings (OSTI)

Occasionally, in some BWRs, fuel pellet washout from a single degraded fuel rod has resulted in high offgas levels that were sufficient to impede the reactor operation. In addition, certain sound fuel rods have exhibited high eddy-current liftoff values during routine poolside measurements. Investigators pursued these two recent BWR fuel issues by performing detailed hotcell examinations on selected fuel rods from the Hope Creek reactor. The results provided insights into the mechanisms involved and poss...



Slate Creek Hot Springs Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Slate Creek Hot Springs Geothermal Area Slate Creek Hot Springs Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Slate Creek Hot Springs Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.171,"lon":-114.624,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


East Basin Creek Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

East Basin Creek Geothermal Area East Basin Creek Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: East Basin Creek Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.2633,"lon":-114.811,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Smith Creek Valley Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Smith Creek Valley Geothermal Area Smith Creek Valley Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Smith Creek Valley Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.3128,"lon":-117.5493,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Deer Creek Hot Spring Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Deer Creek Hot Spring Geothermal Area Deer Creek Hot Spring Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Deer Creek Hot Spring Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.09167,"lon":-116.05,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Foote Creek Rim I Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Foote Creek Rim I Wind Farm Foote Creek Rim I Wind Farm Facility Foote Creek Rim I Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner PacifiCorp/Eugene Water & Electric Board Developer SeaWest/Tomen Energy Purchaser PacifiCorp/Eugene Water & Electric Board Location Carbon County WY Coordinates 41.652605°, -106.189914° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.652605,"lon":-106.189914,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Big Creek Hot Springs Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Creek Hot Springs Geothermal Area Creek Hot Springs Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Big Creek Hot Springs Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.3067,"lon":-114.3375,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Indian Creek Hot Springs Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Creek Hot Springs Geothermal Area Creek Hot Springs Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Indian Creek Hot Springs Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.8129,"lon":-115.1229,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rehabilitate Newsome Creek Watershed, 2007-2008 Annual Report.  

DOE Green Energy (OSTI)

The Nez Perce Tribe Department of Fisheries Resource Management, Watershed Division approaches watershed restoration with a ridge-top to ridgetop approach. The Nez Perce Tribe (NPT) and the Nez Perce National Forest (NPNF) have formed a partnership in completing watershed restoration activities, and through this partnership more work is accomplished by sharing funding and resources in our effort. The Nez Perce Tribe began watershed restoration projects within the Newsome Creek watershed of the South Fork Clearwater River in 1997. Progress has been made in restoring the watershed through road decommissioning and culvert replacement. Starting in FY 2001 and continuing into the present, a major stream restoration effort on the mainstem of Newsome Creek has been pursued. From completing a watershed assessment to a feasibility study of 4 miles of mainstem rehabilitation to carrying that forward into NEPA and a final design, we will begin the effort of restoring the mainstem channel of Newsome Creek to provide spawning and rearing habitat for anadromous and resident fish species. Roads have been surveyed and prioritized for removal or improvement as well as culverts being prioritized for replacement to accommodate fish passage throughout the watershed.

Bransford, Stephanie [Nez Perce Tribe Fisheries/Watershed Program



Alturas Lake Creek Flow Augmentation, 1986 Final Report.  

DOE Green Energy (OSTI)

Two alternatives were outlined in the first statement of work as possibilities for flow augmentation in Alturas Lake Creek. The alternatives were to raise the level of Alturas Lake and to acquire necessary water rights in Alturas Lake Creek. The first alternative considered in the study was raising the water level at Alturas Lake with a low head dam. Raising Alturas Lake, appeared feasible in that it provided the necessary fish flows in Alturas Lake Creek. However, raising the level of Alturas Lake has adverse effects to other resources and forced pursuing the second alternative as defined in this report. Some of these effects included: flooding Smokey Bear boat ramp, inundation of recreation beaches for extended periods, flooding of the campground and some of the road system, potentially contaminating the quality of lake water from flooded toilet vaults, and destroying the conifer canopy around the lake. Maintenance and operation costs of the dam, along with the need to have a watermaster to distribute flows over the course of the irrigation season, raised additional concerns that detracted from this alternative. The second alternative considered was the acquisition of water rights. This led to an appraisal of the water right values which was completed by BPA with a comparison appraisal done by the Forest Service.

Andrews, John; Lloyd, John; Webster, Bert (Sawtooth National Forest, Twin Falls, ID)



Microsoft Word - ProvisionsFundsColvilleConfederatedTribesPurchaseLoupLoupCreekAeneasCreekProperties_CX.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7, 2011 7, 2011 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Dave Roberts Project Manager - KEWU-4 Proposed Action: Provisions of funds to the Colville Confederated Tribes for purchase of the Loup Loup Creek and Aeneas Creek properties. Fish and Wildlife Project No.: 2008-104-00 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.25 Transfer, lease, disposition or acquisition of interests in uncontaminated land for habitat preservation or wildlife management, and only associated buildings that support these purposes. Uncontaminated means that there would be no potential for release of substances at a level, or in a form, that would pose a threat to public health or the environment.


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


Isotopic Analysis At Separation Creek Area (Van Soest, Et Al., 2002) | Open  

Open Energy Info (EERE)

Isotopic Analysis At Separation Creek Area (Van Soest, Et Al., 2002) Isotopic Analysis At Separation Creek Area (Van Soest, Et Al., 2002) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Isotopic Analysis- Fluid At Separation Creek Area (Van Soest, Et Al., 2002) Exploration Activity Details Location Separation Creek Area Exploration Technique Isotopic Analysis- Fluid Activity Date Usefulness useful DOE-funding Unknown References M. C. van Soest, B. M. Kennedy, W. C. Evans, R. H. Mariner (2002) Mantle Helium And Carbon Isotopes In Separation Creek Geothermal Springs, Three Sisters Area, Central Oregon- Evidence For Renewed Volcanic Activity Or A Long Term Steady State System(Question) Retrieved from "http://en.openei.org/w/index.php?title=Isotopic_Analysis_At_Separation_Creek_Area_(Van_Soest,_Et_Al.,_2002)&oldid=687475"


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



Baxter Creek Gateway Park: assessment of an urban stream restoration project  

E-Print Network (OSTI)

Restoration Project: Maintenance and Management Guide. Citythe Baxter Creek Maintenance and Management Guide and thatEOA, 2005), Maintenance & Management Guide (El Cerrito,

Goodman, Judd; Lunde, Kevin B; Zaro, Theresa



DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


The air assault expeditionary force (AAEF) experiment: examining the impact of technology on battle command using live, virtual and constructive simulation  

Science Conference Proceedings (OSTI)

The AAEF Campaign of Discovery Experiments is the principal series of prototype discovery experiments conducted within the US Army. The campaign was originally approved for four annual excursions, 2004--2007, but has been tentatively extended through ... Keywords: air assault expeditionary force (AAEF), army test and evaluation command (ATEC), constructive, live, soldier battle laboratory (SBL), spiral C, virtual

Robert M. Lehnherr; Steven E. Strukel



Habitat Evaluation Procedures (HEP) Report; Carey Creek, Technical Report 2005.  

DOE Green Energy (OSTI)

In August 2002, the Habitat Evaluation Procedure (HEP) was used to determine baseline habitat suitability on the Carey Creek property, an acquisition completed by the Kalispel Tribe of Indians in December 2001. Evaluation species and appropriate models include bald eagle, black-capped chickadee, Canada goose, mallard, yellow warbler, and white-tailed deer. Habitat Suitability Index (HSI) values were visually estimated and agreed upon by all HEP team members. The Carey Creek Project provides a total of 172.95 Habitat Units (HUs) for the species evaluated. Conifer forest habitat provides 4.91 HUs for bald eagle, black-capped chickadee, and white-tailed deer. Forested wetlands provide 52.68 HUs for bald eagle, black-capped chickadee, mallard, and white-tailed deer. Scrub-shrub wetlands provide 2.82 HUs for mallard, yellow warbler and white-tailed deer. Wet meadow and grassland meadow provide 98.13 HUs for mallard and Canada goose. Emergent wetlands provide 11.53 HUs for mallard, muskrat, and Canada goose. Open water provides 2.88 HUs for Canada goose, mallard, and muskrat. The objective of using HEP at the Carey Creek Project and other protected properties is to document the quality and quantity of available habitat for selected wildlife species. In this way, HEP provides information on the relative value of the same area at future points in time so that the effect of management activities on wildlife habitat can be quantified. When combined with other tools, the baseline HEP will be used to determine the most effective on-site management, restoration, and enhancement actions to increase habitat suitability for targeted species. The same process will be replicated every five years to quantitatively evaluate the effectiveness of management strategies in improving and maintaining habitat conditions while providing additional crediting to BPA for enhanced habitat values.

Entz, Ray



Ice Climbing in Clear Creek Canyon A climbing trip report by Glenn Murray  

E-Print Network (OSTI)

Ice Climbing in Clear Creek Canyon A climbing trip report by Glenn Murray SUMMARY: I climb ice in to ask about local climbing. The guys there told me there was ice nearby, in Clear Creek Canyon. I. Four pitches? Five? It was time to find a partner. The only ice climber I knew in Denver was a friend


Life Cycle Management Plan for Main Generator and Exciter at Wolf Creek Generating Station: Generic Version  

Science Conference Proceedings (OSTI)

As the electric power industry becomes more competitive, life cycle management (LCM) of systems, structures, and components (SSCs) becomes more important to keep nuclear power plants economically viable throughout their remaining licensed operating terms, whether 40 or 60 years. This report provides Wolf Creek Nuclear Operating Corp. with an optimized LCM plan for the main generators and exciters at Wolf Creek Power Plant.



DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


Exploration Of The Upper Hot Creek Ranch Geothermal Resource, Nye County,  

Open Energy Info (EERE)

Of The Upper Hot Creek Ranch Geothermal Resource, Nye County, Of The Upper Hot Creek Ranch Geothermal Resource, Nye County, Nevada Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Report: Exploration Of The Upper Hot Creek Ranch Geothermal Resource, Nye County, Nevada Details Activities (2) Areas (1) Regions (0) Abstract: The Upper Hot Creek Ranch (UHCR) geothermal system had seen no significant exploration activity prior to initiation of this GRED III project. Geochemical geothermometers calculated from previously available but questionable quality analyses of the UHCR hot spring waters indicated possible subsurface temperatures of +320 oF. A complex Quaternary and Holocene faulting pattern associated with a six mile step over of the Hot Creek Range near the UHCR also indicated that this area was worthy of some


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Owl Creek Hot Springs Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » Owl Creek Hot Springs Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Owl Creek Hot Springs Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (0) 10 References Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"300px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.3439,"lon":-114.4631,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Vegetation survey of Pen Branch and Four Mile Creek wetlands  

SciTech Connect

One hundred-fifty plots were recently sampled (vegetational sampling study) at the Savannah River Site (SRS). An extensive characterization of the vascular flora, in four predetermined strata (overstory, Understory, shrub layer, and ground cover), was undertaken to determine dominance, co-dominance, and the importance value (I.V.) of each species. These results will be used by the Savannah River Laboratory (SRL) to evaluate the environmental status of Four Mile Creek, Pen Branch, and two upland pine stands. Objectives of this study were to: Describe in detail the plant communities previously mapped with reference to the topography and drainage, including species of plants present: Examine the successional trends within each sampling area and describe the extent to which current vegetation communities have resulted from specific earlier vegetation disturbances (e.g., logging and grazing); describe in detail the botanical field techniques used to sample the flora; describe the habitat and location of protected and/or rare species of plants; and collect and prepare plant species as herbarium quality specimens. Sampling was conducted at Four Mile Creek and Pen Branch, and in two upland pine plantations of different age growth.

Not Available



Vegetation survey of Pen Branch and Four Mile Creek wetlands  

Science Conference Proceedings (OSTI)

One hundred-fifty plots were recently sampled (vegetational sampling study) at the Savannah River Site (SRS). An extensive characterization of the vascular flora, in four predetermined strata (overstory, Understory, shrub layer, and ground cover), was undertaken to determine dominance, co-dominance, and the importance value (I.V.) of each species. These results will be used by the Savannah River Laboratory (SRL) to evaluate the environmental status of Four Mile Creek, Pen Branch, and two upland pine stands. Objectives of this study were to: Describe in detail the plant communities previously mapped with reference to the topography and drainage, including species of plants present: Examine the successional trends within each sampling area and describe the extent to which current vegetation communities have resulted from specific earlier vegetation disturbances (e.g., logging and grazing); describe in detail the botanical field techniques used to sample the flora; describe the habitat and location of protected and/or rare species of plants; and collect and prepare plant species as herbarium quality specimens. Sampling was conducted at Four Mile Creek and Pen Branch, and in two upland pine plantations of different age growth.

Not Available



Asotin Creek Model Watershed Plan: Asotin County, Washington, 1995.  

DOE Green Energy (OSTI)

The Northwest Power Planning Council completed its ``Strategy for Salmon'' in 1992. This is a plan, composed of four specific elements,designed to double the present production of 2.5 million salmon in the Columbia River watershed. These elements have been called the ``four H's'': (1) improve harvest management; (2) improve hatcheries and their production practices; (3) improve survival at hydroelectric dams; and (4) improve and protect fish habitat. The Asotin Creek Model Watershed Plan is the first to be developed in Washington State which is specifically concerned with habitat protection and restoration for salmon and trout. The plan is consistent with the habitat element of the ``Strategy for Salmon''. Asotin Creek is similar in many ways to other salmon-bearing streams in the Snake River system. Its watershed has been significantly impacted by human activities and catastrophic natural events, such as floods and droughts. It supports only remnant salmon and trout populations compared to earlier years. It will require protection and restoration of its fish habitat and riparian corridor in order to increase its salmonid productivity.

Browne, Dave



Stream sediment detailed geochemical survey for Date Creek Basin, Arizona  

SciTech Connect

Results of the Date Creek Basin detailed geochemical survey are reported. Field and laboratory data are reported for 239 stream sediment samples. Statistical and areal distributions of uranium and possible uranium-related variables are displayed. A generalized geologic map of the area is provided, and pertinent geologic factors which may be of significance in evaluating the potential for uranium mineralization are briefly discussed. Based on stream sediment geochemical data, significant concentrations of uranium are restricted to the Anderson Mine area. The 84th percentile concentrations of U-FL, U-NT, and U-FL/U-NT combined with low thorium/U-NT values reflect increased mobility and enrichment of uranium in the carbonate host rocks of that area. Elements characteristically associated with the uranium mineralization include lithium and arsenic. No well defined diffusion halos suggesting outliers of similar uranium mineralization were observed from the stream sediment data in other areas of the Date Creek Basin. Significant concentrations of U-FL or U-NT found outside the mine area are generally coincident with low U-FL/U-NT values and high concentrations of zirconium, titanium, and phosphorus. This suggests that the uranium is related to a resistate mineral assemblage derived from surrounding crystalline igneous and metamorphic rocks.

Butz, T.R.; Tieman, D.J.; Grimes, J.G.; Bard, C.S.; Helgerson, R.N.; Pritz, P.M.



Kerr-McGee launches talent at House Creek flood  

Science Conference Proceedings (OSTI)

Kerr-McGee Corp. gets tertiary status on potassium hydroxide treatment augmenting the polymer flood of House Creek Sussex Unit. Kerr-McGee took over the House Creek flood project when it bought some $65.6 million in Powder River Basin properties from Sonat Exploration Co. of Birmingham, Alabama. Those Campbell and Converse county properties included some 75,000 net acres of leases and approximately 11 MMboe in developed and undeveloped reserves. At first, Kerr-McGee planned to go ahead with Sonat's 3-to-1 line drive pattern for its flood, but further study persuaded the company to go to a 1-to-1 pattern. The original 3-to-1 pattern had three rows of producers for one row of injectors. The 1-to-1 pattern has one row of producers for one row of injectors. Even though it's technically a polymer flood, the project qualifies for tertiary recovery status because of the potassium hydroxide (KOH) treatment used to stabilize clays in the touchy Sussex Formation.

Lyle, D.



Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Water Conservation Study for Manastash Creek Water Users, Kittias County, Washington, Final Report 2002.  

DOE Green Energy (OSTI)

Manastash Creek is tributary of the Yakima River and is located southwest and across the Yakima River from the City of Ellensburg. The creek drains mountainous terrain that ranges in elevation from 2,000 feet to over 5,500 feet and is primarily snowmelt fed, with largest flows occurring in spring and early summer. The creek flows through a narrow canyon until reaching a large, open plain that slopes gently toward the Yakima River and enters the main stem of the Yakima River at river mile 154.5. This area, formed by the alluvial fan of the Creek as it leaves the canyon, is the subject of this study. The area is presently dominated by irrigated agriculture, but development pressures are evident as Ellensburg grows and develops as an urban center. Since the mid to late nineteenth century when irrigated agriculture was established in a significant manner in the Yakima River Basin, Manastash Creek has been used to supply irrigation water for farming in the area. Adjudicated water rights dating back to 1871 for 4,465 acres adjacent to Manastash Creek allow appropriation of up to 26,273 acre-feet of creek water for agricultural irrigation and stock water. The diversion of water from Manastash Creek for irrigation has created two main problems for fisheries. They are low flows or dewatered reaches of Manastash Creek and fish passage barriers at the irrigation diversion dams. The primary goal of this study, as expressed by Yakama Nation and BPA, is to reestablish safe access in tributaries of the Yakima River by removing physical barriers and unscreened diversions and by adding instream flow where needed for fisheries. The goal expressed by irrigators who would be affected by these projects is to support sustainable and profitable agricultural use of land that currently uses Manastash Creek water for irrigation. This study provides preliminary costs and recommendations for a range of alternative projects that will partially or fully meet the goal of establishing safe access for fisheries in Manastash Creek by reducing or eliminating diversions and eliminating fish passage barriers. Further study and design will be necessary to more fully develop the alternatives, evaluate their environmental benefits and impacts and determine the effect on Manastash Creek water users. Those studies will be needed to determine which alternative has the best combination of benefits and costs, and meets the goal of the Manastash Creek water users.

Montgomery Watson Harza (Firm)



Campbell Creek Research Homes FY 2012 Annual Performance Report  

Science Conference Proceedings (OSTI)

The Campbell Creek project is funded and managed by the Tennessee Valley Authority (TVA) Technology Innovation, Energy Efficiency, Power Delivery & and Utilization Office. Technical support is provided under contract by the Oak Ridge National Laboratory (ORNL) and the Electric Power Research Institute.The project was designed to determine the relative energy efficiency of typical new home construction, energy efficiency retrofitting of existing homes, and high -performance new homes built from the ground up for energy efficiency. This project will compare three houses that represented the current construction practice as a base case (Builder House CC1); a modified house that could represent a major energy- efficient retrofit (Retrofit House CC2); and a house constructed from the ground up to be a high- performance home (High Performance House CC3). In order tTo enablehave a valid comparison, it was necessary to simulate occupancy in all three houses and heavily monitor the structural components and the energy usage by component. All three houses are two story, slab on grade, framed construction. CC1 and CC2 are approximately 2,400 square feet2. CC3 has a pantry option, that is primarily used as a mechanical equipment room, that adds approximately 100 square feet2. All three houses are all-electric (with the exception of a gas log fireplace that is not used during the testing), and use air-source heat pumps for heating and cooling. The three homes are located in Knoxville in the Campbell Creek Subdivision. CC1 and CC2 are next door to each other and CC3 is across the street and a couple of houses down. The energy data collected will be used to determine the benefits of retrofit packages and high -performance new home packages. There are over 300 channels of continuous energy performance and thermal comfort data collection in the houses (100 for each house). The data will also be used to evaluate the impact of energy -efficient upgrades ton the envelope, mechanical equipment, or demand -response options. Each retrofit will be evaluated incrementally, by both short -term measurements and computer modeling, using a calibrated model. This report is intended to document the comprehensive testing, data analysis, research, and findings within the January 2011 through October 2012 timeframe at the Campbell Creek research houses. The following sections will provide an in-depth assessment of the technology progression in each of the three research houses. A detailed assessment and evaluation of the energy performance of technologies tested will also be provided. Finally, lessons learned and concluding remarks will be highlighted.

Gehl, Anthony C [ORNL; Munk, Jeffrey D [ORNL; Jackson, Roderick K [ORNL; Boudreaux, Philip R [ORNL; Khowailed, Gannate A [ORNL



Fish Passage Assessment: Big Canyon Creek Watershed, Technical Report 2004.  

DOE Green Energy (OSTI)

This report presents the results of the fish passage assessment as outlined as part of the Protect and Restore the Big Canyon Creek Watershed project as detailed in the CY2003 Statement of Work (SOW). As part of the Northwest Power Planning Council's Columbia Basin Fish and Wildlife Program (FWP), this project is one of Bonneville Power Administration's (BPA) many efforts at off-site mitigation for damage to salmon and steelhead runs, their migration, and wildlife habitat caused by the construction and operation of federal hydroelectric dams on the Columbia River and its tributaries. The proposed restoration activities within the Big Canyon Creek watershed follow the watershed restoration approach mandated by the Fisheries and Watershed Program. Nez Perce Tribal Fisheries/Watershed Program vision focuses on protecting, restoring, and enhancing watersheds and treaty resources within the ceded territory of the Nez Perce Tribe under the Treaty of 1855 with the United States Federal Government. The program uses a holistic approach, which encompasses entire watersheds, ridge top to ridge top, emphasizing all cultural aspects. We strive toward maximizing historic ecosystem productive health, for the restoration of anadromous and resident fish populations. The Nez Perce Tribal Fisheries/Watershed Program (NPTFWP) sponsors the Protect and Restore the Big Canyon Creek Watershed project. The NPTFWP has the authority to allocate funds under the provisions set forth in their contract with BPA. In the state of Idaho vast numbers of relatively small obstructions, such as road culverts, block thousands of miles of habitat suitable for a variety of fish species. To date, most agencies and land managers have not had sufficient, quantifiable data to adequately address these barrier sites. The ultimate objective of this comprehensive inventory and assessment was to identify all barrier crossings within the watershed. The barriers were then prioritized according to the amount of habitat blocked at each site and the fish life history stages impacted. This assessment protocol will hopefully prove useful to other agencies and become a model for use in other watersheds.

Christian, Richard



Johnson Creek Artificial Propagation and Enhancement Project Operations and Maintenance Program; Brood Year 1998: Johnson Creek Chinook Salmon Supplementation, Biennial Report 1998-2000.  

DOE Green Energy (OSTI)

The Nez Perce Tribe, through funding provided by the Bonneville Power Administration, has implemented a small scale chinook salmon supplementation program on Johnson Creek, a tributary in the South Fork of the Salmon River, Idaho. The Johnson Creek Artificial Propagation Enhancement project was established to enhance the number of threatened Snake River summer chinook salmon (Oncorhynchus tshawytscha) returning to Johnson Creek through artificial propagation. Adult chinook salmon collection and spawning began in 1998. A total of 114 fish were collected from Johnson Creek and 54 fish (20 males and 34 females) were retained for Broodstock. All broodstock were transported to Lower Snake River Compensation Plan's South Fork Salmon River adult holding and spawning facility, operated by the Idaho Department of Fish and Game. The remaining 60 fish were released to spawn naturally. An estimated 155,870 eggs from Johnson Creek chinook spawned at the South Fork Salmon River facility were transported to the McCall Fish Hatchery for rearing. Average fecundity for Johnson Creek females was 4,871. Approximately 20,500 eggs from females with high levels of Bacterial Kidney Disease were culled. This, combined with green-egg to eyed-egg survival of 62%, resulted in about 84,000 eyed eggs produced in 1998. Resulting juveniles were reared indoors at the McCall Fish Hatchery in 1999. All of these fish were marked with Coded Wire Tags and Visual Implant Elastomer tags and 8,043 were also PIT tagged. A total of 78,950 smolts were transported from the McCall Fish Hatchery and released directly into Johnson Creek on March 27, 28, 29, and 30, 2000.

Daniel, Mitch; Gebhards, John



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Couse/Tenmile Creeks Watershed Project Implementation : 2007 Conservtion Projects. [2007 Habitat Projects Completed].  

DOE Green Energy (OSTI)

The Asotin County Conservation District (ACCD) is the primary entity coordinating habitat projects on private lands within Asotin County watersheds. The Tenmile Creek watershed is a 42 square mile tributary to the Snake River, located between Asotin Creek and the Grande Ronde River. Couse Creek watershed is a 24 square mile tributary to the Snake River, located between Tenmile Creek and the Grande Ronde River. Both watersheds are almost exclusively under private ownership. The Washington Department of Fish and Wildlife has documented wild steelhead and rainbow/redband trout spawning and rearing in Tenmile Creek and Couse Creek. The project also provides Best Management Practice (BMP) implementation throughout Asotin County, but the primary focus is for the Couse and Tenmile Creek watersheds. The ACCD has been working with landowners, Bonneville Power Administration (BPA), Washington State Conservation Commission (WCC), Natural Resource Conservation Service (NRCS), Farm Service Agency (FSA), Salmon Recovery Funding Board (SRFB), Washington Department of Fish and Wildlife (WDFW), U.S. Forest Service, Pomeroy Ranger District (USFS), Nez Perce Tribe (NPT), Washington Department of Ecology (DOE), National Marine Fisheries Service (NOAA Fisheries), and U.S. Fish and Wildlife Service (USFWS) to address habitat projects in Asotin County. The Asotin Subbasin Plan identified priority areas and actions for ESA listed streams within Asotin County. Couse Creek and Tenmile Creek are identified as protection areas in the plan. The Conservation Reserve Enhancement Program (CREP) has been successful in working with landowners to protect riparian areas throughout Asotin County. Funding from BPA and other agencies has also been instrumental in protecting streams throughout Asotin County by utilizing the ridge top to ridge top approach.

Asotin County Conservation District



Microsoft Word - MissionCreek_Kingston_Acquisition_CX_final.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

purchase purchase of the Mission Creek Property. Fish and Wildlife Project No.: 2002-003-00, Contract # BPA-44646 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.25 Transfer, lease, disposition or acquisition of interests in uncontaminated land for habitat preservation or wildlife management, and only associated buildings that support these purposes. Uncontaminated means that there would be no potential for release of substances at a level, or in a form, that would pose a threat to public health or the environment. Location: Township 19 North, Range 21 West, Section 33 of the Dixon Quad, in Lake County, Montana Proposed by: Bonneville Power Administration (BPA) and CSKT Description of the Proposed Action: BPA proposes to fund the acquisition of 12 acres of property

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Foote Creek Rim II Wind Farm | Open Energy Information  

Open Energy Info (EERE)

II Wind Farm II Wind Farm Facility Foote Creek Rim II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Caithness Developer SeaWest Energy Purchaser Bonneville Power Admin Location Carbon County WY Coordinates 41.663881°, -106.186001° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.663881,"lon":-106.186001,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Microsoft Word - CX_PistolCreek_Final.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

25, 2011 25, 2011 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Cecilia Brown Project Manager - KEWM-4 Proposed Action: Provision of funds to the Confederated Salish and Kootenai Tribes for purchase of the Pistol Creek Property. Fish and Wildlife Project No.: 2002-003-00 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.25 Transfer, lease, disposition or acquisition of interests in uncontaminated land for habitat preservation or wildlife management, and only associated buildings that support these purposes. Uncontaminated means that there would be no potential for release of substances at a level, or in a form, that would pose a threat to public health or the environment. Location: Township 17 North, Range 18 West, Sections 30 and 31, Lake County, MT.


Town of Black Creek, North Carolina (Utility Company) | Open Energy  

Open Energy Info (EERE)

North Carolina (Utility Company) North Carolina (Utility Company) Jump to: navigation, search Name Town of Black Creek Place North Carolina Utility Id 202 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png EP-I Renewable Energy Industrial Industrial GS3 Electric GS4 Gov Office GS5 Commercial/Demand Commercial GS5 Commercial/Demand(with Renewable Portfolio Standards) Commercial RS 1 Residential Residential RS 1 Residential(with Renewable Portfolio Standards) Residential


Microsoft Word - CX_ThorneCreek_Final.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 1 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Cecilia Brown Project Manager - KEWM-4 Proposed Action: Provision of funds to the Confederated Salish and Kootenai Tribes for purchase of the Thorne Creek Property. Fish and Wildlife Project No.: 2002-003-00, Contract CR-201269 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.25 Transfer, lease, disposition or acquisition of interests in uncontaminated land for habitat preservation or wildlife management, and only associated buildings that support these purposes. Uncontaminated means that there would be no potential for release of substances at a level, or in a form, that would pose a threat to public health or the environment.


Crane Creek known geothermal resource area: an environmental analysis  

DOE Green Energy (OSTI)

The Crane Creek known geothermal resource area (KGRA) is located in Washington County, in southwestern Idaho. Estimated hydrothermal resource temperatures for the region are 166/sup 0/C (Na-K-Ca) and 176/sup 0/C (quartz). The KGRA is situated along the west side of the north-south trending western Idaho Fault Zone. Historic seismicity data for the region identify earthquake activity within 50 km. The hot springs surface along the margin of a siliceous sinter terrace or in adjacent sediments. Approximately 75% of the KGRA is underlain by shallow, stony soils on steep slopes indicating topographic and drainage limitations to geothermal development. Species of concern include sage grouse, antelope, and mule deer. There is a high probability of finding significant prehistoric cultural resources within the proposed area of development.

Spencer, S.G.; Russell, B.F. (eds.)



Protect and Restore Mill Creek Watershed : Annual Report CY 2005.  

DOE Green Energy (OSTI)

The Nez Perce Tribe Department of Fisheries Resource Management, Watershed Division approaches watershed restoration with a ridge-top to ridge-top approach. The Nez Perce Tribe and the Nez Perce National Forest (NPNF) have formed a partnership in completing watershed restoration activities, and through this partnership, more work is accomplished by sharing funding and resources in our effort. The Nez Perce Tribe began watershed restoration projects within the Mill Creek watershed of the South Fork Clearwater River in 2000. Progress has been made in restoring the watershed through excluding cattle from critical riparian areas through fencing. Starting in FY 2002, continuing into 2004, trees were planted in riparian areas in the meadow of the upper watershed. In addition, a complete inventory of culverts at road-stream crossings was completed. Culverts have been prioritized for replacement to accommodate fish passage throughout the watershed, and one high priority culvert was replaced in 2004. Maintenance to the previously built fence was also completed.

McRoberts, Heidi



Castle Creek known geothermal resource area: an environmental analysis  

DOE Green Energy (OSTI)

The Castle Creek known geothermal resource area (KGRA) is part of the large Bruneau-Grand View thermal anomaly in southwestern Idaho. The KGRA is located in the driest area of Idaho and annual precipitation averages 230 mm. The potential of subsidence and slope failure is high in sediments of the Glenns Ferry Formation and Idaho Group found in the KGRA. A major concern is the potential impact of geothermal development on the Snake River Birds of Prey Natural Area which overlaps the KGRA. Any significant economic growth in Owyhee County may strain the ability of the limited health facilities in the county. The Idaho Archaeological survey has located 46 archaeological sites within the KGRA.

Spencer, S.G.; Russell, B.F. (eds.)



Foote Creek Rim IV Wind Farm | Open Energy Information  

Open Energy Info (EERE)

IV Wind Farm IV Wind Farm Facility Foote Creek Rim IV Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Caithness Developer SeaWest Energy Purchaser Bonneville Power Admin Location Carbon County WY Coordinates 41.626456°, -106.202095° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.626456,"lon":-106.202095,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Foote Creek Rim III Wind Farm | Open Energy Information  

Open Energy Info (EERE)

III Wind Farm III Wind Farm Facility Foote Creek Rim III Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Caithness Developer SeaWestM&N Wind Power Energy Purchaser Xcel Energy Location Carbon County WY Coordinates 41.643488°, -106.198876° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.643488,"lon":-106.198876,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Microsoft Word - CX_Beaver Creek.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Clearance Memorandum Clearance Memorandum Jay Marcotte Project Manager - KEWU-4 Proposed Action: Bonneville Power Administration (BPA) funding to acquire the Beaver Creek property and to maintain this property for fish and wildlife habitat protection. Budget Information: Work Order # 00225478 Fish and Wildlife Project No.: 2009-003-00, 43451 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.25 Transfer, lease, disposition or acquisition of interests in uncontaminated land for habitat preservation or wildlife management, and only associated buildings that support these purposes. Uncontaminated means that there would be no potential for release of substances at a level, or in a form, that would pose a threat to public health or the environment.


Brood Year 2004: Johnson Creek Chinook Salmon Supplementation Report, June 2004 through March 2006.  

DOE Green Energy (OSTI)

The Nez Perce Tribe, through funding provided by the Bonneville Power Administration, has implemented a small scale chinook salmon supplementation program on Johnson Creek, a tributary in the South Fork of the Salmon River, Idaho. The Johnson Creek Artificial Propagation Enhancement project was established to enhance the number of threatened Snake River spring/summer chinook salmon (Oncorhynchus tshawytscha) returning to Johnson Creek to spawn through artificial propagation. This was the sixth season of adult chinook broodstock collection in Johnson Creek following collections in 1998, 2000, 2001, 2002, and 2003. Weir installation was completed on June 21, 2004 with the first chinook captured on June 22, 2004 and the last fish captured on September 6, 2004. The weir was removed on September 18, 2004. A total of 338 adult chinook, including jacks, were captured during the season. Of these, 211 were of natural origin, 111 were hatchery origin Johnson Creek supplementation fish, and 16 were adipose fin clipped fish from other hatchery operations and therefore strays into Johnson Creek. Over the course of the run, 57 natural origin Johnson Creek adult chinook were retained for broodstock, transported to the South Fork Salmon River adult holding and spawning facility and held until spawned. The remaining natural origin Johnson Creek fish along with all the Johnson Creek supplementation fish were released upstream of the weir to spawn naturally. Twenty-seven Johnson Creek females were artificially spawned with 25 Johnson Creek males. Four females were diagnosed with high bacterial kidney disease levels resulting in their eggs being culled. The 27 females produced 116,598 green eggs, 16,531 green eggs were culled, with an average eye-up rate of 90.6% resulting in 90,647 eyed eggs. Juvenile fish were reared indoors at the McCall Fish Hatchery until November 2005 and then transferred to the outdoor rearing facilities during the Visual Implant Elastomer tagging operation. These fish continued rearing in the outdoor collection basin until release in March 2006. All of these fish were marked with Coded Wire Tags and Visual Implant Elastomer tags. In addition 12,056 of the smolts released were also tagged with Passive Integrated Transponder tags. Hand counts provided by marking crews were used to amend the number of juvenile salmon released from the original egg count. A total of 90,450 smolts were released directly into Johnson Creek on March 13 through 15, 2006.

Gebhards, John S.; Hill, Robert; Daniel, Mitch [Nez Perce Tribe



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Biomonitoring of fish communities, using the Index of Biotic Integrity (IBI) in Rabbit Creek-Cat Creek Watershed, Summer 1992  

SciTech Connect

The Index of Biotic Integrity (IBI) is a method for evaluating the health of water bodies and watersheds by analyzing sample catches of fishes. Sites are scored on a numerical scale of 12--60 and on that basis assigned to a ``bioclass`` ranging from ``very poor`` to ``excellent.`` Overall, the major causes of depressed IBI scores in the Rabbit Creek watershed would appear to be: Organic pollution, mostly from livestock, but also from agricultural runoff and possible septic tank failures; sedimentation, principally from stream bank damage by cattle, also possibly from agriculture and construction; toxic pollution from agrochemicals applied to Holly Springs Golf course and agricultural fields` and Warming of water and evaporation loss due to elimination of shade on stream banks and construction of ponds.



Geothermometry At Upper Hot Creek Ranch Area (Benoit & Blackwell, 2006) |  

Open Energy Info (EERE)

Geothermometry At Upper Hot Creek Ranch Area (Benoit & Blackwell, 2006) Geothermometry At Upper Hot Creek Ranch Area (Benoit & Blackwell, 2006) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Upper Hot Creek Ranch Area (Benoit & Blackwell, 2006) Exploration Activity Details Location Upper Hot Creek Ranch Area Exploration Technique Geothermometry Activity Date Usefulness useful DOE-funding Unknown Notes Ten water samples were collected for chemical analysis and interpretation. Analyses of three samples of the UHCR thermal give predicted subsurface temperatures ranging from 317 to 334 oF from the Na-K-Ca, silica (quartz), and Na-Li geothermometers. The fact that all three thermometers closely agree gives the predictions added credibility. References Dick Benoit, David Blackwell (2006) Exploration Of The Upper Hot


DOE - Office of Legacy Management -- Dow Chemical Co - Walnut Creek - CA 02  

Office of Legacy Management (LM)

Dow Chemical Co - Walnut Creek - CA Dow Chemical Co - Walnut Creek - CA 02 FUSRAP Considered Sites Site: Dow Chemical Co. - Walnut Creek (CA.02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 2800 Mitchell Drive , Walnut Creek , California CA.02-1 Evaluation Year: 1987 CA.02-2 CA.02-3 Site Operations: From 1947 to 1957, conducted process studies and experimental investigations on different uranium and thorium-bearing ores; pilot-scale solvent extraction of uranium from phosphoric acid; liquid waste disposal studies CA.02-1 CA.02-4 CA.02-5 Site Disposition: Eliminated - Radiation levels below criteria CA.02-6 CA.02-7 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium, Thorium CA.02-1 CA.02-4


Horse Creek Hot Spring Pool & Spa Low Temperature Geothermal Facility |  

Open Energy Info (EERE)

Horse Creek Hot Spring Pool & Spa Low Temperature Geothermal Facility Horse Creek Hot Spring Pool & Spa Low Temperature Geothermal Facility Jump to: navigation, search Name Horse Creek Hot Spring Pool & Spa Low Temperature Geothermal Facility Facility Horse Creek Hot Spring Sector Geothermal energy Type Pool and Spa Location North Fork, Idaho Coordinates Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Cement Creek Ranch Pool & Spa Low Temperature Geothermal Facility | Open  

Open Energy Info (EERE)

Cement Creek Ranch Pool & Spa Low Temperature Geothermal Facility Cement Creek Ranch Pool & Spa Low Temperature Geothermal Facility Jump to: navigation, search Name Cement Creek Ranch Pool & Spa Low Temperature Geothermal Facility Facility Cement Creek Ranch Sector Geothermal energy Type Pool and Spa Location Crested Butte, Colorado Coordinates 38.8697146°, -106.9878231° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Thermal Gradient Holes At Upper Hot Creek Ranch Area (Benoit & Blackwell,  

Open Energy Info (EERE)

Hot Creek Ranch Area (Benoit & Blackwell, Hot Creek Ranch Area (Benoit & Blackwell, 2006) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Thermal Gradient Holes At Upper Hot Creek Ranch Area (Benoit & Blackwell, 2006) Exploration Activity Details Location Upper Hot Creek Ranch Area Exploration Technique Thermal Gradient Holes Activity Date Usefulness not useful DOE-funding Unknown Notes Ten temperature gradient holes up to 500' deep were initially planned but higher than anticipated drilling and permitting costs within a fixed budget reduced the number of holes to five. Four of the five holes drilled to depths of 300 to 400' encountered temperatures close to the expected regional thermal background conditions. These four holes failed to find any evidence of a large thermal anomaly surrounding the UHCR hot springs. The


Simulation of Tracer Concentration Data in the Brush Creek Drainage Flow Using an Integrated Puff Model  

Science Conference Proceedings (OSTI)

During the 1984 ASCOT field study in Brush Creek Valley, two perfluorocarbon tracers were released into the nocturnal drainage flow at two different heights. The resulting surface concentrations were sampled at 90 sites, and vertical ...

K. Shankar Rao; Richard M. Eckman; Rayford P. Hosker Jr.



Observations of Nighttime Winds Using Pilot Balloons in Anderson Creek Valley, Geysers, California  

Science Conference Proceedings (OSTI)

Nighttime drainage or downslope winds along the east-facing slope of Anderson Creek Valley located in the Geysers area of northern California are examined using pilot balloons as air parcel tracers. Observations made over four nights show a ...

Carmen J. Nappo; Howell F. Snodgrass


Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EA-1895: Lolo Creek Permanent Weir Construction near town of Weippe,  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5: Lolo Creek Permanent Weir Construction near town of 5: Lolo Creek Permanent Weir Construction near town of Weippe, Clearwater County, Idaho EA-1895: Lolo Creek Permanent Weir Construction near town of Weippe, Clearwater County, Idaho Summary DOE's Bonneville Power Administration is preparing this EA to evaluate the potential environmental impacts of replacing an existing seasonal fish weir with a permanent weir, which would be used to monitor federally-listed Snake River steelhead and collect spring Chinook salmon adults to support ongoing supplementation programs in the watershed. The Bureau of Land Management, a cooperating agency, preliminarily determined Lolo Creek to be suitable for Congressional designation into the Wild and Scenic River System. The EA includes a Wild and Scenic River Section 7 analysis.


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



EA 1714: Final Environmental Assessment | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EA 1714: Final Environmental Assessment EA 1714: Final Environmental Assessment EA 1714: Final Environmental Assessment Toda America, Incorporated Electric Drive Vehicle Battery and Component Manufacturing Initiative Project Battle Creek, MI The U.S. Department of Energy (DOE) proposes, through a cooperative agreement with Toda America, Incorporated (Toda) to partially fund the construction of a manufacturing plant to produce oxide materials for cathodes for lithium-ion batteries. The plant would be constructed within an existing industrial park in Battle Creek, Michigan. This plant would support the anticipated growth in the lithium-ion battery industry and, more specifically, the electric drive vehicle (EDV) industry and hybrid-electric vehicle (HEV) industry. If approved, DOE would provide



Office of Legacy Management (LM)

_. _. ..' 'October Behnke Warehbusing'Incorporated t d:~x~rM:lt~,~fo~:~~~r Corp.1 P. '0. Box 2102 8.. # c 'Battle Creek, MI 49016' 7, ' 1994 I .;I", m,y +I\. ~' , I,' . I I~' _ 'SUBJECT: RADIOLOGICAL SURVEY.INSPECTION (REPORT'NO. 99%90003/94056) 'Dear, Mr.. Behnke: This refers'to~'the special inspection,'conducted by Messrs. William Snell and i Mike Kurth on September 26; 1994, of the facility formerly occupied.by the: Oliver Corporation, located at 433 East Michigan Avenue, Battle Creek, Michigan. Licensed activities were previously-authbrized,by Atomic Energy Commission (AEC,) Source Material License Nos. SNM-591, SUB-579 and C-3725. The,preliminary results of our inspection findings were discussed with you just before the conclusion of thelinspection on September 26, 1994.


Willow Creek Wildlife Mitigation Project. Final Environmental Assessment.  

DOE Green Energy (OSTI)

Today`s notice announces BPA`s proposal to fund land acquisition or acquisition of a conservation easement and a wildlife management plan to protect and enhance wildlife habitat at the Willow Creek Natural Area in Eugene, Oregon. This action would provide partial mitigation for wildlife and wildlife habitat lost by the development of Federal hydroelectric projects in the Willamette River Basin. The project is consistent with BPA`s obligations under provisions of the Pacific Northwest Electric Power Planning and Conservation Act of 1980 as outlined by the Northwest Power Planning Council`s 1994 Columbia River Basin Fish and Wildlife Program. BPA has prepared an environmental assessment (DOE/EA-1023) evaluating the proposed project. Based on the analysis in the EA, BPA has determined that the proposed action is not a major Federal action significantly affecting the quality of the human environment, within the meaning of the National Environmental Policy Act (NEPA) of 1969. Therefore, the preparation of an environmental impact statement (EIS) is not required and BPA is issuing this FONSI.




West Foster Creek Expansion Project 2007 HEP Report.  

DOE Green Energy (OSTI)

During April and May 2007, the Columbia Basin Fish and Wildlife Authority's (CBFWA) Regional HEP Team (RHT) conducted baseline Habitat Evaluation Procedures (HEP) (USFWS 1980, 1980a) analyses on five parcels collectively designated the West Foster Creek Expansion Project (3,756.48 acres). The purpose of the HEP analyses was to document extant habitat conditions and to determine how many baseline/protection habitat units (HUs) to credit Bonneville Power Administration (BPA) for funding maintenance and enhancement activities on project lands as partial mitigation for habitat losses associated with construction of Grand Coulee and Chief Joseph Dams. HEP evaluation models included mule deer (Odocoileus hemionus), western meadowlark (Sturnella neglecta), sharp-tailed grouse, (Tympanuchus phasianellus), Bobcat (Lynx rufus), mink (Neovison vison), mallard (Anas platyrhynchos), and black-capped chickadee (Parus atricapillus). Combined 2007 baseline HEP results show that 4,946.44 habitat units were generated on 3,756.48 acres (1.32 HUs per acre). HEP results/habitat conditions were generally similar for like cover types at all sites. Unlike crediting of habitat units (HUs) on other WDFW owned lands, Bonneville Power Administration received full credit for HUs generated on these sites.

Ashley, Paul R.



Blue Creek Winter Range : Wildlife Mitigation Project : Final Environmental Assessment.  

DOE Green Energy (OSTI)

Bonneville Power Administration (BPA) proposes to fund that portion of the Washington Wildlife Agreement pertaining to the Blue Creek Winter Range Wildlife Mitigation Project (Project) in a cooperative effort with the Spokane Tribe, Upper Columbia United Tribes, and the Bureau of Indian Affairs (BIA). If fully implemented, the proposed action would allow the sponsors to protect and enhance 2,631 habitat units of big game winter range and riparian shrub habitat on 2,185 hectares (5,400 acres) of Spokane Tribal trust lands, and to conduct long term wildlife management activities within the Spokane Indian Reservation project area. This Final Environmental Assessment (EA) examines the potential environmental effects of securing land and conducting wildlife habitat enhancement and long term management activities within the boundaries of the Spokane Indian Reservation. Four proposed activities (habitat protection, habitat enhancement, operation and maintenance, and monitoring and evaluation) are analyzed. The proposed action is intended to meet the need for mitigation of wildlife and wildlife habitat adversely affected by the construction of Grand Coulee Dam and its reservoir.

United States. Bonneville Power Administration; United States. Bureau of Indian Affairs; Spokane Tribe of the Spokane Reservation, Washington



Vermont Marble Company, Proctor, Vermont: Otter Creek hydroelectric feasibility report  

DOE Green Energy (OSTI)

Vermont Marble Company (VMCO) owns and operates four hydroelectric projects in a 50-mile reach of Otter Creek in west central Vermont. This study concerns three of the installations - Center Rutland, Beldens, and Huntington Falls. The fourth site is known as Proctor and will be studied separately. All four plants operate as run-of-river stations, and the limited reservoir storage capacity places severe limitations on any other type of operation. The plants are presently operating at much lower outputs than can be obtained, because they do not use the available discharge and head. The results show that, under the assumptions made in this study, Beldens and Huntington Falls can be economically improved. The rehabilitation of the Center Rutland plant did not look economically attractive. However, the improvement of Center Rutland should not be eliminated from further consideration, because it could become economically attractive if the cost of energy starts escalating at a rate of around 10% per year. The study included a brief appraisal of the existing generating facilities and condition of existing concrete structures, a geological reconnaissance of the sites, analysis of the power potential, flood studies, technical and economic investigations and comparative evaluations of the alternatives for developing the streamflow for power generation, selection of the most suitable alternative, financial analysis, preparation of drawings, and preparation of detailed quantity and cost estimates.




Mitigation of light rail transit construction on jurisdictional areas in the White Rock Creek floodplain, Dallas, Texas  

E-Print Network (OSTI)

and consulting in Dallas, Texas. In this capacity, Ms.WHITE ROCK CREEK FLOODPLAIN, DALLAS, TEXAS Emily Schieffer (Boulevard, Suite 510, Dallas, Texas 75207, Phone: 214-741-

Schieffer, Emily; Smiley, Jerry



Evaluation of the Bell Creek Field micellar-polymer pilot  

SciTech Connect

A review of the performance of the Gary Energy Corporation micellar-polymer pilot in the Bell Creek Field has been completed. The ultimate recovery beyond waterflooding is projected to be 27,000 barrels of oil, compared to an anticipated level of 90,000 barrels from simulation studies. The projected incremental recovery is subject to uncertainties since significant secondary oil was being produced at the initiation of chemical injection. The predicted recovery from simulation studies is considered to be optimistic, principally because the displaceable oil saturations were assumed too high. Although the anticipated recovery may have been optimistic, it is clear that the level of increased oil recovery has been disappointing and that the economics of a project if expanded would be unfavorable. Several possible explanations are cited for the less-than-expected oil recovery: (1) there is evidence that a permeability barrier exists in the southeast quadrant of the pilot, which would have caused injected fluids in that quadrant to have flowed out of the pattern area. A pressure pulse test appeared to confirm the existence of the flow barrier, but the available data from two tracer surveys were inconclusive; (2) the equivalent weight of the injected sulfonate may have been too low, based upon the appearance of sulfonate in produced waters before incremental oil was recovered. This could have occurred since the lower equivalent weight fractions are highly water soluble and have low adsorption rates; and (3) the salinity of water injected with the chemical slug may have been too low to achieve the low interfacial tensions needed for efficient oil displacement. 16 figures, 8 tables.

Fanchi, J.R.; Dauben, D.L.



The Sugar Creek zinc deposit, Jackson Co. TN -- Exploration history, geology and mineralization  

SciTech Connect

During the 60's and 70's zinc exploration of central TN and KY was active. The Sugar Creek Project was one of several investigated by Exxon. The discovery hole, Cu 15, was drilled in early 1973. The Sugar Creek Zinc Deposit was acquired by Independence Mining Co. in 1986 and I.M.C. has subsequently completed additional drilling, both stepout and confirmation holes. A total of 137 holes for 300,833 ft have been drilled. The Sugar Creek deposit is a typical Tennessee zinc deposit (Mississippi Valley Type) which occurs in solution collapse breccias in the Lower Ordovician, Knox Dolomite. The Knox consists of fine grained dolomite with interlayered limestones and crystalline dolomite. Only scattered residual limestone is found in the Sugar Creek area. Collapse breccias have formed which control zinc deposition and are similar to other TN Zn. deposits. At Sugar Creek the types of breccias include: a vertically exaggerated glory hole breakthrough breccia which extends to within 137 ft. of the Knox unconformity, has 500 ft. of zinc mineralization with 8 significant zinc intervals; holes with stacked zinc intervals interpreted to be sides of breakthrough breccia; and single zinc intervals in laterally positioned bedded mineral zones. A total of 99 holes were drilled in the more intense mineralized areas. The ratio of ore to non ore holes is nearly 1 to 1. The mineralization is typical M.V.T. with predominantly sphalerite and only minor occurrences of galena, fluorite, pyrite, etc.

Reinbold, G.; Moran, A.V.; Stevens, D.L. (Independence Mining Co. Inc., Reno, NV (United States))



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Johnson Creek Artificial Propagation and Enhancement Project Operations and Maintenance Program; Brood Year 2000: Johnson Creek Chinook Salmon Supplementation, Biennial Report 2000-2002.  

DOE Green Energy (OSTI)

The Nez Perce Tribe, through funding provided by the Bonneville Power Administration, has implemented a small scale chinook salmon supplementation program on Johnson Creek, a tributary in the South Fork of the Salmon River, Idaho. The Johnson Creek Artificial Propagation Enhancement project was established to enhance the number of threatened Snake River summer chinook salmon (Oncorhynchus tshawytscha) returning to Johnson Creek through artificial propagation. Adult chinook salmon trapping, broodstock selection, and spawning was first implemented in 1998, did not occur in 1999, and was resumed in 2000. A total of 152 salmon were trapped in Johnson Creek in 2000, of which 73 (25 males, 16 females, and 32 jacks) fish were transported to Idaho Fish and Game=s South Fork Salmon River adult holding and spawning facility for artificial propagation purposes. The remaining 79 (29 males, 16 females, and 24 jacks) fish were released above the weir to spawn naturally. A total of 65,060 green eggs were taken from 16 female salmon and transported to the McCall Fish Hatchery for incubation and rearing. Egg counts indicated an average eye-up rate of 86.0% for 55,971 eyed eggs. Average fecundity for Johnson Creek females was 4,066 eggs per female. Juvenile fish were reared indoors at the McCall Fish Hatchery through November 2001. These fish were transferred to outdoor rearing facilities in December 2001 where they remained until release in March 2002. All of these fish were marked with Coded Wire Tags and Visual Implant Elastomer tags. In addition 9,987 were also PIT tagged. Hand counts provided by marking crews were used to amend the number of juvenile salmon released from the original egg count. A total of 57,392 smolts were released into a temporary acclimation channel in Johnson Creek on March 18, 19, 20, 2002. These fish were held in this facility until a fish screen was removed on March 22, 2002 and the fish were allowed to emigrate.

Daniel, Mitch; Gebhards, John; Hill, Robert



Granite Creek Hot Spring Pool & Spa Low Temperature Geothermal Facility |  

Open Energy Info (EERE)

Granite Creek Hot Spring Pool & Spa Low Temperature Geothermal Facility Granite Creek Hot Spring Pool & Spa Low Temperature Geothermal Facility Facility Granite Creek Hot Spring Sector Geothermal energy Type Pool and Spa Location Teton County, Wyoming Coordinates 43.853632°, -110.6314491° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


EA-1957: Cabin Creek Biomass Facility, Place County, CA | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7: Cabin Creek Biomass Facility, Place County, CA 7: Cabin Creek Biomass Facility, Place County, CA EA-1957: Cabin Creek Biomass Facility, Place County, CA SUMMARY DOE is proposing to provide funding to Placer County, California to construct and operate a two-megawatt wood-to-energy biomass facility at the Eastern Regional Materials Recovery Facility (MRF) and Landfill in unincorporated Placer County. The wood-to-energy biomass facility would use a gasification technology. The fuel supply for the proposed project would be solely woody biomass, derived from a variety of sources including hazardous fuels residuals, forest thinning and harvest residuals, and Wildland Urban Interface sourced waste materials from residential and commercial property defensible space clearing and property management activities


Furnace Creek Ranch Pool & Spa Low Temperature Geothermal Facility | Open  

Open Energy Info (EERE)

Furnace Creek Ranch Pool & Spa Low Temperature Geothermal Facility Furnace Creek Ranch Pool & Spa Low Temperature Geothermal Facility Facility Furnace Creek Ranch Sector Geothermal energy Type Pool and Spa Location Death Valley, California Coordinates Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Asotin Creek ISCO Water Sample Data Summary: Water Year 2002, Annual Report 2001-2002.  

DOE Green Energy (OSTI)

The Pomeroy Ranger District operates 3 automated water samplers (ISCOs) in the Asotin Creek drainage in cooperation with the Asotin Model Watershed. The samplers are located on Asotin Creek: Asotin Creek at the mouth, Asotin Creek at Koch site, and South Fork Asotin Creek above the forks. At the end of Water Year (WY) 2001 we decided to sample from Oct. 1 through June 30 of each water year. This decision was based on the difficulty of obtaining good low flow samples, since the shallow depth of water often meant that instrument intakes were on the bed of the river and samples were contaminated with bed sediments. The greatest portion of suspended sediment is transported during the higher flows of fall and especially during the spring snow runoff period, and sampling the shorter season should allow characterization of the sediment load of the river. The ISCO water samplers collected a daily composite sample of 4 samples per day into one bottle at 6-hour intervals until late March when they were reprogrammed to collect 3 samples per day at 8-hour intervals. This was done to reduce battery use since battery failure had become an ongoing problem. The water is picked up on 24-day cycles and brought to the Forest Service Water Lab in Pendleton, OR. The samples are analyzed for total suspended solids (TSS), conductivity, and turbidity. A total dissolved solids value is estimated based on conductivity. The USGS gage, Asotin Creek at the mouth, No.13335050 has been discontinued and there are no discharge records available for this period.

Peterson, Stacia



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


BPA Riparian Fencing and Alternative Water Development Projects Completed within Asotin Creek Watershed, 2000 and 2001 Asotin Creek Fencing Final Report of Accomplishments.  

DOE Green Energy (OSTI)

The Asotin County Conservation District (ACCD) is the primary entity coordinating habitat projects on both private and public lands within the Asotin Creek watershed. The watershed covers approximately 325 square miles in the Blue Mountains of southeastern Washington in Water Resource Inventory Area (WRIA) 35. According to Washington Department of Fish and Wildlife's (WDFW) Priority WRIA's by ''At-Risk Stock Significance Map'', it is the highest priority WRIA in southeastern Washington. Summer steelhead, bull trout, and Snake River spring chinook salmon which are listed under the Endangered Species Act (ESA), are present in the watershed. WDFW manages it as a Wild Steelhead Reserve; no hatchery fish have been released here since 1997. The ACCD has been working with landowners, Bonneville Power Administration (BPA), Washington State Conservation Commission (WCC), Natural Resource Conservation Service (NRCS), Washington Department of Fish and Wildlife (WDFW), U.S. Forest Service, Pomeroy Ranger District (USFS), Nez Perce Tribe, Washington Department of Ecology (DOE), National Marine Fisheries Service (NMFS), and U.S. Fish and Wildlife Service (USFWS) to address habitat projects in Asotin County. Local students, volunteers and Salmon Corps members from the Nez Perce Tribe have been instrumental in the success of the Model Watershed Program on Asotin Creek. ACCD began coordinating habitat projects in 1995 with the help of BPA funding. Approximately two hundred and seventy-six projects have been implemented as of 1999. The Washington State Legislature was successful in securing funding for endangered salmon and steelhead recovery throughout the State in 1998. While these issues were new to most of the State, the ACCD has been securing and administering funding for endangered salmonids since 1994. The ''Asotin Creek Riparian Planting 2000-053-00 and Asotin Creek Riparian Fencing 2000-054-00'' teamed BPA and the Governor's Salmon Recovery Funding to plant approximately 84,191 trees and shrubs in the Asotin Creek Watershed. In addition BPA and private cost-share dollars were utilized to drill 3 wells, provide 15 off-site alternative water developments (troughs), 5 spring developments, and 9,100 feet of riparian fencing. The trees will provide shade and long-term LWD recruitment to the stream. The wells, alternative water developments, springs and fencing will reduce direct animal impacts on the stream. In one area alone, a well, 3,000 ft of riparian fence with 5 alternative water developments will exclude 300 head of cattle from using the stream as a source of drinking water during the winter months.

Johnson, B.J. (Bradley J.)



Site-wide remedial alternative development in Bear Creek Valley, Oak Ridge Reservation  

SciTech Connect

This paper presents a case study of an environmental restoration project at a major mixed waste site that poses unique challenges to remediation efforts. Bear Creek Valley is located immediately west of the Y-12 Plant on the Oak Ridge Reservation (ORR) in Oak Ridge, Tennessee. The Y-12 Plant was built in 1943 as part of the Manhattan Project, with its original mission being electromagnetic separation of uranium. Since being completed, the Y-12 Plant has also been used for chemical processing of uranium and lithium compounds as well as precision fabrication of components containing these and other materials. Wastes containing radionuclides, metals, chlorinated solvents, oils, coolants, polychlorinated biphenyis (PCBs), and others were disposed of in large quantities at Bear Creek Valley as a result of manufacturing operations at the Y-12 Plant. The Bear Creek Valley feasibility study is using innovative strategies to efficiently and thoroughly consider the information available regarding Bear Creek Valley and process options that could be combined into its remedial alternatives.

Anderson, M. [Jacobs Engineering Group, Inc., Oak Ridge, TN (United States)



Evaluation of additional data from Bell Creek micellar pilot indicates greater success  

SciTech Connect

In the Oil and Gas Journal, March 14, 1983, a summary was presented of a performance evaluation of the Bell Creek micellar-polymer pilot project. The project review had been funded and published by DOE, Keplinger, and Associates made the project review.

Holm, L.W.




U.S. Energy Information Administration (EIA) Indexed Site




E-Print Network (OSTI)

c:es .B~l:JJ:. }eti. ',~, Colorado School of Mines, VoL 2'1,v Piceance Creek Basin v Colorado r and 9 p' 1974. Pc:u:~tBetween 'che White and Colorado Rivers, '! \\lo:ci:hwegt:ern

Mehran, M.



DOE/EA-1967: Hills Creek-Lookout Point Transmission Line Rebuild, Lane County, Oregon  

Energy.gov (U.S. Department of Energy (DOE))

Bonneville Power Administration is preparing an EA to assess potential environmental impacts of the proposed rebuild of its 26-mile 115 kilovolt (kV) wood-pole Hills Creek-Lookout Point transmission line, which is generally located between Lowell and Oakridge, in Lane County, Oregon.


Pataha Creek Model Watershed : January 2000-December 2002 Habitat Conservation Projects.  

Science Conference Proceedings (OSTI)

The projects outlined in detail on the attached project reports were implemented from calendar year 2000 through 2002 in the Pataha Creek Watershed. The Pataha Creek Watershed was selected in 1993, along with the Tucannon and Asotin Creeks, as model watersheds by NPPC. In previous years, demonstration sites using riparian fencing, off site watering facilities, tree and shrub plantings and upland conservation practices were used for information and education and were the main focus of the implementation phase of the watershed plan. These practices were the main focus of the watershed plan to reduce the majority of the sediment entering the stream. Prior to 2000, several bank stabilization projects were installed but the installation costs became prohibitive and these types of projects were reduced in numbers over the following years. The years 2000 through 2002 were years where a focused effort was made to work on the upland conservation practices to reduce the sedimentation into Pataha Creek. Over 95% of the sediment entering the stream can be tied directly to the upland and riparian areas of the watershed. The Pataha Creek has steelhead in the upper reaches and native and planted rainbow trout in the mid to upper portion. Suckers, pikeminow and shiners inhabit the lower portion because of the higher water temperatures and lack of vegetation. The improvement of riparian habitat will improve habitat for the desired fish species. The lower portion of the Pataha Creek could eventually develop into spawning and rearing habitat for chinook salmon if some migration barriers are removed and habitat is restored. The upland projects completed during 2000 through 2002 were practices that reduce erosion from the cropland. Three-year continuous no-till projects were finishing up and the monitoring of this particular practice is ongoing. Its direct impact on soil erosion along with the economical aspects is being studied. Other practices such as terrace, waterway, sediment basin construction and the installation of strip systems are also taking place. The years 2000 through 2002 were productive years for the Pataha Creek Model Watershed but due to the fact that most of the cooperators in the watershed have reached their limitation allowed for no-till and direct seed/ two pass of 3 years with each practice, the cost share for these practices is lower than the years of the late 90's. All the upland practices that were implemented have helped to further reduce erosion from the cropland. This has resulted in a reduction of sedimentation into the spawning and rearing area of the fall chinook salmon located in the lower portion of the Tucannon River. The tree planting projects have helped in reducing sedimentation and have also improved the riparian zone of desired locations inside the Pataha Creek Watershed. The CREP (Conservation Reserve Enhancement Program) along with the CCRP (Continuous Conservation Reserve Program) are becoming more prevalent in the watershed and are protecting the riparian areas along the Pataha Creek at an increasing level every year. Currently roughly 197 acres of riparian has been enrolled along the Pataha Creek in the CREP program.

Bartels, Duane G.



Resource appraisal of three rich oil-shale zones in the Green River Formation, Piceance Creek Basin, Colorado  

SciTech Connect

The main oil-shale-bearing member of the Eocene Green River Formation, the Parachute Creek Member, contains several distinct rich oil-shale zones that underlie large areas of Piceance Creek Basin in NW. Colorado. Three of these have been selected for an oil-shale resource-appraisal study. Two over-lie and one underlies the main saline zone in the Parachute Creek Member. The uppermost of these zones, the Mahogany Zone, is in the upper third of the Parachute Creek Member/ it ranges in thickness from less than 75 to more than 225 ft and is the most persistent oil- shale unit in the Green River Formation underlying an area of more than 1,200 sq miles in the Piceance Creek Basin. The second rich zone is separated from the Mahogany Zone by a variable thickness of sandstone, siltstone, or low- grade oil shale. This zone attains a maximum thickness of more than 250 ft and underlies an area of more than 700 sq miles. The third rich oil-shale zone is in the lower third of the Parachute Creek Member. It underlies an area of about 300 sq miles near the depositional center of the Piceance Creek Basin and attains a thickness of more than 150 ft. The 3 rich oil-shale zones have total resources of 317 billion bbl of oil in the areas appraised.

Donnell, J.R.; Blair, R.W. Jr.



Salmon Supplementation Studies in Idaho Rivers; Field Activities Conducted on Clear and Pete King Creeks, 2001 Annual Report.  

DOE Green Energy (OSTI)

In 2001 the Idaho Fisheries Resource Office continued as a cooperator on the Salmon Supplementation Studies in Idaho Rivers (ISS) project on Pete King and Clear creeks. Data relating to supplementation treatment releases, juvenile sampling, juvenile PIT tagging, brood stock spawning and rearing, spawning ground surveys, and snorkel surveys were used to evaluate project data points and augment past data. Due to low adult spring Chinook returns to Kooskia National Fish Hatchery (KNFH) in brood year 1999 there was no smolt supplementation treatment release into Clear Creek in 2001. A 17,014 spring Chinook parr supplementation treatment (containing 1000 PIT tags) was released into Pete King Creek on July 24, 2001. On Clear Creek, there were 412 naturally produced spring Chinook parr PIT tagged and released. Using juvenile collection methods, Idaho Fisheries Resource Office staff PIT tagged and released 320 naturally produced spring Chinook pre-smolts on Clear Creek, and 16 natural pre-smolts on Pete King Creek, for minimum survival estimates to Lower Granite Dam. There were no PIT tag detections of brood year 1999 smolts from Clear or Pete King creeks. A total of 2261 adult spring Chinook were collected at KNFH. Forty-three females were used for supplementation brood stock, and 45 supplementation (ventral fin-clip), and 45 natural (unmarked) adults were released upstream of KNFH to spawn naturally. Spatial and temporal distribution of 37 adults released above the KNFH weir was determined through the use of radio telemetry. On Clear Creek, a total of 166 redds (8.2 redds/km) were observed and data was collected from 195 carcasses. Seventeen completed redds (2.1 redds/km) were found, and data was collected data from six carcasses on Pete King Creek.

Gass, Carrie; Olson, Jim M. (US Fish and Wildlife Service, idaho Fishery Resource Office, Ahsahka, ID)



DOE/EA-1544: Environmental Assessment for the Proposed Anadarko/Veritas Salt Creek 3D Vibroseis Project (June 2005)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

___________________________ ___________________________ Salt Creek 3D Vibroseis Project Environmental Assessment BLM Casper Field Office June 2005 Page 1 ENVIRONMENTAL ASSESSMENT FOR THE PROPOSED ANADARKO / VERITAS SALT CREEK 3D VIBROSEIS PROJECT DOE EA No. EA-1544 BLM Case No. WYW-163071 BLM EA No. WY- 060-EA05-95 WOGCC Permit No. 025-05-015G _________________________________________________________________________________________________ Salt Creek 3D Vibroseis Project Environmental Assessment BLM Casper Field Office June 2005 Page 2 TABLE OF CONTENTS 1.0 PURPOSE AND NEED 1.1 Introduction 3 1.2 Purpose and need for action 3 1.3 Conformance with land use plan 3 1.4 Relationship to statutes, regulations, 4


Civil Works Fact Sheets  

E-Print Network (OSTI)

HAMILTON DAM, FLINT RIVER, FLINT, MI ............................................ LRD-19 HOLES CREEK, WEST

US Army Corps of Engineers


Sensitivity of Orographic Moist Convection to Landscape Variability: A Study of the Buffalo Creek, Colorado, Flash Flood Case of 1996  

Science Conference Proceedings (OSTI)

A number of numerical experiments with a high-resolution mesoscale model were conducted to study the convective rainfall event that caused the 1996 Buffalo Creek, Colorado, flash flood. Different surface conditions and treatments of land surface ...

Fei Chen; Thomas T. Warner; Kevin Manning



A protocol for evaluating thermal performance of 14 solar steam generators for the Kogan Creek solar boost project.  

E-Print Network (OSTI)

??The Kogan Creek Solar Boost is a world-first commercial project that sees AREVA Solar designing, supplying and constructing CLFR-based solar steam generators for CS Energy, (more)

Watson, Bond



Categorization of Nocturnal Drainage Flows within the Brush Creek Valley and the Variability of Sigma Theta in Complex Terrain  

Science Conference Proceedings (OSTI)

The monthly frequencies of nocturnal drainage flows in the Brush Creek Valley were estimated over the period August 1982January 1985 for the purpose of evaluating the representativeness of the drainage flows observed during a few intensive study ...

Paul H. Gudiksen



Development of a Nested Grid, Second Moment Turbulence Closure Model and Application to the 1982 ASCOT Brush Creek Data Simulation  

Science Conference Proceedings (OSTI)

An improved, second-moment turbulence-closure model and a random particle kernel diffusion model are described and tested with the 1982 ASCOT (Atmospheric Studies in Complex Terrain) data collected in Brush Creek, Colorado. Three improvements of ...

T. Yamada; S. Bunker



miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Categorical Exclusion (CX) Determination Proposed Action: Expansion of O'Fallon Creek Substation Yard  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Expansion of O'Fallon Creek Substation Yard Expansion of O'Fallon Creek Substation Yard Description of Proposed Action: The Western Area Power Administration (Western) is proposing to expand the current yard to accommodate an additional bay for a dedicated electrical feed to a future oil pumping station that will be part of the Keystone XL project. Number and Title of Categorical Exclusions Being Applied: 10 CFR 10210410 Subpmi D, Appendix B, B4.11: Construction of electric power substations ... or modification of existing substations and support facilities. Regulatory Requirements for CX Determination: The DOE Guidelines for Compliance with the Regulatory Requirements for the National Environmental Policy Act at 10 CFR 1021AI0(b), require the following determinations be made in order for a proposed action to be categorically


Microsoft Word - CX-SpringCreek-WineCountry-TowerRelocationFY13_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

November 29, 2012 November 29, 2012 REPLY TO ATTN OF: KEPR-4 SUBJECT: Environmental Clearance Memorandum Justin Estes Project Manager - TELM-TPP-3 Proposed Action: Spring Creek - Wine County No. 1 Transmission Tower Relocation Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B4.6 Additions and modifications to transmission facilities Location: Multnomah County, OR Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA is proposing to relocate one transmission tower, located on private agricultural land, which has been damaged by farm equipment. Currently, tower 29/3 on BPA's Spring Creek - Wine Country No. 1 transmission line, resides on an agricultural access road that is bordered on both sides by active agricultural fields. This

Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - Spring Creek Final Draft CX 7-15-2013.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6, 2013 6, 2013 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Cecilia Brown Project Manager - KEWM-4 Proposed Action: Spring Creek Property funding Fish and Wildlife Project No. and Contract No.: 2002-003-00, BPA-007168 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.25 Real property transfers for cultural resources protection, habitat preservation, and wildlife management Location: Township 17 North, Range 20 West, Section 26, Lake County, MT Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA proposes to fund the Salish and Kootenai Tribes for the purchase of 10 acres of property, referred to as the Spring Creek Land Acqusition in Lake


Furnace Creek Inn Pool & Spa Low Temperature Geothermal Facility | Open  

Open Energy Info (EERE)

Inn Pool & Spa Low Temperature Geothermal Facility Inn Pool & Spa Low Temperature Geothermal Facility Jump to: navigation, search Name Furnace Creek Inn Pool & Spa Low Temperature Geothermal Facility Facility Furnace Creek Inn Sector Geothermal energy Type Pool and Spa Location Death Valley, California Coordinates Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Protect and Restore Mill Creek Watershed; Annual Report 2002-2003.  

DOE Green Energy (OSTI)

The Nez Perce Tribe Department of Fisheries Resource Management, Watershed Division approaches watershed restoration with a ridge-top to ridge-top approach. Watershed restoration projects within the Mill Creek watershed are coordinated with the Nez Perce National Forest. The Nez Perce Tribe began watershed restoration projects within the Mill Creek watershed of the South Fork Clearwater River in 2000. Progress has been made in restoring the watershed through excluding cattle from critical riparian areas through fencing. During the FY 2002, trees were planted in riparian areas in the meadow of the upper watershed. In addition, a complete inventory of culverts at road-stream crossings was completed. Culverts have been prioritized for replacement to accommodate fish passage throughout the watershed. Maintenance to the previously built fence was also completed.

McRoberts, Heidi (Nez Perce Tribe, Department of Fisheries Resource Management, Lapwai, ID)



Chinook Salmon Adult Abundance Monitoring in Lake Creek, Idaho, 2002 Annual Report.  

DOE Green Energy (OSTI)

Underwater time- lapse video technology has been used to monitor adult spring and summer chinook salmon (Oncorhynchus tshawytscha) escapement into the Secesh River and Lake Creek, Idaho, since 1998. Underwater time-lapse videography is a passive methodology that does not trap or handle this Endangered Species Act listed species. Secesh River chinook salmon represent a wild spawning aggregate that has not been directly supplemented with hatchery fish. The Secesh River is also a control stream under the Idaho Salmon Supplementation study. This project has successfully demonstrated the application of underwater video monitoring to accurately quantify chinook salmon abundance in Lake Creek in 1998, 1999, 2001 and 2002. The adult salmon spawner escapement into Lake Creek in 2002 was 410 fish. Jack salmon comprised 7.1 percent of the run. Estimated hatchery composition was 6.1 percent of the spawning run. The first fish passage on Lake Creek was recorded on June 26, 15 days after installation of the fish counting station. Peak net upstream movement of 41 adults occurred on July 8. Peak of total movement activity was August 18. The last fish passed through the Lake Creek fish counting station on September 2. Snow pack in the drainage was 91% of the average during the winter of 2001/2002. Video determined salmon spawner abundance was compared to redd count expansion method point estimates in Lake Creek in 2002. Expanded index area redd count and extensive area redd count point estimates in 2002, estimated from one percent fewer to 56 percent greater number of spawners than underwater video determined spawner abundance. Redd count expansion methods varied from two percent fewer to 55 percent greater in 2001, 11 to 46 percent fewer in 1999 and 104 to 214 percent greater in 1998. Redd count expansion values had unknown variation associated with the point estimates. Fish per redd numbers determined by video abundance and multiple pass redd counts of the larger extensive survey areas in Lake Creek have varied widely. In 2002 there were 2.05 fish per redd. There were 2.07 fish per redd in 2001, 3.58 in 1999 and in 1998, with no jacks returning to spawn, there were 1.02 fish per redd. Migrating salmon in Lake Creek exhibited two behaviorally distinct segments of fish movement in 2002. Mainly upstream only movement of both sexes characterized the first segment. The second segment consisted of upstream and downstream movement with less net upstream movement and appeared to correspond with the time of active spawning. The fish counting stations did not impede salmon movements, nor was spawning displaced downstream. Fish moved freely upstream and downstream through the fish counting structures. The downstream movement of salmon afforded by this fish counting station design may be an important factor in the reproductive success of listed salmon. This methodology provides more accurate salmon spawner abundance information than expansion of single-pass and multiple-pass redd counts. Accurate adult escapement information would allow managers to determine if recovery actions benefited listed chinook salmon in tributary streams.

Faurot, Dave; Kucera, Paul



Hot Creek Pool & Spa Low Temperature Geothermal Facility | Open Energy  

Open Energy Info (EERE)

Pool & Spa Low Temperature Geothermal Facility Pool & Spa Low Temperature Geothermal Facility Jump to: navigation, search Name Hot Creek Pool & Spa Low Temperature Geothermal Facility Facility Hot Creek Sector Geothermal energy Type Pool and Spa Location Mammoth Lakes Park Area, California Coordinates Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Microsoft Word - CX-SwanValley-Goshen_GraniteCreekBoxCulvert_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4 4 SUBJECT: Environmental Clearance Memorandum Joe Johnson Natural Resource Specialist - TFBV-Kalispell Proposed Action: Replace existing bridge with a concrete box culvert at Granite Creek along Bonneville Power Administration's (BPA) Swan Valley-Goshen 161-kV transmission line. Budget Information: Work Order # 189268-01 PP&A Project No.: PP&A 2047 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3, Routine maintenance activities for structures, rights-of-way, and infrastructures, (such as roads), that are required to maintain infrastructures in a condition suitable for a facility to be used for its designated purpose. Location: The proposed project is located on Granite Creek along BPA's Swan Valley-Goshen


Reintroduction of Lower Columbia River Chum Salmon into Duncan Creek, 2007 Annual Report.  

DOE Green Energy (OSTI)

The National Marine Fisheries Service (NMFS) listed Lower Columbia River (LCR) chum salmon as threatened under the Endangered Species Act (ESA) in March, 1999 (64 FR 14508, March 25, 1999). The listing was in response to the reduction in abundance from historical levels of more than one-half million returning adults to fewer than 10,000 present-day spawners. Harvest, habitat degradation, changes in flow regimes, riverbed movement and heavy siltation have been largely responsible for this decline. The timing of seasonal changes in river flow and water temperatures is perhaps the most critical factor in structuring the freshwater life history of this species. This is especially true of the population located directly below Bonneville Dam, where hydropower operations can block access to spawning sites, dewater redds, strand fry, cause scour or fill of redds and increase sedimentation of spawning gravels. Prior to 1997, only two chum salmon populations were recognized as genetically distinct in the Columbia River, although spawning had been documented in many Lower Columbia River tributaries. The first population was in the Grays River (RKm 34), a tributary of the Columbia River, and the second was a group of spawners utilizing the mainstem Columbia River just below Bonneville Dam (RKm 235) adjacent to Ives Island and in Hardy and Hamilton creeks. Using additional DNA samples, Small et al. (2006) grouped chum salmon spawning in the mainstem Columbia River and the Washington State tributaries into three groups: the Coastal, the Cascade and the Gorge. The Coastal group comprises those spawning in the Grays River, Skamokawa Creek and the broodstock used at the Sea Resources facility on the Chinook River. The Cascade group comprises those spawning in the Cowlitz (both summer and fall stocks), Kalama, Lewis, and East Fork Lewis rivers, with most supporting unique populations. The Gorge group comprises those spawning in the mainstem Columbia River from the I-205 Bridge up to Bonneville Dam and those spawning in Hamilton and Hardy creeks. Response to the federal ESA listing has been primarily through direct-recovery actions: reducing harvest, hatchery supplementation using local broodstock for populations at catastrophic risk, habitat restoration (including construction of spawning channels) and flow agreements to protect spawning and rearing areas. Both state and federal agencies have built controlled spawning areas. In 1998, the Washington Department of Fish and Wildlife (WDFW) began a chum salmon supplementation program using native stock on the Grays River. This program was expanded during 1999 - 2001 to include reintroduction into the Chinook River using eggs from the Grays River Supplementation Program. These eggs are incubated at the Grays River Hatchery, reared to release size at the Sea Resources Hatchery on the Chinook River, and the fry are released at the mouth of the Chinook River. Native steelhead, chum, and coho salmon are present in Duncan Creek, and are recognized as subpopulations of the Lower Gorge population, and are focal species in the Lower Columbia Fish Recovery Board (LCFRB) plan. Steelhead, chum and coho salmon that spawn in Duncan Creek are listed as Threatened under the ESA. Duncan Creek is classified by the LCFRB plan as a watershed for intensive monitoring (LCFRB 2004). This project was identified in the 2004 Federal Columbia River Power System (FCRPS) revised Biological Opinion (revised BiOp) to increase survival of chum salmon, 'BPA will continue to fund the program to re-introduce Columbia River chum salmon into Duncan Creek as long as NOAA Fisheries determines it to be an essential and effective contribution to reducing the risk of extinction for this ESU'. (USACE et al. 2004, page 85-86). The Governors Forum on Monitoring and Salmon Recovery and Watershed Health recommends one major population from each ESU have adult and juvenile monitoring. Duncan Creek chum salmon are identified in this plan to be intensively monitored. Planners recommended that a combination of natural and hatchery production

Hillson, Todd D. [Washington Department of Fish and Wildlife



Environmental assessment for the Hoe Creek underground, Coal Gasification Test Site Remediation, Campbell County, Wyoming  

SciTech Connect

The U.S. Department of Energy (DOE) has prepared this EA to assess environmental and human health Issues and to determine potential impacts associated with the proposed Hoe Creek Underground Coal Gasification Test Site Remediation that would be performed at the Hoe Creek site in Campbell County, Wyoming. The Hoe Creek site is located south-southwest of the town of Gillette, Wyoming, and encompasses 71 acres of public land under the stewardship of the Bureau of Land Management. The proposed action identified in the EA is for the DOE to perform air sparging with bioremediation at the Hoe Creek site to remove contaminants resulting from underground coal gasification (UCG) experiments performed there by the DOE in the late 1970s. The proposed action would involve drilling additional wells at two of the UCG test sites to apply oxygen or hydrogen peroxide to the subsurface to volatilize benzene dissolved in the groundwater and enhance bioremediation of non-aqueous phase liquids present in the subsurface. Other alternatives considered are site excavation to remove contaminants, continuation of the annual pump and treat actions that have been used at the site over the last ten years to limit contaminant migration, and the no action alternative. Issues examined in detail in the EA are air quality, geology, human health and safety, noise, soils, solid and hazardous waste, threatened and endangered species, vegetation, water resources, and wildlife. Details of mitigative measures that could be used to limit any detrimental effects resulting from the proposed action or any of the alternatives are discussed, and information on anticipated effects identified by other government agencies is provided.



Oak Creek Wind Power Phase 2 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Phase 2 Wind Farm Phase 2 Wind Farm Jump to: navigation, search Name Oak Creek Wind Power Phase 2 Wind Farm Facility Oak Creek Wind Power Phase 2 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Caithness Developer M&N Wind Power/Oak Creek Energy Systems Energy Purchaser Southern California Edison Co Location Tehachapi CA Coordinates 35.07665°, -118.25529° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.07665,"lon":-118.25529,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Williston basin. Milestone test renews interest in Red Wing Creek field's meteor crater  

SciTech Connect

New drilling in the vicinity of Red Wing Creek field in McKenzie County, North Dakota has renewed interest in an area that has intrigued geologists for a number of years. Red Wing Creek was discovered in 1972 by True Oil Co. and has demonstrated better per-acre oil recovery than any other oil field in the Williston Basin. Fully developed several years ago, the field produces from what has been described as the central peak of an astrobleme, within a meteor crater. The current test by Milestone Petroleum Inc. is permitted to 14,200 ft and is being drilled on the rim of the crater, in SW SW 35-148n-101w, approx. a mile south of Red Wing production. The primary objective is the Ordovician Red River; but plans call for drilling deeper, through the Winnipeg, to below the Mississippian sediments that produce at Red Wing Creek field. At least 3 unsuccessful Red River tests have been drilled in or near the field in earlier years, but not in the area where Milestone is drilling. Production at Red Wing has come from porosity zones in a Mississippian oil column that measured 2600 ft in the original well; the better wells are in the heart of the field, on a rebound cone in the center of the crater.

Rountree, R.



Habitat Projects Completed within the Asotin Creek Watershed, 1999 Completion Report.  

DOE Green Energy (OSTI)

The Asotin Creek Model Watershed Program (ACMWP) is the primary entity coordinating habitat projects on both private and public lands within the Asotin Creek watershed. The Asotin Creek watershed covers approximately 325 square miles in the Blue Mountains of southeastern Washington in WRIA 35. According to WDFW's Priority WRIA's by At-Risk Stock Significance Map, it is the highest priority in southeastern WA. Snake River spring chinook salmon, summer steelhead and bull trout, which are listed under the Endangered Species Act (ESA), are present in the watershed. The ACMWP began coordinating habitat projects in 1995. Approximately two hundred seventy-six projects have been implemented through the ACMWP as of 1999. Twenty of these projects were funded in part through Bonneville Power Administration's 1999 Columbia Basin Fish and Wildlife Program. These projects used a variety of methods to enhance and protect watershed conditions. In-stream work for fish habitat included construction of hard structures (e.g. vortex rock weirs), meander reconstruction, placement of large woody debris (LWD) and whole trees and improvements to off-channel rearing habitat; thirty-eight were created with these structures. Three miles of stream benefited from riparian improvements such as vegetative plantings (17,000 trees and shrubs) and noxious weed control. Two sediment basin constructions, 67 acres of grass seeding, and seven hundred forty-five acres of minimum till were implemented to reduce sediment production and delivery to streams in the watershed.

Johnson, Bradley J.



Habitat Projects Completed within the Asotin Creek Watershed, 1998 Completion Report.  

DOE Green Energy (OSTI)

The Asotin Creek Model Watershed Program (ACMWP) is the primary entity coordinating habitat projects on both private and public lands within the Asotin Creek watershed. The Asotin Creek watershed covers approximately 325 square miles in the Blue Mountains of southeastern Washington. Snake River spring chinook salmon, summer steelhead and bull trout, which are listed under the Endangered Species Act (ESA), are present in the watershed. The ACMWP began coordinating habitat projects in 1995. Approximately two hundred forty-six projects have been implemented through the ACMWP as of 1998. Fifty-nine of these projects were funded in part through Bonneville Power Administration's 1998 Columbia Basin Fish and Wildlife Program. These projects used a variety of methods to enhance and protect watershed conditions. In-stream work for fish habitat included construction of hard structures (e.g. vortex rock weirs), meander reconstruction, placement of large woody debris (LWD) and whole trees and improvements to off-channel rearing habitat; one hundred thirty-nine pools were created with these structures. Three miles of stream benefited from riparian improvements such as fencing, vegetative plantings, and noxious weed control. Two alternative water developments were completed, providing off-stream-watering sources for livestock. 20,500 ft of upland terrace construction, seven sediment basin construction, one hundred eighty-seven acres of grass seeding, eight hundred fifty acres of direct seeding and eighteen sediment basin cleanouts were implemented to reduce sediment production and delivery to streams in the watershed.

Johnson, Bradley J.



A fisheries evaluation of the Wapato, Sunnyside, and Toppenish Creek canal fish screening facilities, spring 1988  

DOE Green Energy (OSTI)

The Bonneville Power Administration, the United States Bureau of Reclamation, and the Washington State Department of Ecology are funding the construction and evaluation of fish passage and protection facilities at irrigation and hydroelectric diversions in the Yakima River Basin, Washington State. The programs provide offsite enhancement to compensate for fish and wildlife losses caused by hydroelectric development throughout the Columbia River Basin and address natural propagation of salmon to help mitigate the impact of irrigation in the Yakima River Basin. The Wapato, Sunnyside, and Toppenish Creek Screens are three of the facilities in the basin. This report evaluates the effectiveness of the screens in intercepting and returning juvenile salmonids unharmed to the river from which they were diverted. We evaluated the effectiveness of new screening facilities at the Toppenish Creek, Wapato, and Sunnyside canals in southcentral Washington State. Screen integrity tests indicated that fish released in front of the screens were prevented from entering the canal behind the screens. We conducted descaling tests at the Toppenish Creek Screens. We measured the time required for fish to move through the screen facilities. Methods used in 1988 were the same as those used at Sunnyside in 1985 and in subsequent years at Richland. Toppenish/Satus, and Wapato. 11 refs., 11 figs., 14 tabs.

Neitzel, D.A.; Abernethy, C.S.; Lusty, E.W.



Habitat Evaluation Procedures (HEP) Report; Calispell Creek Project, Technical Report 2004-2005.  

DOE Green Energy (OSTI)

On July 13, 2004, the Habitat Evaluation Procedure (HEP) was used to determine baseline habitat suitability on the Calispell Creek property, an acquisition completed by the Kalispel Tribe of Indians in February 2004. Evaluation species and appropriate models include Canada goose, mallard, muskrat, yellow warbler, and white-tailed deer. Habitat Suitability Index (HSI) values were visually estimated and agreed upon by all HEP team members. The Calispell Creek Project provides a total of 138.17 Habitat Units (HUs) for the species evaluated. Emergent wetland habitat provides 5.16 HUs for mallard and muskrat. Grassland provides 132.02 HUs for mallard and Canada goose. Scrub-shrub vegetation provides 0.99 HUs for yellow warbler and white-tailed deer. The objective of using HEP at the Calispell Creek Project and other protected properties is to document the quality and quantity of available habitat for selected wildlife species. In this way, HEP provides information on the relative value of the same area at future points in time so that the effect of management activities on wildlife habitat can be quantified. When combined with other tools, the baseline HEP will be used to determine the most effective on-site management, restoration, and enhancement actions to increase habitat suitability for targeted species. The same process will be replicated every five years to quantitatively evaluate the effectiveness of management strategies in improving and maintaining habitat conditions while providing additional crediting to BPA for enhanced habitat values.

Entz, Ray



Lake Roosevelt Fisheries Evaluation Program; Meadow Creek vs. Lake Whatcom Stock Kokanee Salmon Investigations in Lake Roosevelt, 2001 Annual Report.  

DOE Green Energy (OSTI)

Lake Roosevelt has been stocked with Lake Whatcom stock kokanee since 1989 with the primary objective of creating a self-sustaining recreational fishery. Due to low return numbers, it was hypothesized a stock of kokanee, native to the upper Columbia River, might perform better than the coastal Lake Whatcom strain. Kokanee from Meadow Creek, a tributary of Kootenay Lake, British Columbia were selected as an alternative stock. Matched pair releases of Lake Whatcom and Meadow Creek kokanee were made from Sherman Creek Hatchery in late June 2000 and repeated in 2001. Stock performance between Lake Whatcom and Meadow Creek kokanee was evaluated using three performance measures; (1) the number of returns to Sherman Creek, the primary egg collection facility, (2) the number of returns to other tributaries and (3) the number of returns to the creel. Kokanee were collected during five passes through the reservoir via electrofishing, which included 87 tributary mouths during the fall of 2000 and 2001. Chi-square analysis indicated age two Meadow Creek kokanee returned to Sherman Creek in significantly higher numbers when compared to the Whatcom stock in 2000 ({chi}{sup 2} = 736.6; d.f. = 1; P < 0.01) and 2001 ({chi}{sup 2} = 156.2; d.f. = 1; P < 0.01). Reservoir wide recoveries of age two kokanee had similar results in 2000 ({chi}{sup 2} = 735.3; d.f. = 1; P < 0.01) and 2001 ({chi}{sup 2} = 150.1; d.f. = 1; P < 0.01). Six Lake Whatcom and seven Meadow Creek three year olds were collected in 2001. The sample size of three year olds was too small for statistical analysis. No kokanee were collected during creel surveys in 2000, and two (age three kokanee) were collected in 2001. Neither of the hatchery kokanee collected were coded wire tagged, therefore stock could not be distinguished. After two years of monitoring, neither Meadow Creek or Lake Whatcom kokanee appear to be capable of providing a run of three-year-old spawners to sustain stocking efforts. The small number of hatchery three-year-olds collected indicated that the current stocking methods will continue to produce a limited jacking run largely composed of precocious males and a small number of three-year-olds. However, supplemental creel data indicated anglers harvested two-year-old hatchery kokanee 30-45 days after release. Supplemental creel data should continue to be collected to accurately evaluate hatchery contributions to the creel.

McLellan, Holly; Scholz, Allan



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Battle against Phonons (A "Life at the Frontiers of Energy Research" contest entry from the 2011 Energy Frontier Research Centers (EFRCs) Summit and Forum  

DOE Green Energy (OSTI)

'Battle against Phonons' was submitted by the Solid-State Solar-Thermal Energy Conversion (S3TEC) EFRC to the 'Life at the Frontiers of Energy Research' video contest at the 2011 Science for Our Nation's Energy Future: Energy Frontier Research Centers (EFRCs) Summit and Forum. Twenty-six EFRCs created short videos to highlight their mission and their work. This video was selected as one of five winners by a distinguished panel of judges for the special award, 'Best with Popcorn'. S3TEC, an EFRC directed by Gang Chen at the Massachusetts Institute of Technology is a partnership of scientists from four research institutions: MIT (lead), Oak Ridge National Laboratory, Boston College, and Rensselaer Polytechnic Institute. The Office of Basic Energy Sciences in the U.S. Department of Energy's Office of Science established the 46 Energy Frontier Research Centers (EFRCs) in 2009. These collaboratively-organized centers conduct fundamental research focused on 'grand challenges' and use-inspired 'basic research needs' recently identified in major strategic planning efforts by the scientific community. The overall purpose is to accelerate scientific progress toward meeting the nation's critical energy challenges. The mission of the Solid-State Solar Thermal Energy Conversion Center is 'to create novel, solid-state materials for the conversion of sunlight into electricity using thermal and photovoltaic processes.' Research topics are: solar photovoltaic, photonic, metamaterial, optics, solar thermal, thermoelectric, phonons, thermal conductivity, defects, ultrafast physics, interfacial characterization, matter by design, novel materials synthesis, charge transport, defect tolerant materials, and scalable processing.

Chen, Gang (Director, Solid-State Solar-Thermal Energy Conversion Center); S3TEC Staff



DOE/EIS-0265-SA-168: Supplement Analysis for the Watershed Management Program EIS - Protect and Restore Lolo Creek Watershed - Jim Brown Creek Streambank Stabilization (08/10/04)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Supplement Analysis for the Watershed Management Program EIS (DOE/EIS-0265/SA-168) Sabrina Keen Fish and Wildlife Project Manager, KEWU-4 Proposed Action: Protect and Restore Lolo Creek Watershed - Jim Brown Creek Streambank Stabilization Project No: 1996-077-02 Wildlife Management Techniques or Actions Addressed Under This Supplement Analysis (See App. A of the Wildlife Mitigation Program EIS): 1.8 Bank Protection through Vegetation Management, 1.9 Structural Bank Protection using Bioengineering Methods Location: Clearwater County, Idaho Proposed by: Bonneville Power Administration (BPA) and the Nez Perce Tribe Description of the Proposed Action: The Bonneville Power Administration, Nez Perce Tribe, and Potlatch Corporation are proposing to stabilize streambanks along Jim Brown Creek near


Sediment and radionuclide transport in rivers: radionuclide transport modeling for Cattaraugus and Buttermilk Creeks, New York  

Science Conference Proceedings (OSTI)

SERATRA, a transient, two-dimensional (laterally-averaged) computer model of sediment-contaminant transport in rivers, satisfactorily resolved the distribution of sediment and radionuclide concentrations in the Cattaraugus Creek stream system in New York. By modeling the physical processes of advection, diffusion, erosion, deposition, and bed armoring, SERATRA routed three sediment size fractions, including cohesive soils, to simulate three dynamic flow events. In conjunction with the sediment transport, SERATRA computed radionuclide levels in dissolved, suspended sediment, and bed sediment forms for four radionuclides (/sup 137/Cs, /sup 90/Sr, /sup 239/ /sup 240/Pu, and /sup 3/H). By accounting for time-dependent sediment-radionuclide interaction in the water column and bed, SERATA is a physically explicit model of radionuclide fate and migration. Sediment and radionuclide concentrations calculated by SERATA in the Cattaraugus Creek stream system are in reasonable agreement with measured values. SERATRA is in the field performance phase of an extensive testing program designed to establish the utility of the model as a site assessment tool. The model handles not only radionuclides but other contaminants such as pesticides, heavy metals and other toxic chemicals. Now that the model has been applied to four field sites, including the latest study of the Cattaraugus Creek stream system, it is recommended that a final model be validated through comparison of predicted results with field data from a carefully controlled tracer test at a field site. It is also recommended that a detailed laboratory flume be tested to study cohesive sediment transport, deposition, and erosion characteristics. The lack of current understanding of these characteristics is one of the weakest areas hindering the accurate assessment of the migration of radionuclides sorbed by fine sediments of silt and clay.

Onishi, Y.; Yabusaki, S.B.; Kincaid, C.T.; Skaggs, R.L.; Walters, W.H.



Habitat Evaluation Procedures (HEP) Report; Tacoma Creek South Project, Technical Report 2003-2005.  

DOE Green Energy (OSTI)

On July 6, 2004, the Habitat Evaluation Procedure (HEP) was used to determine baseline habitat suitability on the Tacoma Creek South property, an acquisition completed by the Kalispel Tribe of Indians in June 2004. Evaluation species and appropriate models include bald eagle, black-capped chickadee, Canada goose, mallard, muskrat, yellow warbler, and white-tailed deer. Habitat Suitability Index (HSI) values were visually estimated and agreed upon by all HEP team members. The Tacoma Creek South Project provides a total of 190.79 Habitat Units (HUs) for the species evaluated. Emergent wetlands provide 20.51 HUs for Canada goose, mallard, and muskrat. Grassland provides 1.65 HUs for Canada goose and mallard. Scrub-shrub vegetation provides 11.76 HUs for mallard, yellow warbler, and white-tailed deer. Conifer forest habitat provides 139.92 HUs for bald eagle, black-capped chickadee, and white-tailed deer. Deciduous forest also provides 19.15 HUs for bald eagle, black-capped chickadee, mallard, and white-tailed deer. The objective of using HEP at the Tacoma Creek South Project and other protected properties is to document the quality and quantity of available habitat for selected wildlife species. In this way, HEP provides information on the relative value of the same area at future points in time so that the effect of management activities on wildlife habitat can be quantified. When combined with other tools, the baseline HEP will be used to determine the most effective on-site management, restoration, and enhancement actions to increase habitat suitability for targeted species. The same process will be replicated every five years to quantitatively evaluate the effectiveness of management strategies in improving and maintaining habitat conditions while providing additional crediting to BPA for enhanced habitat values.

Entz, Ray


Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EA-1895: Lolo Creek Permanent Weir Construction near town of Weippe, Clearwater County, Idaho  

Energy.gov (U.S. Department of Energy (DOE))

DOEs Bonneville Power Administration is preparing this EA to evaluate the potential environmental impacts of replacing an existing seasonal fish weir with a permanent weir, which would be used to monitor federally-listed Snake River steelhead and collect spring Chinook salmon adults to support ongoing supplementation programs in the watershed. The Bureau of Land Management, a cooperating agency, preliminarily determined Lolo Creek to be suitable for Congressional designation into the Wild and Scenic River System. The EA includes a Wild and Scenic River Section 7 analysis.


Exploration of the Upper Hot Creek Ranch Geothermal Resource, Nye County, Nevada  

DOE Green Energy (OSTI)

The Upper Hot Creek Ranch (UHCR) geothermal system had seen no significant exploration activity prior to initiation of this GRED III project. Geochemical geothermometers calculated from previously available but questionable quality analyses of the UHCR hot spring waters indicated possible subsurface temperatures of +320 oF. A complex Quaternary and Holocene faulting pattern associated with a six mile step over of the Hot Creek Range near the UHCR also indicated that this area was worthy of some exploration activity. Permitting activities began in Dec. 2004 for the temperature-gradient holes but took much longer than expected with all drilling permits finally being received in early August 2005. The drilling and geochemical sampling occurred in August 2005. Ten temperature gradient holes up to 500 deep were initially planned but higher than anticipated drilling and permitting costs within a fixed budget reduced the number of holes to five. Four of the five holes drilled to depths of 300 to 400 encountered temperatures close to the expected regional thermal background conditions. These four holes failed to find any evidence of a large thermal anomaly surrounding the UHCR hot springs. The fifth hole, located within a narrow part of Hot Creek Canyon, encountered a maximum temperature of 81 oF at a depth of 105 but had cooler temperatures at greater depth. Temperature data from this hole can not be extrapolated to greater depths. Any thermal anomaly associated with the UHCR geothermal system is apparently confined to the immediate vicinity of Hot Creek Canyon where challenges such as topography, a wilderness study area, and wetlands issues will make further exploration time consuming and costly. Ten water samples were collected for chemical analysis and interpretation. Analyses of three samples of the UHCR thermal give predicted subsurface temperatures ranging from 317 to 334 oF from the Na-K-Ca, silica (quartz), and Na-Li geothermometers. The fact that all three thermometers closely agree gives the predictions added credibility. Unfortunately, the final result of this exploration is that a moderate temperature geothermal resource has been clearly identified but it appears to be restricted to a relatively small area that would be difficult to develop.

Dick Benoit; David Blackwell



Exploration of the Upper Hot Creek Ranch Geothermal Resource, Nye County, Nevada  

DOE Green Energy (OSTI)

The Upper Hot Creek Ranch (UHCR) geothermal system had seen no significant exploration activity prior to initiation of this GRED III project. Geochemical geothermometers calculated from previously available but questionable quality analyses of the UHCR hot spring waters indicated possible subsurface temperatures of +320 oF. A complex Quaternary and Holocene faulting pattern associated with a six mile step over of the Hot Creek Range near the UHCR also indicated that this area was worthy of some exploration activity. Permitting activities began in Dec. 2004 for the temperature-gradient holes but took much longer than expected with all drilling permits finally being received in early August 2005. The drilling and geochemical sampling occurred in August 2005. Ten temperature gradient holes up to 500 deep were initially planned but higher than anticipated drilling and permitting costs within a fixed budget reduced the number of holes to five. Four of the five holes drilled to depths of 300 to 400 encountered temperatures close to the expected regional thermal background conditions. These four holes failed to find any evidence of a large thermal anomaly surrounding the UHCR hot springs. The fifth hole, located within a narrow part of Hot Creek Canyon, encountered a maximum temperature of 81 oF at a depth of 105 but had cooler temperatures at greater depth. Temperature data from this hole can not be extrapolated to greater depths. Any thermal anomaly associated with the UHCR geothermal system is apparently confined to the immediate vicinity of Hot Creek Canyon where challenges such as topography, a wilderness study area, and wetlands issues will make further exploration time consuming and costly. Ten water samples were collected for chemical analysis and interpretation. Analyses of three samples of the UHCR thermal give predicted subsurface temperatures ranging from 317 to 334 oF from the Na-K-Ca, silica (quartz), and Na-Li geothermometers. The fact that all three thermometers closely agree gives the predictions added credibility. Unfortunately, the final result of this exploration is that a moderate temperature geothermal resource has been clearly identified but it appears to be restricted to a relatively small area that would be difficult to develop.

Dick Benoit; David Blackwell



Improvement of Anadromous Fish Habitat and Passage in Omak Creek, 2008 Annual Report : February 1, 2008 to January 31, 2009.  

DOE Green Energy (OSTI)

During the 2008 season, projects completed under BPA project 2000-100-00 included installation of riparian fencing, maintenance of existing riparian fencing, monitoring of at-risk culverts and installation of riparian vegetation along impacted sections of Omak Creek. Redd and snorkel surveys were conducted in Omak Creek to determine steelhead production. Canopy closure surveys were conducted to monitor riparian vegetation recovery after exclusion of cattle since 2000 from a study area commonly known as the Moomaw property. Additional redd and fry surveys were conducted above Mission Falls and in the lower portion of Stapaloop Creek to try and determine whether there has been successful passage at Mission Falls. Monitoring adult steelhead trying to navigate the falls resulted in the discovery of shallow pool depth at an upper pool that is preventing many fish from successfully navigating the entire falls. The Omak Creek Habitat and Passage Project has worked with NRCS to obtain additional funds to implement projects in 2009 that will address passage at Mission Falls, culvert replacement, as well as additional riparian planting. The Omak Creek Technical Advisory Group (TAG) is currently revising the Omak Creek Watershed Assessment. In addition, the group is revising strategy to focus efforts in targeted areas to provide a greater positive impact within the watershed. In 2008 the NRCS Riparian Technical Team was supposed to assess areas within the watershed that have unique problems and require special treatments to successfully resolve the issues involved. The technical team will be scheduled for 2009 to assist the TAG in developing strategies for these special areas.

Dasher, Rhonda; Fisher, Christopher [Colville Confederated Tribes




Office of Legacy Management (LM)

B I OENV I RONMENTAL FEATURES B I OENV I RONMENTAL FEATURES OF THE OGOTORUK CREEK AREA, CAPE THOMPSON, ALASKA A First Summary by The Committee on Environmental Studies for Project Chariot . . December 1960 r Division of Biology and Medicine, AEC Washington, D. C. IT U S WEGWS LIBIA3"b This page intentionally left blank NUCLEAR EXPLOSIONS -PEACE UL APPLICATIONS . . BIOLOGY AND MEDICINE BIOENVIRONMENTAL FEATURES OF THE OGOTORUK CREEK AREA . . CAPE THOMPSON, ALASKA A F i r s t Sumnary The C o d t t e e on E n v i r o n m e n t a l S t u d i e s for P r o j e c t C h a r i o t PLllWSHARE PROGRAM THE UNITED STATES ATOMIC ENERGY COMMISSION December, 1 9 6 0 MAP OF ALASKA - CHARIOT LOCATION SCALE IN MILES . 111*1.1) , FOREWORD . . This summary is based on the reports on more than 30 bioenvironmental investigations carried out' in the Cape Thompson area in Alaska since


Toms Creek integrated gasification combined cycle demonstration project. Quarterly report, July 1--September 30, 1993  

SciTech Connect

The use of an upgraded version of General Electric`s Frame 6 gas turbine, which has been designated as Frame 6 (FA) will make a significant improvement to the thermal efficiency and overall economics of the Toms Creek Project. Replacing the smaller, less efficient Frame 6 (B) gas turbine with the new Frame 6 (FA) will increase the net power production from a nominal 55 MW to 105 MW. The coal feed rate will correspondingly increase from 430 tpd to 740 tpd. All process flows and equipment sizes will be increased accordingly. Selected process parameters for the original and revised Toms Creek IGCC plant configurations are compared in Table 2. There is an approximately 10% increase in net plant efficiency for the revised configuration. Using this increased plant size, the pressure vessels become larger due to an increased through-put, but are still dimensioned for shop fabrication and over-the-road shipment. The preliminary cost estimate for the enlarged demonstration plant was prepared by factoring the estimates for the original plant. Revised quotes for the larger equipment will be solicited and used to generate more accurate cost information for the revised plant.

Feher, G.



Reedy Creek Utilities, Lake Buena Vista, Florida, solar energy system performance evaluation, December 1979-March 1980  

DOE Green Energy (OSTI)

The Reedy Creek solar system operated moderately well during the December 1979 through March 1980 heating season. The overall performance of the system was below estimated design performance but the solar system still supplied 47% of the building conditioning loads. The thermal performance is summarized. The system failed to reach design performance levels in the cooling subsystem. Since the cooling load of 40.24 million Btu was nearly three times larger than the space heating and domestic hot water loads of 14.44 million Btu, the overall system performance was significantly reduced. Although collected solar energy exceeds the system load in most months, the solar fraction is necessarily less than 100% due to the normal operating inefficiencies of pumps, heat exchanger, and particularly the absorption chiller. At Reedy Creek, excessive storage losses, presumably due to high storage temperatures, further degrade system performance. Collector array efficiency based on the total incident solar radiation was 11%. This was significantly lower than the 14% collector array efficiency for the 1979 heating season.

Logee, T.



West Foster Creek 2007 Follow-up Habitat Evaluation Procedures (HEP) Report.  

DOE Green Energy (OSTI)

A follow-up habitat evaluation procedures (HEP) analysis was conducted on the West Foster Creek (Smith acquisition) wildlife mitigation site in May 2007 to determine the number of additional habitat units to credit Bonneville Power Administration (BPA) for providing funds to enhance and maintain the project site as partial mitigation for habitat losses associated with construction of Grand Coulee Dam. The West Foster Creek 2007 follow-up HEP survey generated 2,981.96 habitat units (HU) or 1.51 HUs per acre for a 34% increase (+751.34 HUs) above baseline HU credit (the 1999 baseline HEP survey generated 2,230.62 habitat units or 1.13 HUs per acre). The 2007 follow-up HEP analysis yielded 1,380.26 sharp-tailed grouse (Tympanuchus phasianellus) habitat units, 879.40 mule deer (Odocoileus hemionus) HUs, and 722.29 western meadowlark (Sturnella neglecta) habitat units. Mule deer and sharp-tailed grouse habitat units increased by 346.42 HUs and 470.62 HUs respectively over baseline (1999) survey results due largely to cessation of livestock grazing and subsequent passive restoration. In contrast, the western meadowlark generated slightly fewer habitat units in 2007 (-67.31) than in 1999, because of increased shrub cover, which lowers habitat suitability for that species.

Ashley, Paul R.



Structural integrity analysis of the degraded drywell containment at the Oyster Creek Nuclear generating station.  

SciTech Connect

This study examines the effects of the degradation experienced in the steel drywell containment at the Oyster Creek Nuclear Generating Station. Specifically, the structural integrity of the containment shell is examined in terms of the stress limits using the ASME Boiler and Pressure Vessel (B&PV) Code, Section III, Division I, Subsection NE, and examined in terms of buckling (stability) using the ASME B&PV Code Case N-284. Degradation of the steel containment shell (drywell) at Oyster Creek was first observed during an outage in the mid-1980s. Subsequent inspections discovered reductions in the shell thickness due to corrosion throughout the containment. Specifically, significant corrosion occurred in the sandbed region of the lower sphere. Since the presence of the wet sand provided an environment which supported corrosion, a series of analyses were conducted by GE Nuclear Energy in the early 1990s. These analyses examined the effects of the degradation on the structural integrity. The current study adopts many of the same assumptions and data used in the previous GE study. However, the additional computational recourses available today enable the construction of a larger and more sophisticated structural model.

Petti, Jason P.



The Oak Ridge Y-12 Plant biological monitoring and abatement program for East Fork Poplar Creek  

SciTech Connect

In May 1985, a National Pollutant Discharge Elimination System permit was issued for the Oak Ridge Y-12 Plant, a nuclear weapons components production facility located in Oak Ridge, Tennessee, and operated by Martin Marietta Energy Systems, Inc., for the US Department of Energy. As a condition of the permit, a Biological Monitoring and Abatement Program (BMAP) was developed to demonstrate that the effluent limitations established for the Oak Ridge Y-12 Plant protect the classified uses of the receiving stream (East Fork Poplar Creek), in particular, the growth and propagation of fish and aquatic life, as designated by the Tennessee Department of Health and Environment. A second purpose for the BMAP is to document the ecological effects resulting from implementation of a water pollution control program that will include construction of nine new wastewater treatment facilities over the next 4 years. Because of the complex nature of the effluent discharged to East Fork Poplar Creek and the temporal and spatial variability in the composition of the effluent (i.e., temporal variability related to various pollution abatement measures that will be implemented over the next several years and spatial variability caused by pollutant inputs downstream of the Oak Ridge Y-12 Plant), a comprehensive, integrated approach to biological monitoring was developed for the BMAP. 39 refs., 5 figs., 8 tabs.

Loar, J.M.; Adams, S.M.; Allison, L.J.; Giddings, J.M.; McCarthy, J.F.; Southworth, G.R.; Smith, J.G.; Stewart, A.J. (Oak Ridge National Lab., TN (USA); Springborn Bionomics, Inc., Wareham, MA (USA); Oak Ridge National Lab., TN (USA))



Regulatory compliance issues related to the White Oak Creek Embayment time-critical removal action  

SciTech Connect

In September 1990, Martin Marietta Energy Systems (Energy Systems) discovered high levels of Cesium-137 ({sup 137}Cs) in surface sedimenus near the mouth of White Oak Creek Embayment (WOCE). White Oak Creek (WOC) receives surface water drainage from Oak Ridge National Laboratory. Since this discovery, the Department of Energy (DOE) and Energy Systems have pursued actions designed to stabilize the contaminated WOCE sediments under provisions of the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA), and the implementing regulations in the National Contingency Plan (NCP) (40 CFR Part 300), as a time-critical removal action. By definition, a time-critical removal is an action where onsite activities are initiated within six months of the determination that a removal action is appropriate. Time-critical removal actions allow comparatively rapid mobilization to protect human health and the environment without going through the lengthy and extensive CERCLA Remedial Investigation/Feasibility Study/Record of Decision process. Many aspects of the project, in terms of compliance with the substantive requirements of the NCP and ARARs, have exceeded the regulatory requirements, despite the fact that there is no apparent authority on conducting removal actions at Federal facilities. Much of the interpretation of the NCP was groundbreaking in nature for both EPA and DOE. 4 refs., 2 figs.

Leslie, M. (CDM Federal Programs Corp., Oak Ridge, TN (United States)); Kimmel, B.L. (Oak Ridge National Lab., TN (United States))



Restoring Anadromous Fish Habitat in Big Canyon Creek Watershed, 2004-2005 Annual Report.  

DOE Green Energy (OSTI)

The ''Restoring Anadromous Fish Habitat in the Big Canyon Creek Watershed'' is a multi-phase project to enhance steelhead trout in the Big Canyon Creek watershed by improving salmonid spawning and rearing habitat. Habitat is limited by extreme high runoff events, low summer flows, high water temperatures, poor instream cover, spawning gravel siltation, and sediment, nutrient and bacteria loading. Funded by the Bonneville Power Administration (BPA) as part of the Northwest Power Planning Council's Fish and Wildlife Program, the project assists in mitigating damage to steelhead runs caused by the Columbia River hydroelectric dams. The project is sponsored by the Nez Perce Soil and Water Conservation District. Target fish species include steelhead trout (Oncorhynchus mykiss). Steelhead trout within the Snake River Basin were listed in 1997 as threatened under the Endangered Species Act. Accomplishments for the contract period September 1, 2004 through October 31, 2005 include; 2.7 riparian miles treated, 3.0 wetland acres treated, 5,263.3 upland acres treated, 106.5 riparian acres treated, 76,285 general public reached, 3,000 students reached, 40 teachers reached, 18 maintenance plans completed, temperature data collected at 6 sites, 8 landowner applications received and processed, 14 land inventories completed, 58 habitat improvement project designs completed, 5 newsletters published, 6 habitat plans completed, 34 projects installed, 2 educational workshops, 6 displays, 1 television segment, 2 public service announcements, a noxious weed GIS coverage, and completion of NEPA, ESA, and cultural resources requirements.

Rasmussen, Lynn (Nez Perce Soil and Conservation District, Lewiston, ID)



Restoring Anadromous Fish Habitat in the Lapwai Creek Watershed, Technical Report 2003-2006.  

DOE Green Energy (OSTI)

The Restoring Anadromous Fish Habitat in the Lapwai Creek Watershed is a multi-phase project to enhance steelhead trout in the Lapwai Creek watershed by improving salmonid spawning and rearing habitat. Habitat is limited by extreme high runoff events, low summer flows, high water temperatures, poor instream cover, spawning gravel siltation, and sediment, nutrient and bacteria loading. Funded by the Bonneville Power Administration (BPA) as part of the Northwest Power Planning Council's Fish and Wildlife Program, the project assists in mitigating damage to steelhead runs caused by the Columbia River hydroelectric dams. The project is sponsored by the Nez Perce Soil and Water Conservation District (District). Target fish species include steelhead trout (Oncorhynchus mykiss). Steelhead trout within the Snake River Basin were listed in 1997 as threatened under the Endangered Species Act. Accomplishments for the contract period December 1, 2003 through February 28, 2004 include; seven grade stabilization structures, 0.67 acres of wetland plantings, ten acres tree planting, 500 linear feet streambank erosion control, two acres grass seeding, and 120 acres weed control.

Rasmussen, Lynn



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



Re-Introduction of Lower Columbia River Chum Salmon into Duncan Creek, 2003-2004 Annual Report.  

Science Conference Proceedings (OSTI)

Currently, two methods of reintroduction are being simultaneously evaluated at Duncan Creek. Recolonization is occurring by introducing adult chum salmon from the Lower Gorge (LG) population into Duncan Creek and allowing them to naturally reproduce. The supplementation strategy required adults to be collected and artificially spawned, incubated, reared, and released at the mouth of Duncan Creek. All eggs from the artificial crossings at Washougal Hatchery were incubated and the fry reared to release size at the hatchery. The Duncan Creek chum salmon project was very successful in 2003-04, providing knowledge and experience that will improve program execution in future years. The gear used to collect adult brood stock was changed from tangle nets to beach seines. This increased efficiency and the speed at which adults could be processed in the field, and most likely reduced stress on the adults handled. Certain weaknesses exposed in past seasons still exist and new ones were exposed (e.g. inadequate incubation and rearing space at Washougal Hatchery for any large salvage operation and having to move the rearing troughs outside the raceway in 2004). Egg-to-fry survival rates of 64% and 58% showed that the channels are functioning at the upper end of what can be expected from them. Possibly the most important event this season was the ability to strontium mark and release all naturally-produced fry from the spawning channels. Channel and floodplain modifications reduced the likelihood that floods will damage the channels and negatively impact survival rates.

Hillson, Todd D. (Washington Department of Fish and Wildlife, Olympia, WA)



Analysis of soil and water at the Four Mile Creek seepline near the F- and H-Areas of SRS  

Science Conference Proceedings (OSTI)

Several soil and water samples were collected along the Four Mile Creek (FMC) seepline at the F and H Areas of the Savannah River Site. The samples were analyzed for concentrations of metals, radionuclides, and inorganic constituents. The results of the analyses are summarized for the soil and water samples.

Haselow, J.S.



Superfund Record of Decision (EPA Region 8): Anaconda Smelter Site, Mill Creek, Montana (first remedial action), October 1988  

Science Conference Proceedings (OSTI)

The 160-acre community of Mill Creek is located in Deerlodge County, Montana, immediately adjacent to the Anaconda Smelter NPL site. The community of Mill Creek has been contaminated for over 100 years with smelter emissions, fugitive emissions of flu dust at the smelter, and continued fugitive emissions emanating from adjacent highly contaminated soils. Settled flue emissions in the community of Mill Creek, from the now-defunct copper-smelting operation, contain arsenic, cadmium, and lead. Environmental siting of the community and biological testing of pre-school children, led EPA to conclude that contamination in the Mill Creek area poses an imminent and substantial endangerment to the health of individuals residing there. The primary contaminant of concern at this site is arsenic. Cadmium and lead are secondary contaminants of concern. The selected remedial action for the site includes: permanent relocation of all residents (8 homes) with temporary erosional stabilization of disturbed areas by establishing and maintaining a vegetative cover; demolition, consolidation, and storage.

Not Available



Performance and operation of a crosslinked polymer flood at Sage Spring Creek Unit A, Natrona County, Wyoming  

Science Conference Proceedings (OSTI)

This paper reviews field geology and development, characterizes the reservoir, evaluates secondary performance, and describes the design and benefits of a polymer program. Performance of the Sage Spring Creek Unit A confirms a high flood efficiency and superior oil recovery. The sweep improvement program is a technical and economic success.

Mack, J.C.; Warren, J.


Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Lake Roosevelt Fisheries Evaluation Program; Meadow Creek vs. Lake Whatcom Stock Kokanee Salmon Investigations in Lake Roosevelt, Annual Report 2002.  

DOE Green Energy (OSTI)

Lake Whatcom, Washington kokanee have been stocked in Lake Roosevelt since 1987 with the primary objective of creating a self-sustaining fishery. Success has been limited by low recruitment to the fishery, low adult returns to hatcheries, and a skewed sex ratio. It was hypothesized that a stock native to the upper Columbia River might perform better than the coastal Lake Whatcom stock. Kokanee from Meadow Creek, a tributary of Kootenay Lake, British Columbia were selected as an alternative stock. Post smolts from each stock were released from Sherman Creek Hatchery in late June 2000 and repeated in 2001. Stock performance was evaluated using three measures; (1) number of returns to Sherman Creek, the primary egg collection facility, (2) the number of returns to 86 tributaries sampled and, (3) the number of returns to the creel. In two repeated experiments, neither Meadow Creek or Lake Whatcom kokanee appeared to be capable of providing a run of three-year old spawners to sustain stocking efforts. Less than 10 three-years olds from either stock were collected during the study period. Chi-square analysis indicated age two Meadow Creek kokanee returned to Sherman Creek and to other tributaries in significantly higher numbers when compared to the Lake Whatcom stock in both 2000 and 2001. However, preliminary data from the Spokane Tribe of Indians indicated that a large number of both stocks were precocial before they were stocked. The small number of hatchery three-year olds collected indicated that the current hatchery rearing and stocking methods will continue to produce a limited jacking run largely composed of precocious males and a small number of three-year olds. No kokanee from the study were collected during standard lake wide creel surveys. Supplemental creel data, including fishing derbies, test fisheries, and angler diaries, indicated anglers harvested two-year-old hatchery kokanee a month after release. The majority of the two-year old kokanee harvested were from a direct stock at the Fort Spokane boat launch. Only Lake Whatcom kokanee were stocked from the boat launch, therefore stock performance was not evaluated, however the high success of the stocking location will likely increase harvest of hatchery kokanee in the future. Despite low numbers of the targeted three-year olds, Meadow Creek kokanee should be stocked when possible to promote fish native to the upper Columbia River.

McLellan, Holly



Sherman Creek Hatchery; Washington Department of Fish and Wildlife Fish Program, 2003 Annual Report.  

DOE Green Energy (OSTI)

Sherman Creek Hatchery's primary objective is the restoration and enhancement of the recreational and subsistence fishery in Lake Roosevelt and Banks Lake. The Sherman Creek Hatchery (SCH) was designed to rear 1.7 million kokanee fry for acclimation and imprinting during the spring and early summer. Additionally, it was designed to trap all available returning adult kokanee during the fall for broodstock operation and evaluation. Since the start of this program, the operations on Lake Roosevelt have been modified to better achieve program goals. The Washington Department of Fish and Wildlife, Spokane Tribe of Indians and the Colville Confederated Tribes form the interagency Lake Roosevelt Hatcheries Coordination Team (LRHCT) which sets goals and objectives for both Sherman Creek and the Spokane Tribal Hatchery. The LRHCT also serves to coordinate enhancement efforts on Lake Roosevelt and Banks Lake. Since 1994 the kokanee fingerling program has changed to yearling releases. By utilizing both the hatcheries and additional net pens, up to 1,000,000 kokanee yearlings can be reared and released. The construction and operation of twenty net pens in 2001 enabled the increased production. Another significant change has been to rear up to 300,000 rainbow trout fingerling at SCH from July through October, for stocking into the volunteer net pens. This enables the Spokane Tribal Hatchery (STH) to rear additional kokanee to further the enhancement efforts on Lake Roosevelt. Current objectives include increased use of native tributary stocks where available for propagation into Upper Columbia River Basin waters. The Lake Roosevelt Fisheries Evaluation Program (LRFEP) is responsible for monitoring and evaluation on the Lake Roosevelt Projects. From 1988 to 1998, the principal sport fishery on Lake Roosevelt has shifted from walleye to include rainbow trout and kokanee salmon (Underwood et al. 1997, Tilson and Scholz 1997). The angler use, harvest rates for rainbow and kokanee and the economic value of the fishery has increased substantially during this 10-year period. The investigations on the lake also suggest that the hatchery and net pen programs have enhanced the Lake Roosevelt fishery while not negatively impacting wild and native stocks within the lake. The 2003 Fourth Annual Two Rivers Trout Derby was again a great success. The harvest and data collection were the highest level to date with 1,668 rainbow trout and 416 kokanee salmon caught. The fishermen continue to praise the volunteer net pen program and the hatchery efforts as 90% of the rainbows and 93% of the kokanee caught were of hatchery origin (Lee, 2003).

Lovrak, Jon (Washington Department of Fish and Wildlife, Fish Management Program, Hatcheries Division, Ford, WA); Combs, Mitch (Washington Department of Fish and Wildlife, Fish Management Program, Hatcheries Division, Kettle Falls, WA)



Sherman Creek Hatchery; Washington Department of Fish and Wildlife Fish Program, 2001 Annual Report.  

DOE Green Energy (OSTI)

Sherman Creek Hatchery's primary objective is the restoration and enhancement of the recreational and subsistence fishery in Lake Roosevelt and Banks Lake. The Sherman Creek Hatchery (SCH) was designed to rear 1.7 million kokanee fry for acclimation and imprinting during the spring and early summer. Additionally, it was designed to trap all available returning adult kokanee during the fall for broodstock operations and evaluations. Since the start of this program, the operations on Lake Roosevelt have been modified to better achieve program goals. The Washington Department of Fish and Wildlife, Spokane Tribe of Indians and the Colville Confederated Tribe form the interagency Lake Roosevelt Hatcheries Coordination Team (LRHCT) which sets goals and objectives for both Sherman Creek and the Spokane Tribal Hatchery and serves to coordinate enhancement efforts on Lake Roosevelt and Banks Lake. The primary changes have been to replace the kokanee fingerling program with a yearling (post smolt) program of up to 1,000,000 fish. To construct and operate twenty net pens to handle the increased production. The second significant change was to rear up to 300,000 rainbow trout fingerling at SCH from July through October, for stocking into the volunteer net pens. This enables the Spokane Tribal Hatchery (STH) to rear additional kokanee to further the enhancement efforts on Lake Roosevelt. Current objectives include increased use of native/indigenous stocks where available for propagation into Upper Columbia River Basin Waters. Monitoring and evaluation is preformed by the Lake Roosevelt Fisheries Monitoring Program. From 1988 to 1998, the principle sport fishery on Lake Roosevelt has shifted from walleye to include rainbow trout and kokanee salmon (Underwood et al. 1997, Tilson and Scholz 1997). The angler use, harvest rates for rainbow and kokanee and the economic value of the fishery has increased substantially during this 10-year period. The most recent information from the monitoring program also suggests that the hatchery and net pen rearing programs have been beneficial to enhancing the Lake Roosevelt fishery while not negatively impacting wild and native stocks within the lake. The 2001 fishing season has been especially successful with great fishing for both rainbow and kokanee throughout Lake Roosevelt. The results of the Two Rivers Fishing Derby identified 100 percent of the rainbow and 47 percent of the kokanee caught were of hatchery origin.

Combs, Mitch (Washington Department of Fish and Wildlife, Kettle Falls, WA)



A Fisheries Evaluation of the Wapato, Sunnyside and Toppenish Creek Canal Fish Screening Facilities, Spring 1988 : Annual Report.  

DOE Green Energy (OSTI)

We evaluated the effectiveness of new screening facilities at the Toppenish Creek, Wapato, and Sunnyside canals in southcentral Washington State. Screen integrity tests indicated that fish released in front of the screens were prevented from entering the canal behind the screens. Screen efficiency estimates are 99% ({+-}0.6%) for Toppenish Creek, 99% ({+-}0.3%) for Wapato, and 98% ({+-}0.5%) for Sunnyside. During 1987 at the Wapato Canal, we estimated screen efficiency was 97% ({+-}l%). We conducted descaling tests at the Toppenish Creek Screens. We estimated that 0.2% of steelhead Qncorhynchus mykiss smelts released during tests were descaled. None of the fish released through the fish return pipe were descaled. We measured the time required for fish to move through the screen facilities. The time required for 50% of the test fish to exit the Toppenish Creek Screen forebay was 4 to 9 h for rainbow trout fry and up to 39 h for steelhead smelts. The time for 50% of the test fish to exit the Wapato and Sunnyside screen forebays was less than 8 h. As with past studies, exit times varied with canal flow and species. After 39 h at Toppenish Creek, half the steelhead smelts were still in the forebay when canal flows were 20 cfs. At Sunnyside, half the chinook salmon fry exited the forebay in 1 h or less. Methods used in 1988 were the same as those used at Sunnyside in 1985 and in subsequent years at Richland, Toppenish/Satus, and Wapato. The methods and previous results have been reviewed by the Washington State Department of Fisheries, U.S. Fish and Wildlife Service, National Marine Fisheries Service, Northwest Power Planning Council, and Yakima Indian Nation.

Neitzel, Duane A.; Abernethy, C. Scott; Lusty, E. William (Pacific Northwest Laboratory)



Constructive hierarchy through entitlement: inequality in lithic resource access among the ancient Maya of Blue Creek, Belize  

E-Print Network (OSTI)

This dissertation tests the theory that lithic raw materials were a strategic resource among the ancient Maya of Blue Creek, Belize that markedly influenced the development of socio-economic hierarchies at the site. Recent research has brought attention to the role of critical resource control as a mechanism contributing to the development of political economies among the ancient Maya. Such research has been primarily focused on the control of access to water and agricultural land. The examination of lithic raw materials as a critical economic resource is warranted as stone tools constituted a fundamental component of the ancient Maya economy. My research objectives include measuring raw material variability in the Blue Creek settlement zone and its immediate environs, assessing the amount of spatial and temporal variability present in the distribution of various raw materials, determining the degree to which proximity to a given resource influenced the relative level of its use, and testing whether differential resource access relates to variability in aggregate expressions of wealth. To meet these objectives, I examined 2136 formal stone tools and 24,944 pieces of debitage from excavations across the Blue Creek settlement zone, and I developed a lithic raw material type collection using natural outcrops. Significant spatial and temporal differences were observed in the use of various raw materials. Control of critical resources under conditions of scarcity is shown to have caused social stratification among the ancient Maya of Blue Creek. Initial disparities in use-right arrangements based on first occupancy rights produced substantial, accumulative inequality in economic capability and subsequent achievements. During the Early Classic period, these disproportionate allowances ultimately undermined the more egalitarian structure observed during the Preclassic. The Early Classic period at Blue Creek is characterized by increasing extravagance among the elites and increasing disenfranchisement throughout the hinterlands when compared to earlier periods. This suggests that elites at the site only became fully able to convert their resource monopolies into substantial gains in power, prestige, and wealth during the Classic period.

Barrett, Jason Wallace




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOEIJEA-1219 DOEIJEA-1219 ENVIRONMENTAL ASSESSMENT HOE CREEK UNDERGROUND COAL GASIFICATION TEST SITE REMEDIATION CAMPBELL COUNTY, WYOMING October 1997 U.S. DEPARTMENT OF ENERGY FEDERAL ENERGY TECHNOLOGY CENTER This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or use- fulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any spe- cific commercial product, process. or service by trade name, trademark, manufac-


Microsoft Word - CX_PerryCreek_4.29.11.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

, 2011 , 2011 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Cecilia Brown Project Manager - KEWM-4 Proposed Action: Provision of funds to Montana Fish, Wildlife and Parks for purchase of the Perry Creek Property. Fish and Wildlife Project No.: 2008-800-00, Contract 45235 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.25 Transfer, lease, disposition or acquisition of interests in uncontaminated land for habitat preservation or wildlife management, and only associated buildings that support these purposes. Uncontaminated means that there would be no potential for release of substances at a level, or in a form, that would pose a threat to public health or the environment. Location: Township 24 North, Range 17 West, Section 31, Lake County, Montana


Microsoft Word - 2012_Rapid_Lightening_Creek_Easement_CX_Rev2.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

24, 2012 24, 2012 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Virgil Lee Watts Project Manager - KEWM-4 Proposed Action: AMENDED Provision of funds to the Idaho Department of Fish and Game (IDFG) to purchase the Rapid Lightning Creek Property. Fish and Wildlife Project No.: 1992-061-00 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B 1.25 Real property transfers for cultural resources protection, habitat preservation, and wildlife management. Location: Township 58 North, Range 1 West, Section 24 of Bonner County, Idaho Proposed by: Bonneville Power Administration (BPA) and IDFG Description of the Proposed Action: BPA proposes to provide funds to IDFG for a fee-simple title acquisition of an approximately 27-acre parcel of land adjacent to the Rapid Lightning and


Microsoft Word - JockoSpringCreek_Scott_Acquisition_CX_Final.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

purchase of Jocko Spring Creek Property. Fish and Wildlife Project No.: 2002-003-00, Contract # BPA-44646 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.25 Transfer, lease, disposition or acquisition of interests in uncontaminated land for habitat preservation or wildlife management, and only associated buildings that support these purposes. Uncontaminated means that there would be no potential for release of substances at a level, or in a form, that would pose a threat to public health or the environment. Location: Township 17 North, Range 20 West, Section 26 of the Arlee Quad, in Lake County, Montana Proposed by: Bonneville Power Administration (BPA) and CSKT Description of the Proposed Action: BPA proposes to fund the acquisition of 126 acres of


Microsoft Word - CX-Rock_Creek-John_Day_No1_Spacer_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

9, 2010 9, 2010 REPLY TO ATTN OF: KEP-4 SUBJECT: Environmental Clearance Memorandum Corinn Castro Project Manager - TELM-TPP-3 Proposed Action: Replace spacer dampers along the Rock Creek-John Day No. 1 500-kV transmission line; structures 1/1 to 4/2 and 6/4 to 11/2 Budget Information: Work Order #00234528 PP&A Project No.: PP&A 1167 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3, Routine maintenance activities...for structures, rights-of-way, infrastructures such as roads, equipment...routine maintenance activities, corrective....are required to maintain... infrastructures...in a condition suitable for a facility to be used for its designed purpose. Proposed by: Bonneville Power Administration (BPA)


Microsoft Word - CX-BB3-Dragoon-Creek_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1, 2010 1, 2010 REPLY TO ATTN OF: KEPR-Bell-1 SUBJECT: Environmental Cleareance Memorandum Jason Moon - TELF-TPP-3 Project Manager Proposed Action: Provide heavy vehicular access across Dragoon Creek to maintain and service Bonneville Power Administration's (BPA) Bell-Boundary No.3 transmission line by replacing the existing wood stringer bridge with a precast or modular steel bridge. PP&A Project No.: PP&A 1574 Budget Information: 247745 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3 Routine maintenance/custodial services for buildings, structures, infrastructures (e.g., pathways, roads, and railroads), equipment. B1.13 Construction, acquisition, and relocation of onsite pathways and short onsite access roads


Application of a damage model for rock fragmentation to the Straight Creek Mine blast experiments  

SciTech Connect

Early attempts at estimation of stress wave damage due to blasting by use of finite element calculations met with limited success due to numerical instabilities that prevented calculations from being carried past the fragmentation limit. More recently, the improved damage model PRONTO has allowed finite element calculations which remain stable and yield good agreement between calculated fragmented regions and excavated crater profiles for blasting experiments in granite. Application of this damage model to blast experiments at the Straight Creek Mine in Bell County, Kentucky were complicated by anisotropic conditions and uncertainties in material properties. It appears that significant modifications to the damage model and extensive material testing may be necessary in order to estimate damage in these anisotropic materials. 18 refs., 18 figs.

Thorne, B.J.



Evaluate Habitat Use and Population Dynamics of Lampreys in Cedar Creek, 2001 Annual Report.  

DOE Green Energy (OSTI)

Pacific lamprey (Lampetra tridentata) in the Columbia River Basin have declined to a remnant of their pre-1940s populations and the status of the western brook lamprey (L. richardsoni) is unknown. Identifying the biological and ecological factors limiting lamprey populations is critical to their recovery, but little research has been conducted on these species within the Columbia River Basin. This ongoing, multi-year study examines lamprey populations in Cedar Creek, Washington, a third-order tributary to the Lewis River. This annual report describes the activities and results of the second year of this project. Adult (n = 24), metamorphosed (n = 247), transforming (n = 4), and ammocoete (n = 387) stages from both species were examined in 2001. Lamprey were captured using adult fish ladders, lamprey pots, rotary screw traps, and lamprey electrofishers. Twenty-nine spawning ground surveys were conducted. Nine strategic point-specific habitat surveys were performed to assess habitat requirements of juvenile lamprey.

Stone, Jennifer; Pirtle, Jody; Barndt, Scott A.



Waste management plan for the Lower East Fork Poplar Creek Operable Unit, Oak Ridge, Tennessee  

SciTech Connect

The Lower East Fork Poplar Creek (LEFPC) Remedial Action project will remove mercury-contaminated soils from the floodplain of LEFPC, dispose of these soils at the Y-12 Plant Landfill V, and restore the affected floodplain. The waste management plan addresses management and disposition of all wastes generated during the LEFPC remedial action. Most of the solid wastes will be sanitary or construction/demolition wastes and will be disposed of at existing Y- 12 facilities. Some small amounts of hazardous waste are anticipated, along with possible low-level or mixed wastes (> 35 pCi/g). Liquid wastes will be generated which will be sanitary and capable of being disposed of at the Oak Ridge Sewage Treatment Plant, except sanitary sewage.



Examination of eastern oil shale disposal problems - the Hope Creek field study  

SciTech Connect

A field-based study of problems associated with the disposal of processed Eastern oil shale was initiated in mid-1983 at a private research site in Montgomery County, Kentucky. The study (known as the Hope Creek Spent Oil Shale Disposal Project) is designed to provide information on the geotechnical, revegetation/reclamation, and leachate generation and composition characteristics of processed Kentucky oil shales. The study utilizes processed oil shale materials (retorted oil shale and reject raw oil shale fines) obtained from a pilot plant run of Kentucky oil shale using the travelling grate retort technology. Approximately 1000 tons of processed oil shale were returned to Kentucky for the purpose of the study. The study, composed of three components, is described. The effort to date has concentrated on site preparation and the construction and implementation of the field study research facilities. These endeavors are described and the project direction in the future years is defined.

Koppenaal, D.W.; Kruspe, R.R.; Robl, T.L.; Cisler, K.; Allen, D.L.



An aerial radiological survey of Project Rulison and surrounding area, Battlement Creek Valley, Colorado  

SciTech Connect

An aerial radiological survey was conducted over the Project Rulison site, 40 miles (64 kilometers) northeast of Grand Junction, Colorado, from July 6 through July 12, 1993. Parallel lines were flown at intervals of 250 feet (76 meters) over a 6.5-square-mile (17-square-kilometer) area at a 200-foot (61-meter) altitude surrounding Battlement Creek Valley. The gamma energy spectra obtained were reduced to an exposure rate contour map overlaid on a high altitude aerial photograph of the area. The terrestrial exposure rate varied from 3.5 to 12.5 {mu}R/h (excluding cosmic) at 1 meter above ground level. No anomalous or man-made isotopes were found.




Natural Propagation and Habitat Improvement Idaho: Lolo Creek and Upper Lochsa, Clearwater National Forest.  

DOE Green Energy (OSTI)

In 1983, the Clearwater National Forest and the Bonneville Power Administration (BPA) entered into a contractual agreement to improve anadromous fish habitat in selected tributaries of the Clearwater River Basin. This agreement was drawn under the auspices of the Northwest Power Act of 1980 and the Columbia River basin Fish and Wildlife Program (section 700). The Program was completed in 1990 and this document constitutes the Final Report'' that details all project activities, costs, accomplishments, and responses. The overall goal of the Program was to enhance spawning, rearing, and riparian habitats of Lolo Creek and major tributaries of the Lochsa River so that their production systems could reach full capability and help speed the recovery of salmon and steelhead within the basin.

Espinosa, F.A. Jr.; Lee, Kristine M.



Solar heating and cooling system for an office building at Reedy Creek Utilities  

DOE Green Energy (OSTI)

This final report describes in detail the solar energy system installed in a new two-story office building at the Reedy Creek Utilities Company, which provides utility service to Walt Disney World at Lake Buena Vista, Florida. The solar components were partly funded by the Department of Energy under Contract EX-76-C-01-2401, and the technical management was by NASA/George C. Marshall Space Flight Center. The solar energy system application is 100 percent heating, 80 percent cooling, and 100 percent hot water. The collector is a modular cylindrical concentrator type with an area of 3.840 square feet. The storage medium is water with a capacity of 10,000 gallons hot and 10,000 gallons chilled. Design, construction, operation, cost, maintenance, and performance are described in depth. Detailed drawings are included.

Not Available



Protect and Restore Mill Creek Watershed; Annual Report 2004-2005.  

DOE Green Energy (OSTI)

The Nez Perce Tribe Department of Fisheries Resource Management, Watershed Division approaches watershed restoration with a ridge-top to ridge-top approach. The Nez Perce Tribe and the Nez Perce National Forest (NPNF) have formed a partnership in completing watershed restoration activities, and through this partnership, more work is accomplished by sharing funding and resources in our effort. The Nez Perce Tribe began watershed restoration projects within the Mill Creek watershed of the South Fork Clearwater River in 2000. Progress has been made in restoring the watershed through excluding cattle from critical riparian areas through fencing. Starting in FY 2002, continuing into 2004, trees were planted in riparian areas in the meadow of the upper watershed. In addition, a complete inventory of culverts at road-stream crossings was completed. Culverts have been prioritized for replacement to accommodate fish passage throughout the watershed, and one high priority culvert was replaced in 2004. Maintenance to the previously built fence was also completed.

McRoberts, Heidi (Nez Perce Tribe, Department of Fisheries Resource Management, Lapwai, ID)



Protect and Restore Mill Creek Watershed; Annual Report 2003-2004.  

DOE Green Energy (OSTI)

The Nez Perce Tribe Department of Fisheries Resource Management, Watershed Division approaches watershed restoration with a ridge-top to ridge-top approach. The Nez Perce Tribe and the Nez Perce National Forest have formed a partnership in completing watershed restoration activities, and through this partnership, more work is accomplished by sharing funding and resources in our effort. The Nez Perce Tribe began watershed restoration projects within the Mill Creek watershed of the South Fork Clearwater River in 2000. Progress has been made in restoring the watershed through excluding cattle from critical riparian areas through fencing. Starting in FY 2002, continuing into 2004, trees were planted in riparian areas in the meadow of the upper watershed. In addition, a complete inventory of culverts at road-stream crossings was completed. Culverts have been prioritized for replacement to accommodate fish passage throughout the watershed, and designs completed on two of the high priority culverts. Maintenance to the previously built fence was also completed.

McRoberts, Heidi (Nez Perce Tribe, Department of Fisheries Resource Management, Lapwai, ID)


Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - CX-HillsCreek-LookoutPointWoodPolesFY12_WEB.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

REPLY TO ATTN OF: KEP-Alvey SUBJECT: Environmental Clearance Memorandum Chad Hamel Project Manager - TEP-TPP-1 Proposed Action: Hills Creek-Lookout Point No. 1 wood pole replacements PP&A Project No.: 2315 (WO# 297311) Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3 Routine maintenance Location: Lane County, Oregon Proposed by: Bonneville Power Administration (BPA), Alvey District Description of the Proposed Action: BPA proposes to replace four deteriorating wood pole structures and associated structural/electrical components (e.g. cross arms, insulators, guy anchors) along the subject transmission line. The poles are located on private residential and US Forest Service land. Landowners will be notified prior to replacement activities. Replacement will be in-


Assess Current and Potential Salmonid Production in Rattlesnake Creek Associated with Restoration Efforts; Yakama Indian Nation, Annual Report 2002-2003.  

DOE Green Energy (OSTI)

This document represents the FY2002 BPA contract Statement of Work for the Yakama Nation (YN) portion of the project entitled 'Assessment of current and potential salmonid production in Rattlesnake Creek associated with restoration efforts'. The purpose of the project is to complete detailed surveys of water quality, fish populations, habitat conditions and riparian health in the Rattlesnake Creek sub-basin of the White Salmon River in south central Washington. Results of the surveys will be used to establish Rattlesnake Creek sub-basin baseline environmental factors prior to anticipated removal of Condit Dam in 2006 and enable cost-effective formulation of future watershed restoration strategies.

Morris, Gregory



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



DOE/EA-1371; Integrated Natural Resources Management Plan, Environmental Assessment, and Finding of No Significant Impacts for Rock Creek Reserve (5/2001)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Finding of No Significant Impact Finding of No Significant Impact Integrated Natural Resources Management Plan and Environmental Assessment for Rock Creek Reserve Summary: The Department of Energy (DOE) with the assistance and cooperation of the US. Fish and Wildlife Service, prepared an Integrated Natural Resources Management Plan and Environmental Assessment (Plan)(DOE/EA-1371) for the Rock Creek Reserve at the Rocky Flats Environmental Technology Site (Site) located north of Golden, Colorado. The Rock Creek Reserve was established in May 1999 in recognition of the area's biological significance. Although still under the ownership of the DOE, the Rock Creek Reserve will be co- managed with the U. S. Fish and Wildlife Service as part of an interagency agreement signed by these two


Notice of Availability of the Record of Decision for the Goodnoe Hills and White Creek Wind Energy Projects, Business Plan EIS (DOE/EIS-0183) (October 2005)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

13 Federal Register 13 Federal Register / Vol. 70, No. 226 / Friday, November 25, 2005 / Notices DEPARTMENT OF ENERGY Bonneville Power Administration Goodnoe Hills and White Creek Wind Energy Projects, October 2005 AGENCY: Bonneville Power Administration (BPA), Department of Energy (DOE). ACTION: Notice of availability of Record of Decision (ROD). SUMMARY: BPA has decided to offer contract terms for interconnection of the Goodnoe Hills and White Creek Wind Energy Projects into the Federal Columbia River Transmission System (FCRTS) at the Rock Creek substation in Klickitat County, Washington. The Large Generation Interconnection Agreement (LGIA) provides for interconnection of the Wind Projects with the FCRTS, the operation of Goodnoe Hills and White Creek Wind Energy Projects in the BPA Control Area


Final report from VFL Technologies for the pilot-scale thermal treatment of lower East Fork Poplar Creek floodplain soils. LEFPC appendices, Volume 4, Appendix V-C  

Science Conference Proceedings (OSTI)

This is the the final verification run data package for pilot scale thermal treatment of lower East Fork Poplar Creek floodplain soils. Included are data on volatiles, semivolatiles, and TCLP volatiles.




Transport and Diffusion in the Transition Layer and Planetary Boundary Layer for Drainage Flows in Anderson and Putah Creeks, California, during ASCOT 1980  

Science Conference Proceedings (OSTI)

Approximately 100 constant-volume, superpressured balloons (tetroons) were tracked in the Anderson and Putah Creek drainages of the Geysers geothermal area of northern California as part of the ASCOT (Atmospheric Studies in Complex Terrain) ...

Michael A. Fosberg



Status and Monitoring of Natural and Supplemented Chinook Salmon in Johnson Creek, Idaho, 2006-2007 Annual Report.  

DOE Green Energy (OSTI)

The Nez Perce Tribe Johnson Creek Artificial Propagation Enhancement Project (JCAPE) has conducted juvenile and adult monitoring and evaluation studies for its 10th consecutive year. Completion of adult and juvenile Chinook salmon studies were conducted for the purpose of evaluating a small-scale production initiative designed to increase the survival of a weak but recoverable spawning aggregate of summer Chinook salmon Oncorhynchus tshawytscha. The JCAPE program evaluates the life cycle of natural origin (NOR) and hatchery origin (HOR) supplementation fish to quantify the key performance measures: abundance, survival-productivity, distribution, genetics, life history, habitat, and in-hatchery metrics. Operation of a picket style weir and intensive multiple spawning ground surveys were completed to monitor adult Chinook salmon and a rotary screw trap was used to monitor migrating juvenile Chinook salmon in Johnson Creek. In 2007, spawning ground surveys were conducted on all available spawning habitat in Johnson Creek and one of its tributaries. A total of 63 redds were observed in the index reach and 11 redds for all other reaches for a combined count of 74 redds. Utilization of carcass recovery surveys and adult captures at an adult picket weir yielded a total estimated adult escapement to Johnson Creek of 438 Chinook salmon. Upon deducting fish removed for broodstock (n=52), weir mortality/ known strays (n=12), and prespawning mortality (n=15), an estimated 359 summer Chinook salmon were available to spawn. Estimated total migration of brood year 2005 NOR juvenile Chinook salmon at the rotary screw trap was calculated for three seasons (summer, fall, and spring). The total estimated migration was 34,194 fish; 26,671 of the NOR migrants left in the summer (July 1 to August 31, 2005) as fry/parr, 5,852 left in the fall (September 1 to November 21, 2005) as presmolt, and only 1,671 NOR fish left in the spring (March 1 to June 30, 2006) as smolt. In addition, there were 120,415 HOR supplementation smolts released into Johnson Creek during the week of March 12, 2007. Life stage-specific juvenile survival from Johnson Creek to Lower Granite and McNary dams was calculated for brood year 2005 NOR and HOR supplementation juvenile Chinook salmon. Survival of NOR parr Chinook salmon migrating from Johnson Creek to Lower Granite and McNary dams was 28.2% and 16.2%. Survival of NOR presmolt Chinook salmon migrating from Johnson Creek to Lower Granite and McNary dams was 28.2% and 22.3%. Survival of NOR smolt Chinook salmon migrating from Johnson Creek to Lower Granite and McNary dams was 44.7% and 32.9%. Survival of HOR smolt Chinook salmon migrating from Johnson Creek to Lower Granite and McNary dams was 31.9% and 26.2%. Multi-year analysis on smolt to adult return rate's (SAR's) and progeny to parent ratio's (P:P's) were calculated for NOR and HOR supplementation Brood Year 2002 Chinook salmon. SAR's were calculated from Johnson Creek to Johnson Creek (JC to JC), Lower Granite Dam to Lower Granite (LGD to LGD), and Lower Granite Dam to Johnson Creek (LGD to JC); for NOR fish SAR's were 0.16%, 1.16% and 1.12%, while HOR supplementation SAR's from JC to JC, LGD to LGD and LGD to JC were 0.04%, 0.19% and 0.13%. P:P's for all returning NOR and HOR supplemented adults were under replacement levels at 0.13 and 0.65, respectively. Recruit per spawner estimates (R/S) for Brood Year 2005 adult Chinook salmon were also calculated for NOR and HOR supplemented Chinook salmon at JC and LGD. R/S estimates for NOR and HOR supplemented fish at JC were 231 and 1,745, while R/S estimates at LGD were 67 and 557. Management recommendations address (1) effectiveness of data collection methods, (2) sufficiency of data quality (statistical power) to enable management recommendations, (3) removal of uncertainty and subsequent cessation of M&E activities, and (4) sufficiency of findings for program modifications prior to five-year review.

Rabe, Craig D.; Nelson, Douglas D. [Nez Perce Tribe



About the battle | ENERGY STAR  

NLE Websites -- All DOE Office Websites (Extended Search)

Small business Service providers Service and product providers Verify applications for ENERGY STAR certification Design commercial buildings Energy efficiency program...


Retail battle for conservation dollars  

SciTech Connect

Large companies are entering the profitable retail market with conservation equipment and services that will compete for a share of the $10 to $80 billion Americans will spend on energy efficiency this year. Energy centers and clinics are also opening around the country to market products and compete with the utilities for energy audit business. The new retailing efforts are counting on homeowners' willingness to spend money to lower their energy bills. The smaller companies hope to hold their own against competition from large corporations. (DCK)

McCaughey, J.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Microsoft Word - CX-Alvey-FairviewAlvey-MartinCreek-DrainWoodPolesFY12_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Wood pole replacements on the Alvey-Fairview No. 1 230-kV, Alvey- Wood pole replacements on the Alvey-Fairview No. 1 230-kV, Alvey- Martin Creek 115-kV, and Martin Creek-Drain #1 115-kV transmission line rights-of-way (ROW) PP&A Project No.: 2308 (WO# 297303), 2310 (WO# 297305), 2319 (WO# 297996) Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3 Routine maintenance Location: Alvey and Douglas counties, Oregon Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA proposes to replace 18 deteriorating wood poles and associated structural/electrical components (e.g. cross arms, insulators, guy anchors, etc.) as well as cross arms on three other structures along the subject transmission lines. Replacement will be in-kind and will utilize the existing holes to minimize ground disturbance. If necessary, an auger


DOE/EIS-0415: Final Environmental Impact Statement Deer Creek Station Energy Facility Project Brookings County, South Dakota (April 2010)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENVIRONMENTAL IMPACT STATEMENT Deer Creek Station Energy Facility Project Brookings County, South Dakota U.S. Department of Energy Western Area Power Administration Upper Great Plains Region Billings, Montana DOE/EIS-0415 April 2010 Final Environmental Impact Statement Cover Sheet i COVER SHEET Lead Federal Agency: U.S. Department of Energy, Western Area Power Administration Cooperating Agency: U.S. Department of Agriculture, Rural Utilities Service


Solar-energy-system performance evaluation. Reedy Creek Utility District office building, Lake Buena Vista, Florida, September 1978-February, 1979  

DOE Green Energy (OSTI)

The Reedy Creek site is a two-story office building in Florida whose solar heating system provides space heating and domestic hot water and space cooling. The system consists of an array of parabolic trough collectors, an absorption chiller, a 10,000-gallon hot water tank and a 10,000-gallon cold water tank. The system and its operation are briefly described, and its performance is analyzed using a system energy balance technique. (LEW)

Smith, H.T.



Phase 2 confirmatory sampling data report, Lower East Fork Poplar Creek, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee  

Science Conference Proceedings (OSTI)

A Remedial Investigation of East Fork Poplar Creek (EFPC) concluded that mercury is the principal contaminant of concern in the EFPC floodplain. The highest concentrations of mercury were found to be in a visually distinct black layer of soil that typically lies 15 to 30 cm (6 to 12 in.) below the surface. Mercury contamination was found to be situated in distinct areas along the floodplain, and generally at depths > 20 cm (8 in.) below the surface. In accordance with Comprehensive, Environmental Response, Compensation, and Liability Act (CERCLA), a feasibility study was prepared to assess alternatives for remediation, and a proposed plan was issued to the public in which a preferred alternative was identified. In response to public input, the plan was modified and US Department of Energy (DOE) issued a Record of Decision in 1995 committing to excavating all soil in the EFPC floodplain exceeding a concentration of 400 parts per million (ppm) of mercury. The Lower East Fork Poplar Creek (LEFPC) remedial action (RA) focuses on the stretch of EFPC flowing from Lake Reality at the Y-12 Plant, through the city of Oak Ridge, to Poplar Creek on the Oak Ridge Reservation (ORR) and its associated floodplain. Specific areas were identified that required remediation at the National Oceanographic and Atmospheric Administration (NOAA) Site along Illinois Avenue and at the Bruner Site along the Oak Ridge Turnpike. The RA was conducted in two separate phases. Phase 2, conducted from February to October 1997, completed the remediation efforts at the NOAA facility and fully remediated the Bruner Site. During both phases, data were collected to show that the remedial efforts performed at the NOAA and Bruner sites were successful in implementing the Record of Decision and had no adverse impact on the creek water quality or the city of Oak Ridge publicly owned treatment works.




Stratigraphy, petrology, and depositional environments of upper Cretaceous and Lower Tertiary Sabbath Creek section, Arctic National Wildlife Refuge (ANWR), Alaska  

Science Conference Proceedings (OSTI)

A 9387-ft (2816-m) section of Upper Cretaceous-Lower Tertiary strata is exposed along Sabbath Creek in the northern ANWR of north-eastern Alaska and represents a regressive depositional sequence. The entire section is divided into four lithologic units (A-D), each characterized by distinct depositional assemblages. Unit A, at the base of the section, consists of several coarsening-upward sequences of alternating thick organic-rich siltstones an fine-grained litharenites, representing deposition in subaqueous to lower delta-plain environments. Unit B stratigraphically overlies Unit A and is characterized by multiple, mutually erosive, fining-upward sequences of fine to coarse pebble litharenites typical of point-bar sequences in a meandering stream environment (lower to upper delta plain). Unit C consists of multiple, poorly developed fining-upward sequences of dominantly clast- and matrix-supported pebble conglomerate interpreted as braided stream deposits. At the top of the section, Unit D is characterized by multiple fining- and a few coarsening-upward sequences of organic-rich shale with minor amounts of medium to coarse litharenite and pebble conglomerate representing meandering stream deposition. The Sabbath Creek section is lithologically dissimilar to coeval units to the west. The Sagavanirktok Formation and Colville Group contain pyroclastic material and thick coal beds not seen in the Sabbath Creek section. Instead, this section is lithologically similar to the Moose Channel formation - a regressive, fluvial, deltaic sequence exposed in the MacKenzie delta area of northwestern Canada. Consequently , detailed interpretation of the sabbath Creek section has important implications concerning the petroleum potential of the Arctic National Wildlife Refuge and offshore beaufort Sea.

Buckingham, M.L.



Confirmatory Sampling and Analysis Plan for the Lower East Fork Poplar Creek Operable Unit, Oak Ridge, Tennessee  

SciTech Connect

This document describes the organization, strategy, and procedures to be used to confirm that mercury concentrations in soils in the remediated areas are statistically less than, or equal to, the cleanup standard of 400 ppm. It focuses on confirming the cleanup of the stretch of the Lower East Fork Popular Creed flowing from Lake Reality at the Y-12 Plant, through the City of Oak Ridge, to Poplar Creek on the Oak Ridge Reservation and its associated flood plain.



Habitat Evaluation Procedures (HEP) Report; Willow Creek, Technical Report 1993-1994.  

DOE Green Energy (OSTI)

The Willow Creek site is one of the most significant remaining areas of typical native Willamette Valley habitats, with a variety of wetlands, grasslands, and woodlands. A diverse array of native flora and fauna, with significant wildlife habitats, is present on the site. Wildlife diversity is high, and includes species of mammals, songbirds, raptors, reptiles, amphibians, and one rare invertebrate. Over 200 species of native plants have been identified (including populations of six rare, threatened, or endangered species), along with significant remnants of native plant communities. Willow Creek is located in Lane County, Oregon, on the western edge of the City of Eugene (see Figure 1). The city limit of Eugene passes through the site, and the site is entirely within the Eugene Urban Growth Boundary (UGB). At present, only lands to the east and northeast of the site are developed to full urban densities. Low density rural residential and agricultural land uses predominate on lands to the northwest and south. A partially completed light industrial/research office park is located to the northwest. Several informal trails lead south from West 18th at various points into the site. The area encompasses a total of approximately 349 acres under several ownerships, in sections 3 and 4 of Township 18 South, Range 4 West. wildlife habitat values resulting from the purchase of this site will contribute toward the goal of mitigating for habitat lost as outlined in the Bonneville Power Administration's (BPA) Mitigation and Enhancement Plan for the Willamette River Basin. Under this Plan, mitigation goals were developed as a result of the loss of wildlife habitat due to the development and operation of Federal hydro-electric facilities in the Willamette River Basin. Results of the HEP will be used to: (1) determine the current status and habitat enhancement potential of the site consistent with wildlife mitigation goals and objectives; and (2) develop a management plan for the area. The BPA is considering exercising their option to purchase the Bailey Hill property, acquiring additional properties now owned by The Nature Conservancy, and/or funding enhancement activities for the entire site in order to receive credit under the Mitigation and Enhancement Plan for the Willamette River Basin.

Beilke, Susan


Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Investigation of increased mercury levels in the fisheries of Lower East Fork Poplar Creek (Lefpc), Oak Ridge Reservation, Tennessee  

SciTech Connect

The DOE Western Environmental Technology Office (WETO) is supporting remediation efforts on the U.S. Department of Energy Oak Ridge Reservation in Oak Ridge, Tennessee by performing this study. MSE Technology Applications, Inc. (MSE) has performed a series of literature reviews and bench-scale testing to further evaluate the mercury problem in the Lower East Fork Poplar Creek (LEFPC) at Oak Ridge. The primary problem is that total mercury (HgT) levels in LEFPC water decrease, while HgT levels in sunfish muscle tissue increase, with distance away from the National Security Complex (NSC), despite extensive source control efforts at the facility and within downstream riparian zones. Furthermore, dissolved methylmercury (d-MeHg) levels increase downstream from the NSC, especially during warm weather and/or high flow events. MSE performed four test series that focused on conversion of aqueous phase elemental mercury (Hg deg. A) to methyl mercury (MeHg) by algal-bacterial bio-films (periphyton) present in the stream-bed of LEFPC. Small (mg/L) quantities of un-sulphured molasses and peptone were added to some of the Hinds Creek samples to stimulate initial bacterial growth. Other Hinds Creek samples either were dosed with glutaraldehyde to preclude microbial growth, or were wrapped in aluminum foil to preclude Hg photochemical redox effects. The bench-scale testing for Phase II was completed August 2006. The final reporting and the planning for Phase III testing are in progress. (authors)

Byrne-Kelly, D.; Cornish, J.; Hart, A. [MSE Technology Applications, Inc., 200 Technology Way, Butte, MT (United States); Southworth, G. [Oak Ridge National Laboratory, Oak Ridge, TN (United States); Sims, L. [Bechtel Jacobs Company, Oak Ridge, TN (United States)



Best management practices plan for the Lower East Fork Poplar Creek remedial action project, Oak Ridge, Tennessee  

SciTech Connect

The U.S. Department of Energy (DOE) has three major operating facilities on the DOE Oak Ridge Reservation (ORR) in Oak Ridge, Tennessee: the Oak Ridge Y-12 Plant, the K-25 Site, and the Oak Ridge National Laboratory (ORNL) managed by Lockheed Martin Environmental Research Corporation. All facilities are managed by Lockheed Martin Energy Systems, Incorporated (Energy Systems) for the DOE. The Y-12 Plant is adjacent to the city of Oak Ridge and is also upstream from Oak Ridge along East Fork Poplar Creek. The portion of the creek downstream from the Y-12 Plant is Lower East Fork Poplar Creek (LEFPC). This project will remove mercury-contaminated soils from the LEFPC floodplain, transport the soils to Industrial Landfill V (ILF-V), and restore any affected areas. This project contains areas that were designated in 1989 as a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) site. The site includes DOE property and portions of commercial, residential, agricultural, and miscellaneous areas within the city of Oak Ridge.



Lake Roosevelt Fisheries Evaluation Program : Meadow Creek vs. Lake Whatcom Stock Kokanee Salmon Investigations in Lake Roosevelt Annual Report 2000-2001.  

DOE Green Energy (OSTI)

Lake Roosevelt has been stocked with Whatcom stock kokanee since 1989 to mitigate for anadromous salmon losses caused by the construction of Grand Coulee Dam. The primary objective of the hatchery plantings was to create a self-sustaining recreational fishery. Due to low return numbers, it was hypothesized a native stock of kokanee might perform better than the coastal Whatcom strain. Therefore, kokanee from Meadow Creek, a tributary of Kootenay Lake, British Columbia were selected as an alternative stock. Matched pair releases of Whatcom stock and Meadow Creek kokanee were made from Sherman Creek in late June 2000. Stock performance between Lake Whatcom and Meadow Creek kokanee was evaluated through three performance measures (1) returns to Sherman Creek, the primary egg collection facility, (2) returns to other tributaries, indicating availability for angler harvest, and (3) returns to the creel. A secondary objective was to evaluate the numbers collected at downstream fish passage facilities. Age 2 kokanee were collected during five passes through the reservoir, which included 89 tributaries between August 17th and November 7th, 2000. Sherman Creek was sampled once a week because it was the primary egg collection location. A total of 2,789 age 2 kokanee were collected, in which 2,658 (95%) were collected at Sherman Creek. Chi-square analysis indicated the Meadow Creek kokanee returned to Sherman Creek in significantly higher numbers compared to the Whatcom stock ({chi}{sup 2} = 734.4; P < 0.01). Reservoir wide recoveries indicated similar results ({chi}{sup 2} = 733.1; P < 0.01). No age 2 kokanee were collected during creel surveys. Age 3 kokanee are expected to recruit to the creel in 2001. No age 2 kokanee were collected at the fish passage facilities due to a 170 mm size restriction at the fish passage centers. Age 3 kokanee are expected to be collected at the fish passage centers during 2001. Stock performance cannot be properly evaluated until 2001, when age 3 kokanee are expected to return to Sherman Creek.

McLellan, Holly J.; Scholz, Allan T.



EM SSAB NATIONAL CHAIRS MEETING Deer Creek State Park, Mt. Sterling, Ohio  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EM SSAB NATIONAL CHAIRS MEETING EM SSAB NATIONAL CHAIRS MEETING Deer Creek State Park, Mt. Sterling, Ohio November 5-7, 2013 DAY 1 - Tuesday, November 5, 2013 8:00 a.m. - 8:20 a.m. Welcome and Opening Remarks Cate Alexander, EM SSAB Designated Federal Officer Will Henderson, Chair, Portsmouth Site Specific Advisory Board William Murphie, Manager, Portsmouth Paducah Project Office, DOE-EM 8:20 a.m. - 8:30 a.m. Overview of Meeting Eric Roberts, Facilitator 8:30 a.m. - 9:30 a.m. EM Program Update Alice Williams, Associate Principal Deputy Assistant Secretary for Environmental Management 9:30 a.m. - 10:20 a.m. Round Robin (Chairs' Site Reports) 5 minutes each 10:20 a.m. - 10:30 a.m. Recognition of Departing Chairs 10:30 a.m. - 10:45 a.m. Break 10:45 a.m. - 12:00


Waste Management Plan for the Lower East Fork Poplar Creek Remedial Action Project Oak Ridge, Tennessee  

SciTech Connect

The Lower East Fork Poplar Creek (LEFPC) Remedial Action project will remove mercury-contaminated soils from the floodplain of LEFPC, dispose of these soils at the Y-12 Landfill V, and restore the affected floodplain upon completion of remediation activities. This effort will be conducted in accordance with the Record of Decision (ROD) for LEFPC as a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) action. The Waste Management Plan addresses management and disposition of all wastes generated during the remedial action for the LEFPC Project Most of the solid wastes will be considered to be sanitary or construction/demolition wastes and will be disposed of at existing Y-12 facilities for those types of waste. Some small amounts of hazardous waste are anticipated, and the possibility of low- level or mixed waste exists (greater than 35 pCi/g), although these are not expected. Liquid wastes will be generated which will be sanitary in nature and which will be capable of being disposed 0214 of at the Oak Ridge Sewage Treatment Plant.



Results of the PDF{trademark} test burn at Clifty Creek Station  

Science Conference Proceedings (OSTI)

Process Derived Fuel (PDF{sup TM}) from the ENCOAL process is different from other coals used to generate steam for the power industry. Although PDF{sup TM} is currently produced from Powder River Basin (PRB) subbituminous coal, the coal structure changes during processing. Compared to the parent coal, PDF{sup TM} contains much less moisture and slightly lower volatile matter resulting in a higher heating value and higher ash per million Btu. These coal properties can potentially benefit utility boiler performance. Combining the high combustion reactivity typical of PRB coals with significantly reduced moisture should produce higher flame zone temperatures and shorter flames. As a result, some boilers may experience increased steam production, better burnout, or lower excess air. The objective of the work contracted to Quinapoxet Engineering was to quantify the impacts of burning PDF{sup TM} on boiler performance at Clifty Creek Unit 3. A unique optical temperature monitor called SpectraTemp was used to measure changes in furnace exit gas temperature (FEGT) with time and boiler operating parameters for both PDF{sup TM} blends as well as a baseline coal blend consisting of 60% PRB coal, 20% Ohio coal, and 20% low-volatile eastern bituminous coal from Virginia. FEGT was then related to net plant heat rate, NO{sub x} emissions, and electrostatic precipitator performance.

Johnson, S.A.; Knottnerus, B.



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Flow Characteristics Analysis of Widows' Creek Type Control Valve for Steam Turbine Control  

Science Conference Proceedings (OSTI)

The steam turbine converts the kinetic energy of steam to mechanical energy of rotor blades in the power conversion system of fossil and nuclear power plants. The electric output from the generator of which the rotor is coupled with that of the steam turbine depends on the rotation velocity of the steam turbine bucket. The rotation velocity is proportional to the mass flow rate of steam entering the steam turbine through valves and nozzles. Thus, it is very important to control the steam mass flow rate for the load following operation of power plants. Among various valves that control the steam turbine, the control valve is most significant. The steam flow rate is determined by the area formed by the stem disk and the seat of the control valve. While the ideal control valve linearly controls the steam mass flow rate with its stem lift, the real control valve has various flow characteristic curves pursuant to the stem lift type. Thus, flow characteristic curves are needed to precisely design the control valves manufactured for the operating conditions of nuclear power plants. OMEGA (Optimized Multidimensional Experiment Geometric Apparatus) was built to experimentally study the flow characteristics of steam flowing inside the control valve. The Widows' Creek type control valve was selected for reference. Air was selected as the working fluid in the OMEGA loop to exclude the condensation effect in this simplified approach. Flow characteristic curves were plotted by calculating the ratio of the measured mass flow rate versus the theoretical mass flow rate of the air. The flow characteristic curves are expected to be utilized to accurately design and operate the control valve for fossil as well as nuclear plants. (authors)

Yoo, Yong H.; Sohn, Myoung S.; Suh, Kune Y. [PHILOSOPHIA, Inc., Seoul National University, San 56-1 Sillim-dong, Gwanak-gu, Seoul, 151-742 (Korea, Republic of)



Sherman Creek Hatchery; Washington Department of Fish and Wildlife Fish Program, 2000 Annual Report.  

DOE Green Energy (OSTI)

The Sherman Creek Hatchery (SCH) was designed to rear 1.7 million kokanee fry for acclimation and imprinting during the spring and early summer. Additionally, it was designed to trap all available returning adult kokanee during the fall for broodstock operations and evaluations. Since the start of this program, the operations on Lake Roosevelt have been modified to better achieve program goals. These strategic changes have been the result of recommendations through the Lake Roosevelt Hatcheries Coordination Team (LRHCT) and were done to enhance imprinting, improve survival and operate the two kokanee facilities more effectively. The primary changes have been to replace the kokanee fingerling program with a yearling (post smolt) program of up to 1,000,000 fish. To construct and operate twenty net pens to handle the increased production. The second significant change was to rear 200,000 rainbow trout fingerling at SCH from July through October, for stocking into the volunteer net pens. This enables the Spokane Tribal Hatchery (STH) to rear additional kokanee to further the enhancement efforts on Lake Roosevelt. Monitoring and evaluation is preformed by the Lake Roosevelt Fisheries Monitoring Program. From 1988 to 1998, the principle sport fishery on Lake Roosevelt has shifted from walleye to include rainbow trout and kokanee salmon (Underwood et al. 1997, Tilson and Scholz 1997). The angler use, harvest rates for rainbow and kokanee and the economic value of the fishery has increased substantially during this 10-year period. The most recent information from the monitoring program also suggests that the hatchery and net pen rearing programs have been beneficial to enhancing the Lake Roosevelt fishery while not negatively impacting wild and native stocks within the lake.

Combs, Mitch (Washington Department of Fish and Wildlife, Kettle Falls, WA)



Assess Current and Potential Salmonid Production in Rattlesnake Creek Associated with Restoration Efforts; Underwood Conservation District, Annual Report 2002-2003.  

DOE Green Energy (OSTI)

This project addresses existing habitat conditions, fish population status, and restoration priority sites within the Rattlesnake Creek watershed, a sub-basin of the White Salmon River. Our partners in this project are the United States Geological Service (USGS), and the Yakama Indian Nation (YIN). Underwood Conservation District (UCD) is involved in the project via accomplishment of water quality monitoring, sampling for stable isotopes, and characterization of the watershed geomorphology. These work items are part of an effort to characterize the stream and riparian habitat conditions in Rattlesnake Creek, to help guide habitat and fish restoration work. Water chemistry and temperature information is being collected both on Rattlesnake Creek, and on other tributaries and the main stem of the White Salmon River. Information on the entire system enables us to compare results obtained from Rattlesnake Creek with the rest of the White Salmon system. Water chemistry and temperature data have been collected in a manner that is comparable with data gathered in previous years. The results from data gathered in the 2001-2002 performance period are reported in appendix A at the end of this 2002-2003 report. Additional work being conducted as part of this study includes; an estimate of salmonid population abundance (YIN and USGS); a determination of fish species composition, distribution, and life history (YIN and USGS), and a determination of existing kinds, distribution, and severity of fish diseases (YIN and USGS). The overall objective is to utilize the above information to prioritize restoration efforts in Rattlesnake Creek.

White, Jim



Potential for CO2 Sequestration and Enhanced Coalbed Methane Production, Blue Creek Field, NW Black Warrior Basin, Alabama  

E-Print Network (OSTI)

Carbon dioxide (CO2) is a primary source of greenhouse gases. Injection of CO2 from power plants near coalbed reservoirs is a win-win method to reducing emissions of CO2 to the atmosphere. Limited studies have investigated CO2 sequestration and enhanced coalbed methane production in San Juan and Alberta basins, but reservoir modeling is needed to assess the potential of the Black Warrior basin. Alabama ranks 9th nationally in CO2 emissions from power plants; two electricity generation plants are adjacent to the Black Warrior coalbed methane fairway. This research project was a reservoir simulation study designed to evaluate the potential for CO2 sequestration and enhanced coalbed methane (ECBM) recovery in the Blue Creek Field of Black Warrior basin, Alabama. It considered the injection and production rate, the components of injected gas, coal dewatering, permeability anisotropy, various CO2 soak times, completion of multiple reservoir layers and pressure constraints at the injector and producer. The simulation study was based on a 5-spot well pattern 40-ac well spacing. Injection of 100 percent CO2 in coal seams resulted in average volumes of 0.57 Bcf of sequestered CO2 and average volumes of 0.2 Bcf of enhance methane production for the Mary Lee coal zone only, from an 80-acre 5-spot well pattern. For the entire Blue Creek field of the Black Warrior basin, if 100 percent CO2 is injected in the Pratt, Mary Lee and Black Creek coal zones, enhance methane resources recovered are estimated to be 0.3 Tcf, with a potential CO2sequestration capacity of 0.88 Tcf. The methane recovery factor is estimated to be 68.8 percent, if the three coal zones are completed but produced one by one. Approximately 700 wells may be needed in the field. For multi-layers completed wells, the permeability and pressure are important in determining the breakthrough time, methane produced and CO2 injected. Dewatering and soaking do not benefit the CO2 sequestration process but allow higher injection rates. Permeability anisotropy affects CO2 injection and enhanced methane recovery volumes of the field. I recommend a 5-spot pilot project with the maximum well BHP of 1,000 psi at the injector, minimum well BHP of 500 psi at the producer, maximum injection rate of 70 Mscf/D, and production rate of 35 Mscf/D. These technical results, with further economic evaluation, could generate significant projects for CO2 sequestration and enhance coalbed methane production in Blue Creek field, Black Warrior Basin, Alabama.

He, Ting



DOE/EA-1371; Integrated Natural Resources Management Plan, Environmental Assessment, and Finding of No Significant Impacts for Rock Creek Reserve (5/2001)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

INTEGRATED NATURAL RESOURCES MANAGEMENT PLAN, ENVIRONMENTAL ASSESSMENT and Finding Of No Significant Impacts for ROCK CREEK RESERVE 2001-Closure DOE/EA - 1371 Department of Energy Rocky Flats Environmental Technology Site and The U.S. Fish & Wildlife Service May, 2001 Dear Stakeholder: Enclosed is the Final Rock Creek Reserve Integrated Natural Resources Management Plan (Plan), Environmental Assessment (EA), and Finding Of No Significant Impacts (FONSI). The Rock Creek Reserve was dedicated on May 17, 1999, to be jointly managed by the US Fish and Wildlife Service and US Department of Energy. This Plan/EA was developed in accordance with the National Environmental Policy Act (NEPA) process. Through cooperation with the U.S. Fish and Wildlife Service for joint


Superfund Record of Decision (EPA Region 8): Silver Bow Creek/Butte Area, MT. (Second remedial action), June 1992. Interim report  

Science Conference Proceedings (OSTI)

The Silver Bow Creek/Butte Area site is a mining and processing area located 7 miles east of Anaconda in the Upper Clark Fork River Basin, Deer Lodge County, Montana. Site contamination is the result of over 100 years of mining and process operations in the area. Until the early 1970's, mining, milling, and smelting wastes were dumped directly into Silver Bow Creek and transported downstream. The ROD addresses an interim remedy for all media at OU12. The primary contaminants of concern affecting the soil, sediment, ground water, and surface water in the Inactive area are metals, including arsenic, chromium, and lead; and inorganics.

Not Available



Columbia River Wildlife Mitigation Habitat Evaluation Procedures Report / Scotch Creek Wildlife Area, Berg Brothers, and Douglas County Pygmy Rabbit Projects.  

DOE Green Energy (OSTI)

This Habitat Evaluation Procedure study was conducted to determine baseline habitat units (HUs) on the Scotch Creek, Mineral Hill, Pogue Mountain, Chesaw and Tunk Valley Habitat Areas (collectively known as the Scotch Creek Wildlife Area) in Okanogan County, Sagebrush Flat and the Dormaler property in Douglas County, and the Berg Brothers ranch located in Okanogan County within the Colville Reservation. A HEP team comprised of individuals from the Washington Department of Fish and Wildlife, the Confederated Tribes of the Colville Reservation, and the Natural Resources Conservation Service (Appendix A) conducted baseline habitat surveys using the following HEP evaluation species: mule deer (Odocoileus hemionus), sharp-tailed grouse (Tympanuchus phasianellus), pygmy rabbit (Brachylagus idahoensis), white-tailed deer (Odocoileus virginiana), mink (Mustela vison), Canada goose (Branta canadensis), downy woodpecker (Picoides pubescens), Lewis woodpecker (Melanerpes lewis), and Yellow warbler (Dendroica petechia). Results of the HEP analysis are listed below. General ratings (poor, marginal, fair, etc.,) are described in Appendix B. Mule deer habitat was marginal lacking diversity and quantify of suitable browse species. Sharp-tailed grouse habitat was marginal lacking residual nesting cover and suitable winter habitat Pygmy rabbit habitat was in fair condition except for the Dormaier property which was rated marginal due to excessive shrub canopy closure at some sites. This report is an analysis of baseline habitat conditions on mitigation project lands and provides estimated habitat units for mitigation crediting purposes. In addition, information from this document could be used by wildlife habitat managers to develop management strategies for specific project sites.

Ashley, Paul R.



Integrated Status and Effectiveness Monitoring Program Population Estimates for Juvenile Salmonids in Nason Creek, WA ; 2008 Annual Report.  

DOE Green Energy (OSTI)

This report summarizes juvenile coho, spring Chinook, and steelhead salmon migration data collected at a 1.5m diameter cone rotary fish trap on Nason Creek during 2008; providing abundance and freshwater productivity estimates. We used species enumeration at the trap and efficiency trials to describe emigration timing and to estimate the number of emigrants. Trapping began on March 2, 2008 and was suspended on December 11, 2008 when snow and ice accumulation prevented operation. During 2008, 0 brood year (BY) 2006 coho, 1 BY2007 coho, 906 BY2006 spring Chinook, 323 BY2007 fry Chinook, 2,077 BY2007 subyearling Chinook, 169 steelhead smolts, 414 steelhead fry and 2,390 steelhead parr were trapped. Mark-recapture trap efficiency trials were performed over a range of stream discharge stages. A total of 2,639 spring Chinook, 2,154 steelhead and 12 bull trout were implanted with Passive Integrated Transponder (PIT) tags. Most PIT tagged fish were used for trap efficiency trials. We were unable to identify a statistically significant relationship between stream discharge and trap efficiency, thus, pooled efficiency estimates specific to species and trap size/position were used to estimate the number of fish emigrating past the trap. We estimate that 5,259 ({+-} 359; 95% CI) BY2006 Chinook, 16,816 ({+-} 731; 95% CI) BY2007 Chinook, and 47,868 ({+-} 3,780; 95% CI) steelhead parr and smolts emigrated from Nason Creek in 2008.

Collins, Matthew; Murdoch, Keely [Yakama Nation Fisheries Resource Management



Fisheries Enhancement on the Coeur d'Alene Indian Reservation; Hangman Creek, Annual Report 2001-2002.  

DOE Green Energy (OSTI)

Historically, Hangman Creek produced Chinook salmon (Oncorhynchus tshawytscha) and Steelhead trout (Oncorhynchus mykiss) for the Upper Columbia Basin Tribes. One weir, located at the mouth of Hangman Creek was reported to catch 1,000 salmon a day for a period of 30 days a year (Scholz et al. 1985). The current town of Tekoa, Washington, near the state border with Idaho, was the location of one of the principle anadromous fisheries for the Coeur d'Alene Tribe (Scholz et al. 1985). The construction, in 1909, of Little Falls Dam, which was not equipped with a fish passage system, blocked anadromous fish access to the Hangman Watershed. The fisheries were further removed with the construction of Chief Joseph and Grand Coulee Dams. As a result, the Coeur d'Alene Indian Tribe was forced to rely more heavily on native fish stocks such as Redband trout (Oncorhynchus mykiss gairdneri), Westslope Cutthroat trout (O. clarki lewisii), Bull trout (Salvelinus confluentus) and other terrestrial wildlife. Historically, Redband and Cutthroat trout comprised a great deal of the Coeur d'Alene Tribe's diet (Power 1997).

Peters, Ronald; Kinkead, Bruce; Stanger, Mark



Remedial investigation/feasibility study of the Clinch River/Poplar Creek operable unit. Volume 1: Main text  

Science Conference Proceedings (OSTI)

This report presents the findings of an investigation into contamination of the Clinch River and Poplar Creek near the US Department of Energy`s (DOE`s) Oak Ridge Reservation (ORR) in eastern Tennessee. For more than 50 years, various hazardous and radioactive substances have been released to the environment as a result of operations and waste management activities at the ORR. In 1989, the ORR was placed on the National Priorities List (NPL), established and maintained under the federal Comprehensive environmental Response, Compensation, and Liability Act of 1980 (CERCLA). Under CERCLA, NPL sites must be investigated to determine the nature and extent of contamination at the site, assess the risk to human health and the environment posed by the site, and, if necessary, identify feasible remedial alternatives that could be used to clean the site and reduce risk. To facilitate the overall environmental restoration effort at the ORR, CERCLA activities are being implemented individually as distinct operable units (OUs). This document is the combined Remedial Investigation and Feasibility Study Report for the Clinch River/Poplar Creek OU.




T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos


Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Assess Current and Potential Salmonid Production in Rattlesnake Creek in Association with Restoration Efforts, US Geological Survey Report, 2004-2005 Annual Report.  

SciTech Connect

This project was designed to document existing habitat conditions and fish populations within the Rattlesnake Creek watershed (White Salmon River subbasin, Washington) before major habitat restoration activities are implemented and prior to the reintroduction of salmon and steelhead above Condit Dam. Returning adult salmon Oncorhynchus spp. and steelhead O. mykiss have not had access to Rattlesnake Creek since 1913. An assessment of resident trout populations should serve as a good surrogate for evaluation of factors that would limit salmon and steelhead production in the watershed. Personnel from United States Geological Survey's Columbia River Research Laboratory (USGS-CRRL) attended to three main objectives of the Rattlesnake Creek project. The first objective was to characterize stream and riparian habitat conditions. This effort included measures of water quality, water quantity, stream habitat, and riparian conditions. The second objective was to determine the status of fish populations in the Rattlesnake Creek drainage. To accomplish this, we derived estimates of salmonid population abundance, determined fish species composition, assessed distribution and life history attributes, obtained tissue samples for genetic analysis, and assessed fish diseases in the watershed. The third objective was to use the collected habitat and fisheries information to help identify and prioritize areas in need of restoration. As this report covers the fourth year of a five-year study, it is largely restricted to describing our efforts and findings for the first two objectives.

Allen, M. Brady; Connolly, Patrick J.; Jezorek, Ian G. (US Geological Survey, Western Fisheries Research Center, Columbia River Research Laboratory, Cook, WA)



Life Cycle Management Planning at Wolf Creek Generating Station: EDG, Main Steam, and Feedwater Isolation Valves, and Reactor Protec tion System  

Science Conference Proceedings (OSTI)

As the electric power industry becomes more competitive, life cycle management (LCM) of systems, structures, and components (SSCs) becomes very important to keep plants economically viable throughout their remaining licensed operating terms (either 40-year or 60-year terms). This report provides the industry with lessons learned from applying EPRI's LCM planning process to three SSCs at Wolf Creek Generating Station.



Final report from VFL technologies for the pilot-scale thermal treatment of Lower East Fork Poplar Creek floodplain soils. LEFPC Appendices, Volume 2, Appendix V-A  

Science Conference Proceedings (OSTI)

This document contains information concerning validation of analytical data for the pilot-scale thermal treatment of Lower East Fork Poplar Creek Floodplain soils located at the Y-12 Plant site. This volume is an appendix of compiled data from this validation process.




Obama Administration Announces More Than $32 Million for Energy Projects in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

32 Million for Energy 32 Million for Energy Projects in Michigan Obama Administration Announces More Than $32 Million for Energy Projects in Michigan June 22, 2009 - 12:00am Addthis Battle Creek, MI - U.S. Department of Energy Secretary Steven Chu today announced more than $32 million in Recovery Act funding to support energy efficiency and renewable energy projects in Michigan. Under DOE's State Energy Program, states have proposed statewide plans that prioritize energy savings, create or retain jobs, increase the use of renewable energy, and reduce greenhouse gas emissions. This initiative is part of the Obama Administration's national strategy to support job growth, while making a historic down payment on clean energy. "This funding will provide an important boost for state economies, help put


Findings of No Significant Impact (FONSI) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

March 30, 2010 March 30, 2010 EA-1708: Finding of No Significant Impact Dow Kokam Mi, LLC, Manufacture Advanced Lithium POlymer Batteries for Hybrid and Electric Vehicles At Midland, Michigan March 30, 2010 EA-1725: Finding of No Significant Impact SBE, Inc. Electric Drive Vehicle Battery and Component Manufacturing Initiative Application, Power Ring Manufacturing Scale-up, Barre, Vermont March 25, 2010 EA-1714: Finding of No Significant Impact Toda America, Incorporated, Electric Drive Vehicle Battery and Component Manufacturing Initiative Project, Battle Creek, Michigan March 25, 2010 EA-1717: Finding of No Significant Impact BASF Catalysts, LLC Electric Drive Vehicle Battery and Component Manufacturing Initiative Project, Elyria, Ohio March 22, 2010 EA-1774: Finding of No Significant Impact


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

01 - 12710 of 26,764 results. 01 - 12710 of 26,764 results. Download EA 1714: Final Environmental Assessment Toda America, Incorporated Electric Drive Vehicle Battery and Component Manufacturing Initiative Project Battle Creek, MI http://energy.gov/nepa/downloads/ea-1714-final-environmental-assessment Download DOE-STD-1195-2011 Design of Safety Significant Safety Instrumented Systems Used at DOE Non-Reactor Nuclear Facilities This standard provides requirements and guidance for the design, procurement, installation, testing, maintenance, operation, and quality assurance of safety instrumented systems (SIS) that may be used at Department of Energy (DOE) nonreactor nuclear facilities for safety significant (SS) functions. http://energy.gov/hss/downloads/doe-std-1195-2011 Download DOE-STD-1193-2010


DOE/EA-1508: Environmental Assessment for the Beaver Creek-Hoyt-Erie Transmission Line Rebuild Project  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

BC-HT-EE Mitigation Action Plan Nov. 2005 1 BC-HT-EE Mitigation Action Plan Nov. 2005 1 Mitigation Action Plan To Implement Mitigation Requirements for Beaver Creek-Hoyt-Erie Transmission Line Upgrade Project Morgan and Weld Counties, Colorado November 2005 BC-HT-EE Mitigation Action Plan Nov. 2005 2 Action Plan for Standard Project Practices and Mitigation Mitigation Action Identifier Responsible Party for Implementing Mitigation Action Party Responsible for Monitoring and Ensuring Compliance Construction Contractor Western Maintenance The contractor shall limit the movement of crews and equipment to the ROW, including access routes. The contractor shall limit movement on the ROW to minimize damage to residential yards, grazing land, crops, orchards, and property, and shall avoid marring the lands.


Association of coal metamorphism and hydrothermal mineralization in Rough Creek fault zone and Fluorspar District, Western Kentucky  

SciTech Connect

The ambient coal rank (metamorphism) of the Carboniferous coals in the Western Kentucky coalfield ranges from high volatile A bituminous (vitrinite maximum reflectance up to 0.75% R/sub max/) in the Webster syncline (Webster and southern Union Counties) to high volatile C bituminous (0.45 to 0.60% R/sub max/) over most of the remainder of the area. Anomalous patterns of metamorphism, however, have been noted in coals recovered from cores and mines in fault blocks of the Rough Creek fault zone and Fluorspar District. Coals in Gil-30 borehole (Rough Creek faults, Bordley Quadrangle, Union County) vary with no regard for vertical position, from high volatile C(0.55% R/sub max/) to high volatile A (0.89%R/sub max) bituminous. Examination of the upper Sturgis Formation (Missourian/Virgilian) coals revealed that the higher rank (generally above 0.75% R/sub max/) coals had vein mineral assemblages of sphalerite, twinned calcite, and ferroan dolomite. Lower rank coals had only untwinned calcite. Several sites in Webster County contain various coals (Well (No. 8) to Coiltwon (No. 14)) with vitrinite reflectances up to 0.83% R/sub max/ and associated sphalerite mineralization. Mississippian and Lower Pennsylvanian (Caseyville Formation Gentry coal) coals in the mineralized Fluorspar District have ranks to nearly medium volatile bituminous (1.03% R/sub max/). The regional rank trend exhibited by the fualt zones is generally higher rank than the surrounding areas. Sphalerite mineralization in itself is not unique within Illinois basin coals, but if it was partly responsible for the metamorphism of these coals, then the fluid temperature must have been higher within the above mentioned fault complexes.

Hower, J.C.; Fiene, F.L.; Trinkle, E.J.



Remedial investigation/feasibility study for the Clinch River/Poplar Creek operable unit. Volume 1. Main text  

SciTech Connect

This is the combined Remedial Investigation/Feasibility Study Report for the Clinch River/Poplar Crack (CR/PC) Operable Unit (OU). The CR/PC OU is located in Anderson and Roane Counties, Tennessee and consists of the Clinch River and several of its embayments in Melton Hill and Watts Bar Reservoirs. These waters have received hazardous substances released over a period of 50 years from the US Department of Energy`s Oak Ridge Reservation (ORR), a National Priority List site established under the Comprehensive Environmental Response, Compensation, and Liability Act. A remedial investigation has been conducted to determine the current nature and extent of any contamination and to assess the resulting risk to human health and the environment. The feasibility study evaluates remedial action alternatives to identify any that are feasible for implementation and that would effectively reduce risk. Historical studies had indicated that current problems would likely include {sup 137}Cs in sediment of the Clinch River, mercury in sediment and fish of Poplar Creek and PCBs and pesticides in fish from throughout the OU. Peak releases of mercury and {sup 137}Cs occurred over 35 years ago, and current releases are low. Past releases of PCBs from the ORR are poorly quantified, and current releases are difficult to quantify because levels are so low. The site characterization focused on contaminants in surface water, sediment, and biota. Contaminants in surface water were all found to be below Ambient Water Quality Criteria. Other findings included the following: elevated metals including cesium 137 and mercury in McCoy Branch sediments; PCBs and chlordane elevated in several fish species, presenting the only major human health risk, significant ecological risks in Poplar Creek but not in the Clinch River.




Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Minthorn Springs Creek Summer Juvenile Release and Adult Collection Facility; 1992 Annual Report.  

DOE Green Energy (OSTI)

The Confederated Tribes of the Umatilla Indian Reservation (CT'UIR) and Oregon Department of Fish and Wildlife (ODFW) are cooperating in a joint effort to supplement steelhead and re-establish salmon runs in the Umatilla River Basin. As an integral part of this program, Bonifer and Minthorn Acclimation Facilities are operated for holding and spawning adult steelhead and fall chinook salmon and acclimation and release of juvenile salmon and steelhead. Acclimation of 109,101 spring chinook salmon and 19,977 summer steelhead was completed at Bonifer in the spring of 1992. At Minthorn, 47,458 summer steelhead were acclimated and released. Control groups of spring chinook salmon were released instream concurrent with the acclimated releases to evaluate the effects of acclimation on adult returns to the Umatilla River. Acclimation studies with summer steelhead were not conducted in 1992. A total of 237 unmarked adult steelhead were collected for broodstock at Three Mile Dam from October 18, 1991 through April 24, 1992 and held at Minthorn. Utilizing a 3 x 3 spawning matrix, a total of 476,871 green eggs were taken from 86 females. The eggs were transferred to Umatilla Hatchery for incubation, rearing, and later release into the Umatilla River. A total of 211 fall chinook salmon were also collected for broodstock at Three Mile Dam and held at Minthorn. Using a 1:1 spawning ratio, a total of 195,637 green eggs were taken from 58 females. They were also transferred to Umatilla Hatchery for incubation, rearing, and later release into the Umatilla River. Personnel from the ODFW Eastern Oregon Fish Pathology Laboratory in La Grande took samples of tissues and reproductive fluids from Umatilla River summer steelhead and fall chinook salmon broodstock for monitoring and evaluation purposes. Cell culture assays for replicating agents, including IHNV virus, on all spawned fish were negative. One of 60 summer steelhead tested positive for EIBS virus, while all fall chinook tested we re negative for inclusions. One of 73 summer steelhead sampled for BKD had a high level of antigen, while all others had very low or negative antigen levels. All fall chinook tested had low or negative antigen levels. Regularly-scheduled maintenance of pumps, equipment and facilities was performed in 1992. The progress of outmigration for juvenile releases was monitored at the Westland Canal fish trapping facility by CTUIR and ODFW personnel. Coho and spring chinook yearlings were released in mid-March at Umatilla rivermile (RM) 56 and 60. The peak outmigration period past Westland (RM 27) was mid-April to early May, approximately four to seven weeks after release. Groups of summer steelhead were released from Minthorn (RM 63) and Bonifer (RM 81) in late March and into Meacham Creek near Bonifer in late April. The peak outmigration period past Westland for all groups appeared to be the first two to three weeks in May. Spring chinook yearlings released in mid-April from Bonifer and at Umatilla RM 89, migrated rapidly downriver and the peak outmigration period past Westland appeared to be within a week or two after release. Fall and spring chinook subyearlings released in mid-May at RM 42 and 60, respectively, also migrated rapidly downriver and the peak outmigration period was within days after release. Coded-wire tag recovery information was accessed to determine the contribution of Umatilla River releases to the ocean, Columbia River and Umatilla River fisheries. Total estimated summer steelhead survival have ranged from 0.03 to 0.61% for releases in which recovery information is complete. Coho survival rates have ranged from 0.15 to 4.14%, and spring chinook yearling survival rates from spring releases have ranged from 0.72 to 0.74%. Survival rates of fall chinook yearlings have ranged from 0.08 to 3.01%, while fall chinook subyearling survival rates have ranged from 0.25 to 0.87% for spring released groups.

Rowan, Gerald D.



DOE/EIS-0265-SA-162: Supplement Analysis for the Watershed Management Program EIS -Libby Creek Lower Cleveland Stabilization Project (07/29/04)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

29, 2004 29, 2004 REPLY TO ATTN OF: KEC-4 SUBJECT: Supplement Analysis for the Watershed Management Program EIS (DOE/EIS-0265/SA-162) Ron Morinaka (KEWU - 4) Fish and Wildlife Project Manager - COTR Proposed Action: Libby Creek (Lower Cleveland) Stabilization Project Project No: 199500400 Watershed Management Program (See App. A : Available Management Techniques): 1.6 Install Large Woody Debris Structures; 1.7 Install Other Habitat Complexity Structures; 1.9 Structural Bank Protection using Bioengineering Methods; 1.16 Spawning Habitat Enhancements; 1.17 Rearing Habitat Enhancements; 2.1 Maintain Healthy Riparian Plant Communities. Location: On Libby Creek, located about 18 miles southwest of the town of Libby, Montana


Indications of mineral zoning in a fossil hydrothermal system at the Meager Creek geothermal prospect, British Columbia, Canada, from induced polarization studies  

SciTech Connect

By measuring the induced-polarization parameters m (chargeability) and tau (time-constant) we have found evidence that the center of a presumed fossil hydrothermal system at Meager Creek, British Columbia, lies south of the main manifestation of the present-day convective hydrothermal system. What implication this finding has for development of the present-day system is unknown. However, some of the fractures formed during the development of the fossil hydrothermal system may serve as conduits for fluids of the present-day system. The analysis is limited by the lack of availability of a good subsurface distribution of core samples. Nevertheless, a surface induced-polarization survey is expected to yield information about the geometry of the fossil system. Such knowledge would have implications not only for Meager Creek but for other hydrothermal systems of Cascades volcano type. 16 refs., 15 figs., 1 tab.

Ward, S.H.; Zhao, J.X.; Groenwald, J.; Moore, J.N.



Propane tank explosion (2 deaths, 7 injuries) at Herrig Brothers Feather Creek Farm, Albert City, Iowa, April 9, 1998. Investigation report  

SciTech Connect

This report explains the explosion/BLEVE that took place on April 9, 1998, at the Herrig Brothers Feather Creek Farm, located in Albert City, Iowa. Two volunteer fire fighters were killed and seven other emergency response personnel were injured. Safety issues covered in the report include protection of propane storage tanks and piping, state regulatory oversight of such installations, and fire fighter response to propane storage tank fires.




Life Cycle Management Plans for Hope Creek and Salem: Feedwater Heater and Moisture Separator Controls, Circuit Breakers, and Station Air System  

Science Conference Proceedings (OSTI)

As the electric power industry becomes more competitive, life cycle management (LCM) of systems, structures, and components (SSCs) becomes more important to keep nuclear power plants economically viable throughout their remaining licensed operating terms, whether 40 or 60 years. This report provides utilities with optimized LCM plans for three SSC types at PSEG's Salem and Hope Creek generating stations for use as a resource for LCM planning for these SSC types at other plants.



White Oak Creek Watershed: Melton Valley Area Remedial Investigation Report, Oak Ridge National Laboratory, Oak Ridge, Tennessee: Volume 3 Appendix C  

SciTech Connect

This report provides details on the baseline ecological risk assessment conducted in support of the Remedial Investigation (RI) Report for the Melton Valley areas of the White Oak Creek watershed (WOCW). The RI presents an analysis meant to enable the US Department of Energy (DOE) to pursue a series of remedial actions resulting in site cleanup and stabilization. The ecological risk assessment builds off of the WOCW screening ecological risk assessment. All information available for contaminated sites under the jurisdiction of the US Department of Energy`s Comprehensive Environmental Response, Compensation, and Liability Act Federal Facilities Agreement within the White Oak Creek (WOC) RI area has been used to identify areas of potential concern with respect to the presence of contamination posing a potential risk to ecological receptors within the Melton Valley area of the White Oak Creek watershed. The risk assessment report evaluates the potential risks to receptors within each subbasin of the watershed as well as at a watershed-wide scale. The WOC system has been exposed to contaminant releases from Oak Ridge National Laboratory and associated operations since 1943 and continues to receive contaminants from adjacent waste area groupings.




Final report for the pilot-scale thermal treatment of Lower East Fork Poplar Creek floodplain soils  

SciTech Connect

IT Corporation (IT) was contracted by Martin Marietta Energy Systems, Inc. (Energy Systems) to perform a pilot-scale demonstration of the effectiveness of thermal desorption as a remedial technology for removing mercury from the Lower East Fork Poplar Creek (LEFPC) floodplain soil. Previous laboratory studies by Energy Systems suggested that this technology could reduce mercury to very low levels. This pilot-scale demonstration study was initiated to verify on an engineering scale the performance of thermal desorption. This report includes the details of the demonstration study, including descriptions of experimental equipment and procedures, test conditions, sampling and analysis, quality assurance (QA), detailed test results, and an engineering assessment of a conceptual full-scale treatment facility. The specific project tasks addressed in this report were performed between October 1993 and June 1994. These tasks include soil receipt, preparation, and characterization; prepilot (bench-scale) desorption tests; front-end materials handling tests; pilot tests; back-end materials handling tests; residuals treatment; and engineering scale-up assessment.



Postremediation monitoring program baseline assessment report, Lower East Fork Poplar Creek, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee  

SciTech Connect

Lower East Fork Poplar Creek (LEFPC) and its floodplain are contaminated with mercury (Hg) from ongoing and historical releases from the US Department of Energy (DOE) Oak Ridge Y-12 Plant. A remedial investigation and feasibility study of LEFPC resulted in the signing of a Record of Decision (ROD) in August 1995. In response to the ROD, soil contaminated with mercury above 400 mg/kg was removed from two sites in LEFPC and the floodplain during a recently completed remedial action (RA). The Postremediation Monitoring Program (PMP) outlined in the LEFPC Monitoring Plan was envisioned to occur in two phases: (1) a baseline assessment prior to remediation and (2) postremediation monitoring. The current report summarizes the results of the baseline assessment of soil, water, biota, and groundwater usage in LEFPC and its floodplain conducted in 1995 and 1996 by personnel of the Oak Ridge National Laboratory Biological Monitoring and Abatement Program (BMAP). This report also includes some 1997 data from contaminated sites that did not undergo remediation during the RA (i.e., sites where mercury is greater than 200 mg/kg but less than 400 mg/kg). The baseline assessment described in this document is distinct and separate from both the remedial investigation/feasibility study the confirmatory sampling conducted by SAIC during the RA. The purpose of the current assessment was to provide preremediation baseline data for the LEFPC PMP outlined in the LEFPC Monitoring Plan, using common approaches and techniques, as specified in that plan.

Greeley, M.S. Jr.; Ashwood, T.L.; Kszos, L.A.; Peterson, M.J.; Rash, C.D.; Southworth, G.R. [Oak Ridge National Lab., TN (United States); Phipps, T.L. [CKY, Inc. (United States)



White Oak Creek Embayment time-critical CERCLA removal action sediment-retention structure. Environmental Restoration Program  

SciTech Connect

Over a 20-month period between September 1990 and April 1992, the Department of Energy (DOE), acting through Martin Marietta Energy Systems, Inc., managing contractor for the DOE Oak Ridge Field Office (DOE-OR), conducted a DOE-lead and DOE-funded time-critical removal action at the White Oak Creek Embayment (WOCE), pursuant to the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA). The time-critical removal action specifically consisted of the design and construction of a sediment-retention structure across the mouth of WOCE to prevent off-site migration of sediments contaminated by cesium ({sup 137}Cs) into the Clinch River. Construction of a sediment-retention structure was completed in mid-April 1992. The purpose of this report is to meet the substantive requirements of 40 CFR 300.165 describing ``a complete report on the removal operation and the actions taken.`` This section of the NCP specifically addresses on-scene coordinator reports for the Environmental Protection Agency (EPA) Superfund-lead actions and includes several elements that are not applicable to this DOE-lead action. Only those sections that are pertinent and applicable are addressed in this final report.


Note: This page contains sample records for the topic "battle creek mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Sources of Mercury to East Fork Poplar Creek Downstream from the Y-12 National Security Complex: Inventories and Export Rates  

SciTech Connect

East Fork Poplar Creek (EFPC) in Oak Ridge, Tennessee, has been heavily contaminated with mercury (also referred to as Hg) since the 1950s as a result of historical activities at the U.S. Department of Energy (DOE) Y-12 National Security Complex (formerly the Oak Ridge Y-12 Plant and hereinafter referred to as Y-12). During the period from 1950 to 1963, spills and leaks of elemental mercury (Hg{sup 0}) contaminated soil, building foundations, and subsurface drainage pathways at the site, while intentional discharges of mercury-laden wastewater added 100 metric tons of mercury directly to the creek (Turner and Southworth 1999). The inventory of mercury estimated to be lost to soil and rock within the facility was 194 metric tons, with another estimated 70 metric tons deposited in floodplain soils along the 25 km length of EFPC (Turner and Southworth 1999). Remedial actions within the facility reduced mercury concentrations in EFPC water at the Y-12 boundary from > 2500 ng/L to about 600 ng/L by 1999 (Southworth et al. 2000). Further actions have reduced average total mercury concentration at that site to {approx}300 ng/L (2009 RER). Additional source control measures planned for future implementation within the facility include sediment/soil removal, storm drain relining, and restriction of rainfall infiltration within mercury-contaminated areas. Recent plans to demolish contaminated buildings within the former mercury-use areas provide an opportunity to reconstruct the storm drain system to prevent the entry of mercury-contaminated water into the flow of EFPC. Such actions have the potential to reduce mercury inputs from the industrial complex by perhaps as much as another 80%. The transformation and bioaccumulation of mercury in the EFPC ecosystem has been a perplexing subject since intensive investigation of the issue began in the mid 1980s. Although EFPC was highly contaminated with mercury (waterborne mercury exceeded background levels by 1000-fold, mercury in sediments by more than 2000-fold) in the 1980s, mercury concentrations in EFPC fish exceeded those in fish from regional reference sites by only a little more than 10-fold. This apparent low bioavailability of mercury in EFPC, coupled with a downstream pattern of mercury in fish in which mercury decreased in proportion to dilution of the upstream source, lead to the assumption that mercury in fish would respond to decreased inputs of dissolved mercury to the stream's headwaters. However, during the past two decades when mercury inputs were decreasing, mercury concentrations in fish in Lower EFPC (LEFPC) downstream of Y-12 increased while those in Upper EFPC (UEFPC) decreased. The key assumption of the ongoing cleanup efforts, and concentration goal for waterborne mercury were both called into question by the long-term monitoring data. The large inventory of mercury within the watershed downstream presents a concern that the successful treatment of sources in the headwaters may not be sufficient to reduce mercury bioaccumulation within the system to desired levels. The relative importance of headwater versus floodplain mercury sources in contributing to mercury bioaccumulation in EFPC is unknown. A mercury transport study conducted by the Tennessee Valley Authority (TVA) in 1984 estimated that floodplain sources contributed about 80% of the total annual mercury export from the EFPC system (ORTF 1985). Most of the floodplain inputs were associated with wet weather, high flow events, while much of the headwater flux occurred under baseflow conditions. Thus, day-to-day exposure of biota to waterborne mercury was assumed to be primarily determined by the Y-12 source. The objective of this study was to evaluate the results of recent studies and monitoring within the EFPC drainage with a focus on discerning the magnitude of floodplain mercury sources and how long these sources might continue to contaminate the system after headwater sources are eliminated or greatly reduced.

Southworth, George R [ORNL; Greeley Jr, Mark Stephen [ORNL; Peterson, Mark J [ORNL; Lowe, Kenneth Alan [ORNL; Ketelle, Richard H [ORNL; Floyd, Stephanie B [ORNL



Sources of Mercury to East Fork Poplar Creek Downstream from the Y-12 National Security Complex: Inventories and Export Rates  

SciTech Connect

East Fork Poplar Creek (EFPC) in Oak Ridge, Tennessee, has been heavily contaminated with mercury (also referred to as Hg) since the 1950s as a result of historical activities at the U.S. Department of Energy (DOE) Y-12 National Security Complex (formerly the Oak Ridge Y-12 Plant and hereinafter referred to as Y-12). During the period from 1950 to 1963, spills and leaks of elemental mercury (Hg{sup 0}) contaminated soil, building foundations, and subsurface drainage pathways at the site, while intentional discharges of mercury-laden wastewater added 100 metric tons of mercury directly to the creek (Turner and Southworth 1999). The inventory of mercury estimated to be lost to soil and rock within the facility was 194 metric tons, with another estimated 70 metric tons deposited in floodplain soils along the 25 km length of EFPC (Turner and Southworth 1999). Remedial actions within the facility reduced mercury concentrations in EFPC water at the Y-12 boundary from > 2500 ng/L to about 600 ng/L by 1999 (Southworth et al. 2000). Further actions have reduced average total mercury concentration at that site to {approx}300 ng/L (2009 RER). Additional source control measures planned for future implementation within the facility include sediment/soil removal, storm drain relining, and restriction of rainfall infiltration within mercury-contaminated areas. Recent plans to demolish contaminated buildings within the former mercury-use areas provide an opportunity to reconstruct the storm drain system to prevent the entry of mercury-contaminated water into the flow of EFPC. Such actions have the potential to reduce mercury inputs from the industrial complex by perhaps as much as another 80%. The transformation and bioaccumulation of mercury in the EFPC ecosystem has been a perplexing subject since intensive investigation of the issue began in the mid 1980s. Although EFPC was highly contaminated with mercury (waterborne mercury exceeded background levels by 1000-fold, mercury in sediments by more than 2000-fold) in the 1980s, mercury concentrations in EFPC fish exceeded those in fish from regional reference sites by only a little more than 10-fold. This apparent low bioavailability of mercury in EFPC, coupled with a downstream pattern of mercury in fish in which mercury decreased in proportion to dilution of the upstream source, lead to the assumption that mercury in fish would respond to decreased inputs of dissolved mercury to the stream's headwaters. However, during the past two decades when mercury inputs were decreasing, mercury concentrations in fish in Lower EFPC (LEFPC) downstream of Y-12 increased while those in Upper EFPC (UEFPC) decreased. The key assumption of the ongoing cleanup efforts, and concentration goal for waterborne mercury were both called into question by the long-term monitoring data. The large inventory of mercury within the watershed downstream presents a concern that the successful treatment of sources in the headwaters may not be sufficient to reduce mercury bioaccumulation within the system to desired levels. The relative importance of headwater versus floodplain mercury sources in contributing to mercury bioaccumulation in EFPC is unknown. A mercury transport study conducted by the Tennessee Valley Authority (TVA) in 1984 estimated that floodplain sources contributed about 80% of the total annual mercury export from the EFPC system (ORTF 1985). Most of the floodplain inputs were associated with wet weather, high flow events, while much of the headwater flux occurred under baseflow conditions. Thus, day-to-day exposure of biota to waterborne mercury was assumed to be primarily determined by the Y-12 source. The objective of this study was to evaluate the results of recent studies and monitoring within the EFPC drainage with a focus on discerning the magnitude of floodplain mercury sources and how long these sources might continue to contaminate the system after headwater sources are eliminated or greatly reduced.

Southworth, George R [ORNL; Greeley Jr, Mark Stephen [ORNL; Peterson, Mark J [ORNL; Lowe, Kenneth Alan [ORNL; Ketelle, Richard H [ORNL; Floyd, Stephanie B [ORNL



Remedial investigation/feasibility study of the Clinch River/Poplar Creek operable unit. Volume 1, main text  

SciTech Connect

This document is the combined Remedial Investigation/Feasibility Study (RI/FS) Report for the Clinch River/Poplar Creek Operable Unit (CR/PC OU), an off-site OU associated with environmental restoration activities at the U.S. Department of Energy (DOE) Oak Ridge Reservation (ORR). As a result of past, present, and potential future releases of hazardous substances into the environment, the ORR was placed on the National Priorities List in December 1989 (54 FR 48184). Sites on this list must be investigated for possible remedial action, as required by the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA, 42 U.S.C. 9601, et seq.). This report documents the findings of the remedial investigation of this OU and the feasibility of potential remedial action alternatives. These studies are authorized by Sect. 117 of CERCLA and were conducted in accordance with the requirements of the National Contingency Plan (40 CFR Part 300). DOE, the U.S. Environmental Protection Agency (EPA), and the Tennessee Department of Environment and Conservation (TDEC) have entered into a Federal Facility Agreement (FFA), as authorized by Sect. 120 of CERCLA and Sects. 3008(h) and 6001 of the Resource Conservation and Recovery Act (RCRA) (42 U.S.C. 6901, et seq.). The purpose of this agreement is to ensure a coordinated and effective response for all environmental restoration activities occurring at the ORR. In addition to other responsibilities, the FFA parties mutually define the OU boundaries, set remediation priorities, establish remedial investigation priorities and strategies, and identify and select remedial actions. A copy of this FFA is available from the DOE Information Resource Center in Oak Ridge, Tennessee.




Built to Battle, Robots Test Designers' Mettle  

Science Conference Proceedings (OSTI)

Frostbite, Michael Fuzzy Mauldin's first robot, was built with the power of a snowplow. Visit Fuzzy Mauldin's site for additional details and video clips.


INQUERY Does Battle With TREC-6  

Science Conference Proceedings (OSTI)

... first used by Salton in the 1970s, records phrase ... but the Dragon expansion included oil refineries, coastlines ... bow section" No user supplied text 1 ...


Energy harvesting: A battle against power losses  

E-Print Network (OSTI)

Is it possible, are indefinite operational life and wireless power grids possible? Maybe not for every application, but how about for micro-scale devices? The fact is in situ energy sources like MEMS vibrational and thermoelectric generators can potentially achieve these goals for small footprint systemin-package (SiP) solutions like bio-implantable devices and wireless sensor transceiver network nodes. The key objective is to scavenge sufficient energy from the environment to sustain the micro-power system indefinitely, or at least extend life to practical levels. The problem, however, is micro-scale harvesters can only generate low-to-moderate power, and the energy-storage and power-delivery processes of the system inherently consume a portion of that, which is why the various functions of a loading application must be power-moded, that is, multiplexed, duty-cycled, and turned off when not needed. Fortunately, low frequency ambient vibrations are relatively abundant, stable, and predictable, and tuned MEMS- and CMOS-compatible electrostatic harvesters, for instance, can generate moderate power levels [1], but only if they prevail over the power losses associated with energy storage and power delivery. The focus of this article is to therefore identify, quantify, and discuss the power-consuming mechanisms present in a harvester circuit. Harvesting energy

A. Rinc; Oacute N-mora; Senior Member; Erick O. Torres; Student Member; Ieee Georgia



Solidere : the battle for Beirut's Central District  

E-Print Network (OSTI)

The Beirut Central District was destroyed during the Lebanese Civil War which extended from 1975 to 1990. Unable to reconstruct the center itself, the Lebanese government turned to a private Real Estate Holding Company ...

Mango, Tamam, 1981-



Remedial investigation work plan for the Upper East Fork Poplar Creek characterization area, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee  

Science Conference Proceedings (OSTI)

The Oak Ridge Y-12 Plant, located within the Oak Ridge Reservation (ORR), is owned by the US Department of Energy (DOE) and managed by Lockheed Martin Energy Systems, Inc. The entire ORR was placed on the National Priorities List (NPL) of CERCLA sites in November 1989. Following CERCLA guidelines, sites under investigation require a remedial investigation (RI) to define the nature and extent of contamination, evaluate the risks to public health and the environment, and determine the goals for a feasibility study (FS) of potential remedial actions. The need to complete RIs in a timely manner resulted in the establishment of the Upper East Fork Poplar Creek (UEFPC) Characterization Area (CA) and the Bear Creek CA. The CA approach considers the entire watershed and examines all appropriate media within it. The UEFPC CA, which includes the main Y-12 Plant area, is an operationally and hydrogeologically complex area that contains numerous contaminants and containment sources, as well as ongoing industrial and defense-related activities. The UEFPC CA also is the suspected point of origin for off-site groundwater and surface-water contamination. The UEFPC CA RI also will address a carbon-tetrachloride/chloroform-dominated groundwater plume that extends east of the DOE property line into Union Valley, which appears to be connected with springs in the valley. In addition, surface water in UEFPC to the Lower East Fork Poplar Creek CA boundary will be addressed. Through investigation of the entire watershed as one ``site,`` data gaps and contaminated areas will be identified and prioritized more efficiently than through separate investigations of many discrete units.




Mantle helium and carbon isotopes in Separation Creek Geothermal Springs, Three Sisters area, Central Oregon: Evidence for renewed volcanic activity or a long term steady state system?  

DOE Green Energy (OSTI)

Cold bubbling springs in the Separation Creek area, the locus of current uplift at South Sister volcano show strong mantle signatures in helium and carbon isotopes and CO{sub 2}/{sup 3}He. This suggests the presence of fresh basaltic magma in the volcanic plumbing system. Currently there is no evidence to link this system directly to the uplift, which started in 1998. To the contrary, all geochemical evidence suggests that there is a long-lived geothermal system in the Separation Creek area, which has not significantly changed since the early 1990s. There was no archived helium and carbon data, so a definite conclusion regarding the strong mantle signature observed in these tracers cannot yet be drawn. There is a distinct discrepancy between the yearly magma supply required to explain the current uplift (0.006 km{sup 3}/yr) and that required to explain the discharge of CO{sub 2} from the system (0.0005 km{sup 3}/yr). This discrepancy may imply that the chemical signal associated with the increase in magma supply has not reached the surface yet. With respect to this the small changes observed at upper Mesa Creek require further attention, due to the recent volcanic vent in that area it may be the location were the chemical signal related to the uplift can most quickly reach the surface. Occurrence of such strong mantle signals in cold/diffuse geothermal systems suggests that these systems should not be ignored during volcano monitoring or geothermal evaluation studies. Although the surface-expression of these springs in terms of heat is minimal, the chemistry carries important information concerning the size and nature of the underlying high-temperature system and any changes taking place in it.

van Soest, M.C.; Kennedy, B.M.; Evans, W.C.; Mariner, R.H.



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Twenty-Five Years of Ecological Recovery of East Fork Poplar Creek: Review of Environmental Problems and Remedial Actions  

SciTech Connect

In May 1985, a National Pollutant Discharge Elimination System permit was issued for the Department of Energy s Y-12 National Security Complex (Y-12 Complex) in Oak Ridge, Tennessee, USA, allowing discharge of effluents to East Fork Poplar Creek (EFPC). The effluents ranged from large volumes of chlorinated oncethrough cooling water and cooling tower blow-down to smaller discharges of treated and untreated process wastewaters, which contained a mixture of heavy metals, organics, and nutrients, especially nitrates. As a condition of the permit, a Biological Monitoring and Abatement Program (BMAP) was developed to meet two major objectives: demonstrate that the established effluent limitations were protecting the classified uses of EFPC, and document the ecological effects resulting from implementing a Water Pollution Control Program at the Y-12 Complex. The second objective is the primary focus of the other papers in this special series. This paper provides a history of pollution and the remedial actions that were implemented; describes the geographic setting of the study area; and characterizes the physicochemical attributes of the sampling sites, including changes in stream flow and temperature that occurred during implementation of the BMAP. Most of the actions taken under the Water Pollution Control Program were completed between 1986 and 1998, with as many as four years elapsing between some of the most significant actions. The Water Pollution Control Program included constructing nine new wastewater treatment facilities and implementation of several other pollution-reducing measures, such as a best management practices plan; area-source pollution control management; and various spill-prevention projects. Many of the major actions had readily discernable effects on the chemical and physical conditions of EFPC. As controls on effluents entering the stream were implemented, pollutant concentrations generally declined and, at least initially, the volume of water discharged from the Y-12 Complex declined. This reduction in discharge was of ecological concern and led to implementation of a flow management program for EFPC. Implementing flow management, in turn, led to substantial changes in chemical and physical conditions of the stream: stream discharge nearly doubled and stream temperatures decreased, becoming more similar to those in reference streams. While water quality clearly improved, meeting water quality standards alone does not guarantee protection of a waterbody s biological integrity. Results from studies on the ecological changes stemming from pollution-reduction actions, such as those presented in this series, also are needed to understand how best to restore or protect biological integrity and enhance ecological recovery in stream ecosystems. With a better knowledge of the ecological consequences of their decisions, environmental managers can better evaluate alternative actions and more accurately predict their effects.

Smith, John G [ORNL; Loar, James M [ORNL; Stewart, Arthur J [ORNL



A retrospective study of the chemical analysis cost for the remediation of Lower East Fork Poplar Creek, Oak Ridge, Tennessee  

Science Conference Proceedings (OSTI)

A retrospective study of the remediation of Lower East Fork Poplar Creek (LEFPC) in Oak Ridge, Tennessee was completed. The study was conducted by reviewing the public Comprehensive Environmental Response, Compensation, and Liability Act record documents associated with the remediation of LEFPC and through discussions with the project staff involved or familiar with the project. The remediation took place in two phases. The first phase involved the excavation of about 5,560 yd{sup 3} of soil at the National Oceanic and Atmospheric Administration (NOAA) locations in 1996. The second phase involved the excavation of 39,200 yd{sup 3} at another NOAA location and at the Bruner location in 1997. For the entire project (remedial investigation through cleanup), a total of 7,708 samples (1 sample for each 5.8 yd{sup 3} of soil remediated) were analyzed for mercury. The project obtained special regulatory approval to use two methods for the determination of mercury in soils that are not part of the Resource Conservation and Recovery Act SW-846 methods manual. The mercury analysis cost was $678,000, which represents 9.6% of the cleanup cost. During the cleanup phase of the project, an on-site laboratory was used. The estimated cost savings that the on-site laboratory provided fall into two categories: direct reduction of costs associated with chemical analysis and sample shipment totaling approximately $38,000, which represents a 5.3% savings relative to the estimated cost of using an off-site laboratory, and savings in the amount of $890,000 (12.5% of the $7.1 M cleanup cost), associated with expediting execution of the cleanup work by providing rapid (< 3 hours) sample result turnaround time. The manner in which the analytical services were procured for the LEFPC project suggest that the development of new chemical analysis technology must address deployment, performance, regulatory, robustness, reliability, and business appropriateness factors if the technology is to be used in environmental remediation.

Klatt, L.N.



Economics and analysis of the miscible CO/sub 2/ injection project, Granny's Creek field, West Virginia  

Science Conference Proceedings (OSTI)

The use of carbon dioxide (CO/sub 2/) in a tertiary oil recovery pilot in the Granny's Creek field, West Virginia, was started in 1976. At first the CO/sub 2/ was injected into the Pocono Big Injun sand at four wells at the corners of an approximately square area of 6.7 acres. The CO/sub 2/ was injected as a liquid, and the pilot portion of the reservoir was maintained at or above miscible pressure. Production was taken from a well inside the square pilot area and from eight wells outside the area. The test began with injection of water to increase reservoir pressure to more than the miscibility pressure. Injection started with CO/sub 2/ alone, then alternate slugs of CO/sub 2/ and water, then CO/sub 2/, alone, and finally water alone was injected. The additional oil recovery was 8,681 bbl for an injection total of 19.76 million lb of CO/sub 2/ for a ratio of 19,626 cu ft per bbl. A second or minipilot in which the injection was in the lower or C zone of the Big Injun sand resulted in 2,007.9 bbl of additional oil through September 1980 from the injection of 4.24 million lb of CO/sub 2/ for a ratio of 18,192 cu ft per bbl. The CO/sub 2/ spread quickly across the southern 350 acres of the field and confinement was not attained. The sales price of the oil after royalty and taxes is probably about equal to the most optimistic cost of the CO/sub 2/ per barrel of additional oil at the present time and far less than a more reasonable cost for the CO/sub 2/. Production of additional oil in each case decreased sharply after injection of CO/sub 2/ was stopped so there appeared to be no benefits over an extended period of time from the injection of CO/sub 2/.

Smith, R.V.; Watts, R.J.; Burtch, F.W.



Remedial investigation/feasibility study of the Clinch River/Poplar Creek operable unit. Volume 3: Appendixes E and F -- Risk assessment information  

Science Conference Proceedings (OSTI)

This report presents the findings of an investigation into contamination of the Clinch River and Poplar Creek near the US Department of Energy`s (DOE`s) Oak Ridge Reservation (ORR) in eastern Tennessee. For more than 50 years, various hazardous and radioactive substances have been released to the environment as a result of operations and waste management activities at the ORR. In 1989, the ORR was placed on the National Priorities List (NPL), established and maintained under the federal Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA). Under CERCLA, NPL sites must be investigated to determine the nature and extent of contamination at the site, assess the risk to human health and the environment posed by the site, and, if necessary, identify feasible remedial alternatives that could be