Powered by Deep Web Technologies
Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Bastrop County, Texas ASHRAE 169-2006 Climate Zone | Open Energy...  

Open Energy Info (EERE)

Bastrop County, Texas ASHRAE 169-2006 Climate Zone Jump to: navigation, search County Climate Zone Place Bastrop County, Texas ASHRAE Standard ASHRAE 169-2006 Climate Zone Number...

2

City of Bastrop, Texas (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Bastrop, Texas (Utility Company) Bastrop, Texas (Utility Company) Jump to: navigation, search Name City of Bastrop Place Texas Utility Id 1324 Utility Location Yes Ownership M NERC Location TRE NERC ERCOT Yes ISO Ercot Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Key Accounts Commercial Municipal Commercial Residential Residential Security Lights- 100W HPS Lighting Security Lights- 250W HPS Lighting Security Lights- 400W HPS Lighting Average Rates Residential: $0.1170/kWh Commercial: $0.1060/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"

3

DOE Awards Environmental Services Contract to Gonzales-Stoller  

NLE Websites -- All DOE Office Websites (Extended Search)

Media Contact: Brad Bugger, (208) 526-0833 For Immediate Release January 20, 2011 DOE Awards Environmental Services Contract to Gonzales-Stoller The U.S. Department of Energys...

4

City of Gonzales, Texas (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Gonzales, Texas (Utility Company) Gonzales, Texas (Utility Company) Jump to: navigation, search Name City of Gonzales Place Texas Utility Id 7370 Utility Location Yes Ownership M NERC Location TRE NERC ERCOT Yes Operates Generating Plant Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png LP-1: Medium Commercial Commercial LP-1: Medium Industrial Industrial LP-2: Large Commercial Commercial LP-2: Large Industrial* Industrial Large Commercial Demand > 3500 KW* Commercial Large Industrial Demand > 3500 KW* Industrial Outdoor Lighting-175 Watt Commercial R-1: Residential,Master Metered Residential

5

Alex Harris  

NLE Websites -- All DOE Office Websites (Extended Search)

Alex Harris Chair, Chemistry Department Chemistry Department Building 555 Brookhaven National Laboratory P.O. Box 5000 Upton, NY 11973-5000 Phone: (631) 344-4301 FAX: (631)...

6

Dot Harris  

Energy.gov (U.S. Department of Energy (DOE))

Dot Harris was nominated by President Obama to be the Director of the Office of Economic Impact and Diversity at the United States Department of Energy. She was confirmed by the U.S. Senate on...

7

Dot Harris  

Energy.gov (U.S. Department of Energy (DOE))

LaDoris "Dot" Harris was nominated by President Obama to be the Director of the Office of Economic Impact and Diversity at the United States Department of Energy. She was confirmed by the...

8

Gonzales County, Texas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Gonzales County, Texas: Energy Resources Gonzales County, Texas: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 29.4834878°, -97.5247243° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":29.4834878,"lon":-97.5247243,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

9

James Harris  

NLE Websites -- All DOE Office Websites (Extended Search)

Harris Harris Professor Department of Electrical Engineering California Polytechnic San Luis Obispo jharris@calpoly.edu This speaker was a visiting speaker who delivered a talk or talks on the date(s) shown at the links below. This speaker is not otherwise associated with Lawrence Berkeley National Laboratory, unless specifically identified as a Berkeley Lab staff member. James G. Harris received his BS and MS in EE from UCB and the PhD in EE from Syracuse University. He was an Assistant Professor at Howard University, and an Associate Professor at the University of the District of Columbia, both in Washington, D.C. He is a Professor with the Department of Electrical Engineering and the Computer Engineering Program at Cal Poly in San Luis Obispo, CA. He served as the Department Head of the EE

10

Richard H. Harris, Jr.  

Science Conference Proceedings (OSTI)

... and rheology. In 1997, Mr. Harris successfully completed an ACS short course in Frontiers in Polymer Chemistry. In 1999 ...

2012-07-06T23:59:59.000Z

11

Jeffrey P. Harris  

NLE Websites -- All DOE Office Websites (Extended Search)

Harris Sustainable Federal Operations Group Lawrence Berkeley National Laboratory 1 Cyclotron Road MS WASH D.C. Berkeley CA 94720 Office Location: 962-9336 (202) 448-2251...

12

The effects of human disturbance on birds in Bastrop State Park  

E-Print Network (OSTI)

With rapidly disappearing natural areas due to development and fragmentation, public lands provide important habitat for birds. However, the increasing use of public lands for recreation may decrease the value of these areas for bird use. Human disturbance can damage birds in many ways, including disrupting foraging or social behavior, increasing nest predation, interfering with parent-offspring and pair bonds, increasing nesting failures, and reducing the viability of fledglings. Additionally, birds may perceive humans as predators and leave an area, and the resulting decline in species abundance resembles the effects of habitat loss. Increased human outdoor activity has created the need for information regarding the effects of human disturbance on birds. I investigated the effects of human disturbance on birds in Bastrop State Park (BSP) in central Texas in 1998 and 1999. A wide variety of people use much of BSP, and many areas within the park experience significant amounts of disturbance from people and vehicles, particularly in campgrounds. I evaluated the effects of various types of human disturbance on the presence of 20 avian species, including seven neotropical migratory species. Brown-headed Cowbird (Molothrus ater), Mourning Dove (Zenaida macroura), Carolina Wren (Thryothorus ludovicianus), and Summer Tanager (Piranga rubra), were sensitive to human presence, and Blue Jays (Cyanocitta cristata), and Downy Woodpeckers (Picoides pubescens) occurred in lower abundances in sites with higher numbers of vehicles. However, other species (e.g., American Crow [Corvus brachyrhynchos], Black-and-white Warbler [Mniotilta varia], Pileated Woodpecker [Dryocopus pileatus], Red-eyed Vireo [Vireo olivaceus], Ruby-throated Hummingbird [Archilochus colubris], White-eyed Vireo [Vireo griseus], and Yellow-billed Cuckoo [Coccyzus americanus]) tolerated humans, vehicles, or both. Neotropical migratory species did not show higher sensitivity to disturbance when compared to resident species, and forest interior species were not more sensitive than edge species. My results indicate that some species, including migrants, can become habituated to human presence in protected areas with low harassment and low-intensity, predictable disturbances. Management recommendations for BSP include protecting habitat, minimizing human disturbance in some areas, providing buffer zones between humandominated zones and sites containing vulnerable species, and softening edges in campgrounds.

Marcum, Heidi Ann

2005-08-01T23:59:59.000Z

13

North Carolina Nuclear Profile - Harris  

U.S. Energy Information Administration (EIA) Indexed Site

Harris" "Unit","Summer capacity (mw)","Net generation (thousand mwh)","Summer capacity factor (percent)","Type","Commercial operation date","License expiration date"...

14

Dear Mr. Harris,  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 11 Office of the General Counsel, Department of Energy Dear Mr. Harris, The current certification, compliance and enforcement regulations for Commercial Refrigeration Equipment (CRE) "simply makes no sense". The regulations define the basic model as any product that has a different energy use or efficiency level. It does not allow for modeling the performance of our equipment. Our equipment is customized per order and by mixing and matching different combinations we have 118,000 basic models. The requirement to test two models to get an average energy level increases the number of tests to 236,000. At an average test cost of $3,000, our total costs will be over $700,000,000. The rule needs to be redone. I do not think the process the DOE used for Commercial Refrigeration Equipment was fair and it needs

15

Mr. Harry S. Cohen  

Office of Legacy Management (LM)

a50b a50b Mr. Harry S. Cohen 2956 Hathaway Road Apartment 1105 ' Richmond, Virginia 23225 Dear Mr. Cohen: ..:: The Department of Energy (DOE), as part of its Formerly Utilized Sites Remedial Action Program (FUSRAP), has reviewed information on the former site of the Virginia-Carolina Chemical Corporation, located.at @I8 Perry Street in Richmond, Virginia, to determine whether It contains residual radioactivity traceable to activities conducted on behalf of the Manhattan Engineer District and the Atomic Energy Conar.ission (predecessors to DOE). Based on this review, DOE has concluded that there are no quantities of radioactive material above current guidelines remaining at the site. Therefore, no remedial action is required, and DOE is eliminating the site

16

TO : W. B. Harris  

Office of Legacy Management (LM)

/:' Ofice n/r emordfld%m o UNITED STATE?/ GOVERNMENT /:' Ofice n/r emordfld%m o UNITED STATE?/ GOVERNMENT TO : W. B. Harris # DATE,: Kay 25, 19jl FROM : T. B. Kle ' 4 SUBJECT: RZSJLTS OF AERCSOL SAMPLING AT U.S. B'JRKALI OF ?4EES XRING VISIT OF XARCH 1, 1951 ' I BRUCZTON, PA. 3~XBOL: HSH:PBK:hnh . Purpose of Visit 1. To obtain aerosol samples during the performanc' ent types of explosibility tests. of several differ- 2; To advise as to the safe handling of material, Results 1. Following are tine results of the average concen before, during and after divers explosibility t per cubic rneterof air: rations obtained sts,in milligram5 Sample Description ,# of Corlc Samples Aver ntration (mg U/m3 air) High Lox 1. General Air at Test Hood prior to tests ~1 0 2. Test of Ignition tempera- ture of a layer using

17

Manhattan Project: Harry S. Truman  

Office of Scientific and Technical Information (OSTI)

Harry S. Truman, November 1945 Events > Dawn of the Atomic Era, 1945 > Debate Over How to Use the Bomb, Washington, D.C., Late Spring 1945 Events > Dawn of the Atomic Era, 1945 >...

18

Women @ Energy: Dot Harris | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Dot Harris Dot Harris Women @ Energy: Dot Harris March 15, 2013 - 1:06pm Addthis LaDoris (Dot) Harris is the Director of the Office of Economic Impact and Diversity. LaDoris (Dot) Harris is the Director of the Office of Economic Impact and Diversity. LaDoris (Dot) Harris is the Director of the Office of Economic Impact and Diversity. She was nominated by President Obama and confirmed by the U.S. Senate on March 29, 2012. She has served at some of the world's largest firms including General Electric, ABB Service, and Westinghouse Electric Company. Ms. Harris leads the Department's efforts to ensure minorities and historically underrepresented communities participate fully in Departmental programs. Ms. Harris oversees funding for minority institutions, advocates for small business contracting opportunities, and

19

Comments by Mary Celeste Harris on the Emergency Operation of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

by Mary Celeste Harris on the Emergency Operation of Mirant's Potomac River Generating Station. Comments by Mary Celeste Harris on the Emergency Operation of Mirant's Potomac River...

20

Harris County - Green Building Tax Abatement for New Commercial...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Harris County - Green Building Tax Abatement for New Commercial Construction (Texas) Harris County - Green Building Tax Abatement for New Commercial Construction (Texas) < Back...

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Women @ Energy: Deborah Harris | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Harris Harris Women @ Energy: Deborah Harris March 11, 2013 - 5:33pm Addthis Women @ Energy: Deborah Harris Dr. Deborah Harris's current research interest is in the field of neutrino interactions and oscillations. Her work at Fermilab began with NuMI, the beamline that provides neutrinos to the MINERvA experiment, focusing on the beamline monitoring system. After working on both NOvA and MINOS oscillation experiments she realized that both of these experiments would need a better understanding of neutrino interactions in order to fully exploit the planned statistics of the expected data sets. Deborah is currently the co-spokesperson of MINERvA, an experiment whose goal is to measure neutrino interactions on a variety of different nuclei with unprecedented accuracy. Deborah received her A.B. in Physics from

22

Harry Black Mr. Harry Black currently serves as the Director of Finance for the City of  

E-Print Network (OSTI)

Harry Black Mr. Harry Black currently serves as the Director of Finance for the City of Baltimore of Risk Management. Mr. Black has served as: Executive Vice President & COO of Global Commerce Solutions. Mr. Black is the author of "Achieving Economic Development Success: Tools that work," a nuts

Noakes, David R.

23

Harris County - LEED Requirement for County Buildings | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Harris County - LEED Requirement for County Buildings Harris County - LEED Requirement for County Buildings Harris County - LEED Requirement for County Buildings < Back Eligibility Local Government Savings Category Heating & Cooling Home Weatherization Construction Commercial Weatherization Commercial Heating & Cooling Design & Remodeling Program Info State Texas Program Type Energy Standards for Public Buildings Provider Harris County In 2009, the Harris County Commissioners Court approved a measure that requires all new county buildings to meet minimum LEED certification standards. Buildings do not have to register with the the U.S. Green Building Council. The Harris County Facilities and Property Management (FPM) Division also requires all county buildings to meet minimum energy efficiency and sustainability measures, as described in the

24

Harry Potter, Oxford and Nuclear Energy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Harry Potter, Oxford and Nuclear Energy Harry Potter, Oxford and Nuclear Energy Harry Potter, Oxford and Nuclear Energy July 16, 2012 - 1:30pm Addthis Assistant Secretary Dr. Peter Lyons meets with students on the Oxford University Campus in the same room where scenes from the Harry Potter films were filmed. Assistant Secretary Dr. Peter Lyons meets with students on the Oxford University Campus in the same room where scenes from the Harry Potter films were filmed. Karissa Marcum Public Affairs Specialist, Office of Public Affairs Dr. Peter Lyons, the Assistant Secretary for Nuclear Energy at the Energy Department and the U.S. government's foremost expert on nuclear, met with about a dozen American fellows - in the same room where scenes from the Harry Potter films were filmed - to talk about the low-carbon power

25

Harry Potter, Oxford and Nuclear Energy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Harry Potter, Oxford and Nuclear Energy Harry Potter, Oxford and Nuclear Energy Harry Potter, Oxford and Nuclear Energy July 16, 2012 - 1:30pm Addthis Assistant Secretary Dr. Peter Lyons meets with students on the Oxford University Campus in the same room where scenes from the Harry Potter films were filmed. Assistant Secretary Dr. Peter Lyons meets with students on the Oxford University Campus in the same room where scenes from the Harry Potter films were filmed. Karissa Marcum Public Affairs Specialist, Office of Public Affairs Dr. Peter Lyons, the Assistant Secretary for Nuclear Energy at the Energy Department and the U.S. government's foremost expert on nuclear, met with about a dozen American fellows - in the same room where scenes from the Harry Potter films were filmed - to talk about the low-carbon power

26

MEMORANDUM TO: FROM: Scott Blake Harris  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

31,201 1 31,201 1 MEMORANDUM TO: FROM: Scott Blake Harris General Counsel , Acting ~ssistani'secretary Office o f Fossil Energy SUBJECT: 2011 Annual National Environmental Policy Act (NEPA) Planning Summaries DOE Order 451.1B, Section 4.d, requires that an annual planning summary be prepared that briefly describes:-(1) any Environmental.Assessments (EAs) ongoing or expected t o be prepared in the next 12 months; (2) any Environmental impact Statements (EISs) ongoing or expected t o be prepared in the next 24 months; and (3) any Mitigation Action Plan activities. Attached are the 2011 Annual NEPA Planning Summaries for the Office of Fossil Energy (FE). These summaries include information for the Strategic Petroleum Reserve (SPR), National Energy Technology Laboratory (METL), and Rocky Mountain Oilfield Testing

27

Department of Energy Response to Correspondence from Mary Celeste Harris  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mary Celeste Mary Celeste Harris Related to District of Columbia Public Service Commission Docket No. EO-05-01 Department of Energy Response to Correspondence from Mary Celeste Harris Related to District of Columbia Public Service Commission Docket No. EO-05-01 Docket No. EO-05-01: Department of Energy response to correspondence from Mary Celeste Harris related to District of Columbia Public Service Commission Docket No. EO-05-01 regarding operation of Mirnat Corporation's Potomac River Generating Station. Department of Energy Response to Correspondence from Mary Celeste Harris Related to District of Columbia Public Service Commission Docket No. EO-05-01 More Documents & Publications Department of Energy Response to Correspondence from Alexandria Homeowners and Citizens Associations Related to District of Columbia Public Service

28

EA-1769: Battleground Energy Recovery Project, Harris County, Texas |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

69: Battleground Energy Recovery Project, Harris County, Texas 69: Battleground Energy Recovery Project, Harris County, Texas EA-1769: Battleground Energy Recovery Project, Harris County, Texas Summary This EA evaluates the environmental impacts of a proposal to provide $1.94 million in cost-shared funding to the Houston Advanced Research Center for the Battleground Energy Recovery Project, which would produce 8 megawatts of electricity from high pressure steam generated by capturing heat that is currently lost at the Clean Harbors Deer Park facility. The proposed project was selected by the DOE's Office of Energy Efficiency and Renewable Energy to advance research and demonstration of energy efficiency and renewable energy technologies. Public Comment Opportunities No public comment opportunities available at this time.

29

Development of an ozone climatology for Harris County, Texas  

SciTech Connect

The Houston Regional Monitoring Corporation (HRM) has performed continuous ambient air quality and meteorological monitoring in the Ship Channel area of east Harris County since August 1981. The HRM monitoring network is one of the largest Environmental Protection Agency (EPA) approved Prevention of Significant Deterioration (PSD) monitoring network in the United States operated by an industrial group. As an adjunct to its monitoring. HRM has funded extensive meteorological and statistical analyses of ozone monitoring data in Harris County. One of the goals of these studies was to determine those meteorological conditions responsible for the formation of elevated ozone concentrations in Harris County. The analyses performed included the use of principal component analysis and cluster analysis. These analysis techniques have individually been applied to ozone and air quality research problems. The combined use of these techniques in this analysis, however, is a unique application of these statistical tools to an ozone air quality analysis. As a result of these analyses, a climatology of those episodes conducive to elevated ozone formation in Harris County was developed.

Balentine, H.W.; Carter, J.C. (Radian Corp., Austin, TX (USA)); Preston, J. (Tenneco Polymers, Houston, TX (US))

1987-01-01T23:59:59.000Z

30

Harris County, Texas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Harris County, Texas: Energy Resources Harris County, Texas: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 29.7751825°, -95.3102505° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":29.7751825,"lon":-95.3102505,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

31

TO. TO. , W. B; Harris, Chief, Industrial Hygiene'Branch DA , W. B; Harris, Chief, Industrial Hygiene'Branch DA  

Office of Legacy Management (LM)

~~~~;.Offi~~~~~~~~~~~ ~~~~;.Offi~~~~~~~~~~~ ,/-; l UNITED STh , :__ .~. :__ .~. , , TO. TO. , W. B; Harris, Chief, Industrial Hygiene'Branch DA , W. B; Harris, Chief, Industrial Hygiene'Branch DA Health and Safet Division pa& 1 Ps B.- Klevin :mL -y!yG hMBOL: HSH:PBK hMBOL: HSH:PBK : 1. Purpose of Visit >.. a. To study operations planned by~Bu.reau of Ea: factors for Be, II, thorium, zirconium, etc, i b. ,'To explain to Bureauof Mines' personnel tl in handling any of the aforementioned mate] 2. Scope of Work The Bureau of l&s'mill make a'study of the k several materials specified by-the New York 0p1 1 The study mill include the following tests for .a. Ignition~temperature~of a cloud. b. Determine the amount of inert required to L propagation in any of these materials.

32

Comments by Mary Celeste Harris on the Emergency Operation of Mirant's  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

by Mary Celeste Harris on the Emergency Operation of by Mary Celeste Harris on the Emergency Operation of Mirant's Potomac River Generating Station. Comments by Mary Celeste Harris on the Emergency Operation of Mirant's Potomac River Generating Station. Docket No. EO-05-01: Comments by Mary Celeste Harris on the Emergency Operation of Mirant's Potomac River Generating Station. "I am writing in response to your order of December 20, 2005, declaring the emergency operation of Mirant's Potomac River Generating Station next door to me." Comments by Mary Celeste Harris on the Emergency Operation of Mirant's Potomac River Generating Station. More Documents & Publications Department of Energy Response to Correspondence from Mary Celeste Harris Related to District of Columbia Public Service Commission Docket No.

33

TO I Ppi B. Harris, Chief, Industrial Rygiene Branah  

Office of Legacy Management (LM)

Ppi B. Harris, Chief, Industrial Rygiene Branah Ppi B. Harris, Chief, Industrial Rygiene Branah DATE: .' hpt Health and Safe i-?iSiOll FROM .t A. 3. Breslin 8v SUBJECT: URBHNad ROD DR&RG,TEST AILTWYCKoFF STEZL COO SYMBOL: RSHG%JB:~O On September 6, the m iter accompanied M re Fe Stroke to the Steel Co. in Bewark to witness the trial drawing of l-1/2 i diameter uranium rods* !l'w rods, about four feet in length, were used in the test. just dipped in an 6% solution of hot sulfurio acid, rinsed and ooated in a hot Ca(OH)2 bathe !fhey were D water, In the first attempt at drgsing, the rod jmxmed in the die - ahdhad to bs removed by the use of asludge hammere For the seoond 'attempt, a larger dismeter die was substituted but the drawing was adcompanied by oonsiderable poiee and vibration. Unfortuuatsly, no se&e was

34

FROM: MEMORANDUM FOR SCOTT HARRIS GENERAL COUNSEL RENEWABLE ENERGY  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4,2011 4,2011 FROM: MEMORANDUM FOR SCOTT HARRIS GENERAL COUNSEL RENEWABLE ENERGY SUBJECT: Headquarters Energy Efficiency and Renewable Energy 20 1 1 Annual National Environmental Policy Act Planning Summary Report In accordance with Department of Energy Order 45 1.1 B and the Secretarial Policy on the National Environmental Policy Act (NEPA), attached is the Headquarters Energy Efficiency and Renewable Energy 201 1 Annual National Environmental Policy Act Planning Summary. The NEPA Planning Summary describes the status of ongoing Headquarters related NEPA compliance activities, potential environmental assessments to be prepared in the next 12 months and potential Environmental Impact Statements to be prepared in the next 24 months. If you have any questions or concerns regarding the contents of this document, please

35

Harris County- Green Building Tax Abatement for New Commercial Construction (Texas)  

Energy.gov (U.S. Department of Energy (DOE))

In 2008, the Harris County Commissioners Court adopted guidelines for partial tax abatements for new construction of commercial LEED-certified buildings. The tax abatement was renewed in 2009, and...

36

Water Conservation in the Home Janie L. Harris, M.Ed., CRS  

E-Print Network (OSTI)

Water Conservation in the Home Janie L. Harris, M.Ed., CRS Extension Housing and Environment't Let the Faucet Run Dry Water Conservation in the Home Page 1Family and Consumer Sciences · Texas Agri are used by each family member each day. By implementing conservation practices and installing water

37

Texas Tech at TMEA 2013 Clinicians: Janice Killian & John Wayman, Young Harris College  

E-Print Network (OSTI)

Texas Tech at TMEA 2013 ,k9ki9o Clinicians: Janice Killian & John Wayman, Young Harris College Wood The Yin and Yang of Teaching Music Thurs. Feb 14 th 11:00 am ­ Noon / CC 212 Texas Tech Consortium Thurs. Feb 14 th 5:00-6:00 pm / CC 212 Concert: Texas Tech University Symphonic Wind Ensemble Conductor

Rock, Chris

38

DETERMINATION OF LITHIUM BY FLAME EMISSION SPECTROMETRY Background Reading: Harris, 7th  

E-Print Network (OSTI)

DETERMINATION OF LITHIUM BY FLAME EMISSION SPECTROMETRY Background Reading: Harris, 7th ed., Chap of this experiment is to acquaint you with flame emission spectrometry. The determination of lithium, and all other. It uses a propane/air flame. #12;Lithium by Flame Emission, Page 2 Identify the burner with its nebulizer

Weston, Ken

39

Mercury in the Gulf of Mexico: Sources to receptors$ Reed Harris a,n  

E-Print Network (OSTI)

Mercury in the Gulf of Mexico: Sources to receptors$ Reed Harris a,n , Curtis Pollman b , William of Mexico a b s t r a c t Gulf of Mexico (Gulf) fisheries account for 41% of the U.S. marine recreational. Introduction Gulf of Mexico (Gulf) fisheries account for 41% of the U.S. marine recreational fish catch and 16

Sunderland, Elsie M.

40

Collisionless distribution function for the relativistic force-free Harris sheet  

SciTech Connect

A self-consistent collisionless distribution function for the relativistic analogue of the force-free Harris sheet is presented. This distribution function is the relativistic generalization of the distribution function for the non-relativistic collisionless force-free Harris sheet recently found by Harrison and Neukirch [Phys. Rev. Lett. 102, 135003 (2009)], as it has the same dependence on the particle energy and canonical momenta. We present a detailed calculation which shows that the proposed distribution function generates the required current density profile (and thus magnetic field profile) in a frame of reference in which the electric potential vanishes identically. The connection between the parameters of the distribution function and the macroscopic parameters such as the current sheet thickness is discussed.

Stark, C. R.; Neukirch, T. [School of Mathematics and Statistics, University of St. Andrews, St. Andrews KY16 9SS (United Kingdom)

2012-01-15T23:59:59.000Z

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Read: Entrancing Enchantment: How Harry Cast a Spell Over Hip Nepali Readers  

E-Print Network (OSTI)

July-Sept. 2007|Issue-03 Getting personal with Ruskin Bond | Sudheer Sharma on books What Kathmandu is reading 2|Read|July-Sept., 2007k':ts ahf/df cfpFb}5 kmfO{glk|G6 3|Read|July-Sept., 2007k':ts ahf/df cfpFb}5 kmfO{glk|G6 "Essays... 14 A review by Samrat Upadhyay Breaking new ground 17 A review by Tiku Gauchan Going potty over potter 6 A heady brew: Harry, hype and hip readers SHORT TAKE Q/A 26...

Fineprint Bookclub

2007-01-01T23:59:59.000Z

42

DOE/EA-1470: Environmental Assessment Harry Allen-Mead 500 kV Transmission Line Project Environmental Assessment  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

the the Interior Bureau of Land Management Las Vegas Field Office Las Vegas, Nevada March 2004 Interstate Intertie Centennial Plan Environmental Assessment Harry Allen - Mead 500kV Transmission Line DOE/EA-1470 Harry Allen-Mead 500kV Transmission Line Project Harry Allen-Mead 500kV Transmission Line Environmental Assessment 1 Chapter 1 Purpose and Need 1.1 Introduction The construction of new transmission and distribution facilities is required throughout the western United States to meet the increasing demand for power as more people move to many of the fastest growing communities. According to Executive Order 13212 dated May 18, 2001, "The increased production and transmission of energy in a safe and environmentally sound manner is essential to the well-being of the American people...agencies shall take appropriate actions, to the extent

43

Harry Sim  

NLE Websites -- All DOE Office Websites (Extended Search)

from Insead in France. He is Six-Sigma Black Belt certified, and is a member of the US Green Building Council. Cypress Envirosystems provides innovative...

44

Harry Sim  

NLE Websites -- All DOE Office Websites (Extended Search)

costs. This includes retrofit solutions for HVAC pneumatic controls and lighting controls for buildings, and instrumentation for steam traps, compressed air systems and...

45

The status of resistance in Culex quinquefasciatus say (Diptera: culicidae) populations in Brazos and Harris Counties, Texas  

E-Print Network (OSTI)

In 2002, West Nile virus was isolated for the first time in Harris County, Texas. The subsequent epidemic led the Harris County Mosquito Control Division to initiate an extensive spraying operation to suppress infected adult mosquitoes. The control program was aimed at the predominate disease-carrying mosquito for the southern United States, Culex quinquefasciatus Say. With the increase of insecticide pressure on the mosquito populations, the possibility of resistance was brought into question. A three year study using a vial bioassay test was conducted in Harris (2004-2005) and Brazos (2005-2006) counties to determine the resistance status of Cx. quinquefasciatus to the six chemicals (malathion, naled, resmethrin, permethrin, sumithrin, and pyrethrum) used most frequently in adult mosquito control programs. The resistance ratios acquired from the vial bioassay tests were mapped onto shapefiles for Harris and Brazos counties, which revealed clustering of areas with pyrethroid resistance mosquito populations in the northeastern, southeastern, and southwestern corners of Loop 610 in Harris County. An additional six-month preliminary study, involving six operational areas in Harris County and three in Brazos County, was conducted, demonstrating only minor fluctuations in the monthly resistance ratios occurring in both counties in 2005. A significant correlation was documented between the two years of resistance ratios for mosquitoes to the three pyrethroids in Harris County and all the insecticides except pyrethrum in Brazos County. A significant relationship was also found between the resmethrin resistance ratios and the number of spray events performed during the previous year and the malathion resistance ratios with the insecticide treatments conducted in the same year. The correlation analyses provide data used to predict areas where resistance can develop in the mosquito population, thus providing the control agency more data to plan future control tactics. The overall analysis indicated that Harris County has localized pockets of resistant mosquitoes; but, on a whole, it does not seem to have widespread resistance in its mosquito populations. The only resistance that was detected was in the mosquitoes tested against the three pyrethroids. Mosquitoes in Brazos County, which has no organized mosquito control, demonstrated county-wide susceptibility to all six insecticides tested.

Johnsen, Mark Miller

2007-05-01T23:59:59.000Z

46

Bastrop County, Texas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

58708°, -97.3516558° 58708°, -97.3516558° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.0458708,"lon":-97.3516558,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

47

DOE/EA-1470: Environmental Assessment Harry Allen-Mead 500 kV Transmission Line Project Environmental Assessment  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4 4 DOE/EA-1470 DEPARTMENT OF ENERGY Western Area Power Administration Finding of No Significant Impact and Floodplain Statement of Findings Nevada Power Company's Harry Allen-Mead 500-kV Transmission Line Project Summary - Nevada Power Company (Nevada Power) proposes to build a 48- mile, 500-kilovolt (kV) transmission line between the Harry Allen Substation, northeast of Las Vegas Nevada, and the Mead Substation, southeast of Las Vegas (Proposed Action). The project would be part of the Interstate Intertie of the Centennial Plan. Of the 48 miles, 32 miles are within lands managed by the Bureau of Land Management (BLM), 8 miles are within lands managed by the US Bureau of Reclamation (USBR), and 4 miles are within lands managed by Western Area

48

-blockers and Cocaine: Fatal Attraction? Cristina Gonzales, PharmD  

E-Print Network (OSTI)

5 Gebruik van ArchiMate bij Dunea 27 5.1 Huidig gebruik 27 5.2 Mogelijk gebruik in de toekomst 27 6 Aanbevelingen voor Dunea 30 8.1 Strategie, strategische doelen en verbeterpunten 30 8.2 Beleidsuitgangspunten 31.5 Metamodel 32 8.6 Ontwikkelingen 32 9 Bronnen 33 #12;3 Samenvatting Dunea gebruikt het Novius model om

Pillow, Jonathan

49

Spatiotemporal Imaging for Monitoring CO2 Storage in Coal Jerry M. Harris, Youli Quan, Eduardo Santos, Jolene Robin-McCaskill, Tope Akinbehinje, Yemi Arogunmati, Evan Um  

E-Print Network (OSTI)

Spatiotemporal Imaging for Monitoring CO2 Storage in Coal Jerry M. Harris, Youli Quan, Eduardo, Stanford University Work Flow Summary References Measurement of Acoustic Properties of Coal (a) CO2 the stationary SIRT for partial surveys. Flow Simulation Porofluid Porofluid Confining fluid Pump Coal Sample

Harris, Jerry M.

50

The cost effectiveness of reducing public exposure to carcinogens in Harris County by a abating chemical plant emissions  

SciTech Connect

The work examines the engineering reasonableness and the cost effectiveness of reducing public exposure to carcinogens n ambient air by abating emissions of organic chemicals in waste gas streams from chemical plants in Harris County, Texas, which contains the large chemical manufacturing complex in the Houston ship channel areas. The work also examined the cost effectiveness of reducing public exposure through changing the way vent streams are released to the atmosphere. The achievable exposure reductions are estimated by use of 1980 census data and of ambient concentration estimates. The ambient concentration estimates are calculated using the Texas Climatological Model Version 2 (TCM-2) and publicly available emissions inventory collected by the Texas Air Control Board. The TCM-2 is based on the steady state Gaussian plume hypothesis, Briggs plume rise formations, Pasquill-Gifford dispersion coefficient approximations, and first order pollutant decay. The cost estimates rely on published studies and on the waste gas stream parameters of the chemical plant vents. The cost effectiveness results are compared with the cost effectiveness of controls typically applied to new sources of volatile organic compounds (VOCs) that are controlled because of their contribution to ozone air pollution, not because of the carcinogenicity of their emissions.

Price, J.H. Jr.

1989-01-01T23:59:59.000Z

51

Prediction of Unit Value of Un-Improved Parcels of Harris County, Texas Using LEED Sustainable Sites Criteria of Public Transportation Access  

E-Print Network (OSTI)

Leadership in Energy and Environmental Design (LEED) is one of the environmental assessment tools available to gauge buildings. This rating system is a voluntary system which does not include financial aspects in the evaluation framework. This poses a challenge for encouraging land development projects, since developers consider financial or economic return as a crucial factor before building a project. It becomes essential to know if market really accepts the economic worth of LEED ratings. This research attempted to find out relationship between economic worth of a land and parameters (measurements), which are essential to earn LEED sustainable rating for public transportation access. To find out this relationship and to recognize power of the LEED measurements to predict the appraised value of a land (dollars per square foot) various statistical models were used and predictive equations produced. The observational units were properties in Harris County, Texas that were unimproved and had zero improvement value. The dependent variable was unit value of the property measured in dollars per square foot. The independent variables were measurements that are required for a parcel to earn LEED sustainable site rating for public transportation access and the area of parcel. Data regarding appraised values and land area were acquired from the Harris County Appraisal District and transportation data was obtained from Houston- Galveston Area Council. Multiple regression analysis was used to analyze different models and to develop predictive equations. Findings suggest that LEED green building rating system influences the appraised value, dollars per square foot, of properties. It further implies that market considers the economic effect of the LEED rating system even if this assessment method does not explicitly include financial aspects in the evaluation framework. Findings of this research also suggest that a sustainable feature of a site is related to the economic worth of a related land development project. This will provide encouragement for new sustainable land development projects. This will provide an economic incentive to the owners and developers. Developers will get encouragement to select a site located closer to mass transit networks.

Joshi, Bhagyashri Bharat

2009-12-01T23:59:59.000Z

52

The relevance of the effective school correlates, to alternative education settings, for student in a correctional system, as identified by the teachers and adminstrators in selected charter schools, in Harris County, Texas  

E-Print Network (OSTI)

The State of Texas accepted the Effective School Research model and its correlates as a way of determining whether the states schools are effective. This included all juvenile justice alternative educational facilities. The purpose of the study was to assess the relevance of the Effective School Correlates to alternative educational settings for students in a correctional system as identified by the teachers and administrators in selected charter schools in Harris County, Texas. Secondly, the study was to suggest modification to the Effective School Correlates to make them relevant to an alternative educational setting for students in the correctional system in selected charter schools in Harris County, Texas. The literature revealed a potential lack of fit between the Effective School Correlates as the Key Characteristic of Effective Schools and their relevance to the context of alternative schools for students in the correctional systems. This study led to the postulation that the Effective School Correlates as written may need altering to meet the needs of the specialized correctional school setting. However, it is not clear what shape or direction this alteration would take. Findings of this study indicated that problems existed with the application of the Correlates as they related to the selected Charter Schools in Harris County, Texas. The population size limited the study and caution should be taken not to over-generalize the data.

Cortez-Rucker, Vance

2007-12-01T23:59:59.000Z

53

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Bastrop, TX Texas Propane Fleet Pilot Program Upgrade of propane refueling infrastructure in Bastrop, TX. This CX form is for one location in this project selected under Clean...

54

Ralph Lloyd Harris Memorial Symposium  

Science Conference Proceedings (OSTI)

A Review of Pyro, Hydro and Electro-metallurgical Processes for Recovering Valuable Metals from Superalloy Scrap A Study in Low Grade Thermal Energy...

55

A cross-cultural analysis of the relationship between subsistence productivity and religious eschatology using data from the Human Relations Area Files: a test of a hypothesis drawn from the Marvin Harris' theory of Cultural Materialism  

E-Print Network (OSTI)

This thesis used a cross-cultural sample of ethnographic data collected from the Human Relations Area Files to test the hypothesis, drawn from Marvin Harris' theory of Cultural Materialism, that the presence of a judgmental eschatology (or fate of the soul after death) in a given society is positively correlated with the level of subsistence productivity in that society. Specifically, societies low on the scale of productive complexity were predicted to lack judgmental eschatologies, while societies high on the scale were predicted to have them. The final sample group consisted of 271 cultures, each of which was coded for level of subsistence productivity and for the nature of their eschatology. The level of subsistence productivity was measured in three ways: first, in terms of the broad subsistence classifications (collectors, hunters and fishers, incipient producers, etc.) defined by Alan Lomax in his article A Worldwide Evolutionary Classification of Cultures by Subsistence Systems (1977); secondly, by the percentage of total subsistence activity accounted for by agriculture; and finally, by the intensity of a culture's agricultural practices. The nature of a culture's eschatology was coded as either judgmental or non-judgmental. The coded data was then subjected to a Chi-Square test of significance, and to Pearson's, Spearman's, and Kendall's Tau-b tests to determine the correlation coefficient. Each test was performed three times - once for each of the three subsistence codes versus eschatology. In each case, the Chi-Square test rejected the null hypothesis (that there was no correlation between level of subsistence productivity and eschatology) at a 0.001 level of significance, thus supporting the conclusion that the presence of a judgmental eschatology in a given society is, in fact, related to the level of subsistence productivity in that society. The correlation coefficients ranged from 0.331-0.469, and were all significant at the 0.0001 level. Thus, the proposed hypothesis, and in turn the theory of Cultural Materialism from which it was drawn, were supported by the data, suggesting that the nature of religious beliefs are, at least in part, a product of a culture's subsistence system.

Olson, Jeffery Soland

2000-01-01T23:59:59.000Z

56

Harry Polachek interview: March 24, 1970  

Science Conference Proceedings (OSTI)

Encouraged by his father and a high school teacher, Polachek studied mathematics as an undergraduate at Yeshiva University and while working on his master's degree at Columbia. He was teaching high school and working on his Ph.D. when called to the Aberdeen ...

Richard R. Mertz

1999-08-01T23:59:59.000Z

57

Carbon nanotube composites P. J. F. Harris*  

E-Print Network (OSTI)

of matrix. A wide range of polymer matrices have been employed, and there is growing interest in nanotube/ceramic, as well as from industry, and nanotubes are currently the subject of around 7 papers per day, such as ceramics and metals. The ai

Harris, Peter J F

58

Harry Mynick | Princeton Plasma Physics Lab  

NLE Websites -- All DOE Office Websites (Extended Search)

Join Our Mailing List A Collaborative National Center for Fusion & Plasma Research Search form Search Search Home About Overview Learn More Visiting PPPL History...

59

CX-003793: Categorical Exclusion Determination | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Exclusion Determination CX-003793: Categorical Exclusion Determination Texas Propane Fleet Pilot Program CX(s) Applied: B5.1 Date: 09172010 Location(s): Bastrop, Texas...

60

Harris Hill, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

2.9647806°, -78.6775293° 2.9647806°, -78.6775293° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.9647806,"lon":-78.6775293,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Harris County, Georgia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Georgia: Energy Resources Georgia: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 32.7032697°, -84.8567932° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.7032697,"lon":-84.8567932,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

62

Lab researcher Harry Martz makes flying safer for Americans  

NLE Websites -- All DOE Office Websites (Extended Search)

for Nondestructive Characterization, is checking a case used to acquire X-ray signature data on reference standards and explosive specimens after it enters the EDS. See the...

63

MEMORANDUM FOR: SCOTT BLAKE HARRIS GENERAL COUNSEL OFFICE OF...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

COUNSEL FROM: SUBJECT: EDWARD BRUCE HELD DIRECTOR OFFICE OF INTELLIGENCE AND COUNTERINTELLIGENCE Annual National Environmental Policy Act (NEPA) Planning Summary - 2011 In...

64

Nearest Neighbor Conditional Estimation for Harris Recurrent Markov Chains  

E-Print Network (OSTI)

= AnXn?1 +Bn, (1) where (An)n?N and (Bn)n?N are iid matrix and vector valued random variables (Babillot et al., 1997, for details on recurrence and references) 4 Example 1 Consider the ARCH(2) model Yn = Zn?n, ?2n = ?0 + ?1Y 2 n?1 + ?2Y 2 n?2, where (Zn... one to one mapping between Yn and Y 2n . This is in the form of (1). The above example extends to any finite order. As will become obvious, we need the HRMC to be observable, i.e. we must observe Xn at time n. Example 2 Consider the GARCH(1,1) model Yn...

Sancetta, Alessio

65

HARRY R. BELLER 1 Cyclotron Rd., MS 70A-3317  

E-Print Network (OSTI)

for Excellence in Refereeing, Water Resources Research (AGU). 1997. · American Chemical Society award Union PEER-REVIEWED PUBLICATIONS Müller, J., D. MacEachran, H. Burd, N. Sathitsuksanoh, C. Bi, Y-C. Yeh. Appl. Environ. Microbiol. 79:63-73. Yeh, Y.-C., J. Müller, C. Bi, N. J. Hillson, H. R. Beller, S. R

Ajo-Franklin, Jonathan

66

Generalisation and integration for location-based services Lars Harrie  

E-Print Network (OSTI)

. Nissen, F., A. Hvas, J. Munster-Swendsen, and L. Brodersen, 2003. Small-Display Cartography, Available

Harrie, Lars

67

Overview of Lithography: Challenges and Metrologies Harry J. ...  

Science Conference Proceedings (OSTI)

... Spec for flatness = 45 nm PV at the 32 nm node. ... 1980 1985 1990 1995 2000 2005 Year E xposure tool price Historical tool prices Page 35. ...

68

ELECTROMYOGRAPHY AS A TECHNIQUE FOR LARYNGEAL INVESTIGATION* Katherine S. Harris+  

E-Print Network (OSTI)

there are variants in different systems in different animals. The "red" and "white" designations refer to a difference in the fiber color, familiar from the light and dark meat of chicken. The two types differ the mechanism of consonant voicing. Fiberoptic visualizations of the glottis (Sawashima. Abramson. Cooper

69

Harris 2: Harnessing Human Energy To: Penn State Learning Factory  

E-Print Network (OSTI)

that electromagnetic induction satisfied the most requirements- size, weight, efficiency, cost) The goal was to achieve the ability to extend battery life in mobile devices. Our team has created a device utilizing two linear use to charge an internal NiMH battery. The internal battery lets us store the charge to be used

Demirel, Melik C.

70

West Virginia University Ismail Celik , Harry Finklea, Bruce...  

NLE Websites -- All DOE Office Websites (Extended Search)

goal is to enable direct utilization of coal syngas and other alternate fuels such as biogas in Solid Oxide Fuel Cells (SOFC's). To this end comprehensive ex-situ and in-situ...

71

Alumni Scholarship Recipients 1936 -2006 Barbara Ann Hull Harris  

E-Print Network (OSTI)

endonuclease I-DmoI. Nucleic Acids Res 25:1523­1530 Adams PL, Stahley MR, Kosek AB, Wang J, Strobel SA (2004

Grether, Gregory

72

Lance D. Harry, Jonathan S. Meltrer, Dominick L. Calciano ...  

Science Conference Proceedings (OSTI)

... composite walls, concrete and masonry, and various finishing materials. Also, additional investigation into the strength of various wall components ...

2011-12-01T23:59:59.000Z

73

ORIGINAL INVESTIGATION Frauke Stanke Tim Becker Harry Cuppens  

E-Print Network (OSTI)

at the Institut fu¨ r Physiologische Chemie, Germany for providing pVT100U- mtGFP, Praveen Sharma at National, Ukropcova B, Deutsch WA, Smith SR, Ravussin E (2007) Calorie restriction increases muscle mitochondrial

Ussery, David W.

74

CURRENT INDEX TO LEGAL PERIODICALS Copyright 2010, Marian Gould Gallagher Law Library  

E-Print Network (OSTI)

). Gonzales, Alberto R. Waging war within the Constitution. 42 Tex. Tech. L. Rev. 843-891 (2010). Solera

Choate, Paul M.

75

CX-006755: Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE))

Evaluating and Commercializing a Solvent Based Enhanced Oil Recovery TechnologyCX(s) Applied: B3.7Date: 09/13/2011Location(s): Bastrop County, TexasOffice(s): Fossil Energy, National Energy Technology Laboratory

76

Joint Use School Partnerships in California: Strategies to Enhance Schools and Communities  

E-Print Network (OSTI)

Testa (MercedCitySchoolDistrict),whoseinterviewsGonzales(CaliforniaSchoolBoardsAssociation) providedinsight. CC&SandPHLP:JointUseSchoolPartnershipsin

Vincent, Jeffrey M; Cooper, Tamar

2008-01-01T23:59:59.000Z

77

Idaho National Laboratory - Hydropower Program: Bibliography  

NLE Websites -- All DOE Office Websites (Extended Search)

The final operation and maintenance report on the city of Gonzales Hydroelectric project summarizes operation, maintenance activities, and costs for 2 years of operation....

78

the White House between President Harry Truman, Secretary of State Dean Acheson, Atomic Energy Commission  

E-Print Network (OSTI)

It had been only five-and-a-half years since the atomic bombings of Hiroshima and Nagasaki, but during the previous year the Soviets had detonated their first fission bomb. A small number of influential voices were pressuring the President to authorize the development of hydrogen bombs. That decision was the purpose of the January 31 meeting at the White House. Truman listened as Lilienthal described the reasons for not building the H-bomb. He had barely started when the President cut him off with the question, Can the Russians do it? When his visitors nodded yes, Truman said, In that case, we have no choice. Well go ahead. Upon leaving the White House, Lilienthal glanced at his watch. The President had given him seven minutes. Lilienthal wrote in his diary that Truman was, clearly set on what he was going to do before we set foot inside the door.[1] The first hydrogen bomb was detonated by the USA on November 1, 1952, vaporizing

Chairman David Lilienthal; Defense Secretary; Louis Johnson

1950-01-01T23:59:59.000Z

79

Stationary state volume fluctuations granular medium Matthias Schrter,* Daniel Goldman, Harry Swinney  

E-Print Network (OSTI)

#; Donev, Torquato, F. H. Stillinger, ibid. 011105 #2005#. #15# Srebro Levine, 061301 #2003#. SCHR?TER

Texas at Austin. University of

80

NOAA OAR AOML Special Publication 2007-001 HARRIS B. STEWART, JR.  

E-Print Network (OSTI)

Oceanic and Atmospheric Research Atlantic Oceanographic and Meteorological Laboratory Miami, FL #12 and Atmospheric Research Atlantic Oceanographic and Meteorological Laboratory 4301 Rickenbacker Cswy. Miami, FL Chief CICAR Cooperative Investigation of the Caribbean and Adjacent Regions CO Commanding Office DISCO

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Jerry M. Harris, Olusoga Martins Akintunde*, Tapan Mukerji and Jaime Urban, Department of Geophysics, Stanford University.  

E-Print Network (OSTI)

................................................................ 223 Figure 29 Mine Void and CoalBed Methane Wells in Indiana Base Realignment And Closure BTU British Thermal Unit CBM CoalBed Methane CCS Carbon Capture Department of Energy ECBM enhanced coal bed methane EIA Energy Information Agency EOR Enhanced Oil

Harris, Jerry M.

82

Monty Newman/Hobbs James Curtiss/W&S Troy Harris/Lovington  

E-Print Network (OSTI)

On June 6, 2005, you submitted a U.S. Department of Energy (DOE) report providing the basis for DOEs cost estimate for dispositioning depleted uranium generated at your proposed uranium enrichment facility in

Services Gas; Centrifuge Uranium; Enrichment Facility; Dear Mr. Krich; Joseph G. Giitter; James Ferl; Cty John Parker/nmed

2006-01-01T23:59:59.000Z

83

Strategic petroleum reserve seaway complex distribution enhancements, Brazoria, Galveston and Harris Counties, Texas. Revised environmental assessment  

Science Conference Proceedings (OSTI)

The Strategic Petroleum Reserve (SPR) of the US Department of Energy (DOE) proposes to construct and operate a 40-inch diameter, 46-mile long buried crude oil pipeline from existing facilities of the SPR Seaway Complex located near Freeport, Texas, to an existing commercial crude oil terminal near Texas City, Texas. In May 1984, DOE issued an Environmental Assessment ((EA); DOE/EA-0252) and a Finding of No Significant Impact for this action. The May 1985 EA addressed the construction and operation of a DOE-owned buried crude oil pipeline from Bryan Mound to the ARCO Terminal located in Texas City, Galveston County, Texas. The EA assessed three alternative alignments for outing the pipeline from Bryan Mound past Freeport to a common point near Stratton Ridge. From Stratton Ridge to Texas City, one route segment was considered. All three alternative alignments around Freeport were subsequently determined to be unsuitable for safe construction of a large-diameter buried pipeline, primarily because of crowded pipeline corridors and restricted pipeline rights-of-way (ROW). Therefore, the SPR identified and is herein considering a fourth alternative route segment from Bryan Mound through the City of Freeport, across the Old Brazos River and Dow Barge Canal, and northward to Stratton Ridge. The route is about 11 miles long, and is in or adjacent to existing utility and pipeline right-of-way for about 70% of its length. Crude oil throughput capacity for all cases is 1.10 million barrels per day. This revised EA addresses environmental impacts of construction and operation of the pipeline along the fourth subalternative route segment, as compared to impacts from the three previously considered alternative route segments. 11 refs., 3 figs., 1 tab.

Not Available

1986-02-01T23:59:59.000Z

84

Harmonic generation by reflecting internal waves Bruce Rodenborn, D. Kiefer, H. P. Zhang, and Harry L. Swinney  

E-Print Network (OSTI)

of internal waves," J. Fluid Mech. 390, 271 1999 . 17 P. Puig, A. Palanques, J. Guillen, and M. El Khatab

Texas at Austin. University of

85

Leveraging Multiple Heterogeneous Radios for Energy-efficient Routing Mehedi Bakht, Riccardo Crepaldi, Albert F. Harris III, and Robin Kravets  

E-Print Network (OSTI)

consumed per unit time in the idle state Low-power/low-rate radios apparently fare better on both counts Low idling cost Low power level in the communication states High-power radios Higher data rate Shorter of using a High-power Radio High idle state overhead Non-negligible state transition costs Our Solution Per

Kravets, Robin

86

MINUTES OF THE BOARD OF REGENTS NEW MEXICO STATE UNIVERSITY  

E-Print Network (OSTI)

. Chris Anaya, Vice Chair Mr. Blake B. Curtis, Secretary/Treasurer Mr. Javier M. Gonzales, Member Ms Vice President Nick Franklin Vice President Vimal Chaitanya Director Valerie Pickett Director Fred

Castillo, Steven P.

88

Light trapping beyond the 4n2 limit in thin waveguides Jeremy N. Munday, Dennis M. Callahan, and Harry A. Atwater  

E-Print Network (OSTI)

of guided light in light-emitting diodes Appl. Phys. Lett. 100, 171105 (2012) Nonreciprocal optical Bloch

Heaton, Thomas H.

89

View / Download  

Science Conference Proceedings (OSTI)

Member. News. In Memory of Ralph L. Harris, 19542007. In July, Ralph L. Harris, a professor in the Department of Mining and Mate- rials Engineering at...

90

Browse by Discipline -- E-print Network Subject Pathways: Environmenta...  

Office of Scientific and Technical Information (OSTI)

Kerekes, Tamas (Tamas Kerekes) - Department of Energy Technology, Aalborg University Kwatny, Harry G. (Harry G. Kwatny) - Department of Mechanical Engineering and Mechanics, Drexel...

91

SHREC'11 Track: Shape Retrieval on Non-rigid 3D Watertight ...  

Science Conference Proceedings (OSTI)

... 7. Harris3DGeoMap16, Harris3DGeoMap32 and HKS submitted by Ivan Sipiran and Benjamin Bustos from University of Chile, Chile. ...

2011-04-27T23:59:59.000Z

92

FIPS 140-1 Vendor List  

Science Conference Proceedings (OSTI)

... 1592 - Harris Unified Audio Card. 1949 - Harris AES Software Load Module. ... 757 - Lexmark PrintCryption. 1015 - Lexmark Encryption Plug-In. ...

2013-08-27T23:59:59.000Z

93

I am pleased to provide for your information and use an update to A Brief Guide: Department of Energy-wide Contracts for NEPA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

April 13, 2011 Office of the General Counsel and April 13, 2011 Office of the General Counsel and Office of Procurement and Assistance Management/NNSA DOE-wide Contracts Program Manager Information Gonzales-Stoller Contact Jerome Gonzales jeromegonzales@jgmsinc.com Phone 970-254-1354 Fax 970-254-1356 Address Gonzales-Stoller 336 Main Street, Ste 207 Grand Junction, CO 81501 www.gssnepa.com Contract No. DE-AM52-09NA29164 (small business) HDR Contact Danny Rakestraw Phone 702-938-6049 danny.rakestraw@hdrinc.com Fax 702-938-6060 Address HDR 7180 Pollock Drive, Ste 200 Las Vegas, NV 89119-9005 www.hdrinc.com/doe-nepa-team/ Contract No. DE-AM52-09NA29166 J A D Environmental Contact Ernest (Ernie) C. Harr, Jr. eharr@jason.com Phone 301-828-7342

94

Pyro-decomposition of Pyrite and Arsenopyrite for Sulphur and ...  

Science Conference Proceedings (OSTI)

About this Abstract. Meeting, Materials Science & Technology 2013. Symposium, Ralph Lloyd Harris Memorial Symposium. Presentation Title...

95

August 2011 Jocelyn Marget Richard  

E-Print Network (OSTI)

at the 2011 meeting of the Society for Neuroscience, Washington, DC. Richard, J. M., & Berridge, K. C. (2011 of the Society for Neuroscience, Washington, DC. Dess, N. K., Chapman, C. D., Garrett, C. C., Gonzales, M., Mc, Adobe Illustrator, Noldus Observer, GraphPad Prism, Windows XP/7 and Mac OS X core software References

Berridge, Kent

96

Ground penetrating radar technique to locate coal mining related features: case studies in Texas  

E-Print Network (OSTI)

The goal of this research project is to identify the efficacy of the ground penetrating radar (GPR) technique in locating underground coal mine related subsidence features at Malakoff and Bastrop, Texas. The work at Malakoff has been done in collaboration with the Railroad Commission of Texas (RRC). RRC has been carrying out reclamation of abandoned underground coal mines at Malakoff since the early 1990?s. The history of the specific mining operations (at Malakoff and Bastrop) that took place in the early 1900?s has been difficult to ascertain; therefore, the use of a geophysical techniques like ground penetrating radar to identify hidden voids and potential subsidence features is vital for future reclamation process. Some of the underground mine workings at the field site have collapsed over time affecting the topography by creating sinkholes. GPR data, employing 25 MHz, 50 MHz and 100 MHz frequency antennae, have been collected in common offset patterns and azimuthal pattern. GPR data indicate the mine tunnels possibly connecting existing sinkholes by radargram hyperbolae that correspond with mine openings observed visually or during reclamation. This study also denotes the importance of understanding the variable physical properties of the stratigraphy, which could lead to false alarms by misinterpretation of the radar signals. Natural and man-made above-ground structures cause obstructions in data collection, and hence an optimal design is required for each survey. RRC successfully ground-truthed the data during its reclamation process. In turn, the acquired geophysical data helped to guide the reclamation. At Bastrop, GPR data along with historical documentation led to the conclusion that coal mining did exist in this region but is not a major concern to the immediate stability and safety of the field site. It can be concluded from both the studies that the GPR technique identifies anomalous shafts/tunnels possibly connecting potential failure.

Save, Neelambari R

2004-12-01T23:59:59.000Z

97

Going Home? The Failed Myth of Return in Eddy L. Harriss Native Stranger: A Black Americans Journey into the Heart of Africa and Caryl Phillipss The Atlantic Sound  

E-Print Network (OSTI)

Afro-Atlantic diasporic pilgrims, critical; who travel totext. tepid reception is The pilgrim's poor or dissatisfyingwhen a black diasporic pilgrim, through travel, inserts

Bennett, Zara

2006-01-01T23:59:59.000Z

98

Sandia National Laboratories is seeking applicants for the President Harry S. Truman Fellowship (in National Security Science and Engineering). Candidates for this position are expected to have solved a  

E-Print Network (OSTI)

Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE National Security Science and Engineering). Candidates for this position are expected to have solved Sandia's national security mission. The appointee is expected to foster creativity and to stimulate

99

Distributional lexical semantics: Toward uniform representation paradigms for advanced acquisition and processing tasks  

Science Conference Proceedings (OSTI)

The distributional hypothesis states that words with similar distributional properties have similar semantic properties (Harris 1968). This perspective on word semantics, was early discussed in linguistics (Firth 1957; Harris 1968), and then successfully ...

R. Basili; M. Pennacchiotti

2010-10-01T23:59:59.000Z

100

Molecular Phylogenetics and Evolution 43 (2007) 11511166 www.elsevier.com/locate/ympev  

E-Print Network (OSTI)

: Budgeting Michael Harris, Founder, Pilgrim Center for the Arts PBAF 598V. Building and Managing Your Own

Jackman, Todd

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Vol. XLVII College of Arts & Sciences Alumni Association December 2002 I U C H E M I S T R Y  

E-Print Network (OSTI)

: Budgeting Michael Harris, Founder, Pilgrim Center for the Arts PBAF 598V. Building and Managing Your Own

Indiana University

102

Undergraduate Course Catalog Table of Contents Home Landing Page Welcome and Course Catalog Purpose and Disclaimer Statement........2  

E-Print Network (OSTI)

: Budgeting Michael Harris, Founder, Pilgrim Center for the Arts PBAF 598V. Building and Managing Your Own

Raina, Ramesh

103

Interpretation of monazite ages obtained via in situ analysis E.J. Catlos a,*, L.D. Gilley b  

E-Print Network (OSTI)

and Barreiro, 1990; Harri- son et al., 1997) and inclusions in garnet are armored against daughter product loss

104

An Economic Analysis of the  

Science Conference Proceedings (OSTI)

... 3 Presentation of Harold E. Harris, Engineering Coordinator, Exxon Company, Temperature Correction of Petroleum Products at Retail, Report of ...

2011-10-24T23:59:59.000Z

105

NISTIR 6969 February 2012  

Science Conference Proceedings (OSTI)

Page 1. Selected Laboratory and Measurement Practices, and Procedures, to Support Basic Mass Calibrations (2012 Ed) Georgia L. Harris ...

2012-05-07T23:59:59.000Z

106

GLOBAL EXPLOITATION OF HEAP LEACHABLE GOLD DEPOSITS ...  

Science Conference Proceedings (OSTI)

Session Chairpersons: Donald M. Hausen, Consultant, Salt Lake City, UT; Leonard Harris, Consultant and Former General Manager, Minera Yanacocha, Peru...

107

Syllabus for Economics 449 01 93869 Economic Analysis of Law 8:30 9:30 AM, AA G019 Syllabus for Economics 449 02 96383 Economic Analysis of Law 9:40 10:40 AM, AA G023  

E-Print Network (OSTI)

Contract I Ch 12 Wed Oct 27 Cases: Rexite, Miltenberg, Wilkin, Harris, Mills; Fri Oct 292 Campbell, Eastern

Suzuki, Masatsugu

108

From Extractive Metallurgy to Materials Engineering: A Personal ...  

Science Conference Proceedings (OSTI)

About this Abstract. Meeting, Materials Science & Technology 2013. Symposium, Ralph Lloyd Harris Memorial Symposium. Presentation Title, From Extractive...

109

Transfer and Consumption of Oxygen in Gold-bearing Sulfide Ores  

Science Conference Proceedings (OSTI)

About this Abstract. Meeting, Materials Science & Technology 2013. Symposium, Ralph Lloyd Harris Memorial Symposium. Presentation Title, Transfer and...

110

Downscaling, Data Fusion, and Data Assimilation in Hydro-meteorology  

E-Print Network (OSTI)

for fusion of rainfall data ( e.g. Gorenburg, McLaughlin, and Entekhabi 2001; Tustison, Harris and Foufoula

111

In 2003, the College of Dental Medicine, led by Dean Ira Lamster and Advisory  

E-Print Network (OSTI)

Irving Kittay '41 Jerome L. Klaif '42 * Harry M. Levine '36* William M. May * Grace L. Miller * Dr. Letty * Norman Kahn '58, PhD '64 Estate of Harry M. Levine '36 * Estate of William M. May * Henry I. Nahoum'43 David Knaus, '76, Peds '77 Estate of Harry M. Levine '36 * Estate of Grace L. Miller * (widow of William

Grishok, Alla

112

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

31112 31112 Electrometallurgical Ferroalloy Product Manufacturing EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov PANTEX PLANT Brad Beck (806) 477-6192 bbrack@pantex.com 331210 Iron and Steel Pipe and Tube Manufacturing from Purchased Steel EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov PANTEX PLANT Brad Beck (806) 477-6192 bbrack@pantex.com RIVER PROTECTION Susan Johnson (509) 373-7914 susan_c_johnson@orp.doe.gov 331221 Rolled Steel Shape Manufacturing

113

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

113110 Timber tract operations 113110 Timber tract operations BONNEVILLE POWER ADMIN Greg Eisenach (360) 418-8063 gaeisenach@bpa.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov SOUTHEASTERN POWER ADMIN Ann Craft (706) 213-3823 annc@sepa.doe.gov SOUTHWESTERN POWER ADMIN Gary Bridges (918) 595-6671 gary.bridges@swpa.gov WESTERN POWER ADMIN Cheryl Drake (720) 962-7154 drake@wapa.gov 113310 Cutting and transporting timber BONNEVILLE POWER ADMIN Greg Eisenach (360) 418-8063 gaeisenach@bpa.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov SOUTHEASTERN POWER ADMIN Ann Craft (706) 213-3823 annc@sepa.doe.gov SOUTHWESTERN POWER ADMIN

114

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

83111 83111 Deep Sea Freight Transportation EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov RIVER PROTECTION Susan Johnson (509) 373-7914 susan_c_johnson@orp.doe.gov 483211 Inland Water Freight Transportation EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov RIVER PROTECTION Susan Johnson (509) 373-7914 susan_c_johnson@orp.doe.gov 484110 General Freight Trucking, Local BONNEVILLE POWER ADMIN Greg Eisenach (360) 418-8063 gaeisenach@bpa.gov EM BUSINESS CENTER

115

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

13312 13312 Textile and Fabric Finishing (except Broadwoven Fabric) Mills EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov Y-12 SITE Gloria Mencer (865) 576-2090 mencergd@y12.doe.gov 314991 Rope, Cordage, and Twine Mills EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov Y-12 SITE Gloria Mencer (865) 576-2090 mencergd@y12.doe.gov 314999 All Other Miscellaneous Textile Product Mills EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov

116

Clean Cities: Lone Star Clean Fuels Alliance (Central Texas) coalition  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Lone Star Clean Fuels Alliance (Central Texas) Coalition Lone Star Clean Fuels Alliance (Central Texas) Coalition The Lone Star Clean Fuels Alliance (Central Texas) coalition works with vehicle fleets, fuel providers, community leaders, and other stakeholders to reduce petroleum use in transportation. Lone Star Clean Fuels Alliance (Central Texas) coalition Contact Information Stacy Neef 512-773-8794 stacy.neef@lonestarcfa.org Coalition Website Clean Cities Coordinator Stacy Neef Photo of Stacy Neef Stacy Neef has served as the coordinator for Lone Star Clean Fuels Alliance (Austin) (LSCFA) promoting and advancing the use of alternative fuel and vehicles for fleets in central Texas since 2000. The central Texas region includes Bastrop, Caldwell, Hays, Travis, Williamson Counties; Fort Hood and City of Temple, Texas. LSCFA works closely with other Texas Clean

117

FE Categorical Exclusions | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 13, 2011 September 13, 2011 CX-006757: Categorical Exclusion Determination Evaluating and Commercializing a Solvent Based Enhanced Oil Recovery Technology CX(s) Applied: B3.7 Date: 09/13/2011 Location(s): Smiley, Texas Office(s): Fossil Energy, National Energy Technology Laboratory September 13, 2011 CX-006756: Categorical Exclusion Determination Evaluating and Commercializing a Solvent Based Enhanced Oil Recovery Technology CX(s) Applied: B3.7 Date: 09/13/2011 Location(s): Stairtown, Texas Office(s): Fossil Energy, National Energy Technology Laboratory September 13, 2011 CX-006755: Categorical Exclusion Determination Evaluating and Commercializing a Solvent Based Enhanced Oil Recovery Technology CX(s) Applied: B3.7 Date: 09/13/2011 Location(s): Bastrop County, Texas Office(s): Fossil Energy, National Energy Technology Laboratory

118

Categorical Exclusion Determinations: National Energy Technology Laboratory  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7, 2010 7, 2010 CX-003795: Categorical Exclusion Determination Recovery Act: San Bernardino Associated Government Natural Gas Truck Project CX(s) Applied: B5.1 Date: 09/17/2010 Location(s): Rancho Cucamonga, California Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory September 17, 2010 CX-003793: Categorical Exclusion Determination Texas Propane Fleet Pilot Program CX(s) Applied: B5.1 Date: 09/17/2010 Location(s): Bastrop, Texas Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory September 17, 2010 CX-003790: Categorical Exclusion Determination Texas Propane Fleet Pilot Program CX(s) Applied: B5.1 Date: 09/17/2010 Location(s): Taylor, Texas Office(s): Energy Efficiency and Renewable Energy, National Energy

119

Climate Zone 2A | Open Energy Information  

Open Energy Info (EERE)

Climate Zone 2A Climate Zone 2A Jump to: navigation, search A type of climate defined in the ASHRAE 169-2006 standard consisting of Climate Zone Number 2 and Climate Zone Subtype A. Climate Zone 2A is defined as Hot - Humid with IP Units 6300 < CDD50ºF ≤ 9000 and SI Units 3500 < CDD10ºC ≤ 5000 . The following places are categorized as class 2A climate zones: Acadia Parish, Louisiana Alachua County, Florida Allen Parish, Louisiana Anderson County, Texas Angelina County, Texas Appling County, Georgia Aransas County, Texas Ascension Parish, Louisiana Assumption Parish, Louisiana Atascosa County, Texas Atkinson County, Georgia Austin County, Texas Avoyelles Parish, Louisiana Bacon County, Georgia Baker County, Florida Baker County, Georgia Baldwin County, Alabama Bastrop County, Texas

120

Climate Zone Number 2 | Open Energy Information  

Open Energy Info (EERE)

2 is defined as 2 is defined as Hot - Humid(2A) with IP Units 6300 < CDD50ºF ≤ 9000 and SI Units 3500 < CDD10ºC ≤ 5000 Dry(2B) with IP Units 6300 < CDD50ºF ≤ 9000 and SI Units 3500 < CDD10ºC ≤ 5000 . The following places are categorized as class 2 climate zones: Acadia Parish, Louisiana Alachua County, Florida Allen Parish, Louisiana Anderson County, Texas Angelina County, Texas Appling County, Georgia Aransas County, Texas Ascension Parish, Louisiana Assumption Parish, Louisiana Atascosa County, Texas Atkinson County, Georgia Austin County, Texas Avoyelles Parish, Louisiana Bacon County, Georgia Baker County, Florida Baker County, Georgia Baldwin County, Alabama Bandera County, Texas Bastrop County, Texas Bay County, Florida Beauregard Parish, Louisiana Bee County, Texas

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

91 - 9200 of 26,764 results. 91 - 9200 of 26,764 results. Download CX-006755: Categorical Exclusion Determination Evaluating and Commercializing a Solvent Based Enhanced Oil Recovery Technology CX(s) Applied: B3.7 Date: 09/13/2011 Location(s): Bastrop County, Texas Office(s): Fossil Energy, National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-006755-categorical-exclusion-determination Download CX-006756: Categorical Exclusion Determination Evaluating and Commercializing a Solvent Based Enhanced Oil Recovery Technology CX(s) Applied: B3.7 Date: 09/13/2011 Location(s): Stairtown, Texas Office(s): Fossil Energy, National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-006756-categorical-exclusion-determination Download CX-006757: Categorical Exclusion Determination

122

Alabama - State Energy Profile Data - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Barry (Alabama Power Co) ; James H Miller Jr (Alabama Power Co) ; H Allen Franklin Combined Cycle (Southern Power Co) ; E B Harris Electric Generating Plant ...

123

Truman's decision to drop the bomb to be discussed at 70th anniversary...  

NLE Websites -- All DOE Office Websites (Extended Search)

Office (505) 667-5679 Email "Harry S. Truman considered the use of the atomic bomb on Japan among the most important and consequential actions of his presidency....

124

DOE Hydrogen Analysis Repository: Impact of Hydrogen Production...  

NLE Websites -- All DOE Office Websites (Extended Search)

U.S. Energy Markets Project ID: 99 Principal Investigator: Harry Vidas Keywords: Hydrogen production; hydrogen supply; infrastructure; costs Purpose This project addresses the...

125

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6823 Blackhorse Energy, LLC FE Weatherford Laboratories SCCSequestration Division FY12-15 10111 - 93015 Bruce Brown Houston, Harris County, TX South Louisiana EOR...

126

MT@TMS  

Science Conference Proceedings (OSTI)

Jul 7, 2009 ... Through interviews with Harrie J. Stevens, director of the Center for Glass ... tensile stress, as well as manufacturing and tempering techniques.

127

Processes, Applications, and Performance of Materials in Additive ...  

Science Conference Proceedings (OSTI)

Ian D Harris, Edison Welding Institute Ola L. A. Harrysson, North Carolina State University Sudarsanam Suresh Babu, The Ohio State University Rodney Boyer...

128

Visualization and Data Mining in an 3D Immersive ...  

Science Conference Proceedings (OSTI)

... 39 4.12 Solar Flare . . . . . ... 42 Page 49. 4.12 Solar Flare The Solar Flare data set was processed by Harry Bullen. ...

2010-11-23T23:59:59.000Z

129

Senate Confirms DOE Nominees Daniel Poneman, David Sandalow,...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Blake Harris, General Counsel; David Sandalow, Assistant Secretary for Policy and International Affairs; and Ines Triay, Assistant Secretary for Environmental Management....

130

Participants of the Workshop for a Future Information Infrastructure...  

Office of Scientific and Technical Information (OSTI)

and world Fran Buckley Government Printing Office Howard Harris University of Maryland Eileen Collins National Science Foundation Larry Lannom Corporation for National Research...

131

Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Test Bed. Berkeley: LBNL, 2011. Lasseter, Robert H.. Smart Distribution: Coupled Microgrids., 2011. 2010 Lasseter, Robert H., Joseph H. Eto, Ben Schenkman, John Stevens, Harry...

132

4th International Conference on Biofuels Standards  

Science Conference Proceedings (OSTI)

... Overview of USDA Biomass Programs and Activities Harry Baumes, US Department of ... Development Related to Fuel Use of Fast Pyrolysis Bio-Oil ...

2013-01-31T23:59:59.000Z

133

Microsoft Word - EM QA Corporate Board Meeting Minutes - Dec...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- Richland Charlie Harris - Savannah River Bud Danielson -Chief of Nuclear Safety Jack Craig - EMCBC Russell McCallister - PortsmouthPaducah Jose Franco- Carlsbad Brian Harkins -...

134

Division News - TMS  

Science Conference Proceedings (OSTI)

... on Waste Minimization" (EPD Edition), August 1996. "The Yanacocha Project: An Example of Challenges and Opportunities in Peru," L. Harris, April 1994.

135

Electron Beam Melting (EBM)  

Science Conference Proceedings (OSTI)

Oct 18, 2011 ... Additive Manufacturing of Metals: Electron Beam Melting (EBM) I Sponsored by: MS&T Organization Program Organizers: Ian D. Harris, EWI;...

136

Electron Beam Melting  

Science Conference Proceedings (OSTI)

Oct 9, 2012 ... Additive Manufacturing of Metals: Electron Beam Melting Program Organizers: Ian Harris, EWI; Ola Harrysson, North Carolina State University;...

137

Electron Beam Melting (EBM) II  

Science Conference Proceedings (OSTI)

Oct 19, 2011 ... Additive Manufacturing of Metals: Electron Beam Melting (EBM) II Sponsored by: MS&T Organization Program Organizers: Ian D. Harris, EWI;...

138

Scarboro Creek Wetland  

NLE Websites -- All DOE Office Websites (Extended Search)

Plant Management: Scarboro Creek Wetland * Purple loosestrife was treated with foliar spray of Accord (glyphosphate) by ESD in 2007. Photos by Harry Quarles Invasive Non-native...

139

Microsoft PowerPoint - Pete H's 2008 SWPA Conf Pres(NWK Proj...  

NLE Websites -- All DOE Office Websites (Extended Search)

PROJECTS IMPACTING FEDERAL POWER KANSAS CITY DISTRICT * AmerenUE's (Bagnell Dam) FERC Re-licensing Impacts, Harry S. Truman Project * Draft Tube Bulkheads and Cylinder Hoists...

140

Table 3. Nuclear Reactor Characteristics and Operational ...  

U.S. Energy Information Administration (EIA)

Point Beach Nuclear Plant Quad Cities Generating Station R.E. Ginna Nuclear Power Plant PSEG Salem Generating Station Harris South Texas Project PPL ...

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

3-Dimensional Materials Science  

Science Conference Proceedings (OSTI)

Mar 13, 2008 ... Ewarton Alumina Refinery: Patrick Harris1; 1West Indies Alumina Company ..... assumed that the friction of MGs made slippy with the oil slick,...

142

Microsoft PowerPoint - former_Wadsworth.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Fish sampling ORNL staff members, including former Lab director Jeff Wadsworth (center), sample fish in a local stream ... Photos by Harry Quarles and examine what they collected....

143

Expanding Research Communities and Collaborations: DOE JGI 2014...  

NLE Websites -- All DOE Office Websites (Extended Search)

that are involved in breaking down carbon in these organisms. Three projects focus on biofuels and the role of fungi improving production of them. Steve Harris from the...

144

Microsoft PowerPoint - Pete H's 2007 SWPA Conf Pres(NWK Proj...  

NLE Websites -- All DOE Office Websites (Extended Search)

Contracting, Portland and Kansas City Districts Structural Section, Kansas City District Construction (WAFB), Kansas City District Operations Division, Kansas City District Harry...

145

Conte, Rms B523 + B524 Reno Grant Funded  

E-Print Network (OSTI)

Renovation Kenny Gail 6/23/2010 10/31/2010 Flint, Rm 209A AC Wiater Harry Flint Laboratory 100 Flint, Heating

Massachusetts at Amherst, University of

146

Reliability Technology earns prestigious Los Alamos award  

NLE Websites -- All DOE Office Websites (Extended Search)

Reliability Technology earns award Reliability Technology earns prestigious Los Alamos award LANL has honored Michael Hamada, Harry Martz and a team of researchers with its first...

147

Towards a Policy of Progressive Efficiency  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficiency Title Towards a Policy of Progressive Efficiency Publication Type Book Chapter Year of Publication 2010 Authors Harris, Jeffrey P., Richard C. Diamond, Carl...

148

FAR-FIELD TSUNAMI IMPACT ON THE U.S. EAST COAST FROM AN EXTREME FLANK COLLAPSE OF THE  

E-Print Network (OSTI)

be significant at some locations along the US East Coast (USEC) (e.g., Abadie et al., 2012; Harris et al., 2012

Kirby, James T.

149

MGSC template  

NLE Websites -- All DOE Office Websites (Extended Search)

Hannes E. Leetaru, Principal Investigator Co-PI's Dave Harris, Kentucky Geological Survey Dave Barnes, Western Michigan University John Rupp, Indiana Geological Survey Scott...

150

Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

and Michigan Basins Hannes E. Leetaru, Principal Investigator Co-PI's Dave Harris, Kentucky Geological Survey Dave Barnes, Western Michigan University John Rupp, Indiana...

151

Seismic Design of Steel Special Concentrically Braced Frame ...  

Science Conference Proceedings (OSTI)

Page 1. NEHRP Seismic Design Technical Brief No. 8 ... Dr. John (Jay) L. Harris, III, managed the project to produce this Technical Brief for EL. ...

2013-08-01T23:59:59.000Z

152

Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Harry T. Volkommer, David Klapp, Ed Linton, Hector Hurtado, and Joyashree Roy. "CERTS Microgrid Laboratory Test Bed." IEEE Transactions on Power Delivery 26, no. 1 (2011). 2010...

153

Sandia National Laboratories: Careers: Students & Postdocs: Fellowship...  

NLE Websites -- All DOE Office Websites (Extended Search)

Truman Fellowship Sandia established the President Harry S. Truman Fellowship in National Security Science and Engineering to attract the best nationally recognized new Ph.D....

154

2013 NIST Sigma Xi Postdoctoral Poster Presentation ...  

Science Conference Proceedings (OSTI)

... Situ Measurement Platform for Energy Materials and ... Measurement of Surface Plasmon Energies on Metal ... Gacek, EM Peterson, CB Fox, JM Harris ...

155

Microsoft PowerPoint - 10 Lee LCLS Lessons Learned PM Workshop...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

revised - Harry Peters Compatibility Mode Microsoft PowerPoint - 15.1500Michael Deane Compatibility Mode Microsoft PowerPoint - 16.0805Tom Fox Compatibility Mode...

156

5 Fermi 4/13/01  

NLE Websites -- All DOE Office Websites (Extended Search)

Rajendran Raja, Hans Jstlein, Jeff Appel, Dave Christian, Mike Syphers, Herman White, Peter Garbincius. Additional volunteers are: Mike Albrow, Bruce Baller, Chuck Brown, Harry...

157

Effective Teaching Conference on October 11-12  

NLE Websites -- All DOE Office Websites (Extended Search)

Issues submit Effective Teaching Conference on October 11-12 Los Alamos National Laboratory Foundation's 15th annual conference on education will feature Harry K. Wong and...

158

SDSU General Catalog 2009-2010 341 In the College of Professional Studies and Fine Arts  

E-Print Network (OSTI)

Association. Faculty Emeritus: Boggs, Cooke, Dickerson, Gunning, Josephson, Spindler, Stout Director: Harris agencies, and labo- ratories; as food service managers; and as specialists in advertising, sales

Gallo, Linda C.

159

SDSU General Catalog 2006-2007 351 Didactic Program in Dietetics is accredited by the Commission on  

E-Print Network (OSTI)

, Gunning, Josephson, Stout Chair: Harris Professor: Spindler Associate Professors: Beshgetoor, Kern in advertising, sales, or marketing of foods and nutritional products and services. Impacted Program The foods

Gallo, Linda C.

160

226 SDSU General Catalog 2007-2008 In the College of Professional Studies and Fine Arts  

E-Print Network (OSTI)

. Faculty Emeritus: Boggs, Cooke, Dickerson, Gunning, Josephson, Stout Chair: Harris Professors: Kern in advertising, sales, or marketing of foods and nutritional products and services. Impacted Program The foods

Gallo, Linda C.

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Crafting culture : artisan cooperatives in Oaxaca, Mexico  

E-Print Network (OSTI)

Renarrativizing of Postrevolutionary Mexico. In Fragments ofThe Politics of Culture in Mexico since 1940, eds. Gilbertpopulares en el capitalismo. Mexico: Nueva Imagen. Harris,

Edwards, Meghan E.

2009-01-01T23:59:59.000Z

162

You Can't Always Get What You Want: School Governance In California  

E-Print Network (OSTI)

Williams v. State of California, Order on State Demurrernot the situation in California. Studies have shown that theet. al. vs. State of California. Deposition of Wendy Harris.

Timar, Thomas

2002-01-01T23:59:59.000Z

163

Set-Aside EM Nation-Wide Indefinite Delivery/Indefinite Quantity Contracts  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SET-ASIDE EM NATION-WIDE SET-ASIDE EM NATION-WIDE INDEFINITE DELIVERY/INDEFINITE QUANTITY CONTRACTS Contractor Name Team Members/Principal Subcontractors Clauss Construction AECOM, Inc. Cavanagh Services Group, Inc. EnergX, LLC Dynamic Management Solutions, LLC (DMS) CA - LLC Member Restoration Services, Inc, LLC Member Wastren Advantage, Inc. - LLC Member SAIC Bartlett Services, Inc. Siempelkamp Nuclear Services Gonzales-Stoller Remediation Services, LLC JG Management Systems, Inc. - LLC Member (Protégé) The S.M. Stoller Corporation - LLC Member (Mentor) AET Environmental, Inc. ALS Laboratory Group AquaTierra Associates, Inc. DBA Weiss Assoc. ARCADIS U.S., Inc. AREVA Federal Services, LLC

164

Tribal Group Call 8-2-06 final  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Summary Summary TEC Tribal Topic Group Conference Call August 2, 2006 Participants: Jay Jones, Department of Energy (DOE)/Office of Civilian Radioactive Waste Management (OCRWM), chaired the session. Other Topic Group members included Kevin Blackwell (Federal Railroad Administration), Peter Blaney (Legin, Inc.), Elizabeth Helvey (JK Research Associates, Inc./BSC), Ed Gonzales (Pueblo de San Ildefonso), Angela Kordyak (DOE/Office of General Counsel), Robert Lupton (DOE/NV), Corinne Macaluso (DOE/OCRWM), Titto Moses (Confederated Tribes of the Umatilla Indian Reservation), Christina Nelson (National Conference of State Legislatures), Jennifer Patric (Booz Allen Hamilton), Stanley Paytiamo (Pueblo of Acoma), Wilda Portner (SAIC), Willie Preacher (Shoshone-Bannock Tribes), Herman

165

Criterion validity of a 10-category scale for ranking physical activity in Norwegian women  

E-Print Network (OSTI)

of certain types of activities such as cycling and carrying heavy loads. Heart rate monitoring is limited when measuring low-intensity activity due to stronger relative influence of stress and relies more heavily on individual calibration [15]. A combined... , Kerrison N, Langenberg C, Arriola L, Clavel-Chapelon F, Barricart A, Boeing H, Gonzales C, Kaaks R, Key T, Khaw KT, May A, Nilsson P, Norat T, Overvad K, Palli D, Panico S, Quiros R, et al: Validity of a short questionnaire to assess physical activity in 10...

Borch, Kristin B; Ekelund, Ulf; Brage, Soren; Lund, Eiliv

2012-01-19T23:59:59.000Z

166

September/October 2007 Clovertales  

E-Print Network (OSTI)

. Gelman, Samuel D. George, Philip M. Georges, Sekou C. Georgescu, Cezar Gerace, Chelsea M. Gerard, Cory W, Graham R. Hampton, Clarice J. Han, Ji Sook Han, Jiami Han, Jun Hance, Frederick P. Handler, Ariela S L. Harris, Lisa M. Harris, Sarah Hartblay, Trevor A. Hartjen, Sarah A. Hartman, Chelsea E. Hartough

Goodman, Robert M.

167

September/October 2010 Clovertales  

E-Print Network (OSTI)

. Gelman, Samuel D. George, Philip M. Georges, Sekou C. Georgescu, Cezar Gerace, Chelsea M. Gerard, Cory W, Graham R. Hampton, Clarice J. Han, Ji Sook Han, Jiami Han, Jun Hance, Frederick P. Handler, Ariela S L. Harris, Lisa M. Harris, Sarah Hartblay, Trevor A. Hartjen, Sarah A. Hartman, Chelsea E. Hartough

Goodman, Robert M.

168

Arentze, Rasouli and Timmermans 1 Integrating a Multi-Agent Model of Land Development and an Activity-Based Model of  

E-Print Network (OSTI)

on Integrated Travel Demand and Network Supply Modeling, Tampa, USA. Theo Arentze, Soora Rasouli and Harry and an Activity-Based Model of Transport Demand: Progress and Developments1 Theo Arentze, Soora Rasouli and Harry aimed at integrating activity-based models of transport demand and models of land development

Kemner, Ken

169

Probabilistic and Max-margin structured learning in Human Action Recognition  

E-Print Network (OSTI)

are `space-time interest point' (STIP) from Laptev [2005] and `space-time cuboid' from Dollar et al. [2005a]. While STIP is devel- oped as an space-time extension of Harris corner detector Harris and Stephens [1988 been reported that produce compelling results using STIP and cuboids in the bag-of-feature frame- work

New South Wales, University of

170

Dean's List Fall 2012 Harpur College of Arts and Sciences  

E-Print Network (OSTI)

. Gelman, Samuel D. George, Philip M. Georges, Sekou C. Georgescu, Cezar Gerace, Chelsea M. Gerard, Cory W, Graham R. Hampton, Clarice J. Han, Ji Sook Han, Jiami Han, Jun Hance, Frederick P. Handler, Ariela S L. Harris, Lisa M. Harris, Sarah Hartblay, Trevor A. Hartjen, Sarah A. Hartman, Chelsea E. Hartough

Zhang, Zhongfei "Mark"

171

CATALOG 20002001CATALOG 20002001 4 The University  

E-Print Network (OSTI)

. Gelman, Samuel D. George, Philip M. Georges, Sekou C. Georgescu, Cezar Gerace, Chelsea M. Gerard, Cory W, Graham R. Hampton, Clarice J. Han, Ji Sook Han, Jiami Han, Jun Hance, Frederick P. Handler, Ariela S L. Harris, Lisa M. Harris, Sarah Hartblay, Trevor A. Hartjen, Sarah A. Hartman, Chelsea E. Hartough

Rhode Island, University of

172

Celebrating Diversity in Computing: Speaking at the Richard Tapia  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Diversity in Computing: Speaking at the Richard Tapia Diversity in Computing: Speaking at the Richard Tapia Conference Celebrating Diversity in Computing: Speaking at the Richard Tapia Conference March 1, 2013 - 9:53am Addthis Director Dot Harris spoke with over 330 students about diversity in computing and other technical careers at the Richard Tapia Diversity in Computing Conference in February 2013.Photo Credit: Reggie Campbell, RL Campbell Photography Director Dot Harris spoke with over 330 students about diversity in computing and other technical careers at the Richard Tapia Diversity in Computing Conference in February 2013.Photo Credit: Reggie Campbell, RL Campbell Photography Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity Finding your niche and making your mark should be the goal of any young

173

Introducing a Girl to Engineering - A Day at Argonne National Lab |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Introducing a Girl to Engineering - A Day at Argonne National Lab Introducing a Girl to Engineering - A Day at Argonne National Lab Introducing a Girl to Engineering - A Day at Argonne National Lab February 25, 2013 - 2:51pm Addthis Participants of the 2013 Introduce a Girl to Engineering Day gather at Argonne National Laboratory with Director Dot Harris. Participants of the 2013 Introduce a Girl to Engineering Day gather at Argonne National Laboratory with Director Dot Harris. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity Did you know that while women comprise 48 percent of the U.S. workforce, they hold only 24 percent of STEM jobs? STEM, or science, technology, engineering, and mathematics, is critical for the mission of the Energy Department in securing our clean energy future - and it's critical for the

174

Leadership | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Leadership Leadership Leadership Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity LaDoris "Dot" Harris was nominated by President Obama to be the Director of the Office of Economic Impact and Diversity at the United States Department of Energy. She was confirmed by the U.S. Senate on March 29, 2012. Ms. Harris brings nearly 30 years of management and leadership experience to this position, having served at some of the world's largest firms and leading a successful energy, IT, and healthcare consulting firm. More about Dot Harris Andre H. Sayles Principal Deputy Director of the Office of Economic Impact and Diversity and Acting Deputy Director of the Office of Minority Business and Economic Development Andre H. Sayles, Ph.D., joined the Department of Energy as the Principal

175

Leveling the Playing Field for Women: Work at the Energy Department |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Leveling the Playing Field for Women: Work at the Energy Department Leveling the Playing Field for Women: Work at the Energy Department Leveling the Playing Field for Women: Work at the Energy Department August 15, 2012 - 1:40pm Addthis Karl Fraiser, a member of the Savannah River Special Emphasis Planning Committee, meets with Dot Harris at the site’s Women’s Equality Day Celebration. | Photo by Rob Davis, Savannah River Site. Karl Fraiser, a member of the Savannah River Special Emphasis Planning Committee, meets with Dot Harris at the site's Women's Equality Day Celebration. | Photo by Rob Davis, Savannah River Site. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity We Need to Get More Women Involved Women hold only 27 percent of jobs in science and engineering-sectors that are essential to our nation's growth in a 21st

176

Talking Small Business in Knoxville, Tennessee | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Talking Small Business in Knoxville, Tennessee Talking Small Business in Knoxville, Tennessee Talking Small Business in Knoxville, Tennessee July 18, 2012 - 2:11pm Addthis Dot Harris speaking live to WBIR, a local Knoxville television station, the morning of the Energy Department/National Nuclear Security Administration Small Business Summit (July 10). Photo: DOE Photographer Lynn Frenny Dot Harris speaking live to WBIR, a local Knoxville television station, the morning of the Energy Department/National Nuclear Security Administration Small Business Summit (July 10). Photo: DOE Photographer Lynn Frenny Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity During the last fiscal year, the Energy Department contracted with over 7,000 small businesses, doing over $8 billion worth of business overall.

177

Native American Students in STEM Fields: A Critical Need for our Country |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Native American Students in STEM Fields: A Critical Need for our Native American Students in STEM Fields: A Critical Need for our Country Native American Students in STEM Fields: A Critical Need for our Country August 1, 2012 - 10:20am Addthis Dot Harris, Director of the Office of Economic Impact and Diversity, speaks about her engineering career to Native American students at the Intertribal Youth Summit on July 30. | Photo Credit: AnneMarie Ashburn, Department Of Energy. Dot Harris, Director of the Office of Economic Impact and Diversity, speaks about her engineering career to Native American students at the Intertribal Youth Summit on July 30. | Photo Credit: AnneMarie Ashburn, Department Of Energy. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity "Engineering has greatly enhanced my critical thinking and analytical

178

Proud to Be a Girl - A Visit to Oak Ridge National Laboratory | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Proud to Be a Girl - A Visit to Oak Ridge National Laboratory Proud to Be a Girl - A Visit to Oak Ridge National Laboratory Proud to Be a Girl - A Visit to Oak Ridge National Laboratory August 20, 2013 - 10:38am Addthis Girls from Martha O'Bryan Community Center and Maryville Christian School visiting Director Dot Harris at Oak Ridge National Laboratory discussed STEM careers, educational opportunities, and exploring science this August. Girls from Martha O'Bryan Community Center and Maryville Christian School visiting Director Dot Harris at Oak Ridge National Laboratory discussed STEM careers, educational opportunities, and exploring science this August. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity There's an old axiom that you can't be what you can't see. Perhaps if

179

Leveling the Playing Field for Women: Work at the Energy Department |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Leveling the Playing Field for Women: Work at the Energy Department Leveling the Playing Field for Women: Work at the Energy Department Leveling the Playing Field for Women: Work at the Energy Department August 15, 2012 - 1:40pm Addthis Karl Fraiser, a member of the Savannah River Special Emphasis Planning Committee, meets with Dot Harris at the site’s Women’s Equality Day Celebration. | Photo by Rob Davis, Savannah River Site. Karl Fraiser, a member of the Savannah River Special Emphasis Planning Committee, meets with Dot Harris at the site's Women's Equality Day Celebration. | Photo by Rob Davis, Savannah River Site. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity We Need to Get More Women Involved Women hold only 27 percent of jobs in science and engineering-sectors that are essential to our nation's growth in a 21st

180

Fossil Energy Acting Assistant Secretary Recognized at Black Engineer of  

NLE Websites -- All DOE Office Websites (Extended Search)

Fossil Energy Acting Assistant Secretary Recognized at Black Fossil Energy Acting Assistant Secretary Recognized at Black Engineer of the Year Awards Fossil Energy Acting Assistant Secretary Recognized at Black Engineer of the Year Awards February 19, 2013 - 8:54am Addthis Director Dot Harris presents Chris Smith, Principal Deputy Assistant Secretary and Acting Assistant Secretary of Fossil Energy, with a professional achievement award at the Black Engineer of the Year Awards conference this February. Photo Credit: Nancy Jo Brown/106FOTO Director Dot Harris presents Chris Smith, Principal Deputy Assistant Secretary and Acting Assistant Secretary of Fossil Energy, with a professional achievement award at the Black Engineer of the Year Awards conference this February. Photo Credit: Nancy Jo Brown/106FOTO Dot Harris Dot Harris

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Fossil Energy Acting Assistant Secretary Recognized at Black Engineer of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fossil Energy Acting Assistant Secretary Recognized at Black Fossil Energy Acting Assistant Secretary Recognized at Black Engineer of the Year Awards Fossil Energy Acting Assistant Secretary Recognized at Black Engineer of the Year Awards February 19, 2013 - 8:54am Addthis Director Dot Harris presents Chris Smith, Principal Deputy Assistant Secretary and Acting Assistant Secretary of Fossil Energy, with a professional achievement award at the Black Engineer of the Year Awards conference this February. Photo Credit: Nancy Jo Brown/106FOTO Director Dot Harris presents Chris Smith, Principal Deputy Assistant Secretary and Acting Assistant Secretary of Fossil Energy, with a professional achievement award at the Black Engineer of the Year Awards conference this February. Photo Credit: Nancy Jo Brown/106FOTO Dot Harris Dot Harris

182

CX-004115: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

115: Categorical Exclusion Determination 115: Categorical Exclusion Determination CX-004115: Categorical Exclusion Determination Harris County North Bayou Central Plant CX(s) Applied: B5.1 Date: 09/24/2010 Location(s): Harris County, Texas Office(s): Energy Efficiency and Renewable Energy, Golden Field Office Harris County, Texas proposes to use $13,773,400 of Energy Efficiency and Conservation Block Grant (EECBG) funds to support the purchase of an energy efficiency package to be installed within the newly constructed Harris County North Bayou Central Plant (NBCP). The proposed project is part of a larger scope of work which involves the construction of the NBCP building, however; EECBG funds will only be used towards the purchase of energy efficiency equipment and any cost associated with labor/installation of the

183

NETL: 2001 Conference on Selective Catalytic Reduction (SCR)...  

NLE Websites -- All DOE Office Websites (Extended Search)

Operating Experience with SCR on a 600-MW PRB-Fired Boiler PDF-8KB Dave Harris, Black & Veatch & Scot Pritchard, Cormetech Bench- and Pilot-Scale Evaluation of SCR and Other...

184

Materials Science  

NLE Websites -- All DOE Office Websites (Extended Search)

particles H. Boukari, D. Green, and M.T. Harris Searching for charge scattering from stripes in La2-xSrxCuO4 and related compounds R. Christianson, R. Leheny, R. Birgeneau, L....

185

From phoneme to morpheme: another verification using a corpus  

Science Conference Proceedings (OSTI)

We scientifically test Harris's hypothesis that morpheme/ word boundaries can be detected from changes in the complexity of phoneme sequences. We re-formulate his hypothesis from a more information theoretic viewpoint and use a corpus to test whether ...

Kumiko Tanaka-Ishii; Zhihui Jin

2006-12-01T23:59:59.000Z

186

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

Neutrino Monologues: Debbie Harris Project X: Bob Tschirhart Moderator - Chris Miller of COD. Tickets - 7 by calling 630840.ARTS or online with no fees at www.fnal.govculture....

187

Karissa Marcum | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

is a Public Affairs Specialist in the Office of Public Affairs. Most Recent The Internet Caf of the Nuclear World July 19 Harry Potter, Oxford and Nuclear Energy July 16...

188

Chicago Office 9800 South Cass Avenue  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Science Chicago Office 9800 South Cass Avenue Argonne, Illinois 60439 January 20,2011 Scott Blake Harris, General Counsel Office of the General Counsel GC-1 FORS - SUBJECT: OFFICE...

189

JOURNAL DE PHYSIQUE IV C2-721 Colloque C2, suppl. au Journal de Physique 11, Vol. 1, septembre 1991  

E-Print Network (OSTI)

.R, Kapitulnik A, Harris J.S, Appl.Phys.Lett. 51(15),(1987) 1191 /6/ Hamdi A.H, Mantese J.V, Micheli A.L, Laugal

Paris-Sud XI, Université de

190

Saving Energy and Enabling Auto-Demand Response in Existing Buildings...  

NLE Websites -- All DOE Office Websites (Extended Search)

Saving Energy and Enabling Auto-Demand Response in Existing Buildings and Plants Using Non-Invasive Retrofit Technologies Speaker(s): Harry Sim Date: April 7, 2011 - 12:00pm...

191

Modeling and Simulating Metal-Forming Equipment  

Science Conference Proceedings (OSTI)

Note in Figure 2 that the fundamental blocks in the forging process simulation .... for the engineer to answer questions concerning the wisdom of possibly adding a ... Harry N. Norton, Handbook of Transducers for Electronic Measuring Systems...

192

Millersville University Editorial Style Guide Updated January 2012 1  

E-Print Network (OSTI)

Fred J. Herfst President and Executive Director Harry Davis Vice President Mary Kenderdine Office Manager and Secretary to the Board Lana E. Kenderdine Treasurer and Financial Officer Dr. Ian Rutherford

Hardy, Christopher R.

193

University of Saskatchewan College of ArtS & SCieNCe  

E-Print Network (OSTI)

Fred J. Herfst President and Executive Director Harry Davis Vice President Mary Kenderdine Office Manager and Secretary to the Board Lana E. Kenderdine Treasurer and Financial Officer Dr. Ian Rutherford

Patterson, William P.

194

A New Earth-Abundant Semiconductor for Solar Energy Conversion  

Science Conference Proceedings (OSTI)

Presentation Title, G2, ZnSnN2: A New Earth-Abundant Semiconductor for Solar Energy Conversion. Author(s), Lise Lahourcade, Naomi C Coronel, Harry A...

195

A five-gene phylogeny of Pezizomycotina Joseph W. Spatafora1  

E-Print Network (OSTI)

Schultz Biozentrum Klein Flottbek und Botanischer Garten der Universita¨t Hamburg, Systematik der Pflanzen Ohnhorststr. 18, D-22609 Hamburg, Germany Harrie Sipman Botanischer Garten und Botanisches Museum Berlin

Arnold, A. Elizabeth

196

Blair Road Kudzu  

NLE Websites -- All DOE Office Websites (Extended Search)

Plant Management: Blair Road and Hwy 58 Intersection * Kudzu treated with foliar spray of Garlon 3a and Tordon by CSC in 2004. Photo by Harry Quarles Invasive Non-native...

197

Constructing Approximations to the Efficient Set of Convex Quadratic ...  

E-Print Network (OSTI)

it is important to gain as much information as possible about the solution set of a given problem ...... the total energy production cost is minimized,. the wear ..... Markets. Basil Blackwell Ltd, Oxford, 1987. [34] H[arry] M. Markowitz. Portfolio...

198

Microsoft PowerPoint - Pete H's 2008 SWPA Conf Pres(NWK Proj...  

NLE Websites -- All DOE Office Websites (Extended Search)

- September 2011 Draft Tube Bulkheads and Cylinder Hoists Repair Project, Harry S. Truman Power Plant 3,630,000++ Total 150,000 Construction, Kansas City Dist. Contract S&A...

199

Effects of Process/Microstructure on the Threshold Fatigue Crack ...  

Science Conference Proceedings (OSTI)

6. D.O. Harris. Journal of Bas~c Engineering, 39. 1967, p.49. 7. M.S. G~lbert and S.N. Malih. unpublished research. GE Aircraft Eng~nes, Cincinnati, Ohio. 8.

200

Designed by Zoning: Evaluating the Spatial Effects of Land Use Regulation  

E-Print Network (OSTI)

by Harris and Batty. Other agent-based models have simulatedagents, which seems like a natural next step based on Knaap et al using developers as players in a game-theory model.

Warren, Charles Reuben

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Chromatin-driven de novo discovery of DNA binding motifs in the human malaria parasite  

E-Print Network (OSTI)

as: Harris et al. : Chromatin-driven de novo discovery ofARTICLE Open Access Chromatin-driven de novo discovery ofis now evidence that the chromatin architecture plays an

Harris, Elena Y; Ponts, Nadia; Le Roch, Karine G; Lonardi, Stefano

2011-01-01T23:59:59.000Z

202

EditEd by Tony Hey, STewarT TanSley, and KriSTin Tolle F o u r t h  

E-Print Network (OSTI)

Diane Harpold & Bill Rodgers Catharine & Richard Harris Benjamin Harrison Karen & Stephen Henderson Treisman Drew Westen Moderator: Patricia Hayes 12:30-1:50 ATLAS Black Box 2465 Rust Belt City Renewal

Fähndrich, Manuel A.

203

Undergraduate Alumni LEHIGH UNIVERSITY 1 Founder's Associate  

E-Print Network (OSTI)

Diane Harpold & Bill Rodgers Catharine & Richard Harris Benjamin Harrison Karen & Stephen Henderson Treisman Drew Westen Moderator: Patricia Hayes 12:30-1:50 ATLAS Black Box 2465 Rust Belt City Renewal

Napier, Terrence

204

Faculty Page 401Sonoma State University 2006-2008 Catalog Carlos C. Ayala (2002)  

E-Print Network (OSTI)

Diane Harpold & Bill Rodgers Catharine & Richard Harris Benjamin Harrison Karen & Stephen Henderson Treisman Drew Westen Moderator: Patricia Hayes 12:30-1:50 ATLAS Black Box 2465 Rust Belt City Renewal

Ravikumar, B.

205

ANNUAL REPORT University of Cambridge  

E-Print Network (OSTI)

Diane Harpold & Bill Rodgers Catharine & Richard Harris Benjamin Harrison Karen & Stephen Henderson Treisman Drew Westen Moderator: Patricia Hayes 12:30-1:50 ATLAS Black Box 2465 Rust Belt City Renewal

Kraft, Markus

206

FindingsV O L U M E 1 7 , N U M B E R 1 s F A L L / W I N T E R 2 0 0 1 U N I V E R S I T Y O F M I C H I G A N  

E-Print Network (OSTI)

Diane Harpold & Bill Rodgers Catharine & Richard Harris Benjamin Harrison Karen & Stephen Henderson Treisman Drew Westen Moderator: Patricia Hayes 12:30-1:50 ATLAS Black Box 2465 Rust Belt City Renewal

Shyy, Wei

207

Secretaries Chu and Salazar will Join Senator Reid to Make Solar...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Salazar and Senate Majority Leader Harry Reid will make an announcement regarding job creation and solar energy development at the Nevada Test Site. Nevada stands to be the leading...

208

Secretary Chu, Senator Reid, Rep. Berkley Announce Conditional...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

clearly shows that Nevada is well on its way to becoming a global leader in clean energy job creation," said Senate Majority Leader Harry Reid. "Thanks to public-private...

209

Draft Agenda for  

NLE Websites -- All DOE Office Websites (Extended Search)

Scott Harris, DOE General Counsel 2:15 pm 2:30 pm Break 2:30 pm 3:30 pm Federal Appropriations (Recovery Act, Application of Cleanup Activities, etc.) Will Grant, Barbara...

210

BER Science Network Requirements Workshop -- July 26-27, 2007  

E-Print Network (OSTI)

LLNL (Climate) Bert DeJong, PNNL (EMSL) Dick Eagan, ANL (ARM) Steve Meacham, NSF George Michaels, PNNL (Comp Bio)Kevin Regimbal, PNNL (EMSL) Mike Sayre, NIH Harris Shapiro,

Tierney, Brian L.; Dart, Eli

2008-01-01T23:59:59.000Z

211

National Air & Space Intelligence Center Holds Program About...  

NLE Websites -- All DOE Office Websites (Extended Search)

30, 2013 - 4:52pm Addthis Dot Harris, Director of the Office of Economic Impact and Diversity, speaks with Aurea Rivera, President and CEO of Imagineering Results Analysis Corp.,...

212

Characterization Technologies - Programmaster.org  

Science Conference Proceedings (OSTI)

Mar 5, 2013... Richard Harris1; Joseph Chason2; Michael Nixon1; Pavol Stofke3; 1Air ... Indrajit Charit1; Darryl Butt1; James Cole1; 1Boise State University

213

Engineering Awards Committee Meeting Minutes  

E-Print Network (OSTI)

Kemper Hall Attended: Walter Harris, Xin Liu, Bernard Levy, Jay Lund, Jim Shackelford (for Subash Risbud the outdated call information copied from the academic senate web site to committee members. Jim Shackelford

Islam, M. Saif

214

Engineering of Bacterial Methyl Ketone Synthesis for Biofuels  

Published Ahead of Print 28 October 2011. 10.1128/AEM.06785-11. Appl. Environ. Microbiol.2012, 78(1):70. DOI: Harry R. Beller Ee-Been Goh, Edward E. K ...

215

Transport and Failure in Li-ion Batteries | Stanford Synchrotron...  

NLE Websites -- All DOE Office Websites (Extended Search)

Transport and Failure in Li-ion Batteries Monday, February 13, 2012 - 1:30pm SSRL Conference Room 137-322 Stephen J. Harris, General Motors R&D While battery performance is well...

216

Contesting an Illusion of Equity: A Textual Analysis of Friend of the Court Briefs in the University of Michigans Affirmative Action Cases  

E-Print Network (OSTI)

action at the University of Michigan (pp. 97-188).Ann Arbor: University of Michigan Press. Harris, C. (1995).action at the University of Michigan (pp. 17-59). Ann Arbor,

Ledesma, Mara C.

2004-01-01T23:59:59.000Z

217

Final_Tech_Session_Schedule_and_Location.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

and Nitrogen Using Laser-Induced Breakdown Spectroscopy (LIBS) Ronny D. Harris 1 , Michael H. Ebinger 1 , Clifton W. Meyer 1 and David A. Cremers 1 Earth and Environmental Sciences...

218

CX-002864: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

864: Categorical Exclusion Determination 864: Categorical Exclusion Determination CX-002864: Categorical Exclusion Determination Harris County North Bayou Central Plant CX(s) Applied: B5.1 Date: 07/01/2010 Location(s): Harris County, Texas Office(s): Energy Efficiency and Renewable Energy, Golden Field Office Harris County, Texas proposes to use $13,773,400 of Energy Efficiency and Conservation Block Grant (EECBG) funds to support the purchase of an energy efficiency package to be installed within the newly constructed Harris County North Bayou Central Plant (NBCP). The proposed project is part of a larger scope of work which involves the construction of the NBCP building, however; EECBG funds will only be used toward the purchase of energy efficient equipment and any costs associated with labor/installation of the

219

Session III  

Science Conference Proceedings (OSTI)

... our technologically augmented environments confronts and overwhelms us on a daily ... a project that very much owes its genesis to the support of Ralph Harris, and ... Continuous growth in global energy demands, fluctuations in fossil fuel...

220

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

41222 41222 Boat Dealers EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov STRATEGIC PETROLEUM RESERVE Sally Leingang (504) 734-4362 sally.leingang@spr.doe.gov 441229 All Other Motor Vehicle Dealers CARLSBAD FIELD OFFICE Roland Taylor roland.taylor@wipp.ws CHICAGO OPERATIONS Larry Thompson (630) 252-2711 larry.thompson@ch.doe.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov GOLDEN FIELD OFFICE Karen Downs (720) 356-1269 karen.downs@go.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov KANSAS CITY PLANT C. J. Warrick (816) 997-2874 cwarrick@kcp.com LOS ALAMOS LAB

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Feb01_tribenotes  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TEC Tribal Issues Topic Group Meeting TEC Tribal Issues Topic Group Meeting February 6, 2001 Portland, Oregon Participants: Richard Arnold (Las Vegas Indian Center), Helen Belencan (DOE/EM- 22), Kevin Blackwell (DOT/FRA), Wynona Boyer (Shoshone-Bannock Tribes), Mike Calhoun (DOT/FRA), Michael Chavarria/Joseph Mark Chavarria (Santa Clara Pueblo), Kevin Clarke (DOE/RL), Sandra Covi (UPR), Martha Crosland (DOE/EM- 11), Jim Daust (CVSA), Ed Gonzales (ELG Engineering), Ken Gray (CTUIR), Veronica Herkshan (Shoshone-Bannock Tribes), Robert Holden (NCAI), Judith Holm (DOE/NTPA), Henry Jacobs (DOT/FRA), Daniel King (Oneida Nation), Edward Liebow (EH&SP), Linda Minton (ENA), Stanley Paytiamo (Pueblo of Acoma EPA), Wilda Portner (SAIC), Max Powell (DOE/YMSCO), Mike Rowswell (Assoc. of State Rail Safety Managers), Greg Sahd (DOE/CAO/WIPP), Patrick Sobotta (Nez Perce

222

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

53210 53210 Office Supplies and Stationery Stores BONNEVILLE POWER ADMIN Greg Eisenach (360) 418-8063 gaeisenach@bpa.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov KANSAS CITY PLANT C. J. Warrick (816) 997-2874 cwarrick@kcp.com NEVADA SITE OFFICE Anita Ross (702) 295-5690 rossal@nv.doe.gov NEVADA TEST SITE Trudy Rocha (702) 295-0557 rocha@nv.doe.gov NEW BRUNSWICK LAB NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov OHIO FIELD OFFICE Pam Thompson (859) 219-4056 pam.thompson@lex.doe.gov PANTEX PLANT Brad Beck (806) 477-6192 bbrack@pantex.com PORTSMOUTH PADUCAH OFFICE Pam Thompson (859) 219-4056 pam.thompson@lex.doe.gov PRINCETON PLASMA LAB Arlene White (609) 243-2080

223

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

41219 41219 Other Accounting Services BONNEVILLE POWER ADMIN Greg Eisenach (360) 418-8063 gaeisenach@bpa.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NEVADA SITE OFFICE Anita Ross (702) 295-5690 rossal@nv.doe.gov NEVADA TEST SITE Trudy Rocha (702) 295-0557 rocha@nv.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov OHIO FIELD OFFICE Pam Thompson (859) 219-4056 pam.thompson@lex.doe.gov PORTSMOUTH PADUCAH OFFICE Pam Thompson (859) 219-4056 pam.thompson@lex.doe.gov ROCKY MOUNTAIN OILFIELD CENTER Jenny Krom (307) 233-4818 jenny.krom@rmotc.doe.gov SOUTHEASTERN POWER ADMIN Ann Craft (706) 213-3823 annc@sepa.doe.gov SOUTHWESTERN POWER ADMIN Gary Bridges (918) 595-6671

224

TEC/WG Tribal Topic Group  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

August 24, 2005 August 24, 2005 Participants: Jay Jones (DOE/RW - Group Chair), Vicki Best (BSC), Kevin Blackwell (FRA), Greg Fasano (BSC), Ed Gonzales (ELG Engineering), Lisa Gover (NTEC), Steven Grey (DOE/CI), Elizabeth Helvey (BSC), Angela Hill (DOE/RW), Corinne Macaluso (DOE/RW), Marsha Keister (INL), Ellen Ott (DOE/GC), Jennifer Patric (BAH), Wilda Portner (SAIC Contractor Support), Willie Preacher (Shoshone-Bannock Tribes), Lisa Sattler (CSM-MW), Linda Sikkema (NCSL), Neil Weber (Pueblo of San Ildefonso), Andrea Wilkins (NCSL) Issues discussed during this call included the upcoming TEC meeting in Pueblo, CO; phone calls to Tribes along Yucca Mountain corridor; update on Nevada Tribal activities, and other issues. Action Items: Responsible Party Action to be Taken

225

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11410 11410 Business and Secretarial Schools EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov 611420 Computer Training ARGONNE LAB Karl Duke (630) 252-8842 sblo@anl.gov BROOKHAVEN LAB Jill Clough-Johnston (631) 344-3173 clough@bnl.gov CARLSBAD FIELD OFFICE Roland Taylor roland.taylor@wipp.ws CHICAGO OPERATIONS Larry Thompson (630) 252-2711 larry.thompson@ch.doe.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov FEMI LAB Joe Collins (630) 840-4169 jcollins@fnal.gov GOLDEN FIELD OFFICE Karen Downs (720) 356-1269 karen.downs@go.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov

226

Atlanta TEC Meeting -- Tribal Group Summary 3-6-07  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Atlanta, GA - January 31, 2007 Atlanta, GA - January 31, 2007 Session Chaired by: Jay Jones (DOE, Office of Civilian Radioactive Waste Management, OCRWM) Regular Members in Attendance: Kenny Anderson (Las Vegas Paiute Tribe), Richard Arnold (Las Vegas Indian Center/Pahrump Paiute Tribe), Tony Boyd (Pueblo of Acoma), Rob Burnside (Confederated Tribes of the Umatilla Indian Reservation, CTUIR), Floyd Chaney (Mohegan Tribe), Sandra Covi (Union Pacific Railroad), Martha Crosland (DOE/Office of General Counsel, GC), Kristen Ellis (DOE/Intergovernmental and External Affairs, CI), Frank Gavigan (Mohegan Tribe), Ed Gonzales (ELG Engineering/Pueblo de San Ildefonso), Robert Gruenig (National Tribal Environmental Council, NTEC), Paloma Hill (OCRWM Intern), Judith Holm (OCRWM), Gayl Honanie (Hopi Tribe), Lisa Janairo

227

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

621420 621420 Outpatient Mental Health and Substance Abuse Centers EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov KANSAS CITY PLANT C. J. Warrick (816) 997-2874 cwarrick@kcp.com NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov PANTEX PLANT Brad Beck (806) 477-6192 bbrack@pantex.com 621493 Freestanding Ambulatory Surgical and Emergency Centers EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov KANSAS CITY PLANT C. J. Warrick (816) 997-2874 cwarrick@kcp.com NEVADA SITE OFFICE Anita Ross (702) 295-5690 rossal@nv.doe.gov NEVADA TEST SITE Trudy Rocha (702) 295-0557 rocha@nv.doe.gov

228

Effect of low-dose, low-LET γ-radiation and BaP injection on pulmonary immunity in A/J mice  

NLE Websites -- All DOE Office Websites (Extended Search)

low-dose, low-LET γ-radiation and BaP injection on pulmonary immunity in A/J mice low-dose, low-LET γ-radiation and BaP injection on pulmonary immunity in A/J mice K. Gott, V. Gonzales, M. Makvandi, N. Kikendall, A. Monier, E. Maloy, C. Rietz, B. Scott and J. Wilder. Lovelace Respiratory Research Institute, Albuquerque, NM Introduction: Low-dose, low-linear-energy-transfer (LET) radiation (LDR; < 100 mGy) activates the immune response (Nowosielska et al., 2006), presumably via epigenetic pathways (Scott et al., 2009) and has been implicated as suppressing both alpha-radiation-induced and smoking-related lung cancer (Scott et al. 2009). One of the hypothesized adaptive-response mechanisms by which LDR does so is by activating immune cell function in the lung, which would then increase their anti-cancer surveillance

229

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

21213 21213 Engineered Wood Member (except Truss) Manufacturing BONNEVILLE POWER ADMIN Greg Eisenach (360) 418-8063 gaeisenach@bpa.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov SOUTHEASTERN POWER ADMIN Ann Craft (706) 213-3823 annc@sepa.doe.gov SOUTHWESTERN POWER ADMIN Gary Bridges (918) 595-6671 gary.bridges@swpa.gov WESTERN POWER ADMIN Cheryl Drake (720) 962-7154 drake@wapa.gov 321920 Wood Container and Pallet manufacturing BONNEVILLE POWER ADMIN Greg Eisenach (360) 418-8063 gaeisenach@bpa.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512

230

TEC/WG Tribal Topic Group  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

April 4, 2005 - Phoenix, AZ April 4, 2005 - Phoenix, AZ Group Chair: Jay Jones (DOE/OCRWM) Tribal Topic Group Members Present: Nancy Bennett (UNM/ATRI), Kevin Blackwell (DOT/FRA), Kristen Ellis (DOE/CI), Ed Gonzales (ELG), Elizabeth Helvey (BSC), Jeff Hepting (Pueblo of Acoma), Robert Holden (NCAI), Judith Holm (DOE/OCRWM), Dan King (Oneida Nation), Gary Lanthrum (DOE/OCRWM), Bob Lupton (DOE/ORD/IR), Corinne Macaluso (DOE/OCRWM), Ellen Ott (DOE/GC), Jennifer Patric (BAH), Stanley Paytiamo (Pueblo of Acoma), Wilda Portner (SAIC), Willie Preacher (Shoshone-Bannock Tribes), Herman Shorty (Navajo Nation), Linda Sikkema (NCSL), Larry Stern (CVSA), Neil Weber (Pueblo of San Ildefonso), Christopher Wells (SSEB), Stephen White (NAEMT), Andrea Wilkins (NCSL), Corina Williams (Oneida Nation) (NOTE: Other

231

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

91110 91110 Postal Service EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov KANSAS CITY PLANT C. J. Warrick (816) 997-2874 cwarrick@kcp.com NEVADA SITE OFFICE Anita Ross (702) 295-5690 rossal@nv.doe.gov NEVADA TEST SITE Trudy Rocha (702) 295-0557 rocha@nv.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov PANTEX PLANT Brad Beck (806) 477-6192 bbrack@pantex.com RIVER PROTECTION Susan Johnson (509) 373-7914 susan_c_johnson@orp.doe.gov STRATEGIC PETROLEUM RESERVE Sally Leingang (504) 734-4362 sally.leingang@spr.doe.gov 492110 Couriers and Express Delivery Services EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen

232

Low-dose, low-LET γ-radiation alters carcinogen-induced splenic cytokine production and immune cell phenotype of A/J mice  

NLE Websites -- All DOE Office Websites (Extended Search)

dose, low-LET γ-radiation alters carcinogen-induced splenic cytokine production and immune cell dose, low-LET γ-radiation alters carcinogen-induced splenic cytokine production and immune cell phenotype of A/J mice. V. Gonzales, K. Gott, M. Makvandi, N. Kikendall, A. Monier, E. Maloy, C. Rietz, B. Scott and J. Wilder. Lovelace Respiratory Research Institute, Albuquerque, NM. Introduction: Low-dose, low-linear-energy-transfer (LET) radiation (LDR; < 100 mGy) activates the immune response, presumably via epigenetic pathways (Scott et al. 2009) and may lead to cancer suppression (Nowosielska et al. 2006). One of the mechanisms by which it might do so is by altering the cytokines produced after carcinogen and/or radiation exposure. Alternatively, LDR may activate

233

Idaho National Laboratory Annual Site Environmental Report Issued |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

National Laboratory Annual Site Environmental Report Issued National Laboratory Annual Site Environmental Report Issued Idaho National Laboratory Annual Site Environmental Report Issued September 20, 2011 - 12:00pm Addthis Media Contact Brad Bugger 208-526-0833 The annual report that informs stakeholders about the Idaho National Laboratory's environmental performance for the year 2010 is now available to the public. To access the report, go to (www.gsseser.com/annuals/2010) or contact Gonzales-Stoller Surveillance at (208) 525-8250, to request a CD containing the report. The report includes data generated by effluent monitoring and environmental surveillance of air, water, soil, vegetation, biota and agricultural products for radioactivity. The results are then compared with historical data, background measurements, and/or applicable standards and requirements

234

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11110 11110 Newspaper Publishers EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov 511120 Periodical Publishers AMES LAB Lisa Rodgers (515) 294-4191 rodgers@ameslab.gov ARGONNE LAB Karl Duke (630) 252-8842 sblo@anl.gov BONNEVILLE POWER ADMIN Greg Eisenach (360) 418-8063 gaeisenach@bpa.gov BROOKHAVEN LAB Jill Clough-Johnston (631) 344-3173 clough@bnl.gov CARLSBAD FIELD OFFICE Roland Taylor roland.taylor@wipp.ws CHICAGO OPERATIONS Larry Thompson (630) 252-2711 larry.thompson@ch.doe.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov FEMI LAB Joe Collins (630) 840-4169 jcollins@fnal.gov GOLDEN FIELD OFFICE

235

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

23110 23110 Automobile and Other Motor Vehicle Merchant Wholesalers BONNEVILLE POWER ADMIN Greg Eisenach (360) 418-8063 gaeisenach@bpa.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov NEVADA SITE OFFICE Anita Ross (702) 295-5690 rossal@nv.doe.gov NEVADA TEST SITE Trudy Rocha (702) 295-0557 rocha@nv.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov RIVER PROTECTION Susan Johnson (509) 373-7914 susan_c_johnson@orp.doe.gov SOUTHEASTERN POWER ADMIN Ann Craft (706) 213-3823 annc@sepa.doe.gov SOUTHWESTERN POWER ADMIN Gary Bridges (918) 595-6671 gary.bridges@swpa.gov WESTERN POWER ADMIN Cheryl Drake (720) 962-7154 drake@wapa.gov 423120 Motor Vehicle Supplies and New Parts Merchant Wholesalers

236

TEC/WG Tribal Topic Group  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

January 29, 2002 - New Orleans, LA January 29, 2002 - New Orleans, LA Participants: Richard Arnold (Las Vegas Indian Center), Wynona Boyer (Shoshone- Bannock Tribes), Judith Bradbury (PNL), Rob Burnside (CTUIR), Joseph Mark Chavarria (Santa Clara Pueblo), Martha Crosland (DOE/EM), Maxine Ewankow (8-Northern Indian Pueblos Council), Ed Gonzales (ELG), Ken Gray (CTUIR), Judith Holm (DOE/NTPA), Patrice Kent (NTEC), Dan King (Oneida Nation), Bob Lupton (DOE/OCRWM), Wilda Portner (SAIC), Mike Rowswell (Association of State Rail Safety Managers), Larry Stern (CVSA), Leon Tafoya (Santa Clara Pueblo), Neil Weber (Pueblo of San Ildefonso), Corina Williams (Oneida Nation) Issues discussed during this meeting included the DOE National Transportation Program November 2001 Tribal Partnering Workshop, the DOE Indian Policy Implementation Plan,

237

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

61110 61110 Office Administrative Services BONNEVILLE POWER ADMIN Greg Eisenach (360) 418-8063 gaeisenach@bpa.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov KANSAS CITY PLANT C. J. Warrick (816) 997-2874 cwarrick@kcp.com NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov OHIO FIELD OFFICE Pam Thompson (859) 219-4056 pam.thompson@lex.doe.gov PORTSMOUTH PADUCAH OFFICE Pam Thompson (859) 219-4056 pam.thompson@lex.doe.gov RIVER PROTECTION Susan Johnson (509) 373-7914 susan_c_johnson@orp.doe.gov ROCKY FLATS ROCKY MOUNTAIN OILFIELD CENTER Jenny Krom (307) 233-4818 jenny.krom@rmotc.doe.gov SOUTHEASTERN POWER ADMIN Ann Craft (706) 213-3823 annc@sepa.doe.gov SOUTHWESTERN POWER ADMIN

238

TEC/WG Tribal Topic Group  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TEC Tribal Topic Group Conference Call TEC Tribal Topic Group Conference Call January 18, 2006 Group Chair: Jay Jones (DOE/OCRWM) Participating TEC Tribal Topic Group Members: Rob Burnside (CTUIR), Earl Easton (U.S. NRC), Kristen Ellis (DOE/CI), Ed Gonzales (ELG), Angela Hill (DOE/OCRWM), Marsha Keister (INL), Dan King (Oneida Nation), Corinne Macaluso (DOE/OCRWM), Titto Moses (CTUIR), Stanley Paytiamo (Pueblo of Acoma), Willie Preacher (Shoshone-Bannock Tribes), Cathy Reynolds (DOE/GC), Larry Stern (CVSA), Kevin Tafoya (Santa Clara Pueblo), Neil Weber (Pueblo de San Ildefonso), Andrea Wilkins (NCSL), Sarah Wochos (CSG-MW) DOE support contractors also participated in this call. Action Items: Responsible Party Action to be Taken Jay Jones/Corinne Macaluso/ Email and fax 180(c)-related 2006 Federal Register Notices to Tribal

239

Green Bay TEC Meeting -- Tribal Group Summary 10-26-06  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Green Bay, Wisconsin - September 14, 2006 Green Bay, Wisconsin - September 14, 2006 Session Chaired by: Jay Jones, DOE, Office of Civilian Radioactive Waste Management, OCRWM Regular Members in Attendance: Sandra Alexander (Confederated Tribes of the Umatilla Indian Reservation, CTUIR); Kenny Anderson, Las Vegas Paiute Tribe; Richard Arnold, Las Vegas Indian Center/Pahrump Paiute Tribe); Kevin Tafoya, Santa Clara Pueblo; Christina Nelson, National Conference of State Legislatures; Ed Gonzales, ELG Engineering/Pueblo de San Ildefonso; Judith Holm, OCRWM; Marsha Keister, Idaho National Laboratory; Joe Kennedy, Timbisha Shoshone Tribe; Daniel King, Oneida Nation of Wisconsin; Sue Loudner, Pueblo of Acoma; Bob Lupton, DOE Yucca Mountain Project; Corinne Macaluso, OCRWM; Kevin Mariano, Pueblo of Acoma; Calvin Meyers, Moapa

240

Microsoft Word - tribal issues group call 7-25.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TEC Tribal Issues Topic Group Conference Call TEC Tribal Issues Topic Group Conference Call July 25, 2002 Participants: Jacqueline Agnew (CERT/DOE), Judith Bradbury (PNL), Martha Crosland (DOE/EM), Scott Doig (Prairie Island Indian Community), Ed Gonzales (ELG), Judith Holm (DOE/NTPA), Patrice Kent (NTEC), Dan King (Oneida Nation), Bob Lupton (DOE/OCRWM), Wilda Portner (SAIC), Mike Rowswell (Association of State Rail Safety Managers), Larry Stern (CVSA), Catherine Volk (DOE/EM), Neil Weber (Pueblo of San Ildefonso), Corina Williams (Oneida Nation) Issues discussed during this call included introduction of CERT intern, Jacqueline Agnew, to the group, review of action item status from the January TEC meeting in New Orleans, the Transportation Addendum to the DOE Indian Policy Implementation Plan, and status of the

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

FORESTRY COLORADO WESTERN POWER ADMIN POC Cheryl Drake Telephone  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FORESTRY FORESTRY COLORADO WESTERN POWER ADMIN POC Cheryl Drake Telephone (720) 962-7154 Email drake@wapa.gov Timber tract operations 113110 Cutting and transporting timber 113310 GEORGIA SOUTHEASTERN POWER ADMIN POC Ann Craft Telephone (706) 213-3823 Email annc@sepa.doe.gov Timber tract operations 113110 Cutting and transporting timber 113310 NEW MEXICO NNSA SERVICE CENTER POC Gregory Gonzales Telephone (505) 845-5420 Email ggonzales@doeal.gov Timber tract operations 113110 Cutting and transporting timber 113310 OHIO EM BUSINESS CENTER POC Karen Bahan Telephone (513) 246-0555 Email karen.bahan@emcbc.doe.gov Timber tract operations 113110 Cutting and transporting timber 113310 OKLAHOMA SOUTHWESTERN POWER ADMIN POC Gary Bridges Telephone (918) 595-6671 Email gary.bridges@swpa.gov Timber tract operations 113110

242

TEC/WG Tribal Topic Group  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

March 9, 2005 March 9, 2005 Participants: Vicki Best (BSC), Kevin Clarke (DOE/RL), Sandi Covi (UPR), Kristen Ellis (DOE/CI), Greg Fasano (BSC), Ed Gonzales (ELG), Jay Jones (DOE/OCRWM), Dan King (Oneida Nation), Bob Lupton (DOE/YMPO), Corinne Macaluso (DOE/OCRWM), Ellen Ott (DOE/GC), Jennifer Patric (BAH), Wilda Portner (SAIC), Lisa Sattler (CSG/MW), Neil Weber (Pueblo of San Ildefonso), Steve White (NAEMT), Andrea Wilkins (NCSL) Jay Jones (DOE/OCRWM) chaired the call. Action Items: Responsible Party Action to be Taken C. Macaluso/J. Jones/W. Portner Send HMEP information to Topic Group. J. Jones Check with FRA (Kevin Blackwell) about addressing Group on April 4 regarding rail inspection program. J. Jones/W. Portner Send agenda for April 4 meeting to Group.

243

Fermilab | Graphics Standards | Guidelines | Colors  

NLE Websites -- All DOE Office Websites (Extended Search)

Colors Colors Fermilab's core color is NAL blue, developed for Fermilab in the 1970s by the Rustoleum® paint company. NAL blue, Fermilab's core color, should be the main color for: Two-color applications with black ink on white paper. Logo/mark treatments when a color besides black is desirable. Primary communications from the lab Directorate. Primary communications from the Office of Communication. Multicolor treatments in all media that communicate a core Fermilab message. NAL Blue - R0 G51 B153 When more than one color is desired, the use of colors from Fermilab’s recommended palette is strongly encouraged. The recommended palette is derived from the original selections of Robert Wilson and Angela Gonzales. The links below provide the colors’ nearest Pantone Matching System (PMS)

244

SBOT NAICS Series  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

922120 922120 Police Protection CARLSBAD FIELD OFFICE Roland Taylor roland.taylor@wipp.ws CHICAGO OPERATIONS Larry Thompson (630) 252-2711 larry.thompson@ch.doe.gov EM BUSINESS CENTER Karen Bahan (513) 246-0555 karen.bahan@emcbc.doe.gov GOLDEN FIELD OFFICE Karen Downs (720) 356-1269 karen.downs@go.doe.gov HEADQUARTERS PROCUREMENT Michael Raizen (202) 287-1512 michael.raizen@hq.doe.gov LOS ALAMOS LAB Dennis Roybal (505) 667-4419 dr@lanl.gov NATIONAL ENERGY TECHNOLOGY LAB Larry Sullivan (412) 386-6115 larry.sullivan@netl.doe.gov NATIONAL ENERGY TECHNOLOGY LAB Larry Sullivan (412) 386-6115 larry.sullivan@netl.doe.gov NNSA SERVICE CENTER Gregory Gonzales (505) 845-5420 ggonzales@doeal.gov OAK RIDGE LAB Cassandra McGee Stu (865) 576-3560 mcgeecm@ornl.gov OAK RIDGE OPERATIONS Freda Hopper (856) 576-9430

245

TEC/WG Tribal Topic Group  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

November 15, 2004 November 15, 2004 Participants: Nancy Bennett (UNM/ATRI), Vicki Best (YMPO), Kevin Blackwell (FRA), Tony Bouve (FRA), Mike Calhoun (FRA), Greg Fasano (SAIC), Ed Gonzales (ELG), Elizabeth Helvey (BSC), Dennis Hurtt (DOE/CBFO), Jay Jones (DOE/RW), Dan King (Oneida Nation), Bob Lupton (DOE/OCRWM), Julie Offner (BAH), Ellen Ott (DOE/GC), Jennifer Patric (BAH),Wilda Portner (SAIC), Lisa Sattler (CSG/MW), Linda Sikkema (NCSL), Steve White (NAEMT) Jay Jones (DOE/RW) chaired the call, which focused on Tribal outreach associated with future shipments to Yucca Mountain. Action Items: Responsible Party Action to be Taken All Tribal Group Members Open discussions on 180(c) funding allocation methodologies; does a needs assessment and the formula

246

Colorado Vehicle Fleets Case Study Analysis  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Experiences with Compressed Natural Gas in Experiences with Compressed Natural Gas in Colorado Vehicle Fleets Case Study Analysis August 2012 Case Study Analysis August 2012 2 Acknowledgements The Colorado Energy Office would like to thank the following individuals and organizations for their participation in the case studies: Jay Valentine, City of Grand Junction Joseph Noorlag, Republic Services Victor Lovato, Denver International Airport The Colorado Energy Office would also like to thank the following people for their review and input to this document: Wendy DaFoe, National Renewable Energy Laboratory John Gonzales, National Renewable Energy Laboratory Alexine Hazarian, Encana Natural Gas Inc. Paul Kerkhoven, NGV America Charlie Kerr, Cummins-Westport Inc. Sheble McConnellogue, Northern Colorado Clean Cities

247

Unlocking the Promise of a Clean Energy Future by Boosting Diversity in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Unlocking the Promise of a Clean Energy Future by Boosting Unlocking the Promise of a Clean Energy Future by Boosting Diversity in STEM Unlocking the Promise of a Clean Energy Future by Boosting Diversity in STEM December 11, 2012 - 10:56am Addthis There is a critical need for more minorities to enter the energy industry. Hands-on activities like the workshop pictured above at the Spelman Girls Institute (Nov 17, 2012) help provide these entry points. There is a critical need for more minorities to enter the energy industry. Hands-on activities like the workshop pictured above at the Spelman Girls Institute (Nov 17, 2012) help provide these entry points. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity *Editor's Note: This article was originally published in the December 2012

248

Seven Small Businesses Awarded Contracts by the Office of Environmental  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Seven Small Businesses Awarded Contracts by the Office of Seven Small Businesses Awarded Contracts by the Office of Environmental Management Seven Small Businesses Awarded Contracts by the Office of Environmental Management June 19, 2012 - 2:45pm Addthis Large nuclear material processing tanks, like the one destined for Savannah River Site's (SRS) Salt Waste Processing Facility, will be managed with the support of qualified small businesses. Large nuclear material processing tanks, like the one destined for Savannah River Site's (SRS) Salt Waste Processing Facility, will be managed with the support of qualified small businesses. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity Today the Energy Department announced contract awards to seven small-disadvantaged businesses to perform critical technical

249

Science.gov? Try ciencia.science.gov | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Science.gov? Try ciencia.science.gov Science.gov? Try ciencia.science.gov Science.gov? Try ciencia.science.gov October 15, 2012 - 10:10am Addthis Science.gov? Try ciencia.science.gov Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity If you laid out 200 million pieces of paper in a line, you'd travel the length of 508,000 football fields - which may give you some sense of the vastness of the amount of content that was translated into Spanish from science.gov this week. The 200 million pages of authoritative U.S. government science information can now be accessed on ciencia.science.gov, home of the Spanish version of research and development results from 17 organizations within 13 federal science agencies, 55 scientific databases, and 2,100 scientific websites.

250

National African American History Month, 2013: A Presidential Proclamation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

National African American History Month, 2013: A Presidential National African American History Month, 2013: A Presidential Proclamation National African American History Month, 2013: A Presidential Proclamation February 7, 2013 - 4:44pm Addthis Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity What does this mean for me? Learn more about the Energy Department's efforts to foster a diverse and inclusive work environment by visiting our Office of Economic Impact and Diversity website. In February, we celebrate National African American History Month, honoring the heritage of individuals and communities who have shaped our country. President Obama's Proclamation speaks to the power of individuals with the American spirit to make a difference, and the potential of tomorrow's

251

Streamlining the Government Contracting Process, One System at a Time |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Streamlining the Government Contracting Process, One System at a Streamlining the Government Contracting Process, One System at a Time Streamlining the Government Contracting Process, One System at a Time July 31, 2012 - 1:31pm Addthis Streamlining the Government Contracting Process, One System at a Time Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity It's no secret that small business owners have very busy schedules. They must manage business development, operations, finances, personnel, as well as accessing passwords to access the numerous websites necessary to do business with the federal government. To assist small businesses to alleviate the burden of managing many different user names and passwords for various business websites, we are streamlining online resources to create a one-stop-shop to registering your

252

Wrapping Up: Our Conversation on Increasing Diversity in STEM Education and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Wrapping Up: Our Conversation on Increasing Diversity in STEM Wrapping Up: Our Conversation on Increasing Diversity in STEM Education and the Workforce Wrapping Up: Our Conversation on Increasing Diversity in STEM Education and the Workforce March 5, 2013 - 9:43am Addthis Watch our science and tech experts answer questions and share advice on STEM Education and Careers. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity Where Can I Learn More? Visit diversity.energy.gov for more on the Department's efforts to support minority participation in STEM fields. The national alarm has been sounded. While industry demand for science, technology, engineering and math (STEM) professionals is building at a feverish pace, there's a major roadblock to filling these jobs. The STEM gap is widening for women and minorities. Blacks and Latinos represent

253

Seven Small Businesses Awarded Contracts by the Office of Environmental  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Seven Small Businesses Awarded Contracts by the Office of Seven Small Businesses Awarded Contracts by the Office of Environmental Management Seven Small Businesses Awarded Contracts by the Office of Environmental Management June 19, 2012 - 2:45pm Addthis Large nuclear material processing tanks, like the one destined for Savannah River Site's (SRS) Salt Waste Processing Facility, will be managed with the support of qualified small businesses. Large nuclear material processing tanks, like the one destined for Savannah River Site's (SRS) Salt Waste Processing Facility, will be managed with the support of qualified small businesses. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity Today the Energy Department announced contract awards to seven small-disadvantaged businesses to perform critical technical

254

Senate Confirms DOE Nominees Daniel Poneman, David Sandalow, Kristina  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Senate Confirms DOE Nominees Daniel Poneman, David Sandalow, Senate Confirms DOE Nominees Daniel Poneman, David Sandalow, Kristina Johnson, Steve Koonin, Scott Harris, and Ines Triay Senate Confirms DOE Nominees Daniel Poneman, David Sandalow, Kristina Johnson, Steve Koonin, Scott Harris, and Ines Triay May 21, 2009 - 12:00am Addthis WASHINGTON, D.C. -- This week, the Senate confirmed six DOE nominees, including Deputy Secretary Daniel Poneman, Under Secretary for Energy Kristina Johnson, and Under Secretary for Science Steven Koonin. Also confirmed this week were Scott Blake Harris, General Counsel; David Sandalow, Assistant Secretary for Policy and International Affairs; and Ines Triay, Assistant Secretary for Environmental Management. Secretary Chu said, "We are fortunate to have such talented and dedicated

255

National African American History Month, 2013: A Presidential Proclamation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

African American History Month, 2013: A Presidential African American History Month, 2013: A Presidential Proclamation National African American History Month, 2013: A Presidential Proclamation February 7, 2013 - 4:44pm Addthis Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity What does this mean for me? Learn more about the Energy Department's efforts to foster a diverse and inclusive work environment by visiting our Office of Economic Impact and Diversity website. In February, we celebrate National African American History Month, honoring the heritage of individuals and communities who have shaped our country. President Obama's Proclamation speaks to the power of individuals with the American spirit to make a difference, and the potential of tomorrow's leaders to claim a better future.

256

Making STEM Personal: Introducing the Women @ Energy Series | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

STEM Personal: Introducing the Women @ Energy Series STEM Personal: Introducing the Women @ Energy Series Making STEM Personal: Introducing the Women @ Energy Series March 18, 2013 - 11:53am Addthis Graphic by Sarah Gerrity. Graphic by Sarah Gerrity. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity Check Us Out on Pinterest Get inspired! Check out our Women @ Energy Pinboard . Occupations in Science, Technology, Engineering and Mathematics (STEM) are among the fastest growing job sectors - offering top paying positions and a host of opportunities. On top of all that, STEM jobs are passports to changing the world through innovation and discovery. In celebration of Women's History Month, we're launching a new feature

257

Hispanic Heritage Month - Honoring a Heritage and Individual Success |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Hispanic Heritage Month - Honoring a Heritage and Individual Hispanic Heritage Month - Honoring a Heritage and Individual Success Hispanic Heritage Month - Honoring a Heritage and Individual Success October 10, 2012 - 9:59am Addthis Dr. Karina Edmonds, the Department's Technology Transfer Director, speaks with Joan Michelson of Green Connections Radio about women in STEM last July. This week she is receiving a Career Achievement Award from Women of Color Magazine. Dr. Karina Edmonds, the Department's Technology Transfer Director, speaks with Joan Michelson of Green Connections Radio about women in STEM last July. This week she is receiving a Career Achievement Award from Women of Color Magazine. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity Hispanic Heritage Month is celebrated from September 15 - October 15,

258

EA-1470: Finding of No Significant Impact | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0: Finding of No Significant Impact 0: Finding of No Significant Impact EA-1470: Finding of No Significant Impact Harry Allen-Mead 500 kV Transmission Line Project, Nevada Nevada Power Company (Nevada Power) proposes to build a 48- mile, 500-kilovolt (kV) transmission line between the Harry Allen Substation, northeast of Las Vegas Nevada, and the Mead Substation, southeast of Las Vegas (Proposed Action). Based on the EA, BLM, and Western errata, Western has determined that the proposed transmission line would not result in any significant environmental impacts, and the preparation of an environmental impact statement (EIS) will not be required. Finding of No Significant Impact and Floodplain Statement of Findings Nevada Power Company's Harry Allen-Mead 500-kV Transmission Line Project, DOE/EA-1470 (October 2004)

259

This is our Future: Secretary Chu and Senator Udall Speak on Attracting  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

This is our Future: Secretary Chu and Senator Udall Speak on This is our Future: Secretary Chu and Senator Udall Speak on Attracting Women and Minorities to the Wind Industry This is our Future: Secretary Chu and Senator Udall Speak on Attracting Women and Minorities to the Wind Industry December 21, 2012 - 12:15pm Addthis Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity This past Wednesday, the Energy Department livestreamed a conversation between Energy Secretary Steven Chu and U.S. Senator Mark Udall (D-CO), two leaders and champions of renewable energy innovation. The topic at hand - the future of the U.S. wind industry - was driven by questions from a live audience and participants online using Twitter, Facebook, Google +, and email to ask Energy about wind technology, policy, and careers.

260

Celebrating National Small Business Week, and Our FY 2011 Small Business  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

National Small Business Week, and Our FY 2011 Small National Small Business Week, and Our FY 2011 Small Business Award Winners Celebrating National Small Business Week, and Our FY 2011 Small Business Award Winners May 25, 2012 - 11:06am Addthis Past awards from the Department of Energy Small Business Awards program. Past awards from the Department of Energy Small Business Awards program. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity What does an environmental remediation company, a company that measures greenhouse gases, and an information technology company have in common? All have been recognized by the Energy Department for their exceptional performance and creativity towards helping the Department achieve our mission. These companies, and 12 others, received a Fiscal Year 2011 Small Business

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Today at 2:30 pm ET: Hangout With Science, Tech, and Innovation Leaders |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Today at 2:30 pm ET: Hangout With Science, Tech, and Innovation Today at 2:30 pm ET: Hangout With Science, Tech, and Innovation Leaders Today at 2:30 pm ET: Hangout With Science, Tech, and Innovation Leaders February 27, 2013 - 9:00am Q&A What questions do you have about science, tech, engineering and math (STEM) education and careers? Ask Us Addthis Join our Google+ Hangout on bridging the diversity gap in STEM education and careers at 2:30 pm ET today. | Graphic courtesy of Sarah Gerrity. Join our Google+ Hangout on bridging the diversity gap in STEM education and careers at 2:30 pm ET today. | Graphic courtesy of Sarah Gerrity. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity

262

Watch Live as Secretary Moniz Kicks off the Minorities in Energy Initiative  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Watch Live as Secretary Moniz Kicks off the Minorities in Energy Watch Live as Secretary Moniz Kicks off the Minorities in Energy Initiative Watch Live as Secretary Moniz Kicks off the Minorities in Energy Initiative September 24, 2013 - 10:35am Addthis Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity During National Hispanic Heritage Month, we celebrate the successes of the Hispanic community and reaffirm our commitment to including persons of Hispanic descent in the Department's programs and activities. Sandra Guzman, award winning multimedia journalist and former editor-in-chief of Latina magazine, will open the program by sharing her unique perspective and serving as Mistress of Ceremonies. Join us from 11am - 12:30pm EST to watch the program. The Minorities in Energy Initiative will link together representatives from

263

Launching the Minorities in Energy Initiative | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Launching the Minorities in Energy Initiative Launching the Minorities in Energy Initiative Launching the Minorities in Energy Initiative September 11, 2013 - 2:37pm Addthis Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity How can I participate? Join Secretary Moniz on September 24 for the launch on our livestream, www.energy.gov/live, from 11am to 12pm EST. Diversity is mission-critical, to our agency and to our country. Without diversity of people who actively engage in the energy economy, our nation will lack a diversity of thought, missing the right people at the table to address challenges, ask questions, and expand our knowledge in energy fields. The Department of Energy is launching a national dialogue to address the pathways forward in expanding engagement of minorities in the energy

264

Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

7 results: 7 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is John Stevens [Clear All Filters] 2011 Lasseter, Robert H., Joseph H. Eto, Ben Schenkman, John Stevens, Harry T. Volkommer, David Klapp, Ed Linton, Hector Hurtado, and Joyashree Roy. "CERTS Microgrid Laboratory Test Bed." IEEE Transactions on Power Delivery 26, no. 1 (2011). 2010 Lasseter, Robert H., Joseph H. Eto, Ben Schenkman, John Stevens, Harry T. Volkommer, David Klapp, Ed Linton, Hector Hurtado, and Jean Roy. CERTS Microgrid Laboratory Test Bed., 2010. 2009 Eto, Joseph H., Robert H. Lasseter, Benjamin Shenkman, John Stevens, David Klapp, Harry T. Volkommer, Ed Linton, Hector Hurtado, and Jean Roy. "CERTS Microgrid Laboratory Test Bed." In IEEE Power & Energy Society General

265

Working With Tribal Nations - A Geographic, Legal, and Economic  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Working With Tribal Nations - A Geographic, Legal, and Economic Working With Tribal Nations - A Geographic, Legal, and Economic Imperative Working With Tribal Nations - A Geographic, Legal, and Economic Imperative June 1, 2012 - 4:59pm Addthis Our Nation’s tribal communities are neighbors to the Energy Department’s National Laboratories and sites. In some cases there are tribes who retain treaty rights to land under the control of the Department. Our Nation's tribal communities are neighbors to the Energy Department's National Laboratories and sites. In some cases there are tribes who retain treaty rights to land under the control of the Department. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity Did You Know? Indian land contains an estimated ten percent of all our energy

266

Hispanic Heritage Month - Honoring a Heritage and Individual Success |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Hispanic Heritage Month - Honoring a Heritage and Individual Hispanic Heritage Month - Honoring a Heritage and Individual Success Hispanic Heritage Month - Honoring a Heritage and Individual Success October 10, 2012 - 9:59am Addthis Dr. Karina Edmonds, the Department's Technology Transfer Director, speaks with Joan Michelson of Green Connections Radio about women in STEM last July. This week she is receiving a Career Achievement Award from Women of Color Magazine. Dr. Karina Edmonds, the Department's Technology Transfer Director, speaks with Joan Michelson of Green Connections Radio about women in STEM last July. This week she is receiving a Career Achievement Award from Women of Color Magazine. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity Hispanic Heritage Month is celebrated from September 15 - October 15,

267

How Small Businesses Support the Department of Energy | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Small Businesses Support the Department of Energy Small Businesses Support the Department of Energy How Small Businesses Support the Department of Energy July 23, 2013 - 4:02pm Addthis Energy Department Small Business Partner Success Stories Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity What are the key facts? Almost half of the subcontracts that come from our Management and Operations contractors and other large prime contractors go to small businesses. In Fiscal Year 2012, $1.3 billion prime contracts and subcontracts from the Department of Energy went to Women Owned Small Businesses. Did you know that small businesses make up 99.7 percent of U.S. employer firms and 64 percent of net new private-sector jobs? The Energy Department relies on a vast network of small businesses around the country and has

268

Tomorrow: Watch The White House Forum on Minorities in Energy Livestream |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tomorrow: Watch The White House Forum on Minorities in Energy Tomorrow: Watch The White House Forum on Minorities in Energy Livestream Tomorrow: Watch The White House Forum on Minorities in Energy Livestream November 12, 2013 - 4:33pm Addthis Fisk University graduate student, George Turner conducting research at the Lawrence Livermore National Laboratory. | Photo courtesy of Lawrence Livermore National Laboratory. Fisk University graduate student, George Turner conducting research at the Lawrence Livermore National Laboratory. | Photo courtesy of Lawrence Livermore National Laboratory. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity How can I participate? Watch the White House Forum on Minorities in Energy Initiative livestream on energy.gov/live. Share your thoughts and perspectives during the livestream on social

269

Visiting With Santa Fe Small Business Owners | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Visiting With Santa Fe Small Business Owners Visiting With Santa Fe Small Business Owners Visiting With Santa Fe Small Business Owners May 10, 2012 - 9:02am Addthis Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity You've got to do your homework in order to contract with the federal government. Whether you are a large or small business owner, learning the ins and outs of government contracting takes dedication, perseverance, and taking advantage of opportunities to meet face-to-face with procurement experts and other businesses. That's where our Small Business Roundtables, Business Opportunity Sessions, conference booths, and Regional Small Business Summits come in. We want to meet directly with small business owners, managers, and staffers, to hear what you need to learn from us to make the contracting

270

Microsoft PowerPoint - Pete H's 2007 SWPA Conf Pres(NWK Proj's Impact Fed Power).ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

AmerenUE, Bagnell Dam AmerenUE, Bagnell Dam FERC Re-licensing Impacts at Harry S. Truman AmerenUE, Bagnell Dam FERC Re-licensing Impacts at Harry S. Truman * FERC recommended AmerenUE initiate discussions with Kansas City District on revising the existing MOA for releases from Truman. * The new FERC license recommended ramp down rates for flood control releases to help prevent bank erosion. * Kansas City District staff met with AmerenUE in late Feb. 2007. * It was explained to AmerenUE that any significant changes to Truman operations would require at least an EA and possibly an EIS. Such an action would be unlikely. Kansas City District US Army Corps of Engineers AmerenUE, Bagnell Dam FERC Re-licensing Impacts at Harry S. Truman AmerenUE, Bagnell Dam FERC Re-licensing Impacts at

271

Why 3D Printers Might Create the Next Robotic Champion | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Why 3D Printers Might Create the Next Robotic Champion Why 3D Printers Might Create the Next Robotic Champion Why 3D Printers Might Create the Next Robotic Champion December 11, 2013 - 4:18pm Addthis As the nation's premier research laboratory, Oak Ridge National Laboratory is one of the world's most capable resources for transforming the next generation of scientific discovery into solutions for rebuilding and revitalizing America's manufacturing industries, with tools like 3D printers. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity The Department of Energy and its partners are adding a new dimension to science, technology, engineering and math education (STEM). This December, high school teams competing in the FIRST Robotics Competition should be racing over to this FIRST Robotics website to put in their bid for a free

272

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

09949 09949 Ohio State University FE Dr. Barbara Anderson SCNGO 2012; 10/1/12 - 9/30/15 Skip Pratt Columbus, OH/Brookfield, CT A New Approach to Understanding the Occurrence and Volume of Natural Gas Hydrate in the Northern Gulf Modeling and analysis of methane hydrate occurrence in industry well logs from the Gulf of Mexico. Modeling and analysis are planned at facilities at Ohio State U. and the residence of B. Anderson. Harry (Skip) Pratt Digitally signed by Harry (Skip) Pratt DN: cn=Harry (Skip) Pratt, o=NETL, ou=NGOPMD, email=skip.pratt@netl.doe.gov, c=US Date: 2012.08.27 10:59:08 -04'00' 8 27 2012 john ganz Digitally signed by john ganz DN: cn=john ganz, o=environmental compliance division, ou=office of general counsel, email=john.ganz@netl.doe.gov, c=US

273

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

963 963 Colorado School of Mines FE N/A SCNGO 10/1/12 - 9/30/15 Skip Pratt Golden, Colorado Measurement and Interpretation of Seismic Velocities and Attenuation in Hydrate-Bearing Sediments. Current lab equipment will be modified for hydrate formation. Hydrates will be synthesized and experimental measurements will be obtained. Models will be developed that describe hydrate influence Bench scale laboratory analysis Harry (Skip) Pratt Digitally signed by Harry (Skip) Pratt DN: cn=Harry (Skip) Pratt, o=NETL, ou=NGOPMD, email=skip.pratt@netl.doe.gov, c=US Date: 2012.08.29 16:54:17 -04'00' 08 29 2012 john ganz Digitally signed by john ganz DN: cn=john ganz, o=environmental compliance division, ou=office of general counsel, email=john.ganz@netl.doe.gov, c=US Date: 2012.09.07 14:24:32 -04'00'

274

No magic show: Real-world levitation to inspire better pharmaceuticals |  

NLE Websites -- All DOE Office Websites (Extended Search)

Argonne scientist Chris Benmore demonstrates his acoustic levitator, which could help to improve the efficiency and quality of pharmaceutical development. (Photo by Dan Harris) Argonne scientist Chris Benmore demonstrates his acoustic levitator, which could help to improve the efficiency and quality of pharmaceutical development. (Photo by Dan Harris) Argonne scientist Chris Benmore demonstrates his acoustic levitator, which could help to improve the efficiency and quality of pharmaceutical development. (Photo by Dan Harris) No magic show: Real-world levitation to inspire better pharmaceuticals By Jared Sagoff * September 12, 2012 Tweet EmailPrint It's not a magic trick and it's not sleight of hand - scientists really are using levitation to improve the drug development process, eventually yielding more effective pharmaceuticals with fewer side effects. Scientists at the U.S. Department of Energy's (DOE) Argonne National Laboratory have discovered a way to use sound waves to levitate individual

275

Here to Serve | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Here to Serve Here to Serve Here to Serve May 11, 2012 - 8:53am Addthis Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity It is a pleasure to join the Administration as the Director of the Office of Economic Impact and Diversity here at the Department of Energy. When President Obama nominated me for this position, I immediately recognized the vital importance of the work that this office does. From assisting small businesses to supporting minority serving institutions to enhancing the diversity and inclusion at the Department, this office has a mission-critical role for our clean energy future. I care deeply about my responsibilities in this position. As the Director at the Office of Economic Impact and Diversity, I'll be leading the

276

Creating Educational Opportunities for Minorities in STEM | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Creating Educational Opportunities for Minorities in STEM Creating Educational Opportunities for Minorities in STEM Creating Educational Opportunities for Minorities in STEM September 17, 2012 - 12:50pm Addthis Winners of the 2011 Regional Science Bowl competition (hosted in partnership with the University of Texas - Pan American) pose at the national competition in Washington, DC. | Courtesy of the University of Texas - Pan American HESTEC Program. Winners of the 2011 Regional Science Bowl competition (hosted in partnership with the University of Texas - Pan American) pose at the national competition in Washington, DC. | Courtesy of the University of Texas - Pan American HESTEC Program. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity EDITOR'S NOTE: This article is cross-posted from Huffington Post Latino

277

A Minority Serving Institution Leads the Way in Better Buildings |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Minority Serving Institution Leads the Way in Better Buildings A Minority Serving Institution Leads the Way in Better Buildings A Minority Serving Institution Leads the Way in Better Buildings July 5, 2012 - 6:06pm Addthis Secretary Chu visits Delaware State University to commemorate the school's efforts with the Better Buildings Initiative. Secretary Chu visits Delaware State University to commemorate the school's efforts with the Better Buildings Initiative. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity In February 2011, President Obama announced the Better Buildings Initiative to make commercial and industrial buildings 20 percent more energy efficient by 2020 and accelerate private sector investment in energy efficiency. Delaware State University (DSU) was selected as one of the

278

In DC and Around the Nation: Join the National Day of Service on Saturday,  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

In DC and Around the Nation: Join the National Day of Service on In DC and Around the Nation: Join the National Day of Service on Saturday, January 19, 2013 In DC and Around the Nation: Join the National Day of Service on Saturday, January 19, 2013 January 16, 2013 - 9:22am Addthis Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity Americans in all 50 states can honor the legacy of Dr. Martin Luther King, Jr., though living out his values of service, care for your neighbor, and social justice. This is a way, as many have said, to "celebrate the man whose dream celebrates us all". Continuing a tradition he started at his first inauguration in 2009, President Obama is calling on Americans to participate in the National Day of Service on Saturday, January 19th, 2013.

279

Why 3D Printers Might Create the Next Robotic Champion | Department of  

NLE Websites -- All DOE Office Websites (Extended Search)

Why 3D Printers Might Create the Next Robotic Champion Why 3D Printers Might Create the Next Robotic Champion Why 3D Printers Might Create the Next Robotic Champion December 11, 2013 - 4:18pm Addthis As the nation's premier research laboratory, Oak Ridge National Laboratory is one of the world's most capable resources for transforming the next generation of scientific discovery into solutions for rebuilding and revitalizing America's manufacturing industries, with tools like 3D printers. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity The Department of Energy and its partners are adding a new dimension to science, technology, engineering and math education (STEM). This December, high school teams competing in the FIRST Robotics Competition should be racing over to this FIRST Robotics website to put in their bid for a free

280

Celebrating our work with Native American Students in STEM During National  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

our work with Native American Students in STEM During our work with Native American Students in STEM During National Native American Heritage Month Celebrating our work with Native American Students in STEM During National Native American Heritage Month November 15, 2012 - 9:28am Addthis Students and faculty participating in AIREI gather at the one-week Energy Summer Institute, held at NREL last summer. Students and faculty participating in AIREI gather at the one-week Energy Summer Institute, held at NREL last summer. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity Throughout November, we celebrate Native American Heritage Month as a country, honoring the first people who lived in the United States and the ways that American Indians and Alaska Natives enrich our Nation.

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Secretary Chu Congratulates FY 2011 Small Business Award Winners |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu Congratulates FY 2011 Small Business Award Winners Secretary Chu Congratulates FY 2011 Small Business Award Winners Secretary Chu Congratulates FY 2011 Small Business Award Winners June 29, 2012 - 2:57pm Addthis Secretary Chu presents the FY 2011 Small Business Award Winners at an award ceremony yesterday at the Energy Department headquarters in Washington, DC. | Energy Department photo. Secretary Chu presents the FY 2011 Small Business Award Winners at an award ceremony yesterday at the Energy Department headquarters in Washington, DC. | Energy Department photo. Dot Harris Dot Harris The Honorable Dot Harris, Director, Office of Economic Impact and Diversity "You are limited only by your imagination, by your courage" Secretary Steven Chu The Energy Department had the pleasure of publicly recognizing the FY 2011

282

The effects of agricultural land use patterns on pollutant runoff from watersheds: rangeland/pastureland and row cropping  

E-Print Network (OSTI)

Much attention is being focused on water quality in rivers, lakes and streams. One of the contributors of pollution to rivers, lakes and streams is runoff from agriculture in the form of nutrients, pesticides and suspended solids. This study was designed to look at the amount of these substances produced in subwatersheds from corn, grain sorghum and cotton farming along the Colorado River in Travis and Bastrop counties. The study also looked at rangeland and row cropped familand to estimate which land use type produced more runoff and pollution to receiving streams. Best management practices were also looked at as a means of limiting the amount of runoff and pollution transport from row cropped areas. Three automated sampling sites were set up to collect water samples after rainfall events. Two of the sites were set up to sample from streams that drained subwatersheds of a tributary to the Colorado River. The land use at one subwatershed consisted primarily of rangeland and pastureland while the land use at the other site consisted mainly of row cropped farmland. The third site was set up to sample on a row cropped farm that employed certain best management practices. The accepted convention is that rangeland produces less runoff @ row cropped areas and therefore contributes less pollutants to receiving waters. The findings from this project generally support this. Additionally, it was found, through computer modeling, that best management practices in the form of terracing, contour plowing and filter strips significantly reduced the amount of runoff and pollutants that move off site from row cropped areas during rainfall events. The implications of these findings are that, where possible, efforts should be made to implement best management practices to reduce the amount of runoff and pollution to receiving waters. Producers also need to be educated as to how to implement and maintain best management practices to obtain optimal benefits.

Jayne, Andrew A.

1995-01-01T23:59:59.000Z

283

Why We Fight -- Celebrating Women's Equality Day | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Why We Fight -- Celebrating Women's Equality Day Why We Fight -- Celebrating Women's Equality Day Why We Fight -- Celebrating Women's Equality Day August 26, 2013 - 12:07pm Addthis Our Women @ Energy series is one way we're spreading the word about women leaders, including Mayling Wong-Squires (left), a Mechanical Engineer at the Energy Department's Fermi National Accelerator Laboratory. | Photo courtesy of Fermi National Accelerator Laboratory. Our Women @ Energy series is one way we're spreading the word about women leaders, including Mayling Wong-Squires (left), a Mechanical Engineer at the Energy Department's Fermi National Accelerator Laboratory. | Photo courtesy of Fermi National Accelerator Laboratory. Dot Harris Dot Harris

284

NEPA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Learned September 2009 1 Learned September 2009 1 Third Quarter FY 2009 September 1, 2009; Issue No. 60 U.S. DEPARTMENT OF ENERGY QUARTERLY REPORT National Environmental Policy Act LESSONS LEARNED LEARNED LESSONS N E P A DOE General Counsel Scott Blake Harris Aims To Improve the NEPA Review Process In his first month on the job, DOE's new General Counsel, Scott Blake Harris, issued operating principles for NEPA document review by the Office of General Counsel (GC) to reduce the time required for such reviews and avoid multiple rounds of comments, particularly for

285

PROPOSED INSTALLATION AND OPERATION OF A  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

D D DRAFT ENVIRONMENTAL ASSESSMENT BATTLEGROUND ENERGY RECOVERY PROJECT HARRIS COUNTY, TEXAS U.S. DEPARTMENT OF ENERGY National Energy Technology Laboratory FEBRUARY 2011 THIS PAGE INTENTIONALLY LEFT BLANK COVER SHEET Responsible Agency: U.S. Department of Energy Title: Draft Environmental Assessment for the Battleground Energy Recovery Project (DOE/EA-1769) Location: Deer Park, Harris County, Texas Contact: William J. Gwilliam, Document Manager National Energy Technology Laboratory U.S. Department of Energy P.O. Box 880 3610 Collins Ferry Road Morgantown, WV 26505 Email: william.gwilliam@netl.doe.gov Fax: 304-285-4403

286

~tx22C0.ptx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

+ + + + + STUDYING THE COMMUNICATIONS REQUIREMENTS OF ELECTRIC UTILITIES TO INFORM FEDERAL SMART GRID POLICIES + + + + + PUBLIC MEETING + + + + + THURSDAY, JUNE 17, 2010 + + + + + The Public Meeting was held in Room 8E069 at the Department of Energy, Forrestal Building, 1000 Independence Avenue, S.W., Washington, D.C., at 10:00 a.m., Scott Blake Harris, Chair, presiding. PRESENT: BECKY BLALOCK SHERMAN J. ELLIOTT LYNNE ELLYN SCOTT BLAKE HARRIS JIM INGRAHAM JIM L. JONES MICHAEL LANMAN KYLE McSLARROW ROY PERRY 202-234-4433 Neal R. Gross & Co., Inc. Page 2

287

Microsoft Word - Final EA for HARC Battleground.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FINAL ENVIRONMENTAL ASSESSMENT BATTLEGROUND ENERGY RECOVERY PROJECT HARRIS COUNTY, TEXAS U.S. DEPARTMENT OF ENERGY National Energy Technology Laboratory OCTOBER 2011 THIS PAGE INTENTIONALLY LEFT BLANK COVER SHEET Responsible Agency: U.S. Department of Energy Title: Final Environmental Assessment for the Battleground Energy Recovery Project (DOE/EA-1769) Location: Deer Park, Harris County, Texas Contact: William J. Gwilliam, Document Manager National Energy Technology Laboratory U.S. Department of Energy P.O. Box 880 3610 Collins Ferry Road Morgantown, WV 26505 Email: william.gwilliam@netl.doe.gov Fax: 304-285-4403

288

Travaux effectus sous la direction de William Goubert Litii Thse effectue sous la direction de Michle Rombaut et Patrick Lambert  

E-Print Network (OSTI)

détecteur de SIP de Harris (Harris et al. 1988) pour détecter les "Space-Time Interest Points", noté STIP régulière. La détection des STIP est réalisée en utilisant une matrice Hessienne- Laplace H (Laptev, 2005 temporelle pour les coins détectés. Pour extraire les STIP, différents critères ont été proposés. Comme dans

289

PWR Fuel Shipping Limits & RNP Core Design  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fuel Fuel Transportation Experience Steven Edwards, Progress Energy September 21, 2005 2 Discussion Topics Progress Energy Transportation History Success Factors Shipment Security Dedicated Trains Emergency Response Public Communication/Participation Summary 3 Brunswick Harris Crystal River Robinson Progress Energy Nuclear Plants 4 Spent Fuel Management Strategy Maintain operating reserve at all nuclear units Spent fuel shipping program to reduce inventories at Brunswick and Robinson Maximize use of Harris spent fuel pools 5 Transportation Experience 191 shipments 1,000 MTU transported 4,541 spent fuel assemblies transported 6 Transportation Experience First Shipment - 1977 Active spent fuel transportation program since 1989 12 to 15 shipments per year

290

ii The Economic Impacts of Bioenergy Crop Production on U.S. Agriculture.  

E-Print Network (OSTI)

Cover: Soil scientists Harry Pionke (left) and Ron Schnabel examine a switchgrass stand. If switchgrass were to become a major crop, it could add up to $5 billion to farmers ' income and contribute to the reduction of the United States ' dependence on oil imports.

Daniel G. De; La Torre Ugarte; Marie E. Walsh; Hosein Shapouri; Stephen P. Slinsky; G. De; La Torre Ugarte; Marie E. Walsh; Hosein Shapouri

2003-01-01T23:59:59.000Z

291

2003www.irp.gatech.edu 2003 Georgia Tech Fact Book  

E-Print Network (OSTI)

Accrediting Board Planning Accreditation Board · Georgia Tech operates on the semester system. · Georgia Tech in the College of Computing ranked 12th. The Computer Systems program in the College of Computing ranked 8th Georgia Department of Transportation General Motors Harris Corporation IBM Lockheed Martin Radiant Systems

Li, Mo

292

Reciprocal transformations and deformations of integrable hierarchies  

E-Print Network (OSTI)

We present changes of variables that transform new integrable hierarchies found by Szablikowski and B{\\l}aszak using the $R$-matrix deformation technique [J. Math. Phys. 47 (2006), paper 043505, nlin.SI/0501044] into known Harry-Dym-type and mKdV-type hierarchies.

A. Sergyeyev

2008-12-30T23:59:59.000Z

293

Sustainable Energy Science and Engineering Center Photovoltaic Systems Engineering  

E-Print Network (OSTI)

Date: May 17, 2012 ENI Renewable Energy Prize 2012 The prestigious ENI Renewable and Non-conventional Energy Prize 2012 has been awarded to Harry Atwater of the California Institute of Technology and Albert cells Atwater's and Polman's research addresses the key problems in photovoltaic technology: 1

Krothapalli, Anjaneyulu

294

19th International Conference on Photochemical Conversion and Storage of Solar Energy  

E-Print Network (OSTI)

IPS-19 19th International Conference on Photochemical Conversion and Storage of Solar Energy 29@caltech.edu Prof. Harry Gray hbg@caltech.edu Prof. Jonas Peters jpeters@caltech.edu Dye-Sensitized & Polymer Solar Cells Advanced Photovoltaics Photocatalysis Solar Fuels Production Photoelectrochemistry

Goddard III, William A.

295

arXiv:hep-ph/0010338v26Dec2000 FERMILAB-Conf-00/279-T  

E-Print Network (OSTI)

. Lorenzo D´iaz-Cruz (Puebla) Duane Dicus (Texas, Austin) Bogdan Dobrescu (Yale) Tommaso Dorigo (INFN Padova (Stony Brook) Tao Han (Wisconsin) Brian W. Harris (Argonne) Hong-Jian He (Texas, Austin) David Hedin. Its elucidation remains one of the primary goals of future high energy physics experimentation

California at Santa Cruz, University of

296

Int J Multimed Info Retr DOI 10.1007/s13735-012-0024-2  

E-Print Network (OSTI)

for video semantic analysis. Among others, STIP feature is mostly used [10]. A popular way to gener- ate the STIP feature is by using the Harris3D detector [10] followed by the processing of HOG/HOF [11] descriptor. Besides the STIP feature, another recent feature type, i.e., MoSIFT shows promising performance

Chang, Shih-Fu

297

Exploring higher dimensional black holes at the large hadron collider.  

E-Print Network (OSTI)

formation in the grazing collision of high-energy particles, Phys. Rev. D67 (2003) 024009, [gr-qc/0209003]. [27] C. M. Harris, Physics Beyond the Standard Model: Exotic Leptons and Black Holes at Future Colliders. PhD thesis, University of Cambridge, 2003...

Harris, Chris M; Palmer, M J; Parker, Michael A; Richardson, P

298

Building Applications Team Dale Sartor 510.486.5988 DASartor@lbl.gov  

E-Print Network (OSTI)

.S. DOE. By putting ENERGY STAR labels on their products, manufacturers harness market forces to promote energy-efficient products. Energy Efficient Government Purchasing Jeff Harris 202.484.0883 ·· JPHarris@lbl.gov http://www.ren/doe.gov/FEMP/procurement LBNL supports DOE and EPA programs to encourage federal, state

299

CLASS OF 1954Reunion Honor Roll of Donors 2003-2004  

E-Print Network (OSTI)

A. Branegan, Jr. '35 ++ D.J. Branning '60 ++ Frederick C. Braun III '63 ++ J. Douglas Breen '68 '91 ++ Stephen A. Bromfeld '72 John A. Broscious '55 ++ David B. Brown `12P Harry K. Brown, Jr. `66 Campo '09P `12P Steven A. Campo '09P `12P ++ Megan J. Capuano '91 ++ Robert W. Cardwell, Jr. `75 Charles

Miami, University of

300

PAUL SHORT --MENS BROWN file:///Users/bkatten/Desktop/R092812AF.html[9/28/12 4:04:11 PM  

E-Print Network (OSTI)

Sarah J. Girotti '93 ++ Bernard Gitlin '62 '89P '92P ++ John H. Glanville '77 ++ William A. Glaser, Jr Richard F. Boyer '68 ++ Richard R. Bradley '61 Charles J. Brand '74 `77G++ James A. Branegan, Jr. '35 ++ D A. Broscious '55 ++ David B. Brown `12P Harry K. Brown, Jr. `66 Judith S. Brown `12P Linda K. Brown

Royer, Dana

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

The President's Society The President's Society members are among the University of Memphis' most generous and loyal benefactors.  

E-Print Network (OSTI)

Policy and University Professor Goldstone, Jack A. Virginia E. and John T. Hazel, Jr. Endowed Chair. Harris Chair in Economics Wegman, Edward J. Bernard J. Dunn Professor of Information Technology Foundation Professor of Law CLARENCE J. ROBINSON PROFESSORS Bakhash, Shaul History Crew, Spencer History D

Memphis, University of

302

International Collaborative Tsunamis, Storm Surge, and Wave-Structure Interaction Research Opportunities Using the Oregon State Multidirectional Wave Basin and Large Wave Flume  

E-Print Network (OSTI)

Opportunities Using the Oregon State Multidirectional Wave Basin and Large Wave Flume Solomon Yim1 , Harry Yeh2 wave 0.8m high in a water depth of 1m. Its waveboards are controlled on an individual basis, making) water depth. The Wave Research Laboratory supports high resolution, large-scale experiments with dense

Yim, Solomon C.

303

Department of Geosciences Oregon State University  

E-Print Network (OSTI)

, Harry Yeh, and Solomon Yim, OSU Coastal and Ocean Engineering, Hinsdale Wave Research Lab Bob Yeats, OSU be considered as a funding source for the kind of shallow-water mapping that we propose. An important wrinkle of the three highest priorities within the National Tsunami Plan is shallow-water mapping. More information

Wright, Dawn Jeannine

304

THE HISTORY OF STANDARD OIL/EXXONMOBIL IN BATON ROUGE Oral History Interviewee Contact Survey Form  

E-Print Network (OSTI)

THE HISTORY OF STANDARD OIL/EXXONMOBIL IN BATON ROUGE Oral History Interviewee Contact Survey Form LSU Libraries Special Collections Williams Center for Oral History If you think that you location; T. Harry Williams Center for Oral History: ATTN: Staff LSU Libraries Special Collections Agnes

Harms, Kyle E.

305

The University of Georgia and the Arch Foundation for the University of Georgia  

E-Print Network (OSTI)

. and Angelia M. Harris Foundation Dorothy Smith Hines Ms. Jane Hook Holmes William K. Holmes *Dean J. Alton Estate Robert S. Cannon Andy H. and Vivian Carden Cargill, Inc. John Huland Carmical Foundation William M. Stelling William J. Stembler and Anne M. Stembler W. E. `Brother' Stewart and Deidra Collins Stewart Matt

Scott, Robert A.

306

Arctic Sea Ice Decline: Observations, Projections, Mechanisms, and Implications  

E-Print Network (OSTI)

or phase space. In this work we con- sider the trajectory of sea ice in the ice thickness phase space. We175 Arctic Sea Ice Decline: Observations, Projections, Mechanisms, and Implications Geophysical Is the Trajectory of Arctic Sea Ice? Harry L. Stern and Ronald W. Lindsay Polar Science Center, Applied Physics

Lindsay, Ron

307

SENTINEL 1 10/29/98 8:47 AM SENTINEL: A Multiple Engine Information Retrieval  

E-Print Network (OSTI)

SENTINEL 1 10/29/98 8:47 AM SENTINEL: A Multiple Engine Information Retrieval and Visualization describe a prototype Information Retrieval system, SENTINEL, under development at Harris Corporation's Information Systems Division. SENTINEL is a fusion of multiple information retrieval technologies, integrating

308

AMERICAN UNIVERSITY College of Arts and Science  

E-Print Network (OSTI)

/01 University of Delaware, Department of History Lecture Series, May 2001 A Widespread and Understandable Activism," Bulletin of the Atomic Scientists, (December, 1988). "We Can Hold an Atomic Bomb Exhibit (July 18, 2003) (My title was "Still Wild About Harry?") "The 1945 Atomic Bombing of Nagasaki

Lansky, Joshua

309

JOURNAL DE PHYSIQUE Colloque C3, suppliment au no 5-6, Tome 33, Mai-Juin 1972,page C3-99 THE EXACT HARTREE-POCK PROBLEM FOR LITHIUM CRYSTALS  

E-Print Network (OSTI)

HARTREE-POCK PROBLEM FOR LITHIUM CRYSTALS : A PRELIMINARY REPORT (I) F. E. HARRIS, L. KUMAR, and H. J resultats preliminaires des calculs exacts de Hartree-Fock pour des cristaux de lithium sont obtenus par une en accord avec les rksultats exp6- rimentaux pour le cristal de lithium et ils montrent que des

Paris-Sud XI, Université de

310

Policy Options Workshop Accelerating Energy Efficiency Improvements In Commercial Buildings November 29, 2011  

E-Print Network (OSTI)

Policy Options Workshop ­ Accelerating Energy Efficiency Improvements In Commercial Buildings of Energy Marilyn Brown Georgia Institute of Technology Lindsay Brumbelow Department of Energy Lane Burt U Department of Energy Charlotte Franchuk Oak Ridge National Laboratory Jeff Harris Alliance to Save Energy

Oak Ridge National Laboratory

311

Don't Supersize Me! Toward a Policy of Consumption-Based Energy Efficiency  

E-Print Network (OSTI)

Don't Supersize Me! Toward a Policy of Consumption-Based Energy Efficiency Jeffrey Harris, Rick ultimately reverse) the growth in total energy consumption and carbon emissions. Instead, policy makers need for effective policy in a carbon- and oil-constrained world with increasingly brittle energy markets. To start

Diamond, Richard

312

RC 22275 (Log# W0112-022) (12/05/2001) Computer Science/Mathematics  

E-Print Network (OSTI)

RC 22275 (Log# W0112-022) (12/05/2001) Computer Science/Mathematics IBM Research Report Scalable Center 650 Harry Road San Jose, CA 95120-6099 LIMITED DISTRIBUTION NOTICE This report has been submitted for publication outside of IBM and will probably be copyrighted if accepted for publica- tion. It has been issued

Shaikh, Anees

313

Publications Received Books listed below that are marked with a  

E-Print Network (OSTI)

, volume 1 Harry Bunt and Reinhard Muskens (editors) (Tilburg University) Dordrecht: Kluwer Academic 468 #12;Publications Received Meijs, volume 30), 2000, xv+344 pp; hardbound, ISBN 90-420-0419-3, $97Publications Received Books listed below that are marked with a t have been selected for review

314

RC 22275 (Log# W0112022) (12/05/2001) Computer Science/Mathematics  

E-Print Network (OSTI)

RC 22275 (Log# W0112­022) (12/05/2001) Computer Science/Mathematics IBM Research Report Scalable Center 650 Harry Road San Jose, CA 95120­6099 LIMITED DISTRIBUTION NOTICE This report has been submitted for publication outside of IBM and will probably be copyrighted if accepted for publica­ tion. It has been issued

Shaikh, Anees

315

ROBERTS, FRED S. Professor II Birthdate: 19 June 1943  

E-Print Network (OSTI)

.) (pp. 165-184), Baltimore: Paul H. Brookes, 2008. Representative awards: Outstanding Ph.D. student-principal investigator and executive director, Exxon Mobil Bernard Harris Summer Science Camp ($80,000), 2009 Science. Ph.D., University of Nebraska, 1978; M.S., Kansas State, 1975; B.S., Kansas State, 1973. Area

316

Eventdriven, Rolebased Mobility in Disaster Recovery Networks  

E-Print Network (OSTI)

-1-59593-737-7/07/0009 ...$5.00. disaster response scenarios, understanding communication patterns in such networks is criticalEvent­driven, Role­based Mobility in Disaster Recovery Networks Samuel C. Nelson, Albert F. Harris important tools in understanding the com- plex characteristics of disaster recovery networks is simula- tion

Kravets, Robin

317

Use the drop-down search menus and operators (AND, OR, NOT) to customize your search. Search by topic, author, journal title, publication year, and other fields.  

E-Print Network (OSTI)

by topic, author, journal title, publication year, and other fields. Topic Enter your search words, joined, and subject terms; choose Title from the drop-down search menu to restrict your search to document titles only for the most comprehensive search. 1.To find all articles by Francis Harry Compton Crick, click , enter Crick F

California at Berkeley, University of

318

Argonne Accelerator Institute  

NLE Websites -- All DOE Office Websites (Extended Search)

et al. 2:30 - 3:00 Coffee Break 3:00 - 3:10 EPBCP Processing Mike Kelly 3:15 - 4:15 Tour EP BCP Processing Mike Kelly Large Available Lab. Space Harry Weerts 4:15 - 6:00...

319

The impacts of climate change at Mount Rainier National Park  

E-Print Network (OSTI)

. Cahall, Jr. Dorothy and Leicester Lancaster Ralph J. McMillan Dorothy and Thomas Robinson Harry L. Rust George M. Rust Geraldine and Irving Schaffer Grace and James H. Schnabel Bernice and Francis Shannon. Murray Rust, Jr. Julia and J. Edward Tyler, III 1935 Leonor and Cornelius Ackerson Rachel and Curtis

Hille Ris Lambers, Janneke

320

William S. Cortright Annie and Robert Mitchell  

E-Print Network (OSTI)

. Cahall, Jr. Dorothy and Leicester Lancaster Ralph J. McMillan Dorothy and Thomas Robinson Harry L. Rust George M. Rust Geraldine and Irving Schaffer Grace and James H. Schnabel Bernice and Francis Shannon. Murray Rust, Jr. Julia and J. Edward Tyler, III 1935 Leonor and Cornelius Ackerson Rachel and Curtis

Napier, Terrence

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Spec Towns Track Family & Graduate  

E-Print Network (OSTI)

University Village RIVERBEND RD Botany Greenhouses Greenhouses Center for Applied Isotope Study Central Food ST SOULE ST WEST GREEN ST DW BROOKSDR Conner Lumpkin House Barrow Clark Howell Geology Lab Bookstore Harris Commons Vandiver Hall WILLIAMSST Waddel Pharmacy South Performing Arts Geography/ Geology Georgia

Hall, Daniel

322

Spec Towns Track Family & Graduate  

E-Print Network (OSTI)

University Village RIVERBEND RD Botany Greenhouses Greenhouses Center for Applied Isotope Study Central Food CEDAR ST SOULE ST WEST GREEN ST DW BROOKSDR Conner Lumpkin House Barrow Clark Howell Geology Lab Harris Commons Vandiver Hall WILLIAMSST Waddel Pharmacy South Performing Arts Geography/ Geology Georgia

Hall, Daniel

323

S T A T EEngineeringThe Magazine of the Penn State College of Engineering Winter 2004 2 Engineering Penn State  

E-Print Network (OSTI)

, sustainability, and profit- abilityofthefruitandvegetableindustrythroughapplication of new technology. MaryJane Model to Evaluate Impact of Architectural andTechnologyOptimizations."Thepaperwasco-writtenby Mary Jane S P A C E Winter 2004 Vol. 20, No. 1 Editor: Curtis Chan Writers: Jane Harris Barbara Ann Hale A

Demirel, Melik C.

324

S T A T EEngineeringThe Magazine of the Penn State College of Engineering Summer2003 Four faculty members received the title of "distinguished  

E-Print Network (OSTI)

, was named national president of the Chi Epsilon civil engineering honor society. Mary Jane Irwin, distin science and engineering; and Mary Jane Irwin, distinguished professor of computer science and engineering Chan Writers: Jane Harris Barbara Ann Hale A'ndrea Elyse Messer Editorial Assistant: Stefanie Tomlinson

Demirel, Melik C.

325

Book review Carbon Nanotube Science: Synthesis, Properties and Appli-  

E-Print Network (OSTI)

Book review Carbon Nanotube Science: Synthesis, Properties and Appli- cations, Peter J.F. Harris in the nanotube discovery is dis- cussed in the first chapter of this book), a few years after ful- lerenes were of the nanotechnology era ­ you'll find their pictures on book covers, in newspaper articles and magazine centerfolds

Harris, Peter J F

326

Summary of the Very Large Hadron Collider Physics and Detector subgroup  

SciTech Connect

We summarize the activity of the Very Large Hadron Collider Physics and Detector subgroup during Snowmass 96. Members of the group: M. Albrow, R. Diebold, S. Feher, L. Jones, R. Harris, D. Hedin, W. Kilgore, J. Lykken, F. Olness, T. Rizzo, V. Sirotenko, and J. Womersley. 9 refs.

Denisov, D.; Keller, S.

1996-12-31T23:59:59.000Z

327

INCT FOR CLIMATE CHANGE | 2009.2010 | ACTIVITY REPORT | BRAzIL National Institute of Science and  

E-Print Network (OSTI)

, Tennessee BEN CHANDLER, Kentucky RUSS CARNAHAN, Missouri BARON P. HILL, Indiana HARRY E. MITCHELL, Arizona, New Mexico PAUL D. TONKO, New York JIM MATHESON, Utah LINCOLN DAVIS, Tennessee BEN CHANDLER, Kentucky and Assistant Director for Academic Affairs, Labora- tory for Laser Energetics, University of Rochester Oral

328

Date: May 17, 2012 ENI Renewable Energy Prize 2012  

E-Print Network (OSTI)

Date: May 17, 2012 ENI Renewable Energy Prize 2012 The prestigious ENI Renewable and Non; Renewable and Non-conventional Energy; Protection of the Environment; and Debut in Research. The jury-conventional Energy Prize 2012 has been awarded to Harry Atwater of the California Institute of Technology and Albert

Elowitz, Michael

329

Studienstadt Studieren  

E-Print Network (OSTI)

S. Hauptmann, Organische Chemie, 1st edn, VEB Harri Deutsch, Thun, Frankfurt am Main, 1985. 20 K. P University in 2001, where he is currently the Irving M. Klotz Professor of Physical Chemis- try. Geiger Organischen Chemie, ed. G. Thieme, Stuttgart, New York, 4th edn, 1991. 86 V. A. Marple, K. L. Rubow and S. M

Bartels, Soeren

330

DRAFT LIST OF KEY INDICATORS IDENTIFIED BY THE SOCIOECONOMIC AND INSTITUTIONAL WORKING GROUP  

E-Print Network (OSTI)

-time Residents Total population by census tract and block Age (using typical census data) Average household Redevelopment and Community Reinvestment Public investment in local and regional infrastructure (spatially Public Utility District Bob Harris Retired Supervisor, US Forest Service, Lake Tahoe Basin Management

Standiford, Richard B.

331

Residential Care Facilities  

E-Print Network (OSTI)

All material appearing in this report is in the public domain and may be reproduced or copied without permission; citation as to source, however, is appreciated. Suggested citation Moss AJ, Harris-Kojetin LD, Sengupta M, et al. Design and operation of the

unknown authors

2011-01-01T23:59:59.000Z

332

The Bulletin - BNL's Weekly Newspaper  

NLE Websites -- All DOE Office Websites (Extended Search)

George Harris George Harris A | B | C | D | E | F | G | H | I | J | K | L | M N | O | P | Q | R | S | T | U | V | W | X | Y | Z In Memoriam Home | Bulletin Home Posted: October 2, 2008 George Harris, who joined the Plant Engineering Division as a janitor on January 8, 1962, became a painter in 1966, and a painter A in 1974, died on July 9, 2008. He was 76. He had retired on July 13, 1993. ***** Rod di Girolamo adds some fond memories of George Harris George was the first full time painter added to the AGS Experimental Area Operations Group we had assigned full time; 21 riggers, 2 carpenters, 3 electricians, 1 A/C person 2 welders and several Custodians who supported and worked with the approximately 40 Technicians comprising the EAO "Team." George had a very big smile, and everyone was "brother." He didn't know the words "No" or Can't do it." The tougher the job, the bigger his smile.

333

GEOPHYSICS, VOL. 64, NO. 5 (SEPTEMBER-OCTOBER 1999); P. 13471348 Computers and creativity  

E-Print Network (OSTI)

GEOPHYSICS, VOL. 64, NO. 5 (SEPTEMBER-OCTOBER 1999); P. 1347­1348 Computers and creativity John A. Scales and Roel Snieder "The real danger is not that computers will begin to think like men, but that men will begin to think like computers."--Sydney J. Harris "Technical skill is mastery of complexity while

Scales, John

334

Annual UCF Progress Energy Senior Design Symposium  

E-Print Network (OSTI)

Sponsored by Harris & Progress Energy #12;16 Bi-Directional Hydro-Turbine The turbine consists3rd Annual UCF ­ Progress Energy Senior Design Symposium on Renewable & Sustainable Energy Friday and sustainable energy. For the third year in a row, the symposium was sponsored by Progress Energy. Twenty seven

Van Stryland, Eric

335

Sputtering of lunar regolith simulant by protons and singly and multicharged Ar ions at solar wind energies  

E-Print Network (OSTI)

for solar wind multi- charged ions having similar neutralization potential energies [1]. WeightedSputtering of lunar regolith simulant by protons and singly and multicharged Ar ions at solar wind energies F.W. Meyer a, , P.R. Harris a , C.N. Taylor a,1 , H.M. Meyer III b , A.F. Barghouty c , J.H. Adams

336

LANL | Solid Earth Geophysics | EES-17  

NLE Websites -- All DOE Office Websites (Extended Search)

LANL : Earth & Environmental Sciences : Solid Earth Geophysics (EES-17) LANL : Earth & Environmental Sciences : Solid Earth Geophysics (EES-17) Home Publications Collaboration & Links Staff Research Highlights Ground-Based Nuclear Explosion Monitoring Geodynamics & National Security Nonlinear Elasticity Time Reversal Los Alamos Seismic Network Stimulated Porous Fluid Flow Resource Recovery Seismic & Acoustic Imaging Exploration Geophysics Induced Seismicity Volcanoes & Earthquakes Other Research CONTACTS Group Leader Ken Rehfeldt Administrative Contacts Jody Benson Cecilia Gonzales Geophysics (EES-17) The Geophysics Group supports the national security mission of Los Alamos National Laboratory by providing technical expertise to monitor movement of Earth's crust while predicting the effects of these events on the environment. Though our focus is on seismic monitoring, we also apply electric, magnetic, radionuclide, and acoustic technologies to monitor underground explosions, maintain our ability to conduct tests, and develop the Yucca Mountain Project. In addition, we study the nonlinear properties of earth materials, imaging with seismic waves, how seismic waves affect the interaction of porous rocks and fluids, use of seismic waves to characterize underground oil reservoirs, volcanology and volcanic seismicity, advanced computational physics of earth materials, and using drilling technology to study the crust of the earth. These tasks are complemented by our extensive background in both conventional and hot dry rock geothermal energy development and geophysical support of the Nevada Test Site.

337

Modeling aspects of the ecological and evolutionary dynamics of the endangered Houston toad  

E-Print Network (OSTI)

The goal of my dissertation was to describe the dynamics of a group of Houston toads located at the Griffith League Ranch (GLR), Bastrop County, Texas. My research included using statistical modeling to predict activity and abundance, mark-recapture techniques to estimate survivorship, and simulation modeling to explore the impacts of the difference in age at first reproduction and to project the future dynamics of the population at the GLR. From 2001 2005, 225 individual Houston toads (199 M : 26 F) were captured using two methods: breeding pond surveys and drift fences. Houston toads were neither caught equally among capture methods, nor across years. Toad activity was mostly confined within their breeding season, and activity was not continuous. A logistic regression indicated activity depended on time of year, mean precipitation, mean minimum daily temperature, and mean percent lunation as well as two-way interactions with moon-phase and other variables. Abundance depended on time of year, current precipitation, minimum temperature, and two-way interactions between time of year and the other two variables. Twenty-one of the 199 males (10.5%) and no females were recaptured among years. The probability of male survival was estimated using program MARK. Eight of 16 candidate models were supported and all but one contained precipitation as a covariate, indicating precipitation is important for Houston toad survival. Survivorship estimates varied from 0.1 to 0.41. The sex ratio was significantly male-biased. The odds of catching females in traps were 3.5 greater than capturing females in a pond, while the odds of capturing males in a trap were 0.28 compared to ponds. Results from a simulation model indicated the sex ratio is biased because of the difference in maturation times between males and females, coupled with high juvenile mortality. Results from an individual-based, spatially-explicit, stochastic simulation model, indicated a relatively low probability (~ 0.013) of B. houstonensis going extinct at the GLR within the next 10 years. Emergent properties of the model were similar to results observed in the field or reported in the literature. The model also identified that dispersal of Houston toads should be a future research priority.

Swannack, Todd Michael

2007-08-01T23:59:59.000Z

338

Microsoft Word - CIGNLDOECSCCostRMExtensionLtr10-8-10.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DIRECT & VOICE MAIL: 1-202-842-4711 FACSIMILE: 1-202-328-3544 E-MAIL: omerb@aol.com October 8, 2010 Hon. Scott Blake Harris General Counsel, GC-1 U.S. Department of Energy 1000 Independence Avenue, S.W. Washington, DC 20585 Re: U.S. Department of Energy Notice of Inquiry on Convention on Supplementary Compensation for Nuclear Damage Contingent Cost Allocation, 75 Fed. Reg. 43945 (Jul. 27, 2010) and 75 Fed. Reg. 51986 (Aug. 24, 2010) Dear Mr. Harris: On behalf of the Contractors International Group on Nuclear Liability (CIGNL), this is to request an extension to Tuesday, November 30, 2010 of the public comment period for reply comments to the U.S. Department of Energy (DOE) Notice of Inquiry (NOI) on the Convention

339

Tuesday Webcast for Industry: Tax Rebates/Credits Available for Energy Efficiency Actions  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tax Rebates/Credits Available for Energy Tax Rebates/Credits Available for Energy Efficiency Actions Webcast Questions and Answers: May 8, 2012 Presenters: Jeff Harris, Senior Vice President of Programs, Alliance to Save Energy Tim Konicek, Executive Director, CleanTech Partners The U.S. Department of Energy's (DOE's) Advanced Manufacturing Office (AMO) hosts a series of webcasts on the first Tuesday of every month from 2:00 p.m. to 3:00 p.m. Eastern Time. The series helps industrial personnel learn about various ways to save energy and reduce carbon emissions. Jeff Harris, Senior Vice President of the Alliance to Save Energy (ASE), and Tim Konicek, Executive Director of CleanTech Partners on behalf of Focus on Energy, were the presenters for the May 2012 seminar, Tax Rebates/Credits Available for Energy Efficiency

340

EM Wins Award for Role as Strong Small Businesses Advocate | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Wins Award for Role as Strong Small Businesses Advocate Wins Award for Role as Strong Small Businesses Advocate EM Wins Award for Role as Strong Small Businesses Advocate June 28, 2012 - 12:00pm Addthis DOE Office of Economic Impact and Diversity Director Dot Harris, left, presents the Sub-to-Prime Small Business Champion of the Year Award to EM Small Business Advocate Kay Rash, center, and EM Deputy Assistant Secretary for Acquisition and Project Management Jack Surash during DOE’s Fiscal Year 2011 DOE Secretarial Small Business Awards Program Wednesday. DOE Office of Economic Impact and Diversity Director Dot Harris, left, presents the Sub-to-Prime Small Business Champion of the Year Award to EM Small Business Advocate Kay Rash, center, and EM Deputy Assistant Secretary for Acquisition and Project Management Jack Surash during DOE's Fiscal

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Creating What You Can Imagine, Changing the World | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Creating What You Can Imagine, Changing the World Creating What You Can Imagine, Changing the World Creating What You Can Imagine, Changing the World March 1, 2013 - 4:57pm Addthis Dot Harris, Director of the Department of Energy’s Office of Economic Impact and Diversity meets with students at Argonne National Laboratory’s Introduce a Girl to Engineering Day (Photo by Argonne National Laboratory) Dot Harris, Director of the Department of Energy's Office of Economic Impact and Diversity meets with students at Argonne National Laboratory's Introduce a Girl to Engineering Day (Photo by Argonne National Laboratory) Lauren Andersen Policy Advisor at White House Office of Science and Technology Policy Editor's Note: This blog was originally posted on the White House website. As we celebrate the historic accomplishments of women during Women's

342

Intentionally Including - Engaging Minorities in Physics Careers |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Intentionally Including - Engaging Minorities in Physics Careers Intentionally Including - Engaging Minorities in Physics Careers Intentionally Including - Engaging Minorities in Physics Careers April 24, 2013 - 4:37pm Addthis Joining Director Dot Harris (second from left) were Marlene Kaplan, the Deputy Director of Education and director of EPP, National Oceanic and Atmospheric Administration, Claudia Rankins, a Program Officer with the National Science Foundation and Jim Stith, the past Vice-President of the American Institute of Physics Resources. Joining Director Dot Harris (second from left) were Marlene Kaplan, the Deputy Director of Education and director of EPP, National Oceanic and Atmospheric Administration, Claudia Rankins, a Program Officer with the National Science Foundation and Jim Stith, the past Vice-President of the

343

Lessons Learned Quarterly Report, September 2009 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

9 9 Lessons Learned Quarterly Report, September 2009 Welcome to the 60th quarterly report on lessons learned in the NEPA process. We are pleased to feature the extraordinary support provided by our NCO volunteers and to introduce Scott Blake Harris, DOE General Counsel, and his plans for improving the DOE NEPA process. Thank you for your continuing support of the Lessons Learned program. As always, we welcome your suggestions for improvement. Articles included in this issue: DOE NCO Volunteers Lend a Hand To Expedite Recovery Act Projects DOE General Counsel Scott Blake Harris Aims To Improve the NEPA Review Process CEQ Report to Congress on Recovery Act DOE Grants NEPA Variances for Two Solicitations Introducing DOE's New General Counsel Mercury Storage EIS Under Way

344

TSHL  

NLE Websites -- All DOE Office Websites (Extended Search)

Tsung-Shung Harry Lee Tsung-Shung Harry Lee phone: 630/252-4094 FAX: 630/252-6008 e-mail: lee@phy.anl.gov Expanded Curriculum Vitae available as PDF file Biographical sketch 1965 B.A., Taiwan National University, Taiwan 1968 M.S., Tsing-Hua University, Taiwan 1973 Ph.D., University of Pittsburgh 1973-75 Research Associate, Bartol Research Foundation 1975-77 Research Associate, Argonne National Laboratory 1977-80 Assistant Physicist, Argonne National Laboratory 1981-93 Physicist, Argonne National Laboratory 1993-present Senior Physicist, Argonne National Laboratory Visiting appointments 1997 Research Center for Nuclear Physics, Osaka University, Japan 1992-1998 Adjunct Professor, University of Pittsburgh 1984-1987 Swiss Institute of Nuclear Physics, Switzerland 1981 Center of Theoretical Physics, MIT

345

1754-6834-5-20.pdf  

NLE Websites -- All DOE Office Websites (Extended Search)

Tracking Tracking dynamics of plant biomass composting by changes in substrate structure, microbial community, and enzyme activity Biotechnology for Biofuels 2012, 5:20 doi:10.1186/1754-6834-5-20 Hui Wei (Hui.Wei@nrel.gov) Melvin Tucker (Melvin.Tucker@nrel.gov) John Baker (John.Baker@nrel.gov) Michelle Harris (Michelle.Harris@umassmed.edu) Yonghua Luo (yul136@mail.utexas.edu) Qi Xu (Qi.xu@nrel.gov) Michael Himmel (Mike.Himmel@nrel.gov) Shi-You Ding (Shi.you.Ding@nrel.gov) ISSN 1754-6834 Article type Research Submission date 12 January 2012 Acceptance date 10 April 2012 Publication date 10 April 2012 Article URL http://www.biotechnologyforbiofuels.com/content/5/1/20 This peer-reviewed article was published immediately upon acceptance. It can be downloaded, printed and distributed freely for any purposes (see copyright notice below). Articles

346

Faces of the Recovery Act: Jobs at Savannah River Site | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Jobs at Savannah River Site Jobs at Savannah River Site Faces of the Recovery Act: Jobs at Savannah River Site Addthis Description The Savannah River Site in Aiken, SC has been able to create/save thousands of jobs through the Recovery Act. These are the stories of just a few of the new hires. Speakers Skila Harris, Doug Clark, Bill Picciano, Kelli Culpepper, Nancy Cole, Duration 5:08 Topic Recovery Act Waste Management Nuclear Security & Safety Credit Energy Department Video SKILA HARRIS: We understand the health risks associated with radioactivity much better today than we did 50 years ago. And at the sites where this country was developing its weapons, we were not responsible in how we handled those materials. The recovery act has allowed us to accelerate the clean-up, hire a lot more people so we can

347

Name of Contractor: ActioNet, Inc. Contract Number: DE-DT0003143  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Federal and Eligible Contractor Use (Contractors must obtain written Federal and Eligible Contractor Use (Contractors must obtain written approval from the DOE Contracting Officer) Name of Contractor: ActioNet, Inc. Contract Number: DE-DT0003143 Expiration Date: 04/12/2014 Brief description of the products or services available: Information Technology Support Services Type of Business: Small Business Extent of Competition: Competed within Alliant Small Business GWAC Contract Specialist: Arness Harris Telephone Number: (202) 287-1601 E-Mail Address: arness.harris@hg.doe.gov For ordering information contact: OCIO COR: Tim Beckham COR Telephone Number: (301) 903-3187 Name of Contractor: DLT Solutions, Inc. Contract Number: DE-AB01-071M00180 Expiration Date: 03/20/2013 Brief description of the products or services available: Red Hat Proprietary Computer Software

348

Alliance Laundry Systems LLC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Alliance Laundry Systems LLC Alliance Laundry Systems LLC Shepard Street, P.O. Box 990 Ripon, WI 54971-0990 Tel 920.748.3121 Fax 920.748.4429 www.comlaundry.com Via E-Mail - GC_comments@hq.doe.gov December 7, 2010 Mr. Scott Blake Harris General Counsel U.S. Department of Energy 1000 Independence Ave., S.W. Washington, DC 20585 Subject: Your Request of 11-30-2010 Regarding Clothes Washer Test Procedure Waivers Dear Mr. Harris: Thank you for asking for our comments. Alliance Laundry Systems LLC (ALS) is knowledgeable of the multiple petitions for waiver to the Department's Clothes Washer Test Procedure, regarding the need for an expanded "test load size" table to account for clothes container capacities beyond the existing test procedure Table 5.1 maximum capacity of 3.5 cubic feet. While we do not manufacture clothes washers

349

Giving Back Through Our Talented STEM Professionals | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Giving Back Through Our Talented STEM Professionals Giving Back Through Our Talented STEM Professionals Giving Back Through Our Talented STEM Professionals January 17, 2014 - 4:51pm Addthis Events like Argonne National Laboratory's annual Introduce a Girl to Engineering Day are produced with the volunteer support of the Department of Energy's STEM professionals. Above, Director Dot Harris visits the event in 2013. Events like Argonne National Laboratory's annual Introduce a Girl to Engineering Day are produced with the volunteer support of the Department of Energy's STEM professionals. Above, Director Dot Harris visits the event in 2013. Andre H. Sayles, Ph.D. Andre H. Sayles, Ph.D. Principal Deputy Director of the Office of Economic Impact and Diversity and Acting Deputy Director of the Office of Minority Business and Economic

350

Walking the Walk: Making DOE Management and Operations More Efficient and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Walking the Walk: Making DOE Management and Operations More Walking the Walk: Making DOE Management and Operations More Efficient and Effective Walking the Walk: Making DOE Management and Operations More Efficient and Effective July 2, 2012 - 3:03pm Addthis Beth Tomasoni was part of a team from the Office of Management that included Richard Leotta and John Harris who improved diversity and inclusion in procurement by ensuring that more than 70% of contract work by dollar amount went to small businesses. Beth Tomasoni was part of a team from the Office of Management that included Richard Leotta and John Harris who improved diversity and inclusion in procurement by ensuring that more than 70% of contract work by dollar amount went to small businesses. Melvin G. Williams, Jr. Melvin G. Williams, Jr. Former Associate Deputy Secretary

351

Helping STEM Take Root: EM Tribal Partnership Looks To the Future of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Helping STEM Take Root: EM Tribal Partnership Looks To the Future Helping STEM Take Root: EM Tribal Partnership Looks To the Future of Science Education Helping STEM Take Root: EM Tribal Partnership Looks To the Future of Science Education November 1, 2012 - 12:00pm Addthis Umatilla Tribes Department of Science and Engineering Director Stuart Harris, far right, explains the purpose of the Tribes’ greenhouses to Senior Advisor for Environmental Management David Huizenga, center, and Richland Operations Office Manager Matt McCormick. Umatilla Tribes Department of Science and Engineering Director Stuart Harris, far right, explains the purpose of the Tribes' greenhouses to Senior Advisor for Environmental Management David Huizenga, center, and Richland Operations Office Manager Matt McCormick. EM and Tribal leaders join in the celebration of the opening of the Umatilla Tribes' new field station and greenhouses funded in part by EM.

352

Opportunities for Minority Students in the Solar Industry | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Opportunities for Minority Students in the Solar Industry Opportunities for Minority Students in the Solar Industry Opportunities for Minority Students in the Solar Industry November 20, 2012 - 9:00am Addthis The Long Island Solar Farm (LISF) -- currently the largest solar photovoltaic power plant in the Eastern United States -- generates enough renewable energy to power approximately 4,500 homes. LISF is located at Brookhaven National Laboratory. | Photo courtesy of Brookhaven National Laboratory. The Long Island Solar Farm (LISF) -- currently the largest solar photovoltaic power plant in the Eastern United States -- generates enough renewable energy to power approximately 4,500 homes. LISF is located at Brookhaven National Laboratory. | Photo courtesy of Brookhaven National Laboratory. Dot Harris Dot Harris

353

jbc.M110.215962.full.pdf  

NLE Websites -- All DOE Office Websites (Extended Search)

arabinan-specific arabinan-specific D D-1,2- arabinofuranosidase identified from screening the activities of bacterial GH43 glycoside hydrolases Alan Cartmell 1,2 *, Lauren McKee 1,2 *, Maria J. Peña 2 , Johan Larsbrink 3 , Harry Brumer 3 , Satoshi Kaneko 4 , Hitomi Ichinose 4 , Richard J. Lewis 1 , Anders Viksø-Nielsen 5 , Harry J. Gilbert 1,2¶ and Jon Marles-Wright 1 1 Institute for Cell and Molecular Biosciences, Newcastle University, The Medical School, Newcastle upon Tyne NE2 4HH, U.K; 2 The Complex Carbohydrate Research Center, The University of Georgia, 315 Riverbend Road, Athens, GA 30602, USA; 3 School of Biotechnology, Royal Institute of Technology, AlbaNova University Centre, 10691 Stockholm, Sweden; 4 Food Biotechnology Division, National Food Research Institute, 2-1-12 Kannondai, Tsukuba, Ibaraki 305-8642, Japan,

354

Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

7 results: 7 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is Laura Van Wie McGrory [Clear All Filters] 2006 McGrory, Laura Van Wie, Philip Coleman, David Fridley, Jeffrey P. Harris, and Edgar Villasenor Franco. "Two Paths to Transforming Markets through Public Sector Energy Efficiency: Bottom Up versus Top Down." In 2006 ACEEE Summer Study on Energy Efficiency in Buildings. Pacific Grove, CA, 2006. McGrory, Laura Van Wie, Philip Coleman, David Fridley, Jeffrey P. Harris, and Edgar Villasenor Franco. Two Paths to Transforming Markets through Public Sector Energy Efficiency: Bottom Up versus Top Down In 2006 ACEEE Summer Study on Energy Efficiency in Buildings . Vol. 6., 2006. 2004 Wiel, Stephen, Laura Van Wie McGrory, and Lloyd Harrington. Energy

355

Energy Media Advisories | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

March 9, 2011 March 9, 2011 Secretary Chu to Visit Morgan State University Chu to Tour University's CAESECT Center and Discuss Value of STEM Education February 15, 2011 Secretary Chu and Senator Reid to Make Major Energy Announcement for Nevada Washington, D.C. - U.S. Secretary Steven Chu and U.S. Senator Harry Reid will host a press conference call today, Tuesday, February 15 at 4:00 pm EST to make a major funding announcement concerning a Nevada clean energy project. Today's announcement will create jobs and help the renewable energy industry expand in Nevada. WHO: Secretary of Energy Steven Chu U.S. Senator Harry Reid February 8, 2011 WEDNESDAY: Chu, Salazar, Vilsack to Participate in Onshore Renewable Energy Workshop Secretaries Chu , Salazar, Vilsack will open conference with roundtable

356

Microsoft Word - LG response to DOE letter to clothes washer waivers  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

LG ELECTRONICS LG ELECTRONICS 1776 K Street NW Washington, DC 20006 By email: GC_comments@hq.doe.gov December 7, 2010 Scott Blake Harris, Esq. General Counsel United States Department of Energy 1000 Independence Avenue, SW Washington, DC 20585 Re: Alternative test procedure for large-capacity clothes washer models Dear Mr. Harris, Thank you for seeking the views of interested parties concerning implementation of an alternative test procedure for large-capacity clothes washer models, i.e., those in excess of 3.8 cu ft. You appropriately state that the situation you have described presents a set of "unique circumstances." LG Electronics' suggestions herein are crafted in light of these unique circumstances. As discussed herein, LG Electronics believes that there is a relatively simple and

357

Ambassadors of the Minorities in Energy Initiative | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Initiative » Ambassadors of the Initiative » Ambassadors of the Minorities in Energy Initiative Ambassadors of the Minorities in Energy Initiative Ambassadors gather with Secretary Ernest Moniz, Director Dot Harris, and speakers from the White House Forum on Minorities in Energy, a dialogue on diversity in the energy sector held on Wednesday, November 13, 2013. Ambassadors gather with Secretary Ernest Moniz, Director Dot Harris, and speakers from the White House Forum on Minorities in Energy, a dialogue on diversity in the energy sector held on Wednesday, November 13, 2013. The Ambassadors of the Minorities in Energy Initiative were announced by Secretary Ernest Moniz on November 13, 2013. These senior-level leaders have committed to lending their voice to the mission of the Minorities in

358

Minutes of October 15 meeting  

NLE Websites -- All DOE Office Websites (Extended Search)

10/15/99 Oscillations Measurements Working Group Meeting 10/15/99 Oscillations Measurements Working Group Meeting Deborah Harris Last modified: Tue Oct 26 09:57:25 CDT 1999 Oscillation Measurements Working Group Minutes Attendees: Bob Bernstein Steve Geer Debbie Harris Kevin McFarland (by phone) Steve Parke Rajendran Raja Panagiotis Spentzouris Ray Stefanksi Literature Search and Secure: Carl Albright has produced three lists of papers submitted to Los Alamos preprint server in the past year on the topics of 1: CP violation in neutrino mixing, 2: Matter effects and 3: Sterile neutrinos. General hope was expressed that he and Greg Anderson would sift through these papers and perhaps produce a "top ten" list for each. This list could exist on the web with links to the papers themselves, with hope that as people read the

359

Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Running a fuel cell directly on solid coal, without the need for coal gasification Running a fuel cell directly on solid coal, without the need for coal gasification 800ºC in 100% H 2 Current Response to 50 mV Step in Potential Rate of decay used to measure oxygen transport through tin For more information, please contact Randy Gemmen (Randall.Gemmen@netl.doe.gov) or Harry Abernathy (Harry.Abernathy@netl.doe.gov). Test Sample Installed in Furnace Schematic of LTA-SOFC Test Sample LTA-SOFC System Designs Cylindrical Cell Design Developed by CellTech Power LLC (Westborough, MA) Planar Design in Which Tin Reacts with Fuel in Separate Chamber A liquid tin anode solid oxide fuel cell (LTA-SOFC) * Operating Temperature: 800-1000ºC * Highest Reported Power Density: 200 mW/cm 2 Can be removed for an LTA-SOFC system LTA-SOFC Research at NETL Objectives

360

Savannah River Site - Salt Waste Processing Facility Independent Technical Review  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SALT WASTE PROCESSING FACILITY SALT WASTE PROCESSING FACILITY INDEPENDENT TECHNICAL REVIEW November 22, 2006 Conducted by: Harry Harmon, Team Lead Civil/Structural Sub Team Facility Safety Sub Team Engineering Sub Team Peter Lowry, Lead James Langsted, Lead George Krauter, Lead Robert Kennedy Chuck Negin Art Etchells Les Youd Jerry Evatt Oliver Block Loring Wyllie Richard Stark Tim Adams Tom Anderson Todd LaPointe Stephen Gosselin Carl Costantino Norman Moreau Patrick Corcoran John Christian Ken Cooper Kari McDaniel _____________________________ Harry D. Harmon ITR Team Leader SPD-SWPF-217 SPD-SWPF-217: Salt Waste Processing Facility Independent Technical Review 11/22/2006 ACKNOWLEDGEMENT The ITR Team wishes to thank Shari Clifford of Pacific Northwest National Laboratory for

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Conversations and Connections - The Expertise of our Small Business  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Conversations and Connections - The Expertise of our Small Conversations and Connections - The Expertise of our Small Business Program Managers Conversations and Connections - The Expertise of our Small Business Program Managers August 20, 2012 - 2:57pm Addthis Freda Hopper serves as a Small Business Program Manager at Oak Ridge Operations Office, helping small businesses learn how to work with the Department and access contract opportunities. Here, she joins Dot Harris (at podium) at a Small Business Summit in Oak Ridge this July. Freda Hopper serves as a Small Business Program Manager at Oak Ridge Operations Office, helping small businesses learn how to work with the Department and access contract opportunities. Here, she joins Dot Harris (at podium) at a Small Business Summit in Oak Ridge this July. John Hale III John Hale III

362

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

51 - 18660 of 26,764 results. 51 - 18660 of 26,764 results. Download CX-004115: Categorical Exclusion Determination Harris County North Bayou Central Plant CX(s) Applied: B5.1 Date: 09/24/2010 Location(s): Harris County, Texas Office(s): Energy Efficiency and Renewable Energy, Golden Field Office http://energy.gov/nepa/downloads/cx-004115-categorical-exclusion-determination Download CX-003981: Categorical Exclusion Determination Energy Efficiency and Conservation Block Grant Green Jobs Revolving Loan Fund/Borrower: Estate Products Manufacturing Group, Incorporated CX(s) Applied: B5.1 Date: 09/22/2010 Location(s): Louisville, Kentucky Office(s): Energy Efficiency and Renewable Energy, Golden Field Office http://energy.gov/nepa/downloads/cx-003981-categorical-exclusion-determination Download CX-003982: Categorical Exclusion Determination

363

Secretaries Chu and Salazar will Join Senator Reid to Make Solar Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretaries Chu and Salazar will Join Senator Reid to Make Solar Secretaries Chu and Salazar will Join Senator Reid to Make Solar Energy Announcement Secretaries Chu and Salazar will Join Senator Reid to Make Solar Energy Announcement July 7, 2010 - 12:00am Addthis WASHINGTON - Secretary of Energy Steven Chu, Secretary of the Interior Ken Salazar and Senate Majority Leader Harry Reid will make an announcement regarding job creation and solar energy development at the Nevada Test Site. Nevada stands to be the leading state for solar energy production and green energy jobs. This announcement will encourage increased development of solar energy technology in the Silver State. WHO: Secretary of Energy Steven Chu Secretary of Interior Ken Salazar Nevada Senator Harry Reid UNLV President Neal Smatresk Nevada Development Authority President Somer Hollingsworth

364

United States Government Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

$!.! p $!.! p j ?r!qI , < REPLY TO ATTN OF: EMCBC:YERACE Consolidated Business Center SUBJECT: ANNUAL NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) SUMMARY FOR 2011 - ENVIRONMENTAL MANAGEMENT CONSOLIDATED BUSINESS CENTER (EMCBC) TO: Scott Blake Harris, Counsel, GC-1, HQ-FORS ~eference: Memofandurn, Scott Blake Harris to Distribution, "Reminder Regarding Annual National Environmental Policy Act (NEPA) Planning Summaries" dated December 08,2010 The EMCBC 201 1 NEPA Planning Summary is being submitted as required by DOE Order 45 1. lB, National Environmental Policy Act Compliance Program, Section 5.a (7). The EMCBC Annual NEPA Planning Summary for 201 1 has no Environmental Assessments or Environmental Impact Statements expected by any of the EMCBC Service Level

365

January 2012 ARRA Energy Assurance Planning Bulletin Available | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

January 2012 ARRA Energy Assurance Planning Bulletin Available January 2012 ARRA Energy Assurance Planning Bulletin Available January 2012 ARRA Energy Assurance Planning Bulletin Available January 3, 2012 - 12:00pm Addthis The Department released the January 2012 issue of the ARRA Energy Assurance Planning Bulletin (EAPB). The ARRA EAPB is issued quarterly to provide information on energy assurance planning resources, upcoming events, training opportunities, and important grant deliverable dates. This is the ninth issue of the EAP Bulletin; previous issues are available for download. Addthis Related Articles April 2012 ARRA Energy Assurance Planning Bulletin Available July 2012 ARRA Energy Assurance Planning Bulletin Available LaDoris (Dot) Harris is the Director of the Office of Economic Impact and Diversity. Women @ Energy: Dot Harris

366

Impact of Hydrogen Production on U.S. Energy Markets  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydrogen Production on Impact of Hydrogen Production on Hydrogen Production on Impact of Hydrogen Production on U.S. Energy Markets U.S. Energy Markets Presented to: Presented to: DOE Hydrogen Transition DOE Hydrogen Transition Analysis Workshop Analysis Workshop Washington DC Washington DC January 26, 2006 January 26, 2006 Prepared by: Prepared by: E. Harry Vidas, Energy and Environmental Analysis, Inc. E. Harry Vidas, Energy and Environmental Analysis, Inc. Paul Friley, Brookhaven National Laboratory Paul Friley, Brookhaven National Laboratory AZ CA Project Scope Project Scope * Focus will be on competition between hydrogen production and distribution technologies with respect to hydrogen fuel demand, technology cost, regional mix, and impact on feedstock prices. * Evaluate impacts on U.S. energy markets including price

367

Lessons Learned Quarterly Report, September 2009 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Lessons Learned Quarterly Report, September 2009 Lessons Learned Quarterly Report, September 2009 Lessons Learned Quarterly Report, September 2009 Welcome to the 60th quarterly report on lessons learned in the NEPA process. We are pleased to feature the extraordinary support provided by our NCO volunteers and to introduce Scott Blake Harris, DOE General Counsel, and his plans for improving the DOE NEPA process. Thank you for your continuing support of the Lessons Learned program. As always, we welcome your suggestions for improvement. Articles included in this issue: DOE NCO Volunteers Lend a Hand To Expedite Recovery Act Projects DOE General Counsel Scott Blake Harris Aims To Improve the NEPA Review Process CEQ Report to Congress on Recovery Act DOE Grants NEPA Variances for Two Solicitations Introducing DOE's New General Counsel

368

West Virginia Smart Grid Implementation Plan (WV SGIP) Project  

NLE Websites -- All DOE Office Websites (Extended Search)

WV DoE-NRCCE-APERC DRAFT February 16, 2009 WV DoE-NRCCE-APERC DRAFT February 16, 2009 1 West Virginia Smart Grid Implementation Plan (WV SGIP) Project APERC Report on Customer Complaints to WV PSC about Electric Power Service Ali Feliachi, Muhammad Choudhry, John Saymansky and Ed Sneckenberger February 16, 2009 Introduction APERC has appreciated that one of the most important sources for data on the consumer perspective of the current electric power grid in West Virginia would be the WV Public Service Commission (WV PSC). Thus, an email request was sent on December 19, 2008 to Byron Harris at the WV PSC to request any advice or approaches to determine customer and regulatory perspectives of the current electric power grid in WV. Customer Complaint Data Bryon Harris was able to provide a spreadsheet of customer complaints in West Virginia for

369

Slide 1  

U.S. Energy Information Administration (EIA) Indexed Site

Impact of Futures Trading on Impact of Futures Trading on Commodity Markets and Prices Dr. James L. Smith, Cary M. Maguire Chair in Oil & Gas Management EIA Annual Conference April 26, 2011 Some Questions * How does futures trading affect the volatility of oil prices? Some Questions * How does futures trading affect the volatility of oil prices? * How does futures trading affect the level of oil prices? Some Questions * How does futures trading affect the volatility of oil prices? * How does futures trading affect the level of oil prices? * How does the influx of financial traders alter the answers given above? Growth in Market Share of Financial Traders Source: Buyuksahin, Haigh, Harris, Overdahl, and Robe (2008) Growth in Number of Large Financial Traders Source: Buyuksahin, Haigh, Harris, Overdahl, and Robe (2008)

370

Walking the Walk: Making DOE Management and Operations More Efficient and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Walking the Walk: Making DOE Management and Operations More Walking the Walk: Making DOE Management and Operations More Efficient and Effective Walking the Walk: Making DOE Management and Operations More Efficient and Effective July 2, 2012 - 3:03pm Addthis Beth Tomasoni was part of a team from the Office of Management that included Richard Leotta and John Harris who improved diversity and inclusion in procurement by ensuring that more than 70% of contract work by dollar amount went to small businesses. Beth Tomasoni was part of a team from the Office of Management that included Richard Leotta and John Harris who improved diversity and inclusion in procurement by ensuring that more than 70% of contract work by dollar amount went to small businesses. Melvin G. Williams, Jr. Melvin G. Williams, Jr. Former Associate Deputy Secretary

371

Conversations and Connections - The Expertise of our Small Business  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Conversations and Connections - The Expertise of our Small Conversations and Connections - The Expertise of our Small Business Program Managers Conversations and Connections - The Expertise of our Small Business Program Managers August 20, 2012 - 2:57pm Addthis Freda Hopper serves as a Small Business Program Manager at Oak Ridge Operations Office, helping small businesses learn how to work with the Department and access contract opportunities. Here, she joins Dot Harris (at podium) at a Small Business Summit in Oak Ridge this July. Freda Hopper serves as a Small Business Program Manager at Oak Ridge Operations Office, helping small businesses learn how to work with the Department and access contract opportunities. Here, she joins Dot Harris (at podium) at a Small Business Summit in Oak Ridge this July. John Hale III John Hale III

372

NASA Ames Saves Energy and Reduces Project Costs with Non-Invasive Retrofit Technologies  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NASA Ames Saves Energy and Reduces Project Costs NASA Ames Saves Energy and Reduces Project Costs with Non-Invasive Retrofit Technologies The Wireless Pneumatic Thermostat Enables Energy Efficiency Strategies, Ongoing Commissioning and Improved Operational Control Harry Sim CEO Cypress Envirosystems harry.sim@cypressenvirosystems.com www.cypressenvirosystems.com NASA Ames Reduced Project Cost by Over 80% with Non-Invasive Retrofit Technologies * Legacy Pneumatic Thermostats  Waste energy  High maintenance costs  Uncomfortable occupants  No visibility * Project Scope  14 buildings  1,370 pneumatic thermostats  Integration with campus BAS  Diagnostics for ongoing commissioning * Traditional DDC Retrofit  Cost over $4.1 million  Asbestos exposure/abatement  Occupants significantly disrupted

373

40th Anniversary of Title IX | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

40th Anniversary of Title IX 40th Anniversary of Title IX 40th Anniversary of Title IX June 22, 2012 - 10:15am Addthis Dot Harris, Director of the Office of Economic Impact and Diversity (pictured in middle of photo) with a group of Girl Scouts and Girls Inc members during a mentoring session after the White House Title IX Anniversary celebration on Wednesday. Dot Harris, Director of the Office of Economic Impact and Diversity (pictured in middle of photo) with a group of Girl Scouts and Girls Inc members during a mentoring session after the White House Title IX Anniversary celebration on Wednesday. Editor's Note: This blog is authored by Valerie Jarrett, Senior Advisor and Assistant to the President for Intergovernmental Affairs and Public Engagement. This was originally posted on the White House blog.

374

OE Blog Archive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

August 27, 2012 August 27, 2012 Satellite image of Tropical Storm Isaac. | Courtesy of NOAA. UPDATE: Tropical Storm Isaac Information on customer power outages and other impacts on the energy sector as Tropical Storm Isaac develops. August 1, 2012 Dot Harris, Director of the Office of Economic Impact and Diversity, speaks about her engineering career to Native American students at the Intertribal Youth Summit on July 30. | Photo Credit: AnneMarie Ashburn, Department Of Energy. Native American Students in STEM Fields: A Critical Need for our Country The Office of Economic Impact and Diversity's Dot Harris recently met with youth from Tribal Nations around the U.S. to discuss the benefits of STEM education. July 26, 2012 The Department awardees are being recognized for their efforts in a variety of fields - from advances in power electronics for the electric grid to innovations in scientific computation to new physics developments. | Photo courtesy of Argonne National Laboratory.

375

National Air & Space Intelligence Center Holds Program About Empowering  

NLE Websites -- All DOE Office Websites (Extended Search)

National Air & Space Intelligence Center Holds Program About National Air & Space Intelligence Center Holds Program About Empowering Women in the Workplace National Air & Space Intelligence Center Holds Program About Empowering Women in the Workplace September 30, 2013 - 4:52pm Addthis Dot Harris, Director of the Office of Economic Impact and Diversity, speaks with Aurea Rivera, President and CEO of Imagineering Results Analysis Corp., Kathleen Tucker, Director of the Information Exploitation Squadron, Global Exploitation Intelligence Group, NAISC, and Ann Carbonell, Chief of the National Geospatial Intelligence Agency Support Team in September 2013. Photo by National Air and Space Intelligence Center. Dot Harris, Director of the Office of Economic Impact and Diversity, speaks with Aurea Rivera, President and CEO of Imagineering Results Analysis

376

Indian Energy Blog Archive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

October 22, 2012 October 22, 2012 Crow Nation Students Participate in Algae Biomass Research Project Student interns from the Crow Tribe in Montana participate in an algae biomass research project that could help prepare them for cleantech jobs and pave the way for their Tribe to produce clean, renewable energy. August 1, 2012 Dot Harris, Director of the Office of Economic Impact and Diversity, speaks about her engineering career to Native American students at the Intertribal Youth Summit on July 30. | Photo Credit: AnneMarie Ashburn, Department Of Energy. Native American Students in STEM Fields: A Critical Need for our Country The Office of Economic Impact and Diversity's Dot Harris recently met with youth from Tribal Nations around the U.S. to discuss the benefits of STEM

377

Sandia came into being as an  

NLE Websites -- All DOE Office Websites (Extended Search)

Sandia came into being as an Sandia came into being as an ordnance design, testing, and assembly facility, and was located on Sandia Base, in Albuquerque, New Mexico, to be close to an airfield and work closely with the military. Originally known as Z Division, part of what's now Los Alamos National Laboratory, Sandia was born out of America's atomic bomb development effort - the Manhattan Project. In 1949, President Harry S. Truman

378

Distinguished Teaching Award Recipients Academic Senate Winners Non-Academic Senate  

E-Print Network (OSTI)

and Bernard C. Stinner '55 '80P Edwin M. Undercuffler '55 '85P '02GP ++ G. Lunette and William J. Wessner, Jr. Belair '69 '13P ++ Jill S. and Steven L. Edwards '69 '01P '05P '07P ++ J. Spencer Ferebee, Jr. '69 '69 ++ Judith P. and Thomas S. Spencer '69 '75G '97P ++ Mary and Harry D. Tweedie, Jr. '69 '99P

Jalali. Bahram

379

2012h o n o r r o l l o f d o n o r s Photo credits  

E-Print Network (OSTI)

and Bernard C. Stinner '55 '80P Edwin M. Undercuffler '55 '85P '02GP ++ G. Lunette and William J. Wessner, Jr. Belair '69 '13P ++ Jill S. and Steven L. Edwards '69 '01P '05P '07P ++ J. Spencer Ferebee, Jr. '69 '69 ++ Judith P. and Thomas S. Spencer '69 '75G '97P ++ Mary and Harry D. Tweedie, Jr. '69 '99P

Bar, Moshe

380

ISET Journal of Earthquake Technology, Paper No. 458, Vol. 42, No. 4, December 2005, pp. 95-110 FLOOD ELEVATION, INUNDATION DISTANCE AND FLOW  

E-Print Network (OSTI)

Peterson*, Harry Yeh**, R.K. Chadha***, G. Latha**** and Toshitaka Katada***** *Portland State University level (swash zone) to establish maximum still-water height, which ranged from 2.3 to 4.4 m mean tide-to-moderate forcing, i.e, maximum still water 2-4 m MTL, in the low-relief settings of the South-East India coastal

Gupta, Vinay Kumar

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Annual Report 2009-2010  

E-Print Network (OSTI)

which make for a much more attractive and welcoming environment, especially on dark evenings. The scheme was devised by local sculptor, Harry Gray and a public unveiling was held in September 2009. In November Her Majesty The Queen sealed eight boxes... known as SMS Precis, produced by the School of Military Survey and covering such subjects as map compilation, field astronomy, lithographic processes and the use of oblique air photographs. Music ? Personal archive of musician, broadcaster...

Cambridge University Library

2013-09-26T23:59:59.000Z

382

The association between psychiatric diagnosis and violent re-offending in adult offenders in the community  

E-Print Network (OSTI)

. Langan P, Lewin D: Recidivism of prisoners released in 1994. Washington D.C.: Department of Justice; 2002. 3. Home Office: Probation Statistics England and Wales 2002. London: ONS; 2004. 4. Quincy V, Rice M, Harris G, Cormier C: Violent offenders... . Appraising and managing risk Washington, DC: American Psychological Associa- tion; 1998. 5. Webster C, Douglas K, Eaves D, Hart S: HCR-20: Assessing the risk for violence (Version 2) Vancouver, BC: Mental Health, Law, and Policy Institute, Simon Fraser...

Grann, Martin; Danesh, John; Fazel, Seena

2008-11-25T23:59:59.000Z

383

Urgent supplemental appropriation bill, 1980: Low-income energy assistance program. Hearings before a Subcommittee of the Committee on Appropriations, House of Representatives, Ninety-Sixth Congress, First Session  

SciTech Connect

Two supplemental budget requests are considered, for low-income full assistance programs. One totals $150 million which, if approved would remain in the Community Services Administration (CSA); the second totals $1.2 billion, which would be, if approved, transferred from CSA to HEW. Specific testimony is presented by Thomas P. O'Neill, Jr. House of Representatives; Patrica Roberts Harris, HEW; and Graciela Olivarez, Community Services Administration. Statements by many other interested members of Congress are presented. (MCW)

1979-01-01T23:59:59.000Z

384

Evaluation of the NeuStream-S Flue Gas Desulfurization Process  

Science Conference Proceedings (OSTI)

Harris Group Inc. (HGI) of Denver, Colorado, was contracted by the Electric Power Research Institute (EPRI) to monitor, evaluate, and prepare this report on a dual-alkali flue gas desulfurization (FGD) process developed by Neumann Systems Group, Inc. (NSG). The process is being demonstrated in a nominal 20-MW demonstration plant, treating a slip stream of flue gas from the Colorado Springs Utilities 142-MW Drake Unit 7. HGI evaluated performance, operability, and readiness for scale-up of the process. Co...

2011-05-31T23:59:59.000Z

385

Wilcox sandstone reservoirs in the deep subsurface along the Texas Gulf Coast - their potential for production of geopressured geothermal energy. Final report  

DOE Green Energy (OSTI)

The following subjects are included: regional setting, stratigraphic sections, Lower Wilcox sandstone distribution, formation pressure, formation temperature used to delineate geothermal fairways, Zapata Fairway, Duval Fairway, Live Oak Fairway, De Witt Fairway, Colorado Fairway, and Harris Fairway. Depositional and structural style, formation pressures and temperatures, porosity and permeability, formation water salinity, and Cuero Prospect are covered for De Witt Fairway. Depositional and structural style, formation and fluid properties, and Eagle Lake Prospect are covered for Colorado Fairway. (MHR)

Debout, D.G.; Weise, B.R.; Gregory, A.R.; Edwards, M.B.

1979-10-01T23:59:59.000Z

386

qryFairAct2000  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fair Act Inventory Data Fair Act Inventory Data OrgUnit State Location FTE Function Reason YrFirst Appeared RespName RespTitle RespPhone YrCostConv FTESav EstAnnCostSav PostMEODate The Secretary of Energy Advisory Board DC Forrestal 1.0 Y000 A 1999 Roscoe+Harris Management+Analyst 0 0 The Secretary of Energy Advisory Board DC Forrestal 1.0 Y000 B 1999 Roscoe+Harris Management+Analyst 0 0 The Secretary of Energy Advisory Board DC Forrestal 1.0 Y000 A 1999 Roscoe+Harris Management+Analyst 202-586-5527 Albuquerque Field Office NM Albuquerque 1.0 Y815 A 1999 John Jackson 505-845-5474 0 0 Albuquerque Field Office NM ALBUQUERQUE 1.0 U800 A 1999 John Jackson 505-845-5474 Albuquerque Field Office NM ALBUQUERQUE 1.0 U800 A 1999 John Jackson 505-845-5474 Albuquerque Field Office NM ALBUQUERQUE 3.0 U800 A 1999 John Jackson 505-845-5474 Albuquerque Field Office

387

Online Monitoring Technical Basis and Analysis Framework for Large Power Transformers; Interim Report for FY 2012  

SciTech Connect

The Light Water Reactor Sustainability program at Idaho National Laboratory (INL) is actively conducting research to develop and demonstrate online monitoring (OLM) capabilities for active components in existing Nuclear Power Plants. A pilot project is currently underway to apply OLM to Generator Step-Up Transformers (GSUs) and Emergency Diesel Generators (EDGs). INL and the Electric Power Research Institute (EPRI) are working jointly to implement the pilot project. The EPRI Fleet-Wide Prognostic and Health Management (FW-PHM) Software Suite will be used to implement monitoring in conjunction with utility partners: the Shearon Harris Nuclear Generating Station (owned by Duke Energy for GSUs, and Braidwood Generating Station (owned by Exelon Corporation) for EDGs. This report presents monitoring techniques, fault signatures, and diagnostic and prognostic models for GSUs. GSUs are main transformers that are directly connected to generators, stepping up the voltage from the generator output voltage to the highest transmission voltages for supplying electricity to the transmission grid. Technical experts from Shearon Harris are assisting INL and EPRI in identifying critical faults and defining fault signatures associated with each fault. The resulting diagnostic models will be implemented in the FW-PHM Software Suite and tested using data from Shearon-Harris. Parallel research on EDGs is being conducted, and will be reported in an interim report during the first quarter of fiscal year 2013.

Nancy J. Lybeck; Vivek Agarwal; Binh T. Pham; Heather D. Medema; Kirk Fitzgerald

2012-09-01T23:59:59.000Z

388

Report DRAFT: TESTS INDICATE OLIVE OIL LABELED AS EXTRA VIRGIN OFTEN FAILS INTERNATIONAL AND U.S. STANDARDS Microbiological Food Safety of Olive Oil: A Review of the Literature  

E-Print Network (OSTI)

Safety and Security at UC Davis. She works on various research and outreach projects, with an emphasis in tree nuts. She also coordinates with UC Food Safety and the Center for Produce Safety at UC Davis, including maintaining information on publications, outbreaks and recalls on the UC Food Safety website. Dr. Linda J. Harris Dr. Harris is a specialist in UC Cooperative Extension and the Associate Director of the Western Institute for Food Safety and Security at UC Davis. Dr. Harriss research focuses on microbial food safety,emphasizing the microbiology of fresh fruits and vegetables and tree nuts. She develops and validates standard microbiological methods and uses these methods to evaluate the behavior of food borne pathogens on fruits, vegetables and tree nuts under different storage and processing conditions. She uses these methods to evaluate antimicrobial treatments including various sanitizers and thermal processes for their efficacy in reducing microbial populations on various cut and intact produce and tree nut surfaces. She is the co-host of the UC Food Safety website. The UC Davis Olive Center is the only academic center of its kind in North America, a leader in education and research on olive growing and processing. Learn more at www.olivecenter.ucdavis.edu and on Facebook. CONTENTS

Mary Palumbo; Linda J. Harris

2011-01-01T23:59:59.000Z

389

Estimates of Energy Cost Savings Achieved from 2009 IECC Code-Compliant, Single Family Residences in Texas  

E-Print Network (OSTI)

This report presents estimates of the energy cost savings to be achieved from 2009 International Energy Conservation Code (IECC) code-compliant, single-family residences in Texas compared to the pre-2009 IECC codes, including: the 2001 IECC, the 2006 IECC, and the 2006 IECC w/ Houston amendments (w/ HA). A series of simulations were performed using an ESL simulation model (BDL version 4.01.07 of IC3) based on the DOE-2.1e simulation and the appropriate TMY2 weather files for three counties representing three 2009 IECC Climate Zones across Texas: Harris County for Climate Zone 2, Tarrant County for Climate Zone 3, and Potter County for Climate Zone 4. Two options based on the choice of heating fuel type were considered: (a) an electric/gas house (gas-fired furnace for space heating, and gas water heater for domestic water heating), and (b) a heat pump house (heat pump for space heating, and electric water heater for domestic water heating). The base-case building was assumed to be a 2,325 sq. ft., square-shape, one story, single-family, detached house with a floor-to-ceiling height of 8 feet. The house has an attic with a roof pitched at 23 degrees. The base-case building envelope and system characteristics were determined from the general characteristics and the climate-specific characteristics as specified in the 2001 IECC, the 2006 IECC, the 2006 IECC w/HA, and the 2009 IECC. In addition, to facilitate a better comparison with the 2009 code, several modifications were applied to the pre-2009 IECC codes. As a result, the estimated annual energy cost savings per house associated with the 2009 IECC compared to the 2001 and 2006 IECC are: (a) an electric/gas house: $462/year and $206/year for Harris County, $432/year and $216/year for Tarrant County, and $576/year and $153/year for Potter County and (b) a heat pump house: $490/year and $203/year for Harris County, $487/year and $226/year for Tarrant County, and $680/year and $155/year for Potter County. The corresponding % savings of total energy cost of a 2009 IECC code-compliant house are: (a) an electric/gas house: 22.7% and 10.1% for Harris County, 21.8% and 10.9% for Tarrant County, and 28.9% and 7.7% for Potter County and (b) a heat pump house: 21.6% and 8.9% for Harris County, 20.9% and 9.7% for Tarrant County, and 25.7% and 5.8% for Potter County.

Kim, H.; Baltazar, J. C.; Haberl, J.

2011-01-01T23:59:59.000Z

390

CHEMISTRY DEPARTMENT ORGANIZATION Nuclear & Particle Physics  

NLE Websites -- All DOE Office Websites (Extended Search)

CHEMISTRY DEPARTMENT ORGANIZATION CHEMISTRY DEPARTMENT ORGANIZATION Nuclear & Particle Physics Associate Laboratory Director Berndt Mueller Basic Energy Sciences (BES) Associate Laboratory Director James Misewich Financial Support Angela Wefer Department Chair Alexander L. Harris Gregory Hall, Deputy Chair Jean Petterson, Sr. Administrative Assistant Quality Assurance Rep. Charles Gortakowski *Assoc. Laser Safety Officer (Jack Preses) Berndt Mueller Training Coordinator/ Records Management (Linda Sallustio) Dept. Systems Support & Cyber Security POC Mahendra Kahanda Berndt Mueller Basic Energy Sciences (BES) Nuclear & Particle Physics Neutrino & Nuclear Chemistry Minfang Yeh Gas-Phase Molecular Dynamics Gregory Hall Electron and Photo-

391

Microsoft Word - EM QA Corporate Board Meeting Minutes - Dec 2013 (DRAFT)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

th th Environmental Management Quality Assurance Corporate Board Meeting Minutes December 02, 2013 - Nevada Site Office Page 1 of 10 Voting Board Members in Attendance: Greg Hayward - Idaho Jay Mullis- Oak Ridge Stacy Charboneau - Richland Charlie Harris - Savannah River Bud Danielson -Chief of Nuclear Safety Jack Craig - EMCBC Russell McCallister - Portsmouth/Paducah Jose Franco- Carlsbad Brian Harkins - River Protection Bob Murray (vice-chair) - Headquarters EM-43 Matt Moury (chair) - Headquarters EM-40 Introductions, Roll Call, and Status from Last Meeting - Matt Moury and Larry Perkins Matt Moury provided some introductions and welcomed everyone to the meeting.

392

Microsoft Word - DOE Ex Parte Memo - 09 02 Mtg-09.09.10.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 10, 2010 September 10, 2010 By e-mail to: expartecommunications@hq.doe.gov Daniel Cohen Assistant General Counsel for Legislation and Regulatory Law Office of the General Counsel Department of Energy 1000 Independence Avenue, SW Washington, DC 20585-0121 Re: Ex Parte Memorandum On September 2, 2010, the following participants held a meeting at the Department of Energy ("DOE"): Timothy Ballo and Emma Cheuse (Earthjustice); Kit Kennedy, Christine Chang, and Meg Waltner (Natural Resources Defense Council or "NRDC"); Cliff Majersik (Institute for Market Transformation or "IMT"). The following DOE staff were present in this meeting: General Counsel Scott Blake Harris, Daniel Cohen, Ami Grace-Tardy, and Bryan Miller

393

LMI | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

LMI LMI Energy Frontier Research Centers (EFRCs) EFRCs Home Centers Research Science Highlights News & Events Publications Contact BES Home Centers LMI Print Text Size: A A A RSS Feeds FeedbackShare Page Light-Material Interactions in Energy Conversion (LMI-EFRC) Director(s): Harry Atwater Lead Institution: California Institute of Technology Mission: To tailor the morphology, complex dielectric structure, and electronic properties of matter to sculpt the flow of sunlight, enabling light conversion to electrical and chemical energy with unprecedented efficiency. Research Topics: solar (photovoltaic), solid state lighting, phonons, thermal conductivity, electrodes - solar, materials and chemistry by design, optics, synthesis (novel materials), synthesis (self-assembly) Materials Studied:

394

PowerPoint Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

Budget and TYCP Process Budget and TYCP Process Discussion Bob Harris UGP Regional Manager and PM 1 Preliminary 10-Year Capital Budget/Funding Establish Programmatic Asset Management/Capital Funding Process Asset Management Customer Networking Sustainable Funding Discussion Utilize Programmatic Asset Management/Capital Funding AMPIP WESTERN'S ROADMAP ROBUST ASSET MANAGEMENT PROGRAM/WESTERN-WIDE CAPITAL BUDGET 2013 2014 NOV MAY ... ... ... 2 Rates Presentation Jack Murray DSW Rates Manager 3 P-DP Rate Discussion * Transmission rates experiencing long-term upward pressure. * Cost of rebuilding aging infrastructure a key component responsible for potential rate increases. * As additional plant completed and placed in service, annual costs to service debt increase,

395

Savannah River Site Salt Waste Processing Facility Technology Readiness Assessment Report  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Salt Waste Processing Facility Salt Waste Processing Facility Technology Readiness Assessment Report Kurt D. Gerdes Harry D. Harmon Herbert G. Sutter Major C. Thompson John R. Shultz Sahid C. Smith July 13, 2009 Prepared by the U.S. Department of Energy Washington, D.C. SRS Salt Waste Processing Facility Technology Readiness Assessment July 13, 2009 ii This page intentionally left blank SRS Salt Waste Processing Facility Technology Readiness Assessment July 13, 2009 iii SRS Salt Waste Processing Facility Technology Readiness Assessment July 13, 2009 iii Signatures SRS Salt Waste Processing Facility Technology Readiness Assessment July 13, 2009 iv This page intentionally left blank SRS Salt Waste Processing Facility

396

Property:Knows | Open Energy Information  

Open Energy Info (EERE)

Knows Knows Jump to: navigation, search This is a property of type Page. It is equivalent to the well-known foaf:knows property. Pages using the property "Knows" Showing 14 pages using this property. A Aaronbeach + Jweers + D Dbrodt + JZ +, GregZiebold +, Elainethale +, ... Dmulcahy + Ylin + G Graham7781 + GregZiebold +, JZ +, Jorn.Aabakken +, ... GregZiebold + Woodjr +, Twong +, Rgelman +, ... H Harris + DWC Bot + J JZ + GregZiebold +, Woodjr +, Dbrodt +, ... Jackie Lyndon + Meredith1219 +, Graham7781 + Jayhuggins + Rmckeel +, Jweers +, Dbrodt +, ... Jweers + Woodjr +, Twong +, Sadiecox +, ... M Meredith1219 + Graham7781 +, Jackie Lyndon + R Rmckeel + Woodjr +, Twong +, Rgelman +, ... T Twong + Dbrodt +, ElaineWood +, Graham7781 +, ...

397

Environmental Assessments (EA) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

November 4, 2011 November 4, 2011 EA-1905: Final Environmental Assessment Department of Energy Funding For Double Eagle Water System, Carlsbad, New Mexico (November 2011) November 1, 2011 EA-1866: Final Environmental Assessment and Finding of No Significant Impact Argonne National Laboratory Modernization Planning October 31, 2011 EA-1769: Final Environmental Assessment and Finding of No Significant Impact Houston Advanced Research Center, Battleground Energy Recovery Project, Deer Park, Harris County, Texas (October 2011) October 28, 2011 EA-1889: Draft Environmental Assessment Disposal of Decommissioned, Defueled Naval Reactor Plants from USS Enterprise (CVN 65) October 20, 2011 EA-1812: Draft Environmental Assessment Haxtun Wind Energy Project, Logan and Phillips Counties, Colorado

398

DocHdl1OnPPMSVRtmpTarget  

NLE Websites -- All DOE Office Websites (Extended Search)

SAVANNAH RIVER SITE SAVANNAH RIVER SITE ANNUAL ENVIRONMENTAL REPORT SUMMARY Savannah River Nuclear Solutions, LLC Savannah River Site Aiken, South Carolina 2 SAVANNAH RIVER SITE HISTORY/DESCRIPTION 1950 President Harry S. Truman asks DuPont to design, construct, and manage the Savannah River Plant 1953 First SRS Reactor goes critical 1954 First delivery of plutonium product 1972 Atomic Energy Commission designates SRS a National Environmental Research Park 1988 All production reactors shut down 1989 SRS placed on the National Priorities List, becomes regulated by the Environmental Protection Agency; Savannah River Plant becomes Savannah River Site, reflecting mission change 1991 End of Cold War 1996 The Defense Waste Processing Facility

399

07-26-2012_Kathleen_Hogan_FT  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WRITTEN STATEMENT OF DR. KATHLEEN HOGAN DEPUTY ASSISTANT SECRETARY FOR ENERGY EFFICIENCY OFFICE OF ENERGY EFFICIENCY & RENEWABLE ENERGY U.S. DEPARTMENT OF ENERGY BEFORE THE SUBCOMMITTEE ON ENERGY & THE ENVIRONMENT COMMITTEE ON SCIENCE, SPACE, AND TECHNOLOGY UNITED STATES HOUSE OF REPRESENTATIVES JULY 26, 2012 2 Chairman Harris, Ranking Member Miller, and Members of the Subcommittee, thank you for the opportunity to discuss the Department of Energy's (DOE's) transportation portfolio-specifically the Vehicle Technologies Program (VTP). As part of the President's sustained, all-of-the-above approach to American energy, the Department is working to develop advanced vehicle technologies that can secure our energy future.

400

Development of Aerosol Models for Radiative Flux Calculations at ARM Sites: Utility of Trajectory Clustering for Characterizing Aerosol Climatology  

NLE Websites -- All DOE Office Websites (Extended Search)

Development of Aerosol Models for Radiative Flux Development of Aerosol Models for Radiative Flux Calculations at ARM Sites: Utility of Trajectory Clustering for Characterizing Aerosol Climatology E. Andrews Cooperative Institute for Research in the Environment University of Colorado Boulder, Colorado E. Andrews, J. A. Ogren, P. J. Sheridan, and J. M. Harris Climate Monitoring and Diagnostics Laboratory National Oceanic and Atmospheric Administration Boulder, Colorado P. K. Quinn Pacific Marine Environmental Laboratory National Oceanic and Atmospheric Administration Seattle, Washington Abstract The uncertainties associated with assumptions of generic aerosol properties in radiative transfer codes are unknown, which means that these uncertainties are frequently invoked when models and

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Manufacturing Science and Technology: Organizations  

NLE Websites -- All DOE Office Websites (Extended Search)

Machining Operations Machining Operations Machining Services Electronic Fabrication Manufacturing Process Science & Technology Thin Film, Vacuum, & Packaging Organic Materials Ceramic & Glass Meso Manufacturing & Systems Development Visiting Us AMTTP Center Organizational chart Organizations Our Business areas Manufacturing Science and Technology David Plummer, Director Manufacturing Enterprise Joe M. Harris, Senior Manager Machining Operations Mathew Donnelly, Manager Machining Services Daryl Reckaway, Acting Manager Electronic Fabrication Phillip L. Gallegos, Manager Manufacturing Process Science and Technology Mark F. Smith, Senior Manager Thin Film, Vacuum, and Packaging Mark F. Smith, Acting Manager Organic Materials Mike Kelly, Manager Ceramic and Glass Alex Roesler, Manager

402

Photo of the Week: Acoustic Levitation for Medicine | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Acoustic Levitation for Medicine Acoustic Levitation for Medicine Photo of the Week: Acoustic Levitation for Medicine October 19, 2012 - 2:08pm Addthis This acoustic levitator was originally developed to help NASA simulate microgravity conditions, but now, scientists are using this piece of equipment to study pharmaceutical solutions at the molecular level. At Argonne National Laboratory, droplets are suspended in air between two sets of speakers, which generate sound waves at frequencies slightly above the audible range -- about 22 kilohertz. Learn more about how acoustic levitation is performed and how it helps scientists study pharmaceuticals here. | Photo by Dan Harris, Argonne National Laboratory.

403

Small Column Ion Exchange at Savannah River Site Technology Readiness Assessment Report  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Small Column Ion Exchange Technology at Small Column Ion Exchange Technology at Savannah River Site U.S. Department of Energy Office of Environmental Management Office of Technology Innovation and Development Technology Readiness Assessment Report November 2011 U.S. DOE-EM Office of Technology Innovation and Development November 11, 2011 Small Column Ion Exchange Program Technology Readiness Assessment Page 2 of 112 This page intentionally left blank November 11, 2011 U.S. DOE-EM Office of Technology Innovation and Development Small Column Ion Exchange Program Technology Readiness Assessment Page 3 of 112 APPROVALS ________________________ _ Harry D. Harmon Date

404

Berkeley Lab Earth Sciences Division - Departments - Ecology  

NLE Websites -- All DOE Office Websites (Extended Search)

departments > ecology departments > ecology Ecology Department Core Capabilities Advanced Technology Bioenergy Biofuels Human Health Soil Systems Water Resources People Facilities, Centers & Labs Publications Ecology Department Principal Investigators Gary Andersen Harry Beller Nicholas Bouskill Eoin Brodie Romy Chakraborty Eric Dubinsky Hoi-Ying Holman Christer Jansson Janet Jansson Nigel Quinn Tamas Torok Ecology Department Ecology Department Ecology Department Ecology Department Ecology Department Ecology Department Ecology Department Ecology Department Ecology Department Ecology Department Ecology Department Historical Background ecology comic In 1995 the Center for Environmental Biotechnology was set up as a multidivisonal center under the direction of Dr. Jennie Hunter-Cevera. In 1998, the Ecology Department was created within the Earth Sciences

405

Microsoft Word - 10-13-11 Final Testimony _Klara_.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

National Energy Technology Laboratory Office of Fossil Energy U.S. Department of Energy Before the Subcommittee on Energy and Environment Committee on Science, Space and Technology U.S. House of Representatives Coal Research and Development October 13, 2011 Thank you Chairman Harris and members of the Subcommittee; I appreciate the opportunity to discuss the Department of Energy's (DOE) coal research & development activities. Interagency Task Force on Carbon Capture and Storage Before I discuss the Department's Clean Coal Research Program, I will briefly review the conclusions from the Interagency Task Force on Carbon Capture & Storage (CCS). In August 2010, the final report from the Task Force was issued summarizing the Administration's efforts

406

Microsoft PowerPoint - D-R ASME-IGTI-DOE CO2 5-15-07.pps  

NLE Websites -- All DOE Office Websites (Extended Search)

Compression Compression Carbon Dioxide Compression Harry Miller, Product Manager - Marketing ASME - IGTI Turbo Expo May 15, 2007 © Copyright 2006 Safe Harbor Disclosure Safe Harbor Disclosure Some of the information contained in this document contains "forward-looking statements". In many cases, you can identify forward-looking statements by terminology such as "may," "will," "should," "expects," "plans," "anticipates," "believes," "estimates," "predicts," "potential," or "continue," or the negative of such terms and other comparable terminology. These forward-looking statements are only predictions and as such inherently included risks and uncertainties. Actual events or results may differ materially as

407

Meeting Minutes  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

th Environmental Management Quality Assurance Corporate Board Meeting Minutes May 1, 2012 - Las Vegas, NV Page 1 of 9 Voting Board Members in Attendance: Randy Kay - Idaho Jason Armstrong - Oak Ridge Ray Corey - Richland Charles Harris - Savannah River Bud Danielson -Chief of Nuclear Safety Jack Craig - EMCBC Matt Moury (chair) - Headquarters EM-40 Jack Zimmerman - Portsmouth/Paducah Bob Murray (vice-chair) - Headquarters EM-43 Courtland Fesmire - Carlsbad Walter Scott - River Protection Introductions Bob Murray noted he would like to start a periodical QA managers call with the sites. This would be to share Lessons Learned and group discussion and not HQ leading the discussions.

408

2012 CERTS R&M Peer Review - Transmission Investment Assessment Under Uncertainty - Ben Hobbs  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Transmission Transmission Investments Under Uncertainty & Transmission Investments Under Uncertainty & High Renewable Penetration: Representing Market Response using a Multi-stage Stochastic Model Approach with Recourse Model Approach with Recourse Benjamin F. Hobbs & Francisco Munoz Geography & Environmental Engineering Applied Math & Stat Geography & Environmental Engineering, Applied Math & Stat. Environment, Energy, Sustainability & Health Institute The Johns Hopkins University Richard E Schuler Richard E. Schuler Civil & Environmental Engineering, and Economics Cornell University August 2, 2011 Thanks to Saamrat Kasina and Harry van der Weijde for their assistance, and DOE CERTS for funding and DOE CERTS for funding O i Overview 1. The problem 1. The problem

409

Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Uranium Processing Facility Uranium Processing Facility Harry E. Peters Y-12 Site Office Federal Project Director Uranium Processing Facility Project February 8, 2012 APPROVED FOR PUBLIC RELEASE This document has been approved for release to the public by: /s/ Scott A. Hawks 2/9/12 YSO Classification Officer Date The Nation's EU Processing Facility Mission: Ensuring the Nation's enriched uranium processing is secure, safe, and efficient. UPF-Key to Y-12 Transformation Today Future * 9212 is past end-of-life * Existing EU facilities don't meet modern nuclear safety or security standards

410

Conservation Standards Enforcement | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Conservation Standards Enforcement Conservation Standards Enforcement Conservation Standards Enforcement The Office of the General Counsel is working to ensure that manufacturers of consumer products and commercial equipment meet the nation's conservation standards. Through its new focus on enforcement, the Department of Energy will save money for consumers and reduce greenhouse gas emissions. "For the sake of our environment and our economy, it's critical that we enforce our energy efficiency regulations," said Scott Blake Harris, former DOE General Counsel. "Strong enforcement of the rules will encourage compliance and keep manufacturers who break the law from having a competitive advantage over manufacturers who play by the rules." DOE enforces the energy and water conservation standards

411

"1. Browns Ferry","Nuclear","Tennessee Valley Authority",3309  

U.S. Energy Information Administration (EIA) Indexed Site

Alabama" Alabama" "1. Browns Ferry","Nuclear","Tennessee Valley Authority",3309 "2. James H Miller Jr","Coal","Alabama Power Co",2675 "3. Barry","Coal","Alabama Power Co",2575 "4. E C Gaston","Coal","Alabama Power Co",1878 "5. H Allen Franklin Combined Cycle","Gas","Southern Power Co",1815 "6. Joseph M Farley","Nuclear","Alabama Power Co",1734 "7. Widows Creek","Coal","Tennessee Valley Authority",1604 "8. Colbert","Coal","Tennessee Valley Authority",1574 "9. E B Harris Electric Generating Plant","Gas","Southern Power Co",1269

412

Samnites, Ligurians and Romans revisited  

E-Print Network (OSTI)

specifically, these techniques have quite rightly, it should be emphasised been institutionalised, within cultural heritage legislation (precautionary inspection of archaeological interest: Legge 25 giugno 2005, n. 109 art. 2-ter e ss.) and has become... nel Sannio, p. 452-3 in that volume. 41 Liv. Per. 20. For the conflict between Romans and Ligurians, see (in addition to the works cited in n. 1 on p. 42/134): W.V. Harris, War and imperialism in Republican Rome, 327-70 BC (Oxford, 1979), p. 225-7; S...

Patterson, John Robert

2013-10-29T23:59:59.000Z

413

Detecting exotic heavy leptons at the large hadron collider.  

E-Print Network (OSTI)

ar X iv :h ep -p h/ 01 08 09 7v 1 1 0 A ug 2 00 1 Preprint typeset in JHEP style. - HYPER VERSION Cavendish-HEP-01/10 DAMTP-2001-71 CERN-TH/2001-205 Detecting Exotic Heavy Leptons at the Large Hadron Collider B.C. Allanach?, C.M. Harris, M... , CB3 0WA, UK. Abstract: New almost-degenerate charged and neutral heavy leptons are a feature of a number of theories of physics beyond the Standard Model. The prospects for detecting these at the Large Hadron Collider using a time-of-flight technique...

Allanach, B C; Harris, Chris M; Parker, Michael A; Richardson, P; Webber, Bryan R

414

Black holes at accelerators.  

E-Print Network (OSTI)

collision of high-energy particles, Phys. Rev. D 67, 024009 (2003) [arXiv:gr-qc/0209003]. [6] D. M. Eardley and S. B. Giddings, Classical black hole production in high-energy collisions, Phys. Rev. D 66, 044011 (2002) [arXiv:gr-qc/0201034]. [7] H. Yoshino... about black hole formation in high-energy collisions, Class. Quant. Grav. 22, L61 (2005) [arXiv:hep-ph/0505125]. [16] G. T. Horowitz, Higher dimensional generalizations of the Kerr black hole, arXiv:gr-qc/0507080. [17] C. M. Harris and P. Kanti...

Webber, Bryan R

415

Analysis of Well ER-6-2 Testing, Yucca Flat FY 2004 Testing Program, Nevada Test Site, Nye County, Nevada, Rev. No.: 0  

SciTech Connect

This report documents the analysis of data collected for Well ER-6-2 during fiscal year (FY) 2004 Yucca Flat well development and testing program (herein referred to as the ''testing program''). Participants in Well ER-6-2 field development and hydraulic testing activities were: Stoller-Navarro Joint Venture (SNJV), Bechtel Nevada (BN), Desert Research Institute (DRI), Los Alamos National Laboratory (LANL), Lawrence Livermore National Laboratory (LLNL), U.S. Geological Survey (USGS), and the University of Nevada, Las Vegas-Harry Reid Center (UNLV-HRC). The analyses of data collected from the Well ER-6-2 testing program were performed by the SNJV.

Greg Ruskauff

2005-07-01T23:59:59.000Z

416

Macroeconomic policy, investment, and urban unemployment in less-developed countries  

SciTech Connect

The two-sector Harris-Todaro model, extended to include a government sector and aggregate demand, is used to analyze the effects on output, prices, and employment of policies designed to mitigate urban unemployment. An increase in aggregate demand will be inflationary even though output will increase. Government job creation will be inflationary, will stimulate manufacturing output, but may result in a decrease in agricultural output. Investment in agriculture will increase agricultural output, decrease manufacturing output, and decrease price level. Investment in manufacturing results in an increase in manufacturing output, and agricultural output and employment will decline and prices will fall. 16 references.

Haessel, W.

1978-02-01T23:59:59.000Z

417

Bulls, Bears and Excess Volatility: can currency intervention help?  

E-Print Network (OSTI)

, in G.M. Constantinides, M. Harris and R. Stulz (eds), Handbook of the Eco- nomics of Finance, Elsevier Science. [4] Bergsten, C. F. (1997), The Dollar and the Euro , Foreign Affairs, 76(40), 83-93. [5] Corrado, L., Miller, M. H. and L. Zhang (2002... ): Exchange Rate Monitoring Band: Theory and Policy, CEPR DP 3337. [6] Corsetti G., A. Dasgupta, S. Morris and H. S. Shin (2004), Does One Soros Make a Difference? A Theory of Currency Crises with Large and Small Traders, Review of Economic Studies, 71...

Corrado, Luisa; Miller, Marcus; Zhang, Lei

418

Acquisition and registration of aerial video imagery of urban traffic  

SciTech Connect

The amount of information available about urban traffic from aerial video imagery is extremely high. Here we discuss the collection of such video imagery from a helicopter platform with a low-cost sensor, and the post-processing used to correct radial distortion in the data and register it. The radial distortion correction is accomplished using a Harris model. The registration is implemented in a two-step process, using a globally applied polyprojective correction model followed by a fine scale local displacement field adjustment. The resulting cleaned-up data is sufficiently well-registered to allow subsequent straight-forward vehicle tracking.

Loveland, Rohan C [Los Alamos National Laboratory

2008-01-01T23:59:59.000Z

419

The M-sigma Relation for Nucleated Galaxies  

E-Print Network (OSTI)

Momentum feedback from super-Eddington accretion offers a simple explanation for the observed M-sigma and M-M_{spheroid} relations between supermassive black holes (SMBH) and the spheroids of their host galaxies. Recently Ferrarese et al. and Wehner & Harris observed analogous relations between the masses of central star clusters and their hosts. We show that stellar winds and supernovae from such nuclear clusters (NC) give similar feedback explanations for this case also, and we discuss the connection to the Faber-Jackson relation for the spheroids themselves.

Dean E. McLaughlin; Andrew R. King; Sergei Nayakshin

2006-08-24T23:59:59.000Z

420

Microsoft Word - Coverpage.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Securing Cyberspace Securing Cyberspace for the 44 th Presidency A Report of the CSIS Commission on Cybersecurity for the 44 th Presidency Cochairs: Representative James R. Langevin Representative Michael T. McCaul Scott Charney Lt. General Harry Raduege, USAF (Ret) Project Director: James A. Lewis Center for Strategic and International Studies Washington, DC December 2008 About CSIS In an era of ever-changing global opportunities and challenges, the Center for Strategic and International Studies (CSIS) provides strategic insights and practical policy solutions to decisionmakers. CSIS conducts research and analysis and develops policy initiatives that look into the future and anticipate change. Founded by David M. Abshire and Admiral Arleigh Burke at

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Microsoft Word - 062910rndtble.doe.wd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Executive Court Reporters Executive Court Reporters (301) 565-0064 1 UNITED STATES OF AMERICA DEPARTMENT OF ENERGY PUBLIC ROUNDTABLE DATA ACCESS AND PRIVACY ISSUES RELATED TO SMART GRID TECHNOLOGIES U.S. Department of Energy Forrestal Building Independence Avenue, SW Washington, DC 20585 Room SE-069 Tuesday June 29, 2010 Moderator: Scott Blake Harris General Counsel Department of Energy Co-Moderator: Phil Weiser Senior Advisor for Technology and Innovation To the Director National Economic Council Executive Court Reporters (301) 565-0064 2 PANELISTS: David Szczupak Executive Vice President Global Product Organization Whirlpool Corporation Robert Rowe President and CEO Northwestern Energy Michael Goodroe President and CEO

422

Texas Bentonites as Amendments of Aflatoxin-Contaminated Poultry Feed  

E-Print Network (OSTI)

Aflatoxins are toxic organic compounds produced by fungi in grains. Moderately contaminated grains that cannot be used as food are often directed to animal feed. Economically-feasible detoxification measures for contaminated feeds are needed. The objectives of this research were to identify effective bentonites as aflatoxin adsorbents and to evaluate the performance of the clays as aflatoxin amendments in feed for broiler chickens. Five bentonite samples from Gonzales, Texas, USA were collected and analyzed against the published selection criteria for aflatoxin adsorbents: aflatoxin adsorption capacity, pH, cation exchange capacity (CEC), organic carbon, particle size distribution, and mineralogical and structural compositions. Two bentonites were identified as potentially good aflatoxin adsorbents based on the analyses. These two bentonites were selected for an in vivo poultry experiment where chickens were fed with aflatoxin-contaminated corn (1400 ppb) to test the detoxification efficacy of the clays. Detailed mineralogy analyses were conducted on these two samples (4TX and 1TX) after size fractionation. Clay 4TX and 1TX contained 87 percent and 65 percent clay, respectively. Smectite was the dominant mineral phase in both clay fractions. Quartz and feldspars were also present in both samples. These minerals are unlikely to cause harmful effects on the chickens. The presence of pyrite and heavy metals in 1TX raised concerns about its use in animal feed. The clays were introduced into feed by mixing the dry bentonite powder with the feed for twelve minutes in a mechanical mixer. The body weight was increased by 21 percent with clay 4TX and 14 percent with clay 1TX in the aflatoxin diet. The concentration of total aflatoxins in liver was reduced by 36 percent with the addition of clays. Liver visual appearance was also improved from pale red to a more reddish color resembling the healthy red liver. All chickens fed clean feed had significantly higher body weights than those fed with highly contaminated feed, suggesting that the clays did not completely eliminate aflatoxin toxicity. The published aflatoxin binder selection criteria were useful for screening bentonites as aflatoxin amendments. The selected bentonites based on the criteria could effectively sequester aflatoxins in vivo. Yet direct mixing of bentonite as dry powder to highly contaminated poultry feed could not eliminate the toxicity of aflatoxins.

Barrientos Velazquez, Ana Luisa

2011-05-01T23:59:59.000Z

423

Impacts of Sedimentation from Oil and Gas Development on Stream Macroinvertebrates in Two Adjacent Watersheds of the Allegheny National Forest of Northwestern Pennsylvania  

SciTech Connect

Fritz, Kelley'*, Steven Harris', Harry Edenborn2, and James Sams2. 'Clarion University of Pennsylvania, Clarion, PA 16214, 2National Energy Technology Laboratory, U.S. Dept. Energy, Pittsburgh, PA 15236. Impacts a/Sedimentation/rom Oil and Gas Development on Stream Macroinvertebrates in Two Adjacent Watersheds a/the Allegheny National Forest a/Northwestern Pennsylvania - The Allegheny National Forest (ANF), located in northwestern Pennsy Ivania, is a multiuse forest combining commercial development with recreational and conservation activities. As such, portions of the ANF have been heavily logged and are now the subject of widespread oil and gas development. This rapid increase in oil and gas development has led to concerns about sediment runoff from the dirt and gravel roads associated with development and the potential impact on the aquatic biota of the receiving streams. We examined and compared the benthic macroinvertebrate communities in two adjacent watersheds of similar size and topography in the ANF; the Hedgehog Run watershed has no oil and gas development, while the adjacent Grunder Run watershed has extensive oil and gas development. In Hedgehog and Grunder Run, we collected monthly kicknet samples from riffles and glides at two sites from April to October 2010. At the same intervals, we measured standard water quality parameters, including conductivity and turbidity. Preliminary results have indicated much higher turbidity in Grunder Run, but little difference in the diversity and abundance of benthic macro invertebrates inhabiting the two streams.

Fritz, K.; Harris, S.; Edenborn, H.M.; Sams, J.

2011-01-01T23:59:59.000Z

424

Color-Magnitude Relations within Globular Cluster Systems of Giant Elliptical Galaxies: The Effects of Globular Cluster Mass Loss and the Stellar Initial Mass Function  

E-Print Network (OSTI)

Several recent studies have provided evidence for a `bottom-heavy' stellar initial mass function (IMF) in massive elliptical galaxies. Here we investigate the influence of the IMF shape on the recently discovered color-magnitude relation (CMR) among globular clusters (GCs) in such galaxies. To this end we use calculations of GC mass loss due to stellar and dynamical evolution to evaluate (i) the shapes of stellar mass functions in GCs after 12 Gyr of evolution as a function of current GC mass along with their effects on integrated-light colors and mass-to-light ratios, and (ii) their impact on the effects of GC self-enrichment using the 2009 `reference' model of Bailin & Harris. As to the class of metal-poor GCs, we find the observed shape of the CMR (often referred to as the `blue tilt') to be very well reproduced by Bailin & Harris' reference self-enrichment model once 12 Gyr of GC mass loss is taken into account. The influence of the IMF on this result is found to be insignificant. However, we find...

Goudfrooij, Paul

2013-01-01T23:59:59.000Z

425

Understanding the Role of Thiolate Ligation in Nature's Hydroxylating Heme  

NLE Websites -- All DOE Office Websites (Extended Search)

Michael T. Green1, John H. Dawson2, Harry B. Gray3 Michael T. Green1, John H. Dawson2, Harry B. Gray3 1Department of Chemistry, The Pennsylvania State University, PA 16802 2Department of Chemistry and Biochemistry, The University of South Carolina, SC 29208 3Beckman Institute, California Institute of Technology, Pasadena, CA 91125 Cytochromes P450 are thiolate-ligated heme enzymes that play critical roles in a number of important physiological processes. P450s are involved in the metabolism of carcinogens and pesticides and in the production of glucocorticoids and sex hormones. Defects in these enzymes have been associated with disease states, such as glaucoma, congenital adrenal hyperplasia, psuedovitamin D-deficiency rickets, and Parkinson's. Interest in P450s stems not only from their obvious biological importance but also from a desire to harness their synthetic potential. P450s catalyze the hydroxylation of organic substrates, often with high degrees of regio and stereo selectivity. When uncatalyzed, these reactions require extremely high temperatures to proceed even non-specifically. A recent x-ray absorption study performed at SSRL, hints at what allows the enzymes to perform these demanding reactions without destroying themselves.

426

Manhattan Project: Potsdam and the Final Decision to Use the Bomb, July  

Office of Scientific and Technical Information (OSTI)

Joseph Stalin, Harry Truman, and Winston Churchill at the Potsdam Conference, July 1945 POTSDAM AND THE FINAL DECISION TO USE THE BOMB Joseph Stalin, Harry Truman, and Winston Churchill at the Potsdam Conference, July 1945 POTSDAM AND THE FINAL DECISION TO USE THE BOMB (Potsdam, Germany, July 1945) Events > Dawn of the Atomic Era, 1945 The War Enters Its Final Phase, 1945 Debate Over How to Use the Bomb, Late Spring 1945 The Trinity Test, July 16, 1945 Safety and the Trinity Test, July 1945 Evaluations of Trinity, July 1945 Potsdam and the Final Decision to Bomb, July 1945 The Atomic Bombing of Hiroshima, August 6, 1945 The Atomic Bombing of Nagasaki, August 9, 1945 Japan Surrenders, August 10-15, 1945 The Manhattan Project and the Second World War, 1939-1945 Potsdam, July 19, 1945. Truman wrote a note on the back of the photograph in which he states incorrectly that Stalin did not know about the atomic bomb. After President Harry S. Truman received word of the success of the Trinity test, his need for the help of the Soviet Union in the war against Japan was greatly diminished. The Soviet leader, Joseph Stalin, had promised to join the war against Japan by August 15th. Truman and his advisors now were not sure they wanted this help. If use of the atomic bomb made victory possible without an invasion, then accepting Soviet help would only invite them into the discussions regarding the postwar fate of Japan. During the second week of Allied deliberations at Potsdam, on the evening of July 24, 1945, Truman approached Stalin without an interpreter and, as casually as he could, told him that the United States had a "new weapon of unusual destructive force." Stalin showed little interest, replying only that he hoped the United States would make "good use of it against the Japanese." The reason for Stalin's composure became clear later: Soviet intelligence had been receiving information about the atomic bomb program since fall 1941.

427

201117686 6537..6542  

NLE Websites -- All DOE Office Websites (Extended Search)

Introducing Introducing endo-xylanase activity into an exo-acting arabinofuranosidase that targets side chains Lauren S. McKee a,b , Maria J. Peña b , Artur Rogowski a , Adam Jackson a , Richard J. Lewis a , William S. York b , Kristian B. R. M. Krogh c , Anders Viksø-Nielsen c , Michael Skjøt c , Harry J. Gilbert a,b,1 , and Jon Marles-Wright a a Institute for Cell and Molecular Biosciences, Newcastle University, The Medical School, Newcastle upon Tyne NE2 4HH, United Kingdom; b The Complex Carbohydrate Research Center, University of Georgia, 315 Riverbend Road, Athens, GA 30602; and c Novozymes A/S, Krogshoejvej 36, 2880 Bagsvaerd, Denmark Edited by Arnold L. Demain, Drew University, Madison, NJ, and approved February 9, 2012 (received for review October 28, 2011) The degradation of the plant cell wall by glycoside hydrolases is central to environmentally sustainable industries. The major

428

LANL Mobile News  

NLE Websites -- All DOE Office Websites (Extended Search)

Reliability Technology earns prestigious Los Alamos award Reliability Technology earns prestigious Los Alamos award LANL has honored Michael Hamada, Harry Martz and a team of researchers with its first Richard Feynman Prize for Innovation Achievement.08/27/13 New gamma-ray observatory begins operations at Sierra Negra volcano in the state of Puebla, Mexico The High-Altitude Water Cherenkov Gamma Ray Observatory has begun formal operations at its site in Mexico.08/21/13 Meltwater effects on flow of Greenland's ice sheet less severe for sea level rise than earlier feared, scientists say The team found that accelerating ice sheet movement from increasing meltwater lubrication is likely to have only a minor role in future sea-level rise.08/19/13 Little Boy weaponeer William "Deak" Parsons, wartime Los Alamos

429

Staff and Contractors Blog Archive | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Staff and Contractors Staff and Contractors Blog Archive Staff and Contractors Blog Archive RSS April 3, 2013 Save the date for the Asian Pacific American Heritage Month Family Day at the Smithsonian! This year it will be at the National Museum of American History on Saturday, May 4, 2013. More details to come. 2013 Asian American & Pacific Islander Heritage Month Resources and Theme Editor's Note: This information is provided by the White House Initiative on Asian Americans and Pacific Islanders. February 19, 2013 Director Dot Harris presents Chris Smith, Principal Deputy Assistant Secretary and Acting Assistant Secretary of Fossil Energy, with a professional achievement award at the Black Engineer of the Year Awards conference this February. Photo Credit: Nancy Jo Brown/106FOTO

430

By Leila Belkora, Office of Public Affairs  

NLE Websites -- All DOE Office Websites (Extended Search)

Leila Belkora, Leila Belkora, Office of Public Affairs I want to complete some analysis on DZero's Run Ib data and prepare for Run II. Right now I'm at the begin- ning of multiple analyses, and I'm eager to see where they lead. -Harry Melanson, Research Division DZero Collaborator I want to get the fixed-target pro- gram going. It's been four years since we shut down in 1992. It's time to run again. My own experiment is one of those getting ready to run. In the first half of 1996, I'll work to get it installed, and in the last half of the year, hopefully I'll be running it. -Peter Garbincius, Research Division Fixed-Target Run Coordinator Volume 19 FRIDAY, JANUARY 19, 1996 Number 2 I n s i d e f ACCELERATOR ARCHAEOLOGY . . . . . . . . .2 FESS KEEPS DATA FLOWING . . . . . . . . . . . . . . .4

431

 

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

B1.2 Training exercises and simulation B1.2 Training exercises and simulation Energy Efficiency and Conservation Strategy Meetings and Employee Education Initiatives Purpose: The purpose of the Energy Efficiency and Conservation Strategy meetings are to develop a comprehensive plan for energy based on the needs of all units within the City. Description: The EECS meetings will include members of the executive team and senior level staff. The EECS members include: Dr. Larry Sullivan, CEO/City Manager, Charlie Bassett, Finance Director, Craig Lindholm, Community Redevelopment and Grants, Shirley Jaster, Community Development and Planning, Jerry Sparks, Economic Development Director, Dan Shiner, Chief of Police, Harry Simms, Fire Chief, Rose Stewart, Human Resources Director, Kerry Meredith, City Secretary, Vicki Melde, Public Relations Coordinator, Bill King, Texarkana Water Utilities, and

432

EIS-0443: Record of Decision | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3: Record of Decision 3: Record of Decision EIS-0443: Record of Decision Project Financing for Southwest Intertie Project - South The U.S. Department of Energy (DOE), Western Area Power Administration, is considering whether to provide partial financing of the southern portion of the Southwest lntertie Project (SWIP-South) which consists of approximately 235 miles of 500- kilovolt (kV) transmission line. SWIP-South would extend from Harry Allen substation near Las Vegas, Nevada northward to the proposed Thirtymile Substation near Ely, Nevada. Partial financing of SWlP-South is being considered under the provisions of Western's Transmission Infrastructure Program. Final Environmental Impact Statement Project Financing for Southwest Intertie Project - South, DOE/EIS-0443 (January 2010)

433

Pacific Northwest Site Office P.O. BOX 350, Kg-42  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pacific Northwest Site Office Pacific Northwest Site Office P.O. BOX 350, Kg-42 Richland, Washington 99352 JAN 1 8 2019 MEMORANDUM FOR SCOTT B. HARRIS, GENERAL COUNSEL OFFICE OF GENERAL COUNSEL FROM: SUBJECT: GC- I , HQ JULIE K. ERlCKSON PACIFIC NORTHWEST SITE OFFICE 20 1 1 ANNUAL NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) PLANNING SUMMARY DOE 0 45 1.1B requires Secretarial Officers and Heads of Field Organizations to submit a Annual NEPA Planning Summary to the Office of General Counsel. We have consulted your December 8,201 0, memorandum, and guidance posted on the Office of NEPA Policy and Compliailce (GC-54) web site, and have no NEPA activities to report. If you have any questions, please contact me, or your staff may contact Theresa Aldridge, Operations Division, at (509) 372-4508, or Peter Siebach, Integrated Support Center - Chicago

434

Information Request Yucca Mountain Site  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

, 2008 , 2008 TO: Sue Tierney, Phil Niedzielski-Eichner, Skila Harris FROM: Chris Kouts SUBJECT: Information Request As requested, enclosed is the additional information you requested last week regarding use of engineered barriers. Please let me know if you need additional information or have any questions. A,4- -/0 7 The Suitability of the Yucca Mountain Site and the Issue of Natural Barriers as the Principal Barriers for Demonstrating Safety This paper addresses two issues that are frequently raised concerning the suitability of the Yucca Mountain site for development as a repository. The first issue is that the Yucca Mountain site is technically unsound and that an engineered barrier system is required because the site is not capable of protecting public health and safety. The second issue is

435

CX-003027: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

27: Categorical Exclusion Determination 27: Categorical Exclusion Determination CX-003027: Categorical Exclusion Determination The Replacement of PacifiCorp's Kennewick - Dayton Hilltop Microwave Communication Equipment CX(s) Applied: B1.7, B4.6 Date: 06/22/2010 Location(s): Benton County, Washington Office(s): Bonneville Power Administration The single channel radio hop between the Bonneville Power Administration (BPA)-owned Kennewick Radio Station and PacifiCorp-owned Dayton Radio Station would be replaced by PacifiCorp with a 28 DS1 digital radio system. The path length is 62 miles, requiring a space diversity system to be installed. The radio at Dayton would be a Harris Constellation terminal, installed in rack D2 underneath the Hinkle Truepoint Radio. At Kennewick the main and diversity antennas would be Andrew UHX8-65, mounted on the BPA

436

DOE Extends Comment Period on Notice of Inquiry Under the Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Notice of Inquiry Under the Energy Notice of Inquiry Under the Energy Independence and Security Act DOE Extends Comment Period on Notice of Inquiry Under the Energy Independence and Security Act August 18, 2010 - 4:33pm Addthis Today, in response to a formal request, General Counsel Scott Blake Harris approved a 30-day extension of the public comment period on DOE's Notice of Inquiry (75 FR 43945) soliciting comment on the development of regulations to carry out section 934 of the Energy Independence and Security Act of 2007, which implements the Convention on Supplementary Compensation for Nuclear Damage. The public comment period will be extended to October 27, 2010. The signed extension which is provided here, will be published shortly in the Federal Register. Addthis Related Articles DOE Extends Comment Period on Notice of Inquiry Under the Energy

437

Department of Energy Files Motion to Withdraw Yucca Mountain License  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Files Motion to Withdraw Yucca Mountain Files Motion to Withdraw Yucca Mountain License Application Department of Energy Files Motion to Withdraw Yucca Mountain License Application March 3, 2010 - 12:00am Addthis WASHINGTON, D.C. - The U.S. Department of Energy today filed a motion with the Nuclear Regulatory Commission to withdraw the license application for a high-level nuclear waste repository at Yucca Mountain with prejudice. "President Obama is fully committed to ensuring that the Nation meets our long-term storage obligations for nuclear waste," said Department of Energy General Counsel Scott Blake Harris. "In light of the decision not to proceed with the Yucca Mountain nuclear waste repository, the President directed Secretary Chu to establish the Blue Ribbon Commission on America's

438

Secretary Chu, Senator Reid Announce Department of Energy Conditional  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chu, Senator Reid Announce Department of Energy Chu, Senator Reid Announce Department of Energy Conditional Commitment for a Loan Guarantee for Nevada Geothermal Project Secretary Chu, Senator Reid Announce Department of Energy Conditional Commitment for a Loan Guarantee for Nevada Geothermal Project June 9, 2011 - 12:00am Addthis Washington, D.C. - U.S. Energy Secretary Steven Chu and Senate Majority Leader Harry Reid today announced the offer of a conditional commitment to provide a partial guarantee for a $350 million loan for a geothermal power generation project. The project, sponsored by Ormat Nevada, Inc., is expected to produce a total of 121 megawatts (MW) of clean, baseload power from three geothermal power facilities and will increase geothermal power production in Nevada by nearly 25 percent. The facilities are Jersey

439

2004 Federal Energy and Water Management Award Winners | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4 Federal Energy and Water Management Award Winners 4 Federal Energy and Water Management Award Winners 2004 Federal Energy and Water Management Award Winners October 7, 2013 - 4:30pm Addthis Water Conservation Award to an Individual Renewable Energy Award to Organization Renewable Energy Award to an Individual Mobility Energy Efficiency Awards to Organizations Energy Security and Reliability Award to a Small Group Energy Security and Reliability Award to an Individual Energy Efficiency/Energy Program Management Awards to Organizations Energy Efficiency/Energy Management Awards to Small Groups Energy Efficiency/Energy Management Awards to an Individual Exceptional Service Awards to Individuals ENERGY STAR® Building Award for Superior Performance Louis R. Harris, Jr. Award Water Conservation Award to an Individual

440

News From the D.C. Office  

NLE Websites -- All DOE Office Websites (Extended Search)

3 Aerial view of Washington D.C. 3 Aerial view of Washington D.C. News From the D.C. Office The federal government is the largest single purchaser in the world for many energy-related products. Federal buying power-along with that of state and local agencies-represents a largely untapped resource to increase the energy efficiency of consumer products and commercial equipment. LBL is helping the DOE Federal Energy Management Program (FEMP) develop and lead a government-wide initiative to capture this market-transforming opportunity. Jeff Harris and others in LBL's D.C. office are heading FEMP's efforts to identify how future federal purchases can be more energy-efficient. The U.S. government spends more than $70 billion a year to purchase supplies and equipment, of which an estimated $10-20 billion are energy-

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Savannah River Site - Salt Waste Processing Facility: Briefing on the Salt Waste Processing Facility Independent Technical Review  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Salt Waste Processing Facility Independent Technical Review Harry Harmon January 9, 2007 2 U.S. Department of Energy Outline * SWPF Process Overview * Major Risks * Approach for Conducting Review * Discussion of Findings * Conclusions 3 U.S. Department of Energy Salt Waste Processing Facility 4 U.S. Department of Energy SWPF Process Overview Alpha Finishing Process CSSX Alpha Strike Process MST/ Sludge Cs Strip Effluent DSS 5 U.S. Department of Energy BOTTOM LINE The SWPF Project is ready to move into final design. 6 U.S. Department of Energy Major Risks * Final geotechnical data potentially could result in redesign of the PC-3 CPA base mat and structure. * Cost and schedule impacts arising from the change from ISO-9001 to NQA-1 quality assurance requirements. * The "de-inventory, flush, and then hands-on

442

Enforcement Letter, WEL-2010-02 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WEL-2010-02 WEL-2010-02 Enforcement Letter, WEL-2010-02 December 23, 2010 Enforcement Letter issued to National Security Technologies, LLC related to a flash fire event at the Nevada National Security Site The Office of Enforcement reviewed the NSTec fire investigation report, management review report, root cause analysis (RCA), and corrective action plan; the Martin-Harris Construction Environmental, Safety and Health Plan; and the construction subcontract and accompanying exhibits. The Office of Enforcement also obtained and reviewed a number of core company directives, assessments, and inspection documents identified in exhibit E of the subcontract. Enforcement Letter, WEL-2010-02 More Documents & Publications Independent Oversight Review, Nevada National Security - May 2013

443

District of Columbia | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

, 2013 , 2013 Elon Musk, CEO of Tesla Motors, and Secretary Chu during a fireside chat at the 2013 ARPA-E Energy Innovation Summit | Photo by Sarah Gerrity, Energy Department. Wrap Up: 2013 ARPA-E Energy Innovation Summit The 2013 ARPA-E Energy Innovation Summit concluded Wednesday with a final networking session in the Technology Showcase. March 1, 2013 ARPA-E Innovators: FORO Foro Energy, with the help of ARPA-E funding, has accomplished what many though impossible - sending high powered lasers over long distances. March 1, 2013 Director Dot Harris spoke with over 330 students about diversity in computing and other technical careers at the Richard Tapia Diversity in Computing Conference in February 2013.Photo Credit: Reggie Campbell, RL Campbell Photography

444

Secretary Chu, Senator Reid Announce Department of Energy Conditional  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chu, Senator Reid Announce Department of Energy Chu, Senator Reid Announce Department of Energy Conditional Commitment for a Loan Guarantee for Nevada Geothermal Project Secretary Chu, Senator Reid Announce Department of Energy Conditional Commitment for a Loan Guarantee for Nevada Geothermal Project June 9, 2011 - 12:00am Addthis Washington, D.C. - U.S. Energy Secretary Steven Chu and Senate Majority Leader Harry Reid today announced the offer of a conditional commitment to provide a partial guarantee for a $350 million loan for a geothermal power generation project. The project, sponsored by Ormat Nevada, Inc., is expected to produce a total of 121 megawatts (MW) of clean, baseload power from three geothermal power facilities and will increase geothermal power production in Nevada by nearly 25 percent. The facilities are Jersey Valley

445

S M Stoller Star Center-B100 Monthly/Effluent; Largo, FL  

Office of Legacy Management (LM)

B100 Monthly/Effluent; Largo, FL B100 Monthly/Effluent; Largo, FL 7030-226 Accutest Job Number: F30882 Sampling Date: 04/06/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.

446

S M Stoller Star Center-B100  

Office of Legacy Management (LM)

B100 B100 7030-226/Monthly Accutest Job Number: F27169 Sampling Date: 10/05/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D. Laboratory Director

447

S M Stoller Pinellas Environmental Restoration Project - Young - Rainey Star Center  

Office of Legacy Management (LM)

Young - Rainey Star Center Young - Rainey Star Center 110406202 Accutest Job Number: F30886 Sampling Date: 04/06/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.

448

S M Stoller Star Center-B100 Monthly/Effluent; Largo, FL  

Office of Legacy Management (LM)

B100 Monthly/Effluent; Largo, FL B100 Monthly/Effluent; Largo, FL 7030-226 Accutest Job Number: F29123 Sampling Date: 01/06/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.

449

S M Stoller Star Center-WWNA Monthly; Largo, FL  

Office of Legacy Management (LM)

7170 7170 Sampling Date: 10/05/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D. Laboratory Director e-Hardcopy 2.0 Automated Report 12 1 of 12

450

S M Stoller Quarterly Sampling, STAR Center, Largo, FL  

Office of Legacy Management (LM)

227 227 Sampling Dates: 03/31/04 - 04/01/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D. Laboratory Director e-Hardcopy 2.0 Automated Report

451

Vessel Cold-Ironing Using a Barge Mounted PEM Fuel Cell: Project Scoping and Feasibility  

NLE Websites -- All DOE Office Websites (Extended Search)

3-0501 3-0501 Unlimited Release Printed February 2013 Vessel Cold-Ironing Using a Barge Mounted PEM Fuel Cell: Project Scoping and Feasibility Joseph W. Pratt and Aaron P. Harris Prepared by Sandia National Laboratories Albuquerque, New Mexico 87185 and Livermore, California 94550 Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000. Approved for public release; further dissemination unlimited. 2 Issued by Sandia National Laboratories, operated for the United States Department of Energy by Sandia Corporation. NOTICE: This report was prepared as an account of work sponsored by an agency of the

452

Publications, Oxide Molecular Beam Epitaxy Group, Condensed Matter Physics  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications In Press M. P. M. Dean, G. Dellea, R. S. Springell, F. Yakhou-Harris, K. Kummer, N. B. Brookes, X. Liu, Y. Sun, J. Strle, T. Schmitt, L. Braicovich, G. Ghiringhelli, I. Bozovic and J. P. Hill. "Persistence of magnetic excitations in La2-xSrxCuOP4 from the undoped insulator to the heavily overdoped non-superconducting metal." Nature Materials (Submitted 2013). In press. J. Wu, O. Pelleg, G. Logvenov, A. T. Bollinger, Y. Sun, G. S. Boebinger, M. Vanevic, Z. Radovic and I. Bozovic. "Anomalous (in)dependence of interface superconductivity on carrier density." Nature Materials (Submitted 2012). In press. G. Dubuis, A. T. Bollinger, D. Pavuna and I. Bozovic. "On Field Effect Studies and Superconductor-Insulator Transition in High-Tc Cuprates."

453

Alpaca Farmers Shearing Energy Costs with Solar | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Alpaca Farmers Shearing Energy Costs with Solar Alpaca Farmers Shearing Energy Costs with Solar Alpaca Farmers Shearing Energy Costs with Solar June 24, 2010 - 4:11pm Addthis Alpacas stand outside a solar powered barn on the property of Larry and Cathi Dietsch | Photo courtesy of Larry Dietsch Alpacas stand outside a solar powered barn on the property of Larry and Cathi Dietsch | Photo courtesy of Larry Dietsch Paul Lester Communications Specialist, Office of Energy Efficiency and Renewable Energy It takes a lot of work - and energy - to keep a herd of alpacas, known for their lustrous, long wool coats, happy and healthy. But, by harnessing the sun to power their 12-acre farm, a Georgia couple has shown they are up to the task. Larry and Cathi Dietsch, owners of Destiny Alpacas in Young Harris, are

454

National Nuclear Security Administration Nevada Site Office  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

93-851 8 93-851 8 JAM 1 4 2010 Scott Blake Harris, General Counsel, DOEiHQ (GC-1) FORS NATIONAL NUCLEAR SECURITY ADMINISTRATION NEVADA SITE OFFICE (NNSA/NSO) NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) ANNUAL PLANNING SUMMARY Pursuant to DOE Order 451. IB, NEPA Compliance Program, NNSA/NSO is pleased to provide the enclosed Annual NEPA Planning Summary. The document provides a brief description of ongoing and planned NEPA actions for calendar year 201 0. If there are any questions regarding this summary, please contact our NEPA Compliance Officer, Linda M. Cohn, at (702) 295-0077. s r4/(&~1/:~d Stephen A. Mellington Enclosure: As stated cc wtencl. via e-mail: C. M. Borgstrom, DOEiHQ (GC-54) FORS B. A. Costner, DOEiHQ (GC-54) FORS M. E. Martin, NNSAIHQ (NA-56) FORS

455

Information Request  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

November 25, 2008 November 25, 2008 TO: Sue Tierney, Phil Niedzielski-Eichner, Skila Harris FROM: Chris Kouts SUBJECT: Information Request As requested, enclosed is the additional information you requested yesterday. 1. Testimony: * September 24, 2008 before the Senate Committee on Commerce, Science and Transportation, * July 15, 2008 before the House Committee on Energy and Commerce * October 4, 2007 before the House Committee on the Budget and Chairman Spratt 2. Proposed Legislation "Nuclear Fuel Management and Disposal Act" submitted to Congress March 6, 2007 3. State-by-State Maps that outline each state's electricity generation mix, commercial spent nuclear fuel inventories, and payments into the Nuclear Waste Fund The additional information on the history of the use of engineered barriers will be

456

Agenda | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Agenda Agenda Chemical Sciences, Geosciences, & Biosciences (CSGB) Division CSGB Home About Research Areas Scientific Highlights Reports & Activities Principal Investigators' Meetings BES Home Third DOE BES Separations Research Workshop Agenda Print Text Size: A A A RSS Feeds FeedbackShare Page Third DOE/BES Separations Research Workshop Agenda Postworkshop Reference Edition Last Modified May 18, 1999 Note that the titles and abstracts of presentations may be found by clicking on the names of the individual presenter Tuesday, May 11, 1999 7:00-9:00 Welcoming reception (cash bar) Wednesday, May 12, 1999 7:30-8:30 Continental breakfast 8:30-9:00 Welcome and Introductions 9:00 - 9:25 D. G.Imre 9:25 - 10:05 Joel Harris(2programs) Rory Uibel, Dion Rivera 10:05-10:30 S. L. Regen

457

Printing Tiny Batteries | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Stories of Discovery & Innovation: "Printing" Stories of Discovery & Innovation: "Printing" Tiny Batteries? Energy Frontier Research Centers (EFRCs) EFRCs Home Centers Research Science Highlights News & Events EFRC News Observing the Sparks of Life EFRC Events DOE Announcements Publications Contact BES Home 06.26.13 Stories of Discovery & Innovation: "Printing" Tiny Batteries? Print Text Size: A A A Subscribe FeedbackShare Page Researchers use sophisticated 3D printing techniques to create batteries the size of a grain of sand. This work, featured in the Office of Science's Stories of Discovery & Innovation, was supported in part by the Light-Materials Interactions for Energy Conversion (LMI), an EFRC led by Harry Atwater at the California Institute of Technology. Last modified: 6/26/2013 8:53:17

458

 

NLE Websites -- All DOE Office Websites (Extended Search)

MINUTES of the MINUTES of the Nu-Factory Physics Study Group Meeting Friday, Sept. 17, 1999 Present: Debbie Harris, Eric Hawker, Stephen Parke, Rajendran Raja, Bob Bernstein,Heidi Schellman, Steve Geer, Panagiotis Spentzouris 1. Charge Those present are being asked by the Fermilab Directorate to participate in a study of the physics capabilities of a neutrino factory. Heidi Schellman and Steve Geer have been fingered as co-coordinators for the study. A draft of the charge is appended below. Although the charge for the group is not yet final, we are encouraged to get cracking. We are expected to include others who are interested in the study ... and indeed would like to be as inclusive as possible. 2. Meetings We have only 6 months to complete the study. Therefore it is urgent to get started with regular

459

Microsoft Word - P450.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Understanding the Role of Thiolate Ligation in Nature's Understanding the Role of Thiolate Ligation in Nature's Hydroxylating Heme Enzymes Michael T. Green, 1 John H. Dawson, 2 Harry B. Gray 3 1 Department of Chemistry, The Pennsylvania State University, PA 16802 2 Department of Chemistry and Biochemistry, The University of South Carolina, SC 29208 3 Beckman Institute, California Institute of Technology, Pasadena, CA 91125 Cytochromes P450 are thiolate-ligated heme enzymes that play critical roles in a number of important physiological processes. P450s are involved in the metabolism of carcinogens and pesticides and in the production of glucocorticoids and sex hormones. Defects in these enzymes have been associated with disease states, such as glaucoma, congenital adrenal hyperplasia, psuedovitamin D-deficiency rickets, and Parkinson's.

460

The Power of Information | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The Power of Information The Power of Information The Power of Information July 21, 2010 - 6:16pm Addthis Scott Blake Harris Former General Counsel What does this mean for me? A modern grid should provide consumers with real time data on their energy use and its costs -- giving everyone the chance to manage their own energy use and save money. This fall we will issue reports to synthesize this public discussion, inform regulators and policy-makers about what we have learned, and offer suggestions about how quickly and effectively to improve the grid. The National Academy of Engineering recently set out to identify the most important engineering feats of the 20th Century. Their list included many landmark achievements, such as the Internet (13th) and highways (11th), but they ultimately proclaimed electrification to be "the single most

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Disposal Systems Evaluations and Tool Development - Engineered Barrier System (EBS) Evaluation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Disposal Systems Disposal Systems Evaluations and Tool Development - Engineered Barrier System (EBS) Evaluation (FCRD-USED-2011-000132) Prepared for U.S. Department of Energy Used Fuel Disposition Campaign Carlos F. Jové Colón (SNL) Florie A. Caporuscio, Schön S. Levy (LANL) Mark Sutton, James A. Blink, Harris R. Greenberg, Massimiliano Fratoni, William G. Halsey, Thomas J. Wolery (LLNL) Jonny Rutqvist, Carl I. Steefel, Juan Galindez, Jens Birkholzer, Hui-Hai Liu, (LBNL) June 15 th , 2011 SAND2011-4335 P Prepared by: Sandia National Laboratories Albuquerque, New Mexico 87185 Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of

462

FinalTestimony_VictorKDer04-06-2011.pdf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Victor K. Der Acting Assistant Secretary for Fossil Energy U.S. Department of Energy Before the House Science, Space, and Technology Committee Subcommittee on Energy and Environment Offshore Drilling Safety and Response Technologies Hearing April 6, 2011 Chairman Harris, Ranking Member Miller, and members of the Subcommittee, thank you for the opportunity to appear before you today to discuss the Department of Energy's (DOE) perspective on research and development (R&D) to improve oil and gas drilling in ever-deeper waters with greater margins of safety, reduced risk of spills, and better mitigation approaches should there be a spill. As you know, the Office of Fossil Energy (FE) leads DOE's efforts to ensure that we use our hydrocarbon resources - coal, oil, and natural gas - for clean, affordable, and reliable energy. A

463

SRS Tank 48H Waste Treatment Project Technology Readiness Assessment  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Savannah River Site Tank 48H Savannah River Site Tank 48H Waste Treatment Project Technology Readiness Assessment Harry D. Harmon Joan B. Berkowitz John C. DeVine, Jr. Herbert G. Sutter Joan K. Young SPD-07-195 July 31, 2007 Prepared by the U.S. Department of Energy Aiken, South Carolina SRS Tank 48H Waste Treatment Project SPD-07-195 Technology Readiness Assessment July 31, 2007 Signature Page 7/31/07 ___________________________ _________________________ John C. DeVine, Jr., Team Member Date SRS Tank 48H Waste Treatment Project SPD-07-195 Technology Readiness Assessment July 31, 2007 Executive Summary The purpose of this assessment was to determine the technology maturity level of the candidate Tank 48H treatment technologies that are being considered for implementation at DOE's

464

DOE Extends Comment Period on Notice of Inquiry Under the Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

October 14, 2010 - 10:17am October 14, 2010 - 10:17am Addthis Today, in response to a formal request, General Counsel Scott Blake Harris approved a second and final extension of the public comment period to November 30, 2010 on DOE's Notice of Inquiry (75 FR 43945) soliciting comment on the development of regulations to carry out section 934 of the Energy Independence and Security Act of 2007, which implements the Convention on Supplementary Compensation for Nuclear Damage. The original deadline of September 27, 2010 was extended to October 27, 2010 (75 FR 51986) in response to public comment. The signed extension provided here will be published shortly in the Federal Register. Addthis Related Articles DOE Extends Comment Period on Notice of Inquiry Under the Energy Independence and Security Act

465

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

21 - 5530 of 9,640 results. 21 - 5530 of 9,640 results. Download EIS-0309-SA-02: Supplement Analysis Air and Ocean Transport of Enriched Uranium between Foreign Nations and the United States http://energy.gov/nepa/downloads/eis-0309-sa-02-supplement-analysis Download Lessons Learned Quarterly Report, September 2009 Welcome to the 60th quarterly report on lessons learned in the NEPA process. We are pleased to feature the extraordinary support provided by our NCO volunteers and to introduce Scott Blake Harris, DOE General Counsel, and his plans for improving the DOE NEPA process. http://energy.gov/nepa/downloads/lessons-learned-quarterly-report-september-2009 Download Lessons Learned Quarterly Report, June 2010 Welcome to the 63rd quarterly report on lessons learned in the NEPA process. In this issue, we continue our observance of the 40th anniversary

466

definingarosenfeld-v31  

NLE Websites -- All DOE Office Websites (Extended Search)

DEFINING A STANDARD METRIC FOR ELECTRICITY SAVINGS DEFINING A STANDARD METRIC FOR ELECTRICITY SAVINGS Jonathan Koomey*, Hashem Akbari, Carl Blumstein, Marilyn Brown, Richard Brown, Chris Calwell, Sheryl Carter, Ralph Cavanagh, Audrey Chang, David Claridge, Paul Craig, Rick Diamond, Joseph H. Eto, William Fulkerson, Ashok Gadgil, Howard Geller, José Goldemberg, Chuck Goldman, David B. Goldstein, Steve Greenberg, David Hafemeister, Jeff Harris, Hal Harvey, Eric Heitz, Eric Hirst, Holmes Hummel, Dan Kammen, Henry Kelly, Skip Laitner, Mark Levine, Amory Lovins, Gil Masters, James E. McMahon, Alan Meier, Michael Messenger, John Millhone, Evan Mills, Steve Nadel, Bruce Nordman, Lynn Price, Joe Romm, Marc Ross, Michael Rufo, Jayant Sathaye, Lee Schipper, Stephen H. Schneider, James L. Sweeney, Malcolm Verdict, Diana Vorsatz,

467

Final_Tech_Session_Schedule_and_Location.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

Commercial Commercial Deployment of CO Commercial Deployment of CO 2 2 Capture and Storage (CCS) Capture and Storage (CCS) Harry Audus IEA Greenhouse Gas R&D Programme 4 th Annual Conference on CCS May 2-5, 2005 Alexandria, Virginia, USA www.ieagreen.org.uk Programme Members Programme Members 17 Member Countries 17 Member Countries 10 Industrial Sponsors 10 Industrial Sponsors www.ieagreen.org.uk CO CO 2 2 emissions by sector: 1990 emissions by sector: 1990 - - 2030 2030 (Source: IEA (Source: IEA - - World Energy Outlook 2004) World Energy Outlook 2004) 0 2 000 4 000 6 000 8 000 10 000 12 000 14 000 16 000 18 000 1990 2002 2010 2020 2030 million tonnes of CO 2 Power Generation Other Transformation Industry Transport Other Sectors www.ieagreen.org.uk Introduction Introduction *Current international status of CCS. * Regional drivers: N America, Europe, Asia-OECD, China, India, Middle

468

August 2008 "The Y-12 Times"  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 August 2008 www.y12.doe.gov/news/times.php P.O. Box 2009 Oak Ridge, TN 37831-8245 Managing Editors Amy Alley: alleyab@y12.doe.gov Heidi Spurling: spurlinghw@y12.doe.gov Layout/Design Lisa Harris Contributors Ellen Boatner Ken Davis Kathy Fahey Vicki Hinkel Kathryn King-Jones Jamie Loveday Mary Murray I N S I D E Page 3 Y-12: DOE's Mentor of the Year Page 3 Getting healthier together Pages 4 5 tips to help you pass the test Pages 5 Y-12's rhythm makers strike a chord Page 6 Why four employees return to class Page 7 Sticking to New Year's resolutions Page 8 Apprenticeship program replaces critical skills Brett Pate Ray Smith Donna Watson Lisa Xiques times times the B&W Technical Services Y-12, LLC, a partnership between Babcock & Wilcox Technical Services Group Inc. and Bechtel National Inc., operates the

469

Project Title  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Storage R&D Project Review Meeting Carbon Storage R&D Project Review Meeting Developing the Technologies and Building the Infrastructure for CO 2 Storage August 21-23, 2012 2 Acknowledgments Dave Harris, Kentucky Geological Survey Dave Barnes, Western Michigan University John Rupp, Indiana Geological Survey Scott Marsteller, Schlumberger Carbon Services John McBride, Brigham Young University * Project is funded by the U.S. Department of Energy through the National Energy Technology Laboratory (NETL) and by a cost share agreement with the Illinois Department of Commerce and Economic Opportunity, Office of Coal Development through the Illinois Clean Coal Institute * ConocoPhillips: in-kind match * Western Kentucky Carbon Storage Foundation: matching funding * SeisRes 2020, Houston: VSP acquisition and processing

470

AR03-04  

NLE Websites -- All DOE Office Websites (Extended Search)

andia National Laboratories began in 1945 on Sandia andia National Laboratories began in 1945 on Sandia Base in Albuquerque, New Mexico, as Z Division, part of what's now Los Alamos National Laboratory. Both labs were born out of America's atomic bomb development effort-the Manhattan project. Sandia came into being as an ordnance design, testing, and assembly facility, and was located on Sandia Base to be close to an airfield and work closely with the military. In 1949, President Harry Truman wrote a letter to the American Telephone and Telegraph Company president offering the company "an opportunity to render an exceptional service in the national interest" by managing Sandia. AT&T accepted, began managing the Labs on Nov. 1, 1949, and continued in the role for nearly 44 years. The Labs' original mission-

471

MHATT-CAT  

NLE Websites -- All DOE Office Websites (Extended Search)

MHATT-CAT, Center for Real-Time X-ray Studies Collaborative Access Team MHATT-CAT, Center for Real-Time X-ray Studies Collaborative Access Team 7-BM 7-ID A fixed-angle double-mirror filter for producing a pink undulator beam at the Advanced Photon Source E. Dufresne, T. Sanchez, T. Nurushev, and S. Dierker A study of concentration fluctuations in the binary mixture hexane-nitrobenzene with x-ray photon correlation spectroscopy E. Dufresne, T. Nurushev, R. Clarke, and S. Dierker Direct measurement of the time structure of ultra-short x-ray pulses D. Walton Direct structural determination of systems with two-dimensional periodicity Y. Yacoby, R. Pindak, R. MacHarrie, J. Pitney, and R. Clarke Local electronic and structural studies of transition metal oxides: magneto-structural correlations T.A. Tyson, H. Woo, L. Dieng, C. Cui, R.F.C. Farrow, and W.P. Lowe

472

Sandia National Laboratories: About Sandia: Leadership  

NLE Websites -- All DOE Office Websites (Extended Search)

About About Leadership Leadership with Paul Hommert : President and Laboratories Director Throughout its history, Sandia has been guided by the core principle of - in the words of President Harry Truman - providing "exceptional service in the national interest." Paul Hommert Paul Hommert President & Laboratories Director Paul Hommert is the director of Sandia National Laboratories and president of Sandia Corporation. Sandia has principal sites in Albuquerque, N.M., and Livermore, Calif., an annual budget of $2.5 billion, and approximately 9,400 employees. View full biography President's message Download biography (PDF, 1.5 MB) Kim Sawyer Kim Sawyer Deputy Laboratories Director & Executive Vice President for Mission Support Kimberly (Kim) C. Sawyer is the deputy Laboratories director and executive

473

Livermore Contract Announcement | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Livermore Contract Announcement Livermore Contract Announcement Livermore Contract Announcement May 8, 2007 - 12:45pm Addthis Remarks as Prepared for Energy Secretary Samuel Bodman Good afternoon. Thank you all for coming and welcome to the Lawrence Livermore National Laboratory employees who are watching this on our Webcast. I know my remarks are of special importance to you. The Lawrence Livermore National Laboratory opened in 1952 using the "team science" approach pioneered by Ernest O. Lawrence. Livermore was - and is - a place where "new ideas" are dominant. Few would have predicted back then how deeply the work conducted at Lawrence Livermore would influence the course of history. And yet it has. Today is the 123rd anniversary of President Harry S Truman's birth. The first Cold War president, Truman's decisive

474

Multiple_Projects_Section_1705_Loan_Guarantees.pdf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

meeting was held at 10:00 am on October 20, 2009 with the following participants: meeting was held at 10:00 am on October 20, 2009 with the following participants: Department of Energy Scott Blake Harris, General Counsel, Department of Energy Sean A. Lev, Deputy General Counsel (Environment and Nuclear Programs), Department of Energy Bruce Diamond, Assistant General Counsel Renewable Energy Industry Representatives - Charles R. Shipp (Federally Registered Lobbyist), Partner, SC Partners LLC, Clients: NTR plc, NextLight Renewable Power, U.S. Combined Heat and Power Association, Solar Energy Industries Association - Katherine A. Gensler (Federally Registered Lobbyist), Manager of Legislative and Regulatory Affairs, Solar Energy Industries Association - Steven W. Howlett, Senior Vice President, General Electric - Gene Grace, Senior Counsel, American Wind Energy Association

475

National Nuclear Security Administration Service Center  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Service Center Service Center P. 0. Box 5400 ~ ~ ~ A d M m t b n Albuquerque, NM 87185 MEMORANDUM FOR: Scott Blake Harris, General Counsel, GC- 1, HQ FROM: Karen L. Boardman, Director * * SUBJECT: Annual National Environmental Policy Act Planning Summary for FY 201 1 In response to your memorandum of December 8,201 0, attached is the 20 1 1 Annual National Environmental Policy Act (NEPA) Planning Summary. The information is provided for the National Nuclear Security Administration, Service Center (NNSAISC) in Albuquerque, NM. Furthermore, in reply to the question, "Would a site-wide environmental impact statement facilitate future NEPA compliance efforts?" The general operations of this site can be described as administrative similar to those operations within the Forrestal building in D.C. Therefore, a

476

Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

response of an oligonucleotide-based biosensor to environmental mercury response of an oligonucleotide-based biosensor to environmental mercury Harry M. Edenborn Geosciences Division, Office of Science and Engineering Research, National Energy Technology Laboratory, U.S. Department of Energy, P.O. Box 10940, Pittsburgh, PA 15236 Introduction 5'-6-FAM (TTCTTTCTTCCCCTTGTTTGTT)-DAB-3' The molecular beacon used previously consisted of two mercury-binding oligonucleotide sequences (underlined), connected by a linker sequence (CCCC), and terminated by the fluorophore and quencher moieties, fluorescein (6-FAM) and dabcyl (DAB), respectively. In this configuration, the fluorophore exhibits its maximum UV fluorescence at 520 nm. CTTGTTTGTT-DAB-3' | C | C Hg Hg Hg | C | CTTCTTTCTT-6-FAM-5' One environmental pollutant of particular relevance to the

477

 

NLE Websites -- All DOE Office Websites (Extended Search)

organization meeting for non-oscillations group organization meeting for non-oscillations group 2PM on Thursday, October 7th, 1999 NEWS:Eric Hawker (hawker@fnal.gov) is the contact person for the non-oscillations group Attendance: Heidi Schellman Fritz DeJongh Eric Hawker Jae Yu (after 3) Debbie Harris (after 3) Many people could not attend due to the time chosen. Not able to attend and asked for different meeting time. Jorge Morfin Kevin McFarland Ray Stefanski We also found that several people who had expressed interest in the group were not on the mailing list. We're trying to rectify this. We first discussed whether exotics and normal DIS should split into two groups. The discussions were so interesting we probably won't split for now. General Work plan The non-oscillation sub group of the neutrino factory study will be

478

Reliant Bluebonnet Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Reliant Bluebonnet Biomass Facility Reliant Bluebonnet Biomass Facility Jump to: navigation, search Name Reliant Bluebonnet Biomass Facility Facility Reliant Bluebonnet Sector Biomass Facility Type Landfill Gas Location Harris County, Texas Coordinates 29.7751825°, -95.3102505° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":29.7751825,"lon":-95.3102505,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

479

JGI - Scientific Posters  

NLE Websites -- All DOE Office Websites (Extended Search)

News and Publications News and Publications News Releases Science Highlights JGI in the News Notable Scientific Publications Scientific Posters The Primer Templates and Logos Scientific Posters - Archive Note: neither these posters nor their contents may be reproduced except by permission of JGI. JGI Sequencing Projects: Statistics and Timelines (JGI User Meeting 2007) Tijana Glavina del Rio, Kerrie Barry, Lynne Goodwin, Miranda Harmon-Smith, Harris Shapiro, Susan Lucas and David Bruce. What's new in project management? A Look at the JGI Project Management Office (JGI User Meeting 2007) David Bruce, Lynne Goodwin, Kerrie Barry, Susannah Tringe, Tijana Glavina del Rio Comparison of Protocols for Isolating Large Insert Clone DNA that is Suitable for High Throughput Library Construction (JGI User Meeting 2007)

480

dec11-Times.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 December 2011 www.y12.doe.gov/news/times.php P.O. Box 2009 Oak Ridge, TN 37831-8245 W H A T ' S I N S I D E Page 2 Governance Transformation at Y-12 Page 3 Employees bring benefi ts to life Pages 4 and 5 A healthy start to 2012 Page 6 A visit from Christmas past Page 8 Have a plan - just in case B&W Technical Services Y-12, LLC, a partnership between Babcock & Wilcox Technical Services Group Inc. and Bechtel National Inc., operates the Y-12 National Security Complex. A newsletter for employees and friends of the Y-12 National Security Complex Managing Editors Amy Alley: alleyab@y12.doe.gov Heidi Spurling: spurlinghw@y12.doe.gov Layout Lisa Harris Contributors Mary Bryant Ellen Boatner Ashley Douglas Kathy Fahey Scott Fraker John Holbrook David Keim Terry Marlar Jill McNutt

Note: This page contains sample records for the topic "bastrop harris gonzales" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

DOE_MA0518 December 2000  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

was written in conjunction with the 50th was written in conjunction with the 50th anniversary commemoration of the Nevada Test Site. The history was released at the official celebration held in Las Vegas, Nevada, on December 18, 2000, fifty years after President Harry S. Truman formally designated the site as the location for conducting nuclear weapons tests within the continental United States. The history represents a unique partnership between a field office and two headquarters offices of the U.S. Department of Energy. The Department's Nevada Operations Office provided the initial impetus for the project and offered support and resources throughout the researching and writing of the history. The Office of Defense Programs of the Department's National Nuclear Security Administration provided funding for printing the history. The History

482

United States Government Department of Energy Idaho Operations Office  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1, 2011 1, 2011 Subject: 2011 National Environmental Policy Act Planning Summary (OS-ETSD-11-001) To: Scott Blake Harris, General Counsel DOE-HQ, GC-1IFORS In accordance with DOE Order 451.1 B, the Department of Energy, Idaho Operations Office (DOE-ID) is submitting its 2011 National Environmental Policy Act (NEPA) Planning Summary. The 2011 NEPA Planning Summary will be made available to the public as required by the Order. Estimated NEPA document costs are provided for actions that are well enough defined from a planning and budget perspective. If you have any questions concerning the attachment or the DOE-ID NEPA compliance program, please contact me or our NEPA Compli (208) 526-5053. ',Manager Attachment cc: C. M. Borgstrom, DOE-HQ, GC-54/FORS B. M. Angle, BBWI, MS-3428

483

Progress and issues in single well seismic imaging | Open Energy  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » Progress and issues in single well seismic imaging Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Paper: Progress and issues in single well seismic imaging Authors Thomas M. Daley, Ernest L. Majer, Roland Gritto and Jerry M. Harris Conference 70th Annual International Meeting of the Society of Exploration Geophysicists, Expanded Abstracts; N/A; 2000/01/01 Published N/A, 2000 DOI Not Provided Check for DOI availability: http://crossref.org Online Internet link for Progress and issues in single well seismic imaging Citation

484

UNCONVENTIONAL ENERGY RESOURCES NETL Team Technical Coordinator: Alexandra Hakala  

NLE Websites -- All DOE Office Websites (Extended Search)

UNCONVENTIONAL ENERGY RESOURCES NETL Team Technical Coordinator: Alexandra Hakala UNCONVENTIONAL ENERGY RESOURCES NETL Team Technical Coordinator: Alexandra Hakala Name Title Affiliation Hakala, Alexandra Physical Scientist NETL Sames, Gary Physical Scientist NETL Dilmore, Robert General Eng NETL Peckney, Natalie General Eng NETL Veloski, Garret Research Chemist NETL Diehl, Rod Physical Scientist NETL Hammack, Richard Physical Scientist NETL Wells, Art Research Chemist NETL Stanko, Denny Phy Sci Tech NETL Hedges, Sheila Research Chemist NETL Lopano, Christina Physical Scientist NETL Edenborn, Harry Microbiologist NETL Goodman, Angela Physical Scientist NETL McIntyre, Dustin Mechanical Eng NETL Soeder, Daniel Physical Scientist NETL Mroz, Thomas Geologist NETL Strazisar, Brian Physical Scientist NETL Kutchko, Barbara Physical Scientist NETL Rose, Kelly Geologist NETL Brohmal, Grant

485

 

NLE Websites -- All DOE Office Websites (Extended Search)

Non-oscillation group meeting minutes Non-oscillation group meeting minutes Tuesday 10/19/99 Attendance: Jorge Morfin Eric Hawker Eric Zimmerman Gerry Garvey Fritz DeJongh Debbie Harris Joe Formaggio John Krane Ray Stefanski Jae Yu Kevin McFarland - Jorge Morfin gave a presentation on possible structure function measurements and the measurements of nuclear effects that could be done with high intesity neutrino beams. Some of these include... - measure s and sbar separately in the proton, also c and cbar - Fermi-motion effects at high x in nuclear targets - nuclear dependence and shadowing effects. - Gerry Garvey expressed some interest in doing lower energy form factor measurements. - Code is being devloped to produce a simple ntuple of neutrino beam characteristics and neutrino cross sections. Both Heidi and Jae Yu are

486

Manhattan Project: People Images  

Office of Scientific and Technical Information (OSTI)

PEOPLE IMAGES PEOPLE IMAGES Resources > Photo Gallery Scroll down to see each of these images individually. The images are: 1. J. Robert Oppenheimer, Enrico Fermi, and Ernest Lawrence (courtesy the Lawrence Berkeley National Laboratory); 2. Hanford, Washington, workers sending money home (reproduced from the photo insert in F. G. Gosling, The Manhattan Project: Making the Atomic Bomb (Washington: History Division, Department of Energy, October 2001)); 3. Oppenheimer and Leslie Groves at the Trinity Site, September 1945 (reproduced from the cover of the Office of History and Heritage Resources publication: The Signature Facilities of the Manhattan Project (Washington: History Division, Department of Energy, 2001)); 4. A WAC detachment marching at Oak Ridge, Tennessee, June 1945 (courtesy the Army Corps of Engineers; it is reprinted in Rachel Fermi and Esther Samra, Picturing the Bomb: Photographs from the Secret World of the Manhattan Project (New York: Harry N. Abrams, Inc., Publishers, 1995), 40);

487

Component Testing for Industrial Trucks and Early Market Applications - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Aaron Harris (Primary Contact), Brian Somerday, Chris San Marchi Sandia National Laboratories P.O. Box 969 Livermore, CA 94551-0969 Phone: (925) 294-4530 Email: apharri@sandia.gov DOE Manager HQ: Antonio Ruiz Phone: (202) 586-0729 Email: Antonio.Ruiz@ee.doe.gov Project Start Date: January 2010 Project End Date: May 2011 (carryover from Fiscal Year [FY] 2011 extended objectives into FY 2012) Fiscal Year (FY) 2012 Objectives (1) Provide technical basis for the development of standards defining the use of steel (Type 1) storage pressure vessels for gaseous hydrogen: Compare fracture mechanics based design approach - for fatigue assessment of pressure vessels for

488

Microsoft PowerPoint - Proceedings Cover Sheets  

NLE Websites -- All DOE Office Websites (Extended Search)

A Brief Worldwide Look A Brief Worldwide Look A Brief Worldwide Look A Brief Worldwide Look at at CCS Technology & Plans CCS Technology & Plans Presented at: 5 th Annual Conference on CCS May 8-11, 2006, Alexandria, USA by Eur. Ing. Harry Audus IEA Greenhouse Gas R&D Programme www.ieagreen.org.uk Existing CCS Existing CCS ' ' Commercial Commercial ' ' * Projects * Projects * There are 3 projects that can be said to be operating 'commercially' at a significant scale. * Sleipner * Weyburn * In Salah * These schemes each capture and store approximately 1 million tonnes CO 2 /year * This total of 3 million tonnes CO 2 /year is roughly equivalent to the annual emissions from one modern coal-fired power plant. *'Commercial' as opposed to non-commercial demonstrations www.ieagreen.org.uk Monitored Monitored CO CO 2 2 Stored Underground

489

The Y-12 Times, a newsletter for employees and friends of the Y-12 National Security Complex, Vol. 10, No. 6, June 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

6 6 June 2010 www.y12.doe.gov/news/times.php P.O. Box 2009 Oak Ridge, TN 37831-8245 W H A T ' S I N S I D E Page 2 Kohlhorst answers employees' questions Page 3 The ultimate cutting-edge technology Pages 4 and 5 Y-12 volunteers hit area communities Page 6 Catch up with Y-12 retiree Jack Rider Page 8 Alpha 3 gets a makeover B&W Technical Services Y-12, LLC, a partnership between Babcock & Wilcox Technical Services Group Inc. and Bechtel National Inc., operates the Y-12 National Security Complex. A newsletter for employees and friends of the Y-12 National Security Complex Managing Editors Amy Alley: alleyab@y12.doe.gov Heidi Spurling: spurlinghw@y12.doe.gov Layout Lisa Harris Contributors Ellen Boatner Beth Eckerman Ryn Etter Kathy Fahey Scott Hackler Vicki Hinkel John Holbrook

490

DOE's Coal Research and Development | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Coal Research and Development Coal Research and Development DOE's Coal Research and Development October 13, 2011 - 2:14pm Addthis Statement of Mr. Scott Klara, Deputy Laboratory Director, National Energy Technology Laboratory before the Subcommittee on Energy and Environment, Committee on Science, Space and Technology, U.S. House of Representatives. Thank you Chairman Harris and members of the Subcommittee; I appreciate the opportunity to discuss the Department of Energy's (DOE) coal research & development activities. Interagency Task Force on Carbon Capture and Storage Before I discuss the Department's Clean Coal Research Program, I will briefly review the conclusions from the Interagency Task Force on Carbon Capture & Storage (CCS). In August 2010, the final report from the Task

491

Microsoft Word - 31436026_19.DOC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

COMMISSION COMMISSION In the Matter of U.S. DEPARTMENT OF ENERGY (High Level Waste Repository Construction Authorization Application) ) ) ) ) ) ) ) ) July 9, 2010 Docket No. 63-001-HLW U.S. DEPARTMENT OF ENERGY'S BRIEF IN SUPPORT OF REVIEW AND REVERSAL OF THE BOARD'S RULING ON THE MOTION TO WITHDRAW Scott Blake Harris Sean A. Lev James Bennett McRae U.S. DEPARTMENT OF ENERGY Office of General Counsel Department of Energy 1000 Independence Avenue, S.W. Washington, D.C. 20585 Donald P. Irwin Michael R. Shebelskie HUNTON & WILLIAMS LLP Riverfront Plaza, East Tower 951 East Byrd Street Richmond, Virginia 23219-4074 Counsel for the U.S. Department of Energy i Table of Contents Page I. PRELIMINARY STATEMENT ..........................................................................................1

492

6-15-11_Final_Testimony_(Frantz).pdf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Frantz Frantz Director of the Loan Programs Office U.S. Department of Energy Before the Subcommittee on Energy and Environment Committee on Science, Space, and Technology United States House of Representatives June 15, 2011 Introduction Chairman Harris, Ranking Member Miller, and members of the Subcommittee, thank you for the opportunity to testify today. My name is David Frantz, and I am the Director of Origination for the Department of Energy's (DOE) Loan Programs Office (LPO) and previously served as Director of the Loan Programs Office prior to Jonathan Silver's arrival. DOE's loan programs provide critical support for the nation's commercial deployment of clean energy and the jobs and economic growth that come with it. I welcome the opportunity to discuss with you the Department's funding for FY 2011, our

493

Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3, 2012 3, 2012 Shelton Clark, President of Eberline Services, receives the Small Business of the Year award from Dot Harris, Director of the Office of Economic Impact and Diversity. Eberline Services, a New Mexico-based small business, gets 90% of their business from the Energy Department. They specialize in radiological protection and environmental services. | Photo by Charles Watkins, DOE Photographer. No Small Task: How Small Businesses are Critical to our Energy Future The Energy Department depends on small businesses across the country to help fulfill its mission. July 3, 2012 Argonne Lab researchers used the Advanced Photon Source to look at the structure of spider's dragline silk, which allows arachnids to swing from branches and dangle from window frames, the Spiderman equivalent of swinging from high buildings and dangling from Gotham's towers. | Creative Commons photo by Flickr user Djumbo.

494

Tuesday Webcasts for Industry: Tax Rebates/Credits Available for Energy Efficiency Actions  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Industry: Industry: Tax Rebates/Credits Available for Energy Efficiency Actions May 8, 2012 Industry Sector Incentives for Energy-Efficient Investments Jeffrey Harris Alliance to Save Energy USDOE/AMO Tuesday Webcasts for Industry May 8 2012 About the Alliance to Save Energy We promote energy efficiency worldwide to achieve a healthier economy, a cleaner environment and greater energy security. - Non-profit; headquartered in Washington DC; operations world-wide - 14 Members of Congress - Bi-Cameral; Bi-Partisan - Leaders of environmental, consumer, and trade associations - State and local policy makers, corporate executives - Led by Senator Mark Warner (D-Va.) and Tom King, Chairman of the Board, and President, National Grid USA Overview  Role of incentives

495

Rhodia Houston Plant Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Rhodia Houston Plant Biomass Facility Rhodia Houston Plant Biomass Facility Jump to: navigation, search Name Rhodia Houston Plant Biomass Facility Facility Rhodia Houston Plant Sector Biomass Facility Type Non-Fossil Waste Location Harris County, Texas Coordinates 29.7751825°, -95.3102505° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":29.7751825,"lon":-95.3102505,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

496

Microsoft Word - RoutingTG_12-19-06_call_minutes_rev1.rtf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

December 19, 2006, 11:00 a.m.-12:15 p.m. EST December 19, 2006, 11:00 a.m.-12:15 p.m. EST Conference Call Minutes Chair: Jay Jones (RW) Participants: Jane Beetem (CSG/MW), Kevin Blackwell (DOT/FRA), David Blee (USTC), Barbara Byron (California Energy Commission), Kurt Colborn (MHF), Sandy Covi (UP), Ken Dahkle (Nebraska State Police), Ray English ( NNPP), Scott Field (WIEB), Dan Fisher (Public Utilities Commission of Ohio), Bob Halstead (Nevada Agency For Nuclear Projects), Harry Hopes (CSX), Lisa Janairo (CSG-MW), Paul Johnson (ORNL), Marsha Keister (INL), Mel Massaro (DOT/FRA), Christina Nelson (NCSL), Doug Osborn (SNL), Cort Richardson (CSG-NE), Tim Runyon (CSG-MW), Sarah Wochos (CSG/MW) Contractor Support: Ralph Best (BSC), Randy Coppage (BAH), Michele Enders (SAIC), Lee Finewood (BAH)

497

President Obama Announces More Key Administration Posts | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

July 27, 2011 - 3:25pm July 27, 2011 - 3:25pm Addthis WASHINGTON - Today, President Barack Obama announced his intent to nominate the following individuals to key Administration posts: David Danielson - Assistant Secretary for Energy Efficiency and Renewable Energy, Department of Energy Dot Harris - Director of the Office of Minority Economic Impact, Department of Energy President Obama said, "I am honored that these talented individuals have decided to join this Administration and serve our country. I look forward to working with them in the months and years to come." President Obama announced his intent to nominate the following individuals to key Administration posts: David Danielson, Nominee for Assistant Secretary for Energy Efficiency and Renewable Energy, Department of Energy

498

Agency Points of Contact for Tribal Consultation Agency Point of Contact Email and Phone  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Points of Contact for Tribal Consultation Points of Contact for Tribal Consultation Agency Point of Contact Email and Phone Department of the Interior Sarah Harris Chief of Staff to the Assist Secretary - Indian Affairs Tribalconsultation@bia.gov (202) 208-7163 Department of Justice Tracy Toulou Director, Office of Tribal Justice OTJ@usdoj.gov (202) 514-8812 Department of State Reta Lewis Special Representative for Global Intergovernmental Affairs tribalconsultation@state.gov (202) 647-7710 Department of the Treasury Alexander Gelber Deputy Assistant Secretary alexander.gelber@treasury.gov (202) 622-1513 Department of Defense Serena Bellew Acting Senior Advisor and Liaison for Native American Affairs Serena.bellew@osd.mil

499

Portsmouth Site Delivers First Radioactive Waste Shipment to Disposal  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Delivers First Radioactive Waste Shipment to Delivers First Radioactive Waste Shipment to Disposal Facility in Texas Portsmouth Site Delivers First Radioactive Waste Shipment to Disposal Facility in Texas August 27, 2013 - 12:00pm Addthis Waste management and transportation personnel worked late to complete the first shipment to WCS. Through a contract with DOE, WCS will treat and accept potentially hazardous waste that has been at the Portsmouth site for decades. Pictured (from left) are Scott Fraser, Joe Hawes, Craig Herrmann, Jim Book, John Lee, John Perry, Josh Knipp, Melissa Dunsieth, Randy Barr, Rick Williams, Janet Harris, Maureen Fischels, Cecil McCoy, Trent Eckert, Anthony Howard and Chris Ashley. Waste management and transportation personnel worked late to complete the first shipment to WCS. Through a contract with DOE, WCS will treat and

500

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

7, 2011 7, 2011 spacer Subscribe | Contact Us | Archive | Classifieds | Guidelines | Help Search GO spacer Calendar Have a safe day! Monday, June 27 PARTICLE ASTROPHYSICS SEMINARS WILL RESUME IN THE FALL 3:30 p.m. DIRECTOR'S COFFEE BREAK - 2nd Flr X-Over 4 p.m. All Experimenters' Meeting - Curia II Operating CM-1, an 8-cavity TESLA-Style Cryomodule; Achievements in Liquid Argon Electronics; GCC Power Outage Tuesday, June 28 Noon Summer Lecture Series - One West Speaker: Deborah Harris, Fermilab Title: Neutrino Physics 3:30 p.m. DIRECTOR'S COFFEE BREAK - 2nd Flr X-Over THERE WILL BE NO ACCELERATOR PHYSICS AND TECHNOLOGY SEMINAR TODAY Click here for NALCAL, a weekly calendar with links to additional information. Upcoming conferences Campaigns Take Five Weather Weather Chance of thunderstorms