Powered by Deep Web Technologies
Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Join the College of Business and Behavioral Science in Barcelona, Spain When: First Summer Session 2012  

E-Print Network [OSTI]

Join the College of Business and Behavioral Science in Barcelona, Spain When: First Summer Session 2012 Where: Barcelona, Spain Courses: Clemson University courses taught in English by Clemson Spain's Majestic Costa Brava Current plans call for students and professors to live together

Bolding, M. Chad

2

Marta Poblet, Universitat Autonoma de Barcelona, Spain (Ed.) Mobile Technologies for Conflict  

E-Print Network [OSTI]

in conflict prevention and dispute management aiming to learn how mobile technologies can play a disruptive. Mobile Technologies, Conflict Management, and ODR: Exploring Common Grounds; Marta Poblet.- Part IMarta Poblet, Universitat Autonoma de Barcelona, Spain (Ed.) Mobile Technologies for Conflict

Autònoma de Barcelona, Universitat

3

Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 1 EUSIPCO 2011, Barcelona Spain, August 29-September Xing Fan, Carlos Busso and John H.L. Hansen  

E-Print Network [OSTI]

Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 1 EUSIPCO 2011, Barcelona Spain, August Barcelona, Spain #12;Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 2 EUSIPCO 2011, Barcelona with neutral speech #12;Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 3 EUSIPCO 2011, Barcelona

Busso, Carlos

4

CAMBRIDGE, U.K., AND BARCELONA, SPAIN--As the horse-trading to select a site for the Inter-  

E-Print Network [OSTI]

CAMBRIDGE, U.K., AND BARCELONA, SPAIN--As the horse-trading to select a site for the Inter studying four candidate sites, in Canada, Japan, France, and Spain. To boost its odds, the E.U. decided to put forward only one candidate--either Cadarache in France or Vandellòs in Spain--and asked David King

5

E-Print Network 3.0 - association barcelona spain Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

| Study Abroad Program Summer Programs Course Syllabus- Barcelona: the City and its History... city in Europe," Barcelona enjoys the reputation of a cosmopolitan city with a...

6

Black Africans in Barcelona, Spain: An Exploration of Integration into Catalan Society  

E-Print Network [OSTI]

les minoreis elniques. Lerida, Spain: Universitat de L1eida.6 200 1-2004. Catalunya, Spain: Grinver. SA. Gozalvez Perez,Picanya (Valencia), Spain: Generalitat Valenciana. Makom •

Osuji, Chinyere

2006-01-01T23:59:59.000Z

7

ROSER MATAMALA Ph.D. in Biological Sciences, 1997. University of Barcelona (Spain), Smithsonian  

E-Print Network [OSTI]

-1993 Research Assistant, Institut de Recerca i Tecnologia Agroalimentaries, IRTA, Cabrils, Spain Publications

Kemner, Ken

8

EVS27 International Battery, Hybrid and Fuel Cell Electric Vehicle Symposium 1 Barcelona, Spain, November 17-20, 2013  

E-Print Network [OSTI]

EVS27 International Battery, Hybrid and Fuel Cell Electric Vehicle Symposium 1 EVS27 Barcelona and Fuel Cell Electric Vehicle Symposium 2 However, for embedded systems, studies look for simple signals for the diagnosis of electrochemical generators (batteries or fuel cell). It is now possible to acquire

Paris-Sud XI, Université de

9

First approach to the El Frontal tracksite (Berriasian, Soria, Spain): perspectives on  

E-Print Network [OSTI]

207 First approach to the El Frontal tracksite (Berriasian, Soria, Spain): perspectives Català de Paleontologia Miquel Crusafont. Carrer Escola Industrial, 23, 08201 Sabadell (Barcelona) Spain Ciencias. Universidad de Zaragoza. Calle Pedro Cerbuna, 12, 50009 Zaragoza, Spain. bernat

Falkingham, Peter

10

Barcelona, Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCT BiomassArnprior,AurantiaBanburyBankInvestBarbados:

11

Holocene forest history of the eastern plateaux in the Segura Mountains (Murcia, southeastern Spain)  

E-Print Network [OSTI]

Holocene forest history of the eastern plateaux in the Segura Mountains (Murcia, southeastern Spain´nica), Facultad de Biologi´a, Universidad de Murcia, Campus de Espinardo, 30100 Murcia, Spain b Area de Bota´nica, Facultad de Ciencias, Universidad Auto´noma de Barcelona, 01893 Bellaterra, Barcelona, Spain c School

Herrera, Carlos M.

12

Immigration, work and health in Spain: the influence of legal status and employment contract on reported health indicators  

E-Print Network [OSTI]

Universidad de Valencia, Valencia, Spain J. Benach HealthNetwork (Emconet), Barcelona, Spain A. M. Garc? a Á M.and Health (ISTAS), Madrid, Spain C. Ruiz-Frutos Department

2010-01-01T23:59:59.000Z

13

Meteorology Group, Departament de Fsica, Universitat de les Illes Balears, Palma de Mallorca, Spain IMEDEA, UIB-CSIC, Palma de Mallorca, Spain  

E-Print Network [OSTI]

, Spain 2 IMEDEA, UIB-CSIC, Palma de Mallorca, Spain 3 Instituto Nacional de Meteorologõ�a, Madrid, Spain Geltru, Barcelona, Spain A Case of Convection Development over the Western Mediterranean Sea: A Study of precipitation were recorded in coastal lands of eastern Spain, and 180 mm were estimated over the sea with radar

Romero, Romu

14

This is the authors' version of the work. It is posted here for your personal use only. Not for redistribution. The definitive version is accepted for publication in the European Wireless 2014, Barcelona, Spain, May 2014.  

E-Print Network [OSTI]

, Spain, May 2014. Distributed Spectrum Allocation for Autonomous Cognitive Radio Networks Anatolij Zubow usage of non-occupied spectrum licensed to Pri- mary Users (PU). With the Non-Contiguous OFDM of available spectrum. A promising solution to achieve this goal is the Cognitive Radio (CR) approach

Wichmann, Felix

15

The Dirichlet Problem for the Total Variation Flow Dept. de An'alisis Matem'atico, Universitat de Valencia, 46100 Burjassot (Valencia), Spain  

E-Print Network [OSTI]

'atico, Universitat de Valencia, 46100 Burjassot (Valencia), Spain C. Ballester Department of Tecnologia, University of Pompeu­Fabra, La Rambla 30­32, 08002 Barcelona, Spain V. Caselles Department of Tecnologia, University of Pompeu­Fabra, La Rambla 30­32, 08002 Barcelona, Spain J. M. Maz'on Dept. de An'alisis Matem

Caselles, Vicent

16

INTRODUCTION The massive sulfide deposits of southern Spain  

E-Print Network [OSTI]

INTRODUCTION The massive sulfide deposits of southern Spain and Portugal were formed about 300 Ma). Spain became a Roman province, and mining of the rich deposits of the Iberian pyrite belt for copper, California 94025 A. Palanques Instituto de Ciencias del Mar, 08039 Barcelona, Spain ABSTRACT A metal

van Geen, Alexander

17

Helsinki Journal, Entry 38, April 22, 2007 Well, we have successfully completed our eleven day trip to Spain. Our itinerary  

E-Print Network [OSTI]

to Spain. Our itinerary was as follows: catch a morning flight from Helsinki to Barcelona, sightsee-efficient design and architecture, but thank God for countries like Spain, where beauty can trump practicality

Bardsley, John

18

SEDIMENTARY ARCHITECTURE AND CONTROLING MECHANISMS, LLOBREGAT DELTA, HOLOCENE-PLEISTOCENE (SPAIN)  

E-Print Network [OSTI]

SEDIMENTARY ARCHITECTURE AND CONTROLING MECHANISMS, LLOBREGAT DELTA, HOLOCENE-PLEISTOCENE (SPAIN baixa. E-08034 Barcelona, Spain. E-mail: (desire.gamez@upc.edu) 2 ICREA, Geomodels- Dep. of Geotechnical Madrid, Spain The reconstruction of the sedimentary architecture of the Llobregat delta is based

Politècnica de Catalunya, Universitat

19

Seropositivity and Risk Factors Associated with Toxoplasma gondii Infection in Wild Birds from Spain  

E-Print Network [OSTI]

Spain Oscar Cabezo´ n1 , Ignacio Garci´a-Bocanegra2 , Rafael Molina-Lo´ pez3 , Ignasi Marco1 , Juan M Veterinaria, Universitat Auto`noma de Barcelona, Bellaterra, Spain, 2 Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad de Co´rdoba, Co´rdoba, Spain, 3 Centre de Fauna Salvatge de Torreferrussa

Richner, Heinz

20

INFORMATION MEETINGS: HBC 340-G from 12:00-1:00 on Wednesday, 9/28 Spend Spring Break in Spain  

E-Print Network [OSTI]

in Spain Spring break 2012 in Madrid, Toledo and Barcelona SPA 300.3 Culture and Arts of Spain (1 and monuments in Castile Tuesday, March 13: Excursion to Toledo Lecture Jewish Spain and El Greco's paintings in Toledo Group lunch in Toledo Wednesday, March 14: Contemporary Spain

Kovalev, Leonid

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

On the late Miocene closure of the MediterraneanAtlantic gateway through the Guadix basin (southern Spain)  

E-Print Network [OSTI]

(southern Spain) S.K. Hüsing a, , O. Oms b , J. Agustí c , M. Garcés d , T.J. Kouwenhoven e , W. Krijgsman, 08193 Bellaterra, Spain c Institut de Paleontologia M. Crusafont, Escola Industrial 23, 08201 Sabadell, Spain d Group of Geodynamics and Basin Analysis, University of Barcelona, Campus de Pedralbes, 08028

Utrecht, Universiteit

22

Cerda and Barcelona : research and plan  

E-Print Network [OSTI]

The Industrial Revolution had a huge impact on nineteenth century cities had plans to expand the "old city". Due to its historical controversy a plans developed during that time was the Eixample plan in Barcelona. The ...

Alonso Fernández, Valeria, 1977-

2008-01-01T23:59:59.000Z

23

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

24

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

25

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

26

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

27

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

28

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

29

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

30

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

31

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

32

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

33

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

34

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

35

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

36

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

37

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

38

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

39

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

40

First Results of a Full Scaled Passive Treatment System for High Metal Concentration AMD at the Iberian Pyrite Belt, SW Spain  

E-Print Network [OSTI]

at the Iberian Pyrite Belt, SW Spain M. A. Caraballo a), F. Macías a), T. S. Rötting b), J. M. Nieto a), C. Ayora c) a) Department of Geology, University of Huelva. Avda. Fuerzas Armadas s/n, 21071 Huelva, Spain "Jaume Almera" CSIC, Lluís Solé y Sabarís, s/n. Barcelona 08028, Spain. Abstract Acidity load

Politècnica de Catalunya, Universitat

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

42

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

43

ISFNT-11, Barcelona, Spain, September 16-20, 2013 2013, ITER Organization  

E-Print Network [OSTI]

, Fabrication and Testing of the ITER First Wall and Shielding Blanket Presented by A. René Raffray Blanket Domestic Agency; 7SNL , US ITER Domestic Agency; 11th International Symposium on Fusion Nuclear Technology and neutron loads in the vacuum vessel and ex-vessel components · Provide a plasma-facing surface which

Raffray, A. René

44

E-Print Network 3.0 - argonaut barcelona reactor Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

studies of such phenomena and their mathematical modeling... . Packard (Santa FeVenice) R. Rigler (StockholmLausanne) F. Sagues (Barcelona) K. C. Showalter Source:...

45

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

46

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

47

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

48

Ris National Laboratory Radiation Research Department  

E-Print Network [OSTI]

Quimica Analitica, Facultat de Quimica, Universitat de Barcelona, 08028 Barcelona, Spain 15 Commissariat à

49

SPAIN PROGRAM Madrid Four Week /  

E-Print Network [OSTI]

SPAIN PROGRAM Madrid Four Week / Madrid and Málaga Six Week 2014 Summer Program APPLICATION FORM face to scapobia@binghamton.edu. It will be used to make a photo ID card for you to use in Spain. 7 and the full refund and cancellation policy on the Spain program website pages. 8. Submit all materials to the

Suzuki, Masatsugu

50

Appears in Proceedings of the 10th Annual International Conference on Parallel Architectures and Compilation Techniques, Barcelona, Spain, September 2001.  

E-Print Network [OSTI]

of Inter-Chain Memory Parallelism for Pointer-Chasing Codes Nicholas Kohout Seungryul Choi Dongkeun Kim, College Park Univ. of Maryland, College Park nicholas.j.kohout@intel.com choi@cs.umd.edu fdongkeun

Yeung, Donald

51

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

52

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

53

EXCHANGE INTERNSHIP (code 25802). Regulations School of Industrial Engineering of Barcelona (ETSEIB)  

E-Print Network [OSTI]

EXCHANGE INTERNSHIP (code 25802). Regulations School of Industrial Engineering of Barcelona (ETSEIB) Definition and aims 1. Definition and characteristics of the exchange internship 1.1 Exchange internships are designed for exchange students whose internship period at the ETSEIB is not validated by their home

Casanellas, Marta

54

Index of /~lipman/Spain  

E-Print Network [OSTI]

Index of /~lipman/Spain. [ICO], Name · Last modified · Size · Description. [DIR], Parent Directory, -. [ ], 1. Derived_categories_and_functors.pdf, 22-Feb-2009 04:

55

Congreso de Metodos Numericos en Ingenieria 2009 Barcelona, 29 junio al 2 de julio, 2009  

E-Print Network [OSTI]

Congreso de M´etodos Num´ericos en Ingenier´ia 2009 Barcelona, 29 junio al 2 de julio, 2009 c SEMNI-Felgueroso2 , Ferm´in Navarrina1 y Manuel Casteleiro1 GMNI--Grupo de M´etodos Num´ericos en Ingenier no estructuradas, M´etodos num´ericos de alto orden Resumen. En este trabajo se presenta una t´ecnica de detecci

Colominas, Ignasi

56

Congreso de Metodos Numericos en Ingenieria 2009 Barcelona, 29 junio al 2 de julio, 2009  

E-Print Network [OSTI]

Congreso de M´etodos Num´ericos en Ingenier´ia 2009 Barcelona, 29 junio al 2 de julio, 2009 c SEMNI´in Navarrina1 y Manuel Casteleiro1 GMNI--Grupo de M´etodos Num´ericos en Ingenier´ia Departamento de M´etodos dise~no de aeronaves. Sin embargo, la aplicaci´on de m´etodos num´ericos exitosos en CFD a la resoluci

Colominas, Ignasi

57

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

58

Mirrors and Echoes: Women's Writing in Twentieth-Century Spain  

E-Print Network [OSTI]

Contemporary Women Writers of Spain. Boston: Twayne, 1988.L. , ed. Women Writers of Spain: An Annotated Bio-Biblio-Identity in Contemporary Spain, ed. Jo Labanyi. New York:

Bergmann, Emilie L.; Herr, Richard

2007-01-01T23:59:59.000Z

59

Economy and Rhetoric of Exchange in Early Modern Spain  

E-Print Network [OSTI]

Elliott, J. H. Imperial Spain 1469-1716. London: Penguin,2002. ---. Spain and its World 1500-1700. New Haven andin Early Seventeenth- Century Spain. Lewisburg: Bucknell UP,

Ruiz, Eduardo German

2010-01-01T23:59:59.000Z

60

Artisans and work in a Barcelona cotton factory (1770-1816)  

E-Print Network [OSTI]

curioso, erudito, econo?mico y comercial, 191 (7 January 1787), copy in BC: Arxiu Go`nima, 68/4. 31. AHCB: FC, B?242: Book of salaries, 1780. 32. AHCB: Arxiu del Veguer, XXXVII?1244, 1796; AHCB: FC, B?246: Book of salaries, 1784. 33. Arxiu de Santa Maria...`ncia [hereafter, RA], plets civils,n. 1092, Rosa Coll versus Domingo Crous, 1793. 35. AHCB: FC, B?253: Book of salaries, 1792. 36. AHCB: FC, B?257: Book of salaries, 1795. 37. For an example of the average of a household income, see Arxiu Diocesa` de Barcelona...

Vicente, Martha Valentin

2000-04-01T23:59:59.000Z

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Professor Ignacio Luengo, Universidad Complutense, Madrid, Spain ...  

E-Print Network [OSTI]

Apr 14, 2009 ... Speaker: Professor Ignacio Luengo, Universidad Complutense, Madrid, Spain. Title: “Rational Cuspidal Curves, Surface Singularities and ...

1910-90-41T23:59:59.000Z

62

The Electricity Industry In Spain Edward Kahn  

E-Print Network [OSTI]

PWP-032 The Electricity Industry In Spain Edward Kahn August 1995 This paper is part of the working-5180 www.ucei.berkeley.edu/ucei #12;1 The Electricity Industry In Spain Edward Kahn Lawrence Berkeley the current structure of the electricity industry in Spain and recent changes to its legal and regulatory

California at Berkeley. University of

63

Foreign Fishery Developments United States-Spain  

E-Print Network [OSTI]

Foreign Fishery Developments United States-Spain Fisheries Trade, 1980-85 Introduction The U though Spain was forced to become a net importer of fishery products in 1977. due to the extension of 200-mile Exclusive Economic Zones (EEZ) by coastal coun tries. U.S. exports of edible seafoods to Spain

64

UNIVERSIDAD CARLOS III de MADRID Madrid, Spain  

E-Print Network [OSTI]

UNIVERSIDAD CARLOS III de MADRID Madrid, Spain College of Charleston Bilateral Exchange Program Spain and around the world. It programs in Business Ad- ministration, Economics and Law are ranked among the best in Spain. While studying at UC3M, students are able to partake of the vibrant culture of Madrid

Young, Paul Thomas

65

Pain in Spain: Immigrant Integration and Prosperity  

E-Print Network [OSTI]

Pain in Spain: Immigrant Integration and Prosperity Kevin Kennedy University of New Hampshire % Unemployment Rate, 2008-2010 Time #12;Background Foreign Population in Spain by Countries 2011 2010 Foreigners #12;Foreign-Born Population in Spain Year Total % of Total Population 2008 6418. 1 14.1 2007 6044. 5

New Hampshire, University of

66

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

67

CURRICULUM VITAE CARLES BOIX  

E-Print Network [OSTI]

of Barcelona, Spain): June 1986. B.A. in Law (University of Barcelona, Spain): June 1985. ACADEMIC EXPERIENCE Science and of Economics. Universitat Pompeu Fabra, Barcelona, Spain. 1996-97, Spring 1998. HONORS

68

The Virtual Observatory and Grid in Spain  

E-Print Network [OSTI]

The Virtual Observatory (VO) is nearing maturity, and in Spain the Spanish VO (SVO) exists since June 2004. There have also been numerous attempts at providing more or less encompassing grid initiatives at the national level, and finally Spain has an official National Grid Initiative (NGI). In this article we will show the VO and Grid development status of nationally funded initiatives in Spain, and we will hint at potential joint VO-Grid use-cases to be developed in Spain in the near future.

J. D. Santander-Vela

2008-07-08T23:59:59.000Z

69

Appears in Workshop on Memory Access Decoupled Architectures, PACT-01, Barcelona, Spain, September 2001 1 Multithreading Decoupled Architectures for Complexity-Effective  

E-Print Network [OSTI]

, as they depend on large multi-ported and highly-associative structures. Additionally, with energy consumption, the decentralized nature of decoupled designs makes them inherently scalable. Due to the increased demands

70

TME Spain | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWende NewSowitec do Brasil EnergiaSur deT-O Green EuropeTME Spain

71

from the members: The naked truth of postdocs in Spain  

E-Print Network [OSTI]

cuts will cause “exodus” from Spain. Science, 336, 139-140.naked truth of postdocs in Spain With this letter we intendfellowship to later return to Spain thanks to another (

Jimenez-Valverde, Alberto; Acevedo, Pelayo

2012-01-01T23:59:59.000Z

72

Is Nothing Sacred? Spain Performs the Death of God  

E-Print Network [OSTI]

The Poetry of modernismo in Spain." The Cambridge HistoryNothing Sacred? Spain Performs the Death of God Is Alrick C.tone of nineteenth-century Spain evolves, in the strategy of

Knight, Jr., Alrick C.

2006-01-01T23:59:59.000Z

73

Light pollution in Spain. An european perspective  

E-Print Network [OSTI]

Spain appears in light pollution maps as a country less polluted than their neighbours in the European Union. This seems to be an illusion due to its low population density. The data indicate that Spain is one of the most contaminated countries. To reach these conclusions we compare the Spanish case to those of other European countries.

Alejandro Sanchez de Miguel; Jaime Zamorano

2008-10-23T23:59:59.000Z

74

Secrets of the arts : Enlightenment Spain's contested Islamic craft heritage  

E-Print Network [OSTI]

This dissertation examines the artistic and architectural mutations occurring in Spain during the eighteenth century, when Spain decided to participate in the Enlightenment's philosophical project that emphasized the ...

Francis, Razan

2014-01-01T23:59:59.000Z

75

Live in Spain while earning academic credit Spring 2013  

E-Print Network [OSTI]

+ + + Live in Spain while earning academic credit Spring 2013 · Study at one of Spain's oldest Spain with other CSU students · Take advantage of the opportunities you will have to travel throughout Spain & greater Europe Centrally located 20 miles from the vibrant city of Madrid, Alcalá de Henares

76

J. Phys. I France 6 (1996) 1967-1986 DECEMBER1996, PAGE 196 Organic Ferromagnets. Hydrogen Bonded Supramolecular  

E-Print Network [OSTI]

de Barcelona, CSIC, Campus de la U-A-B., 08193-Bellaterra. Catalunya. Spain (~ Departament de Quimica Fiqic~, Facultat de Quimica, Universitat de Barcelona, Av. Diagonal 647, 08028-Barcelona, Spain (Receii

Paris-Sud XI, Université de

77

Low-Cost Photovoltaics: Luminescent Solar Concentrators And Colloidal Quantum Dot Solar Cells  

E-Print Network [OSTI]

Photovoltaic Solar Energy Conference and Exhibition, Barcelona, Spain,Photovoltaic Solar Energy Conference and Exhibition, Valencia, Spain,

Leow, Shin Woei

2014-01-01T23:59:59.000Z

78

Spain offers a total of 900 Millions Spain proposes to double her contribution to host ITER, the experimental fusion  

E-Print Network [OSTI]

Spain offers a total of 900 Millions Spain proposes to double her contribution to host ITER commission Romani Prodi and the rotating presidency of the European Union, held by Italy, that Spain. The science and technology minister, Juan Costa, stated that Spain is now willing to contribute 20

79

Course Syllabus-"Sketches of Spain": Spain in Contemporary Mass and Visual Culture Language of Instruction: English  

E-Print Network [OSTI]

Course Syllabus-"Sketches of Spain": Spain in Contemporary Mass and Visual Culture Language and assets and in the development of Spain's main industries and businesses, leveraging the legacy would address questions such as: how is "Spanish-ness" been fabricated in Spain and outside? how does

80

A residential energy demand system for Spain  

E-Print Network [OSTI]

Sharp price fluctuations and increasing environmental and distributional concerns, among other issues, have led to a renewed academic interest in energy demand. In this paper we estimate, for the first time in Spain, an ...

Labandeira Villot, Xavier

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Chemistry & Biology 13, 815823, August 2006 2006 Elsevier Ltd All rights reserved DOI 10.1016/j.chembiol.2006.06.001 Rational Dissection of Binding Surfaces  

E-Print Network [OSTI]

University Dr Aiguader 80 08003 Barcelona Spain 2 Barcelona Science Park University of Barcelona Josep Samitier 1-15 08028 Barcelona Spain 3 Severo Ochoa Center for Molecular Biology (CBMSO) CSIC-UAM 28049 Cantoblanco Spain 4 Animal Health Research Center (CISA-INIA) 28130 Valdeolmos Spain Summary Peptide

Pompeu Fabra, Universitat

82

Rationale for precise and accurate 210 Pb assay in  

E-Print Network [OSTI]

- Institut de Ciència i Tecnologia Ambientals, Universitat Autònoma de Barcelona, 08193 Bellaterra, Spain 5

83

Discriminating Shareholders through the Exclusion of Pre-emption Rights? The European Infringement Proceeding against Spain  

E-Print Network [OSTI]

Kristoffel Grechenig ECFR 4/2007 V. Why Spain? . . . . . . .Commission decided to call on Spain to change its corporatewould decrease in value. Spain considered the Com- missions

Grechenig, Kristoffel

2009-01-01T23:59:59.000Z

84

Is Spain a Statist Society? A Research Perspective on Organizations, Reflexivity and Collective Action  

E-Print Network [OSTI]

the United Kingdom and Spain”, Dirección General de Cienciathe United Kingdom and Spain. ” Dirección General de Ciencia1994b. “Social Movements in Spain. ” Tocqueville Revue, Vol.

Laraña, Enrique

2009-01-01T23:59:59.000Z

85

Readings in Common: Assimilation and Interpretive Authority in Early Modern Spain  

E-Print Network [OSTI]

Practice in Early Modern Spain. Minneapolis: University of1993. Harvey, L. P. Muslims in Spain, 1500-1614. Chicago:of Religion in Early Modern Spain. Princeton: Princeton

Kimmel, Seth Ross

2010-01-01T23:59:59.000Z

86

Mediterranean clonal selections evaluated for modern hedgerow olive oil production in Spain  

E-Print Network [OSTI]

station, Constantí, Catalonia, Spain. We are grateful toBoella farm (La Canonja, Spain) for their collaboration inolive oil production in Spain Paul M. Vossen by Joan Tous,

Tous, Joan; Romero, Agusti; Hermoso, Juan Francisco; Ninot, Antonia

2011-01-01T23:59:59.000Z

87

In:Safeprocess'09, 7th IFAC Symposium on Fault Detection, Supervision and Safety of Technical Processes, Barcelona, 2009. ISBN: 978-3-902661-46-3  

E-Print Network [OSTI]

Processes, Barcelona, 2009. ISBN: 978-3-902661-46-3 Post-mortem Diagnosis of Bottling Plants Based-based system that performs post-mortem fault localization of food packaging plants and, more specifically, bottling plants based on recorded data. In this project, we need to cope with non-negligible transportation

Cengarle, María Victoria

88

The Pitfalls of Democracy and Debate: Authority and Inequality in Classrooms in Southeast Spain  

E-Print Network [OSTI]

F. (2011, February 7). Spain’s salad growers are modern-dayclasses in southeast Spain. She can be contacted atin Classrooms in Southeast Spain Maisa Taha University of

Taha, Maisa

2013-01-01T23:59:59.000Z

89

Internship in Toulouse FRANCE / Girona SPAIN / Nottingham UK The Company  

E-Print Network [OSTI]

Internship in Toulouse FRANCE / Girona SPAIN / Nottingham UK The Company Stipje is an organisation. We have offices in the United Kingdom, France and Spain and have students working with us from almost

Rostock, Universität

90

Computer Architecture and Electronics Department University of Crdoba (Spain)  

E-Print Network [OSTI]

Computer Architecture and Electronics Department University of Córdoba (Spain) Advance Driver. The University of Córdoba is one of the most prestigious universities in Spain, and a pioneer in the fields

Kuehnlenz, Kolja

91

Senior DOE Officials in Spain to Participate in World Petroleum...  

Broader source: Energy.gov (indexed) [DOE]

Senior DOE Officials in Spain to Participate in World Petroleum Congress, July 1, 2008 Senior DOE Officials in Spain to Participate in World Petroleum Congress, July 1, 2008 Senior...

92

CP 2005 Sitges, Spain, October 3, 2005 Preference Reasoning  

E-Print Network [OSTI]

CP 2005 Sitges, Spain, October 3, 2005 Preference Reasoning Francesca Rossi University of Padova, Italy CP 2005 Sitges, Spain, October 3, 2005 Joint work with ... Stefano Bistarelli, Univ. Pescara, Australia CP 2005 Sitges, Spain, October 3, 2005 Ultimate goal A formalism to model many kinds

Rossi, Francesca

93

Spain and the Bologna Plan: A Modern Day  

E-Print Network [OSTI]

Spain and the Bologna Plan: A Modern Day Controversy By: Danielle Vasan Communication of Privatization #12;Higher Education in Spain before Bologna 1983: Three-cycled degree system Diplomado (3-5 years) Licenciado (1-2 years) Doctor (3 years & Thesis) #12;Higher Education in Spain Today Graduado

New Hampshire, University of

94

UMass Lowell Intensive Spanish Language & Culture in Cdiz, Spain  

E-Print Network [OSTI]

UMass Lowell Intensive Spanish Language & Culture in Cádiz, Spain Program Description Travel to Spain and study at the University of Cádiz in a specialized intensive language program established Lowell During the Summer in Cádiz, Spain! Complete Levels 1-4 (12 credit) of Spanish language in one

Massachusetts at Lowell, University of

95

Regional Management of Mediterranean Ecosystems in Spain1  

E-Print Network [OSTI]

Regional Management of Mediterranean Ecosystems in Spain1 Jose A. Carrera, Estanislao de Simon Conservacion de la Naturaleza), Madrid, Spain. Abstract: Management of the fragile and greatly modified level studies on reforestation, hydrol- ogy, and desert control. Most of Spain has a typical

Standiford, Richard B.

96

Renewable Energy Policy and Developments in Spain  

E-Print Network [OSTI]

Renewable Energy Policy and Developments in Spain Wednesday, October 30, 2013 4:00 - 5:30 p in Spanish energy policy. In this talk, Labandeira describes Spanish policies to promote renewable energy, assessing their effectiveness within a wider energy and public-policy context. RSVP link: Download any free

Zhang, Junshan

97

VOLUME 87, NUMBER 2 P H Y S I C A L R E V I E W L E T T E R S 9 JULY 2001 Noise-Induced Scenario for Inverted Phase Diagrams  

E-Print Network [OSTI]

'Estructura i Constituents de la Matèria, Universitat de Barcelona, Diagonal 647, E-08028 Barcelona, Spain 2, Spain 3 Instituto Mediterráneo de Estudios Avanzados (CSIC-UIB), E-07071 Palma de Mallorca, Spain

Toral, Raúl

98

Animal Antimicrobial Peptides: An Overview  

E-Print Network [OSTI]

, Barcelona, Spain 2 Centro de Investigaciones Biolo´ gicas (CSIC), Madrid, Spain Abstract: Antibiotic´ i Franque`s 1-11, E-08028 Barcelona, Spain; email: andreu@admin.qo.ub.es Contract grant sponsor

Pompeu Fabra, Universitat

99

BioMed Central Page 1 of 18  

E-Print Network [OSTI]

/Baldiri Reixac 10-12, 08028 Barcelona, Spain, 2Life Sciences, Barcelona Supercomputing Center (BSC), c/Jordi Girona 29, 08034 Barcelona, Spain, 3Systems Biology, MRC Laboratory of Molecular Biology, Hills Road, CB2 Companys 23, 08010 Barcelona, Spain Email: Roland A Pache - roland.pache@irbbarcelona.org; M Madan Babu

Babu, M. Madan

100

E-Print Network 3.0 - american engineering record Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

36 The 2011 Barcelona European Academic Conference Barcelona, Spain 2011 Teaching, Innovation and the Engineering Summary: and the Engineering Communication Interface David...

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

J. Phys. I France 6 (1996) 1555-1565 DECEMBERI996, PAGE 1555 Stable Molecular Metal [Pd(dddt)2jAg154Br350: Syntl~esis,  

E-Print Network [OSTI]

of Experimental Mineralogy, Russian Academy of Sciences, Chemogolovka MD, 142432 Russia (~) Departament de Quimica Fisica, Facultat de Quimica, Universitat de Barcelona, 08028 Barcelona, Spain (~ Institut de Ciencia de

Paris-Sud XI, Université de

102

Madrid, Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowell Point,ECO Auger11.Spain: Energy Resources Jump to:

103

Territorial Dimension as Political Strategy: Elite-driven Center-Periphery Cleavage in Spain 1977-2008  

E-Print Network [OSTI]

Party Collaboration in Spain (1977-2004). ComparativeEthnoterritorial Concurrence in Spain. Publius: Journal ofand Regional Elections in Spain. South European Society and

Martinez-Tapia, Oscar

2008-01-01T23:59:59.000Z

104

asturias spain genetic: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

true of Jurassic turtles from Wes- tern Europe. A new genus and species of Late Jurassic turtle Benton, Michael 204 Last date modified 11613 Location and Institution SPAIN...

105

andratx mallorca spain: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: Iron oxide mineralogy in late Miocene red beds from La Gloria, Spain: rock-magnetic, voltammetric spectroscopy and voltammetry. All three methods have low limits...

106

NCORRECTEDPROOF JVAC 4963 111  

E-Print Network [OSTI]

-08003 Barcelona, Spain7 b Department of Organic Chemistry, University of Barcelona, Barcelona, Spain8 c Animal Health Research Center (INIA), Valdeolmos, Madrid, Spain9 d Severo Ochoa Center for Molecular Biology, CSIC, Cantoblanco, Madrid, Spain10 Received 19 August 2004; accepted 22 October 2004 11 Abstract

Pompeu Fabra, Universitat

107

Zarzuela : or lyric theatre as consumer nationalism in Spain, 1874-1930  

E-Print Network [OSTI]

2003. Carr, Raymond. Spain, 1808-1975. 2 nd ed. Oxford:Chase, Gilbert. The Music of Spain. 2 nd rev. ed. New York:in Renaissance England and Spain. Ithaca: Cornell UP, 1985.

Young, Clinton David

2006-01-01T23:59:59.000Z

108

International Family Business Succession Planning. Recent Developments in Germany and Spain  

E-Print Network [OSTI]

4. Recents reforms in Spain 4.1. Family Protocols in theDevelopments in Germany and Spain Business Roland Krausein North America; 50% in Spain and 80 % in Germany. 8

Krause, Roland

2009-01-01T23:59:59.000Z

109

Last date modified 1/16/13 Location and Institution SPAIN -MADRID  

E-Print Network [OSTI]

Last date modified 1/16/13 Location and Institution SPAIN - MADRID ST. LOUIS/or Scholarships http://spain.slu in Spain. You must apply within 3 months prior to departure. Documents must

Galles, David

110

Traumatized subjects : horror film and the legacy of mass extermination in post-dictatorship Spain  

E-Print Network [OSTI]

6-18. No-Do. Dir. Elio Quiroga. Spain: Eqlipse ProduccionesDir. Antonio Bayona. Spain: Rodar y Rodar, 2007. Los ojos deDir. Guillem Morales. Spain: Rodar y Rodar, 2010. Ortega y

Boehm, Scott Walter

2012-01-01T23:59:59.000Z

111

SPAN 320's (all civ courses, Spain and Latin America) Course Objectives and Programmatic Alignment  

E-Print Network [OSTI]

SPAN 320's (all civ courses, Spain and Latin America) Course Objectives in Spain/Latin America's social history Graded oral presentation Essays 1a, 1b

Mayfield, John

112

E-Print Network 3.0 - asturias spain idria Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sites from northwestern Spain... , near Spain, by 1988 (Hay 1990). In Venice Lagoon in northern Italy in 1992 and in Mar Picolo Source: San Francisco Estuary...

113

E-Print Network 3.0 - almaden asturias spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sites from northwestern Spain... , near Spain, by 1988 (Hay 1990). In Venice Lagoon in northern Italy in 1992 and in Mar Picolo Source: San Francisco Estuary...

114

European Regional Science Association 51s t European Congress  

E-Print Network [OSTI]

European Regional Science Association ­ 51s t European Congress Barcelona, Spain, 30t h August ­ 3r Association ­ 51s t European Congress Barcelona, Spain, 30t h August ­ 3r d September 2011 2 Introduction

115

TAXONOMIC POTENTIAL OF THE CHEMICAL CONSTITUENTS  

E-Print Network [OSTI]

GINEBREDA * Departamento de Quimica Orgánica Bio16gica (C. l. D., C.S.I. C.), . J. Girona Salgado 18, 08034 Barcelona, Spain ' ** Passeig Bonanova 75, 08017 Barcelona, Spain *** Secci6n de Quimica Cubntica

Paris-Sud XI, Université de

116

CROSS-CULTURAL BUSINESS BEHAVIOR. DOING BUSINESS IN SPAIN. (SUMMER 2012)  

E-Print Network [OSTI]

CROSS-CULTURAL BUSINESS BEHAVIOR. DOING BUSINESS IN SPAIN. (SUMMER 2012) Lecturer: Ms. Pilar Barra etiquette and the way to negotiate in Spain. - To analyse the keys to improve business negotiations in Spain Traditions and Customs 2.- Corporate Culture in Spain 2.1 Spanish Economy 2.2 Corporate Culture in Spanish

Escolano, Francisco

117

Volume 102, pp. 209220 OctoberDecember 2007 Observations in Pluteus section Pluteus in Spain  

E-Print Network [OSTI]

in Spain: two new records for Europe A. Justo & M.L. Castro fjusto@uvigo.es or alfredo de Vigo E-36310 Vigo Spain Abstract -- Pluteus atropungens and Pluteus brunneidiscus are recorded in studies of fungal biodiversity in the Iberian Peninsula (Spain, Portugal) and Balearic Islands (Spain

Hibbett, David S.

118

Coming out in Spain: 'Los Invisibles Published Thursday 24th February 11  

E-Print Network [OSTI]

Coming out in Spain: 'Los Invisibles Published Thursday 24th February 11 Dr Richard Cleminson in Spain. His co-authored 'Los Invisibles': A History of Male Homosexuality in Spain, 1850 been published in Spain. "The history of this period must never be forgotten. It serves not only

Berzins, M.

119

GENERAL CO-CHAIRS: F. J. Perales (Univ. Illes Balears, Spain)  

E-Print Network [OSTI]

GENERAL CO-CHAIRS: F. J. Perales (Univ. Illes Balears, Spain) B. Fisher (University of Edinburgh, UK) PROGRAM COMMITTEE: Abásolo, M. (DMI-UIB, Spain) Aloimonos, Y. (Univ. of Maryland, USA) Bagdanov, A. D. (UAB-CVC, Spain) Baldasarri, S. (Univ. Zaragoza, Spain) Bartoli A. (CNRS_LASMEA, France

Illes Balears, Universitat de les

120

Fusing Statecharts and Java MARIA-CRISTINA MARINESCU, Computer Science Dept., Universidad Carlos III, Leganes, Spain  

E-Print Network [OSTI]

III, Legan´es, Spain C ´ESAR S ´ANCHEZ, IMDEA Software Institute, Spain and Institute for Applied Physics, CSIC, Spain This paper presents FUSE, an approach for modeling and implementing embedded software-Cristina Marinescu, Computer Science Dept., Universidad Carlos III de Madrid, Leganes, Spain; C´esar S´anchez IMDEA

Sánchez, César

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

MANAGING THE NATIONAL ROAD NETWORK MAINTENANCE IN SPAIN Vctor Gmez Fras  

E-Print Network [OSTI]

MANAGING THE NATIONAL ROAD NETWORK MAINTENANCE IN SPAIN Víctor Gómez Frías GETINSA (Spain), vgomez@getinsa.es Teresa Sánchez Chaparro ANECA (Spain), tsanchez@aneca.es ABSTRACT The Spanish Ministry of Public Works point of view. In order to understand the importance and difficulty that presents in Spain

Paris-Sud XI, Université de

122

Sir --We read with interest your editorial "Ending the pain in Spain" (Nature 428, 1;  

E-Print Network [OSTI]

Sir -- We read with interest your editorial "Ending the pain in Spain" (Nature 428, 1; 2004 expertise and will to come and work in Spain. Mark van Raaij* Departamento de Bioquímica, Facultad de postdoc working outside Spain for almost five years, I welcome your Editorial "Ending the pain in Spain

123

cond-mat/980426724Apr1998 Confinement and Quantization Effects  

E-Print Network [OSTI]

to the presence of 1) Present address: Institut de Cienca de Materials de Barcelona, 08193 Bellaterra, Spain 2

Moshchalkov, Victor V.

124

Comparison of the Evolution of Energy Intensity in Spain and in the EU15. Why is Spain Different?  

E-Print Network [OSTI]

Energy intensity in Spain has increased since 1990, while the opposite has happened in the EU15. Decomposition analysis of primary energy intensity ratios has been used to identify which are the key sectors driving the ...

Ocaña, Carlos

125

Alvin W. Orbaek 1904 Addison Rd Apt 4, Houston, TX 77030  

E-Print Network [OSTI]

Catalonia, Barcelona, Spain Space Studies (87% grade average) May 2003 National University of Ireland Galway at ACS meeting. CTAE, Barcelona, Spain Junior Engineer May 2007-August 2007 Galactic Suite Space Hotel. Deloitte S2G, Barcelona, Spain Accounts Payable Assistant 2003 ­ 2005 Record Retention manager, Training

Alvarez, Pedro J.

126

July 2013 M.S. in Genetics -University of A Corua, A Corua, Spain June 2012 B.S. in Biology -University of A Corua, A Corua, Spain  

E-Print Network [OSTI]

EDUCATION July 2013 M.S. in Genetics - University of A Coruña, A Coruña, Spain June 2012 B.S. in Biology - University of A Coruña, A Coruña, Spain RESEARCH INTERESTS Marine Biology, Genotoxicology, Chromosomal Proteins, Molecular Evolution, Genomics, Molecular Techniques. 2011 University of A Coruña, Spain

Eirin Lopez, Jose Maria

127

Fox, J., Parsons, S., Krause, P., and Elvang-Goransson, M. (1993) A generic framework for uncertain reasoning, in Qualitative Reasoning and Decision Technologies, N. Piera Carret and M. G. Singh eds., CIMNE Press, Barcelona.  

E-Print Network [OSTI]

Press, Barcelona. Ginsberg, M. L. (1987) Readings in non-monotonic reasoning, Morgan-Kaufmann, San Mateo-303. Prade H., and Testemale C. (1987) Representation of soft constraints and fuzzy attribute values by means, Boca Raton, Florida. Reiter, R. (1978) On closed world databases, in Logic and Databases, H. Gallaire

Parsons, Simon

128

Forging an Ascetic Planet: Jesuit Lives and Virtues on the Mission Frontier of Eighteenth-Century New Spain  

E-Print Network [OSTI]

Atlantic World: Britain and Spain in America, 1492-1830. Newcentury Revolution in Spain. Princeton: Princeton UP, 1958.265-76. Lynch, John. Bourbon Spain, 1700-1808. New York:

Green, Bryan David

2012-01-01T23:59:59.000Z

129

ACTIVITY COORDINATOR HOST LOCATION 1.1. Observation session for management level European partners UA Spain  

E-Print Network [OSTI]

UA Spain 1.2. Observation session for Staff level European partners UPMF France 2.1. Development.3. Management meetings UA, PU UA, PU Spain, Jordan 4. Networking and sustainability (network) 3. Capacity

130

E-Print Network 3.0 - asturias northern spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Publishers. Printed in the Netherlands. Summary: , near Spain, by 1988 (Hay 1990). In Venice Lagoon in northern Italy in 1992 and in Mar Picolo... Spain in Galicia by 1988,...

131

Proactive Recruitment and Retentionist Patterns of Migration and Nationality Policy in Argentina, Italy, and Spain (1850-1919).  

E-Print Network [OSTI]

and Nationality Policies in Argentina, Italy, and Spain (First, I examine Argentina’s policy of attracting migrants/and Nationality Policy in Argentina, Italy, and Spain (1850-

Cook Martín, David

2005-01-01T23:59:59.000Z

132

Tips on Studying Abroad at the Universidad Politcnica de Valencia in Spain  

E-Print Network [OSTI]

Tips on Studying Abroad at the Universidad Politécnica de Valencia in Spain Want to know what it- ence a new culture. · Valencia was the only place that CEE majors could go in Spain, so that's where I largest city in Spain, so don't worry about running out of things to do or being bored. From the City

Li, Mo

133

PEFC-Certified Fencing for 2010 Pamplona Bull Run JUL 05 2010 | SPAIN  

E-Print Network [OSTI]

PEFC-Certified Fencing for 2010 Pamplona Bull Run JUL 05 2010 | SPAIN This year, the fences marking and to create local jobs. Welcoming the decision, PEFC Spain Director, Ana Noriega commented "we are delighted to PEFC, the world's largest forest certification system and the leading system in Spain, ensuring

134

Late Quaternary deposition and facies model for karstic Lake Estanya (North-eastern Spain)  

E-Print Network [OSTI]

Late Quaternary deposition and facies model for karstic Lake Estanya (North-eastern Spain) MARIO-50059 Zaragoza, Spain (E-mail: mariomm@ipe.csic.es) EAWAG, Swiss Federal Institute of Aquatic Research Ca´diz, Poli´gono Ri´o San Pedro s/n, 11510 Puerto Real (Ca´diz), Spain Associate Editor: Stephen

Gilli, Adrian

135

Fire Effects and Fuel Management in Mediterranean Ecosystems in Spain1  

E-Print Network [OSTI]

Fire Effects and Fuel Management in Mediterranean Ecosystems in Spain1 Ricardo Vélez2 1 Presented, California. 2 Doctor Ingeniero de Montes, ICONA - Forest Fire Section, Madrid Spain. Abstract: Forest fuels in the Mediterranean eco- systems of Spain are characterized by generalized pyrophytism and large accumulations

Standiford, Richard B.

136

Country Profile -Spain What are my chances of getting a job?  

E-Print Network [OSTI]

1 Country Profile - Spain Job market What are my chances of getting a job? Finding graduate work in Spain is currently very difficult as unemployment is extremely high. In March 2012 the BBC reported that Spain has the highest unemployment rate in the European Union (EU), with almost one in four people

Banaji,. Murad

137

Astronomical forcing of sedimentary cycles in the middle to late Miocene continental Calatayud Basin (NE Spain)  

E-Print Network [OSTI]

Basin (NE Spain) H. Abdul Aziz aY *, F. Hilgen a , W. Krijgsman b , E. Sanz c , J.P. Calvo d, Spain d Departemento de Petrologia y Geoqu|¨mica, Fac. CC. Geolo¨gicas, Universidad Complutense, 28040 Madrid, Spain Received 16 August 1999; received in revised form 28 January 2000; accepted 29 January 2000

Utrecht, Universiteit

138

Numerical simulation and sensitivity study of a severe hailstorm in northeast Spain  

E-Print Network [OSTI]

Numerical simulation and sensitivity study of a severe hailstorm in northeast Spain E. García Atmósfera, Instituto de Medio Ambiente, Universidad de León, 24071 León, Spain b Grup de Meteorologia, Departament de Física, Universitat de les Illes Balears, Palma de Mallorca, Spain Accepted 8 August 2005

Romero, Romu

139

A Comparison of Management Strategies in the Oak Woodlands of Spain and California1  

E-Print Network [OSTI]

A Comparison of Management Strategies in the Oak Woodlands of Spain and California1 Lynn Huntsinger and savannas in California and southern Spain are compared. There are many similarities between the Spanish woodlands and savanna in California and southern Spain (table 1). Although the two woodlands have much

Standiford, Richard B.

140

Cultural Capital in Spain'S MeMory WarS Dr. SebaStiaan Faberoberlin College  

E-Print Network [OSTI]

History MeMory trutH Cultural Capital in Spain'S MeMory WarS Dr. SebaStiaan Faberoberlin College Since the late 1990s, Spain has seen a series of public disputes over the historical memory tell it--and the relationship that today's Spain should have with that past. In the past fifteen years

Andrews, Peter B.

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

SPAIN: COTS Data-Center Ethernet for Multipathing over Arbitrary Topologies  

E-Print Network [OSTI]

SPAIN: COTS Data-Center Ethernet for Multipathing over Arbitrary Topologies Jayaram Mudigonda switches, which could obviate the commodity pricing of these parts. In this paper, we describe SPAIN ("Smart Path Assign- ment In Networks"). SPAIN provides multipath forward- ing using inexpensive

142

Long-period eccentricity control on sedimentary sequences in the continental Madrid Basin (middle Miocene, Spain)  

E-Print Network [OSTI]

Miocene, Spain) Hemmo A. Abels a,b, , Hayfaa Abdul Aziz a,b , Wout Krijgsman b , Sander J.B. Smeets Madrid Basin (central Spain) is dated bio-magnetostratigraphically between 15.2 Ma and 11.5 Ma-dominated intervals is similar to a previously documented Late Miocene shift in the Teruel Basin of northeast Spain

Utrecht, Universiteit

143

Cestodes from Artemia parthenogenetica (Crustacea, Branchiopoda) in the Odiel Marshes, Spain  

E-Print Network [OSTI]

Cestodes from Artemia parthenogenetica (Crustacea, Branchiopoda) in the Odiel Marshes, Spain/n, 41013 Seville, Spain Abstract A total of 3,300 specimens of brine shrimps Artemia parthenogenetica from the Odiel Marshes, Huelva Province, SW Spain, were studied during several seasons of 2002 and 2003

Green, Andy J.

144

2011-2012BROWNBAGCOLLOQUIUMSERIES A Gambler's Penance in Seventeenth Century Spain  

E-Print Network [OSTI]

2011-2012BROWNBAGCOLLOQUIUMSERIES A Gambler's Penance in Seventeenth Century Spain WEDNESDAY, and Collaboration in Early Modern Spain," has been published in 2011. He has also published various chapters in books about Cervantes or about Masculinity in Spain and Italy. Additionally, he is a member

Berdichevsky, Victor

145

MODELING MULTIFUNCTIONAL AGROFORESTRY SYSTEMS WITH ENVIRONMENTAL VALUES: DEHESA IN SPAIN AND WOODLAND  

E-Print Network [OSTI]

Chapter MODELING MULTIFUNCTIONAL AGROFORESTRY SYSTEMS WITH ENVIRONMENTAL VALUES: DEHESA IN SPAIN Research (CSIC) Pinar 25, 28006, Madrid, Spain. e-mail: pcampos@ieg.csic.es; acaparros@ieg.csic.es 2 University Complutense, Madrid, Spain. E-mail: ecerdate@ccee.ucm.es 3 College of Natural Resources

Standiford, Richard B.

146

Analysis of badlands: coupling of tectonic and land surface processes in the Pyrenees of Spain  

E-Print Network [OSTI]

Analysis of badlands: coupling of tectonic and land surface processes in the Pyrenees of Spain MSc to rainstorms. In north-east Spain, sediment from rapidly eroding badlands has significantly reduced reservoir-funded research consortium (SESAM II) with partners at the University of Lleida, Spain

Baer, Christian

147

Testing models for the Messinian salinity crisis: The Messinian record in Almera, SE Spain  

E-Print Network [OSTI]

Testing models for the Messinian salinity crisis: The Messinian record in Almería, SE Spain Juan C Fuentenueva s.n., Universidad de Granada, 18002 Granada, Spain b School of Earth, Ocean and Planetary Sciences, SE Spain, display excellent exposures of Messinian (Late Miocene) sequences. The Sorbas, Almería

Riding, Robert

148

Last updated: June 13, 2013 4:29 pm Brain drain in Spain leaves  

E-Print Network [OSTI]

Last updated: June 13, 2013 4:29 pm Brain drain in Spain leaves scientific research on the wane By Tobias Buck in Madrid Amaya Moro-Martín returned to Spain five years ago, after spending 11 years generous funding and a tenured position in Spain. Ms Moro-Martín's fellowship runs out at the end

Moro-Martin, Amaya

149

FEEDING ECOLOGY OF THE BARN OWL IN CENTRAL CHILE AND SOUTHERN SPAIN: A COMPARATIVE STUDY  

E-Print Network [OSTI]

FEEDING ECOLOGY OF THE BARN OWL IN CENTRAL CHILE AND SOUTHERN SPAIN: A COMPARATIVE STUDY CARLOSM. HERREV&AND FABIANM. JAKSI·1 EstacidnBioldgicade Dogaria, Sevilla-12, Andalucia, Spain, and Instituto de of the Barn Owl (Tyro alba) in the mediterranean- climate areasof central Chile and southernSpain. In both

Herrera, Carlos M.

150

First report of Neofusicoccum parvum causing canker and die-back of Eucalyptus in Spain  

E-Print Network [OSTI]

First report of Neofusicoccum parvum causing canker and die-back of Eucalyptus in Spain Eugenia disease in Eucalyptus globulus in North Spain. Keywords Eucalyptus canker. Neofusicoccum parvum . Botryosphaeriaceae A canker disease outbreak was observed for the first time on Eucalyptus globulus in North Spain

151

Facultad de Ciencias Econmicas y Empresariales CROSS-CULTURAL BUSINESS BEHAVIOR. DOING BUSINESS IN SPAIN.  

E-Print Network [OSTI]

IN SPAIN. (SUMMER 2011) Lecturer: Ms. Pilar Barra. Department: Finance and Accounting. Universidad de intercultural communication. - To learn both business etiquette and the way to negotiate in Spain. - To analyse the keys to improve business negotiations in Spain. CONTENTS 0.- Introduction. Stereotypes 1.- Influences

Escolano, Francisco

152

BC3954/BC5974 Construction and Culture through Spain and Portugal  

E-Print Network [OSTI]

BC3954/BC5974 Construction and Culture through Spain and Portugal December 27, 2014 ­ January 11 and Culture through Spain and Portugal December 27, 2014 ­ January 11, 2015 The Department of Building Construction is offering its 13th annual interdisciplinary Winter Education Abroad Program through Spain

Beex, A. A. "Louis"

153

WORKING PAPER N 2007 -39 Income and wealth concentration in Spain in a  

E-Print Network [OSTI]

WORKING PAPER N° 2007 - 39 Income and wealth concentration in Spain in a historical and fiscal and Wealth Concentration in Spain in a Historical and Fiscal Perspective Facundo Alvaredo, Paris School of income and wealth in Spain over the 20th century using personal income and wealth tax return statistics

Boyer, Edmond

154

Madrid, Spain *This program is offered every Summer, Spring and Fall  

E-Print Network [OSTI]

Madrid, Spain *This program is offered every Summer, Spring and Fall To view the most recent information about the Spanish Language Immersion Program in Spain please go to the SDSU College of Extended 2009 Gloria Cossio and Jose Alberto Martinez Spain Summer 2008 Experience by Rodolfo Nubes My

Ponce, V. Miguel

155

Complementary Pu Resuspension Study at Palomares, Spain  

SciTech Connect (OSTI)

Soil in an area near Palomares, Spain, was contaminated with plutonium as a result of a mid-air collision of U.S. military aircraft in January 1966. The assessment for potential inhalation dose can be found in Iranzo et al., (1987). Long-term monitoring has been used to evaluate remedial actions (Iranzo et al., 1988) and there are many supporting studies of the Pu contamination at Palomares that have been carried out by the Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas (CIEMAT) in Madrid. The purpose of this study is to evaluate the resuspension of Pu from the soil in terms of Pu-concentrations in air and resuspension rates in a complementary investigation to those of CIEMAT but in an intensive short-term field effort. This study complements the resuspension studies of CIEMAT at Palomares with additional information, and with confirmation of their previous studies. Observed mass loadings (M) were an average of 70 mg/m{sup 3} with peaks in the daytime of 130 mg/m{sup 3} and low values at night below 30 {micro}g/m{sup 3}. The Pu-activity of aerosols (A) downwind of plot 2-1 was 0.12 Bq/g and the enhancement factor (E{sub f}) had a value of 0.3, which is low but similar to a typical value of 0.7 for other undisturbed sites. This E{sub f} value may increase further away from ground zero. The particle size distribution of the Pu in air measured by cascade impactors was approximately lognormal with a median aerodynamic diameter of 3.7 {micro}m and a geometric standard deviation of 3.5 in the respirable range. This peak midway between 1 ? m and 10 {micro}m in the respirable range is commonly observed. Daily fluctuations in the Pu concentration in air (C) detected by the UHV were lognormally distributed with a geometric standard deviation of 4.9 indicating that the 98th percentile would be 24 times as high as the median. Downwind of plot 2-1 the mean Pu concentration in air, C, was 8.5 {micro}Bq/m{sup 3}. The resuspension factor (Sf) was 2.4 x 10{sup -10} m{sup -1} and agrees very well with the values between 10{sup -10} m{sup -1} and 10{sup -9} m{sup -1} previously reported. We observed a mean Pu/Am ratio of 7.1 with a relative variation of 30%, which compares well with a mean value of 6.5 for nearby plot 2-2. The resuspension rate (R) was in the middle of the range, 10{sup -11} s{sup -1} to 10{sup -12} s{sup -1} as observed in other stable sites, and indicates low potential for Pu redistribution.

Shinn, J

2002-10-01T23:59:59.000Z

156

Paternal Genetic History of the Basque Population of Spain  

E-Print Network [OSTI]

This study examines the genetic variation in Basque Y chromosome lineages using data on 12 Y-short tandem repeat (STR) loci in a sample of 158 males from four Basque provinces of Spain (Alava, Vizcaya, Guipuzcoa, and Navarre). As reported...

Young, Kristin Leigh; Sun, Guangyun; Deka, Ranjan; Crawford, Michael H.

2011-01-01T23:59:59.000Z

157

The Ranero Hydrothermal Dolomites (Albian, Karrantza Valley, Northwest Spain)  

E-Print Network [OSTI]

The Ranero Hydrothermal Dolomites (Albian, Karrantza Valley, Northwest Spain): Implications Recherche Développement, Carbonate Sedimentology Group, avenue Larribau s/n, 64018 Pau Cedex - France e'Espagne) sont présentées dans cette étude. Les corps dolomitiques sont encaissés dans des carbonates de

Paris-Sud XI, Université de

158

1 INTRODUCTION In Spain, Plasticized polyvinyl chloride (PVC-  

E-Print Network [OSTI]

1 INTRODUCTION In Spain, Plasticized polyvinyl chloride (PVC- P) geomembranes began being used in waterproof- ing of infrastructure in the seventies. Early usage of PVC-P geomembranes was not particularly for the PVC-P homogeneous geomem- branes used in roofing. Subsequently, other stan- dards were drafted

Zornberg, Jorge G.

159

July 2010 M.S. in Molecular, Cellular Biology and Genetics -University of A Corua, A Corua, Spain. July 2009 B.S. in Biology -University of A Corua, A Corua, Spain.  

E-Print Network [OSTI]

, A Coruña, Spain. July 2009 B.S. in Biology - University of A Coruña, A Coruña, Spain. RESEARCH INTERESTS, Spain. ISBN:978-3-8484-5960-8, pp. 1-66. Ciro Rivera-Casas Ph. D. Student - Department of Cellular15171, Spain GRANTS Grants as a particioant researcher 2011 MICINN, Spanish Research Program

Eirin Lopez, Jose Maria

160

ELSEVIER Journal of Electroanalytical Chemistry 392 (1995) 55-61 Oxidized and reduced poly( 2,5-di-(-2-thienyl)-pyrrole)  

E-Print Network [OSTI]

Fisica, Facultat de Quimica, Universitat de Barcelona, Marti i Franqubs 1, 08028 Barcelona, Spare h Departament d'Enginyeria Quimica i Metall~rgia, Facultat de Quimica Universitat de Barcelona Martf i, Franqubs 1, 08028, Barcelona, Spain c Departament de Quimica Orgilnica, Facultat de Quimica, Universitat de

Otero, Toribio Fernández

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

A review of "Conscience on Stage: The Comedia as Casuistry in Early Modern Spain" by Hillaire Kallendorf  

E-Print Network [OSTI]

, social and cultural historians? (20). Hilaire Kallendorf. Conscience on Stage: The Comedia as Casuistry in Early Modern Spain. Toronto: University of Toronto Press, 2007. x + 299 pp. $65. Review by elizabeth r. wright, university of georgia. Spain?s... playwrights. Yet a miniscule proportion of plays have attracted careful and sustained scholarly scrutiny or are performed regularly in repertories. This book reports on one scholar?s project to widen the lens through which we view Spain?s ?Golden Age...

Wright, Elizabeth

2009-01-01T23:59:59.000Z

162

ELSEVIER SyntheticMetals 102 (1999) 1402-1403 Study of the processability of the poly(SNS) in different media  

E-Print Network [OSTI]

, Facultad de Quimica, Laboratorio de Electroquimica, P.O. 1072, 20080 San Sebasticin (Spain) b LCTEM, Departament de Quimica Fisica, Universitat de Barcelona, Marti i Franquh 1, 08028 Barcelona (Spain) ' Departament d'Enginyeria Quimica i Metal.Ilirgia, Universitat de Barcelona, Marti i Franquks 1, 08028

Otero, Toribio Fernández

163

Tourism's Impact on Economic Growth and Development in Spain  

E-Print Network [OSTI]

Tourism's Impact on Economic Growth and Development in Spain Jessica Dennis #12;Spanish Civil War,500,000,000 International Tourism Receipts 1960-2008 (US$ in year 2000) #12;$0 $200,000,000,000 $400,000,000,000 $600 (US$ in the year 2000) #12;0.00% 1.00% 2.00% 3.00% 4.00% 5.00% 6.00% International Tourism Receipts

New Hampshire, University of

164

26 IEEE COMPUTATIONAL INTELLIGENCE MAGAZINE | NOVEMBER 2011 1556-603X/11/$26.002011IEEE European Centre for Soft Computing, SPAIN  

E-Print Network [OSTI]

, European Centre for Soft Computing, SPAIN O. Cordón, European Centre for Soft Computing, SPAIN CITIC-UGR: Research Center on Information and Communication Technologies, University of Granada, 18014 Granada, SPAIN, SPAIN J. Santamaría, University of Granada, SPAIN #12;NOVEMBER 2011 | IEEE COMPUTATIONAL INTELLIGENCE

Granada, Universidad de

165

EXaMINE -Experimentation of a Monitoring and Control System for Managing Vulnerabilities of the European  

E-Print Network [OSTI]

-08004 Barcelona, Spain Sart-Tilman B28, B-4000 Li`ege, Belgium Abstract -- This paper presents (Spain) AIA - Consulting and Engineering (Spain) CESI - Consulting and Engineering (Italy) SEMA Group

Wehenkel, Louis

166

E-Print Network 3.0 - ai seville spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Spain Universidad de Alicante CIEE, Council 20th Century Spanish......

167

E-Print Network 3.0 - arousa nw spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on Nutrient and Phytoplankton Dynamics in a Shallow Estuary After Summary: Kingdom (Wash, Thames estuary, Horecambe and Caenarfon bays), in Spain (Galice, Mediterranean coast......

168

E-Print Network 3.0 - almeria spain alteracion Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

del Grup d'Hidrologia Subterrnia Dept. Enginyeria del Terreny, Cartogrfica i Geofsica UPC Summary: Groundwater flow and recharge in the Doana aquifer system (Huelva, SW Spain)...

169

E-Print Network 3.0 - algeciras spain steel Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

lower values than model columns... : at a station in Spain. Bottom: at a station in Netherland. The model simulation with assimilation shows better Source: Ecole Polytechnique,...

170

International Family Business Succession Planning. Recent Developments in Germany and Spain  

E-Print Network [OSTI]

Tools of transmission in Germany 2.1. Power of attorney postas being unconstitutional. 33 Germany's Constitutional CourtRecent Developments in Germany and Spain Business Roland

Krause, Roland

2009-01-01T23:59:59.000Z

171

JOURNALDE PHYSIQUE IV Colloque C4, supplement au Journal de Physique 111,Vol. 1,novembre 1991  

E-Print Network [OSTI]

-SouthamptonSO9 SNH, Great-Britain *MetalurgiaFisica-Cienciade 10sMateriales,DepartamentodeIngenieria Quirnicay Metalurgie,Fac- ultad de Quimica, Universidadde Barcelona, SP-08028Barcelona,Spain Abstract. Two way shape

Boyer, Edmond

172

Continuous Time Random Walks and South Spain Seismic Series  

E-Print Network [OSTI]

Levy flights were introduced through the mathematical research of the algebra or random variables with infinite moments. Mandelbrot recognized that the Levy flight prescription had a deep connection to scale-invariant fractal random walk trajectories. The theory of Continuous Time Random Walks (CTRW) can be described in terms of Levy distribution functions and it can be used to explain some earthquake characteristics like the distribution of waiting times and hypocenter locations in a seismic region. This paper checks the validity of this assumption analyzing three seismic series localized in South Spain. The three seismic series (Alboran, Antequera and Loja) show qualitatively the same behavior, although there are quantitative differences between them.

A. Posadas; J. Morales; F. Vidal; O. Sotolongo-Costa; J. C. Antoranz

2002-05-27T23:59:59.000Z

173

Association of Renewable Energy Producers Spain | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 EastMaine: Energy Resources JumpAspen Aerogels JumpRenewable Energy Producers Spain

174

BeyWatch (Smart Grid Project) (Spain) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: Energy ResourcesJersey: EnergyBerthoud,Biodiesel Place: Orem,BeyWatchSpain)

175

Spain Installed Wind Capacity Website | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA Region -SonelgazSunbelt Wind FarmSouthwestSpain

176

Theory Auger neutralization and deexcitation slow ions metal surfaces Materialen Fisika Kimika Fakultatea, 1072 Postakutxatila, Euskal Herriko Unibertsitatea, 20080 Donostia, Spain  

E-Print Network [OSTI]

Kimika Fakultatea, 1072 Postakutxatila, Euskal Herriko Unibertsitatea, 20080 Donostia, Spain Lorente Unibertsitatea, 20080 Donostia, Spain Unidad Asociada al Instituto Ciencia Ciencia Materiales, C.S.I.C., Cantoblanco, 28049 Madrid, Spain #Received contribution of conduction electrons to Auger neutralization

Muiño, Ricardo Díez

177

The 1964 Festival of Music of the Americas and Spain: A Critical Examination of Ibero-American Musical Relations in the Context of Cold War Politics  

E-Print Network [OSTI]

Rodrigo dies, telling him that Spain will be reborn from theAsturias. All bells of Spain miraculously toll at Rodrigo’s1964): 6. ———. “Bases in Spain. ” The Washington Post, 10

Payne, Alyson

2012-01-01T23:59:59.000Z

178

8th International Symposium on Growth and Nutrition in Children with Chronic Renal Disease: 28–30 May 2009, Oviedo, Asturias, Spain  

E-Print Network [OSTI]

2009, Oviedo, Asturias, Spain Fernando Santos & Frederick J.of Oviedo, Oviedo, Asturias, Spain F. J. Kaskel Montefiores/n, 33006 Oviedo, Asturias, Spain e-mail: fsantos@uniovi.es

Santos, Fernando; Kaskel, Frederick J.; Mak, Robert H.; Caldas, Alberto

2010-01-01T23:59:59.000Z

179

July 2012 M.S. in Molecular Cellular and Genetic Biology (honors) -University of A Corua, A Corua, Spain July 2011 B.S. in Biology -University of A Corua, A Corua, Spain  

E-Print Network [OSTI]

of A Coruña, A Coruña, Spain July 2011 B.S. in Biology - University of A Coruña, A Coruña, Spain RESEARCH, University of A Coruña, Spain. Advisors: Dr. Jose M. Eirin Lopez, Dr. Josefina Mendez. 2011 - 2012 Master student, Dept. Cellular and Molecular Biology, University of A Coruña, Spain. 2005 - 2011 Bachelor student

Eirin Lopez, Jose Maria

180

Quality of environmental impact statements in Portugal and Spain  

SciTech Connect (OSTI)

One of the key steps of the Environmental Impact Assessment Process, defined by Directive 337/85 'on the assessment of the effects of certain public and private projects' is the preparation of the Environmental Impact Statement (EIS) of a Project. The quality of the EIS is of great importance to properly inform the public and the decision makers about the significant environmental effects of the project. Using the 'Guidance on EIA-EIS Review' 2001 report, produced with the support of the European Commission, this paper analyses the overall quality of 46 recently elaborated EIS from Portugal and Spain (1998-2003). It also analyses the quality of the various chapters of the EIS and the Non-Technical Summary. A comparison is made between the quality of the EIS from Portugal and from Spain. The results for Portugal are also compared with those of other European countries (Ireland and United Kingdom) in similar periods. Finally it presents overall conclusions and suggestions for improvement.

Canelas, Leonel; Almansa, P.; Merchan, M.; Cifuentes, Pedro

2005-04-15T23:59:59.000Z

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

November 2010-Ph.D. in Biology. University of A Corua, Spain. Dr. J.M. Eirin-Lopez, advisor (Genetics, Evolution). July 2007-M.S. in Genetics and Biochemistry University of A Corua, Spain.  

E-Print Network [OSTI]

EDUCATION November 2010- Ph.D. in Biology. University of A Coruña, Spain. Dr. J.M. Eirin-Lopez, advisor (Genetics, Evolution). July 2007- M.S. in Genetics and Biochemistry University of A Coruña, Spain. July 2005- B.S. in Biology (honors). University of A Coruña, Spain. RESEARCH INTERESTS Marine Biology

Eirin Lopez, Jose Maria

182

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

183

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

184

Use of high-resolution ichnological and stable isotope data for assessing completeness of a KP boundary section, Agost, Spain  

E-Print Network [OSTI]

­P boundary section, Agost, Spain Francisco J. Rodri´guez-Tovar a,*, Francisca Marti´nez-Ruiz b , Stefano M. Bernasconi c a Departamento de Estratigrafi´a y Paleontologi´a, Universidad de Granada, 18002 Granada, Spain b Instituto Andaluz de Ciencias de la Tierra CSIC-Universidad de Granada, 18002 Granada, Spain c

Gilli, Adrian

185

See also http://www.umass.edu/loop/content/civil-andenvironmental-engineering-student-wins-fulbright-study-rail-transportation-spain  

E-Print Network [OSTI]

See also http://www.umass.edu/loop/content/civil-andenvironmental-engineering- student-wins-fulbright-study-rail-transportation-spain to study transportation engineering in Madrid, Spain during 2013-2014. I had the good fortune to meet with Radha a short time ago and learned during our conversation that while abroad in Spain, one of her

Massachusetts at Amherst, University of

186

STANDARD RESIDUE REGULATIONS FOR CHLORAMPHENICOL Departmento de Farmacologia y Toxicologia, Facultad de Veterinaria, Universidad de Leon, Spain  

E-Print Network [OSTI]

STANDARD RESIDUE REGULATIONS FOR CHLORAMPHENICOL IN SPAIN A. ANADON Departmento de Farmacologia y Toxicologia, Facultad de Veterinaria, Universidad de Leon, Spain Chloramphenicol is an antibiotic widely used forms mainly used in Spain are the free base, succinate and palmitate and the dosage forms

Boyer, Edmond

187

A Statistical Adjustment of Regional Climate Model Outputs to Local Scales: Application to Platja de Palma, Spain  

E-Print Network [OSTI]

de Palma, Spain A. AMENGUAL Grup de Meteorologia, Departament de Fi´sica, Universitat de les Illes Mallorca, Spain V. HOMAR AND R. ROMERO Grup de Meteorologia, Departament de Fi´sica, Universitat de les Illes Balears, Palma de Mallorca, Spain S. ALONSO Grup de Meteorologia, Departament de Fi

Romero, Romu

188

The multi-dimensional additionality of innovation policies. A multi-level application to Italy and Spain.  

E-Print Network [OSTI]

and Spain. Alberto Marzucchi & Sandro Montresor October 2012 Preliminary ­ Do not quote without prior, at the national and regional level (multi-level). An empirical application is carried out for Italy and Spain, while they show output additionality in Spain only, where they are also able to spur innovative

Sussex, University of

189

Birori Goa Lima Mexico City Lisbon Naples Palermo Seville Soriano Liampo Villanovafranca Beyond Italy and New Spain  

E-Print Network [OSTI]

Italy and New Spain Itineraries for an Iberian Art History (1440-1640) Convened by Michael Cole Iberian Europe to the Kingdom of the New Spain. New proposals of itineraries for the origin and interpretation of corn cane sculptures Joana Barreto (Villa Medici, Rome): Spain, Italy, Flanders: Some Dynamics

Qian, Ning

190

Tornadoes over complex terrain: an analysis of the 28th August 1999 tornadic event in eastern Spain  

E-Print Network [OSTI]

Tornadoes over complex terrain: an analysis of the 28th August 1999 tornadic event in eastern Spain Fi´sica, Universitat de les Illes Balears, Palma de Mallorca 07071, Spain b Instituto Nacional de Meteorologi´a, Centre Meteorolo`gic a les Illes Balears, Palma de Mallorca, Spain c IMEDEA, UIB-CSIC, Palma de

Romero, Romu

191

Stabilization and restoration of an uranium mill site in Spain  

SciTech Connect (OSTI)

In the south of Spain on the outskirts of the town of Andujar an inactive uranium mill tailings site has been remediated in place. Mill equipment, buildings and process facilities have been dismantled and demolished and 06q the resulting metal wastes and debris have been placed in the tailings pile. The tailings mass has been reshaped by flattening the sideslopes to improve stability and a cover system has been placed over the pile. Remedial action works started in February 1991 and were completed by April 1994. This paper describes the remediation works for the closure of the Andujar mill site and in particular discusses the approaches used for the dismantling and demolition of the processing facilities and the stabilization of the tailings pile.

Santiago, J.L.; Estevez, C.P. [ENRESA, Madrid (Spain)

1995-12-31T23:59:59.000Z

192

Assuming Roles: Gender, Crisis and the Conservation of Spain in the Early Seventeenth Century  

E-Print Network [OSTI]

and the Hispanic World, 1606-1611 (Oxford: Clarendon Press, 1982), 2, and especially the first section of chapter 2 entitled “Renewed Deliberations.” 5 Giovanni Botero, The Reason of State (1589), trans. P.J. and D.P Whaley (London: Routledge, 1956), 157. 6... Española: Según la Impresión de 1611, con las Adiciones de Benito Remigio Noydens Publicadas en la de 1674, Martín de Riquer, ed. (Barcelona: S.A. Horta, 1943), 1011. 18 Alexandra Shepard notes that in early modern England a man lacking money...

Gaston, Ryan

2010-12-14T23:59:59.000Z

193

AUSTRALIA BELGIUM CHINA FRANCE GERMANY HONG KONG SAR INDONESIA (ASSOCIATED OFFICE) ITALY JAPAN PAPUA NEW GUINEA SAUDI ARABIA SINGAPORE SPAIN SWEDEN  

E-Print Network [OSTI]

PAPUA NEW GUINEA SAUDI ARABIA SINGAPORE SPAIN SWEDEN UNITED ARAB EMIRATES UNITED KINGDOM UNITED STATES

Royal Holloway, University of London

195

Wave Propagation in Fractured Poroelastic Media  

E-Print Network [OSTI]

Wave Propagation in Fractured. Poroelastic Media. WCCM, Barcelona, Spain, July 2014. Juan E. Santos,. 1. 1. Instituto del Gas y del Petr´oleo (IGPUBA), UBA,

2014-06-22T23:59:59.000Z

196

PDF file  

E-Print Network [OSTI]

Mòdul B4 Campus Nord, 08034 Barcelona, Spain ..... by spectral differentiation of u and w, the stream func- ... 2(a)) and associated with these jets, the stream-.

2001-06-16T23:59:59.000Z

197

Shibboleth-based Access to and Usage of Grid Resources  

E-Print Network [OSTI]

Sinnott,R.O. Watt,J. Jiang,J. Ajayi,O. Proceedings of IEEE International Conference on Grid Computing, Barcelona, Spain, September 2006.

Sinnott, R.O.

198

E-Print Network 3.0 - achieving behavioral control Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Conf. on Fuzzy Systems, Barcelona, Spain, July 1997 Selecting Behaviors using Fuzzy Logic Summary: in order to get more complex behaviors. This paper addresses these issues by...

199

To Spain and Back: Changing Roles and Identities of Ecuadorian Female Migrants  

E-Print Network [OSTI]

In the late 1990s and early 2000s, Ecuadorian migration to Spain expanded due to economic and political push and pull factors between the two countries. Through the feminization of migration, women came to represent approximately half of all...

Dudley, Lindsay Erin

2013-05-31T23:59:59.000Z

200

Mediterranean clonal selections evaluated for modern hedgerow olive oil production in Spain  

E-Print Network [OSTI]

oil output Cumulative oil production tons/acre 5.68b 5.83bmodern hedgerow olive oil production in Spain Paul M. VossenNinot Traditional olive oil production is limited by its

Tous, Joan; Romero, Agusti; Hermoso, Juan Francisco; Ninot, Antonia

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

E-Print Network 3.0 - area cadiz spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Search Sample search results for: area cadiz spain Page: << < 1 2 3 4 5 > >> 1 CURRICULUM VITAE (update October 2007) Mariana Ribas Ribas mariana.ribas@uca.es Summary: ....

202

Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

E-Print Network [OSTI]

Energy Researh (SEfAS) Norway Ms. Grønli has been workingPower Research Institute), Norway, since 1995. She holds aGRID ACCESS AND PRICING IN NORWAY, SPAIN AND CALIFORNIA – A

Gronli, Helle; Gomez San Ramon, Tomas; Marnay, Chris

1999-01-01T23:59:59.000Z

203

Contribution (Poster) TNT2008 September 01-05, 2008 Oviedo-Spain  

E-Print Network [OSTI]

Contribution (Poster) TNT2008 September 01-05, 2008 Oviedo-Spain LIGHT EMITTING DIODES ON SILICON) or quantum well (QW) light-emitting diodes by molecular beam epitaxy to obtain direct band gaps on GaP grown

Boyer, Edmond

204

E-Print Network 3.0 - anesthesia santiago spain Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

groups J. Lopez-Santiago... Complutense de Madrid, E-28040 Madrid, Spain. (dmg@astrax.fis.ucm.es) During the last years (1999 - 2004), our Source: Gutirrez, David Montes -...

205

E-Print Network 3.0 - andalusia sothern spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

6164, 2008 www.adv-sci-res.net2612008 Summary: , in Spain, Eastern Andalusia (AOR), Aragon (ARN), the Balearic Islands (BAL), Castilla la Man- cha (MCM... ogico en Illes...

206

The Photovoltaic Crisis and the Demand-side Generation in Spain  

E-Print Network [OSTI]

The RES-E promotion policy in Spain gave priority to the photovoltaic (henceforth, PV) ground-mounted installations. For years, the coupling of customer-side generation coupled with excess energy exports was never specifically considered. However...

Mir-Artigues, Pere

2013-03-01T23:59:59.000Z

207

Arsenic in public water supplies and cardiovascular mortality in Spain  

SciTech Connect (OSTI)

Background: High-chronic arsenic exposure in drinking water is associated with increased cardiovascular disease risk. At low-chronic levels, as those present in Spain, evidence is scarce. In this ecological study, we evaluated the association of municipal drinking water arsenic concentrations during the period 1998-2002 with cardiovascular mortality in the population of Spain. Methods: Arsenic concentrations in drinking water were available for 1721 municipalities, covering 24.8 million people. Standardized mortality ratios (SMRs) for cardiovascular (361,750 deaths), coronary (113,000 deaths), and cerebrovascular (103,590 deaths) disease were analyzed for the period 1999-2003. Two-level hierarchical Poisson models were used to evaluate the association of municipal drinking water arsenic concentrations with mortality adjusting for social determinants, cardiovascular risk factors, diet, and water characteristics at municipal or provincial level in 651 municipalities (200,376 cardiovascular deaths) with complete covariate information. Results: Mean municipal drinking water arsenic concentrations ranged from <1 to 118 {mu}g/L. Compared to the overall Spanish population, sex- and age-adjusted mortality rates for cardiovascular (SMR 1.10), coronary (SMR 1.18), and cerebrovascular (SMR 1.04) disease were increased in municipalities with arsenic concentrations in drinking water >10 {mu}g/L. Compared to municipalities with arsenic concentrations <1 {mu}g/L, fully adjusted cardiovascular mortality rates were increased by 2.2% (-0.9% to 5.5%) and 2.6% (-2.0% to 7.5%) in municipalities with arsenic concentrations between 1-10 and>10 {mu}g/L, respectively (P-value for trend 0.032). The corresponding figures were 5.2% (0.8% to 9.8%) and 1.5% (-4.5% to 7.9%) for coronary heart disease mortality, and 0.3% (-4.1% to 4.9%) and 1.7% (-4.9% to 8.8%) for cerebrovascular disease mortality. Conclusions: In this ecological study, elevated low-to-moderate arsenic concentrations in drinking water were associated with increased cardiovascular mortality at the municipal level. Prospective cohort studies with individual measures of arsenic exposure, standardized cardiovascular outcomes, and adequate adjustment for confounders are needed to confirm these ecological findings. Our study, however, reinforces the need to implement arsenic remediation treatments in water supply systems above the World Health Organization safety standard of 10 {mu}g/L.

Medrano, Ma Jose, E-mail: pmedrano@isciii.es [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Boix, Raquel; Pastor-Barriuso, Roberto [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain)] [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Palau, Margarita [Subdireccion General de Sanidad Ambiental y Salud Laboral, Direccion General de Salud Publica y Sanidad Exterior, Ministerio de Sanidad y Politica Social, Madrid (Spain)] [Subdireccion General de Sanidad Ambiental y Salud Laboral, Direccion General de Salud Publica y Sanidad Exterior, Ministerio de Sanidad y Politica Social, Madrid (Spain); Damian, Javier [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain)] [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Ramis, Rebeca [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain) [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); CIBER en Epidemiologia y Salud Publica (CIBERESP), Madrid (Spain); Barrio, Jose Luis del [Departamento de Salud Publica, Universidad Rey Juan Carlos, Madrid (Spain)] [Departamento de Salud Publica, Universidad Rey Juan Carlos, Madrid (Spain); Navas-Acien, Ana [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States) [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Department of Epidemiology, Welch Center for Prevention, Epidemiology and Clinical Research, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States)

2010-07-15T23:59:59.000Z

208

Genetic Variation in the Population of Ibiza (Spain): Genetic Structure, Geography, and Language  

E-Print Network [OSTI]

Genetic Variation in the Population of Ibiza (Spain): Genetic Structure, Geography, and Language ANTONIA PICORNELL,' ANA MIGUEL,' JOSE A. CASTRO,' M. MISERICORDIA RAMON,' RECTOR ARYA,2 AND M.H. CRAWFORD2 Abstract A sample of 203 individuals from... Ibiza (Balearic Islands, Spain) were tested for blood group and serum protein genetic variation and compared with other circum-Mediterranean populations. Allele fre- quencies were calculated for the following blood group and serum sys- tems: ABO, Rh...

Picornell, Antonia; Miguel, Ana; Castro, Jose A.; Ramon, M. Misericordia; Arya, Rector; Crawford, Michael H.

1996-11-01T23:59:59.000Z

209

International Work Placement Case Study: Les Sol de Portecarrero, Almeria, Lara spent nine months in 2011/2012 as an English teaching assistant in Almeria in Spain  

E-Print Network [OSTI]

International Work Placement Case Study: Les Sol de Portecarrero, Almeria, Spain Lara spent nine months in 2011/2012 as an English teaching assistant in Almeria in Spain at Les Sol de Portocarrero

Mumby, Peter J.

210

Time-resolved pattern evolution in a large-aperture class A laser Nonlinear Dynamics and Chaos Group. Universidad Rey Juan Carlos, 28933 Mostoles, Madrid, Spain  

E-Print Network [OSTI]

and Chaos Group. Universidad Rey Juan Carlos, 28933 Mo´stoles, Madrid, Spain J. M. Guerra Departamento de Optica, Facultad de Ciencias Fi´sicas, Universidad Complutense de Madrid, 28040 Madrid, Spain Received 15

Rey Juan Carlos, Universidad

211

Phone: (+34) 965 90 3707 -Fax: (+34) 965 90 3678 -email: dic@ua.es -twitter: @dic_ua Po. Box 99 -03080 -Alicante (Spain)  

E-Print Network [OSTI]

. Box 99 - 03080 - Alicante (Spain) NEWS & EVENTS PROFESSOR FLORENTINO REGALADO, AWARDED THE MEDAL Raspeig s/n 03690 San Vicente del Raspeig Alicante (Spain) Tel: (+34) 96 590 3707 Fax: (+34) 96 590 3678

Escolano, Francisco

212

ELSEVIER Synthetic Metals 84 (1997) 183-184 Reversible redox switching in polypyrrole and poly-SNS films  

E-Print Network [OSTI]

Vascc, Departamento de Qujmica-Fisica, Facultad de Quimica, Lab. de Electroquimica, P.O. Box 1072, 20080 San Sebastian (Spain) Dep. Quimica Fisica, Dep. d'Enginyeria Quimica i Metalltirgia, Facultat de Quimica, Universitat de Barcelona, Marti i FranquCs 1: 08028 Barcelona (Spain). Abstract Two different

Otero, Toribio Fernández

213

Atmos. Chem. Phys., 12, 23132343, 2012 www.atmos-chem-phys.net/12/2313/2012/  

E-Print Network [OSTI]

Technologies (INTE), Technical University of Catalonia (UPC), Barcelona, Spain 5Department of Physics and Nucelar Engineering (FEN),Technical University of Catalonia (UPC), Barcelona, Spain 6Universities Space of height and time until 20 April, we made a first guess of release rates based on fuel inventories

Meskhidze, Nicholas

214

Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barr 1 Supporting the Specification ofSupporting the Specification of  

E-Print Network [OSTI]

Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barré 1 Supporting the Specification of #12;Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barré 2 Outline 1. Research context. Summary and ongoing work #12;Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barré 3 Research Context

Laforcade, Pierre

215

Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain Paper number: 197  

E-Print Network [OSTI]

. Madrid, Spain Paper number: 197 #12;Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain #12;Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain #12;Ocean Waves Measurement and Analysis

Grilli, Stéphan T.

216

The Education Office of the Embassy of Spain in Canada would appreciate if your Organization/Institution could circulate among potential candidates this information about  

E-Print Network [OSTI]

The Education Office of the Embassy of Spain in Canada would appreciate if your Organization AND CULTURE TEACHING ASSISTANTS IN SPAIN FOR 2014/2015 (ENGLISH OR FRENCH LANGUAGES) Positions available as an English or French language teaching assistant all over Spain for university graduates or undergraduate

217

For most of its history Spain had been a country of emigration--sending laborers abroad to find employment. But the latter quarter of the 20th  

E-Print Network [OSTI]

1 I. Problem For most of its history Spain had been a country of emigration--sending laborers abroad to find employment. But the latter quarter of the 20th century has seen Spains status shift from individuals to live and work in the southern European state. Immigrants to Spain come from diverse locations

New Hampshire, University of

218

First International Symposium on Fishing Vessel Energy Efficiency E-Fishing, Vigo, Spain, May 2010  

E-Print Network [OSTI]

First International Symposium on Fishing Vessel Energy Efficiency E-Fishing, Vigo, Spain, May 2010 HydroPêche: a way to improve energy efficiency of fishing devices Grégory Germain 1 , Philippe Druault 2 should provide a substantial gain on the fuel consumed of actual fishing devices while maintaining

Lewandowski, Roger

219

Forms Of Address In The Popular Press: A Comparison of Spain, Mexico and the United States  

E-Print Network [OSTI]

with each form of address. A comparison of forms of address in magazines and newspapers in Spain, Mexico, and the United States reveals certain correlations with speech patterns in those three countries, as well as with the products and services advertised....

Callahan, Laura

2000-01-01T23:59:59.000Z

220

Multicomponent reactive transport modeling at the Ratones uranium mine, Cceres (Spain)  

E-Print Network [OSTI]

Multicomponent reactive transport modeling at the Ratones uranium mine, Cáceres (Spain) Modelación management. The Ratones uranium mine was abandoned and flooded in 1974. Due to its reducing underground water, uranium, reactive transport, granite hydrochemistry, Ratones mine. Resumen La inundación de minas

Politècnica de Catalunya, Universitat

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

The Early Aptian of Aralar (northern Spain): stratigraphy, sedimentology, ammonite biozonation, and OAE1  

E-Print Network [OSTI]

The Early Aptian of Aralar (northern Spain): stratigraphy, sedimentology, ammonite biozonation Stratigraphy Ammonite biozonation TOC Oceanic Anoxic Event 1 a b s t r a c t The stratigraphy, sedimentology. The sedimentology indicates general deposition in a shallow marine environment, corresponding to mixed siliciclastic

Gilli, Adrian

222

Samuel Johnson Born 24 January 1980 in Seville, Spain. British nationality.  

E-Print Network [OSTI]

Samuel Johnson Born 24 January 1980 in Seville, Spain. British nationality. samuel networks, S. Johnson, J. J. Torres, J. Marro, and M. A. Muñoz, Physical Review Letters, in press. arXiv: 1002.3286. Evolving networks and the development of neural systems, S. Johnson, J. Marro and J. J

Johnson, Samuel

223

Tectonic control for evaporite formation in the Eastern Betics (Tortonian; Spain)  

E-Print Network [OSTI]

Tectonic control for evaporite formation in the Eastern Betics (Tortonian; Spain) Wout Krijgsman a for the Venta de la Virgen section by integration of biostratigraphic, magnetostratigraphic and isotopic dating for the emergence of a threshold that finally led to evaporite formation in the Fortuna basin. © 2006 Elsevier B

Utrecht, Universiteit

224

Impact of the lateral boundary conditions resolution on dynamical downscaling of precipitation in mediterranean spain  

E-Print Network [OSTI]

. We represent the spectrum of GCMs resolutions currently applied in climate change research by using for climate simulation and future climate change assessment (IPCC 2001). Although they incorpo- rate the main in mediterranean spain A. Amengual Ã? R. Romero Ã? V. Homar Ã? C. Ramis Ã? S. Alonso Received: 27 March 2006 / Accepted

Romero, Romu

225

2008 European PV Conference, Valencia, Spain COMPARISON OF SOLAR RADIATION FORECASTS FOR THE USA  

E-Print Network [OSTI]

2008 European PV Conference, Valencia, Spain COMPARISON OF SOLAR RADIATION FORECASTS FOR THE USA J models 1 INTRODUCTION Solar radiation and PV production forecasts are becoming increasingly important/) three teams of experts are benchmarking their solar radiation forecast against ground truth data

Perez, Richard R.

226

Benthic foraminiferal turnover across the Cretaceous/ Paleogene boundary at Agost (southeastern Spain)  

E-Print Network [OSTI]

;c a Departamento de Ciencias de la Tierra, Universidad de Zaragoza, 50009 Zaragoza, Spain b Department of Earth and Environmental Sciences, Wesleyan University, Middletown, CT 06459-0139, USA c Center for the Study of Global, benthic foraminifera are rare. Several opportunistic taxa (e.g. the agglutinant Haplophragmoides sp.) have

Royer, Dana

227

Therapeutic Index of Gramicidin S is Strongly Modulated by D-Phenylalanine Analogues at the Concepcion Solanas,  

E-Print Network [OSTI]

, Spain, Departament de Cie`ncies Experimentals i de la Salut, UniVersitat Pompeu Fabra, Dr. Aiguader 88, 08003 Barcelona, Spain, Centro de InVestigaciones Biolo´gicas, CSIC, Ramiro de Maeztu 9, 28040 Madrid, Spain, and Instituto de Qui´mica-Fi´sica Rocasolano, CSIC, Serrano 119, 28006 Madrid, Spain Recei

Pompeu Fabra, Universitat

228

Workshop in honor of Antoine Salin: Recent advances on the dynamics of atomic and molecular particles  

E-Print Network [OSTI]

(Universidad de Rosario, Argentina) Alducin, Maite (Donostia International Physics Center, Spain) Arasa, Carina (Universidad de Barcelona, Spain) Arnau, Andrés (Universidad del País Vasco, Spain) Bauer, Peter (JKU Linz Physics Center, Spain) Crespos, Cédric (Université de Bordeaux I, France) Díaz, Cristina (University

Muiño, Ricardo Díez

229

Vaccine 29 (2011) 44224429 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

, Spain b Departament de Ciències Experimentals i de la Salut, Universitat Pompeu Fabra, 08003 Barcelona, Spain c Departament d'Agricultura, Alimentació i Acció Rural de la Generalitat de Catalunya (DAR), Spain d Departament de Producció Animal, ETSEA, Universidad de Lleida 25198, Spain e Centro Nacional de

Pompeu Fabra, Universitat

230

The C-Terminus of H-Ras as a Target for the Covalent Binding of Reactive Compounds Modulating Ras-  

E-Print Network [OSTI]

´ficas, Madrid, Spain, 2 Department of Experimental and Health Sciences, Universitat Pompeu Fabra, Barcelona, Spain, 3 Department of Organic Chemistry, Faculty of Sciences, University of Ma´laga, Ma´laga, Spain, 4 Microbiologi´a, Instituto de Salud Carlos III, Madrid, Spain Abstract Ras proteins are crucial players

Pompeu Fabra, Universitat

231

RESEARCH ARTICLE The cost of resistance to colistin in Acinetobacter  

E-Print Network [OSTI]

Andreu2 and Luis Rivas1** 1 Center for Biological Research (CIB-CSIC), Madrid, Spain 2 Proteomics Unit, Barcelona, Spain 3 Services of Infectious Diseases, Virgen del Rocío University Hospitals, Sevilla, Spain Barce- lona, Spain E-mail: david.andreu@upf.edu Abbreviations: OM, outer membrane; PMXs, polymyxins; SRP

Pompeu Fabra, Universitat

232

Organochlorine pesticides in cow's milk from agricultural region in Northwestern Spain  

SciTech Connect (OSTI)

During the past 30 years, the variety and usage of pesticides have increased in Spain and worldwide. Agricultural use of pesticides can be expected to result in residues in or food and feed. Several limited monitoring programs have received an extensive investigation in order to detect residues from organochlorine compounds in milk. This paper reports the findings of a pesticide residue study in cow's milk samples examined during the time period of one year between May of 1987 and March of 1988. The cow's milk samples destined to human consumption were collected from an agrarian area located at a geographic region of northwestern Spain. Analyses were conducted for DDT complex DDT{sub s}, DDD, DDE and isomers alpha, beta and gamma (lindane), aldrin, dieldrin, endrin, heptachlor, heptachlor epoxide, alpha- and beta-endosulfan, metoxichlor and mirex.

La Riva, C. de (Municipal Lab. of Leon, (Spain)); Anadon, A. (Univ. Complutense, Madrid (Spain))

1991-04-01T23:59:59.000Z

233

`Home Away From Home:' Migrant Organizations and Transnational Politics Among Latin American Migrants in Spain  

E-Print Network [OSTI]

, Argentina, Bolivia, Chile, Colombia, Costa Rica, the Dominican Republic, Ecuador, Equatorial Guinea Guatemala, Honduras, Nicaragua, Paraguay, Peru, the Philippines, Portugal, and Uruguay. 3 Although the process of migration has never been... well be the catalyst for national political change, and at the very least may alter the political priorities of governments by focusing their energies abroad (Itzigsohn 2000). 19 In the case of Latin American migrants to Spain, their presence...

Freudenburg, Kevin Michael

2011-04-27T23:59:59.000Z

234

Fast neutron incineration in the energy amplifier as alternative to geologic storage the case of Spain  

E-Print Network [OSTI]

In previous reports [1][2] we have presented the conceptual design of a fast neutron driven sub-critical device (Energy Amplifier) designed both for energy amplification (production) and for the incineration of unwanted ³waste² from Nuclear Light Water Reactors (LWR). The latter scheme is here applied to the specific case of Spain, where 9 large LWR¹s are presently in operation. It is shown that a cluster of 5 EA¹s is a very effective and realistic solution to the elimination (in 37 years) of the present and foreseen (till 2029) LWR-Waste stockpiles of Spain, but with major improvements over Geologic Storage, since: (1) only a Low Level Waste (LLW) surface repository of reasonable size is ultimately required; (2) the large amount of energy stored in the trans-Uranics is recovered, amounting for each of the 37 years of incineration to a saving of about 8% of the present primary energy demand of Spain (100 MTep/y); (3) the slightly enriched (1.1%) Uranium, unburned by LWR¹s, can be recovered for further us...

Rubbia, Carlo; Kadi, Y; Rubio, Juan Antonio

1997-01-01T23:59:59.000Z

235

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

236

Barcelona, (data / fecha / date) ......................................... Signatura / Firma / Signature  

E-Print Network [OSTI]

: ............................................................................................................. NIF o Nº Passaport / NIF o Nº Pasaporte/ NIF or Passport Nr: ................................. Data de

Geffner, Hector

237

Barcelona talk 1 Redish 1. PERSPECTIVE  

E-Print Network [OSTI]

's lives. The development of thermodynamics and the steam engine led to the railroad and the steamship, information science, and materials engineering will see the most growth and activity. WHO NEEDS TO LEARN

Maryland at College Park, University of

238

Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

SciTech Connect (OSTI)

The openness of the transmission grid and the incentives given by transmission pricing form the foundation for retail and wholesale competition in the electricity market. The deregulated markets of Norway, Spain, and California all have introduced retail access and wholesale competition, although with different approaches to pricing of transmission grid services. This paper will briefly describe the three different solutions, and discuss some of their implications. Of the three electricity systems, Norway was the first to open the grid to competition in electricity trade. The Norwegian Energy Law of 1990 introduced open competition to wholesale and retail trade starting January 1991. In Spain, the Electricity Law of 1997 came into force early in 1998. Wholesale and retail markets in California were opened for competition on April 1, 1998, following the passage of Assembly Bill 1890, in August 1996. Introducing competition in electricity markets also implies introducing Third Party Access to the transmission grid. All potential competitors have to be given access to the grid in order to compete, no matter who owns the actual wires. This principle raises several challenges, notably, how to price transmission services. Who is to pay for which transmission services? The Norwegian grid is divided into three levels depending on its function. The transmission grid includes all parts of the national grid having a transmission function, meaning that some lower voltage levels also are included. In Spain, the definition of the transmission grid is similar, including the 400 kV and 220 kV national grid as well as lower voltage installations that could affect transmission operation or generation dispatch. For historic reasons, wholesale electricity transactions in the US are regulated by the federal government through the FERC. However, operations of utility systems within one state fall primarily under state jurisdiction. Because the utility systems in California generally are large and exchanges between them limited, the role of FERC was small prior to restructuring, although the state is a large importer of power.

Gronli, H.; Gomez San Ramon, T.; Marnay, C.

1999-09-01T23:59:59.000Z

239

Decommissioning and waste disposal methods for an uranium mill facility in Spain  

SciTech Connect (OSTI)

In the south of Spain on the outskirts of the town of Andujar an inactive uranium mill tailings pile is being stabilized in place. Mill equipment, buildings and process facilities have been dismantled and demolished and the resulting metal wastes and debris will be placed in the pile. The tailings mass is being reshaped by flattening the sideslopes and a cover system will be placed over the pile. This paper describes the technical procedures used for the remediation and closure of the Andujar mill site and in particular discusses the approaches used for the dismantling and demolition of the processing facilities and the disposal of the metal wastes and demolition debris.

Santiago, J.L. [ENRESA, Madrid (Spain); Sanchez, M. [INITEC, Madrid (Spain)

1993-12-31T23:59:59.000Z

240

Sabine Pass, LA Exports to Spain Liquefied Natural Gas (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998Hampshire"RhodeWest Virginia"TotalFeet) Brazil LiquefiedSpain

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Cameron, LA Liquefied Natural Gas Exports to Spain (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998 10,643 10,998 10,998 10,64397 272 522 542 627ThousandThousandSpain

242

U.S. and Spain to Develop Solar Decathlon Europe | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up from theDepartment of Dept. of Energy, OfficeDepartment ofSpain to Develop Solar

243

Organochlorine pollutants in water, soils, and earthworms in the Guadalquivir River, Spain  

SciTech Connect (OSTI)

Organochlorine compounds (insecticides and polychlorinated biphenyls) are known to maintain their stability in the aquatic environment for long periods. DDT and cyclodiene insecticides were used widely in Spain until their use was banned in 1976; DDT and its degradation products are still found in environmental samples. Since DDT has been legally restricted for use, lindane has become important as a substitute for DDT. This study has been carried out along Guadalquivir River, Spain. This river runs across an agricultural area where pesticides are used extensively. The Guadalquivir basin is the most economically important area of the South of the Iberian Peninsula; its economic importance stems from its proximity to a major metropolitan areas (Cordova, Seville), which indicates the presence of numerous urban, commercial, and industrial locations in the vicinity of the sampling stations. The purposes of this investigation are: (1) to determine the levels of organochlorine compounds in water, soils, and earthworms sampled in ten stations of the Guadalquivir River; (2) to evaluate biological accumulation of pollutants studied within the food webs; (3) to evaluate regional patterns and time trends of residues. 15 refs., 1 fig., 2 tabs.

Hernandez, L.M.; Fernandez, M.A.; Gonzalez, M.J. (Institute of Organic Chemistry, Madrid (Spain))

1992-08-01T23:59:59.000Z

244

A proposal to improve ecological compensation practice in road and railway projects in Spain  

SciTech Connect (OSTI)

To reduce ecological impacts caused by development projects, avoidance, minimization and compensation techniques have to be taken together into consideration along Environmental Impact Assessment (EIA) procedures. This paper explores the particular role that ecological compensation has had in recent road and railway EIA procedures in Spain, as seen through the review of a set of recent EIA Records of Decision (RODs) that confirms precedent findings. Noticing that residual impacts are not paid much attention, and that there is no evidence of a solid public participation in ecological impact evaluation, it proposes to increase the awareness on residual impacts, as a way to make easier public access to the allegedly most sensitive moment of EIA implementation: (residual) impact evaluation. -- Highlights: ? Ecological compensation practice in Spain is much lower than avoidance or mitigation. ? Residual impacts are overlooked in EIA processes and public participation is low. ? An increased awareness of residual impacts may also promote public participation. ? Current context needs these small steps to move towards better compensation practice.

Villarroya, Ana, E-mail: avillarroya@alumni.unav.es; Puig, Jordi, E-mail: jpbaguer@unav.es

2013-09-15T23:59:59.000Z

245

A Review of "New World Gold: Cultural Anxiety and Monetary Disorder in Early Modern Spain" by Elvira Vilches  

E-Print Network [OSTI]

) and the Dominican Tom?s Mercado?s Suma de tratos y contratos (Guide to negotiations and contracts, 1569). Not unlike the bumper crop of books on personal finance that have ap- peared since our own economic meltdown of 2008, the proliferation of such texts... of Columbus?s travel log or Cort?s?s ?Letters from Mexico.? Whether read in parts or as a whole, Vilches?s book offers the reader a layered and insightful examination of early modern Spain?s ?Golden Age,? attune to all the contradictions that follow from...

Wright, Elizabeth R.

2011-01-01T23:59:59.000Z

246

Highlights of Spanish Astrophysics VI, Proceedings of the IX Scientific Meeting of the Spanish Astronomical Society held on September 13 -17, 2010, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.)  

E-Print Network [OSTI]

, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.) Chromospheric activity of FGK stars. Astrof´isica, E-28040 Madrid, Spain 2 Universidad Aut´onoma de Madrid, Dpto. de F´isica Te´orica C-XI, Fac. Ciencias, Madrid, Spain 3 LAEX, CAB (CSIC-INTA), ESAC Campus, P.O. BOX 73, 28691 Villanueva de la

Complutense de Madrid, Universidad

247

Highlights of Spanish Astrophysics VI, Proceedings of the IX Scientific Meeting of the Spanish Astronomical Society held on September 13 -17, 2010, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.)  

E-Print Network [OSTI]

, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.) Chemical Tagging the Hyades-28040 Madrid, Spain. 2 Instituto de Astrof´isica de Canarias, C/ Via L´actea s/n, E-38200 La Laguna, Spain Abstract Stellar Kinematic Groups are kinematical coherent groups of stars which may share a com

Complutense de Madrid, Universidad

248

European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. Forecasting of Regional Wind Generation by a Dynamic  

E-Print Network [OSTI]

European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. Forecasting of Regional Wind. Abstract-Short-term wind power forecasting is recognized nowadays as a major requirement for a secure and economic integration of wind power in a power system. In the case of large-scale integration, end users

Paris-Sud XI, Université de

249

An estimate of the effects of climate change on the rainfall of Mediterranean Spain by the late twenty first century  

E-Print Network [OSTI]

An estimate of the effects of climate change on the rainfall of Mediterranean Spain by the late outside the periods, which would incorporate changing AP frequencies during a period of sustained climate the atmospheric circulation at 925 and 500 hPa and the distribution of daily pre- cipitation for Mediterranean

Romero, Romu

250

Clinical Studies MLH1 Founder Mutations with Moderate Penetrance in  

E-Print Network [OSTI]

. In Spain, founder mutations in MMR genes have only been identified in the MSH2 gene (11, 12). Authors, Barcelona, Spain; 8Programa de Consell Genètic en Càncer, Institut Català d'Oncologia, Hospital Germans Trias i Pujol, Badalona, Spain; 9Programa de Consell Genèti

Rosenberg, Noah

251

Decommissioning of facilities and encapsulation of wastes for an uranium mill site in Spain  

SciTech Connect (OSTI)

In the south of Spain on the outskirts of the town of Andujar an inactive uranium mill tailings site is being remediated in place. Mill equipment, buildings and process facilities have been dismantled and demolished and the resulting metal wastes and debris have been placed in the tailings pile. The tailings mass has been reshaped by flattening the sideslopes to improve stability and a cover system has been placed over the pile. Remedial action works started in February 1991 and will be completed by March 1994. This paper describes the progress of the remediation works for the closure of the Andujar mill site and in particular discusses the approaches used for the dismantling and demolition of the processing facilities and the stabilization of the tailings pile.

Santiago, J.L. [Enresa, Madrid (Spain); Sanchez, M. [Initec, Madrid (Spain)

1994-12-31T23:59:59.000Z

252

The Astrophysical Journal Supplement Series, 202:18 (8pp), 2012 October doi:10.1088/0067-0049/202/2/18 C 2012. The American Astronomical Society. All rights reserved. Printed in the U.S.A.  

E-Print Network [OSTI]

path and the solar wind speed. The nominal energy channels of the ACE, STEREO, and Wind spacecraft have Barcelona, Barcelona, Spain 2 Department of Physics, University of Helsinki, Helsinki, Finland Received 2012 measurements of solar energetic particles (SEPs). The measured spectra, time­intensity profiles, and pitch

Sanahuja, Blai

253

Ecosystem Service Supply and Vulnerability to Global Change in Europe Dagmar Schrter,1,2  

E-Print Network [OSTI]

, Helsinki, Finland. 10 CREAF, University of Barcelona, Barcelona, Spain. 11 IMK-IFU, Forschungszentrum, Joensuu, Finland. 16 Tyndall Centre for Climate Change Research, University of East Anglia, Norwich, UK, 2050, 2080, relative to baseline conditions in 1990 (5). bioenergy production). However, many changes

Gracia, Carlos

254

HYDROMECHANICAL CHARACTERIZATION FOR SITE SELECTION IN CO2 PERMANENT  

E-Print Network [OSTI]

-BarcelonaTech), Barcelona, Spain 3 Energy City Foundation (CIUDEN), Spanish Government CO2 Geological Storage Programme (Vilarrasa et al., 2011, Energy Procedia) Trees killed by CO2 leakage in Mammoth Mountains (Farrar et al EQUATIONS Mass conservation equation Darcy's law Momentum balance Effective stress Hooke's law (linear

Politècnica de Catalunya, Universitat

255

Biological sweetening of energy gases mimics in biotrickling filters Marc Fortuny a,c  

E-Print Network [OSTI]

. In this con- text, biological processes for air pollution control are gain- ing popularity (Deshusses, 1997 Bellaterra, 08193 Bellaterra, Barcelona, Spain b Department of Mining Engineering and Natural Resources

256

Mixing in confined stratified aquifers Diogo Bolster, Francisco J. Valdes-Parada, Tanguy LeBorgne, Marco  

E-Print Network [OSTI]

Barcelona, Spain5 b Department of Civil Engineering and Geological Sciences, University of Notre Dame,6 Indiana, USA7 c Divisi´on de Ciencias B´asicas e Ingenier´ia, Universidad Autnoma8 Metropolitana

Bolster, Diogo

257

Accepted by D. Gower: 26 May 2014; published: 14 Jul. 2014 ISSN 1175-5326 (print edition)  

E-Print Network [OSTI]

,2 & SALVADOR CARRANZA2,3 1 CIBIO, Centro de Investigação em Biodiversidade e Recursos Genéticos, In la Barceloneta 37-49, E-08003 Barcelona, Spain 3 Corresponding author. E-mail: salvador

Carranza, Salvador

258

Drawing a Graph in a Hypercube David R. Wood  

E-Print Network [OSTI]

Drawing a Graph in a Hypercube David R. Wood #3; Departament de Matem#18;atica Aplicada II Universitat Polit#18;ecnica de Catalunya Barcelona, Spain david.wood@upc.edu Submitted: Nov 16, 2004; Accepted

Wood, David R.

259

Drawing a Graph in a Hypercube David R. Wood  

E-Print Network [OSTI]

Drawing a Graph in a Hypercube David R. Wood Departament de Matem`atica Aplicada II Universitat Polit`ecnica de Catalunya Barcelona, Spain david.wood@upc.edu Submitted: Nov 16, 2004; Accepted: Aug 11

Wood, David R.

260

JOURNALDE PHYSIQUE IV ColloqueC2, suppl6mentau Journal de Physique 111, Volume 5, f6vrier 1995  

E-Print Network [OSTI]

and J. Fernhdez Metalurgia Fisica-Cienca de Materiales, Dept. de Ingenieria Qulmica y Metalurgia, Facultad de Quimica, Marti i Franqu2s, 1.E-08028 Barcelona, Spain Abstract :TwoWay ShapeMemory Effect

Boyer, Edmond

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Andrew Turner, Raul Pampin and Adrian Puiu CCFE-PR(13)38  

E-Print Network [OSTI]

Pla 2, Torres Diagonal Litoral B3, 08019 Barcelona, Spain #12;. #12;Neutronics Analysis of the ITER In Science Centre, Abingdon, Oxon, OX14 3DB, UK 2 F4E Fusion for Energy, Josep Pla 2, Torres Diagonal Litoral

262

Routledge Planning, History and Environment series City and Soul in Divided Societies  

E-Print Network [OSTI]

CITIES, NINE SORROWS 4 Sarajevo, Bosnia-Herzegovina: `Urbicide' and Dayton; 5 Johannesburg, South Africa Hiria; 9 Mostar, Bosnia- Herzegovina: The City as War Spoils; 10 Barcelona, Spain: An Inclusive

Stanford, Kyle

263

Traffic Grooming in Unidirectional WDM Ring Networks: the all-to-all unitary case  

E-Print Network [OSTI]

~noz DMAT ­ UPC Mod C-3. Campus Nord, c/ Jordi Girona, 1-3 08034 Barcelona, Catalonia, SPAIN xml rate signals into higher speed streams (see the surveys Dutta and Rouskas, 2002b; Modiano and Lin, 2001

Bermond, Jean-Claude

264

Neuroinformatics (2011) 9:279-302 DOI 10.1007/s12021-011-9122-1  

E-Print Network [OSTI]

acquisition techniques that produce endless streams of imagery, there has been renewed interest in automated Nord E-08034 Barcelona, Spain #12;2 Engin T¨uretken et al. (a) (b) (c) (d) Fig. 1: Delineation results

Fua, Pascal

265

Noname manuscript No. (will be inserted by the editor)  

E-Print Network [OSTI]

acquisition techniques that produce endless streams of imagery, there has been renewed interest in automated Nord E-08034 Barcelona, Spain #12;2 Engin T¨uretken et al. (a) (b) (c) (d) Fig. 1: Delineation results

Fua, Pascal

266

Toward Kilo-instruction Processors ADRI AN CRISTAL, OLIVERIO J. SANTANA, and MATEO VALERO  

E-Print Network [OSTI]

access latencies. Categories and Subject Descriptors: C.1.1 [Processor Architectures]: Single Data Stream`ecnica de Catalunya, Edifici D6, Campus Nord, c/ Jordi Girona 1-3, 08034 Barcelona, Spain; email: {adrian

Martínez, José F.

267

Assessing velocity and impedance changes due to CO2 saturation using interferometry on repeated seismic sources.  

E-Print Network [OSTI]

, Barcelona : Spain (2010)" #12;Introduction The role played by the industrial emission of carbon dioxide (CO2) in climate change has been well documented. Geological sequestration is a process to store CO2

Boyer, Edmond

268

A review of "The Sale of the Century: Artistic Relations between Spain and Great Britain, 1604-1655." by Jonathan Brown and John Elliott, eds.  

E-Print Network [OSTI]

. Jonathan Brown and John Elliott, eds. The Sale of the Century: Ar- tistic Relations between Spain and Great Britain, 1604?1655. Madrid: Yale University Press and Museo Nacional del Prado, 2002. 315 pp. $65 hardback. Review by ELIZABETH R. WRIGHT..., UNIVERSITY OF GEORGIA. Art historian Jonathan Brown and historian John Elliott have joined forces to provide an indispensable guide to the political and artistic relationship between Spain and England in the first half of the seventeenth century. Though...

Elizabeth R. Wright

2003-01-01T23:59:59.000Z

269

Heterozoan carbonate lithofacies and sequence stratigraphy: a study of Pliocene strata of the Agua Amarga basin, southeastern Spain  

E-Print Network [OSTI]

). Heterozoan systems are likely to behave differently than photozoan systems in response to hydrodynamics and relative sea-level change, making the use of heterozoan models important for accurate prediction of facies distribution. The hydrodynamic regimen... response to sea- level change than is typical for photozoan carbonates. GEOLOGIC SETTING Throughout the Neogene, the Betic Cordillera of southern and southeastern Spain was compressed by the Iberia-Africa collision, with regional shortening oriented...

Hess, Anya Victoria

2011-12-31T23:59:59.000Z

270

Environmental performance of construction waste: Comparing three scenarios from a case study in Catalonia, Spain  

SciTech Connect (OSTI)

The main objective of this paper is to evaluate environmental impacts of construction wastes in terms of the LIFE 98 ENV/E/351 project. Construction wastes are classified in accordance with the Life Program Environment Directive of the European Commission. Three different scenarios to current waste management from a case study in Catalonia (Spain) have been compared: landfilling, recycling and incineration, and these scenarios were evaluated by means of Life Cycle Assessment. The recommendations of the Catalan Waste Catalogue and the European Waste Catalogue have been taken into account. Also, the influence of transport has been evaluated. Results show that in terms of the Global Warming Potential, the most environmentally friendly treatment was recycling, followed by incineration and lastly landfilling. According to the influence of treatment plants location on the GWP indicator, we observe that incineration and recycling of construction wastes are better than landfilling, even for long distances from the building site to the plants. This is true for most wastes except for the stony types, than should be recycled close to the building site. In summary, data from construction waste of a Catalan case study was evaluated using the well established method of LCA to determine the environmental impacts.

Ortiz, O., E-mail: oscarortiz@unipamplona.edu.c [Rovira i Virgili University, Environmental Analysis and Management Group (AGA), Chemical Engineering Department, Av. Paisos Catalans 26, 43007, Tarragona (Spain); University of Pamplona, Department of Industrial Engineering, Km 1 Via Bucaramanga, Pamplona, N de S (Colombia); Pasqualino, J.C.; Castells, F. [Rovira i Virgili University, Environmental Analysis and Management Group (AGA), Chemical Engineering Department, Av. Paisos Catalans 26, 43007, Tarragona (Spain)

2010-04-15T23:59:59.000Z

271

Lagrangian transport in a microtidal coastal area: the Bay of Palma, island of Mallorca, Spain  

E-Print Network [OSTI]

Coastal transport in the Bay of Palma, a small region in the island of Mallorca, Spain, is characterized in terms of Lagrangian descriptors. The data sets used for this study are the output for two months (one in autumn and one in summer) of a high resolution numerical model, ROMS, forced atmospherically and with a spatial resolution of 300 m. The two months were selected because its different wind regime, which is the main driver of the sea dynamics in this area. Finite-size Lyapunov Exponents (FSLEs) were used to locate semi-persistent Lagrangian coherent structures (LCS) and to understand the different flow regimes in the Bay. The different wind directions and regularity in the two months have a clear impact on the surface Bay dynamics, whereas only topographic features appear clearly in the bottom structures. The fluid interchange between the Bay and the open ocean was tudied by computing particle trajectories and Residence Times (RT) maps. The escape rate of particles out of the Bay is qualitatively different, with a 32$%$ more of escape rate of particles to the ocean in October than in July, owing to the different geometric characteristics of the flow. We show that LCSs separate regions with different transport properties by displaying spatial distributions of residence times on synoptic Lagrangian maps together with the location of the LCSs. Correlations between the time-dependent behavior of FSLE and RT are also investigated, showing a negative dependence when the stirring characterized by FSLE values moves particles in the direction of escape.

Ismael Hernández-Carrasco; Cristóbal López; Alejandro Orfila; Emilio Hernández-García

2013-11-05T23:59:59.000Z

272

Road-corridor planning in the EIA procedure in Spain. A review of case studies  

SciTech Connect (OSTI)

The assessment of different alternatives in road-corridor planning must be based on a number of well-defined territorial variables that serve as decision making criteria, and this requires a high-quality preliminary environmental assessment study. In Spain the formal specifications for the technical requirements stipulate the constraints that must be considered in the early stages of defining road corridors, but not how they should be analyzed and ranked. As part of the feasibility study of a new road definition, the most common methodology is to establish different levels of Territorial Carrying Capacity (TCC) in the study area in order to summarize the territorial variables on thematic maps and to ease the tracing process of road-corridor layout alternatives. This paper explores the variables used in 22 road-construction projects conducted by the Ministry of Public Works that were subject to the Spanish EIA regulation and published between 2006 and 2008. The aim was to evaluate the quality of the methods applied and the homogeneity and suitability of the variables used for defining the TCC. The variables were clustered into physical, environmental, land-use and cultural constraints for the purpose of comparing the TCC values assigned in the studies reviewed. We found the average quality of the studies to be generally acceptable in terms of the justification of the methodology, the weighting and classification of the variables, and the creation of a synthesis map. Nevertheless, the methods for assessing the TCC are not sufficiently standardized; there is a lack of uniformity in the cartographic information sources and methodologies for the TCC valuation. -- Highlights: • We explore 22 road-corridor planning studies subjected to the Spanish EIA regulation. • We analyze the variables selected for defining territorial carrying capacity. • The quality of the studies is acceptable (methodology, variable weighting, mapping). • There is heterogeneity in the methods for territorial carrying capacity valuation.

Loro, Manuel, E-mail: manuel.loro@upm.es [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain) [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Arce, Rosa M., E-mail: rosa.arce.ruiz@upm.es [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Ortega, Emilio, E-mail: e.ortega@upm.es [Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain) [Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Department of Construction and Rural Roads, Forestry Engineering School, Universidad Politécnica de Madrid, Ciudad Universitaria s/n, 28040 Madrid (Spain); and others

2014-01-15T23:59:59.000Z

273

Workshop (W60) on "Burning Plasma Physics and Simulation" 4-5 July 2005, University Campus, Tarragona, Spain  

E-Print Network [OSTI]

. Reimerdes EPS[2005] no wall limit ideal wall limit no wall limit with External coils #12;3.5 4.0 4.5 5.0 5.8 0.6 0.4 0.2 0 0.2 0.4 0.6 0.8 1.0 1.20 1.4 RFA b / 3.4li MARS with wall beta limit Pulse No: 59223, Tarragona, Spain Under the Auspices of the IEA Large Tokamak Implementing Agreement Present understanding

274

Attitudes to diversity: A cross-cultural study of education students in Spain, England, and the United States  

E-Print Network [OSTI]

, Florian, Lani , Rouse, Martyn and Stough, Laura M.(2010) 'Attitudes to diversity: a cross-cultural study of education students in Spain, England and the United States', European Journal of Teacher Education, 33: 3, 245 — 264 To link to this Article: DOI...), and American students (70% White or European American, 19% Hispanic, 4% Asian American, 2% African American, and 4% other). The average age of the students was 26 years with a mean teaching experience of 2.31 years (SD = 4.38) (5.68 for the Spanish students, 1...

Stough, Laura

2010-01-01T23:59:59.000Z

275

,"Liquefied U.S. Natural Gas Re-Exports to Spain (Million Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes; Column: EnergyShale Proved Reserves (Billion Cubic Feet)" ,"Click worksheet name orSpain (Million

276

Competitive sorption of cadmium and lead in acid soils of central Spain  

SciTech Connect (OSTI)

The bioavailability and ultimate fate of heavy metals in the environment are controlled by chemical sorption. To assess competitive sorption of Pb and Cd, batch equilibrium experiments (generating sorption isotherms) and kinetics sorption studies were performed using single and binary metal solutions in surface samples of four soils from central Spain. For comparisons between soils, as well as, single and binary metal solutions, soil chemical processes were characterized using the Langmuir equation, ionic strength, and an empirical power function for kinetic sorption. In addition, soil pH and clay mineralogy were used to explain observed sorption processes. Sorption isotherms were well described by the Langmuir equation and the sorption kinetics were well described by an empirical power function within the reaction times in this study. Soils with higher pH and clay content (characterized by having smectite) had the greatest sorption capacity as estimated by the maximum sorption parameter (Q) of the Langmuir equation. All soils exhibited greater sorption capacity for Pb than Cd and the presence of both metals reduced the tendency for either to be sorbed although Cd sorption was affected to a greater extent than that of Pb. The Langmuir binding strength parameter (k) was always greater for Pb than for Cd. However, these k values tended to increase as a result of the simultaneous presence of both metals, that may indicate competition for sorption sites promoting the retention of both metals on more specific sorption sites. The kinetic experiments showed that Pb sorption is initially faster than Cd sorption from both single and binary solutions although the simultaneous presence of both metals affected the sorption of Cd at short times while only a minor effect was observed on Pb. The estimated exponents of the kinetic function were in all cases smaller for Pb than for Cd, likely due to diffusion processes into micropores or interlayer space of the clay minerals which occurs more readily for Cd than Pb. Finally, the overall sorption processes of Pb and Cd in the smectitic soil with the highest sorption capacity of the studied soils are slower than in the rest of the soils with a clay mineralogy dominated by kaolinite and illite, exhibiting these soils similar sorption rates. These results demonstrate a significant interaction between Pb and Cd sorption when both metals are present that depends on important soil properties such as the clay mineralogy.

Serrano, S.; Garrido, F.; Campbell, C.G.; Garcia-Gonzolez, Maria Teresa

2004-01-30T23:59:59.000Z

277

An analysis of markets for small-scale, advanced coal-combustion technology in Spain, Italy, and Turkey  

SciTech Connect (OSTI)

This report discusses the examination of potential overseas markets for using small-scale, US-developed, advanced coal-combustion technologies (ACTs). In previous work, member countries of the Organization for Economic Cooperation and Development (OECD) were rated on their potential for using ACTs through a comprehensive screening methodology. The three most promising OECD markets were found to be Spain, Italy, and Turkey. This report provides in-depth analyses of these three selected countries. First, it addresses changes in the European Community with particular reference to the 1992 restructuring and its potential effect on the energy situation in Europe, specifically in the three subject countries. It presents individual country studies that examine demographics, economics, building infrastructures, and energy-related factors. Potential niches for ACTs are explored for each country through regional analyses. Marketing channels, strategies, and the trading environments in each country are also discussed. The information gathered indicates that Turkey is a most promising market, Spain is a fairly promising market, and Italy appears to be a somewhat limited market for US ACTs. 76 refs., 16 figs., 14 tabs.

Placet, M.; Gerry, P.A.; Kenski, D.M.; Kern, D.M.; Nehring, J.L.; Szpunar, C.B.

1989-09-01T23:59:59.000Z

278

Future Network & MobileSummit 2013 Conference Proceedings Paul Cunningham and Miriam Cunningham (Eds)  

E-Print Network [OSTI]

Atos, Madrid, Spain 8 i2CAT, Barcelona, Spain 9 Fraunhofer FOKUS, Berlin, Germany 10 University of Bristol, Bristol, UK 11 IT innovation centre, Southampton, UK Abstract: Internet systems are currently too of innovative research ideas that could arise from the mixture of their diverse technologies and resources

Sandhu, Ravi

279

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2DO.1.6 BULK LIFETIME ENHANCEMENT BY FIRING STEPS  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2DO.1.6 1 to getter metallic impurities and firing of silicon nitride (SiN) to induce hydrogen passivation. We analyse impurities and hydrogen bulk passivation, respectively. Additionally, the fired SiN layers have to ensure

280

G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June -1 July 2005 Tarragona (Spain) 1 Source Regulation of Fast Energetic  

E-Print Network [OSTI]

G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005 Tarragona (Spain, Rome, Italy #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005, EPM, ...) #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005

Vlad, Gregorio

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.25 MODELLING THE CURING DYNAMICS OF ETHYLENE-VINYL ACETATE  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3. Alshuth2 , M. Köntges1 and R. Brendel1,3 1 Institute for Solar Energy Research Hamelin (ISFH), Am Ohrberg 1, D-31860 Emmerthal, Germany 2 German Institute of Rubber Technology, Eupener Stra�e 33, D-30519

282

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.3.1 ELECTRON AND HOLE MOBILITY REDUCTION AND HALL FACTOR IN PHOSPHORUS-  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.3.1 1 of Engineering, The Australian National University, Canberra, ACT 0200, Australia 2 Department of Electronic Materials Engineering, The Australian National University, Canberra ACT 0200, Australia 3 Institut für

283

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.1.5 BORON-OXYGEN-RELATED RECOMBINATION CENTERS IN COMPENSATED SILICON  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.1 Rougieux2 , Daniel Macdonald2 , Karsten Bothe1 , and Jan Schmidt1 1 Institute for Solar Energy Research and Computer Science, The Australian National University Canberra ACT 0200, Australia ABSTRACT: The impact

284

To Appear in Proc. Third International Workshop on Solar Polarization, Tenerife, Spain, 2002, Eds. J. Trujillo Bueno & J. Sanchez Almeida., ASP Conference Series  

E-Print Network [OSTI]

window and secondary optics. The secondary optics uses a field mirror to re-image the pupil on a 25 cmTo Appear in Proc. Third International Workshop on Solar Polarization, Tenerife, Spain, 2002, Eds Solar Telescope G¨oran B. Scharmer, Dan Kiselman, Mats G. L¨ofdahl & Luc H. M. Rouppe van der Voort

Löfdahl, Mats

285

European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. State-of-the-Art on Methods and Software Tools for Short-Term  

E-Print Network [OSTI]

European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. State-of-the-Art on Methods and Software Tools for Short-Term Prediction of Wind Energy Production G. Giebel*, L. Landberg, Risoe National Roskilde, Denmark Abstract: The installed wind energy capacity in Europe today is 20 GW, while

Paris-Sud XI, Université de

286

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2CV.3.24 DAIDALOS A PLUGIN BASED FRAMEWORK  

E-Print Network [OSTI]

these plugins, complex objects can be created in a modular way. The definitions of input- and output-data within25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2CV.3,2 1 Institute for Solar Energy Research Hamelin (ISFH), Am Ohrberg 1, 31860 Emmerthal, Germany 2

287

Lung Cancer Attributable to Indoor Radon Exposures in Two Radon--Prone Areas, Stei (Romania) and Torrelodones (Spain)  

SciTech Connect (OSTI)

Radon and radon progeny are present indoors, in houses and others dwellings, representing the most important contribution to dose from natural sources of radiation. Most studies have demonstrated an increased risk of lung cancer at high concentration of radon for both smokers and nonsmokers. For medium and low concentrations which are the typical residential radon levels, recent researches have also demonstrated increased risks of lung cancer for people exposed. The work presents a comparative analysis of the radon exposure data in the two radon--prone areas, Stei, Transylvania, (Romania), in the near of old Romanian uranium mines and in the granitic area of Torrelodones town, Sierra de Guadarrama (Spain). One important difference between the two studied areas is related to the houses built using uranium waste as construction material in Stei area. Measurements of indoor radon were performed in 280 dwellings (Romania) and 91 dwellings (Spain) by using nuclear track detectors, CR 39. The highest value measured in Stei area was 2650 Bq{center_dot}m{sup -3}. and 366 Bq{center_dot}m{sup -3} in the Spanish region. The results are compute with the BEIR VI report estimates using the age-duration model at an exposure rate below 2650 Bq{center_dot}m{sup -3}. A total of 233 lung cancer deaths were calculated in the Stei area for a period of 13 years (1994-2006), which is 116.82% higher than observed from the national statistics. In comparison, in Torrelodones area, a number of 276 deaths caused by lung cancer were estimated along a period of 13 years, which is 2.09 times higher than the number observed by authorities. This represents a significantly evidence that elevated risk can strongly be associated with cumulated radon exposure.

Dinu, Alexandra; Cosma, Constantin; Vasiliniuc, Stefan [Faculty of Env. Science, 'Babes-Bolyai' University, Fantanele, No. 30 Cluj Napoca (Romania); Sainz, Carlos; Poncela, Luis Santiago Quindos [Department of Medical Physics, Faculty of Medicine, University of Cantabria, c/Herrera Oria s/n. 39011, Santander (Spain)

2009-05-22T23:59:59.000Z

288

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

289

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

290

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

291

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

292

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

293

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

294

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

295

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

296

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

297

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

298

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

299

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

300

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

302

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

303

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

304

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

305

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

306

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

307

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

308

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

309

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

310

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

311

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

312

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

313

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

314

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

315

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

316

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

317

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

318

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

319

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

320

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

322

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

323

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

324

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

325

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

326

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

327

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

328

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

329

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

330

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

331

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

332

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

333

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

334

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

335

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

336

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

337

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

338

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

339

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

340

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

342

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

343

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

344

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

345

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

346

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

347

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

348

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

349

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

350

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

351

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

352

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

353

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

354

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

355

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

356

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

357

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

358

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

359

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

360

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

362

In T. R. G. Green, J. J. Canas, & C. P. Warren (Eds): Proceedings of the Eight Conference on Cognitive Ergonomics. p 139-144. (ECCE8, Granada, Spain, September 10-13.)  

E-Print Network [OSTI]

on Cognitive Ergonomics. p 139-144. (ECCE8, Granada, Spain, September 10-13.) Reusing processes and documenting Ergonomic Psychology Group Language and Communication Laboratory Ergonomic Psychology Group INRIA

Paris-Sud XI, Université de

363

algab barcelonas menufestival: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

obtained new ultra-thin crystalline silicon wafers, a significant development for the photovoltaic industry. Investigadores de la UPC Politcnica de Catalunya, Universitat...

364

AGROECOLOGIST WORK Department of Plant Sciences HOME 721 Barcelona Avenue  

E-Print Network [OSTI]

: Unifying Principles Sustainability and Agroecosystem Management Stable Isotopes in Ecology River Basin.D., Soil Science, Colorado State University, Fort Collins, Colorado. Dissertation: 'Aggregate and Soil Leuven, Belgium. Major: Soil Science; Minor: Tropical Agriculture. Thesis: 'Soils and Land Use

California at Davis, University of

365

UNIVERSITAT DE BARCELONA Departament d'Astronomia i Meteorologia  

E-Print Network [OSTI]

Environments at Mm and Submm Wavelengths Mem`oria presentada per Aina Palau Puigvert per optar al grau de Meteorologia Bienni 2000­2002 Mem`oria presentada per Aina Palau Puigvert per optar al grau de Doctora en Ci

Estalella, Robert

366

Erfahrungsbericht Jura in Barcelona (Spanien) 2002-03  

E-Print Network [OSTI]

.B. das Bikini, Universal oder La Paloma. In einer NebenstraÃ?e zur Rambla, fast an der Placa Catalunya

Greifswald, Ernst-Moritz-Arndt-Universität

367

Radar-based dynamic testing of the cable-suspended bridge crossing the Ebro River at Amposta, Spain  

SciTech Connect (OSTI)

Microwave remote sensing is the most recent experimental methodology suitable to the non-contact measurement of deflections on large structures, in static or dynamic conditions. After a brief description of the radar measurement system, the paper addresses the application of microwave remote sensing to ambient vibration testing of a cable-suspended bridge. The investigated bridge crosses the Ebro River at Amposta, Spain and consists of two steel stiffening trusses and a series of equally spaced steel floor beams; the main span is supported by inclined stay cables and two series of 8 suspension cables. The dynamic tests were performed in operational conditions, with the sensor being placed in two different positions so that the response of both the steel deck and the arrays of suspension elements was measured. The experimental investigation confirms the simplicity of use of the radar and the accuracy of the results provided by the microwave remote sensing as well as the issues often met in the clear localization of measurement points.

Gentile, Carmelo [Politecnico di Milano, Dept. of Architecture, Built environment and Construction engineering (ABC), Piazza Leonardo da Vinci 32, 20133 Milan (Italy); Luzi, Guido [Centre Tecnòlogic de Telecomunicacions de Catalunya (CTTC), Division of Geomatics, Av. Gauss, 7 E-08860 Castelldefels (Barcelona) (Spain)

2014-05-27T23:59:59.000Z

368

Roof-top solar energy potential under performance-based building energy codes: The case of Spain  

SciTech Connect (OSTI)

The quantification at regional level of the amount of energy (for thermal uses and for electricity) that can be generated by using solar systems in buildings is hindered by the availability of data for roof area estimation. In this note, we build on an existing geo-referenced method for determining available roof area for solar facilities in Spain to produce a quantitative picture of the likely limits of roof-top solar energy. The installation of solar hot water systems (SHWS) and photovoltaic systems (PV) is considered. After satisfying up to 70% (if possible) of the service hot water demand in every municipality, PV systems are installed in the remaining roof area. Results show that, applying this performance-based criterion, SHWS would contribute up to 1662 ktoe/y of primary energy (or 68.5% of the total thermal-energy demand for service hot water), while PV systems would provide 10 T W h/y of electricity (or 4.0% of the total electricity demand). (author)

Izquierdo, Salvador; Montanes, Carlos; Dopazo, Cesar; Fueyo, Norberto [Fluid Mechanics Group, University of Zaragoza and LITEC (CSIC), Maria de Luna 3, 50018 Zaragoza (Spain)

2011-01-15T23:59:59.000Z

369

NREL Response to the Report 'Study of the Effects on Employment of Public Aid to Renewable Energy Sources' from King Juan Carlos University (Spain) (White Paper)  

SciTech Connect (OSTI)

Job generation has been a part of the national dialogue surrounding energy policy and renewable energy (RE) for many years. RE advocates tout the ability of renewable energy to support new job opportunities in rural America and the manufacturing sector. Others argue that spending on renewable energy is an inefficient allocation of resources and can result in job losses in the broader economy. The report, Study of the Effects on Employment of Public Aid to Renewable Energy Sources, from King Juan Carlos University in Spain, is one recent addition to this debate. This report asserts that, on average, every renewable energy job in Spain 'destroyed' 2.2 jobs in the broader Spanish economy. The authors also apply this ratio to the U.S. context to estimate expected job loss from renewable energy development and policy in the United States. This memo discusses fundamental and technical limitations of the analysis by King Juan Carlos University and notes critical assumptions implicit in the ultimate conclusions of their work. The memo also includes a review of traditional employment impact analyses that rely on accepted, peer-reviewed methodologies, and it highlights specific variables that can significantly influence the results of traditional employment impact analysis.

Lantz, E.; Tegen, S.

2009-08-01T23:59:59.000Z

370

Please cite this article in press as: Otero, I., et al., Loss of water availability and stream biodiversity under land abandonment and climate change in a Mediterranean catchment (Olzinelles, NE Spain). Land Use Policy (2010), doi:10.1016/j.landusepol.201  

E-Print Network [OSTI]

biodiversity under land abandonment and climate change in a Mediterranean catchment (Olzinelles, NE Spain under land abandonment and climate change in a Mediterranean catchment (Olzinelles, NE Spain) Iago-cover change Warming Mediterranean catchment Water courses Aquatic fauna a b s t r a c t In the north rim

Gracia, Carlos

371

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2AO.2.3 EFFECT OF SiN DEPOSITION TEMPERATURE ON SURFACE PASSIVATION OF N-TYPE CZ SILICON  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2AO.2N deposition leads to increasing the hydrogen content of the SiN layers. This improves the supply of hydrogen silicon using thermally grown oxide or amorphous films based on hydrogenated silicon compounds has been

372

Highlights of Spanish Astrophysics VIII, Proceedings of the XI Scientific Meeting of the Spanish Astronomical Society held on September 8 12, 2014, in Teruel, Spain. A. J. Cenarro, F. Figueras, C. Hernndez-Monteagudo, J. Trujillo, and L.  

E-Print Network [OSTI]

/INTA), ctra. de Ajalvir km. 4, 28850 Torrej´on de Ardoz, Madrid, Spain 2 Center for Detectors, Rochester, circumstellar extinction and age of FS CMa stars in an unprecedented way. Due to their relatively low brightness ([14]). The distinguishing features consisted of a sharp decrease of the mid-infrared flux above 20µm

Figer, Donald F.

373

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115 NON-LINEAR MECHANICAL PROPERTIES OF ETHYLENE-VINYL ACETATE (EVA) AND ITS  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3,2 1 Institute for Solar Energy Research Hamelin (ISFH), Am Ohrberg 1, D-31860 Emmerthal, Germany 2 ABSTRACT: Polymers such as ethylene-vinyl acetate (EVA) encapsulants are known for their non

374

*Holder of a Scholarship from the Fondo de Investigacin Sanitaria (File No. 97/5653). Sensitization to Anisakis simplex: prevalence in an allergy outpatient clinic of Madrid (Spain)  

E-Print Network [OSTI]

Background: Anisakis simplex is a nematode that has been implicated in IgE-mediated allergic episodes. The aim of this study was to determine the prevalence of clinical and subclinical sensitization to A. simplex in adults attending an allergy outpatient clinic in Madrid (Spain), as well as to assess clinical and laboratory data related to the diagnosis of A. simplex allergy. Methods: We have investigated the alimentary habits (fish ingestion) and the presentation of associated acute or chronic gastrointestinal symptoms in 87 patients referred to our Allergy Outpatient Clinic because of various pathologic conditions. Skin prick tests were performed with an A. simplex extract, and the total and specific (to this parasite) serum IgE levels were measured (CAP-FEIA). Results: Clinical and subclinical sensitization to A. simplex was found in 5.7 % and 23 % of the patients, respectively. The skin tests and the CAP were positive to A. simplex in 16 % and 22 % of the patients, respectively, but the two techniques were simultaneously positive in only 9% of the cases. Forty-four per cent of the patients who had sought medical care because of urticaria, angioedema or anaphylaxis of undetermined aetiology showed a positive CAP assay to A. simplex, as compared to 17 % of those with other reasons for requesting medical consultation (p<0.01). There were no statistically significant differences between the two groups in regard to the results of the skin prick tests. The alimentary habits in the patients with positive skin prick tests and/or positive CAP assay were not signifi-cantly different from those of the patients with negative results. Conclusions. A high proportion of clinical and subclinical sensiti-zation to A. simplex has been detected among patients attending an outpatient allergy clinic in Madrid (Spain). A discrepancy was detected between the skin prick tests and CAP assay results. A habit of fish ingestion and recurrent gastrointestinal episodes do not

M. P. Lpez Sez; J. M. Zubeldia; V. Matheu; M. T. Gracia; M. De Barrio; P. Tornero; T. Herrero

375

Dyslexia Exercises on my Tablet are more Fun Luz Rello Clara Bayarri Azuki G`orriz  

E-Print Network [OSTI]

Dyslexia Exercises on my Tablet are more Fun Luz Rello Clara Bayarri Azuki G`orriz Cookie Cloud Barcelona, Spain dyseggxia@gmail.com ABSTRACT Worldwide, around 10% of the children have dyslexia for children with dyslexia. It features five dif- ferent exercises, which were derived from previous research

376

Journal of Agriculture, Food Systems, and Community Development ISSN: 2152-0801 online  

E-Print Network [OSTI]

University Centre for Sustainability Studies, Lund, Sweden e University of Minnesota, Community Food Systems.034.028 Copyright © 2013 by New Leaf Associates, Inc. Abstract Meeting the demand for food, energy, and water (Barcelona), Spain; martaguadalupe.rivera@uvic.cat b Sustainability Science Program, Harvard University

Ummenhofer, Caroline C.

377

Lightweight ventilated facade prototype: acoustic performance evaluation when the ventilation surface of  

E-Print Network [OSTI]

Lightweight ventilated facade prototype: acoustic performance evaluation when the ventilation del Vall`es, 08173 Barcelona, Spain arquiniampira@yahoo.com Proceedings of the Acoustics 2012 Nantes potentially improve buildings protection against noise pollution from outside. However, in this system the air

Boyer, Edmond

378

Coping with Variability in Model-Based Systems Engineering: An Experience in Green Energy  

E-Print Network [OSTI]

ML, a leading MBSE language, for developing a product line of wind turbine systems used for the generationML and how it has been applied to an ongoing project on wind turbine systems for the generation {strujillo, xmendialdua, jdesosa}@ikerlan.es 2 Alstom Wind Power. Barcelona, Spain {jose

Egyed, Alexander

379

Satellite remote sensing of clouds and the atmosphere 3  

SciTech Connect (OSTI)

This volume contains the proceedings of EOS/SPIE Remote Sensing Symposium which was held September 21--23, 1998 in Barcelona, Spain. Topics of discussion include the following: cloud detection and characterization; earth radiation budget; data assimilation and retrieval methods; and aerosols, ozone, and trace gases.

Russell, J.E. [ed.] [Imperial College of Science, Technology and Medicine, London (United Kingdom)

1998-12-31T23:59:59.000Z

380

Characterizing Web Search Queries that Match Very Few or No Results  

E-Print Network [OSTI]

Research Center Hannover, Germany altingovde@l3s.de Roi Blanco Yahoo! Research Barcelona, Spain roi accompany the original results with some alternative query suggestions (e.g., with a notification by the search engines via both quantitative analyses and user studies on our data (Section 3). To the best

Ulusoy, �zgür

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

SIAM J. DISCRETE MATH. c 2010 Society for Industrial and Applied Mathematics Vol. 24, No. 2, pp. 400419  

E-Print Network [OSTI]

is the generic term for packing low-rate sig- nals into higher speed streams (see the surveys [5, 19, 23, 28, 30 and Combinatorics Group at MA4 Department of UPC, Campus Nord, Barcelona, Spain (Ignasi.Sau@sophia.inria.fr). 400

Paris-Sud XI, Université de

382

Document Assignment in Multi-site Search Engines Ulf Brefeld  

E-Print Network [OSTI]

Document Assignment in Multi-site Search Engines Ulf Brefeld Yahoo! Research Barcelona, Spain to sites is critical for the perfor- mance of multi-site Web search engines. In such settings, sites crawl General Terms Design, Performance, Experimentation Keywords Multi-site web search engines, document

Brefeld, Ulf

383

An integrative taxonomic revision of the Cape Verdean skinks (Squamata, Scincidae)  

E-Print Network [OSTI]

MIRALLES*, RAQUEL VASCONCELOS*, ANA PERERA, DAVID J. HARRIS & SALVADOR CARRANZA Submitted: 12 March 2010 is presented. Corresponding author: Salvador Carranza, Institute of Evolutionary Biology (CSIC-UPF), Pas- seig de la Barceloneta 39-47, 08003 Barcelona, Spain. E-mail: salvador.carranza@ibe.upf-csic.es Aure

Carranza, Salvador

384

Accepted by A.M. Bauer: 7 May 2012; published: 4 Jul. 2012 ISSN 1175-5326 (print edition)  

E-Print Network [OSTI]

on morphology, mitochondrial and nuclear data, with descriptions of eight new species SALVADOR CARRANZA1 37­49, E­08003 Barcelona, Spain. E-mail: Salvador.carranza@ibe.upf-csic.es 2 Department of Zoology SALVADOR CARRANZA & EDWIN NICHOLAS ARNOLD A review of the geckos of the genus Hemidactylus (Squamata

Carranza, Salvador

385

Butllet de la Societat Catalana desembre de 2009  

E-Print Network [OSTI]

Tresorera Aïda Tarragó Vocals Salvador Carranza Gil-Dolz Joan Budó Ricart Dani Aranda Salvachua Albert redactor: Daniel Escoriza Boj Joan Maluquer Margalef Xavier Rivera Salvador Carranza Gil-Dolz Eduard Barcelona, Spain. margarita.metallinou@ibe.upf-csic.es; salvador.carranza@ibe.upf-csic.es 3 Avenida Mar Egeo

Carranza, Salvador

386

Insight into an island radiation: the Tarentola geckos of the Cape Verde  

E-Print Network [OSTI]

Raquel Vasconcelos1,2,3 , Salvador Carranza3 * and D. James Harris1,2 1 CIBIO, Centro de Investigac *Correspondence: Salvador Carranza, Institute of Evolutionary Biology (CSIC-UPF), Passeig Mari´tim de la Barceloneta, 37-49, E-08003 Barcelona, Spain. E-mail: salvador.carranza@ibe.upf-csic.es ABSTRACT Aim

Carranza, Salvador

387

Exploring the network dynamics underlying brain activity during rest Joana Cabral a,b,  

E-Print Network [OSTI]

Exploring the network dynamics underlying brain activity during rest§ Joana Cabral a,b, *, Morten L. Kringelbach b,c , Gustavo Deco a,d a Theoretical and Computational Neuroscience Group, Center of Brain Recerca i Estudis Avanc¸ats (ICREA), Barcelona, Spain Contents 1. Brain activity during rest

Deco, Gustavo

388

RESIDUAL PREDICTION David Sundermann1,2,3  

E-Print Network [OSTI]

Siemens AG, Munich, Germany 2 Universitat Polit`ecnica de Catalunya, Barcelona, Spain 3 University of Southern California, Los Angeles, USA david@suendermann.com, harald.hoege@siemens.com, {antonio, hduxans. Often, when generating (speech synthe- sis) or transforming (voice conversion) speech using one

Suendermann, David

389

CENICS 2013 The Sixth International Conference on Advances in Circuits, Electronics and Micro-  

E-Print Network [OSTI]

and ehealth, bio-systems, navigation systems, automotive systems, home-oriented electronics, bio-systems, etcCENICS 2013 The Sixth International Conference on Advances in Circuits, Electronics and Micro- electronics ISBN: 978-1-61208-302-5 August 25-31, 2013 Barcelona, Spain CENICS 2013 Editors Vladimir Privman

Privman, Vladimir

390

Orange Fluorescent Proteins: Structural Studies of LSSmOrange, PSmOrange and PSmOrange2  

E-Print Network [OSTI]

to greatly decrease the energy of photoconversion and increase its efficiency of photoswitching. Fluorescence Editor: Maria Sola, Molecular Biology Institute of Barcelona, CSIC, Spain Received March 13, 2014 of the Advanced Photon Source was supported by the US Department of Energy, Office of Science, Office of Basic

Verkhusha, Vladislav V.

391

Published in `AI Communications 9 journal', pp1-17. Published by IOS Press (1996) TIGERTM: Knowledge Based Gas Turbine Condition Monitoring  

E-Print Network [OSTI]

: Knowledge Based Gas Turbine Condition Monitoring Dr. Robert Milne and Dr. Charlie Nicol Intelligent, 11 Colon, Barcelona, 08222 Terrassa. Spain 1. INTRODUCTION Given the critical nature of gas turbines and increasing the availability of the gas turbine. Routine preventative maintenance techniques have been used

Travé-Massuyès, Louise

392

INVERTIBLE CONTRACTIONS AND ASYMPTOTICALLY STABLE ODE'S THAT ARE NOT C1  

E-Print Network [OSTI]

systems. Under some sufficient conditions, that include a nonresonance condition, in Rodrigues & Sola dimensions by Mora & Sola-Morales [8]. In the works ElBialy [3], Bin Tan [13] and Abbaci [1] results Catalunya, Av. Diagonal 647, 08028 Barcelona, Spain, e-mail: jc.sola-morales@upc.edu, phone: (34)93 4016552

Politècnica de Catalunya, Universitat

393

Current Biology 21, 17, June 21, 2011 2011 Elsevier Ltd All rights reserved DOI 10.1016/j.cub.2011.05.005 Protected and Threatened Components  

E-Print Network [OSTI]

´tim de la Barceloneta, 37-49, 08003 Barcelona, Spain 7Sea Around Us Project, Fisheries Centre, University Summary The Mediterranean Sea (0.82% of the global oceanic surface) holds 4%­18% of all known marine diversity are spatially congruent with hot spots of fishery impact. Our results highlight that future

Mouquet, Nicolas

394

CYCLOSTATIONARY JOINT PHASE AND TIMING ESTIMATION FOR STAGGERED MODULATIONS  

E-Print Network [OSTI]

-117, Campus Nord UPC, c/Jordi Girona 1-3, 08034 Barcelona, Spain ABSTRACT This paper presents data streams are not time aligned. In particular, stag- gered modulations usually introduce a delay in the quadrature data stream of half the symbol period, which results in smoother phase transitions that restrict

Vázquez, Gregori

395

On-line Predictive Load Shedding for Network Monitoring  

E-Print Network [OSTI]

(UPC), Computer Architecture Dept. Jordi Girona, 1-3 (Campus Nord D6), Barcelona 08034, Spain {pbarlet. Complex analysis on stream- ing network data usually leads to overload situations when presented a large number of #12;users to submit arbitrary traffic queries on live network streams [1, 2]. Recent

Politècnica de Catalunya, Universitat

396

DROP COST AND WAVELENGTH OPTIMAL TWO-PERIOD GROOMING WITH RATIO 4  

E-Print Network [OSTI]

is the generic term for packing low rate sig- nals into higher speed streams (see the surveys [5, 19, 23, 28, 30@dmi.unict.it) ¶Graph Theory and Combinatorics Group at MA4 Department of UPC, Campus Nord, Barcelona, SPAIN. (Ignasi

Bermond, Jean-Claude

397

Vectorized AES core for high-throughput secure environments  

E-Print Network [OSTI]

`odul D6 Campus Nord, 08034 Barcelona, Spain Phone: +34 934 017 001, Fax: +34 934 017 055 mpericas the evaluation of an encryption core capable of handling multiple data streams. The de- sign is oriented towards cryptographic engines with multiple streams to better exploit the available bandwidth. Several specific cases

Kuzmanov, Georgi

398

Side Information Generation for Multiview Distributed Video Coding Using a Fusion Approach  

E-Print Network [OSTI]

& Communications Campus Nord, D-5. Jordi Girona 1-3, 08034 Barcelona, SPAIN E-mail: {xavi, alegon, luis]. The objective of Multiview DVC is to efficiently encode different video streams, but exploiting the possible.e., their video stream is encoded and decoded independently of the other cameras. The third camera, called Wyn

Artigas, Xavier

399

Instability of time-dependent wind-driven ocean gyres Paul C. F. van der Vaart  

E-Print Network [OSTI]

Instability of time-dependent wind-driven ocean gyres Paul C. F. van der Vaart Institute for Marine, Delft, the Netherlands Daniel Calvete Department Fisica Aplicada, UPC, Barcelona, Spain Henk A September 2002 The wind-driven ocean circulation at midlatitudes is susceptible to several types

Schuttelaars, Henk

400

DOI 10.1393/ncc/i2008-10324-3 IL NUOVO CIMENTO Online First  

E-Print Network [OSTI]

DOI 10.1393/ncc/i2008-10324-3 IL NUOVO CIMENTO Online First Filtered deterministic waves and analysis of the fractal dimension of the components of the wind velocity M. Tijera(1 )(), J. L. Cano(1 Meteorologia - Madrid, Spain (3 ) Department of Geotechnical Engineering and Geosciences, UPC - Barcelona

Bolster, Diogo

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

| London Mathematical Society Nonlinearity Nonlinearity 27 (2014) 10031028 doi:10.1088/0951-7715/27/5/1003  

E-Print Network [OSTI]

I, Universitat Polit`ecnica de Catalunya, Diagonal 647, 08028 Barcelona, Spain E-mail: Rafael.Ramirez@upc the caustic types, the winding numbers and the ellipsoids of such minimal periodic trajectories. We also trajectories, so their study is the first task. There exist two remarkable results concerning periodic billiard

Ramírez-Ros, Rafael

402

Atmospheric Environment 40 (2006) 52745297 Influence of the PBL scheme on high-resolution  

E-Print Network [OSTI]

`cnica de Catalunya (UPC), C/ Jordi Girona 1,3, 08034 Barcelona, Spain Received 4 August 2005; received pollutants, such as PBL height, temperature, and wind speed and direction, are analysed. Important temperatures and the weakest winds during daytime, which provokes an enhanced O3 formation. The higher

403

Privacy Preserving Technologies: Extended Bibliography Abedelaziz Mohaisen  

E-Print Network [OSTI]

Project Final Conference, PSD 2004, Barcelona, Catalonia, Spain, June 9-11, 2004: Proceedings, 2004. [2] O-anonymity and the curse of dimensional- ity. Proceedings of the 31st international conference on Very large data bases by conceptual reconstruction. Proceed- ings of the seventh ACM SIGKDD international conference on Knowledge

Zhang, Jun

404

January 20, 2005 ESTEBAN SANZ ESCUD  

E-Print Network [OSTI]

) The finite element method, Technical University of Catalonia UPC, Barcelona (Spain) Fluid flow Seawater Intrusion modeling, Prediction of Conceptual model Uncertainty, Reactive Transport modeling, Geochemistry of carbonate aquifers. EDUCATION 2002-2005, Ph.D. on Hydrogeology and Modeling, Thesis provisional

Politècnica de Catalunya, Universitat

405

Aquatic Botany 69 (2001) 109126 Effect of climatic gradients on the photosynthetic  

E-Print Network [OSTI]

of four Phragmites australis populations Jeannine M. Lessmanna,, Hans Brixa, Václav Bauerb, Olga A, Diagonal 45, Barcelona 08028, Spain Abstract Four populations of Phragmites australis collected from the photosyn- thetic characteristics of Phragmites leaves were evaluated under controlled conditions for each

Brix, Hans

406

Automatic Derivation of Finite-State Machines for Behavior Control Universidad Simon Bolivar  

E-Print Network [OSTI]

´on Bol´ivar Caracas, Venezuela bonet@ldc.usb.ve H´ector Palacios Universidad Sim´on Bol´ivar Caracas, Venezuela hlp@ldc.usb.ve H´ector Geffner ICREA & Universitat Pompeu Fabra Barcelona, SPAIN hector

Bonet, Blai

407

Immosolar Spain | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHiCalifornia:ISI SolarIdanha,Information JumpMorocco Jump

408

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

409

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

410

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

411

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

412

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

413

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

414

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

415

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

416

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

417

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schäfer, Eberhard

418

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

419

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

420

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

422

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

423

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

424

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

425

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

426

ORIGINAL PAPER J. Fang M. J. Barcelona P. J. J. Alvarez  

E-Print Network [OSTI]

, and xylenes (BTEX) are common envi- ronmental contaminants that represent a serious threat to ground water to clean up BTEX-contaminated aqui- fers (National Research Council 1993). Nevertheless, process shifts due to the presence of BTEX com- pounds. Understanding the diversity of such adaptation mechanisms

Alvarez, Pedro J.

427

Publicado en Copyright 2014 Prensa Cientfica S.A. Muntaner, 339 pral. 1. 08021 Barcelona (Espaa)  

E-Print Network [OSTI]

. Metabiología: los orígenes de la creatividad biológica Gregory Chaitin, Virginia Chaitin y Felipe S. Abrahão Gregory Chaitin, Virginia Chaitin y Felipe S. Abrahão de la orígenes creatividad biológica los Enero 2014 creatividad biológica: fenó- menos como la formidable aparición de nuevas formas de vida que tuvo lugar

Chaitin, G. J.

428

Paula Martnez Bonfill, flautista. Neix a Esplugues de Llobregat (Barcelona) l'any  

E-Print Network [OSTI]

a solista ha participat al cicle "El Primer Palau" del Palau de la música catalana. Ha estat guardonada

Geffner, Hector

429

Course Syllabus: Contemporary Barcelona and Its Cultural History Language of Instruction: English  

E-Print Network [OSTI]

of the Palau de la Música (http://www.palaumusica.org/), for which they will be reimbursed. Failure to attend

430

Experiments in Participatory Urbanism: Reform and Autogestión as Emerging Forms of Urban Activism in Barcelona  

E-Print Network [OSTI]

142 Figure 6.1 Pla Buits, location of sites (image:projects. One city initiative, Pla Buits, took a step towardthe Portes de Collserola and Pla Buits, which I detail in

de la Pena, David Scott

2013-01-01T23:59:59.000Z

431

Last updated 7 July 2011 LIST OF PARTICIPANTS AT LIBER 40Th ANNUAL CONFERENCE IN BARCELONA  

E-Print Network [OSTI]

Erfgoedbibliotheek #12;Last updated 7 July 2011 BOSNIA AND HERZEGOVINA Name Institution/Company Ismet Ovcina National and University Library of Bosnia and Herzegovina BULGARIA Name Institution

Politècnica de Catalunya, Universitat

432

Neighborhood as refuge : environmental justice and community reconstruction in Boston, Barcelona, and Havana  

E-Print Network [OSTI]

Environmental Justice (EJ) scholarship has revealed that communities of color and low-income neighborhoods have been disproportionally affected by 'brown' contaminating facilities and excluded from decision-making on their ...

Anguelovski, Isabelle

2011-01-01T23:59:59.000Z

433

Real-Time Demand Side Energy Management  

E-Print Network [OSTI]

Real-Time Demand Side Energy Management Annelize Victor Michael Brodkorb Sr. Business Consultant Business Development Manager Aspen Technology, Inc. Aspen Technology España, S.A. Houston, TX Barcelona, Spain ABSTRACT To remain... competitive, manufacturers must capture opportunities to increase bottom-line profitability. The goal of this paper is to present a new methodology for reducing energy costs – “Demand-Side Energy Management.” Learn how process manufacturers assess energy...

Victor, A.; Brodkorb, M.

2006-01-01T23:59:59.000Z

434

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

435

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

436

Industrial and natural sources of gaseous elemental mercury in the Almadén district (Spain): An updated report on this issue after the ceasing of mining and metallurgical activities in 2003 and major land reclamation works  

SciTech Connect (OSTI)

Two events during the last decade had major environmental repercussions in Almadén town (Spain). First it was the ceasing of activities in the mercury mine and metallurgical facilities in 2003, and then the finalization of the restoration works on the main waste dump in 2008. The combination of both events brought about a dramatic drop in the emissions of gaseous elemental mercury (GEM) to the atmosphere. Although no one would now call the Almadén area as ‘mercury-free’, the GEM levels have fallen beneath international reference safety levels for the first time in centuries. This has been a major breakthrough because in less than one decade the site went from GEM levels in the order of “tens of thousands” to mere “tens” nanogram per cubic meter. Although these figures are per se a remarkable achievement, they do not mark the end of the environmental concerns in the Almadén district. Two other sites remain as potential environmental hazards. (1) The Las Cuevas mercury storage complex, a partially restored ex-mining site where liquid mercury is being stored. The MERSADE Project (LIFE—European Union) has tested the Las Cuevas complex as a potential site for the installation of a future European prototype safe deposit of surplus mercury from industrial activities. Despite restoration works carried out in 2004, the Las Cuevas complex can still be regarded as hotspot of mercury contamination, with high concentrations above 800 ?g g{sup ?1} Hg{sub soil} and 300 ng m{sup ?3} Hg{sub gas}. However, as predicted by air contamination modeling using the ISC-AERMOD software, GEM concentrations fade away in a short distance following the formation of a NW–SE oriented narrow plume extending for a few hundred meters from the complex perimeter. (2) Far more dangerous from the human health perspective is the Almadenejos area, hosting the small Almadenejos village, the so-called Cerco de Almadenejos (CDA; an old metallurgical precinct), and the mines of La Nueva Concepción, La Vieja Concepción and El Entredicho. The CDA is an old metallurgical site that operated between 1794 and 1861, leaving behind a legacy of extremely contaminated soils (mean concentration=4220 ?g g{sup ?1} Hg) and GEM emissions that in summer can reach levels up to 4,000–5,000 ng m{sup ?3}. Thus the CDA remains the sole ‘urban’ site in the district surpassing GEM international reference safety levels. In order to prevent these emissions, the CDA requires immediate action regarding restoration works. These could involve the full removal of soils or their permanent capping to create an impermeable barrier.

Higueras, Pablo, E-mail: pablo.higueras@uclm.es [Departamento de Ingeniería Geológica y Minera, Escuela Universitaria Politécnica de Almadén, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain) [Departamento de Ingeniería Geológica y Minera, Escuela Universitaria Politécnica de Almadén, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); María Esbrí, José [Departamento de Ingeniería Geológica y Minera, Escuela Universitaria Politécnica de Almadén, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain) [Departamento de Ingeniería Geológica y Minera, Escuela Universitaria Politécnica de Almadén, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); Oyarzun, Roberto; Llanos, Willans [Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain) [Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); Departamento de Cristalografía y Mineralogía, Facultad de Ciencias Geológicas, Universidad Complutense, 28040 Madrid (Spain); Martínez-Coronado, Alba [Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain)] [Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); and others

2013-08-15T23:59:59.000Z

437

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

438

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

439

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5’GCGCGCCCATGGGCCCTGCCACCACCCGA3’ (forward primer with NcoI restriction site), 5’GCGCGCCATATGCCTGCCACCACCCGAGGG3’ (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

440

Spain's Earth Scientists and the Oil Spill  

E-Print Network [OSTI]

and a south to north slope current on the sea (1­11), the decision to move the vessel from about 43°N, 9.5°WSpain's Earth Scientists and the Oil Spill THE SPANISH COAST OF GALICIA IS CURRENT- ly subject to an oil spill that, given its spatial and temporal extent, could become one of the worst spills ever

Brown, James H.

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Import of fruits from Spain to Finland.  

E-Print Network [OSTI]

??The research is made for company named Karamelo Citrus S.L.L. It has already business links to many countries and they are working on the link… (more)

Hall, Hardi

2012-01-01T23:59:59.000Z

442

University of Castilla La Mancha Toledo, Spain  

E-Print Network [OSTI]

will be held concurrently. To Register online visit: swatmodel.tamu.edu/conferences/2011 Cancellation Policy Cancellation Policy: Cancel by April 15, 2011 -- receive 70% of registration fee. Cancel after April 15 gassman, Iowa State University, USA A.K. gosain, Indian Institute of Technology, India Ann van griensven

443

XIII REPSOLYPF-HARVARD SEMINAR SALAMANCA, SPAIN  

E-Print Network [OSTI]

of history would support my point. There has not been any politically-inspired price disruption arising from oil, natural gas, terrorism, and finally, about carbon. I offer these four thoughts to stimulate unpredictable and dangerous waters of energy policy in a turbulent and dangerous world. First, oil. We have

Deutch, John

444

XIII REPSOLYPF-HARVARD SEMINAR SALAMANCA, SPAIN  

E-Print Network [OSTI]

JOHN F. KENNEDY SCHOOL OF GOVERNMENT HARVARD UNIVERSITY 79 JFK Street Cambridge, MA 02138, USA REPSOL William W. Hogan French Electricity Liberalization and the European Context ............87 Michel Massoni.........................................................97 María Luisa Huidobro Restructuring Wholesale and Retail Electricity Markets in the United States

Deutch, John

445

Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place: Missouri References: EIA

446

Jornada de Portes obertes de les escoles i facultats del Campus Nord i Campus Sud de Barcelona  

E-Print Network [OSTI]

'AUDITORI DINS EL CAMPUS #12;3 Accés en transport públic: -Metro L3, parada Palau Reial -Trambaix, parada Palau

Politècnica de Catalunya, Universitat

447

Jornada de Portes obertes de les escoles i facultats del Campus Nord i Campus Sud de Barcelona  

E-Print Network [OSTI]

'AUDITORI DINS EL CAMPUS 2 #12;Accés en transport públic: -Metro L3, parada Palau Reial -Trambaix, parada Palau

Politècnica de Catalunya, Universitat

448

Barcelona, (data / fecha / date) Signatura / Firma / Signature: Sollicitud d'Ajut de Matrcula per a Msters Universitaris 2013-14  

E-Print Network [OSTI]

: ............................................................................................................. NIF o Nº Passaport / NIF o Nº Pasaporte / NIF or Passport Nr: ................................. Data

Geffner, Hector

449

Barcelona, (data / fecha / date) Signatura / Firma / Signature: Sollicitud d'Ajut de Matrcula per a Msters Universitaris 2014-15  

E-Print Network [OSTI]

: ............................................................................................................. NIF o Nº Passaport / NIF o Nº Pasaporte / NIF or Passport Nr: ................................. Data

Geffner, Hector

450

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

451

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

452

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

453

Real-Time Traffic Maps  

E-Print Network [OSTI]

d. (2007). Barcelona Traffic Map. Barcelona. 2007. Berendt,Spatial Thinking with Geographic Maps: An Empirical Study.Data on Choropleth Maps in Series." Annals of the

Goldsberry, Kirk Patrick

2007-01-01T23:59:59.000Z

454

16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers  

E-Print Network [OSTI]

on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

Short, Daniel

455

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta

456

Codes for the fast SSS QR eigens  

E-Print Network [OSTI]

Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip ...

457

6th International Symposium on Andean Geodynamics (ISAG 2005, Barcelona), Extended Abstracts: 481-484 A Grenvillian anorthosite-mangerite-charnockite-granite suite in the  

E-Print Network [OSTI]

, in the vicinity of the Southern Peru Copper smelter (Fundición), at about 14 km from Ilo (Fig. 1). A few hundred of the smelter, they are overlaid by Cretaceous volcanics whereas to the north, they are unconformably overlaid

458

Microsoft Word - VIPERS instructions.doc  

Office of Environmental Management (EM)

Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...

459

21F.740 The New Spain: 1977-Present, Fall 2005  

E-Print Network [OSTI]

This course deals with the vast changes in Spanish social, political, and cultural life that have taken place since the death of Franco. It examines the new freedom from censorship; the re-emergence of strong movements for ...

Resnick, Margery

460

Supply chain network for hydrogen transportation in Spain  

E-Print Network [OSTI]

Hydrogen fuel is considered one of the major emerging renewable substitutes for fossil fuel. A crucial factor as to whether hydrogen will be successful depends on its cost as a substitute. Recently, there has been a growing ...

Liang, Li

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Hydraulic fracking sustainability assesment : case of study Luena (Cantabria, Spain).  

E-Print Network [OSTI]

??The opposition to Hydraulic fracturing in Cantabria, has led the Regional Government to enact a law that prohibits their use in the region, which has… (more)

Fernández Ferreras, Jose Antonio

2014-01-01T23:59:59.000Z

462

Integration of public transportation systems : the case of Gipuzkoa, Spain  

E-Print Network [OSTI]

This thesis studies the integration of public transportation systems, focusing on the development of strategies to implement such goal for networks operated by different service agencies. A literature review on public ...

Gómez Gélvez, Julián Andrés

2010-01-01T23:59:59.000Z

463

The regional trade-union : lessons from Spain  

E-Print Network [OSTI]

The region has emerged in the last two decades as a new field of trade-union activity. There is increasing interaction across Europe between unions, employer associations, and state actors at the subnational territorial ...

Fraile, Lydia M

2003-01-01T23:59:59.000Z

464

The Breeding Population of Eurasian Dotterel Charadrius Morinellus in Spain  

E-Print Network [OSTI]

Ricard Gutierrez, Antoni Carulla, Xavier Parellada, Diego Garcia-Ferre, Francesc Xavier Santaeufemia, Jordi Figuerola, Oriol Muntane, Francisco Cerda Journal:  Wader Study Group Bulletin ...

465

Fertility, Female Participation in Employment and Reconciliation Policies in Spain   

E-Print Network [OSTI]

Different aspects of decisions regarding parenthood are analysed. From an institutional perspective, reconciliation policies and features of the female labour market are studied, as well as the values and life views that ...

Ibanez, Marta

2010-01-01T23:59:59.000Z

466

Lindane pollution near an industrial source in Northeast Spain  

SciTech Connect (OSTI)

Since DDT has been legally restricted for use in many countries, lindane, the gamma isomer of hexachlorocyclohexane, ({delta}-HCH), has become important as a substitute for DDT. Lindane is degraded poorly in the environment: it is hydrolyzed poorly and biodegrades slowly. Lindane is relatively immobile in soil. The town of Sabinanigo, located in northeast of the Iberian Peninsula, is host to one of only two factories in western Europe that manufacture lindane. HCH waste is being dumped near Sabinanigo by the chemical company Inquinosa. The purpose of this investigation are: (1) to determine the levels of HCH isomers in water, soil, vegetation, and invertebrates samples in five places of the Gallego river; (2) to evaluate biological accumulation of pollutant studied within the food webs; (3) to find out if the residue levels exceeded the limits recommended of HCH in water.

Hernandez, L.M.; Fernandez, M.A.; Gonzalez, M.J. (Inst. of Organic Chemistry, Madrid (Spain))

1991-01-01T23:59:59.000Z

467

Mirrors and Echoes: Women's Writing in Twentieth-Century Spain  

E-Print Network [OSTI]

Baltús sublima su creatividad frustrada en la lectura, perovoz, el espíritu y la creatividad femeninas con la crónicaque se da entre creatividad y frustración sexual y de los

Bergmann, Emilie L.; Herr, Richard

2007-01-01T23:59:59.000Z

468

http://ifisc.uib.es -Mallorca -Spain BIOSIM: BIOSIMULATION  

E-Print Network [OSTI]

.; Mirasso, C.R.. Coherent regimes of mutually coupled Chua's circuits. Physical Review E 73, 036203 (1, Pere. Theory of collective firing induced by noise or diversity in excitable media. Physical Review E. # Tessone, C.J.; Zanette, D.H. ; Toral R.. Global firing induced by network disorder in ensembles of active

Oro, Daniel

469

Spain in the frame for Europe's bid to host  

E-Print Network [OSTI]

­110; 2003). Hans von Storch,a coastal researcher at the GKSS,an environmental research centre in Geesthacht

470

Paternal Genetic History of the Basque Population of Spain  

E-Print Network [OSTI]

; 0.0073 Mertens et al. (2007) Bosnia 181 0.4621 0.9734#5; 0.0054 Klaric et al. (2005) Bulgaria 126 0.5604 0.9874 #5; 0.0047 Zaharova et al. (2001) Castilla la Mancha 63 0.5226 0.9794 #5; 0.0089 Adams et al. (2008) Castile 131 0.5343 0.9799 #5; 0...% of the total variation and spreading from southeast to northwest through Europe (Cavalli- Sforza et al. 1994). This cline has been interpreted as a genetic signature of the DDM model, with a correlation of 0.89 between the first principal component of gene...

Young, Kristin L.; Sun, Guangyun; Deka, Ranjan; Crawford, Michael H.

2011-09-01T23:59:59.000Z

471

ADASS XV in Spain: The Old Systems Are Dying.  

E-Print Network [OSTI]

and Systems Annular Solar Eclipse! Old Software systems are losing support Scripting and API's are being specifications for a new system which OIR Lunch 2005-10-20 Since 1995, there has been a Birds of a Feather

472

EUDEEP (Smart Grid Project) (Spain) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It is classified as ASHRAEDuvalJusticeEPS Corp JumpESVEUDEEPEUDEEP (Smart

473

HiperDNO (Smart Grid Project) (Spain) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHi Gtel Jump to:County,1143807°,Hilltop,Hinsdale Wave

474

Renewable Energies and Photovoltaics Spain S L REPS | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to: navigation, searchVirginia Blue Ridge And PiedmontReminderville,Jump to:Information

475

EWIS European wind integration study (Smart Grid Project) (Spain) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen

476

2011 University of Castilla la ManCha toledo, spain  

E-Print Network [OSTI]

Change Applications Session A3: Best Management Practices Session F3: Urban Processes and Management Scale Applications Session I4: Hydrology Session B2: Environmental Applications Session G2: Best.m. Discussion & Wrap Up 10:50 a.m. - 12:35 p.m. session a3 - Best management Practices (BmPs) moderator: C

477

Interpolated variaitional transition-state theory: Practical methods for estimating variational transition-state properties and tunneling contributions  

E-Print Network [OSTI]

: Unidad Quimica Fiiica, Departamento Quimica, Uni- versidad Autonoma de Barcelona, Bellaterra 08193

Truong, Thanh N.

478

Discriminacin, generalizacin y clasicacin mediante autmatas neuronales con ruido que induce depresin sinptica  

E-Print Network [OSTI]

Granada Universidad de Granada 18071, Granada (SPAIN) 18071, Granada (SPAIN) 18071, Granada (SPAIN) jmarro

Marro, Joaquín

479

Proceedings of the 10th International Workshop on Quantum Physics and Logic  

E-Print Network [OSTI]

This volume contains the proceedings of the 10th International Workshop on Quantum Physics and Logic (QPL X), which was held July 17-19, 2013 at ICFO in Castelldefels (Barcelona), Spain. The goal of this workshop series is to bring together researchers working on mathematical foundations of quantum physics, quantum computing and spatio-temporal causal structures, and in particular those that use logical tools, ordered algebraic and category-theoretic structures, formal languages, semantic methods and other computer science methods for the study of physical behavior in general. Over the past few years, there has been growing activity in these foundational approaches, together with a renewed interest in the foundations of quantum theory, which complement the more mainstream research in quantum computation.

Bob Coecke; Matty Hoban

2014-12-26T23:59:59.000Z

480

MODIFICACI RLT PAS Acord nm.187/2011 del Consell de Govern pel qual s'aprova la modificaci de  

E-Print Network [OSTI]

000642 210 ETS Arquitectura de Barcelona ADM Cap 1b nivell 1 Cap dels Serveis de Gestió i Suport F JP 35h/s C Barcelona 183 UTG �mbit Arquitectura Barcelona Cap de la UTG �mbit Arquitectura Barcelona - - 2 012986 210 ETS Arquitectura de Barcelona ADM Cap 2 nivell 2 F Cap de l'Oficina de Documentació i Arxiu F

Casanellas, Marta

Note: This page contains sample records for the topic "barcelona spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

482

A Brief History of the Chemistry Department -Part II  

E-Print Network [OSTI]

geniuses during the great #12;A brief history, continued porn poge I the world, among them -Barcelona

Kounaves, Samuel P.

483

E-Print Network 3.0 - alaiz-rodrguez joaqun barreiro Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Garca 1 , Fr Source: Navarro-Arribas, Guillermo - Artificial Intelligence Research Institute, Universitat Autnoma de Barcelona Collection: Computer Technologies and...

484

RESOLUCI DE LA CONVOCATRIA D'AJUTS PER A L'ORGANITZACI DE CONGRESSOS DE LA UPC 2011  

E-Print Network [OSTI]

nd HVDC DOCTORAL COLLOQUIUM BARCELONA 2011 8 1.000 Open MT2 Workshop on Using Linguistic Information

Casanellas, Marta

485

Graellsia, 63(1): 135-142 (2007) * Department of Animal Biology, Faculty of Sciences, University of Granada (Spain) 18071, Granada. Spain. hormiga@ugr.es  

E-Print Network [OSTI]

: Rossomyrmex anatolicus nov. sp., found in the eastern part of the Anatolian plains, near the region of Konya

Villemant, Claire

486

Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan

487

E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

488

[ Enter captions text ] THURSDAY, AUGUST 26, 2010.  

E-Print Network [OSTI]

MARIA AND WE HAVE ZIP CAR ON CAMPUS. A CAR SHARING PROGRAM. WE HAVE AN ESCORT VAN THAT RUNS, ISSUES AROUND CAMPUS TO ZIP CAR, TRANSIT. ANYTHING ALTERNATIVE TRANSPORTATION. >> THAT'S YOUR THING

Sze, Lawrence

489

The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

490

SOLARPERMIT.ORG  

Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database  https://github.com/solarpermit/solarpermit/archive/devel.zip 

491

UCR 05/2013 Washington Academic Internship Program  

E-Print Network [OSTI]

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship

492

AQUATIC PLANT CONTROL RESEARCH PROGRAM  

E-Print Network [OSTI]

. Michael Smart, John W. Barko Environmental Laboratory DEPARTMENT OF THE ARMY Waterways Experiment. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) PO Box 631 Vicksburg, MS NUMBER ORGANIZATION (If IIPplicable) US Army Corps of Engineers 8c. ADDRESS (City, State, and ZIP Code

US Army Corps of Engineers

493

Science and Literary Culture during Spain's Edad de Plata (1923-1936)  

E-Print Network [OSTI]

Whitehead, Alfred North. Science and the Modern World. NewPostures: Literature, Science and the Two Cultures Debate.Critical Theory and Science Fiction. Hanover: Wesleyan

Hiller, Anna Eva

2010-01-01T23:59:59.000Z

494

E-Print Network 3.0 - area sw spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mathematics 2 MSWMA DUAL DEGREE PROGRAM Effective for students starting in 2011-2012 Summary: Academic Years Summer I: STM Course Course Area Credits TMxxx Christology or...

495

Diagenetic controls on porosity and permeability in Miocene carbonates, La Molata, Spain  

E-Print Network [OSTI]

and oxygen isotopes, Sr concentration and 87Sr/86Sr. The carbonate platform was extensively dolomitized at the end of the Miocene but before Pliocene deposition. Amount of dolomite increases basinward and down section; limestone is restricted to the most...

Li, Zhaoqi

2012-05-31T23:59:59.000Z

496

Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

E-Print Network [OSTI]

incentives given by transmission pricing form the foundationhas focussed on transmission pricing, monopoly regulation,

Gronli, Helle; Gomez San Ramon, Tomas; Marnay, Chris

1999-01-01T23:59:59.000Z

497

Mediterranean clonal selections evaluated for modern hedgerow olive oil production in Spain  

E-Print Network [OSTI]

Institut de Recerca i Tecnologia Agroali- mentaria (IRTA)the Institut de Recerca i Tecnologia Agroalimentaria (IRTA)

Tous, Joan; Romero, Agusti; Hermoso, Juan Francisco; Ninot, Antonia

2011-01-01T23:59:59.000Z

498

European Academy of Management 14th Annual Conference EURAM 4-7 June 2014 Valencia Spain  

E-Print Network [OSTI]

relies on the capacity to reuse and connect existing technologies; 3) the design of GT might require forward new markets (first unknown: the markets) and new technologies (second unknown: the technologies innovation that impacts or generate many markets and many technical variations. From a statistical point

Paris-Sud XI, Université de

499

Impact of GPS Zenith Tropospheric Delay data on precipitation forecasts in Mediterranean France and Spain  

E-Print Network [OSTI]

implies that the GPS data has good potential for influencing numerical models in rapidly developing, high for the forecasting of rainfall. Water vapor plays an important role in energy transfer and in the formation of clouds. 1992]. Rocken et al. (1993)] demonstrated agreement between water vapor radiometers and GPS derived

Haase, Jennifer

500

Traumatized subjects : horror film and the legacy of mass extermination in post-dictatorship Spain  

E-Print Network [OSTI]

the display in the shop window, and the film’s last line ofwindow, the most brilliant flash of color in the entire film.windows, which had been covered with curtains throughout the rest of the film.

Boehm, Scott Walter

2012-01-01T23:59:59.000Z