Powered by Deep Web Technologies
Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Bangkok, Thailand: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Bangkok, Thailand: Energy Resources Bangkok, Thailand: Energy Resources Jump to: navigation, search Name Bangkok, Thailand Equivalent URI DBpedia GeoNames ID 1609350 Coordinates 13.753979°, 100.501444° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.753979,"lon":100.501444,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

2

Examining the Role of Boundary Organizations and Environmental Champions in Increasing Natural Hazard Preparedness in Bangkok, Thailand  

E-Print Network (OSTI)

Sage. Masters, J. 2011.Thailands flood gradually subsiding;change increasing Thai Flood Risk. Weather Underground,and soil salinization. Floods are a frequent occurrence in

Bateman, Alexis H.

2013-01-01T23:59:59.000Z

3

Potential for Absorption Cooling Generated from Municipal Solid Waste in Bangkok.  

E-Print Network (OSTI)

?? This masters thesis has been performed in Bangkok, Thailand at the company Eco Design Consultant Co., Ltd. The aim is to investigate the possibilities (more)

Hedberg, Erika

2010-01-01T23:59:59.000Z

4

Thailand  

National Nuclear Security Administration (NNSA)

Transitions Radiation Detection System at Port of Laem Chabang to Thailand http:nnsa.energy.govmediaroompressreleasessldthailand

5

Open to the public! : a new network of communal recreation waterfront space in Bangkok  

E-Print Network (OSTI)

Physically and historically, Bangkok has been shaped by its relationship to its waterfront. Flowing 370 kilometers through Thailand, the Chao Phraya River is more than the nation's lifeline. It was a principal waterway ...

Srirojanapinyo, Apichart

2009-01-01T23:59:59.000Z

6

ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.

1965-09-27T23:59:59.000Z

7

Transport growth in Bangkok: Energy, environment, and traffic congestion. Workshop proceedings  

SciTech Connect

Bangkok, the capital of Thailand, is a physically and economically complexcity with a complicated transport system. With daily traffic congestion averaging 16 hours, the air quality is such that to breathe street level pollution for 8 eight hours is roughly equivalent to smoking nine cigarettes per day. Estimates suggest idling traffic costs up to $1.6 billion annually. Energy use within the transport sector is on a steady rise with an estimated increase in 11 years of two and one half times. Severe health impacts have begun to effect many residents - young children and the elderly being particularly vulnerable. Bangkok`s air quality and congestion problems are far from hopeless. Great potential exists for Bangkok to remedy its transport-related problems. The city has many necessary characteristics that allow an efficient, economical system of transport. For example, its high density level makes the city a prime candidate for an efficient system of mass transit and the multitude and close proximity of shops, street vendors, restaurants, and residential areas is highly conducive to walking and cycling. Technical knowledge and capacity to devise and implement innovative policies and projects to address air quality and congestion problems is plentiful. There is also consensus among Bangkokians that something needs to be done immediately to clear the air and the roads. However, little has been done. This report proposes a new approach to transport planning for Bangkok that integrates consideration of ecological, social, and financial viability in the process of making decisions regarding managing existing infrastructure and investments in new infrastructure. Selected papers have been indexed separately for inclusion in the Energy Science and Technology Database.

Philpott, J. [Asia Regional Office, Bangkok (Thailand)

1995-07-01T23:59:59.000Z

8

Thailand gas project now operational  

SciTech Connect

Now operational, Phase 1 of Thailand's first major natural gas system comprises one of the world's longest (264 miles) offshore gas lines. Built for the Petroleum Authority of Thailand (PTT), this system delivers gas from the Erawan field in the Gulf of Thailand to two electrical power plants near Bangkok, operated by the Electricity Generating Authority of Thailand (EGAT). The project required laying about 360 miles of pipeline, 34-in., 0.625 in.-thick API-5LX-60 pipe offshore and 28-in., 0.406 in.-thick API-5LX-60 onshore. The offshore pipe received a coal-tar coating, a 3.5-5.0 in. concrete coating, and zinc sacrificial-anode bracelets. The onshore line was coated with the same coal-tar enamel and, where necessary, with concrete up to 4.5 in. thick. Because EGAT's two power plants are the system's only customers, no more pipeline will be constructed until deliveries, currently averaging about 100 million CF/day, reach the 250 million CF/day level. The project's second phase will include additional pipelines as well as an onshore distribution network to industrial customers.

Horner, C.

1982-08-01T23:59:59.000Z

9

Measurement of energy-saving effect by intermodal freight transport in Thailand  

Science Journals Connector (OSTI)

In Thailand, transport sector is the largest energy consuming sector (38%). Road haulage of freight transport accounts for approximately 92% of total domestic freight movements. Accordingly, it is one of the largest contributors to adverse environmental impacts. This study presents one option to reduce energy consumption through modal shift from trailer to intermodal transport involving railway and waterway. It focuses on freight movements between Bangkok and Hat Yai in Thailand. Energy savings are measured by multi-objective optimisation model using decision variables consisting of three mode options: trailer only, intermodal-rail and intermodal-waterway. In addition to energy consumption, the objective function also includes time and charge of shipment factor.

Shinya Hanaoka; Taqsim Husnain; Tomoya Kawasaki; Pichet Kunadhamraks

2011-01-01T23:59:59.000Z

10

Thailand's downstream projects proliferate  

SciTech Connect

Thailand continues to press expansion and modernization of its downstream sector. Among recent developments: Construction of an olefins unit at Thailand's second major petrochemical complex and a worldscale aromatics unit in Thailand is threatened by rising costs. Thailand's National Petrochemical Corp (NPC) let a 9 billion yen contract to Mitsui Engineering and Shipbuilding Co. and C. Itoh and Co. for a dual fuel cogeneration power plant at its Mab Ta Phud, Rayong province, petrochemical complex. Financing is in place to flash a green light for a $530 million Belgian-Thai joint venture sponsoring a worldscale polyvinyl chloride/vinyl chloride monomer plant in Thailand. Work is more than 50% complete on the $345 million second phase expansion of Thai Oil's Sri Racha refinery in Chon Buri province. Petroleum Authority of Thailand (PTT) endorsed a plan to install two more natural gas processing plants in Thailand to meet rapidly growing domestic demand for petroleum gas.

Not Available

1991-06-03T23:59:59.000Z

11

The commercial feasibility of underground coal gasification in southern Thailand  

SciTech Connect

Underground Coal Gasification (UCG) is a clean coal technology with the commercial potential to provide low- or medium-Btu gas for the generation of electric power. While the abundance of economic coal and natural gas reserves in the United States of America (USA) has delayed the commercial development of this technology in the USA, potential for commercial development of UCG-fueled electric power generation currently exists in many other nations. Thailand has been experiencing sustained economic growth throughout the past decade. The use of UCG to provide electric power to meet the growing power demand appears to have commercial potential. A project to determine the commercial feasibility of UCG-fueled electric power generation at a site in southern Thailand is in progress. The objective of the project is to determine the commercial feasibility of using UCG for power generation in the Krabi coal mining area located approximately 1,000 kilometers south of Bangkok, Thailand. The project team has developed a detailed methodology to determine the technical feasibility, environmental acceptability, and commercial economic potential of UCG at a selected site. In the methodology, hydrogeologic conditions of the coal seam and surrounding strata are determined first. These results and information describing the local economic conditions are then used to assess the commercial potential of the UCG application. The methodology for evaluating the Krabi UCG site and current project status are discussed in this paper.

Solc, J.; Young, B.C.; Harju, J.A.; Schmit, C.R. [Univ. of North Dakota, Grand Forks, ND (United States). Energy and Environmental Research Center; Boysen, J.E. [B.C. Technologies, Ltd., Laramie, WY (United States); Kuhnel, R.A. [IIASES, Delft (Netherlands)

1996-12-31T23:59:59.000Z

12

Evaluating the feasibility of underground coal gasification in Thailand  

SciTech Connect

Underground coal gasification (UCG) is a clean coal technology that converts in situ coal into a low- to medium-grade product gas without the added expense of mining and reclamation. Potential candidates for UCG are those coal resources that are not economically recoverable or that are otherwise unacceptable for conventional coal utilization processes. The Energy and Environmental Research Center (EERC), through the sponsorship of the US Trade and Development Agency and in collaboration with the Electricity Generating Authority of Thailand (EGAT), is undertaking a feasibility study for the application of UCG in the Krabi coal mining area, 620 miles south of Bangkok in Thailand. The EERC`s objective for this project is to determine the technical, environmental, and economic feasibility of demonstrating and commercializing UCG at a selected site in the Krabi coal mining area. This paper addresses the preliminary developments and ongoing strategy for evaluating the selected UCG site. The technical, environmental, and economic factors for successful UCG operation are discussed, as well as the strategic issues pertaining to future energy expansion in southern Thailand.

Young, B.C.; Harju, J.A.; Schmit, C.R.; Solc, J. [Univ. of North Dakota, Grand Forks, ND (United States). Energy and Environmental Research Center; Boysen, J. [B.C. Technologies, Ltd., Laramie, WY (United States); Kuehnel, R.A. [International Inst. for Aerospace Survey and Earth Sciences, Delft (Netherlands)

1996-12-31T23:59:59.000Z

13

Reinventing flexibility : a hybrid paradigm for Thai markets in Bangkok, Thailand  

E-Print Network (OSTI)

This thesis asserts that the current form of the proliferating modernization of Thai markets in terms of economic growth and the incorporation of building technology to improve goods storage, attractive envelope, and ...

Pattamasattayasonthi, Ekachai

2011-01-01T23:59:59.000Z

14

Global Network Kyoto University has opened a new center in Bangkok, Thailand, dedicated to supporting research,  

E-Print Network (OSTI)

to supporting research, education, and international collaborations across the ASEAN region. To mark the launch of these activities, an official opening ceremony and a symposium titled "Kyoto University in ASEAN -- Past, Present, government, and industry from ASEAN member states and Japan convened at the opening ceremony

Takada, Shoji

15

Thailand's gas line underway: coating a major achievement  

SciTech Connect

Using primarily local personnel and materials, Bredero Price International's Thai pipe-coating plant has prepared some 374 miles of 34 and 28-in. pipe for service in the Gulf of Thailand gas-pipeline project. The enamel-coating shop cleaned, primed and coated all the pipe with coal-tar enamel, glass-fiber mat, felt, and a kraft-paper outer wrap; the cement-coating facility then added a concrete-weight coating to the portion of the pipe earmarked for offshore duty. Scheduled for a 1981 completion, the pipeline will initially carry 250 million CF/day to power-generating plants in Bangpakong and South Bangkok; the volume transported will eventually reach 500 million CF/day when addition offshore production is tied in to the line and an offshore compressor station added.

Hale, D.

1980-12-01T23:59:59.000Z

16

Limits of isotropic plastic deformation of Bangkok clay  

E-Print Network (OSTI)

A model assuming incremental plastic isotropic response has been recently proposed to model the deformation of isotropic packing of grains, in the small-strain range. It is used here on over-consolidated remould clay, to interpret the small-strain range behaviour obtained in [1,2] on Bangkok clay. The data published in [1,2] at constant volume are also used here to measure the size of the domain of validity in the (q/(M'p), p/po) plane, where po is the over-consolidation isotropic pressure, p is the mean stress and q the deviatoric stress, q . So, it is shown that the model works also for clay. This enlarges the application domain of model [3,4] to soft clay with OCR larger than 1.2 to 1.5. Pacs # : 45.70.-n ; 62.20.Fe ; 83.80.Fg, 83.80.Hj

P. Evesque

2005-07-08T23:59:59.000Z

17

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +

18

Verification Checklist Home Address: City: State: Zip:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o

19

Emergency response: an investigation on a possibility of establishing valuable flood protecting infrastructures in Bangkok  

Science Journals Connector (OSTI)

This paper aims to study the flooding event in Bangkok in 2011. Its objective is to seek for the possibility of creating the new flood preventing infrastructures, which may help reducing the flood impacts to the city in future crises, as well as to create a plan regarding to the creation of them in term of locations and sizes. The investigations on Bangkok's population and critical infrastructures suggested that the central area of Bangkok should be protected. As a result, the locations of the proposing infrastructures were selected accordingly and they are expecting to protect 76.02% of the population. Finally, it is concluded that this investment can be considered as worthwhile investment, in the case where there is a possibility that similar disaster may happen in the future, since the beneficial analysis showed that the value of preventable damages significantly exceeds the costs and expenses of the proposing infrastructures.

Thavalit Kampanartkosol

2013-01-01T23:59:59.000Z

20

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

22

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

23

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

24

Joint International Conference on "Sustainable Energy and Environment (SEE 2006)" F-024 (O) 21-23 November 2006, Bangkok, Thailand  

E-Print Network (OSTI)

/removal of biomethanation projects, renewable energy projects and fuel switch projects. Large number of CDM projects from by renewable energy projects. Biomethanation projects have made a significant impact in the CDM market in terms a reasonable guidance for biomethanation projects in CDM. In India, The National Master Plan for biomethanation

Columbia University

25

E-Print Network 3.0 - airport land reclamation Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

AirportAirport Suvarnabhumi Airport... ,Suvarnabhumi Airport, Bangkok, ThailandBangkok, Thailand 12;OverviewOverview Magnitudes and Financing... -- Land purchased inLand...

26

Microsoft Word - NETL-TRS-4-2014_CO2 Storage and Enhanced Gas...  

NLE Websites -- All DOE Office Websites (Extended Search)

Conference, Bangkok, Thailand, Feb 7-9, 2011; SPE, Gaffney, Cline & Associates: Bangkok, Thailand, 2011. Ghaith, A.; Chen, W.; Ortoleva, P. Oscillatory methane release from shale...

27

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network (OSTI)

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

28

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +

29

Electrostatic zipping actuators and their applications to MEMS  

E-Print Network (OSTI)

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology

2004-01-01T23:59:59.000Z

30

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network (OSTI)

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

31

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +

32

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +

33

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network (OSTI)

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

34

Southeast Asia and Kyoto University  

E-Print Network (OSTI)

, Kyoto University opened its ASEAN Center in Bangkok, Thailand (p.11), the latest development in over

Takada, Shoji

35

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network (OSTI)

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

36

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network (OSTI)

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

37

Feasibility study for renovation of north Bangkok Power Plant. Volume 1. Study report. Export trade information  

SciTech Connect

The report addresses the life extension and cycling operation of the three North Bangkok generating units and the technical and economic feasibility of converting the three units to natural gas firing. The report is divided into five sections: Introduction (purpose of study); Summary and Recommendations (findings of study, recommended modifications); Cycling and Life Extension Assessment (describes general considerations for life extension and cycling operation and identifies major obstacles); Conversion to Gas Firing (performance of existing boilers when fired by natural gas and recommended modifications to steam generators); and Cost Estimates and Performance (expected performance changes; estimates, and analyses).

Not Available

1989-08-01T23:59:59.000Z

38

Export.gov - 02092011Thailand Welcome  

NLE Websites -- All DOE Office Websites (Extended Search)

ภาษาไทย ภาษาไทย Register | Manage Account Search Our Site Click to Search Our Site Export.gov Home Opportunities By Industry By Country Market Research Trade Events Trade Leads Free Trade Agreements Solutions International Sales & Marketing International Financing International Logistics Licenses & Regulations Trade Data & Analysis Trade Problems Locations Domestic Offices International Offices FAQ Blog Connect Home > Thailand Local Time in Thailand: Print | E-mail Page Thailand Home Doing Business in Thailand Services for U.S. Companies Education Trade Events Local Service Providers for US exporters Invest in USA Treaty of Amity Intellectual Property Rights in Thailand Student Intern Program Links Contact Us Our Worldwide Network About Us Press Room Other Worldwide Markets

39

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...

40

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org

42

From comfort to kilowatts: An integrated assessment of electricity conservation in Thailand's commercial sector  

SciTech Connect

Thailand serves as a case study of the potential to conserve electricity in the fast-growing commercial sectors of the tropical developing world. We performed a field study of over 1100 Thai office workers in which a questionnaire survey and simultaneous physical measurements were taken. Both air-conditioned and non-air-conditioned buildings were included. We analyzed Thai subjective responses on the ASHRAE, McIntyre and other rating scales, relating them to Effective Temperature, demographics, and to rational indices of warmth such as PMV and TSENS. These results suggest that without sacrificing comfort, significant energy conservation opportunities exist through the relaxation of upper space temperature limits. To investigate the potential for conserving energy in a cost-effective manner, we performed a series of parametric simulations using the DOE-2.1D computer program on three commercial building prototypes based on actual buildings in Bangkok; an office, a hotel, and a shopping center. We investigated a wide range of energy conservation measures appropriate for each building type, from architectural measures to HVAC equipment and control solutions. The best measures applied in combination into high efficiency cases can generate energy savings in excess of 50%. Economic analyses performed for the high efficiency cases, resulted in costs of conserved energy of less than and internal rates of return in excess of 40%. Thermal cool storage, cogeneration, and gas cooling technology showed promise as cost-effective electric load management strategies.

Busch, J.F. Jr.

1990-08-01T23:59:59.000Z

43

Heat Pump Market in Thailand  

Science Journals Connector (OSTI)

The value of hot water system in Thailand, rarely mentioned or quantified, is almost 3,000 million Baht per year. The heat pump is an option of hot water system. The development of heat pump in Thailand is officially started in 2002 according to the program of subsidy for heat pump but before that there was some slow development. Comparing to the cost of hot water production from instantaneous system, local manufactured heat pump is commercial viable even without the subsidy. The imported heat pump compared to local production can be sold to only high end user or high awareness of energy. The important factor of heat pump development is depended on the selling price, performance, and the customer behavior. The highest efficiency may not be the winner in Thai market as the drivers for higher efficiency or co-efficiency of performance of heat pump is not so strong compared to the price. Some of information in this paper cannot be supported by the real data because of the brand name of heat pump cannot be published.

Kuaanan Techato

2012-01-01T23:59:59.000Z

44

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are

45

Thailand-National Energy Policy and Development Plan | Open Energy  

Open Energy Info (EERE)

Thailand-National Energy Policy and Development Plan Thailand-National Energy Policy and Development Plan Jump to: navigation, search Tool Summary Name: Thailand-National Energy Policy and Development Plan Agency/Company /Organization: Government of Thailand Sector: Energy Topics: Low emission development planning, Policies/deployment programs, Background analysis Resource Type: Publications, Case studies/examples Website: www.eppo.go.th/doc/gov-policy-2549/energy-policy-2006.html Program Start: 2006 Country: Thailand UN Region: South-Eastern Asia References: Thailand-Development Plan[1] This article is a stub. You can help OpenEI by expanding it. References ↑ "Thailand-Development Plan" Retrieved from "http://en.openei.org/w/index.php?title=Thailand-National_Energy_Policy_and_Development_Plan&oldid=384165"

46

US fossil fuel technologies for Thailand  

SciTech Connect

The US Department of Energy has been encouraging other countries to consider US coal and coal technologies in meeting their future energy needs. Thailand is one of three developing countries determined to be a potentially favorable market for such exports. This report briefly profiles Thailand with respect to population, employment, energy infrastructure and policies, as well as financial, economic, and trade issues. Thailand is shifting from a traditionally agrarian economy to one based more strongly on light manufacturing and will therefore require increased energy resources that are reliable and flexible in responding to anticipated growth. Thailand has extensive lignite deposits that could fuel a variety of coal-based technologies. Atmospheric fluidized-bed combustors could utilize this resource and still permit Thailand to meet emission standards for sulfur dioxide. This option also lends itself to small-scale applications suitable for private-sector power generation. Slagging combustors and coal-water mixtures also appear to have potential. Both new construction and refurbishment of existing plants are planned. 18 refs., 3 figs., 7 tabs.

Buehring, W.A.; Dials, G.E.; Gillette, J.L.; Szpunar, C.B.; Traczyk, P.A.

1990-10-01T23:59:59.000Z

47

Conference Paper for Electricity Industry in Transition: Issues and Prospects for Asia, Bangkok, Thailand, Jan. 14-16, 2004. 2003 Dennis Ray and Frank Wayno  

E-Print Network (OSTI)

and Education in a Transitioning Electric Power Industry Dennis Ray Executive Director Power Systems Engineering, in some cases over an extended period of time. Historically, the electric-power system has been vertically countries in using collaborative research. 1 Introduction The electric supply industry is in transition from

48

NPP Tropical Forest: Khao Chong, Thailand  

NLE Websites -- All DOE Office Websites (Extended Search)

Khao Chong, Thailand, 1962-1965 Khao Chong, Thailand, 1962-1965 [PHOTOGRAPH] Photograph: Eye-level view of forest interior at Khao Chong (click on the photo to view a series of images from this site) Data Citation Cite this data set as follows: Kira, T. 1998. NPP Tropical Forest: Khao Chong, Thailand, 1962-1965. Data set. Available on-line [http://www.daac.ornl.gov] from Oak Ridge National Laboratory Distributed Active Archive Center, Oak Ridge, Tennessee, U.S.A. Description Productivity of a tropical rain forest was determined at the Khao Chong study site, under the auspices of the Joint Thai-Japanese Biological Expedition to South-East Asia. Biomass increment within a 40 m x 40 m study area for all trees greater than 4.5 cm dbh (diameter at breast height, 130 cm) was monitored between

49

Thailand: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Thailand: Energy Resources Thailand: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":15,"lon":100,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

50

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network (OSTI)

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

51

The effectiveness of jobs-housing balance as a strategy for reducing traffic congestion: a study of metropolitan Bangkok  

E-Print Network (OSTI)

of Thailand. Travel time index (TTI) was developed to measure congestion. In addition to JHB, a number of land use variables were included in the analysis. They are population density, school density, and job accessibility index. Multiple regression models...

Lobyaem, Sonchai

2006-10-30T23:59:59.000Z

52

Sawasdee Sabaidee | Open Energy Information  

Open Energy Info (EERE)

Sawasdee Sabaidee Sawasdee Sabaidee Jump to: navigation, search Name Sawasdee Sabaidee Place Bangkok, Thailand Zip 10900 Sector Solar Product Thailand-based company, Sawasdee Sabaidee is active in sales, planning, design, installation, maintenance, engineering and consulting for solar systems as well as telecommunictaions power back up systems and equipment for industrial and power plants. References Sawasdee Sabaidee[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Sawasdee Sabaidee is a company located in Bangkok, Thailand . References ↑ "Sawasdee Sabaidee" Retrieved from "http://en.openei.org/w/index.php?title=Sawasdee_Sabaidee&oldid=350642" Categories:

53

Thailand-Clean Technology Fund (CTF) | Open Energy Information  

Open Energy Info (EERE)

Thailand-Clean Technology Fund (CTF) Thailand-Clean Technology Fund (CTF) Jump to: navigation, search Name Thailand-Climate Technology Fund (CTF) Agency/Company /Organization African Development Bank, Asian Development Bank, European Bank for Reconstruction and Development, Inter-American Development Bank, World Bank Sector Climate, Energy Focus Area Energy Efficiency, Geothermal, Transportation Topics Background analysis, Finance, Implementation, Low emission development planning, Market analysis Website http://www.climateinvestmentfu Country Thailand South-Eastern Asia References Thailand-CTF Investment Plan[1] Thailand-Climate Technology Fund (CTF) Screenshot Overview "The Clean Technology Fund (CTF), one of two Climate Investment Funds, promotes scaled-up financing for demonstration, deployment and transfer of

54

Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...

55

THE DEPLOYMENT OF ZIP NON-EQUILIBRIUM PHONON DETECTORS IN CDMS II  

E-Print Network (OSTI)

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of

56

WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...

57

Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network (OSTI)

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade

58

Thailand-Measurement and Performance Tracking (MAPT) Initiative | Open  

Open Energy Info (EERE)

Thailand-Measurement and Performance Tracking (MAPT) Initiative Thailand-Measurement and Performance Tracking (MAPT) Initiative Jump to: navigation, search Logo: Thailand-WRI Measurement and Performance Tracking (MAPT) Project Name Thailand-WRI Measurement and Performance Tracking (MAPT) Project Agency/Company /Organization World Resources Institute (WRI) Sector Climate, Energy Topics Background analysis, Baseline projection, Low emission development planning, -NAMA Resource Type Case studies/examples, Guide/manual, Lessons learned/best practices, Training materials, Workshop Website http://www.wri.org/mapt Program Start 2011 Country Thailand South-Eastern Asia References Measurement and Performance Tracking (MAPT) Project[1] Contents 1 Overview 2 Resources 3 Partners 4 References Overview Developing countries are increasingly undertaking mitigation efforts in

59

Thailand-Danish Government Baseline Workstream | Open Energy Information  

Open Energy Info (EERE)

Thailand-Danish Government Baseline Workstream Thailand-Danish Government Baseline Workstream Jump to: navigation, search Name Thailand-Danish Government Baseline Workstream Agency/Company /Organization Danish Government Partner Danish Ministry for Climate, Energy, and Building; The Danish Energy Agency Sector Energy Topics Implementation, Low emission development planning Program Start 2011 Country Thailand South-Eastern Asia References Denmark[1] Overview Progress and Outcomes Capacity building needs identified are lessons learned, challenges and gaps, including those that may be common between countries, and aspects of good practice for assumptions, methodologies and other aspects of baseline setting. References ↑ "Denmark" Retrieved from "http://en.openei.org/w/index.php?title=Thailand-Danish_Government_Baseline_Workstream&oldid=699937

60

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

62

Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

63

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network (OSTI)

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

64

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network (OSTI)

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

65

Thailand-Low Emissions Asian Development (LEAD) Program | Open Energy  

Open Energy Info (EERE)

Thailand-Low Emissions Asian Development (LEAD) Program Thailand-Low Emissions Asian Development (LEAD) Program Jump to: navigation, search Name Thailand-Low Emissions Asian Development (LEAD) Program Agency/Company /Organization ICF International, United States Agency for International Development (USAID) Partner USFS, EPA, United States Department of State Sector Climate, Energy, Land Topics Background analysis, Low emission development planning, -LEDS Website http://www.LowEmissionsAsia.or Country Thailand South-Eastern Asia References USAID LEAD Program[1] The Low Emissions Asian Development (LEAD) program is a regional US Agency for International Development (USAID) activity that supports developing countries in Asia to achieve long-term, transformative development and accelerate sustainable, climate-resilient economic growth while slowing the

66

Thailand-Key Results and Policy Recommendations for Future Bioenergy  

Open Energy Info (EERE)

and Policy Recommendations for Future Bioenergy and Policy Recommendations for Future Bioenergy Development Jump to: navigation, search Name Thailand-Key Results and Policy Recommendations for Future Bioenergy Development Agency/Company /Organization Food and Agriculture Organization of the United Nations Sector Land Focus Area Biomass, Agriculture Topics Co-benefits assessment, Policies/deployment programs, Background analysis Resource Type Lessons learned/best practices Website http://www.fao.org/docrep/013/ Country Thailand UN Region South-Eastern Asia References Thailand-Key Results and Policy Recommendations for Future Bioenergy Development[1] Abstract "The Government of Thailand, through its Alternative Energy Development Plan, has set a target to increase biofuel production to five billion

67

Thailand-UNEP Risoe Technology Needs Assessment Program | Open Energy  

Open Energy Info (EERE)

Thailand-UNEP Risoe Technology Needs Assessment Program Thailand-UNEP Risoe Technology Needs Assessment Program Jump to: navigation, search Name Thailand-UNEP Risoe-Technology Needs Assessment Program Agency/Company /Organization UNEP-Risoe Centre Sector Energy Topics Background analysis, Low emission development planning, -Roadmap, Pathways analysis Website http://tech-action.org/ Country Thailand South-Eastern Asia References UNEP Risoe-Technology Needs Assessment Program[1] Abstract UNEP DTIE in collaboration with the UNEP Risoe Centre will provide targeted financial, technical and methodological support to assist a total of 35 to 45 countries to conduct TNA projects Overview "Technology needs assessment (TNA) is a set of country-driven activities that identifies and determines the mitigation and adaptation technology

68

Thailand Sectoral Study on Climate and Refrigeration Technology in  

Open Energy Info (EERE)

Thailand Sectoral Study on Climate and Refrigeration Technology in Thailand Sectoral Study on Climate and Refrigeration Technology in Developing Countries and the Development of Methods and Instruments for Identifying Reduction Potential and Implementing NAMAs Jump to: navigation, search Name Thailand-Sectoral Study on Climate and Refrigeration Technology in Developing Countries and the Development of Methods and Instruments for Identifying Reduction Potential and Implementing NAMAs Agency/Company /Organization Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH Sector Climate Focus Area Renewable Energy, Greenhouse Gas Topics Low emission development planning, -LEDS, -NAMA, Market analysis Website http://www.giz.de/en/ Program Start 2010 Program End 2012 Country Thailand South-Eastern Asia References Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ)[1]

69

Thailand-Lowering Emissions in Asia's Forests (LEAF) | Open Energy  

Open Energy Info (EERE)

Thailand-Lowering Emissions in Asia's Forests (LEAF) Thailand-Lowering Emissions in Asia's Forests (LEAF) Jump to: navigation, search Name Thailand-Lowering Emissions in Asia's Forests (LEAF) Agency/Company /Organization United States Agency for International Development Sector Climate, Land Focus Area Biomass, Forestry Topics GHG inventory, Low emission development planning, -LEDS Resource Type Training materials Website http://www.snvworld.org/en/sec Country Thailand South-Eastern Asia References LEAF[1] "Lowering Emissions in Asia's Forests (LEAF), supported by USAID/RDMA, aims to strengthen the capacity of target countries to achieve meaningful and sustained reductions in GHG emissions from the forestry-land use sector while assisting them in benefitting from the emerging international REDD+

70

Thailand-Climate Technology Initiative Private Financing Advisory Network  

Open Energy Info (EERE)

Thailand-Climate Technology Initiative Private Financing Advisory Network Thailand-Climate Technology Initiative Private Financing Advisory Network (CTI PFAN) Jump to: navigation, search Logo: Thailand-Climate Technology Initiative Private Financing Advisory Network (CTI PFAN) Name Thailand-Climate Technology Initiative Private Financing Advisory Network (CTI PFAN) Agency/Company /Organization Climate Technology Initiative (CTI), United States Agency for International Development (USAID), Renewable Energy and Energy Efficiency Partnership (REEEP) Partner International Centre for Environmental Technology Transfer Sector Energy Focus Area Agriculture, Biomass, - Biofuels, - Landfill Gas, - Waste to Energy, Buildings, Energy Efficiency, Forestry, Geothermal, Greenhouse Gas, Solar, Transportation, Water Power, Wind Topics Adaptation, Co-benefits assessment, - Energy Access, - Environmental and Biodiversity, - Health, - Macroeconomic, Finance, Implementation, Low emission development planning, -NAMA, -TNA

71

Radiological accident and incident in Thailand: lesson to be learned  

Science Journals Connector (OSTI)

......was transported to a safe storage at the OAEP (Figure-3...the 137Cs source to a safety storage at the Radioactive Waste Management Center, Thailand...including instructions relating to long-term storage or disposition, had been......

Nanthavan Ya-anant; Kanokrat Tiyapun; Kittiphong Saiyut

2011-07-01T23:59:59.000Z

72

Advanced health biotechnologies in Thailand: redefining policy directions  

Science Journals Connector (OSTI)

Many advanced health biotechnologies do not fall clearly into the classic categories used by many regulatory agencies. In Thailand, the Thai Food and Drug Administration (TFDA), Department of Medical Sciences (DMSc

Romn Prez Velasco; Usa Chaikledkaew; Chaw Yin Myint

2013-01-01T23:59:59.000Z

73

Petroleum resources of Indonesia, Malaysia, Brunei, and Thailand  

SciTech Connect

This report presents estimates of the total recoverable crude oil from Indonesia, Malaysia, Brunei, and Thailand (Thailand is not currently an exporter of petroleum but is included because of its proximity to the South China Sea and its high petroleum potential). Also included is an analysis of potential future rates at which these resources could enter into world markets. However, this analysis does not take into account the possible supply of recoverable resources from nonconventional deposits such as tar sands and oil shale.

Not Available

1984-07-01T23:59:59.000Z

74

Energy and the economy: Soaring development in Thailand  

SciTech Connect

Thailand's economy is one of the fastest growing in the world. Spectacular economic growth has brought a number of growing pains, energy being one of the many notables. Thailand's growth campaign has been fueled by oil, and as the economy shows little sign of slowing, energy use continues to grow. The government must balance a surging economy while scrambling to maintain sufficient energy supplies and infrastructure.

Not Available

1993-08-25T23:59:59.000Z

75

High Performance Computing: Needs and Application for Thailand  

E-Print Network (OSTI)

This paper presents the overview of High Performance Computing, the required components, and its applications. Current state of the HPC researches and facilities in Thailand has also been reviewed along with the HPC related research conducted in Kasetsart University. In summary, HPC is a technology that has an impact on Thailand competitiveness. Yet, much more qualifed man-power and broader recognition of the field are desparately needed.

Yuen Poovarawan Putchong; Putchong Uthayopas

1997-01-01T23:59:59.000Z

76

An Update on Ethanol Production and Utilization in Thailand2014  

SciTech Connect

In spite of the recent political turmoil, Thailand has continued to develop its ethanol based alternative fuel supply and demand infrastructure. Its support of production and sales of ethanol contributed to more than doubling the production over the past five years alone. In April 2014, average consumption stood at 3.18 million liter per day- more than a third on its way to its domestic consumption goal of 9 million liters per day by 2021. Strong government incentives and the phasing out of non-blended gasoline contributed substantially. Concurrently, exports dropped significantly to their lowest level since 2011, increasing the pressure on Thai policy makers to best balance energy independency goals with other priorities, such as Thailands trade balance and environmental aspirations. Utilization of second generation biofuels might have the potential to further expand Thailands growing ethanol market. Thailand has also dramatically increased its higher ethanol blend vehicle fleet, with all new vehicles sold in the Thai market now being E20 capable and the number of E85 vehicles increasing three fold in the last year from 100,000 in 2013 to 300,000 in 2014.

Bloyd, Cary N.; Foster, Nikolas AF

2014-09-01T23:59:59.000Z

77

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx

78

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California

79

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http

80

Bioenergy Development in Thailand: Challenges and Strategies  

Science Journals Connector (OSTI)

Abstract In recognition of concerns about the security of energy supply and climate change, the Thai government has developed Alternative Energy Development Plan for the period 20122021. Under this plan, the production of bio- ethanol and biodiesel in 2021 is expected to grow significantly. This growth will add more pressures on water and land requirements for growing energy crops. This is likely to contribute to worsening the security of water and food supply. This paper, therefore, provides an overview of the bioenergy development and current policies in Thailand with a view to identify the challenges faced by the development of bioenergy. A review of the bioenergy policies reveals that the existing policies have been exclusively focus on energy perspective and largely ignore the significance of the implications arising from the interdependencies between energy, water and food. There is a lack of understanding of the interrelationships between bioenergy, water and food policy interactions. The lack of such understanding is likely to pose several challenges including food or fuel dilemma, security of water supply and issues surrounding land use for biofuel production. This paper further emphasizes the need to develop an integrated framework for developing an understanding of the relationships between energy, water and land.

Supannika Wattana

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Thailand-Enhancing Capacity for Low Emission Development Strategies  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » Thailand-Enhancing Capacity for Low Emission Development Strategies (EC-LEDS) Jump to: navigation, search Name Thailand-Enhancing Capacity for Low Emission Development Strategies (EC-LEDS) Agency/Company /Organization United States Agency for International Development, United States Environmental Protection Agency, United States Department of Energy, United States Department of Agriculture, United States Department of State Sector Climate, Energy, Land Topics Low emission development planning, -LEDS Program Start 2010 Program End 2016 Country Thailand

82

An assessment of Thailand's feed-in tariff program  

Science Journals Connector (OSTI)

Abstract Thailand was one of the first Asian countries with a comprehensive feed-in tariff program, with streamlined interconnection regulations adopted by the Thai Cabinet in 2002 and technology-specific tariff Adders in 2006. This paper presents an overview of the country's feed-in tariff, or Adder, program and its development. As of December 2011, Thailand has about 8000MW of renewable energy projects in the pipeline seeking Adder and about 1000MW already connected and selling power to the grid. Thailand's feed-in tariff program has undergone significant transitions especially since 2010 in tariff levels and screening criteria partly in response to applications for 471 solar electric power plants exceeding 2000MW. A powerful new oversight committee comprising utility and Ministry of Energy representatives has raised concerns regarding transparency and consistency, and significantly reduced approval rates of new applications.

Sopitsuda Tongsopit; Chris Greacen

2013-01-01T23:59:59.000Z

83

Kyoto University has launched a Japan-Thailand collaborative research  

E-Print Network (OSTI)

Kyoto University has launched a Japan-Thailand collaborative research project titled "Development of clean and efficient utilization of low rank coals and biomass by solvent treatment," supported biomass waste as well as low-rank coals into valuable products such as carbon fiber, biofuel, and high

Takada, Shoji

84

Natural Ventilation Design for Houses in Thailand Chalermwat Tantasavasdia  

E-Print Network (OSTI)

This paper explores the potential of using natural ventilation as a passive cooling system for new house windows in suburban houses can be opened. Passive cooling design elements are mostly ignored in modern1 Natural Ventilation Design for Houses in Thailand Chalermwat Tantasavasdia , Jelena Srebricb

Chen, Qingyan "Yan"

85

Thailand-The Mitigation Action Implementation Network (MAIN) | Open Energy  

Open Energy Info (EERE)

Thailand-The Mitigation Action Implementation Network (MAIN) Thailand-The Mitigation Action Implementation Network (MAIN) Jump to: navigation, search Name Thailand-The Mitigation Action Implementation Network (MAIN) Agency/Company /Organization Center for Clean Air Policy (CCAP) Partner ICI, Environment Canada, BP, World Bank Institute, Thailand, Ministry of Energy Thailand, Ministry of Industry Thailand, Ministry of Natural Resources and Environment Thailand, Pollution Control Department, Ministry of Natural Resources and Environment Philippines, Climate Change Commission Philippines, Department of Environment and Natural Resources Vietnam, Ministry of Planning and Investment Vietnam, Sub-Institute of Hydrometeorology and Environment of South Vietnam, Ministry of Industry and Trade Vietnam, Ministry of Finance Indonesia, Ministry of Public Works Indonesia, Ministry of Transport Indonesia, Dept. of Clean & Efficient Energy Technology Implementation Indonesia, National Council on Climate Change Malaysia, Ministry of Natural Resources and Environment Malaysia, Dept. of Economic Planning Malaysia, Ministry of Green Technology, Energy and Water Malaysia, Land Public Transport Commission India, Central Electricity Regulatory Commission Pakistan, Dept. of Planning & Development Pakistan, Ministry of Finance Pakistan, Ministry of Foreign Affairs Pakistan, Ministry of Water and Power Germany, Federal Environment Ministry Argentina, Ministry of Energy Argentina, Ministry of Industry Chile, Ministry of Environment Chile, Ministry of Energy Chile, Ministry of Transport Chile, Ministry of Finance Colombia, Ministry of Environment Colombia, Ministry of Transport Colombia, Department of National Planning Colombia, Ministry of Housing Costa Rica, Climate Change Direction Costa Rica, Ministry of Agriculture Costa Rica, Ministry of Housing Costa Rica, Ministry of Energy Dominican Republic, National Climate Change Commission Dominican Republic, National Energy Commission Dominican Republic, Ministry of Environment and Natural Resources Dominican Republic, Ministry of Economy, Planning and Development Dominican Republic, Technical Office for Land Transport (OTTT) Panama Canal Authority Panama Maritime Authority Peru, Ministry of Environment Peru, Ministry of Energy and Mines Peru, Ministry of Transport and Communications Peru, Ministry of Energy and Mines Uruguay, Ministry of the Environment Uruguay, National Transport Directorate Uruguay, Ministry of Industry, Energy and Minerals Uruguay, Ministry of Agriculture Canada, Ministry of the Environment Norway, Ministry of the Environment Sweden, Department of the Environment UK, Department for Energy and Climate Change (DECC), Danish Government

86

Thailand-Status and Potential for the Development of Biofuels and Rural  

Open Energy Info (EERE)

Thailand-Status and Potential for the Development of Biofuels and Rural Renewable Energy Thailand-Status and Potential for the Development of Biofuels and Rural Renewable Energy Agency/Company /Organization Asian Development Bank Sector Energy, Land Focus Area Biomass, - Biofuels, Agriculture Topics Policies/deployment programs, Co-benefits assessment, - Energy Access, Resource assessment, Background analysis Website http://www.adb.org/Documents/R Country Thailand UN Region South-Eastern Asia References Thailand-Status and Potential for the Development of Biofuels and Rural Renewable Energy[1] Thailand-Status and Potential for the Development of Biofuels and Rural Renewable Energy Screenshot Summary "The objectives of this study are to: identify promising areas for investment in the development of the biofuel subsector in Thailand, with due consideration of the country's

87

Thailand-The World Bank Partnership for Market Readiness (PMR) | Open  

Open Energy Info (EERE)

Thailand-The World Bank Partnership for Market Readiness (PMR) Thailand-The World Bank Partnership for Market Readiness (PMR) Jump to: navigation, search Logo: Thailand-The World Bank Partnership for Market Readiness (PMR) Name Thailand-The World Bank Partnership for Market Readiness (PMR) Agency/Company /Organization World Bank Partner Australia, Denmark, EC, Germany, Japan, Netherlands, Norway Spain, Switzerland, UK, and US Sector Climate, Energy Focus Area Non-renewable Energy, Buildings, Economic Development, Energy Efficiency, Goods and Materials, Greenhouse Gas, Grid Assessment and Integration, Industry, Offsets and Certificates, People and Policy, Transportation Topics Baseline projection, Finance, GHG inventory, Implementation, Low emission development planning, Market analysis, Policies/deployment programs

88

Leonics Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Leonics Co Ltd Leonics Co Ltd Jump to: navigation, search Name Leonics Co Ltd Place Bangkok, Thailand Zip 10260 Sector Solar Product Manufactures solar thermal water heating systems, PV inverters, active tracking systems, and PV systems using Kaneka, Solarmax, Sanyo, Bangkok Solar, Sharp and Ekarat Solar modules. Coordinates 13.75333°, 100.504822° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.75333,"lon":100.504822,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

89

A biomethane solution for domestic cooking in Thailand  

Science Journals Connector (OSTI)

Abstract This paper is concerned with the process of switching from non-renewable LPG to renewable biomethane for domestic cooking in Thailand. Most domestic stoves in Thailand use liquid petroleum gas (LPG), supplied in portable tanks. Switching to biomethane requires a method of (a) biomethane production, (b) biomethane storage and (c) stove modification to allow biomethane combustion. This paper will outline a solution to each of these three hurdles. A production plant was developed, a storage and delivery solution was designed and a methodology was developed and implemented for converting stoves for biomethane use. The results show that biomethane can be produced, delivered and combusted safely and efficiently in domestic Thai stoves. These results provide a roadmap for certain local communities to utilize renewable energy in a sustainable fashion.

S. Suwansri; J.C. Moran; P. Aggarangsi; N. Tippayawong; A. Bunkham; P. Rerkkriangkrai

2014-01-01T23:59:59.000Z

90

Dependency and development in northern Thailand's tourism industry  

E-Print Network (OSTI)

?s citizens and thus little real development taking place (Britton 1982; Khan 1997; Mbaiwa 2005; Milne 1987). Some scholars have argued that alternative forms of tourism such as backpacking, adventure tourism, cultural tourism, and ecotourism are better... opium production (Kampe 1997). In addition to substituting other cash crops for opium it is hoped that tourism can help replace the income generated by opium (Renard 2001). Tourism in Northern Thailand tends to focus more on ecotourism and cultural...

Lacher, Richard Geoffrey

2009-05-15T23:59:59.000Z

91

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network (OSTI)

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

92

E-Print Network 3.0 - ambient polycyclic aromatic Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Adducts in Mothers Summary: . Exposure to genotoxins present in ambient air in Bangkok, Thailand: particle associated polycyclic aromatic... DNA Damage from Polycyclic Aromatic...

93

E-Print Network 3.0 - ash financial aspects Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Conference on Fly Ash, Silica Fume, Slag, and Natural Pozzolans in Concrete, Bangkok, Thailand Source: Wisconsin-Milwaukee, University of - Department of Civil Engineering and...

94

E-Print Network 3.0 - advanced sequenching technology Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

Gene... Engineering" at DNA Technology Laboratory, NSTDA, Kasetsart University, Bangkok, Thailand in 2002. 12 Source: Behmer, Spencer T. - Department of Entomology, Texas A&M...

95

E-Print Network 3.0 - ash separators Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Conference on Fly Ash, Silica Fume, Slag, and Natural Pozzolans in Concrete, Bangkok, Thailand Source: Wisconsin-Milwaukee, University of - Department of Civil Engineering and...

96

Analysis of Singularity Lines by Transforms with Parabolic Scaling  

E-Print Network (OSTI)

, Phyathai Road, Patumwan, Bangkok 10330, Thailand. (2) Department of Applied Mathematics, Lappeenranta University of Technology, Lappeenranta, Finland. panuvuth@hotmail.com, jouni.sampo@lut.fi, songkiat

Paris-Sud XI, Université de

97

Thailand-NIES Low-Carbon Society Scenarios 2050 | Open Energy Information  

Open Energy Info (EERE)

Thailand-NIES Low-Carbon Society Scenarios 2050 Thailand-NIES Low-Carbon Society Scenarios 2050 Jump to: navigation, search Name Thailand-NIES Low-Carbon Society Scenarios 2050 Agency/Company /Organization National Institute for Environmental Studies Topics Background analysis, Low emission development planning Website http://2050.nies.go.jp/LCS/ind Program Start 2009 Country Thailand UN Region Eastern Asia References 2050 Low-Carbon Society Scenarios (LCSs)[1] National and Local Scenarios National and local scenarios available from the activity webpage: http://2050.nies.go.jp/LCS/index.html References ↑ "2050 Low-Carbon Society Scenarios (LCSs)" Retrieved from "http://en.openei.org/w/index.php?title=Thailand-NIES_Low-Carbon_Society_Scenarios_2050&oldid=700318" Category: Programs

98

GIZ-Thailand-Programme for Developing and Implementing a Climate Protection  

Open Energy Info (EERE)

Thailand-Programme for Developing and Implementing a Climate Protection Thailand-Programme for Developing and Implementing a Climate Protection Policy Jump to: navigation, search Name Thailand - Programme for developing and implementing a climate protection policy Agency/Company /Organization German Agency for International Cooperation (GIZ) Partner on behalf of the Federal Ministry for the Environment, Nature Conservation and Nuclear Safety (BMU) Sector Energy Focus Area Energy Efficiency Topics Low emission development planning Website http://www.gtz.de/en/themen/28 Program Start 2009 Program End 2012 Country Thailand South-Eastern Asia References Development and Implementation of Climate Policy[1] Overview The ability to develop and implement a climate protection policy in Thailand must be restored. Capacity development activities will target the

99

Thailand-National Energy Efficiency Plan and Evidence-based Mitigation  

Open Energy Info (EERE)

Thailand-National Energy Efficiency Plan and Evidence-based Mitigation Thailand-National Energy Efficiency Plan and Evidence-based Mitigation Strategy Jump to: navigation, search Name GIZ-Thailand-National energy efficiency plan as a core element for an activity- and evidence-based mitigation strategy Agency/Company /Organization Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH Sector Climate Focus Area Renewable Energy, Energy Efficiency Topics Low emission development planning, -LEDS, -NAMA, Technology characterizations Website http://www.gtz.de/en/themen/28 Program End 2015 Country Thailand South-Eastern Asia References Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH[1] Program Overview The project will support the formulation and implementation of a national energy efficiency plan for Thailand, with the aim of tapping efficient and

100

Status and outlook for Thailand's low carbon electricity development  

Science Journals Connector (OSTI)

Thailand is facing an urgency to enhance its energy security and capacity to cope with global warming impacts, as demands on fossil fuel consumption keep rising. This paper reviewed the latest situation on renewable powers and developmental strategies toward low carbon electricity generation in Thailand. Government recently has spent tremendous financial and legislative supports to promote the uses of indigenous renewable energy resources and fuel diversification while contributing in reduction of global greenhouse gas. Major policy challenge is on which types of renewable energy should be more pronounced to ensure sustainable future of the country. Regions in Thailand present different potentials for renewable supply on biomass, municipal wastes, hydropower, and wind. To maximize renewable energy development in each area, location is matter. Currently, energy-derived biomass is widely utilized within the country, however if droughts happen more often and severe, it will not only affect food security but also energy security. Life cycle of biomass energy production may cause other social issues on land and chemical uses. Meanwhile, deployment of wind and solar energy has been slow and needs to speed up to the large extent in comparison with energy proportion from biomass. Nuclear power has already been included in the Thai power development plan 2010 (PDP-2010). However, public acceptance is a major issue. Setting up strategic renewable energy zone to support power producer according to pre-determined potential location may assist development direction. Furthermore, government has to strongly subsidize research and development to lower technology cost and promote private investment on renewable energy industry. In the future, revision of electricity price is needed to allow fair competition between non-renewable and renewable energy once subsidy programs are ended. Environmental tax according to fuel types could help government progressing toward low carbon electricity. Stimulating renewable energy development and utilization at local community is a key for Thai sufficiency economy.

Narumitr Sawangphol; Chanathip Pharino

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Novel Composite Materials Demonstrate Ultra-sensitivity  

NLE Websites -- All DOE Office Websites (Extended Search)

applications. This team participated in the Mai Business Plan Competition in Bangkok, Thailand, March 1-3 and was awarded first place - the H.M. The King of Thailand Award - in...

102

Thai Semcon Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Thai Semcon Co Ltd Thai Semcon Co Ltd Jump to: navigation, search Name Thai Semcon Co., Ltd Place Bangkok, Thailand Zip 10400 Sector Solar Product Thailand-based engineering company undertakes electrical projects, mechanical projects, sanitation systems, construction projects, telecommunication projects as well as solar energy projects. Coordinates 13.75333°, 100.504822° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.75333,"lon":100.504822,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

103

JSX Energy Inc | Open Energy Information  

Open Energy Info (EERE)

JSX Energy Inc JSX Energy Inc Jump to: navigation, search Name JSX Energy Inc Place Bangkok, Thailand Zip 10500 Product Delaware-headquartered company, set up to explore for petroleum in Thailand, also considering PV project development. Coordinates 13.75333°, 100.504822° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.75333,"lon":100.504822,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

104

Ekarat Solar Company Ltd | Open Energy Information  

Open Energy Info (EERE)

Ekarat Solar Company Ltd Ekarat Solar Company Ltd Jump to: navigation, search Name Ekarat Solar Company Ltd Place Bangkok, Thailand Zip 10250 Sector Solar Product A solar PV modules manufacturer and a subsidiary company of Ekarat Engineering Public Company Limited, a transformer manufacturer in Thailand and in South Eastern Asia. Coordinates 13.75333°, 100.504822° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.75333,"lon":100.504822,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

105

Natural Energy Development Co Ltd NED | Open Energy Information  

Open Energy Info (EERE)

Development Co Ltd NED Development Co Ltd NED Jump to: navigation, search Name Natural Energy Development Co Ltd (NED) Place Bangkok, Thailand Zip 10330 Sector Solar, Wind energy Product Thailand-based JV developing wind and solar projects. Coordinates 13.75333°, 100.504822° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.75333,"lon":100.504822,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

106

Thailand-Enhancing Low-carbon Development by Greening the Economy: Policy  

Open Energy Info (EERE)

Thailand-Enhancing Low-carbon Development by Greening the Economy: Policy Thailand-Enhancing Low-carbon Development by Greening the Economy: Policy Dialogue, Advisory Services, Benchmarking Jump to: navigation, search Name Thailand-Enhancing Low-carbon Development by Greening the Economy: Policy Dialogue, Advisory Services, Benchmarking Agency/Company /Organization Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH Sector Climate Focus Area Renewable Energy Topics Low emission development planning, -LEDS, -NAMA, -Roadmap, Market analysis, Pathways analysis Program Start 2011 Program End 2014 Country Thailand South-Eastern Asia References Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ)[1] Program Overview The project will promote Green Economy in developing countries and emerging economies as a realistic approach towards low-carbon development. It will

107

Thailand-NAMA Programme for the Construction Sector in Asia | Open Energy  

Open Energy Info (EERE)

Thailand-NAMA Programme for the Construction Sector in Asia Thailand-NAMA Programme for the Construction Sector in Asia Jump to: navigation, search Name Thailand-NAMA Programme for the Construction Sector in Asia Agency/Company /Organization United Nations Environment Programme (UNEP) Sector Climate Focus Area Renewable Energy, Buildings, Industry Topics Low emission development planning, -LEDS, -NAMA, Market analysis Website http://www.unep.org/sbci/pdfs/ Program End 2017 Country Thailand South-Eastern Asia References Buildings and Climate Change[1] Program Overview This project will support countries to develop Nationally Appropriate Mitigation Actions (NAMA) for the building sector. The NAMAs will be developed and apply common MRV methodologies for buildings in line with work by CDM and UNEP/ISO. NAMA will deliver significant GHG emission

108

Thailand-Low Carbon Asia Research Network (LoCARNet) | Open Energy  

Open Energy Info (EERE)

Thailand-Low Carbon Asia Research Network (LoCARNet) Thailand-Low Carbon Asia Research Network (LoCARNet) Jump to: navigation, search Logo: Thailand-Low Carbon Asia Research Network (LoCARNet) Name Thailand-Low Carbon Asia Research Network (LoCARNet) Agency/Company /Organization Institute for Global Environmental Strategies (IGES) Partner Japan Ministry of Environment Sector Climate, Energy, Land Focus Area Agriculture, Biomass, Buildings, Economic Development, Energy Efficiency, Forestry, Geothermal, Greenhouse Gas, Hydrogen, Industry, Land Use, People and Policy, Solar, Transportation, Wind Topics Background analysis, GHG inventory, Low emission development planning, -LEDS, -NAMA, -Roadmap, Pathways analysis, Policies/deployment programs Website http://lcs-rnet.org/about_loca Program Start 2012

109

Great inclination to smoke among younger adults coming from low-socioeconomic class in Thailand  

Science Journals Connector (OSTI)

We found that smoking prevalence in Thailand were particularly high among younger adults from low-socioeconomic class. The rate of smoking prevalence among low ... that among other age groups. Such a greater diff...

Sunsanee Mekrungrongwong; Keiko Nakamura

2011-08-01T23:59:59.000Z

110

Reclamation of Abandoned Shrimp Pond Soils in Southern Thailand for Cultivation of Mauritius Grass (Brachiaria mutica)  

Science Journals Connector (OSTI)

A study on soil reclamation for cultivation of Mauritius grass was conducted on soils obtained from abandoned shrimp ponds at Ranote District, Songkhla Province, southern Thailand. A glass house experiment on ...

P. Towatana; C. Voradej; N. Leeraphante

2003-09-01T23:59:59.000Z

111

GIZ-Thailand-National energy efficiency plan as a core element for an  

Open Energy Info (EERE)

Thailand-National energy efficiency plan as a core element for an Thailand-National energy efficiency plan as a core element for an activity- and evidence-based mitigation strategy Jump to: navigation, search Name GIZ-Thailand-National energy efficiency plan as a core element for an activity- and evidence-based mitigation strategy Agency/Company /Organization Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH Sector Climate Focus Area Renewable Energy, Energy Efficiency Topics Low emission development planning, -LEDS, -NAMA, Technology characterizations Website http://www.gtz.de/en/themen/28 Program End 2015 Country Thailand South-Eastern Asia References Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH[1] Program Overview The project will support the formulation and implementation of a national

112

The Development of Improved Energy Efficient Housing for Thailand Utilizing Renewable Energy Technology  

E-Print Network (OSTI)

SimBuild 2004, IBPSA-USA National Conference, Boulder, CO, August 4-6th, 2004, p. 1 THE DEVELOPMENT OF IMPROVED ENERGY EFFICIENT 1 HOUSING FOR THAILAND UTILIZING RENEWABLE ENERGY TECHNOLOGY 2 3... The paper reports on the results of research to reduce energy consumption in residential buildings in a hot and humid climate region (Thailand) using efficient architectural building components, energy efficient building systems, and renewable energy...

Rasisuttha, S.; Haberl, J.

113

An Energy Overview of the Kingdom of Thailand  

SciTech Connect

The DOE Office of Fossil Energy is maintaining a web site that is meant to provide useful business- and energy-related information about countries and regions of the world for exporters, project developers, and researchers. The site consists of more than 130 country pages (organized into seven different world regions), with each country page having its own set of links to information sources about that country. There are also more than 30 Country Energy Overviews at the web site -- each of these is a comprehensive review of a specific country's entire energy situation, including sections on Energy Policy, Oil, Natural Gas, Coal, Hydroelectric/Renewables, Nuclear Power, Energy Transmission Infrastructure, Electricity, Electric Industry Overview, Environmental Activities, Privatization, Trade, and Economic Situation. The specific country highlighted in this Country Energy Overview is Thailand. The site is designed to be dynamic. Updates to the overviews will be made as need and resource s permit.

anon.

2003-10-20T23:59:59.000Z

114

Preparation and gasification of a Thailand coal-water fuel  

SciTech Connect

In response to an inquiry by the Department of Mineral Resources (DMR) in Thailand, the Energy and Environmental Research Center (EERC) prepared a four-task program to assess the responsiveness of Wiang Haeng coal to the temperature and pressure conditions of hot-water drying (HWD). The results indicate that HWD made several improvements in the coal, notably increases in heating value and carbon content and reductions in equilibrium moisture and oxygen content. The equilibrium moisture content decreased from 37.4 wt% for the raw coal to about 20 wt% for the HWD coals. The energy density, determined at 500 cP, indicates an increase from 4450 to 6650 Btu/lb by hydrothermal treatment. Raw and HWD coal were then gasified at various mild gasification conditions of 700 C and 30 psig. The tests indicated that the coal is probably similar to other low-rank coals and will produce high levels of hydrogen and be fairly reactive.

Ness, R.O. Jr.; Anderson, C.M.; Musich, M.A.; Richter, J.J.; Dewall, R.A.; Young, B.C. [Univ. of North Dakota, Grand Forks, ND (United States). Energy and Environmental Research Center; Nakanart, A. [Ministry of Industry, Bangkok (Thailand)

1996-12-31T23:59:59.000Z

115

Oil shale and coal in intermontane basins of Thailand  

SciTech Connect

The Mae Tip intermontane basin contains Cenozoic oil shales in beds up to 1 m (3.3 ft) thick interbedded with coal and mudstone. The oil shales contain lamosite-type alginite, and give a maximum oil yield of 122 L/MT (29.3 gal/ton). The beds are laterally continuous for at least 1.5 km (1.0 mi), but pass into mudstones toward the basin margin. The oil shales originated when peat swamps close to a steep basin margin were flooded by shallow lakes, allowing algae to replace rooted vegetation. This distinctive oil shale-coal assemblage is known from many small intermontane basins in Thailand, where locally high geothermal gradients suggest potential for hydrocarbons.

Gibling, M.R.; Srisuk, S.; Ukakimaphan, Y.

1985-05-01T23:59:59.000Z

116

Adaptability Design to Meet Dynamic Customer's Needs N. Janthong1,2,3  

E-Print Network (OSTI)

's University of Technology North Bangkok (KMUTNB), Thailand 3 Thai-France Innovation Institute, King Mongkut's University of Technology North Bangkok (KMUTNB), Thailand Abstract - The customer is the core element to answer unexpected demand and to adapt to SMEs where resources are limited is now needed. Design

Paris-Sud XI, Université de

117

Area Study prior to Companion Modelling to Integrate Multiple Interests in Upper Watershed Management of Northern Thailand  

E-Print Network (OSTI)

Management of Northern Thailand C. Barnaud*, G. Trébuil**, P. Dumrongrojwatthana***, J. Marie**** * CU of northern Thailand have long been accused of degrading the upper watersheds of the country's major basins communities and state agencies, calling for the need for adapted participatory methodologies to facilitate

Boyer, Edmond

118

GSTM1 and CYP1A1 Polymorphisms, Tobacco, Air Pollution, and Lung Cancer: A Study in Rural Thailand  

Science Journals Connector (OSTI)

...Thailand Grant support: Electricity Generating Authority of Thailand...mines from 1955 close to electricity-generating plants was a...Center (the area of the electricity-generating plants), the...least 16 years, the daily consumption was low compared with Western...

Paola Pisani; Petcharin Srivatanakul; Juliette Randerson-Moor; Sutee Vipasrinimit; Somkiat Lalitwongsa; Piyapong Unpunyo; Saghir Bashir; and D. Timothy Bishop

2006-04-01T23:59:59.000Z

119

Thailand-EU-UNDP Low Emission Capacity Building Programme (LECBP) | Open  

Open Energy Info (EERE)

Thailand-EU-UNDP Low Emission Capacity Building Programme (LECBP) Thailand-EU-UNDP Low Emission Capacity Building Programme (LECBP) Jump to: navigation, search Name Thailand-EU-UNDP Low Emission Capacity Building Programme (LECBP) Agency/Company /Organization The European Union (EU), United Nations Development Programme (UNDP), German Federal Ministry for the Environment, Nature Conservation and Nuclear Safety (BMU), Australian Department of Climate Change and Energy Efficiency (DCCEE), Australian Agency for International Development (AusAID) Partner Multiple Ministries Sector Climate Focus Area Renewable Energy, Non-renewable Energy, Agriculture, Biomass, Buildings, Economic Development, Energy Efficiency, Forestry, Geothermal, Goods and Materials, Greenhouse Gas, Industry, Land Use, Offsets and Certificates, People and Policy, Solar, Transportation, Water Power, Wind

120

Fluidized bed combustor 50 MW thermal power plant, Krabi, Thailand. Feasibility study. Export trade information  

SciTech Connect

The report presents the results of a study prepared by Burns and Roe for the Electricity Generating Authority of Thailand to examine the technical feasibility and economic attractiveness for building a 50 MW Atmospheric Fluidized Bed Combustion lignite fired power plant at Krabi, southern Thailand. The study is divided into seven main sections, plus an executive summary and appendices: (1) Introduction; (2) Atmospheric Fluidized Bed Combustion Technology Overview; (3) Fuel and Limestone Tests; (4) Site Evaluation; (5) Station Design and Arrangements; (6) Environmental Considerations; (7) Economic Analysis.

Not Available

1993-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond

2013-08-30T23:59:59.000Z

122

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

123

Northern Thailand Geophysics Field Camp: Overview of Activities Lee M. Liberty  

E-Print Network (OSTI)

Northern Thailand Geophysics Field Camp: Overview of Activities Lee M. Liberty Boise State and industries with communities in need using applied geophysics projects as a means to benefit people and the environment around the world. Our GWB project was developed to educate and connect local geophysicists

Barrash, Warren

124

Life cycle considerations of the flue gas desulphurization system at a lignite-fired power plant in Thailand  

Science Journals Connector (OSTI)

The Flue Gas Desulphurization (FGD) system has been installed at the biggest lignite-fired power generation plant in Thailand to reduce the large...2...emission. In order to understand the costs and benefits, bot...

Sate Sampattagul; Seizo Kato

2004-11-01T23:59:59.000Z

125

Preliminary Study on Design of Longwall Mining from Final Highwall at Mae Moh Lignite Mine in Thailand  

Science Journals Connector (OSTI)

The EGAT Mae Moh lignite mine is the largest open-pit coal ... in Thailand. The total geological and economical reserves of Mae Moh coal field are approximately...FLAC 3D producted by...

Shitoku Shibata; Nay Zarlin; Hideki Shimada

2014-01-01T23:59:59.000Z

126

Energy efficiency and greenhouse gas emission reduction potentials in sugar production processes in Thailand  

Science Journals Connector (OSTI)

Abstract Sugarcane is one of the most promising sources of green energy for a major sugar producing country like Thailand. Any efforts to improve energy efficiency in sugar industry would result for green energy production and more avoided GHG emissions. This paper assesses the potentials for energy saving and GHG emission reduction in sugar production in Thailand. It is found that there is a wide gap between the most efficient mills and the less efficient ones among the countrys 47mills, with specific steam consumption ranging from 400 to 646kg steam/ton cane. Thus significant potential exists for energy saving and GHG emission reduction in many mills, using some of the 17 commonly common technologies/measures identified. For the nine mills studied, which could have resulted in a combined saving savings of 2332% of the total mill energy consumption, further savings of 514% could be achieved.

Sumate Sathitbun-anan; Bundit Fungtammasan; Mirko Barz; Boonrod Sajjakulnukit; Suthum Pathumsawad

2014-01-01T23:59:59.000Z

127

A feasibility study for underground coal gasification at Krabi Mine, Thailand  

SciTech Connect

A study to evaluate the technical, economical, and environmental feasibility of underground coal gasification (UCG) in the Krabi Mine, Thailand, was conducted by the Energy and Environmental Research Center (EERC) in cooperation with B.C. Technologies (BCT) and the Electricity Generating Authority of Thailand (EGAT). The selected coal resource was found suitable to fuel a UCG facility producing 460,000 MJ/h (436 million Btu/h) of 100--125 Btu/scf gas for 20 years. The raw UCG gas could be produced for a selling price of $1.94/MMBtu. The UCG facility would require a total investment of $13.8 million for installed capital equipment, and annual operating expenses for the facility would be $7.0 million. The UCG gas could be either cofired in a power plant currently under construction or power a 40 MW simple-cycle gas turbine or a 60 MW combined-cycle power plant.

Solc, J.; Steadman, E.N. [Energy and Environmental Research Center, Grand Forks, ND (United States); Boysen, J.E. [BC Technologies, Laramie, WY (United States)

1998-12-31T23:59:59.000Z

128

Solartron Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Solartron Co Ltd Solartron Co Ltd Jump to: navigation, search Name Solartron Co Ltd Place Bangkok, Thailand Zip 10110 Sector Solar Product PV solar module manufacturer. Coordinates 13.75333°, 100.504822° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.75333,"lon":100.504822,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

129

Cellennium Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Cellennium Co Ltd Cellennium Co Ltd Jump to: navigation, search Name Cellennium Co Ltd Place Bangkok, Thailand Zip 10400 Product Cellennium Co Ltd is a Thai company that has been researching Vanadium fuel cells. Coordinates 13.75333°, 100.504822° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.75333,"lon":100.504822,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

130

Knowledge-based adaptable design to support customer-oriented production system of industrial equipments  

E-Print Network (OSTI)

Engineering, Faculty of Engineering, King Mongkut's University of Technology North Bangkok (KMUTNB), Thailand 3 Thai-France Innovation Center (TFIC), King Mongkut's University of Technology North Bangkok demand and to adapt to SMEs where resources are limited is now needed. Design adaptability refers

Paris-Sud XI, Université de

131

Atmos. Chem. Phys., 11, 97359747, 2011 www.atmos-chem-phys.net/11/9735/2011/  

E-Print Network (OSTI)

, National Institute of Development Administration, Bangkok, Thailand 5Acid Depositions and Oxidant Research the contribution from the large-scale domes- tic coal/biofuel combustion for heating. The BC-CO rela- tionship

Meskhidze, Nicholas

132

Microsoft Word - DomyCV_long_rev02-22-06_1.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

soils. In: Proceedings of 17 th Congress of Intl. Union of Soil Science. Bangkok, Thailand, August 14-21, 2002. 33. Punshon, T., B.P. Jackson, J.C. Seaman, D.C. Adriano and...

133

Public Management as Citizen Compliance: A Case Study of Income Tax Compliance Behavior in Thailand  

E-Print Network (OSTI)

taxes. Thailand is among the three least tax compliant countries with a tax evasion score of 53.34 percent of GDP while the United States (8.6%), Switzerland (9.13%), and Austria (10.43%) are the most tax compliant countries (Tsakumis, Curatola... in handling with tax avoidance so that he suggested the introduction of statutory general anti-avoidance measures instead of using interpretation from the Supreme Courts decisions. Chanarong (2009) focused on the abuse of tax units to minimize tax burden...

Chandarasorn, Maneekwan

2012-08-31T23:59:59.000Z

134

Life cycle GHG analysis of rice straw bio-DME production and application in Thailand  

Science Journals Connector (OSTI)

Abstract Thailand is one of the leading countries in rice production and export; an abundance of rice straw, therefore, is left in the field nowadays and is commonly burnt to facilitate quick planting of the next crop. The study assesses the life cycle greenhouse gas (GHG) emissions of using rice straw for bio-DME production in Thailand. The analysis is divided into two scenarios of rice straw bio-DME utilization i.e. used as automotive fuel for diesel engines and used as LPG supplement for household application. The results reveal that that utilization of rice straw for bio-DME in the two scenarios could help reduce GHG emissions by around 1470% and 266%, respectively as compared to the diesel fuel and LPG substituted. In case rice straw is considered as a by-product of rice cultivation, the cultivation of rice straw will be the major source of GHG emission contributing around 50% of the total GHG emissions of rice straw bio-DME production. Several factors that can affect the GHG performance of rice straw bio-DME production are discussed along with measures to enhance GHG performance of rice straw bio-DME production and utilization.

Thapat Silalertruksa; Shabbir H. Gheewala; Masayuki Sagisaka; Katsunobu Yamaguchi

2013-01-01T23:59:59.000Z

135

Perspectives on the institutional needs of joint implementation projects for China, Egypt, India, Mexico, and Thailand  

SciTech Connect

One avenue for reducing the net emissions of greenhouse gases (GHG) under the Framework Convention on Climate Change (FCCC) is the joint implementation (JI) of policies and projects to the Convention. Although debate on the practical aspects of JI projects is relatively young, it already includes issues concerning the ability of governments to accept JI projects as well as the project participants` capacity to monitor, evaluate, and verify the financial and GHG benefits. The focus of this paper is an in-depth, country-by-country analysis of current and conceivable institutions in potential host countries. To understand these concerns better, in August 1994 the authors asked colleagues in five developing countries to evaluate their countries` institutional capacity for JI projects. Their perspectives are presented here as individual country case studies. The five countries--Mexico, Egypt, Thailand, India, and China--were chosen because each has significant potential for JI projects.

Mabel, M.; Watt, E.; Sathaye, J. [eds.] [and others

1995-10-01T23:59:59.000Z

136

Reclamation planning and operation at the Mae Moh Lignite Mine, Thailand  

SciTech Connect

The Mae Moh Mine is a large open cut lignite mine situated in Northern Thailand. The mine produces lignite for coal fired power stations located adjacent to the mine. Current mine production is approximately 9 Mtpa providing lignite to eight power stations with a total output of 1,125 MW. The power development plan for Mae Moh provides for 19 power stations by the year 1999 which will require lignite production to be increased to 30.5 Mtpa and overburden will be mined at a rate approaching 300 Mtpa. Environmental management and reclamation planning at Mae Moh are major issues due to water quality impact and land use conflicts. This paper presents the key elements of the reclamation master plan and works strategy for progressive reclamation and water pollution control.

Miller, S.D. [Stuart D. Miller & Associates, Balmain (Australia); Teparat, C. [Electricity Generating Authority of Thailand, Mae Moh (Thailand)

1990-12-31T23:59:59.000Z

137

Eucalyptus plantations for electricity generation: the cost of carbon dioxide abatement in Thailand  

Science Journals Connector (OSTI)

Short-rotation plantations are expected to play an important role in the transition towards renewable energy, in particular in many developing countries. At present, developing countries do not have any carbon dioxide (CO2 ) abatement targets under the Kyoto Protocol, but CO2 mitigating projects might nevertheless be carried out through the Clean Development Mechanism (CDM). The purpose of this paper is to analyse: i) the economics of eucalyptus production in the east and northeast of Thailand and ii) the cost of substituting eucalyptus wood for fossil fuels for electricity production. The productivity of eucalyptus plantations is estimated at 7??11 dry ton/hectare(ha)/year over a rotation period of 3 to 5 years. The levelised cost of eucalyptus wood delivered to the factory gate is estimated at 13??18 USD/fresh ton (1.2??1.7 USD/GJ). If eucalyptus wood is used for electricity generation, the cost of electricity generation would be 6.2 US cents/kWh, and consequently the cost of substituting a wood-fired plant for a coal-fired plant and a gas-fired plant would be 107 and 196 USD/ton-C, respectively. The extent to which eucalyptus plantations could offer economically attractive options for electricity generation and CO2 abatement depends, among other things, on the cost of reducing CO2 emissions in the Annex 1 countries and CO2 mitigation options in developing countries. In addition, it depends on the economics of eucalyptus production as seen by farmers. There are also several other factors that affect an increased establishment of eucalyptus plantations in Thailand. The potential land-use change impact as well as the social and environmental impact associated with establishing mono-culture eucalyptus plantations as a CO2 abatement strategy are, however, not analysed in this paper and should be further investigated.

Wathanyu Amatayakul; Christian Azar

2003-01-01T23:59:59.000Z

138

PLAYER REGISTRATION City State Zip  

E-Print Network (OSTI)

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS

139

Density equation of bio-coal briquettes and quantity of maize cob in Phitsanulok, Thailand  

SciTech Connect

One of the most important crops in Phitsanulok, a province in Northern Thailand, is maize. BaseD on the calculation, the quantity of maize cob produced in this region was approximately 220 kton year{sup -1}. The net heating value of maize cob was found to be 14.2 MJ kg{sup -1}. Therefore, the total energy over 874 TJ year-1 can be obtained from this agricultural waste. In the experiments, maize cob was utilized as the major ingredient for producing biomass-coal briquettes. The maize cob was treated with sodium hydroxide solution before mixing with coal fine. The ratios of coal:maize were 1:2 and 1:3, respectively. The range of briquetting pressures was from 4-8 MPa. The result showed that the density was strongly affected by both parameters. Finally, the relationship between biomass ratio, briquetting pressures and briquette density was developed and validated by using regression technique. 13 refs., 2 figs.

Patomsok Wilaipon [Naresuan University, Phitsanulok (Thailand). Department of Mechanical Engineering

2008-07-01T23:59:59.000Z

140

Preparation and combustion of coal-water fuel from the Sin Pun coal deposit, southern Thailand  

SciTech Connect

In response to an inquiry by the Department of Mineral Resources in Thailand, the Energy & Environmental Research Center (EERC) prepared a program to assess the responsiveness of Sin Pun lignite to the temperature and pressure conditions of hot-water drying. The results indicate that drying made several improvements in the coal, notably increases in heating value and carbon content and reductions in equilibrium moisture and oxygen content. The equilibrium moisture content decreased from 27 wt% for the raw coal to about 15 wt% for the hot-water-dried (HWD) coals. The energy density for a pumpable coal-water fuel (CWF) indicates an increase from 4500 to 6100 Btu/lb by hot-water drying. Approximately 650 lb of HWD Sin Pun CWF were fired in the EERC`s combustion test facility. The fuel burned extremely well, with no feed problems noted during the course of the test. Fouling and slagging deposits each indicated a very low rate of ash deposition, with only a dusty layer formed on the cooled metal surfaces. The combustor was operated at between 20% and 25% excess air, resulting in a flue gas SO{sub 2} concentration averaging approximately 6500 parts per million.

NONE

1997-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Wiang Haeng coal-water fuel preparation and gasification, Thailand - task 39  

SciTech Connect

In response to an inquiry by the Department of Mineral Resources (DMR) in Thailand, the Energy & Environmental Research Center (EERC) prepared a four-task program to assess the responsiveness of Wiang Haeng coal to the temperature and pressure conditions of hot-water drying (HWD). The results indicate that HWD made several improvements in the coal, notably increases (HWD). The results indicate that HWD made several improvements in the coal, notably increases in heating value and carbon content and reductions in equilibrium moisture and oxygen content. The equilibrium moisture content decreased from 37.4 wt% for the raw coal to about 20 wt% for the HWD coals. The energy density for a pumpable coal-water fuel indicates an increase from 4450 to 6650 Btu/lb by hydrothermal treatment. Raw and HWD coal were then gasified at various mild gasification conditions of 700{degrees}C and 30 psig. The tests indicated that the coal is probably similar to other low-rank coals, will produce high levels of hydrogen, and be fairly reactive.

Anderson, C.M.; Musich, M.A.; Young, B.C. [and others

1996-07-01T23:59:59.000Z

142

Life cycle assessment of a community hydroelectric power system in rural Thailand  

Science Journals Connector (OSTI)

Rural electrification and the provision of low cost, low emission technology in developing countries require decision makers to be well informed on the costs, appropriateness and environmental credentials of all available options. While cost and appropriateness are often shaped by observable local considerations, environmental considerations are increasingly influenced by global concerns which are more difficult to identify and convey to all stakeholders. Life cycle assessment is an iterative process used to analyse a product or system. This study iteratively applies life cycle assessment (LCA) to a 3kW community hydroelectric system located in Huai Kra Thing (HKT) village in rural Thailand. The cradle to grave analysis models the hydropower schemes construction, operation and end of life phases over a period of twenty years and includes all relevant equipment, materials and transportation. The study results in the enumeration of the environmental credentials of the HKT hydropower system and highlights the need to place environmental performance, and LCA itself, in a proper context. In the broadest sense, LCA results for the HKT hydropower system are found to reflect a common trend reported in hydropower LCA literature, namely that smaller hydropower systems have a greater environmentally impact per kWh perform less well environmentally - than larger systems. Placed within a rural electrification context, however, the HKT hydropower system yields better environmental and financial outcomes than diesel generator and grid connection alternatives.

Andrew Pascale; Tania Urmee; Andrew Moore

2011-01-01T23:59:59.000Z

143

Preliminary Study of In-situ Combustion in Heavy Oil Field in the North of Thailand  

Science Journals Connector (OSTI)

A small oil field in the north of Thailand has medium viscous and low gas-content heavy oil. Since conventional production methods are ineffective, thermal recovery is potentially suitable to enhance oil recovery for this reservoir. In -situ combustion is a complex EOR process used for medium to heavy crude oils. The process involves the multi-phase fluid flow through porous media with chemical and physical transition of the crude oil components under high temperature and pressure conditions. The simulation results with STARS were investigated by conducting a number of sensitivity studies with varying the parameters like gridblock sizes, air-injection rates, oxygen concentrations, and injected air temperature. The 0.5m-block size was chosen due to the optimum running time with acceptable accuracy. From the results, it can be concluded that changing injection rate from 100 Mscf/d to 400 Mscf/d does not significantly affect cumulative oil production less than 6% incremental recovery. Increase oxygen concentration from 29% to 100% shows an increase in 40.67% oil production. Moreover, if the injected fluid temperature is increased from 80?F to 500?F, total oil production increases 97.14%. Furthermore, optimal operating conditions to enhance recovery of oil were also studied.

Kreangkrai Maneeintr et al

2013-01-01T23:59:59.000Z

144

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network (OSTI)

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

145

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network (OSTI)

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

146

Geochemistry and mineralogy of fly-ash from the Mae Moh lignite deposit, Thailand  

SciTech Connect

The concentration of 21 elements in fly ash from three boilers (75 MW, 150 MW, and 300 MW) at the EGAT power plant, Mae Moh, Thailand, were determined by INAA. The concentration of 10 major elements was determined by XRF. As, Co, Cr, Ni, Mo, and Sb generally increase in concentration going from bottom ash (BA) through the sequence of electrostatic precipitator ashes (ESPA) and reach maxima of As (352 ppm), Co (45 ppm), Cr (105 ppm), Mo (32 ppm), Ni (106 ppm), and Sb (15 ppm) in the ESPA. Ce, Cs, Fe, Hf, La, Sc, Ta, Tb, and Yb did not exhibit concentration trends or are variable except in the case of one boiler, which showed an increase going from BA to ESPA. Only Br decreased in composition going from BA to ESPA. Rb, Sm, U, and Th showed marked variation in trends. The major elements identified by EDS were Al, Si, S, K, Ca, Fe, and Ba, with minor amounts of Mg, Na, Ti, Mn, and Sr. Al, Si, K, and Ca occur together and are present in most of the fly-ash particles. Ba was found as a major component with Ca, Al, and Si. Fe and Ca are usually associated with sulfur. Some small spheres (< 5 {mu}m) are comprised almost entirely of Fe (probably as oxide). Symplectite textures are noted in high-Fe phases. All elements except Br are significantly enriched in the fly ash relative to the coal, which contains 35% ash. Particle chemistry is consistent with the major mineral phases identified by XRD, which include: quartz, magnetite, mullite, gehlenite, anorthite, hematite, anhydrite, and clinopyroxene.

Hart, B.R.; Powell, M.A.; Fyfe, W.S. [Univ. of Western Ontario, London, Ontario (Canada). Dept. of Geology; Ratanasthien, B. [Univ. of Chaing Mai (Thailand). Dept. of Geology

1995-01-01T23:59:59.000Z

147

Student-based archaeological geophysics in northern Thailand Emily A. Hinz*, Lee M. Liberty, and Spencer H. Wood, Boise State University, Fongsaward Singharajawarapan  

E-Print Network (OSTI)

Student-based archaeological geophysics in northern Thailand Emily A. Hinz*, Lee M. Liberty participants to evaluate the practicality and effectiveness of various geophysical techniques: seismic methods including refraction and reflection (not discussed here), ground- penetrating-radar (GPR), DC resistivity

Barrash, Warren

148

The distribution of ten trace elements and minerals in three lignite seams from the Mae Moh Mine, Thailand  

SciTech Connect

Understanding the association of major, minor and trace elements in lignites and their accompanying strata is important from a number of perspectives which include: potential health problems from environmental pollutants, rehabilitation after mining, combustion for power etc. The material which follows represents some preliminary observations on the mineralogy and distribution of 10 trace elements in lignites and accompanying sediments from the Mae Moh mine, Thailand. Samples collected from freshly exposed mine faces were air dried and analyzed for moisture and ash. Trace element concentrations were determined on {open_quotes}whole{close_quotes} coals and sediments by NAA and XRF. All chemical analyses are expressed as a fraction of the total dry sediment. Mineralogy of both LTA and sediments was determined by XRD. The chemistry and morphology of individual particles were examined by the Electron microprobe. The analyses are used to make some conclusions about the spatial occurrence of these elements within the seam and their partitioning between organic and inorganic phases.

Hart, B.; Powell, M.P.; Fyfe, W.S. [Univ. of Ontario (Canada)

1994-12-31T23:59:59.000Z

149

Feasibility study for underground coal gasification at the Krabi coal mine site, Thailand: Volume 1. Progress report, December 1--31, 1995; Export trade information  

SciTech Connect

The report, conducted by Energy and Environmental Research Center, was funded by the US Trade and Development Agency. The objective of this report was to determine the technical, environmental and economic feasibility of developing, demonstrating, and commercializing underground coal gasification (UCG) at the Krabi coal mine site in Southern Thailand. This is Volume 1, the Progress Report for the period December 1, 1995, through December 31, 1995.

Young, B.C.; Schmit, C.R.

1996-01-01T23:59:59.000Z

150

An Examination of the Thermodynamics of Fusion, Vaporization, and Sublimation of Several Parabens by Correlation Gas  

E-Print Network (OSTI)

An Examination of the Thermodynamics of Fusion, Vaporization, and Sublimation of Several Parabens, Kasetsart University, Bangkane, Bangkok 10900, Thailand 2 Department of Chemistry and Biochemistry.com). DOI 10.1002/jps.22423 ABSTRACT: The vaporization, fusion, and sublimation enthalpies of methyl, ethyl

Chickos, James S.

151

Biofuels in the ASEAN Low Emission Development Strategies (LEDS) Forum  

E-Print Network (OSTI)

9/20/2012 1 Biofuels in the ASEAN Low Emission Development Strategies (LEDS) Forum Bangkok, Thailand 19-21 September 2012 Biofuel Policy Group Asian Institute of Technology Outline of the Presentation 1. Objectives of this Presentation 2. Background 3. Status of Biofuel Development in ASEAN 4

152

Design Issues for Corebased Optoelectronic Chips: A Case Study of the WARRP Network Router  

E-Print Network (OSTI)

for harnessing the potential performance benefits of multiprocessor systems which use advanced architectural­579­7566 Electrical Engineering Dept., Kasetsart University, Jatujak, Bangkok 10900, THAILAND fengmkr@ku.ac.th http, is in the range of gigabytes per second and increasing. Conventional all­electrical interconnects are not keeping

Pinkston, Timothy M.

153

Comparative studies of low-temperature watergas shift reaction over Pt=CeO2, Au=CeO2,  

E-Print Network (OSTI)

and Petrochemical College, Chulalongkorn University, Bangkok 10330, Thailand b Department of Chemical Engineering on board steam reforming of gas- oline and diesel fuel is the most logical means powering the PEFCs. However, the H2 produced from reformed gas contains $10% CO. In general, water­gas shift (WGS) reaction

Gulari, Erdogan

154

GSTM1 and CYP1A1 polymorphisms, tobacco, air pollution, and lung cancer: a study in rural Thailand  

SciTech Connect

Incidence rates of lung cancer is high in Lampang Province in northern Thailand, particularly in women. This study was conducted to quantify the risk of lung cancer associated with exposures prevalent in the area and to investigate possible interactions with genetic susceptibility. The presence of several large open-cast coal mines from 1955 close to electricity-generating plants was a particular focus of concern. A point source air pollution exposure index was calculated for each village/ township reported in residential histories based on the linear distance from the Mae Moh Center (the area of the electricity-generating plants), the year-specific gaseous (SO{sub 2} and NO{sub 2}) or total suspended particulate emissions from the Mae Moh Power Plant, and the percentage of wind from the center. Odds ratios for the disease associated with categorical variables were estimated within unconditional logistic regression. Extraction of genomic DNA and genotyping of variants in CYP1A1 and GSTM1 were conducted to assess the extent of modification of risk by these genes that are involved in the metabolism of polycyclic aromatic hydrocarbons. Smoking of local high tar unfiltered products is commonamongst women. None of the three polymorphisms examined increased the risk of lung cancer or modified the risk associated with smoking. 96% of male and 64% of female lung cancer incidence were explained by tobacco smoking. None of the potential sources of air pollution deriving from the combustion of coal and wood, or polymorphisms in the CYP1A1 gene or deletion of the GSTM1 had an effect on the risk of lung cancer, either together or separately.

Pisani, P.; Srivatanakul, P.; Randerson-Moor, J.; Vipasrinimit, S.; Lalitwongsa, S.; Unpunyo, P.; Bashir, S.; Bishop, D.T.

2006-04-15T23:59:59.000Z

155

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...

156

Phylogeography of mtDNA haplogroup R7 in the Indian peninsula  

E-Print Network (OSTI)

://www.fluxus-engineering.com. The samples were selected through a preliminary sequence analysis of the control region in order to include the widest possible range of R7 variation, language and geographical groups. Coales- cent times were calculated by a calibration method described... , Thosarat R: Prehistoric Thailand: From early set- tlement to Sukothai. River Books, Bangkok; 1998. 25. Diamond J, Bellwood P: Farmers and their languages: the first expansions. Science 2003, 300:597-603. 26. Diffloth G: Austroasiatic languages...

Chaubey, Gyaneshwer; Karmin, Monika; Metspalu, Ene; Metspalu, Mait; Selvi-Rani, Deepa; Singh, Vijay Kumar; Parik, Juri; Solnik, Anu; Naidu, B Prathap; Kumar, Ajay; Adarsh, Niharika; Mallick, Chandana Basu; Trivedi, Bhargav; Prakash, Swami; Reddy, Ramesh; Shukla, Parul; Bhagat, Sanjana; Verma, Swati; Vasnik, Samiksha; Khan, Imran; Barwa, Anshu; Sahoo, Dipti; Sharma, Archana; Rashid, Mamoon; Chandra, Vishal; Reddy, Alla G; Torroni, Antonio; Foley, Robert A; Thangaraj, Kumarasamy; Singh, Lalji; Kivisild, Toomas; Villems, Richard

2008-08-04T23:59:59.000Z

157

Coal facies in a Cenozoic paralic lignite bed, Krabi Basin, southern Thailand: Changing peat-forming conditions related to relative sea-level controlled watertable variations  

Science Journals Connector (OSTI)

The Cenozoic Krabi Basin in the southern part of peninsular Thailand contains about 112milliontons proven coal reserves. At present, coal is only produced from the Bang Mark mine located in the southern part of the basin, where the main lignite bed is 720m thick. The lignite bed occurs in an overall paralic succession. The present paper investigates the depositional conditions of an approximately 8m thick lignite bed (main seam) in the Bang Mark mine using organic petrography, including maceral ratios, and geochemistry. The results are further interpreted in a sequence stratigraphic context. The lignite is of low rank and is completely dominated by huminite indicating generally oxygen-deficient conditions in the precursor mire. Very low inertinite contents suggest rare occurrences of wildfires. The lower part of the lignite bed represents a topogenous fresh water peat mire with open water areas that in few cases may have experienced influx of saline water. The peat mire was subjected to periodic inundations and deposition of siliciclastics. Tissue preservation was relatively poor. The upper part of the lignite bed represents a slightly domed fresh water ombrogenous peat mire with a stable watertable and a balance between peat accumulation and accommodation space creation that favoured preservation of plant tissues. In general, the mire vegetation changed from less woody in the topogenous mire to more arborescent in the ombrogenous mire, where plants with suberinised wood cell walls also were more frequent. Decompacted, the lignite bed corresponds to a minimum ~11m thick peat deposit that records from ~22,000 to 55,000years of peat accumulation. Watertable rise in the peat mire was controlled overall by relative sea-level rise. In a sequence stratigraphic context, the lignite bed overlies a terrestrialisation surface (TeS; sensu Diessel, 2007) and the lowermost part records peat formation during a falling watertable and a decreasing accommodation/peat accumulation ratio (terrestrialisation). An accommodation reversal surface (ARS; sensu Diessel, 2007) indicates a change to paludification style of peat formation characterised by rising watertable and a high accommodation/peat accumulation ratio. Another ARS marks a gradual change to a situation with a balanced accommodation/peat accumulation ratio. The overall watertable rise throughout peat formation, but at a gradually slower rate from base to top, suggests that the lignite bed could be located in the late transgressive systems tract (TST).

H.I. Petersen; B. Ratanasthien

2011-01-01T23:59:59.000Z

158

Natural polymorphisms of HIV-1 CRF01_AE integrase coding region in ARV-nave individuals in Cambodia, Thailand and Vietnam: An ANRS AC12 working group study  

Science Journals Connector (OSTI)

The HIV integrase enzyme is essential for the HIV life cycle as it mediates integration of HIV-1 proviral DNA into the infected cell's genome. Recently, the development of drugs capable of inhibiting integrase has provided major new options for HIV-infected, treatment-experienced patients with multidrug resistant virus, as well treatment-nave patients. More than 40 amino acid substitutions within integrase have been described as associated mostly with resistance of HIV B-subtypes to currently available integrase inhibitors (INIs). We have analyzed the natural polymorphisms of the integrase coding region in 87 antiretroviral-nave subjects (32 from Cambodia, 37 from Thailand and 18 from Vietnam) infected with CRF01_AE virus, the predominant HIV-1 strain circulating in Southeast Asia. The 864bp integrase coding region was sequenced using the ANRS consensus sequencing technique from plasma samples, and amino acid results were interpreted for drug resistance according to the ANRS (Updated July 2009, version 18) and Stanford algorithms (Version November 6, 2009). Alignment of the 87 amino acid sequences against the 2004 Los Alamos HIV-1 clade B consensus sequence showed that overall, 119 of 288 (41.3%) amino acid positions presented at least one polymorphism each. Substitutions found in >60% of study subjects occurred at: K14, A21, V31, S39, I72, T112, T124, T125, G134, I135, K136, D167, V201, L234 and S283. Also, new amino acid substitutions of as yet unknown significance were identified: E152K/H, S153F/L, N155I and E157G. None of the known integrase resistance mutations were observed, except E157Q found in one Cambodian subject (1.1%, CI 95% 0.026.3%). The clinical impact of this substitution on resistance of B and nonB-viruses to the licensed INI raltegravir is unclear. If this substitution is confirmed to compromise the virologic response to raltegravir, further studies will be needed to better assess the prevalence of this substitution among CRF01_AE virus.

Janin Nouhin; Tawee Donchai; Khanh Thu Huynh Hoang; Sreymom Ken; Jiraporn Kamkorn; Ton Tran; Ahidjo Ayouba; Martine Peeters; Marie-Laure Chaix; Truong Xuan Lien; Eric Nerrienet; Nicole Ngo-Giang-Huong

2011-01-01T23:59:59.000Z

159

Alcohol policy process in Thailand.  

E-Print Network (OSTI)

??The thesis describes and analyses the Thai alcohol policy process in the period 1997 - 2006, in order to investigate the characteristics and areas for (more)

Thaksaphon, Thamarangsi

2008-01-01T23:59:59.000Z

160

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles

162

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels

163

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu

164

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen

165

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National

166

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

167

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area

168

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in

169

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown

170

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes

171

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to

172

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP

173

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy

174

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com

175

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

176

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California

177

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area

178

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital

179

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation

180

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area

182

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific

183

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean

184

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let

185

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management

186

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre

187

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market

188

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania

189

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds

190

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to

191

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

192

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance

193

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state

194

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound

195

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen

196

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit

197

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton

198

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area

199

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies

200

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto

202

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area

203

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

204

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind

205

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings

206

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area

207

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

208

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

209

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...

210

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

211

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

212

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

213

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

214

Exploring zipping and assembly as a protein folding principle  

E-Print Network (OSTI)

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

215

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

216

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

217

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

218

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...

219

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

220

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area

222

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en

223

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

224

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California

225

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member

226

Moving towards climate-smart flood management in Bangkok and Tokyo  

E-Print Network (OSTI)

Managing the impacts of climate change is no longer a concern of the future, but a significant reality of the present. Preparing for, and mitigating extreme weather events and adapting to the gradual shift in climatic ...

Takemoto, Shoko, M.C.P. Massachusetts Institute of Technology

2011-01-01T23:59:59.000Z

227

Sustaining tradition : design for a contemporary Thai house in northern Bangkok  

E-Print Network (OSTI)

This thesis explores and documents the evolution of a Thai house, which has transformed drastically over the years to meet changes in social aspiration. The result of this investigation had generated the design principles ...

Kanisthakhon, Bundit, 1971-

1998-01-01T23:59:59.000Z

228

Global Cooling: Policies to Cool the World and Offset Global Warming from CO2 Using Reflective Roofs and Pavements  

E-Print Network (OSTI)

Airport Taipei Dusanbe Dar es Salaam Bangkok Chiang MauAirport Taipei Dusanbe Dar es Salaam Bangkok Chiang Mau

Akbari, Hashem

2010-01-01T23:59:59.000Z

229

Emissions mitigation of blended coals through systems optimization  

SciTech Connect

For coal fired power stations, such as those located in the US, that have installed NOx and SOx emissions abatement equipment substantial carbon dioxide reduction could be achieved by shifting from pure PRB coal to blended coals with local bituminous coal. Don Labbe explains how. The article is based on a presentation at Power-Gen Asia 2009, which takes place 7-9 October in Bangkok, Thailand and an ISA POWID 2009 paper (19th Annual Joint ISA POWID/EPRI Controlls and Instrumentation Conference, Chicago, Illinois, May 2009). 4 refs., 3 figs.

Don Labbe [IOM Invensys Operations Management (United States)

2009-10-15T23:59:59.000Z

230

Thailand: Asia Pacific energy series: Country report  

SciTech Connect

As part of our continuing assessment of the Asia-Pacific energy markets, the Energy Program has embarked upon country studies that discuss in detail the structure of the energy sector in each country within the region. The country studies also provide the reader with an overview of the economic situation and, when possible, of the political situation in the country under study. We have particularly highlighted petroleum and gas issues in the country studies and have attempted to show the foreign trade implications of oil and gas trade. Finally, as much as possible, we have provided the latest available statistics---more often than not, from unpublished sources. Staff members have traveled extensively in the countries under review and have spoken to top policymakers in government and industry. Thus, these reports provide not only information but the latest thinking on energy issues in various countries. It is our hope that over the next few years these country studies can be updated and will provide a continuous, long-term source of energy sector analysis for the Asia-Pacific region. 48 refs., 23 figs., 56 tabs.

Fridley, D.

1988-11-01T23:59:59.000Z

231

Constructed Wetlands for Industry in Thailand  

E-Print Network (OSTI)

River Ecosystem Quality Improvement. ­ Environmental Public Policy About us Community wastewater Laem) About us #12;23/05/2012 2 Research Centre for Environmental and Hazardous Substance Management 4,500 - 10,000 cubic meters of wastewater per day Laem Phak Bia Five ponds 1 sedimentation pond, 3

Heal, Kate

232

Thailand-IEA Activities | Open Energy Information  

Open Energy Info (EERE)

Asia References IEA Bilateral Engagement Highlights1 Bilateral Activities IEA-MoEN oil & gas emergency preparedness IEA-MoEN Biofuels Workshop (2009) Emergency Response...

233

APEC experts` group on clean coal technology  

SciTech Connect

These proceedings are the result of a Technical Seminar of the APEC Experts Group on Clean Coal Technology, held in Thailand, September 6-10, 1993. The National Energy Policy Council of Thailand requested the seminar in response to growing public, government and private sector environmental concerns related to increased use of lignite for electricity generation in Thailand. The core of the seminar was a two-day series of 25 technical papers contained in these proceedings. The goals were: (1) to inform government officials and electric utility managers on the range of CCTs, their commercial status, environmental performance, and suitability for various types of coal, including lignite; and (2) to hold a public seminar to inform the public about the same issues set in the context of energy policy concerns that were articulated by the National Energy Policy Council. Sixty people participated in the technical seminar held in Chiang Mai, and approximately 170 people attended the public seminar in Bangkok, Thailand. All papers have been abstracted and indexed separately for inclusion in the Energy Science and Technology Database.

NONE

1993-12-31T23:59:59.000Z

234

Gas treatment and by-products recovery of Thailand`s first coke plant  

SciTech Connect

Coke is needed in the blast furnace as the main fuel and chemical reactant and the main product of a coke plant. The second main product of the coke plant is coke oven gas. During treatment of the coke oven gas some coal chemicals like tar, ammonia, sulphur and benzole can be recovered as by-products. Since the market prices for these by-products are rather low and often erratic it does not in most cases justify the investment to recover these products. This is the reason why modern gas treatment plants only remove those impurities from the crude gas which must be removed for technical and environmental reasons. The cleaned gas, however, is a very valuable product as it replaces natural gas in steel work furnaces and can be used by other consumers. The surplus can be combusted in the boiler of a power plant. A good example for an optimal plant layout is the new coke oven facility of Thai Special Steel Industry (TSSI) in Rayong. The paper describes the TSSI`s coke oven gas treatment plant.

Diemer, P.E.; Seyfferth, W. [Krupp Uhde GmbH, Dortmund (Germany)

1997-12-31T23:59:59.000Z

235

The 23rd Annual Conference of the Southeast Asian Linguistics Society May 29-31, 2013 Chulalongkorn University, Bangkok  

E-Print Network (OSTI)

, or gnzh , formed by combining a decimal cycle, the (ten) Heavenly Stems, tingn , and a duodecimal cycle of the sexagesimal cycle is jiz, formed by combining the first terms of both cycles. The second year is ychu propose an explanation of the origin of the sexagesimal cycle as the combination of two numbering systems

Boyer, Edmond

236

Using a Constant Volume Displacement Ventilation System to Create a Micro Climate in a Large Airport Terminal in Bangkok  

E-Print Network (OSTI)

. The temperature of the air outside of this area is allowed to rise above normal conditions. The idea was to let this temperature rise so that it was either equal to or higher than the outdoor temperature, thus reducing heat gain. Computer simulation programs were...

Simmonds, P.; Gaw, W.

1996-01-01T23:59:59.000Z

237

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network (OSTI)

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

238

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

239

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network (OSTI)

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

240

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network (OSTI)

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating

2009-04-16T23:59:59.000Z

242

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network (OSTI)

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music

243

UN Economic and Social Commission for Asia and the Pacific | Open Energy  

Open Energy Info (EERE)

UN Economic and Social Commission for Asia and the Pacific UN Economic and Social Commission for Asia and the Pacific Jump to: navigation, search Name UN Economic and Social Commission for Asia and the Pacific Address United Nations Economic and Social Commission for Asia and the Pacific (ESCAP), Bangkok Place Bangkok, Thailand Website http://www.unescap.org/ Coordinates 13.7638612°, 100.5087933° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.7638612,"lon":100.5087933,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

244

United Nations Economic and Social Commission for Asia and the Pacific |  

Open Energy Info (EERE)

Pacific Pacific Jump to: navigation, search Logo: United Nations Economic and Social Commission for Asia and the Pacific Name United Nations Economic and Social Commission for Asia and the Pacific Address The United Nations Building Rajadamnern Nok Avenue Place Bangkok, Thailand Year founded 1947 Website http://www.unescap.org/ Coordinates 13.7234186°, 100.4762319° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.7234186,"lon":100.4762319,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

245

Responsible Asia Forest Trade (RAFT) Program | Open Energy Information  

Open Energy Info (EERE)

Responsible Asia Forest Trade (RAFT) Program Responsible Asia Forest Trade (RAFT) Program Jump to: navigation, search Name Responsible Asia Forest Trade (RAFT) Program Agency/Company /Organization U.S. Agency for International Development Sector Land Focus Area Forestry Topics Policies/deployment programs Resource Type Lessons learned/best practices Website http://www.responsibleasia.org Country Cambodia, China, Indonesia, Laos, Malaysia, Papua New Guinea, Thailand, Vietnam UN Region Central Asia, Eastern Asia, South-Eastern Asia References Responsible Asia Forest Trade (RAFT) Program[1] "The Responsible Asia Forestry and Trade (RAFT) is a five-year program funded by the U.S. Agency for International Development Regional Development Mission for Asia (USAID RDMA) in Bangkok. RAFT is managed by

246

UN Economic and Social Commission for Asia and the Pacific (ESCAP) | Open  

Open Energy Info (EERE)

Pacific (ESCAP) Pacific (ESCAP) Jump to: navigation, search Logo: UN Economic and Social Commission for Asia and the Pacific (ESCAP) Name UN Economic and Social Commission for Asia and the Pacific (ESCAP) Address Rajadamnern Nok Avenue Place Bangkok, Thailand References http://www.unescap.org/ No information has been entered for this organization. Add Organization Overview "The United Nations Economic and Social Commission for Asia and the Pacific (ESCAP) is the regional development arm of the United Nations for the Asia-Pacific region. Made up of 62 member States, with a geographical scope that stretches from Turkey in the west to the Pacific island nation of Kiribati in the east, and from the Russian Federation in the north to New Zealand in the south, the region is home to 4.1 billion people, or two

247

(Acid rain workshop)  

SciTech Connect

The traveler presented a paper entitled Susceptibility of Asian Ecosystems to Soil-Mediated Acid Rain Damage'' at the Second Workshop on Acid Rain in Asia. The workshop was organized by the Asian Institute of Technology (Bangkok, Thailand), Argonne National Laboratory (Argonne, Illinois), and Resource Management Associates (Madison, Wisconsin) and was sponsored by the US Department of Energy, the United Nations Environment Program, the United Nations Economic and Social Commission for Asia and the Pacific, and the World Bank. Papers presented on the first day discussed how the experience gained with acid rain in North America and Europe might be applied to the Asian situation. Papers describing energy use projections, sulfur emissions, and effects of acid rain in several Asian countries were presented on the second day. The remaining time was allotted to discussion, planning, and writing plans for a future research program.

Turner, R.S.

1990-12-05T23:59:59.000Z

248

Event:Technical Workshop & Peer Exchange 'NAMA finance and MRV' | Open  

Open Energy Info (EERE)

& Peer Exchange 'NAMA finance and MRV' & Peer Exchange 'NAMA finance and MRV' Jump to: navigation, search Calendar.png Technical Workshop & Peer Exchange 'NAMA finance and MRV': on 2012/09/11 Objectives of the workshop include: Identifying next steps in the implementation of NAMAs in the energy and industry sector Drafting an MRV-design for mitigation actions in the industry and energy sector Identifying capacity building needs in the implementation of NAMAs The workshop will run September 11th-13th. Event Details Name Technical Workshop & Peer Exchange 'NAMA finance and MRV' Date 2012/09/11 Location Bangkok, Thailand Organizer International Partnership on Mitigation and MRV Tags LEDS, Training, CLEAN Website Event Website Ret LikeLike UnlikeLike You like this.Sign Up to see what your friends like.

249

The desulfurization of flue gas at the Mae Moh Power Plant Units 12 and 13  

SciTech Connect

As pollution of air, water and ground increasingly raises worldwide concern, the responsible national and international authorities establish and issue stringent regulations in order to maintain an acceptable air quality in the environment. In Thailand, the Electricity Generating Authority of Thailand (EGAT) takes full responsibility in environmental protection matters as well as in generating the electricity needed to supply the country`s very rapid power demand growth. Due to the rapidly increasing electricity demand of the country, EGAT had decided to install two further lignite-fired units of 300 MW each (Units 12 and 13) at the Mae Moh power generation station and they are now under construction. The arrangement and the capacity of all the power plant units are as shown. In 1989, EGAT started the work on the flue gas desulfurization system of Mae Moh power plant units 12 and 13 as planned. A study has been conducted to select the most suitable and most economical process for flue gas desulfurization. The wet scrubbing limestone process was finally selected for the two new units. Local limestone will be utilized in the process, producing a by-product of gypsum. Unfortunately, natural gypsum is found in abundance in Thailand, so the produced gypsum will be treated as landfill by mixing it with ash from the boilers of the power plants and then carrying it to the ash dumping area. The water from the waste ash water lake is utilized in the process as much as possible to minimize the requirement of service water, which is a limited resource. The Mae Moh power generation station is situated in the northern region of Thailand, 600 km north of Bangkok and about 30 km east of the town of Lampang, close to the Mae Moh lignite mine. Three lignite-fired units (Units 1-3) of 75 MW each, four units (Units 4-7) of 150 MW each and four units (Units 8-11) of 300 MW each are in operation.

Haemapun, C.

1993-12-31T23:59:59.000Z

250

Thailand-Key Results and Policy Recommendations for Future Bioenergy...  

Open Energy Info (EERE)

biofuel feedstock crops. How the Thai Government manages the potential pressures that the bioenergy sector will exert on its natural resources and agricultural markets and the...

251

The Impact of Climate Change on Electricity Demand in Thailand  

E-Print Network (OSTI)

Climate change is expected to lead to changes in ambient temperature, wind speed, humidity, precipitation and cloud cover. As electricity demand is closely influenced by these climatic variables, there is likely to be ...

Parkpoom, Suchao Jake

2008-01-01T23:59:59.000Z

252

Southern thailand coal fired project: Feasibility study. Export trade information  

SciTech Connect

This study, conducted by Black & Veatch International, was funded by the U.S. Trade and Development Agency. The report addresses various technical, environmental, and economic aspects of developing four 1,000 MW units of coal fired electric generating facilities at a site near Prachuap Khiri Khan. The study includes a cost estimate for the units and the fuel delivery port as well as the major conceptual design decisions made for the project. This volume of the report is the Feasibility Study and is divided into the following sections: (1) Introduction/Summary; (2) Generation Planning Study; (3) Site Selection Study; (4) Project Description; (5) Fuel Resource Assessment; (6) Water Resource Assessment; (7) Technical Information to Support the Environmental Impact Assessment; (8) Plant Conceptual Design; (9) Transmission Interconnection; (10) Project Capital Cost Estimate; (11) Project Schedule; (12) Project Implementation Plan; (13) Project Risk Analysis.

NONE

1995-09-01T23:59:59.000Z

253

Thailand-Enhancing Capacity for Low Emission Development Strategies...  

Open Energy Info (EERE)

Enhancing Capacity for Low Emission Development Strategies (EC-LEDS) AgencyCompany Organization United States Agency for International Development, United States Environmental...

254

Environmental Impacts of Tourism in Khao Yai National Park, Thailand  

E-Print Network (OSTI)

Knowledge of visitor impacts is critical for sustainable tourism management in national parks. The focus of past tourism impact research on national parks is either on bio-physical impacts (conducted as recreation ecology research) or on social...

Phumsathan, Sangsan

2011-10-21T23:59:59.000Z

255

Thailand-Programme for Developing and Implementing a Climate...  

Open Energy Info (EERE)

Partner on behalf of the Federal Ministry for the Environment, Nature Conservation and Nuclear Safety (BMU) Sector Energy Focus Area Energy Efficiency Topics Low emission...

256

Household energy consumption and its demand elasticity in Thailand  

Science Journals Connector (OSTI)

This study concentrates on the analysis of energy consumption, expenditure on oil and LPG use in cars and aims to examine the elasticity effect of various types of oil consumption. By using the Deaton's analysis framework, the cross-sectional data of Thai households economic survey 2009 were used. By defining energy goods in the scope of automobile fuel, the results reflect the low importance of high-quality automobile fuel on all income level households. Thai households tend to vary the quality rather than the quantity of thermal energy. All income groups have a tendency to switch to lower quality fuel. Middle and high-middle households (Q3 and Q4) are the income groups with the greatest tendency to switch to lower-quality fuel when a surge in the price of oil price occurs. The poorest households (Q1) are normally insensitive to a change of energy expenditure in terms of quality and quantity. This finding illustrates the LPG price subsidy policy favours middle and high-middle income households. The price elasticity of energy quantity demand is negative in all income levels. High to middle income families are the most sensitive to changes in the price of energy.

Montchai Pinitjitsamut

2012-01-01T23:59:59.000Z

257

Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi

2010-07-30T23:59:59.000Z

258

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network (OSTI)

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

259

Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu

2012-10-26T23:59:59.000Z

260

Thai group set to invest in Chinese petchem complex  

SciTech Connect

A $5-billion refinery and petrochemical complex is planned by Thailand's Charoen Pokphand (Bangkok) at the seaport of Nimpoh, near Shanghai. The company has discussed the project with the central government of China, and state oil and petrochemicals company Sinopec (Beijing) is due to complete a feasibility study within the next two months. Charoen's plastics processing subsidiary, Kuo Shen (Hong Kong), is expected to hold 70% in the venture, Sinopec 20%, and the Chinese government the remaining 10%. Western companies have been invited to participate. Solvay (Brussels), a 49% partner with Charoen Pokphand in the Vinythai polyvinyl chloride (PVC) joint venture at Map Ta Pud, Thailand, has not yet made a commitment. The 5-million m.t./year oil refinery would feed the complex, which will be based on a 450,000-m.t./year ethylene plant, downstream aromatics units, and a range of derivatives plants. The complex, which falls outside the many announced for Thailand's current five-year economic plan, is expcted to be implemented in stages. To begin with, a 120,000-m.t./year PVC plant will be built that will be fed on imported vinyl chloride monomer. Charoen is in discussions with process licensers, including Solvay, European Vinyl Corp., BFGoodrich, and Shinetsu. Half the PVC output will be consumed by Kuo Shen in China, where Charoen has several plastics processing units, including one in Shanghai and one in Nimpoh. Meanwhile, Sinopec's Hong Kong subsidiary is seeking partners to invest in joint venture projects in China. Sinopec president Liu Xuemin says the company is willing to cooperate with overseas companies to establish small petrochemical projects. In addition, Sinopec is negotiating with officials of Dayang in Jiangsu province and the special economic zone of Shen Zhen, near Hong Kong, on joint ventures for plastics and food additives.

Alperowicz, N.

1993-01-06T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

26AUTUMN 2014 Kyoto University Newsletter  

E-Print Network (OSTI)

International Offices: The European Center in Heidelberg and the ASEAN Center in Bangkok World-renowned KU

Takada, Shoji

262

Style Guide THIRD EDITION  

E-Print Network (OSTI)

Bangkok Bogotá Buenos Aires Calcutta Cape Town Chennai Dar es Salaam Delhi Florence Hong Kong Istanbul

Nizkorodov, Sergey

263

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network (OSTI)

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

264

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network (OSTI)

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

265

The Big Trees Were Kings: Challenges for Global Response to Climate Change and Tropical Forests Loss  

E-Print Network (OSTI)

Brazil Guyana Mexico Suriname India Vietnam Gabon ThailandMalaysia France Laos Guyana Suriname Thailand MadagascarLeone, Solomon Islands, Suriname, Thailand, Uruguay, Uganda,

Irland, Lloyd C.

2010-01-01T23:59:59.000Z

266

Nuclear power grows in China`s energy mix  

SciTech Connect

China`s rapid economic growth in the past two decades has caused the nations`s demand for electricity to exceed its capacity. AS of 1992, with power shortages as high as 25 percent, {open_quotes}power plant operators were often forced to resort to rolling brownouts to avoid complete system breakdowns,{close_quotes} says Xavier Chen, an assistant professor with the Asian Institute of Technology`s Energy Program in Bangkok, Thailand. To keep pace with China`s economic development, Chen estimates that {open_quotes}China must increase its electricity capacity 6 to 8 percent a year each year into the foreseeable future.{close_quotes} For now, coal is transported to power plants in the rapidly developing eastern coastal provinces at great expense. Chen also notes that the environmental disadvantages of coal make it a less desirable source of energy than nuclear. Development of nuclear energy is likely to go forward for another reason: In China, there is much less opposition to nuclear power plants than in other developing nations. {open_quotes}Nuclear energy likely will plan an important role in China`s future energy mix and help close the gap between electricity production and demand,{close_quotes} Chen says.

Chen, Xavier [Institute of Technology`s Energy Program, Bangkok (Thailand)

1996-07-01T23:59:59.000Z

267

Regional Community Forestry Training Center for Asia and the Pacific | Open  

Open Energy Info (EERE)

Training Center for Asia and the Pacific Training Center for Asia and the Pacific Jump to: navigation, search Logo: The Center for People and Forests Name The Center for People and Forests Address P.O. Box 1111, Kasetsart Post Office, Pahonyothin Road, Place Bangkok, Thailand Year founded 1987 Phone number (662) 940-5700 Website http://recoftc.org/site/ Coordinates 13.7234186°, 100.4762319° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":13.7234186,"lon":100.4762319,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

268

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network (OSTI)

-1 APPENDIX 2 MARKET PENETRATION MODEL 2-1 APPENDIX 3 U.S. ELECTRICAL SYSTEM LOSS ANALYSIS 3-1 APPENDIX 4 LOAD OF TRANSMISSION LOSSES 9-1 APPENDIX 10 ELECTRICITY USED IN LARGE ELECTRIC MOTORS 10-1 APPENDIX 11 REPLACEMENT RATE is large. Using a conventional market-penetration model with parameters typical of the electric

269

Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce

270

The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert

271

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

272

Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.

1980-09-01T23:59:59.000Z

273

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

274

Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network (OSTI)

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.

275

Dublin Oxford Portland New York Los Angeles Mexico City San Jose Santiago Rio de Janeiro Madrid The Hague Bern 1 of 17 Kiev Casablanca Johannesburg Amman Dubai Karachi Mumbai Tokyo Beijing Bangkok Kuala Lumpur Singapore  

E-Print Network (OSTI)

reduction mandates. This is precisely the reason emissions trading has received so much attention during the development of both domestic and international climate change policy. Properly structured, emissions trading can significantly cut the costs of achieving any given reduction target. Emissions trading can

276

Modeling the 26 December 2004 Indian Ocean tsunami: Case study of impact in Thailand  

E-Print Network (OSTI)

,000 fatalities in 12 countries bordering the Indian Ocean basin (T. Kawata et al., The December 26, 2004 earthquake tsunami disaster of Indian Ocean. Research Group on The December 26, 2004 Earthquake Tsunami

Grilli, Stéphan T.

277

The Indian Ocean tsunami of December 26, 2004: observations in Sri Lanka and Thailand  

Science Journals Connector (OSTI)

On December 26, 2004 a great earthquake (M W 9.3) occurred off the western coast of Sumatra triggering a series of tsunami waves that propagated across the Indian Ocean causing damage and life los...

T. Rossetto; N. Peiris; A. Pomonis; S. M. Wilkinson; D. Del Re; R. Koo

2007-07-01T23:59:59.000Z

278

From comfort to kilowatts: An integrated assessment of electricity conservation in Thailand's commercial sector  

SciTech Connect

This document contains Appendix A, B, and C. In Appendix A, we are working as part of a research project with King Monkut's Institute of Technology, Thonburi, and the University of California, Berkeley (USA) to determine how people respond to the thermal environment inside buildings. We have prepared a short questionnaire which will survey thermal comfort. Our plan is to survey each building during each of three seasons over this year (e.g. hot, rainy, and cool seasons). Appendix B contains supporting technical documentation on conservation potential and Appendix C contains documentation on utility impacts.

Busch, J.F. Jr.

1990-08-01T23:59:59.000Z

279

Stakeholder perceived barriers to the use of solar energy in Thailand's buildings.  

E-Print Network (OSTI)

??Energy efficiency and use of renewable energy is currently a key topic given rising fuel prices and concerns regarding future energy security. Governments around the (more)

Trevarthen, Manda

2011-01-01T23:59:59.000Z

280

Thermal and lighting performance of toplighting systems in the hot and humid climate of Thailand  

E-Print Network (OSTI)

performance of three toplighting systems were compared. For the thermal performance, total cooling loads, heat gains and losses, and interior temperature were evaluated. The lighting performance parameters examined were daylight factor, illuminance level...

Harntaweewongsa, Siritip

2006-10-30T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Characterisation for some emission sources in CMB calculation for Mae Moh area, Thailand  

Science Journals Connector (OSTI)

Particulate samples of agricultural waste burning, straw burning, forest leaf burning, heavy duty truck emission, paved road dust, soil, agricultural soil, coal, electrostatic precipitator ash, and emission from stack power plant were collected from the Mae Moh area. Chemical compositions of sampling filters were analysed to determine the particulate matter source profiles. The analysis included ICP-MS for elemental compositions, ion chromatography for water soluble ions and CHNS/O for carbon species. In all biomass burning profiles organic carbon (OC) was higher during smouldering phase, while elemental carbon (EC) was higher during flaming phase. Results relating to biomass emission during flaming stage showed increase in K+. Organic and elemental carbons were the most abundant in biomass burning and truck exhaust. The abundance of EC was much lower, and the abundance of OC was much higher in biomass burning relative to truck exhaust emission. Al, K, Mg, Ca, and Fe were presented with high abundance in road dust, soil, coal, fly ash and stack samples. The differences in chemical compositions were not sufficient to distinguish geological material and fugitive dust sources. Fly ash profile differed from the others since OC and EC were not detected. Na and Zn were most abundant in stack samples. These findings served as a starting point for source contribution study. For future application of source apportionment using the CMB modelling technique, these source profiles should be appropriately grouped and selected to generate reliable outcomes.

A. Wangkiat; N.W. Harvey; S. Okamoto; S. Wangwongwatana; P. Rachdawong

2004-01-01T23:59:59.000Z

282

Southern thailand coal fired project: Conceptual design. Volume 1. Export trade information  

SciTech Connect

The report addresses various technical, environmental, and economic aspects of developing four 1,000 MW units of coal fired electric generating facilities at a site near Prachuap Khiri Khan. The study includes a cost estimate for the units and the fuel delivery port as well as the major conceptual design decisions made for the project. The study is accompanied by four Conceptual Design manuals. The manual was prepared to communicate project design parameters and requirements to participants of the project, and to control uniformity of design concepts throughout the project. This is Volume 1 of the Conceptual Design and is divided into the following sections: (1) Project Descirption; (2) Site Investigations; (3) Permits and Licenses; (4) Site Planning and Information; (5) Meteorology; (6) Generation Plant Planning; (7) Generatioin Plant Information; (8) Economic Criteria; (9) System Design; (10) Structural Engineering Design Criteria; (11) Mechanical Engineering Design Criteria; (12) Electrical Engineering Design Criteria; (13) Control Engineering Design Criteria; (14) Chemical Engineering Design Criteria; (15) Equipment Nomenclature and Numbering.

NONE

1995-09-01T23:59:59.000Z

283

Southern thailand coal fired project: Conceptual design. Volume 3. Export trade information  

SciTech Connect

This study, conducted by Black & Veatch International, was funded by the U.S. Trade and Development Agency. The report addresses various technical, environmental, and economic aspects of developing four 1,000 MW units of coal fired electric generating facilities at a site near Prachuap Khiri Khan. The study includes a cost estimate for the units and the fuel delivery port as well as the major conceptual design decisions made for the project. The study is accompanied by four Conceptual Design manuals. The manual was prepared to communicate project design parameters and requirements to participants of the project, and to control uniformity of design concepts throughout the project. This is Volume 3 of the Conceptual Design manual which is divided into 12 sections pertaining to System Design Specifications.

NONE

1995-09-01T23:59:59.000Z

284

Southern thailand coal fired project: Conceptual design. Volume 2. Export trade information  

SciTech Connect

This study, conducted by Black & Veatch International, was funded by the U.S. Trade and Development Agency. The report addresses various technical, environmental, and economic aspects of developing four 1,000 MW units of coal fired electric generating facilities at a site near Prachuap Khiri Khan. The study includes a cost estimate for the units and the fuel delivery port as well as the major conceptual design decisions made for the project. The study is accompanied by four Conceptual Design manuals. The manual was prepared to communicate project design parameters and requirements to participants of the project, and to control uniformity of design concepts throughout the project. This is Volume 2 of the Conceptual Design and is divided into the following sections: (1) General Studies; (2) System Analyses.

NONE

1995-09-01T23:59:59.000Z

285

Southern thailand coal fired project: Conceptual design. Volume 4. Export trade information  

SciTech Connect

This study, conducted by Black & Veatch International, was funded by the U.S. Trade and Development Agency. The report addresses various technical, environmental, and economic aspects of developing four 1,000 MW units of coal fired electric generating facilities at a site near Prachuap Khiri Khan. The study includes a cost estimate for the units and the fuel delivery port as well as the major conceptual design decisions made for the project. The study is accompanied by four Conceptual Design manuals. The manual was prepared to commumnicate project design parameters and requirements to participants of the project, and to control uniformity of design concepts throughout the project. This is Volume 4 of the Conceptual Design manual and is divided into 12 sections pertaining to System Design Specifications.

NONE

1995-09-01T23:59:59.000Z

286

Feasibility study for underground coal gasification at the Krabi Coal Mine site, Thailand. Final report  

SciTech Connect

This study, conducted by Energy and Environmental Research Center, was funded by the U.S Trade and Development Agency. The report summarizes the accomplishments of field, analytical data evaluation and modeling activities focused on assessment of underground coal gasification (UCG) feasibility at Krabi over a two year period. The overall objective of the project was to determine the technical issues, environmental impact, and economic of developing and commercializing UCG at the site in Krabi. The report contains an Executive Summary followed by these chapters: (1) Project Overview; (2) Project Site Characterization; (3) Inorganic and Thermal Materials Characterization; (4) Technical and Economic Feasibility of UCG At the Krabi Site; (5) Conclusions and Recommendations; (6) Acknowledgments; (7) References.

Boysen, J.; Sole, J.; Schmit, C.R.; Harju, J.A.; Young, B.C.

1997-01-01T23:59:59.000Z

287

A forecasting model of tourist arrivals from major markets to Thailand  

E-Print Network (OSTI)

International tourism is a rapidly growing phenomenon hics. worldwide. However, the East Asia and Pacific Region is expected to be the focus of the worldwide tourism industry in the new millennium because tourist arrivals and receipts registered a...

Hao, Ching

2012-06-07T23:59:59.000Z

288

Thailand's natural rubber economy in an international setting: an econometric investigation  

SciTech Connect

The Thai natural rubber economy is described in the context of the world rubber market. An econometric model is estimated for 15 structural equations; it includes the Thai, US, and rest-of-the-world rubber economies. Several simulation experiments are analyzed for the period from 1984 to 1995. Impact and dynamic multipliers are reported for major endogenous variables in response to changes in US GDP, world crude oil price, Thai replanting cess tax and Thai natural rubber production. A 1%, one-time increase in the US GDP has a positive effect on the Singapore natural rubber price. A world crude oil price decline shock has a negative effect in both the short-run and the long-run. The INRO buffer stock stabilization policy as well as alternative domestic Thai policies of market intervention are analyzed. The simulation results show that buffer stock management which allows a price band of +/-20% around the price target has the most stabilized price, compared to other band widths and no stock management. The outcome of the increase of the Thai replanting cess tax raises not only cess tax revenue, but also producer and export earning. Results showed that a decrease in rubber production positively affected producer and export earnings in the long-run.

Suwanakul, S.

1986-01-01T23:59:59.000Z

289

High Oral Prevalence of Candida krusei in Leprosy Patients in Northern Thailand  

Science Journals Connector (OSTI)

...Department of Oral Surgery and Dental Radiology, Charite, Medical Faculty...under an artificial light in a dental chair at the dental unit of the...Department of Oral Surgery and Dental Radiology, Charite, Medical Faculty...

P. A. Reichart; L. P. Samaranayake; Y. H. Samaranayake; M. Grote; E. Pow; B. Cheung

2002-12-01T23:59:59.000Z

290

Extensional tectonics in the Gulf of Thailand and South China Sea  

E-Print Network (OSTI)

are observed as N-S striking with normal faults forming all boundaries of the basins which is contrary to the pull-apart basin model. In the propagating extrusion rift model origin, Tapponnier et al (1982) relate the collision of continental India... to terminate in the West Natuna basin. The Three Pagodas fault effectively separates two continental blocks, the Malaysian Peninsula (southern Sundaland block) and Sundaland (northern Sundaland block). Strike-slip motion on the Three Pagodas and Mae Ping...

Marshall, Susan Marie

2012-06-07T23:59:59.000Z

291

Determinants of Success for Community-based Tourism: The Case of Floating Markets in Thailand  

E-Print Network (OSTI)

of participatory planning in Indonesia (1999), Lis (2006) study of community participation in tourism in China, Hipwells study of community- based ecotourism (CBET) in Taiwan (2007), Al-Oun and Al-Homouds study of CBT in 4 Jordan (2008), and Sebeles study... discussed without reference to sustainable development (1997, p. 857). Due to the popularity of SD, the label of ST has been attached to various types of tourism concepts and products such as nature-based tourism, ecotourism, adventure tourism, and so on...

Vajirakachorn, Thanathorn

2012-10-19T23:59:59.000Z

292

Asian Institute of Technology (AIT), Klong Luang, Pathumthani, Thailand The Small Earth Nepal (SEN), Kathmandu, Nepal  

E-Print Network (OSTI)

Earth Nepal (SEN), Kathmandu, Nepal Center of Research for Environment Energy and Water (CREEW), Kathmandu, Nepal International Research Center for River Basin Environment-University of Yamanashi (ICRE). Kathmandu Valley Groundwater Outlook. Asian Institute of Technology (AIT), The Small Earth Nepal (SEN

Walter, M.Todd

293

Thailand-National Energy Efficiency Plan and Evidence-based Mitigation...  

Open Energy Info (EERE)

will be developed and tested as an implementation mechanism. The goal is to reduce the energy intensity of the industrial and commercial sectors by 25% by the year 2030 (from...

294

MIDDLE PERMIAN PRODUCTIDINE BRACHIOPODS FROM CENTRAL THAILAND (THE INDOCHINA TERRANE) WITH PALEOBIOGEOGRAPHIC IMPLICATIONS  

Science Journals Connector (OSTI)

...Philadelphia. 503. a Jin, Y., and Hu, S., 1978...English abstract). a Jin, Y., Liao, Z., and...Beijing (In Chinese). a Jin, Y., Ye, S., Xu...Obercarbonische fauna von Lo-ping, . 160-208, pls 19a...244-425, pls 288a 143 In Xi'an Institute of Geology...

MASATOSHI SONE; CHONGPAN CHONGLAKMANI; ANISONG CHITNARIN

295

Measuring the impact of prices on inequality: With applications to Thailand and Korea  

Science Journals Connector (OSTI)

This paper develops a new methodology to compute social cost of living indices. These indices indicate whether or not price changes have a favourable (or unfavourable) impact on the welfare of the poor. The in...

Hyun H. Son; Nanak Kakwani

2006-08-01T23:59:59.000Z

296

Architectures of Citizenship : : Democracy, Development, and the Politics of Participation in Northeastern Thailand's Railway Communities  

E-Print Network (OSTI)

passive cooling system 388 Figure 7.9: Paw Raengkais groups house .passive cooling system. Chumpae City Source: N/A preponderance of houses

Elinoff, Eli Asher

297

The dynamics of alliance knowledge management : synergistic knowledge sharing between international airlines in Thailand.  

E-Print Network (OSTI)

??The use of knowledge between organisations in alliance networks has been the critical source of collectively creating and sustaining core competences. The awareness of the (more)

Sirisrisornchai, Thitarree

2009-01-01T23:59:59.000Z

298

E-Print Network 3.0 - automated triage system Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Sathaporn - Mechanical Engineering Department, King Mongkut's Institute of Technology North Bangkok Collection: Engineering 78 Forensic Triage for Mobile Phones with DEC0DE...

299

Neuroculture On the implications of  

E-Print Network (OSTI)

by publishing worldwide in Oxford New York Athens Auckland Bangkok Bogotá Buenos Aires Cape-Town Chennai Dar-es-Salaam

Rolls, Edmund T.

300

ARM - Events Archive  

NLE Websites -- All DOE Office Websites (Extended Search)

in Bangkok July 31 2006 Oct 10 Workshop on Systematic Errors in Climate and Numerical Weather Prediction Models (NWP) Deadlines Approaching Oct 02 10th Conference on...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

E-Print Network 3.0 - autogenous arteriovenous fistula Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

Engineering Department, King Mongkut's Institute of Technology North Bangkok Collection: Engineering 13 Journal of Fluids and Structures () Flow-induced vein-wall...

302

E-Print Network 3.0 - atypical smooth muscle Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Mongkut's Institute of Technology North Bangkok Collection: Engineering 36 IOP PUBLISHING JOURNAL OF NEURAL ENGINEERING J. Neural Eng. 6 (2009) 036001 (15pp) doi:10.10881741-2560...

303

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network (OSTI)

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

304

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network (OSTI)

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

305

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network (OSTI)

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

306

Los Angeles San Francisco  

E-Print Network (OSTI)

international airports Average Annual Global Economic Surplus and Profit Distribution across the Air TravelAuckland Bangkok Beijing Boston Chicago London Los Angeles Melbourne Milan Mumbai Munich New Delhi Shanghai Singapore Melbourne Auckland Bangkok Chicago Paris Boston New York Sydney New Delhi Wroclaw #12

Entekhabi, Dara

307

USGS | OpenEI  

Open Energy Info (EERE)

USGS USGS Dataset Summary Description The USGS published spatial data to supplement the report published in 2007 entitled, Geologic Assessment of Undiscovered Oil and Gas Resources of the Black Warrior Basin Province, Alabama and Mississippi. The GIS shapefiles and related metadata are included here. Source USGS Date Released April 11th, 2007 (7 years ago) Date Updated Unknown Keywords gas GIS oil USGS Data application/zip icon au650101cg.zip (zip, 8.7 KiB) application/zip icon au650101g.zip (zip, 9 KiB) application/zip icon au650102cg.zip (zip, 145.6 KiB) application/zip icon au650102g.zip (zip, 7.2 KiB) application/zip icon au650281cg.zip (zip, 138.8 KiB) application/zip icon au650281g.zip (zip, 15.1 KiB) application/zip icon pr6500g.zip (zip, 86.9 KiB)

308

Dateline Los Alamos: Top science news of 2014  

NLE Websites -- All DOE Office Websites (Extended Search)

able to successfully monitor influenza in the United States, dengue fever in Brazil and Thailand, and tuberculosis in China and Thailand using the novel technique, which will be...

309

LOS ALAMOS, N.M., Dec. 22, 2014-Los Alamos National Laboratory...  

NLE Websites -- All DOE Office Websites (Extended Search)

able to successfully monitor influenza in the United States, dengue fever in Brazil and Thailand, and tuberculosis in China and Thailand using the novel technique, which will be...

310

E-Print Network 3.0 - area czech republic Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

15 List of participants Prague Czech Republic Summary: List of participants Austria Thailand Thailand Prague Czech Republic Austria Czech Republic Austria... Austria Warsaw...

311

GSTM1 and CYP1A1 Polymorphisms, Tobacco, Air Pollution, and Lung Cancer: A Study in Rural Thailand  

Science Journals Connector (OSTI)

...the Mae Moh Power Plant, and the percentage of wind from the center...the Mae Moh Power Plant (E year) for...percentage of wind coming from...the Mae Moh Power Plant, and the percentage of wind from the center...

Paola Pisani; Petcharin Srivatanakul; Juliette Randerson-Moor; Sutee Vipasrinimit; Somkiat Lalitwongsa; Piyapong Unpunyo; Saghir Bashir; and D. Timothy Bishop

2006-04-01T23:59:59.000Z

312

An investigation of methods for reducing the use of non-renewable energy resources for housing in Thailand  

E-Print Network (OSTI)

provided by my Thai friends for helping me move the experimental box from the Architecture Woodshop to the solar test bench on the roof of the Langford Architecture Building on the Texas A&M University campus. I would like to thank Mr. Kwanchi Roacha... provided by my Thai friends for helping me move the experimental box from the Architecture Woodshop to the solar test bench on the roof of the Langford Architecture Building on the Texas A&M University campus. I would like to thank Mr. Kwanchi Roacha...

Rasisuttha, Sakkara

2005-08-29T23:59:59.000Z

313

GSTM1 and CYP1A1 Polymorphisms, Tobacco, Air Pollution, and Lung Cancer: A Study in Rural Thailand  

Science Journals Connector (OSTI)

...from the Mae Moh Power Plant, and the percentage of wind from the center...from the Mae Moh Power Plant (E year...the percentage of wind coming from the township...from the Mae Moh Power Plant, and the percentage of wind from the center...

Paola Pisani; Petcharin Srivatanakul; Juliette Randerson-Moor; Sutee Vipasrinimit; Somkiat Lalitwongsa; Piyapong Unpunyo; Saghir Bashir; and D. Timothy Bishop

2006-04-01T23:59:59.000Z

314

Diagnostic Approach to Acute Diarrheal Illness in a Military Population on Training Exercises in Thailand, a Region of Campylobacter Hyperendemicity  

Science Journals Connector (OSTI)

...cost. Military personnel are frequently...in antibiotic selection on the basis...S. military personnel have shown that...S. military training exercises were...the receiver operating characteristic...S. military personnel presenting with...city (base for training exercise) Nakhon...

David R. Tribble; Shahida Baqar; Lorrin W. Pang; Carl Mason; Huo-Shu H. Houng; Chittima Pitarangsi; Carlos Lebron; Adam Armstrong; Orntipa Sethabutr; John W. Sanders

2008-01-30T23:59:59.000Z

315

GSTM1 and CYP1A1 Polymorphisms, Tobacco, Air Pollution, and Lung Cancer: A Study in Rural Thailand  

Science Journals Connector (OSTI)

...deriving from the combustion of coal and...polycyclic aromatic hydrocarbons, the main component...provinces. Emission data were only available...fuel used to heat the residence...the domestic combustion of coal or wood...polycyclic aromatic hydrocarbons. These compounds...formed during combustion of organic material...

Paola Pisani; Petcharin Srivatanakul; Juliette Randerson-Moor; Sutee Vipasrinimit; Somkiat Lalitwongsa; Piyapong Unpunyo; Saghir Bashir; and D. Timothy Bishop

2006-04-01T23:59:59.000Z

316

GSTM1 and CYP1A1 Polymorphisms, Tobacco, Air Pollution, and Lung Cancer: A Study in Rural Thailand  

Science Journals Connector (OSTI)

...Carcinogens (43), an international project that aims at describing...IARC Press; 2004. 7 International Labour Office. International...Switzerland): International Labour Office; 1990...Malats N, Camus-Radon AM, Nyberg F, et...

Paola Pisani; Petcharin Srivatanakul; Juliette Randerson-Moor; Sutee Vipasrinimit; Somkiat Lalitwongsa; Piyapong Unpunyo; Saghir Bashir; and D. Timothy Bishop

2006-04-01T23:59:59.000Z

317

Wind Energy Resource Atlas of Armenia (CD-ROM)  

NLE Websites -- All DOE Office Websites (Extended Search)

Resource Atlas of Armenia (CD-ROM) http:www.nrel.govdocsfy03osti33877CD.zip (ZIP 31.9 MB) NRELCD-500-33877 July 2003 Instructions: The URL above links to a zipped archive...

318

China Energy Databook -- User Guide and Documentation, Version 7.0  

E-Print Network (OSTI)

Thailand Tunisia Turkey Uganda UAE United Kingdom United States Vietnam Rep. Yemen Other [4] Total Coal &

Fridley, Ed., David

2008-01-01T23:59:59.000Z

319

please recycle. Annual Fund support is the lifeblood of the Nicholas School of the  

E-Print Network (OSTI)

ecotourism sustainability in Thailand through an internship made possible by Annual Fund support. "It

Reif, John H.

320

S o u t h P a c i f i c O c e a n P a c i f i c  

E-Print Network (OSTI)

Thailand Tanzania Tajikistan Syria Switz. Sweden Swaziland Suriname Sudan Sri Lanka Spain South Africa

Hart, Gus

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

P E R F O R M I N G A R T S M A N A G E M E N T 0 2 / 2 0 1 1 S o u t h P a c i f i c O c e a n  

E-Print Network (OSTI)

Tonga Togo Thailand Tanzania Tajikistan Syria Switz. Sweden Swaziland Suriname Sudan Sri Lanka Spain

Hart, Gus

322

License Exceptions Supplement No. 1 to Part 740 page 1 Export Administration Regulations September 28, 2001  

E-Print Network (OSTI)

Islands Somalia South Africa Spain Sri Lanka Surinam Swaziland Sweden Switzerland Taiwan Tanzania Thailand

Bernstein, Daniel

323

University Health Service, University of Rochester LIST OF COUNTRIES For the Tuberculin Skin Test (PPD)  

E-Print Network (OSTI)

Somalia South Africa Spain Sri Lanka Sudan Suriname Swaziland Syrian Arab Republic Tajikistan Thailand

Mahon, Bradford Z.

324

Introduction The IRD around the world p. 2  

E-Print Network (OSTI)

indonesia thailand laos vietnam new caledonia madagascar costa-rica togo switzerland ethiopia gabon bolivia

326

Boise State University Human Resource Services Employee Information Form  

E-Print Network (OSTI)

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

327

Existing Commercial Reference Buildings Constructed Before 1980 - Archive  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Existing Commercial Reference Buildings Constructed Before 1980 - Existing Commercial Reference Buildings Constructed Before 1980 - Archive Existing Commercial Reference Buildings Constructed Before 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB) Full service restaurant

328

Existing Commercial Reference Buildings Constructed In or After 1980 -  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Existing Commercial Reference Buildings Constructed In or After Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB)

329

Proceedings of the Workshop on Sentiment Analysis where AI meets Psychology (SAAIP), IJCNLP 2011, pages 7379, Chiang Mai, Thailand, November 13, 2011.  

E-Print Network (OSTI)

Cardiff Social Media Research Group, ITT Dublin / Ireland John.Cardiff@ittdublin.ie Paolo Rosso NLE Lab the second or third page in search results. In this paper, we propose the "Tell me What I Need" (TWIN

Rosso, Paolo

330

E-Print Network 3.0 - asian energy security Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

State-Wide Program for Asian Studies... in Vermont Schools View of the floating market in Thailand at the 2008 Institute in Thailand ... Source: Hayden, Nancy J. - School of...

331

Fulbright U.S. Student Program, 1998-2009 Source: International Institute Fellowships Office  

E-Print Network (OSTI)

, South Africa Jeremy B. Liebowitz, Uganda Joshua D. Whitford, Italy Theodore W. Mayer, Thailand James R James Isaac, Germany Lisa Kenney, Thailand Matthew Lange, Germany Brendan Luecke, Russia Michael Messner

Turner, Monica G.

332

Fulbright U.S. Student Program, 1998-2011 Source: International Institute Fellowships Office  

E-Print Network (OSTI)

. Williams, South Africa Jeremy B. Liebowitz, Uganda Joshua D. Whitford, Italy Theodore W. Mayer, Thailand Galt, Costa Rica James Isaac, Germany Lisa Kenney, Thailand Matthew Lange, Germany Brendan Luecke

Turner, Monica G.

333

Microsoft PowerPoint - 7_James Warden_2013-05-06 123 agreements...  

National Nuclear Security Administration (NNSA)

Norway - Canada - Russian Federation - China - South Africa - Colombia - Switzerland - Egypt - Thailand - EURATOM (27 countries) - Turkey - India - Ukraine - Indonesia - United...

334

Energy-efficiency labels and standards: A guidebook for appliances, equipment and lighting  

E-Print Network (OSTI)

Appliance Manufacturers (AHAM) certification program forAuthority of Thailand AEU AGO AHAM AMI ANSI ANOPR APEC ARI

McMahon, James E.; Wiel, Stephen

2001-01-01T23:59:59.000Z

335

Empowering Women: The Role of Economic Development, Political Culture and Institutional Design in the Worlds Societies  

E-Print Network (OSTI)

Paraguay, Sri Lanka, Suriname, Thailand, Turkey, Ukraine,South Africa, Spain, Suriname, Sweden, Switzerland 25 th -75

Alexander, Amy C.

2007-01-01T23:59:59.000Z

336

To appear in IEEE Transactions on Visualization and Computer Graphics Order of Magnitude Markers: An Empirical Study on Large  

E-Print Network (OSTI)

SouthAfrica KoreaSouth SriLanka Sudan Suriname Swaziland Tajikistan Tanzania Thailand Timor-Leste Togo

Jones, Mark W.

337

PROOF COPY [JES-11-1229R] 068110JES Comparison of Hydrogen and Methane as fuel in Micro-Tubular  

E-Print Network (OSTI)

for choosing methane is explained below. 23 The major external energy sources in Thailand are from coal and 24 of these particular cells with coal gas in Thailand. 41 At MTEC facility, the cell stack were tested in groups of 500, Columbia, South Carolina 29208, USA 5 b National Metal and Materials Technology Center, Thailand Science

Van Zee, John W.

338

Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network (OSTI)

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan

339

E-Print Network 3.0 - addressing medical coding Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

340

Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)

XXX VVV 000001 A A 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT WASTE COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 1 VVV XXX 03 31 2008 1 LD WASTE...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)

XXX XXX 000031 A M 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 4 1 31 20 -1405.00 -93.00 2 32 50...

342

Nuclear Material Transaction Report NRC 741_1  

National Nuclear Security Administration (NNSA)

1 A D 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 4 YYY XXX 1 31 20 -50397.00 -2335.00 2 31 20...

343

NRC Form 741  

National Nuclear Security Administration (NNSA)

A 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 4 YYY XXX 1 31 20 50397.00 2335.00 03 31 2008 1 FAB...

344

Nuclear Material Transaction Report NRC 741_1  

National Nuclear Security Administration (NNSA)

B 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 0 YYY XXX 04 01 2008 BASED ON SHIPPER'S VALUES Example...

345

Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)

A A 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT FOREIGN COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 2 YYY RRRR 03 31 2008 1 AH31 1 EG 309 J...

346

Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)

A B 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT FOREIGN COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 2 YYY RRRR 04 05 2008 1 AH31 1 EG 309 J...

348

The University of Utah Alumni Association Young Alumni  

E-Print Network (OSTI)

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

349

Klimaschutzberatung | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: Klimaschutzberatung Place: Mnchen, Germany Zip: 80469 Sector: Carbon Product: Look at Carbon Markets References:...

350

Celgard LLC | Open Energy Information  

Open Energy Info (EERE)

Carolina Zip: 28273 Product: Celgard battery separators are polypropylene andor polyethylene electrolytic membranes used in high performance battery applications. References:...

351

Eco Fuel Global | Open Energy Information  

Open Energy Info (EERE)

California Zip: 94596 Sector: Services Product: California-based environmental engineering and consulting firm. It's services include alternative fuel production,...

352

Fermilab | Press Room | Fact Sheets & Brochures | Archives |...  

NLE Websites -- All DOE Office Websites (Extended Search)

Economic Impacts Economic Impact FY2010 FY2009 FY2008 FY2007 Procurement Distribution Payroll by Zip Code...

353

SOLARPERMIT.ORG  

Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database https://github.com/solarpermit/solarpermit/archive/devel.zip

354

UCR 05/2013 Washington Academic Internship Program  

E-Print Network (OSTI)

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship

355

CSC420--Introduction to Image Understanding, Fall 2011 Assignment 1: Calibration Checkerboards  

E-Print Network (OSTI)

plane that projects to p. (c) In the Matlab code checkerShow.m, implement the above computation to hand in. Both a short written report and the completed Matlab handout code will be submitted a zip file of your Matlab solution code. The zip file must be called A1Matlab.zip, and should consist

Jepson, Allan D.

356

Presidential address  

Science Journals Connector (OSTI)

...governments should understand that in a free market economy, were part of the solution...tracts of wilderness to palm oil to produce diesel. I read this in the Bangkok Post when...but its just not clear that the free market with its day-to-day volatility is...

Craig Beasley

357

NOAA ARL Monthly Activity Report Bruce B. Hicks, Director  

E-Print Network (OSTI)

NOAA ARL Monthly Activity Report April 2002 Bruce B. Hicks, Director Air Resources Laboratory and Hydrology, to be held in March 2003 in Geneva. An international group of 7 women met in Silver Spring April's participation in meteorology and hydrology, which was held in December 1997 in Bangkok, and will focus on women

358

Mark Gregory Robson, BS, MS, PhD, MPH, DrPH (hc), ATS Rutgers School of Environmental and Biological Sciences  

E-Print Network (OSTI)

, government service, and agribusiness as well as an owner/operator of farming enterprises. #12;Mark Gregory and entrepreneurship, energy efficiency, and niche agriculture, including agro-tourism, community-supported agriculture Professor-Senior Academic Advisor, Chulalongkorn University College of Public Health Sciences. Bangkok

Wang, Changlu

359

GIAGEMolocrcAL lNSTrrurE oF AMFRICA' 5355 Armada Drive I Carlsbad, CA 92008-4S82  

E-Print Network (OSTI)

GIAGEMolocrcAL lNSTrrurE oF AMFRICA' 5355 Armada Drive I Carlsbad, CA 92008-4S82 I:760 603-4500 | Fr 760-6031814 GIA Laboratories Bangkok Carlsbad Gaborone Johannesburg Mumbai New York www

Mathis, Wayne N.

360

EUKARYOTIC CELL, Dec. 2006, p. 21842188 Vol. 5, No. 12 1535-9778/06/$08.00 0 doi:10.1128/EC.00274-06  

E-Print Network (OSTI)

, Massachusetts 02142,1 and Department of Microbiology, School of Dentistry, Chulalongkorn University, Bangkok demand for its chaperone functions can exceed its induction (24). This likely occurs because associations are contingent on cellular stress responses (7) and interactions with genetic variants in particular genomes (1

Carpenter, Anne E.

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Sailing Sinbad's seas  

Science Journals Connector (OSTI)

...merchants traveled to Arabia on these winds, according to finds made in...which lies 34 meters underwater just offshore from the estuary of Walawe River, one of the island's...wreck turned up just last fall on a shrimp farm on the southwest outskirts of Bangkok...

Andrew Lawler

2014-06-27T23:59:59.000Z

362

HYBRIDISATION OF NEURAL NETWORKS AND GENETIC ALGORITHMS FOR TIME-OPTIMAL CONTROL  

E-Print Network (OSTI)

into a time-energy optimal control problem which can be regarded as a Lagrangian constraint optimisation Chaiyaratana Department of Production Engineering King Mongkut's Institute of Technology North Bangkok 1518) are used to solve a multi-objective optimisation problem related to time-optimal control. The results

Coello, Carlos A. Coello

363

Kenyan Shilling KES Stanbic Bank, Nairobi Namibian Dollar NAD Standard Bank Namibia, Ltd, Windhoek  

E-Print Network (OSTI)

Chartered Bank, Tokyo Singapore Dollar SGD The Bank of New York Mellon Thai Bhat THB HSBC Bank, Bangkok Australian Dollar AUD HSBC Bank, Sydney Fiji Dollar FJD Westpac Banking Corporation, Suva New Zealand Dollar, Port Vila British Pound GBP HSBC Bank PLC, London Czech Republic Koruna CZK Ceskoslovenska Obchodni

Qian, Ning

364

THE FIRST CIRCULAR UNESCO-APEID 2011 INTERNATIONAL SYMPOSIUM ON  

E-Print Network (OSTI)

APEID The utilization and conservation of the water resources for human survival, bioproduction and the environment 8 countries: Philippines, Thailand, Indonesia,Afghanistan, Bangladesh, Malawi, Ghana and Japan

Ejiri, Shinji

365

THE FIRST CIRCULAR UNESCO-APEID 2012 INTERNATIONAL SYMPOSIUM ON  

E-Print Network (OSTI)

APEID The utilization and conservation of the water resources for human survival, bioproduction and the environment 8 countries: Philippines, Thailand, Indonesia,Afghanistan, Bangladesh, Malawi, Ghana and Japan

Ejiri, Shinji

366

E-Print Network Topics: K  

NLE Websites -- All DOE Office Websites (Extended Search)

landslide north khon collisional system khon kaen province khon kaen thailand khoot oil shale khoraki va ertebat-e khorana junheng li khorasan province iran khorasan razavi...

367

E-Print Network 3.0 - arabia sudan syrian Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

MADAGASCAR NEPAL GUINEA ERITREA SUDAN ZAMBIA HAITI BHUTAN MYANMAR GAMBIA BANGLADESH... JORDAN THAILAND LITHUANIA SYRIAN ARAB REPUBLIC IRAQ REUNION TURKEY AZERBAIJAN ARGENTINA MACAU...

368

SAFEGUARD AND SECURE CONTROL VERIFY POLICY  

National Nuclear Security Administration (NNSA)

Myanmar, Philippines, Saudi Arabia, Thailand, Vietnam, Japan, United Arab Emirates, Jordan, Indonesia, and Malaysia completed the course. James Conner of NIS joined President of...

369

This Week In Petroleum Printer-Friendly Version  

Gasoline and Diesel Fuel Update (EIA)

especially for net oil importers. In Bangladesh, Brazil, Brunei, India, Indonesia, Jordan, Malaysia, Burma (Myanmar), Pakistan, South Africa, Sri Lanka, and Thailand,...

370

ENERGY U.S. DEPARTMENT OF  

National Nuclear Security Administration (NNSA)

United Arab Emirates, Vietnam, Thailand, Malaysia, Indonesia, the Philippines, Iraq, Jordan, and Myanmar, to enable effective implementation of the Additional Protocol. INSEP...

371

USABC Battery Separator Development  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

facility Corydon, IN Charlotte, NC* Owensboro, KY* Slestat, France* Wuppertal, Germany* Tokyo, Japan Shanghai, China Prachinburi, Thailand* Sao Paulo, Brazil Obernberg,...

372

E-Print Network 3.0 - a549 lung adenocarcinoma Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Collection: Mathematics 48 TP53 gene mutations of lung cancer patients in upper northern Thailand and environmental risk factors Summary: TP53 gene mutations of lung cancer...

373

CHARLES WESLEY WOOD BIOGRAPHICAL SKETCH (http://www.linkedin.com/pub/wes-wood/71/499/230)  

E-Print Network (OSTI)

, Thailand, Honduras, Mexico, The Philippines, Haiti, and New Zealand. Wes served as Associate Editor Program. Consulting projects have included revegetation of coal mine refuse; monitoring nitrate movement

Jawitz, James W.

374

E-Print Network 3.0 - active single basin Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

basins... ) existed during the Late Oligocene and Miocene when the rift basins of Thailand were active because active... into three main areas and tec- tonic provinces: 1)...

375

E-Print Network 3.0 - abandoned mining sites Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

processed and interpreted geophysical data at four separate sites... in Chiang Mai, Thailand. These field sites were selected to train participants in the ... Source:...

376

E-Print Network 3.0 - apec energy project Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

trade agreements Summary: Cooperation (APEC), the Trans-Pacific SEP and the New Zealand-Thailand CEP. Introduction As part... (WTO), the Asia-Pacific Economic Cooperation (APEC),...

377

E-Print Network 3.0 - activityin southern brazil Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Biology and Medicine 32 Dr. David Kemp Australian Minister of Summary: - Southern StatesThailand - sustainable industry development - Southern StatesBrazil - clean coal power......

378

E-Print Network 3.0 - asia taiheiyo sekitan Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

the nations... of Northeast, East, Southeast, and South Asia (e.g., Japan, Korea, China, Thailand, Brunei, Timor Leste Source: Thiruvathukal, George K. - Department of Computer...

379

E-Print Network 3.0 - artificial ab-mountains extraction Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sciences 34 Curriculum Vitae of Rudy Setiono Contact information Summary: , Chiang Mai, Thailand, November 2001. 11. Techniques for extracting rules from artificial neural...

380

E-Print Network 3.0 - arsenic-contaminated pyrite wastes Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

Technologies 10 Proc. Natl. Acad. Sci. USA Vol. 96, pp. 34553462, March 1999 Summary: of Thailand result from arsenic contamination of the shallow groundwaters be- cause of...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

RSAP Successful Grants 2011 Research development grants 2011 funding awards  

E-Print Network (OSTI)

, Students, Law, and Violence in Northern Thailand Howes, Stephen Crawford To develop a research scholars on coal mininginduced displacement and dispossession of indigenous peoples in Jharkhand, India

382

E-Print Network 3.0 - alluvial basin numerical Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

in Great Britain. Palaeocurrents and provenance of the Mae Rim Formation, Northern Thailand Summary: as alluvial fans along the basin's edge. The main goals for this study...

383

E-Print Network 3.0 - asymptomatic african migrants Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

health in the SADC region: Identifying... . . . . . . . . . . . . . . . . 19 5.14 The Thailand Response to Migrants' Access to Health. . . . . . . 19 12;Migration Health... :...

384

E-Print Network 3.0 - adult bullfrogs lithobates Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

wood frog (Lithobates sylvaticus... M C 16 Ranidae Lithobates catesbeianus M W 17 Thailand Ranidae Rana tigrina M C 18 Australia... 36 Ranidae Lithobates clamitans I, M...

385

E-Print Network 3.0 - au mineralization related Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Rock Abuse Collection: Fossil Fuels ; Geosciences 7 Quality Programs 350 4,000 Summary: (Thailand) Master of Communication (Public Relations and Professional Communication)...

386

E-Print Network 3.0 - arsenite-stimulated hemeoxygenase-1 production...  

NLE Websites -- All DOE Office Websites (Extended Search)

46 Proceedings of the 2011 Named Entities Workshop, IJCNLP 2011, pages 5864, Chiang Mai, Thailand, November 12, 2011. Summary: , November 12, 2011. Product Name Identification and...

387

E-Print Network 3.0 - area 2004-2006 technical Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

May 2010 Section of Ecology, Evolution & Systematic Biology Summary: of Technology, Thailand. 2004-2006 ASEM-DUO Fellowship (5, 000). Exchange Program. Roskilde University...

388

E-Print Network 3.0 - arak markazi province Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Asian Natural Language Processing (WSSANLP), IJCNLP 2011, , pages 4045, Chiang Mai, Thailand, November 8, 2011. Summary: on Computational Approaches to Arabic Script-...

389

Shipping Data Generation for the Hunter Valley Coal Chain  

E-Print Network (OSTI)

demand for coal is expected to double in the next decade. Optimization and ...... Transportation Analysis (TRISTAN), Phuket, Thailand, 2007. [4] N.L. Boland and

2013-02-02T23:59:59.000Z

390

E-Print Network 3.0 - aging underground reinforced Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

University Summary: -Infrastructure Developments in Southeast Asia: Case Study of Thailand Underground Suchatvee Suwansawat Dean of Engineering... is the second phase...

391

E-Print Network 3.0 - altun northwest china Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

northwest Fukien ( Fujian) Prov., China. Distribution: southern China; northern Myanmar; Thailand; Laos... ; Cambodia; Laos; Vietnam; Southern China (Hainan, Hong Kong, and...

392

E-Print Network 3.0 - action plan municipality Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

TREATMENT AND DISPOSAL IN THACHIN, Summary: successfully. 12;iii Abstract At present, Thailand does not have action plan and appropriate policy for Fecal... and Transportation...

393

E-Print Network 3.0 - advanced stack hardware Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Pramote - School of Applied Statistics, National Institute of Development Administration Thailand (NIDA); Mooney, Vincent - School of Electrical and Computer Engineering, Georgia...

394

E-Print Network 3.0 - anti-botulinum natural product Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

5 Proceedings of the 2011 Named Entities Workshop, IJCNLP 2011, pages 5864, Chiang Mai, Thailand, November 12, 2011. Summary: , November 12, 2011. Product Name Identification and...

395

E-Print Network 3.0 - arc plasma-catalyst reformer Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Summary: by reforming their political institutions. States such as Indonesia, Thailand, the Philippines, Taiwan and East... systems and other key democratic...

396

Automotive Fuels ? The Challenge for Sustainable Mobility  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GTL Fuel launched in: Austria, Germany, Greece, Italy, Netherlands, Switzerland and Thailand Premium Fuels V-Power fuels: Best performance in Latest engine technology * In 60...

397

E-Print Network 3.0 - alluvial basins in-depth Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

in Great Britain. Palaeocurrents and provenance of the Mae Rim Formation, Northern Thailand Summary: as alluvial fans along the basin's edge. The main goals for this study...

398

E-Print Network 3.0 - america advancing prosperity Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Francesca - Dipartimento di Matematica, Politecnico di Torino Collection: Mathematics 46 Thailand Statistician July 2008; 6(2) : 163-172 Summary: of Prosperity and Depression...

399

E-Print Network 3.0 - agricultural lung diseases Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Biology and Medicine 18 TP53 gene mutations of lung cancer patients in upper northern Thailand and environmental risk factors Summary: TP53 gene mutations of lung cancer...

400

ASEAN's Gradual Evolution: Challenges and Opportunities for Integrating Participatory Procedural Reforms for the Environment in an Evolving Rights-Based Framework  

E-Print Network (OSTI)

Dearden, Linking Ecotourism and Biodiversity Conservation: Athe development of ecotourism in Northern Thailand); Amatlah Mohd, Community-based Ecotourism: A New Proposition for

Abdel-Monem, Tarik

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Survey of Biomass Resource Assessments and Assessment Capabilities...  

Open Energy Info (EERE)

South Korea, Malaysia, Mexico, New Zealand, Papua New Guinea, Peru, Philippines, Russia, Chinese Taipei, Thailand, United States, Vietnam Australia and New Zealand,...

402

Energy Indicators for Sustainable Development: Guidelines and...  

Open Energy Info (EERE)

FactsheetsEnglishindicators.pdf Country: Brazil, Cuba, Lithuania, Mexico, Russia, Slovakia, Thailand UN Region: South-Eastern Asia, "Latin America and Caribbean" is...

403

International reserves management and the current account  

E-Print Network (OSTI)

St. Vincent & Gren. Sudan Suriname Swaziland Syria ThailandRomania Samoa Sri Lanka Suriname Swaziland Syrian ArabVincent & Grens. Sudan Suriname Swaziland Sweden Switzerland

Aizenman, Joshua

2007-01-01T23:59:59.000Z

404

Terrorism Risk, Resilience and Volatility: A Comparison of Terrorism Patterns in Three Southeast Asian Countries  

Science Journals Connector (OSTI)

This article explores patterns of terrorist activity over the period from 2000 through 2010 across three target countries: Indonesia, the Philippines and Thailand.

Gentry White; Michael D. Porter; Lorraine Mazerolle

2013-06-01T23:59:59.000Z

405

National Science and Technology Development Agency | Open Energy...  

Open Energy Info (EERE)

National Science and Technology Development Agency Jump to: navigation, search Name: National Science and Technology Development Agency Place: Thailand Product: Thai national R&D...

406

Base 1 Base 2 Base 3 Base 4 PHILIPPINES  

E-Print Network (OSTI)

'IVOIRE GABON MALI REPUBLIQUE CENTRAFRICAINE THAILANDE CHINE JORDANIE MALAISIE PALESTINE SENEGAL SYRIE BOLIVIE HAITI GHANA INDIA MADAGASCAR NIGER CHAD CAMEROON CONGO IVORY COAST GABON MALI CENTRAL AFRICAN REPUBLIC

407

theirdaroundtheworld irdinanutshell  

E-Print Network (OSTI)

territories Haiti Liban Chad TUNISIA Gabon Cambodia THAILAND 1-9 staff members 10-19 staff members 20-27 staff

408

Tax and Fiscal Policies for Promotion of Industrial Energy Efficiency: A Survey of International Experience  

E-Print Network (OSTI)

and Macfarane, 2003). Norways Industrial Energy Efficiencyto Norways draft budget for 2004, the current energymanagement or energy monitoring. Like Thailand, Norway also

Price, Lynn; Galitsky, Christina; Sinton, Jonathan; Worrell, Ernst; Graus, Wina

2005-01-01T23:59:59.000Z

409

E-Print Network 3.0 - anoxic rice paddy Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

and Ecology 31 Avian influenza, domestic ducks and rice agriculture in Thailand Marius Gilbert a,*, Xiangming Xiao b Summary: intensification; Rice paddy production 1....

410

E-Print Network 3.0 - aflatoxin b1 biomarker Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

of Plant Sciences, University of Arizona Collection: Biology and Medicine 20 Aflatoxin-producing Aspergillus species from Thailand Kenneth C. Ehrlich , Kerri Kobbeman, Beverly...

411

India-Low Emissions Asian Development (LEAD) Program | Open Energy...  

Open Energy Info (EERE)

in up to 11 partner countries: Bangladesh, Cambodia, India, Indonesia, Laos, Malaysia, Nepal, Papua New Guinea, Philippines, Thailand, and Vietnam. References "USAID LEAD...

412

Fast Out of the Gate: How Developing Asian Countries can Prepare...  

Open Energy Info (EERE)

Development (LEAD) program: Bangladesh, Cambodia, India, Indonesia, Laos, Malaysia, Nepal, the Philippines, Papua New Guinea, Thailand, and Vietnam. LEDSGP green logo.png This...

413

Cambodia-Low Emissions Asian Development (LEAD) Program | Open...  

Open Energy Info (EERE)

in up to 11 partner countries: Bangladesh, Cambodia, India, Indonesia, Laos, Malaysia, Nepal, Papua New Guinea, Philippines, Thailand, and Vietnam. USAID LEAD Factsheet LEAD Fact...

414

Enhancing Capacity for Low Emission Development Strategies (EC...  

Open Energy Info (EERE)

Indonesia, Kenya, Republic of Macedonia, Malawi, Mexico, Moldova, Philippines, South Africa, Serbia, Thailand, Ukraine, Vietnam, Zambia Southern Europe, Southern Asia, South...

415

Newsletter Signup Form  

NLE Websites -- All DOE Office Websites (Extended Search)

EETD NEWSLETTER - MANAGE SUBSCRIPTIONS EETD NEWSLETTER - MANAGE SUBSCRIPTIONS (red fields are required) Manage subscriptions: Subscribe Unsubscribe Name E-Mail Affiliation Address Address (line 2) City State/Province Zip/Postal Code Country (please select a country) none Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegowina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Congo, the Democratic Republic of the Cook Islands Costa Rica Cote d'Ivoire Croatia (Hrvatska) Cuba Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic East Timor Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands (Malvinas) Faroe Islands Fiji Finland France France, Metropolitan French Guiana French Polynesia French Southern Territories Gabon Gambia Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guinea Guinea-Bissau Guyana Haiti Heard and Mc Donald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran (Islamic Republic of) Iraq Ireland Israel Italy Jamaica Japan Jordan Kazakhstan Kenya Kiribati Korea, Democratic People's Republic of Korea, Republic of Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libyan Arab Jamahiriya Liechtenstein Lithuania Luxembourg Macau Macedonia, The Former Yugoslav Republic of Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Micronesia, Federated States of Moldova, Republic of Monaco Mongolia Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island Northern Mariana Islands Norway Oman Pakistan Palau Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Kitts and Nevis Saint LUCIA Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Seychelles Sierra Leone Singapore Slovakia (Slovak Republic) Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Islands Spain Sri Lanka St. Helena St. Pierre and Miquelon Sudan Suriname Svalbard and Jan Mayen Islands Swaziland Sweden Switzerland Syrian Arab Republic Taiwan, Province of China Tajikistan Tanzania, United Republic of Thailand Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu Uganda Ukraine United Arab Emirates United Kingdom United States United States Minor Outlying Islands Uruguay Uzbekistan Vanuatu Venezuela Viet Nam Virgin Islands (British) Virgin Islands (U.S.) Wallis and Futuna Islands Western Sahara Yemen Yugoslavia Zambia Zimbabwe

416

Puerto Rico | OpenEI  

Open Energy Info (EERE)

Puerto Rico Puerto Rico Dataset Summary Description Source The Wave Energy Resource Assessment project is a joint venture between NREL, EPRI, and Virginia Tech. EPRI is the prime contractor, Virginia Tech is responsible for development of the models and estimating the wave resource, and NREL serves as an independent validator and also develops the final GIS-based display of the data. Source National Renewable Energy Laboratory (NREL) Date Released September 27th, 2011 (3 years ago) Date Updated October 20th, 2011 (3 years ago) Keywords EPRI GIS NREL Puerto Rico shapefile United States Virginia Tech wave energy Data application/zip icon Download Data in CSV Format (zip, 3.4 MiB) application/zip icon Download Wave Power Density Shapefile (zip, 2.5 MiB) application/zip icon Download Wave Energy Period Shapefile (zip, 2.5 MiB)

417

Transportation Energy Futures | OpenEI  

Open Energy Info (EERE)

Energy Futures Energy Futures Dataset Summary Description The 2009 National Household Travel Survey (NHTS) provides information to assist transportation planners and policy makers who need comprehensive data on travel and transportation patterns in the United States. The 2009 NHTS updates information gathered in the 2001 NHTS and in prior Nationwide Personal Transportation Surveys (NPTS) conducted in 1969, 1977, 1983, 1990, and 1995. Source U.S. Department of Transportation, Federal Highway Administration Date Released February 28th, 2011 (3 years ago) Date Updated Unknown Keywords NHTS TEF transportation Transportation Energy Futures travel trip Data application/zip icon Travel Day Trip File (zip, 42.6 MiB) application/zip icon Household File (zip, 5 MiB) application/zip icon Person File (zip, 17.4 MiB)

418

TEF | OpenEI  

Open Energy Info (EERE)

TEF TEF Dataset Summary Description The 2009 National Household Travel Survey (NHTS) provides information to assist transportation planners and policy makers who need comprehensive data on travel and transportation patterns in the United States. The 2009 NHTS updates information gathered in the 2001 NHTS and in prior Nationwide Personal Transportation Surveys (NPTS) conducted in 1969, 1977, 1983, 1990, and 1995. Source U.S. Department of Transportation, Federal Highway Administration Date Released February 28th, 2011 (3 years ago) Date Updated Unknown Keywords NHTS TEF transportation Transportation Energy Futures travel trip Data application/zip icon Travel Day Trip File (zip, 42.6 MiB) application/zip icon Household File (zip, 5 MiB) application/zip icon Person File (zip, 17.4 MiB)

419

transportation | OpenEI  

Open Energy Info (EERE)

transportation transportation Dataset Summary Description The 2009 National Household Travel Survey (NHTS) provides information to assist transportation planners and policy makers who need comprehensive data on travel and transportation patterns in the United States. The 2009 NHTS updates information gathered in the 2001 NHTS and in prior Nationwide Personal Transportation Surveys (NPTS) conducted in 1969, 1977, 1983, 1990, and 1995. Source U.S. Department of Transportation, Federal Highway Administration Date Released February 28th, 2011 (3 years ago) Date Updated Unknown Keywords NHTS TEF transportation Transportation Energy Futures travel trip Data application/zip icon Travel Day Trip File (zip, 42.6 MiB) application/zip icon Household File (zip, 5 MiB) application/zip icon Person File (zip, 17.4 MiB)

420

US Council for Automotive Research USCAR | Open Energy Information  

Open Energy Info (EERE)

Research USCAR Jump to: navigation, search Name: US Council for Automotive Research (USCAR) Place: Southfield, Michigan Zip: 48075 - Product: Umbrella organization of...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

PPT Research Inc | Open Energy Information  

Open Energy Info (EERE)

PPT Research Inc Jump to: navigation, search Name: PPT Research Inc Place: Allentown, Pennsylvania Zip: 18109 Product: Has developed a closed-loop system for recycling abrasive...

422

Vertex Energy | Open Energy Information  

Open Energy Info (EERE)

Zip: 77058 Product: Vertex is comprised of several companies that together serve as a petroleum recovery company, focused on recyclereuse options for petroleum products, crudes,...

423

WeBiomass Inc | Open Energy Information  

Open Energy Info (EERE)

Zip: 05701 Region: Greater Boston Area Sector: Biomass Product: Commercial Biomass Boiler Systems Website: http:www.webiomass.com Coordinates: 43.58070919775,...

424

Indian Centre for Wind Energy Technology C WET | Open Energy...  

Open Energy Info (EERE)

WET Jump to: navigation, search Name: Indian Centre for Wind Energy Technology (C-WET) Place: Chennai, India Zip: 601 302 Sector: Wind energy Product: Government backed wind...

425

Avestor | Open Energy Information  

Open Energy Info (EERE)

Avestor Jump to: navigation, search Name: Avestor Place: Quebec, Canada Zip: J4B 727 Product: After filing bankruptcy in October 2006, Avestor's assets were acquired by the...

426

Agricultural Waste Solutions Inc AWS | Open Energy Information  

Open Energy Info (EERE)

Inc (AWS) Place: Westlake Village, California Zip: CA 91361 Product: Agricultural Waste Solutions designs small scale gasification systems. References: Agricultural Waste...

427

Multi Empreendimentos | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: Multi Empreendimentos Place: Recife, Pernambuco, Brazil Zip: 50050-200 Sector: Efficiency, Renewable Energy, Services Product:...

428

Nupiaui Participacoes S A | Open Energy Information  

Open Energy Info (EERE)

to: navigation, search Name: Nupiaui Participacoes S.A. Place: Luis Correia, Piaui, Brazil Zip: 64220-000 Sector: Wind energy Product: Brazil based wind project developer,...

429

Sol rios | Open Energy Information  

Open Energy Info (EERE)

rios Jump to: navigation, search Name: Solrios Place: Piranhas, Brazil Zip: 57.460.000 Sector: Buildings, Solar Product: Installs solar powered water heaters for residential,...

430

Eolica Industrial | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: Eolica Industrial Place: Sao Paulo, Sao Paulo, Brazil Zip: 01020-901 Sector: Wind energy Product: Brazil based wind turbine steel towers and...

431

ABEEolica | Open Energy Information  

Open Energy Info (EERE)

ABEEolica Jump to: navigation, search Name: ABEEolica Place: Sao Paulo, Sao Paulo, Brazil Zip: 1136001 Sector: Wind energy Product: Brazil's wind energy association. References:...

432

Refinaria Alberto Pasqualini REFAP | Open Energy Information  

Open Energy Info (EERE)

search Name: Refinaria Alberto Pasqualini (REFAP) Place: Canoas, Rio Grande do Sul, Brazil Zip: 92420 - 221 Sector: Biomass Product: Brazil based biomass producer References:...

433

Prowind Energias Alternativas Ltda | Open Energy Information  

Open Energy Info (EERE)

Name: Prowind Energias Alternativas Ltda Place: Porto Alegre, Rio Grande do Sul, Brazil Zip: 90560-002 Sector: Wind energy Product: Brazil based wind project developer....

434

Dobreve Empreendimentos e Participacoes | Open Energy Information  

Open Energy Info (EERE)

Name: Dobreve Empreendimentos e Participacoes Place: Jaragua do Sul, Santa Catarina, Brazil Zip: 89260-500 Sector: Wind energy Product: Brazil-based wind project developer....

435

Carbotrader | Open Energy Information  

Open Energy Info (EERE)

search Name: Carbotrader Place: Sao Paulo, Sao Paulo, Brazil Zip: 13207 070 Sector: Renewable Energy, Services Product: String representation "Carbotrader is ... rading support."...

436

Gemini Solar Development Company | Open Energy Information  

Open Energy Info (EERE)

Gemini Solar Development Company Jump to: navigation, search Name: Gemini Solar Development Company Place: San Francisco, California Zip: 94105 Sector: Renewable Energy Product:...

437

Bloo Solar formerly Q1 Nanosystems | Open Energy Information  

Open Energy Info (EERE)

Solar formerly Q1 Nanosystems Jump to: navigation, search Name: Bloo Solar (formerly Q1 Nanosystems) Place: West Sacramento, California Zip: 95691 Sector: Solar Product: String...

438

SolarRoofs com | Open Energy Information  

Open Energy Info (EERE)

navigation, search Name: SolarRoofs.com Place: Carmichael, California Zip: 95608 Sector: Solar Product: California-based manufacturer of the patented Skyline solar water heating...

439

New Millennium Power | Open Energy Information  

Open Energy Info (EERE)

Millennium Power Place: Laguna Niguel, California Zip: 92677 Sector: Solar Product: Solar system installer and integrator operating in Orange County, California. References: New...

440

Accurate Solar Power | Open Energy Information  

Open Energy Info (EERE)

Accurate Solar Power Jump to: navigation, search Name: Accurate Solar Power Place: Menlo Park, California Zip: 94025 Product: US manufacturer of microinverters and smart grid...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

California State University CSU | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: California State University (CSU) Place: Los Angeles, California Zip: 90802-4210 Sector: Solar Product: One of the largest higher education...

442

Solar Infra Inc | Open Energy Information  

Open Energy Info (EERE)

Infra Inc Jump to: navigation, search Name: Solar Infra Inc Place: Santa Clara, California Zip: 95054 Product: Manufacturer of crystalline PV modules. References: Solar Infra...

443

Nationwide Solar Funding | Open Energy Information  

Open Energy Info (EERE)

Nationwide Solar Funding Place: Palm Desert, California Zip: 92211 Sector: Solar Product: Provides funding for small (residential and business) solar projects References:...

444

Solar amp Electric Solutions | Open Energy Information  

Open Energy Info (EERE)

amp Electric Solutions Jump to: navigation, search Name: Solar & Electric Solutions Place: Santa Cruz, California Zip: 95062 Sector: Solar Product: Small solar installation firm in...

445

Advantage Solar Inc | Open Energy Information  

Open Energy Info (EERE)

Solar Inc Jump to: navigation, search Name: Advantage Solar Inc. Place: California Zip: 92394 Sector: Solar Product: Dealer in solar equipment and consultant in maintaining...

446

Solarese | Open Energy Information  

Open Energy Info (EERE)

Solarese Jump to: navigation, search Name: solarese Place: San Diego, California Zip: 92129 Sector: Solar Product: Installer of PV and thermal solar systems for residential and...

447

Discover Power | Open Energy Information  

Open Energy Info (EERE)

Discover Power Place: California Zip: 92109 Sector: Renewable Energy, Solar Product: Distributor of solar electric and other renewable energy products. References: Discover...

448

BrightSource Energy | Open Energy Information  

Open Energy Info (EERE)

search Name: BrightSource Energy Place: Oakland, California Zip: 94612 Sector: Solar Product: California-based company that develops, builds, owns, and operates large...

449

Aztec Solar | Open Energy Information  

Open Energy Info (EERE)

Solar Jump to: navigation, search Name: Aztec Solar Place: Rancho Cordova, California Zip: 95742 Sector: Solar Product: Installer of solar hot water and pool heating systems....

450

Sunny Hill Energy | Open Energy Information  

Open Energy Info (EERE)

Sunny Hill Energy Place: San Jose, California Zip: 95113 Sector: Solar Product: California-based solar financing and business support company that bridges residential and...

451

Scheuten Solar USA Inc | Open Energy Information  

Open Energy Info (EERE)

Scheuten Solar USA, Inc. Place: Rancho Santa Margarita, California Zip: 92688 Sector: Solar Product: Manufacturer of Solar PV systems References: Scheuten Solar USA, Inc.1 This...

452

Sequoia Solar Inc | Open Energy Information  

Open Energy Info (EERE)

Solar Inc Jump to: navigation, search Name: Sequoia Solar, Inc. Place: Solana Beach, California Zip: 92075 Sector: Solar Product: California-based installer of solar plants....

453

Solar Depot Inc | Open Energy Information  

Open Energy Info (EERE)

Solar Depot Inc Place: Petaluma, California Zip: 94954 Sector: Solar Product: US-based PV and solar passive system integrator and distributor. References: Solar Depot Inc1 This...

454

Perpetual Energy Systems | Open Energy Information  

Open Energy Info (EERE)

Woodland Hills, California Zip: 91367 Sector: Renewable Energy, Solar Product: String representation "Perpetual Energ ... sustainability." is too long. References: Perpetual Energy...

455

Vaillant Solar Systems | Open Energy Information  

Open Energy Info (EERE)

Vaillant Solar Systems Jump to: navigation, search Name: Vaillant Solar Systems Place: Solana Beach, California Zip: 92075 Sector: Solar Product: California-based solar company...

456

Akeena Solar Inc | Open Energy Information  

Open Energy Info (EERE)

Akeena Solar Inc Place: Los Gatos, California Zip: CA 95032 Sector: Solar Product: Residential and commercial solar electric system installer in the US. References: Akeena Solar...

457

SJ Solar | Open Energy Information  

Open Energy Info (EERE)

SJ Solar Jump to: navigation, search Name: SJ Solar Place: San Jose, California Zip: 95131 Sector: Solar Product: Cell design firm for concentrated solar References: SJ Solar1...

458

International Solar Consulting | Open Energy Information  

Open Energy Info (EERE)

International Solar Consulting Place: Newport Beach, California Zip: 92660 Sector: Renewable Energy, Solar Product: International Solar Consulting works with large commercial and...

459

Econergy Brasil Ltda | Open Energy Information  

Open Energy Info (EERE)

Brasil Ltda Jump to: navigation, search Name: Econergy Brasil Ltda Place: Sao Paulo, Brazil Zip: 01243-020 Sector: Services Product: A consultancy firm providing technical and...

460

Abengoa Bioenergia Brasil | Open Energy Information  

Open Energy Info (EERE)

Brasil Jump to: navigation, search Name: Abengoa Bioenergia Brasil Place: Sao Paulo, Sao Paulo, Brazil Zip: 04551-060 Product: Brazilian-based ethanol producer, subsidiary of...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Energia Regenerativa Brasil Ltda ERB | Open Energy Information  

Open Energy Info (EERE)

Regenerativa Brasil Ltda ERB Jump to: navigation, search Name: Energia Regenerativa Brasil Ltda. (ERB) Place: Porto Alegre, Rio Grande do Sul, Brazil Zip: 91170-240 Sector: Wind...

462

Kyocera Solar do Brasil | Open Energy Information  

Open Energy Info (EERE)

Brasil Jump to: navigation, search Name: Kyocera Solar do Brasil Place: Riode Janeiro, Rio de Janeiro, Brazil Zip: 22790-200 Sector: Services, Solar Product: Brazilian based...

463

Utah State Parks and Recreation | Open Energy Information  

Open Energy Info (EERE)

Recreation Jump to: navigation, search Name: Utah State Parks and Recreation Address: 1594 W North Temple, Suite 116 Place: Salt Lake City, Utah Zip: 84116 Phone Number:...

464

XRAY XRAY XRAY XRAY XRAY XRAY XRAY . DUKE UNIVERSITY HOSPITAL  

E-Print Network (OSTI)

of Birth Name __________________________________ City of Birth Address City _______________________________________________________________ City ____________________________________ State Zip Date of Birth _____________________________ Social _____________________________________________________________________ Address Phone # _______________________ Certificate # (usually SS#) Group

465

Viresco Energy | Open Energy Information  

Open Energy Info (EERE)

Place: Riverside, California Zip: 92507 Product: Company developing a modified gasification process References: Viresco Energy1 This article is a stub. You can help OpenEI...

466

GLASSTECH INC | Open Energy Information  

Open Energy Info (EERE)

search Name: GLASSTECH INC Place: Perrysburg, Ohio Zip: 43551 Sector: Buildings, Efficiency, Services, Solar, Vehicles Website: http:www.glasstech.comdefau References:...

467

Nextronex Energy Systems LLC | Open Energy Information  

Open Energy Info (EERE)

Systems LLC Address: 4400 Moline Martin Rd Place: Millbury, Ohio Zip: 43447-9401 Sector: Efficiency, Renewable Energy, Services, Solar Website: http:www.nextronex.comdefau...

468

Balloon Elica | Open Energy Information  

Open Energy Info (EERE)

de Campinas, 713 Campos Elseos Place: So Paulo, So Paulo Zip: 01201-001 Sector: Efficiency, Renewable Energy, Services, Solar, Wind energy Website: http:...

469

Beijing Sevenstar Electronics Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Sevenstar Electronics Co Ltd Jump to: navigation, search Name: Beijing Sevenstar Electronics Co., Ltd Place: Beijing Municipality, China Zip: 100016 Sector: Solar Product:...

470

Sanyo North America Co | Open Energy Information  

Open Energy Info (EERE)

California Zip: CA 92154 Product: Sanyo North America Co, a subsidiary of Japanese electronics manufacture Sanyo, overseas and supports the North American market, including...

471

Colorado Energy Office | Open Energy Information  

Open Energy Info (EERE)

Office Jump to: navigation, search Name: Colorado Energy Office Address: 1580 Logan Street, Suite 100 Place: Denver, CO Zip: 80203 Website: http:www.colorado.govenergy...

472

Colorado thermal spring water geothermometry (public dataset...  

Open Energy Info (EERE)

dataset) Jump to: navigation, search OpenEI Reference LibraryAdd to library General: Colorado thermal spring water geothermometry (public dataset) Abstract The zipped Excel file...

473

BLM Colorado State Office | Open Energy Information  

Open Energy Info (EERE)

Colorado State Office Abbreviation: Colorado Address: 2850 Youngfield Street Place: Lakewood, CO Zip: 80215 Phone Number: 303-239-3600 ParentHolding Organization: Bureau of Land...

474

Blendstar LLC | Open Energy Information  

Open Energy Info (EERE)

LLC Place: The Woodlands, Texas Zip: 77380 Product: Houston-based operator of ethanol blending and terminal facilities in Tennessee, Kentucky, Oklahoma, Arkansas, Alabama,...

475

Transmediair Inc | Open Energy Information  

Open Energy Info (EERE)

Inc Place: Hillsborough, New Jersey Zip: 08844-1919 Product: New Jersey-based ethanol producer. References: Transmediair, Inc1 This article is a stub. You can help...

476

Central Indiana Ethanol LLC | Open Energy Information  

Open Energy Info (EERE)

Central Indiana Ethanol LLC Jump to: navigation, search Name: Central Indiana Ethanol LLC Place: Marion, Indiana Zip: 46952 Product: Ethanol producer developina a 151 mlpa plant in...

477

Southridge Enterprises | Open Energy Information  

Open Energy Info (EERE)

Enterprises Place: Dallas, Texas Zip: 75219 Product: Holding company for Southridge Ethanol. References: Southridge Enterprises1 This article is a stub. You can help OpenEI by...

478

Sioux River Ethanol LLC | Open Energy Information  

Open Energy Info (EERE)

Sioux River Ethanol LLC Jump to: navigation, search Name: Sioux River Ethanol LLC Place: Hudson, South Dakota Zip: 57034 Product: Farmer owned ethanol producer, Sioux River Ethanol...

479

US Ethanol Vehicle Coalition | Open Energy Information  

Open Energy Info (EERE)

Ethanol Vehicle Coalition Jump to: navigation, search Name: US Ethanol Vehicle Coalition Place: Jefferson City, Missouri Zip: 65109 Product: The National Ethanol Vehicle Coalition...

480

Ethanol Capital Management | Open Energy Information  

Open Energy Info (EERE)

Management Jump to: navigation, search Name: Ethanol Capital Management Place: Tucson, Arizona Zip: 85711 Product: Manages funds investing in Ethanol plants in the US Coordinates:...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Evergreen Securities formerly Ethanol Investments | Open Energy...  

Open Energy Info (EERE)

Securities formerly Ethanol Investments Jump to: navigation, search Name Evergreen Securities (formerly Ethanol Investments) Place London, England, United Kingdom Zip EC2V 5DE...

482

Dakota Ethanol | Open Energy Information  

Open Energy Info (EERE)

Dakota Ethanol Jump to: navigation, search Name: Dakota Ethanol Place: Wentworth, South Dakota Zip: 57075 Product: Farmer Coop owner of a 189m litres per year ethanol plant...

483

Trillium FiberFuels Inc | Open Energy Information  

Open Energy Info (EERE)

Inc Place: Corvallis, Oregon Zip: 97333 Product: Oregon-based biochemical cellulosic ethanol technology developer. References: Trillium FiberFuels Inc1 This article is a stub....

484

Agri Ethanol Products LLC AEPNC | Open Energy Information  

Open Energy Info (EERE)

Agri Ethanol Products LLC AEPNC Jump to: navigation, search Name: Agri-Ethanol Products LLC (AEPNC) Place: Raleigh, North Carolina Zip: 27615 Product: Ethanol producer and project...

485

Great Plains Ethanol | Open Energy Information  

Open Energy Info (EERE)

Great Plains Ethanol Jump to: navigation, search Name: Great Plains Ethanol Place: Chancellor, South Dakota Zip: 57015 Product: Limited liability company owned by its 500 members...

486

MissionPoint Capital Partners | Open Energy Information  

Open Energy Info (EERE)

Norwalk, Connecticut Zip: CT 06854 Product: Private Investment company capitalizing on clean energy technology and increasing capacity. Coordinates: 43.83033, -90.622007...

487

Applied Intellectual Capital AIC | Open Energy Information  

Open Energy Info (EERE)

Zip: 94501-1010 Product: Applied Intellectual Capital (AIC) was founded in 1999 to fund technology development in clean energy, clean water and sustainable resources. References:...

488

Westly Group | Open Energy Information  

Open Energy Info (EERE)

navigation, search Name: Westly Group Place: Menlo Park, California Zip: 94025 Product: Clean technology-oriented venture capital firm. References: Westly Group1 This article...

489

Energex Pellet Fuel Inc | Open Energy Information  

Open Energy Info (EERE)

Energex Pellet Fuel Inc Jump to: navigation, search Name: Energex Pellet Fuel Inc. Place: Mifflintown, Pennsylvania Zip: 17059 Product: Pellets producer with a capacity of 200,000...

490

APowerCap Technologies | Open Energy Information  

Open Energy Info (EERE)

Technologies Jump to: navigation, search Name: APowerCap Technologies Place: Chaiki, Ukraine Zip: 8130 Product: APCT develops breakthrough ultracapacitor-based power modules for...

491

Sai Renewable Power Pvt Ltd SRPPL | Open Energy Information  

Open Energy Info (EERE)

Renewable Power Pvt Ltd SRPPL Jump to: navigation, search Name: Sai Renewable Power Pvt. Ltd. (SRPPL) Place: Hyderabad, Andhra Pradesh, India Zip: 500 020 Sector: Biomass Product:...

492

Astonfield Renewable Resources Ltd ARRL | Open Energy Information  

Open Energy Info (EERE)

Astonfield Renewable Resources Ltd ARRL Jump to: navigation, search Name: Astonfield Renewable Resources Ltd. (ARRL) Place: New York, New York Zip: 10017 Sector: Biomass, Solar...

493

Switchpower | Open Energy Information  

Open Energy Info (EERE)

Sweden Zip: 102 41 Sector: Wind energy Product: Switchpower delivers turn-key photovoltaic (PV) power systems and modern wind turbine generators to private customers,...

494

Sustainable Spaces Inc | Open Energy Information  

Open Energy Info (EERE)

Spaces Inc Jump to: navigation, search Name: Sustainable Spaces Inc. Place: San Francisco, California Zip: 94103 Sector: Carbon Product: California-based provider of energy audits...

495

California Center for Sustainable Energy CCSE | Open Energy Informatio...  

Open Energy Info (EERE)

CCSE Jump to: navigation, search Name: California Center for Sustainable Energy (CCSE) Place: San Diego, California Zip: 92123 Product: California-based technical assistance and...

496

Aeronautica Windpower LLC | Open Energy Information  

Open Energy Info (EERE)

Aeronautica Windpower LLC Jump to: navigation, search Name: Aeronautica Windpower LLC Place: Plymouth, Massachusetts Zip: 23600 Sector: Services, Wind energy Product: String...

497

Bee Cool Inc | Open Energy Information  

Open Energy Info (EERE)

North Ferrisburg, Vermont Zip: Vt 05473 Sector: Solar Product: Producer of polysilicon solar panels and solar trackers, and solar battery chargers. References: Bee Cool Inc1...

498

Shinepower | Open Energy Information  

Open Energy Info (EERE)

Place: Zhejiang Province, China Zip: 317600 Sector: Solar Product: Manufacturer in mini solar panels, solar cell modules. References: Shinepower1 This article is a stub. You...

499

Ferven Technologia | Open Energy Information  

Open Energy Info (EERE)

Madrid, Spain Zip: 28035 Sector: Solar Product: Madrid-based distributor and supplier of solar panels. References: Ferven Technologia1 This article is a stub. You can help...

500

Southwest Wind Farm Private Limited ESS ARR Group | Open Energy...  

Open Energy Info (EERE)

Private Limited ESS ARR Group Jump to: navigation, search Name: Southwest Wind Farm Private Limited (ESS ARR Group) Place: Coimbatore, Tamil Nadu, India Zip: 641402 Sector: Wind...