Powered by Deep Web Technologies
Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Social capital and participatory slum upgrading in Bangkok, Thailand  

E-Print Network [OSTI]

t i o n …………………… … … … … … … . . 39 Figure 3.2: A summary of the commun i t y partici p a t i o n paradig m ………………. . 42 Figure 3.3: The hierarc h i c a l oper ation of social capital …………………………... 49 Figure 3.4: Indicat o r s of social capital... the Baan Mankong (“secure housing”) programme in Bangkok. The Baan Mankong progra m me uses commun i t y par tic i p a t i o n to meet the housin g needs of the urban poor, with finan c i a l assis t a nc e from the state . Sin ce starti n g in 2003...

Archer, Diane

2010-02-09T23:59:59.000Z

2

Conference Paper for Electricity Industry in Transition: Issues and Prospects for Asia, Bangkok, Thailand, Jan. 14-16, 2004. 2003 Dennis Ray and Frank Wayno  

E-Print Network [OSTI]

and Education in a Transitioning Electric Power Industry Dennis Ray Executive Director Power Systems EngineeringConference Paper for Electricity Industry in Transition: Issues and Prospects for Asia, Bangkok University fjw2@cornell.edu Abstract The electric supply industry is in transition from its traditional

3

Open to the public! : a new network of communal recreation waterfront space in Bangkok  

E-Print Network [OSTI]

Physically and historically, Bangkok has been shaped by its relationship to its waterfront. Flowing 370 kilometers through Thailand, the Chao Phraya River is more than the nation's lifeline. It was a principal waterway ...

Srirojanapinyo, Apichart

2009-01-01T23:59:59.000Z

4

Bangkok, Thailand: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo Feng Bio Jump to:Ayuda:PalabrasBadema

5

Thailand natural-gas project moves ahead  

SciTech Connect (OSTI)

The longest offshore pipeline currently under construction in the world is the 264-mile 34-in. submarine transmission line connecting Union Oil's natural gas production platform in the Gulf of Thailand to the 99-mile 28-in. onshore pipeline being laid from the landfall point to Bangkok. The entire facility will be operating by Sept. 15, 1981. Custody of the gas will be transferred to the Petroleum Authority of Thailand (PTT) at the platform; the gas will pass through a dewpoint-control unit at the shoreline near Rayong and to a mainline pressure-regulation and odor-injection station before it is delivered to the Electricity Generation Authority of Thailand (EGAT) at two power plants, Bang Pakong and South Bangkok.

Knapp-Fisher, R.N.; Paritpokee, S.

1981-02-09T23:59:59.000Z

6

Transport growth in Bangkok: Energy, environment, and traffic congestion. Workshop proceedings  

SciTech Connect (OSTI)

Bangkok, the capital of Thailand, is a physically and economically complexcity with a complicated transport system. With daily traffic congestion averaging 16 hours, the air quality is such that to breathe street level pollution for 8 eight hours is roughly equivalent to smoking nine cigarettes per day. Estimates suggest idling traffic costs up to $1.6 billion annually. Energy use within the transport sector is on a steady rise with an estimated increase in 11 years of two and one half times. Severe health impacts have begun to effect many residents - young children and the elderly being particularly vulnerable. Bangkok`s air quality and congestion problems are far from hopeless. Great potential exists for Bangkok to remedy its transport-related problems. The city has many necessary characteristics that allow an efficient, economical system of transport. For example, its high density level makes the city a prime candidate for an efficient system of mass transit and the multitude and close proximity of shops, street vendors, restaurants, and residential areas is highly conducive to walking and cycling. Technical knowledge and capacity to devise and implement innovative policies and projects to address air quality and congestion problems is plentiful. There is also consensus among Bangkokians that something needs to be done immediately to clear the air and the roads. However, little has been done. This report proposes a new approach to transport planning for Bangkok that integrates consideration of ecological, social, and financial viability in the process of making decisions regarding managing existing infrastructure and investments in new infrastructure. Selected papers have been indexed separately for inclusion in the Energy Science and Technology Database.

Philpott, J. [Asia Regional Office, Bangkok (Thailand)

1995-07-01T23:59:59.000Z

7

Thailand gas project now operational  

SciTech Connect (OSTI)

Now operational, Phase 1 of Thailand's first major natural gas system comprises one of the world's longest (264 miles) offshore gas lines. Built for the Petroleum Authority of Thailand (PTT), this system delivers gas from the Erawan field in the Gulf of Thailand to two electrical power plants near Bangkok, operated by the Electricity Generating Authority of Thailand (EGAT). The project required laying about 360 miles of pipeline, 34-in., 0.625 in.-thick API-5LX-60 pipe offshore and 28-in., 0.406 in.-thick API-5LX-60 onshore. The offshore pipe received a coal-tar coating, a 3.5-5.0 in. concrete coating, and zinc sacrificial-anode bracelets. The onshore line was coated with the same coal-tar enamel and, where necessary, with concrete up to 4.5 in. thick. Because EGAT's two power plants are the system's only customers, no more pipeline will be constructed until deliveries, currently averaging about 100 million CF/day, reach the 250 million CF/day level. The project's second phase will include additional pipelines as well as an onshore distribution network to industrial customers.

Horner, C.

1982-08-01T23:59:59.000Z

8

Measurement of genotoxic air pollutant exposures in street vendors and school children in and near Bangkok  

SciTech Connect (OSTI)

The effects of air pollution on human health are a great concern, particularly in big cities with severe traffic problems such as Bangkok, Thailand. In this study, exposure to genotoxic compounds in ambient air was studied by analysis of particle-associated polycyclic aromatic hydrocarbons (PAHs) and benzene through direct measurement of concentrations in air as well as through the use of different biomarkers of exposure: urinary 1-hydroxypyrene (1-OHP) for PAHs and urinary t,t-muconic acid (t,t-MA) for benzene. The study was conducted in various susceptible groups of the population with different occupations in 5 traffic-congested areas of Bangkok, as well as in primary school children. The level of total PAHs on the main roads at various sites ranged from 7.10 to 83.04 ng/m{sup 3}, while benzene levels ranged from 16.35 to 49.25 ppb. In contrast, ambient levels in nearby temples, the control sites, ranged from 1.67 to 3.04 ng/m{sup 3} total PAHs and 10.16 to 16.25 ppb benzene. Street vendors selling clothes were exposed to 16.07 {+-} 1.64 ng/m{sup 3} total PAHs and 21.97 {+-} 1.50 ppb benzene, levels higher than in monks and nuns residing in nearby temples (5.34 {+-} 0.65 ng/m{sup 3} total PAHs and 13.69 {+-} 0.77 ppb benzene). Grilled-meat vendors in the same area were exposed to both total PAHs and benzene at even higher levels, possibly due to additional formation of PAHs during the grilling of meat (34.27 {+-} 7.02 ng/m{sup 3} total PAHs; 27.49 {+-} 2.72 ppb benzene). At the end of the workday, urinary 1-OHP levels in street vendors (0.12 and 0.15 {mu}mol/mol creatinine in clothes and grilled-meat vendors, respectively) were significantly higher than in controls (0.04 {mu}mol/mol creatinine; P < 0.01). Afternoon urinary t,t-MA levels in both groups of street vendors (0.12 mg/g creatinine) were also significantly higher than in controls (0.08 mg/g creatinine; P < 0.05). School children from two schools in Bangkok were exposed to total PAHs and benzene at levels of 6.70 {+-} 0.47 ng/m{sup 3} and 4.71 {+-} 0.25 ppb, respectively, higher than those to which children living outside the city were exposed (1.25 {+-} 0.24 ng/m{sup 3} total PAHs; 2.10 {+-} 0.16 ppb benzene). At the end of the school day, levels of urinary 1-OHP and t,t-MA were significantly higher (P < 0.001 and P < 0.01, respectively) in Bangkok school children (0.23 {mu}mol/mol creatinine and 0.27 mg/g creatinine, respectively) than in school children from outside Bangkok (0.10 {mu}mol/mol creatinine and 0.08 mg/g creatinine, respectively)

Ruchirawat, Mathuros [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand) and Department of Pharmacology, Faculty of Science, Mahidol University, Bangkok 10400 (Thailand)]. E-mail: mathuros@tubtim.cri.or.th; Navasumrit, Panida [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand); Settachan, Daam [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand); Tuntaviroon, Jantamas [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand); Buthbumrung, Nantaporn [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand); Sharma, Suman [Laboratory of Environmental Toxicology, Chulabhorn Research Institute, Bangkok 10210 (Thailand)

2005-08-07T23:59:59.000Z

9

Thailand's downstream projects proliferate  

SciTech Connect (OSTI)

Thailand continues to press expansion and modernization of its downstream sector. Among recent developments: Construction of an olefins unit at Thailand's second major petrochemical complex and a worldscale aromatics unit in Thailand is threatened by rising costs. Thailand's National Petrochemical Corp (NPC) let a 9 billion yen contract to Mitsui Engineering and Shipbuilding Co. and C. Itoh and Co. for a dual fuel cogeneration power plant at its Mab Ta Phud, Rayong province, petrochemical complex. Financing is in place to flash a green light for a $530 million Belgian-Thai joint venture sponsoring a worldscale polyvinyl chloride/vinyl chloride monomer plant in Thailand. Work is more than 50% complete on the $345 million second phase expansion of Thai Oil's Sri Racha refinery in Chon Buri province. Petroleum Authority of Thailand (PTT) endorsed a plan to install two more natural gas processing plants in Thailand to meet rapidly growing domestic demand for petroleum gas.

Not Available

1991-06-03T23:59:59.000Z

10

The commercial feasibility of underground coal gasification in southern Thailand  

SciTech Connect (OSTI)

Underground Coal Gasification (UCG) is a clean coal technology with the commercial potential to provide low- or medium-Btu gas for the generation of electric power. While the abundance of economic coal and natural gas reserves in the United States of America (USA) has delayed the commercial development of this technology in the USA, potential for commercial development of UCG-fueled electric power generation currently exists in many other nations. Thailand has been experiencing sustained economic growth throughout the past decade. The use of UCG to provide electric power to meet the growing power demand appears to have commercial potential. A project to determine the commercial feasibility of UCG-fueled electric power generation at a site in southern Thailand is in progress. The objective of the project is to determine the commercial feasibility of using UCG for power generation in the Krabi coal mining area located approximately 1,000 kilometers south of Bangkok, Thailand. The project team has developed a detailed methodology to determine the technical feasibility, environmental acceptability, and commercial economic potential of UCG at a selected site. In the methodology, hydrogeologic conditions of the coal seam and surrounding strata are determined first. These results and information describing the local economic conditions are then used to assess the commercial potential of the UCG application. The methodology for evaluating the Krabi UCG site and current project status are discussed in this paper.

Solc, J.; Young, B.C.; Harju, J.A.; Schmit, C.R. [Univ. of North Dakota, Grand Forks, ND (United States). Energy and Environmental Research Center; Boysen, J.E. [B.C. Technologies, Ltd., Laramie, WY (United States); Kuhnel, R.A. [IIASES, Delft (Netherlands)

1996-12-31T23:59:59.000Z

11

Evaluating the feasibility of underground coal gasification in Thailand  

SciTech Connect (OSTI)

Underground coal gasification (UCG) is a clean coal technology that converts in situ coal into a low- to medium-grade product gas without the added expense of mining and reclamation. Potential candidates for UCG are those coal resources that are not economically recoverable or that are otherwise unacceptable for conventional coal utilization processes. The Energy and Environmental Research Center (EERC), through the sponsorship of the US Trade and Development Agency and in collaboration with the Electricity Generating Authority of Thailand (EGAT), is undertaking a feasibility study for the application of UCG in the Krabi coal mining area, 620 miles south of Bangkok in Thailand. The EERC`s objective for this project is to determine the technical, environmental, and economic feasibility of demonstrating and commercializing UCG at a selected site in the Krabi coal mining area. This paper addresses the preliminary developments and ongoing strategy for evaluating the selected UCG site. The technical, environmental, and economic factors for successful UCG operation are discussed, as well as the strategic issues pertaining to future energy expansion in southern Thailand.

Young, B.C.; Harju, J.A.; Schmit, C.R.; Solc, J. [Univ. of North Dakota, Grand Forks, ND (United States). Energy and Environmental Research Center; Boysen, J. [B.C. Technologies, Ltd., Laramie, WY (United States); Kuehnel, R.A. [International Inst. for Aerospace Survey and Earth Sciences, Delft (Netherlands)

1996-12-31T23:59:59.000Z

12

Global Network Kyoto University has opened a new center in Bangkok, Thailand, dedicated to supporting research,  

E-Print Network [OSTI]

to supporting research, education, and international collaborations across the ASEAN region. To mark the launch of these activities, an official opening ceremony and a symposium titled "Kyoto University in ASEAN -- Past, Present, government, and industry from ASEAN member states and Japan convened at the opening ceremony

Takada, Shoji

13

Reinventing flexibility : a hybrid paradigm for Thai markets in Bangkok, Thailand  

E-Print Network [OSTI]

This thesis asserts that the current form of the proliferating modernization of Thai markets in terms of economic growth and the incorporation of building technology to improve goods storage, attractive envelope, and ...

Pattamasattayasonthi, Ekachai

2011-01-01T23:59:59.000Z

14

Holistic Approach for Water Management Planning of Nong Chok District in Bangkok, Thailand  

E-Print Network [OSTI]

of “Monkey Cheeks” as wildlife habitat ? Treatment WetlandThe treatment wetland is used to manage stormwater runoffhabitat. walkway treatment wetland walkway Figure 35: Cross-

Suksawang, Wilasinee

2012-01-01T23:59:59.000Z

15

Thailand's gas line underway: coating a major achievement  

SciTech Connect (OSTI)

Using primarily local personnel and materials, Bredero Price International's Thai pipe-coating plant has prepared some 374 miles of 34 and 28-in. pipe for service in the Gulf of Thailand gas-pipeline project. The enamel-coating shop cleaned, primed and coated all the pipe with coal-tar enamel, glass-fiber mat, felt, and a kraft-paper outer wrap; the cement-coating facility then added a concrete-weight coating to the portion of the pipe earmarked for offshore duty. Scheduled for a 1981 completion, the pipeline will initially carry 250 million CF/day to power-generating plants in Bangpakong and South Bangkok; the volume transported will eventually reach 500 million CF/day when addition offshore production is tied in to the line and an offshore compressor station added.

Hale, D.

1980-12-01T23:59:59.000Z

16

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

17

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

18

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

19

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

20

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

22

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

23

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

24

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

25

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

26

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

27

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

28

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

29

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

30

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

31

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

32

Limits of isotropic plastic deformation of Bangkok clay  

E-Print Network [OSTI]

A model assuming incremental plastic isotropic response has been recently proposed to model the deformation of isotropic packing of grains, in the small-strain range. It is used here on over-consolidated remould clay, to interpret the small-strain range behaviour obtained in [1,2] on Bangkok clay. The data published in [1,2] at constant volume are also used here to measure the size of the domain of validity in the (q/(M'p), p/po) plane, where po is the over-consolidation isotropic pressure, p is the mean stress and q the deviatoric stress, q . So, it is shown that the model works also for clay. This enlarges the application domain of model [3,4] to soft clay with OCR larger than 1.2 to 1.5. Pacs # : 45.70.-n ; 62.20.Fe ; 83.80.Fg, 83.80.Hj

P. Evesque

2005-07-08T23:59:59.000Z

33

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

34

E-Print Network 3.0 - airport land reclamation Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AirportAirport Suvarnabhumi Airport... ,Suvarnabhumi Airport, Bangkok, ThailandBangkok, Thailand 12;OverviewOverview Magnitudes and Financing... -- Land purchased inLand...

35

Microsoft Word - NETL-TRS-4-2014_CO2 Storage and Enhanced Gas...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Conference, Bangkok, Thailand, Feb 7-9, 2011; SPE, Gaffney, Cline & Associates: Bangkok, Thailand, 2011. Ghaith, A.; Chen, W.; Ortoleva, P. Oscillatory methane release from shale...

36

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

37

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

38

Southeast Asia and Kyoto University  

E-Print Network [OSTI]

, Kyoto University opened its ASEAN Center in Bangkok, Thailand (p.11), the latest development in over

Takada, Shoji

39

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

40

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

UC International Internships (Thailand and Indonesia)  

E-Print Network [OSTI]

UC International Internships (Thailand and Indonesia) The University of Canterbury is pleased in Indonesia and Thailand over this summer break (2013-2014). There will be an information session on Tuesday will be expected to participate in. For Indonesia, students will help Indonesian students coming to UC for the next

Hickman, Mark

42

From comfort to kilowatts: An integrated assessment of electricity conservation in Thailand's commercial sector  

SciTech Connect (OSTI)

Thailand serves as a case study of the potential to conserve electricity in the fast-growing commercial sectors of the tropical developing world. We performed a field study of over 1100 Thai office workers in which a questionnaire survey and simultaneous physical measurements were taken. Both air-conditioned and non-air-conditioned buildings were included. We analyzed Thai subjective responses on the ASHRAE, McIntyre and other rating scales, relating them to Effective Temperature, demographics, and to rational indices of warmth such as PMV and TSENS. These results suggest that without sacrificing comfort, significant energy conservation opportunities exist through the relaxation of upper space temperature limits. To investigate the potential for conserving energy in a cost-effective manner, we performed a series of parametric simulations using the DOE-2.1D computer program on three commercial building prototypes based on actual buildings in Bangkok; an office, a hotel, and a shopping center. We investigated a wide range of energy conservation measures appropriate for each building type, from architectural measures to HVAC equipment and control solutions. The best measures applied in combination into high efficiency cases can generate energy savings in excess of 50%. Economic analyses performed for the high efficiency cases, resulted in costs of conserved energy of less than and internal rates of return in excess of 40%. Thermal cool storage, cogeneration, and gas cooling technology showed promise as cost-effective electric load management strategies.

Busch, J.F. Jr.

1990-08-01T23:59:59.000Z

43

Thailand | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartmentNationalRestart of the Review of theOFFICE OF CIVIL to ModAdministrationThailand

44

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

45

Thailand  

National Nuclear Security Administration (NNSA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartmentNationalRestart of the Reviewwill help prepare local studentsEJ/EK EN V

46

An Update on Ethanol Production and Utilization in Thailand  

SciTech Connect (OSTI)

Thailand has continued to promote domestic biofuel utilization. Production and consumption of biofuel in Thailand have continued to increase at a fast rate due to aggressive policies of the Thai government in reducing foreign oil import and increasing domestic renewable energy utilization. This paper focuses on ethanol production and consumption, and the use of gasohol in Thailand. The paper is an update on the previous paper--Biofuel Infrastructure Development and Utilization in Thailand--in August 2008.

Bloyd, Cary N.

2009-10-01T23:59:59.000Z

47

US fossil fuel technologies for Thailand  

SciTech Connect (OSTI)

The US Department of Energy has been encouraging other countries to consider US coal and coal technologies in meeting their future energy needs. Thailand is one of three developing countries determined to be a potentially favorable market for such exports. This report briefly profiles Thailand with respect to population, employment, energy infrastructure and policies, as well as financial, economic, and trade issues. Thailand is shifting from a traditionally agrarian economy to one based more strongly on light manufacturing and will therefore require increased energy resources that are reliable and flexible in responding to anticipated growth. Thailand has extensive lignite deposits that could fuel a variety of coal-based technologies. Atmospheric fluidized-bed combustors could utilize this resource and still permit Thailand to meet emission standards for sulfur dioxide. This option also lends itself to small-scale applications suitable for private-sector power generation. Slagging combustors and coal-water mixtures also appear to have potential. Both new construction and refurbishment of existing plants are planned. 18 refs., 3 figs., 7 tabs.

Buehring, W.A.; Dials, G.E.; Gillette, J.L.; Szpunar, C.B.; Traczyk, P.A.

1990-10-01T23:59:59.000Z

48

Using a Constant Volume Displacement Ventilation System to Create a Micro Climate in a Large Airport Terminal in Bangkok  

E-Print Network [OSTI]

In order to conserve energy and create a comfortable climate for both passengers and workers at a new large international airport in Thailand, a design concept was created where only the first 2m above the occupied zone is conditioned...

Simmonds, P.; Gaw, W.

1996-01-01T23:59:59.000Z

49

The effectiveness of jobs-housing balance as a strategy for reducing traffic congestion: a study of metropolitan Bangkok  

E-Print Network [OSTI]

of Thailand. Travel time index (TTI) was developed to measure congestion. In addition to JHB, a number of land use variables were included in the analysis. They are population density, school density, and job accessibility index. Multiple regression models...

Lobyaem, Sonchai

2006-10-30T23:59:59.000Z

50

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

51

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

52

Combined cycle meets Thailand's growing power demands  

SciTech Connect (OSTI)

This article describes how an ample supply of natural gas led the Electricity Generating Authority of Thailand (EGAT) to choose gas-fired combustion turbines. Thailand's rapid industrialization, which began in the late 1980's, placed a great strain on the country's electricity supply system. The demand for electricity grew at an astonishing 14% annually. To deal with diminishing reserve capacity margins, the EGAT announced, in 1988, a power development program emphasizing gas-fired combined cycle power plants. Plans included six 320-MW combined cycle blocks at three sites, and an additional 600-MW gas- and oil-fired thermal plant at Bang Pakong. As electricity demand continued to increase, EGAT expanded its plans to include two additional 320-MW combined cycle blocks, a 600-MW combined cycle block, and a 650-MW gas- and oil-fired thermal plant. All are currently in various stages of design and construction.

Sheets, B.A. (Black and Veatch, Kansas City, MO (United States)); Takabut, K. (Electricity Generating Authority of Thailand, Nonthaburi (Thailand))

1993-08-01T23:59:59.000Z

53

From the Constitution to the Hospital: Universal Health Care in Thailand   

E-Print Network [OSTI]

in Implementing Quality Management Systems in Thailand: Asystem requires accredited hospitals to apply Total Quality Management (

Mattison, Shawn

2007-01-01T23:59:59.000Z

54

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

55

Natural ventilation : design for suburban houses in Thailand  

E-Print Network [OSTI]

Natural Ventilation is the most effective passive cooling design strategy for architecture in hot and humid climates. In Thailand, natural ventilation has been the most essential element in the vernacular architecture such ...

Tantasavasdi, Chalermwat, 1971-

1998-01-01T23:59:59.000Z

56

High Performance Computing: Needs and Application for Thailand  

E-Print Network [OSTI]

This paper presents the overview of High Performance Computing, the required components, and its applications. Current state of the HPC researches and facilities in Thailand has also been reviewed along with the HPC related research conducted in Kasetsart University. In summary, HPC is a technology that has an impact on Thailand competitiveness. Yet, much more qualifed man-power and broader recognition of the field are desparately needed.

Yuen Poovarawan Putchong; Putchong Uthayopas

1997-01-01T23:59:59.000Z

57

Petroleum resources of Indonesia, Malaysia, Brunei, and Thailand  

SciTech Connect (OSTI)

This report presents estimates of the total recoverable crude oil from Indonesia, Malaysia, Brunei, and Thailand (Thailand is not currently an exporter of petroleum but is included because of its proximity to the South China Sea and its high petroleum potential). Also included is an analysis of potential future rates at which these resources could enter into world markets. However, this analysis does not take into account the possible supply of recoverable resources from nonconventional deposits such as tar sands and oil shale.

Not Available

1984-07-01T23:59:59.000Z

58

Energy and the economy: Soaring development in Thailand  

SciTech Connect (OSTI)

Thailand's economy is one of the fastest growing in the world. Spectacular economic growth has brought a number of growing pains, energy being one of the many notables. Thailand's growth campaign has been fueled by oil, and as the economy shows little sign of slowing, energy use continues to grow. The government must balance a surging economy while scrambling to maintain sufficient energy supplies and infrastructure.

Not Available

1993-08-25T23:59:59.000Z

59

An Update on Ethanol Production and Utilization in Thailand—2014  

SciTech Connect (OSTI)

In spite of the recent political turmoil, Thailand has continued to develop its ethanol based alternative fuel supply and demand infrastructure. Its support of production and sales of ethanol contributed to more than doubling the production over the past five years alone. In April 2014, average consumption stood at 3.18 million liter per day- more than a third on its way to its domestic consumption goal of 9 million liters per day by 2021. Strong government incentives and the phasing out of non-blended gasoline contributed substantially. Concurrently, exports dropped significantly to their lowest level since 2011, increasing the pressure on Thai policy makers to best balance energy independency goals with other priorities, such as Thailand’s trade balance and environmental aspirations. Utilization of second generation biofuels might have the potential to further expand Thailand’s growing ethanol market. Thailand has also dramatically increased its higher ethanol blend vehicle fleet, with all new vehicles sold in the Thai market now being E20 capable and the number of E85 vehicles increasing three fold in the last year from 100,000 in 2013 to 300,000 in 2014.

Bloyd, Cary N.; Foster, Nikolas AF

2014-09-01T23:59:59.000Z

60

Essays on Supply Chains Facing Competition from Gray Markets  

E-Print Network [OSTI]

University. Bangkok Post. 2010. BMW Thailand to No Longernews-amp-analysis/ bmw-thailand-no-longer-service-gray-2011b). Prior to Mercedes-Benz, BMW Thailand had decided to

Iravani, Foad

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

62

Kyoto University has launched a Japan-Thailand collaborative research  

E-Print Network [OSTI]

Kyoto University has launched a Japan-Thailand collaborative research project titled "Development of clean and efficient utilization of low rank coals and biomass by solvent treatment," supported biomass waste as well as low-rank coals into valuable products such as carbon fiber, biofuel, and high

Takada, Shoji

63

Natural Ventilation Design for Houses in Thailand Chalermwat Tantasavasdia  

E-Print Network [OSTI]

This paper explores the potential of using natural ventilation as a passive cooling system for new house windows in suburban houses can be opened. Passive cooling design elements are mostly ignored in modern1 Natural Ventilation Design for Houses in Thailand Chalermwat Tantasavasdia , Jelena Srebricb

Chen, Qingyan "Yan"

64

Analysis of Singularity Lines by Transforms with Parabolic Scaling  

E-Print Network [OSTI]

, Phyathai Road, Patumwan, Bangkok 10330, Thailand. (2) Department of Applied Mathematics, Lappeenranta University of Technology, Lappeenranta, Finland. panuvuth@hotmail.com, jouni.sampo@lut.fi, songkiat

Paris-Sud XI, Université de

65

E-Print Network 3.0 - ambient polycyclic aromatic Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Adducts in Mothers Summary: . Exposure to genotoxins present in ambient air in Bangkok, Thailand: particle associated polycyclic aromatic... DNA Damage from Polycyclic Aromatic...

66

E-Print Network 3.0 - ash financial aspects Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Conference on Fly Ash, Silica Fume, Slag, and Natural Pozzolans in Concrete, Bangkok, Thailand Source: Wisconsin-Milwaukee, University of - Department of Civil Engineering and...

67

E-Print Network 3.0 - advanced sequenching technology Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Gene... Engineering" at DNA Technology Laboratory, NSTDA, Kasetsart University, Bangkok, Thailand in 2002. 12 Source: Behmer, Spencer T. - Department of Entomology, Texas A&M...

68

Calibrating Artificial Neural Networks by Global Optimization  

E-Print Network [OSTI]

(2009) A global optimization study on the devolatilisation kinetics of coal, biomass and waste fuels. .... Proc. IEEE ISCAS, Bangkok, Thailand, May 2003, V725-728.

Janos Pinter

2010-07-21T23:59:59.000Z

69

E-Print Network 3.0 - ash separators Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Conference on Fly Ash, Silica Fume, Slag, and Natural Pozzolans in Concrete, Bangkok, Thailand Source: Wisconsin-Milwaukee, University of - Department of Civil Engineering and...

70

Development and analysis of a sustainable, low energy house in a hot and humid climate.  

E-Print Network [OSTI]

??This study examines the lifetime building energy consumption of a typical house in Bangkok, Thailand. The lifetime building energy consumption is composed of three major… (more)

Chulsukon, Pattarayut

2012-01-01T23:59:59.000Z

71

Dependency and development in northern Thailand's tourism industry  

E-Print Network [OSTI]

?s citizens and thus little real development taking place (Britton 1982; Khan 1997; Mbaiwa 2005; Milne 1987). Some scholars have argued that alternative forms of tourism such as backpacking, adventure tourism, cultural tourism, and ecotourism are better... opium production (Kampe 1997). In addition to substituting other cash crops for opium it is hoped that tourism can help replace the income generated by opium (Renard 2001). Tourism in Northern Thailand tends to focus more on ecotourism and cultural...

Lacher, Richard Geoffrey

2009-05-15T23:59:59.000Z

72

Evidence for cenozoic rifting in Thailand from gravity modeling  

E-Print Network [OSTI]

, the continental rift prc&pagated northward along a pre-existin ' zone of weakness in central 'Ihailand. I. PREVIOUS WORK Although geophysical exploration of Thailand and tlie Gulf of Thailaud was performccl priinarily for hydrocarbon and geothermal energy...). Most of these data have been collected froin ivater ivclls. oil wells, and mineral prospecting sites. Heat flow values exceeding 105 mH'/ni ' have been reported in the Fang oil field, San Hampaeng geothermal area. near Ghiang Mai in northern...

Ohnstad, Tiffany A.

2012-06-07T23:59:59.000Z

73

Thailand-Programme for Developing and Implementing a Climate Protection  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump Jump to: navigation,InformationThailand-NIESPolicy | Open

74

Adaptability Design to Meet Dynamic Customer's Needs N. Janthong1,2,3  

E-Print Network [OSTI]

's University of Technology North Bangkok (KMUTNB), Thailand 3 Thai-France Innovation Institute, King Mongkut's University of Technology North Bangkok (KMUTNB), Thailand Abstract - The customer is the core element to answer unexpected demand and to adapt to SMEs where resources are limited is now needed. Design

Paris-Sud XI, Université de

75

Appropriate technology water treatment processes for MaeLa Temporary Shelter, Thailand  

E-Print Network [OSTI]

This thesis recommends the use of horizontal-flow roughing filters to treat spring water of variable annual quality in MaeLa Temporary Shelter, Thailand. The public drinking water system for 45,000 refugees is overseen by ...

Vater, Katherine Ann

2008-01-01T23:59:59.000Z

76

The Great Equalizer: Health Care Access and Infant Mortality in Thailand  

E-Print Network [OSTI]

This paper analyzes Thailand's 2001 healthcare reform, "30 Baht." The program increased funding available to hospitals to care for the poor and reduced copays to 30 Baht (~$0.75). Our estimates suggest the supply-side ...

Gruber, Jonathan

77

The Development of Improved Energy Efficient Housing for Thailand Utilizing Renewable Energy Technology  

E-Print Network [OSTI]

SimBuild 2004, IBPSA-USA National Conference, Boulder, CO, August 4-6th, 2004, p. 1 THE DEVELOPMENT OF IMPROVED ENERGY EFFICIENT 1 HOUSING FOR THAILAND UTILIZING RENEWABLE ENERGY TECHNOLOGY 2 3... The paper reports on the results of research to reduce energy consumption in residential buildings in a hot and humid climate region (Thailand) using efficient architectural building components, energy efficient building systems, and renewable energy...

Rasisuttha, S.; Haberl, J.

78

Extensional tectonics in the Gulf of Thailand and South China Sea  

E-Print Network [OSTI]

EXTENSIONAL TECTONICS IN THE GULF OF THAILAND AND SOUTH CHINA SEA A Thesis by SUSAN MARIE MARSHALI. Submitted to the Office of Graduate Studies of Texas ARM University in partial fulfillment of the requhements for the degree of MASTER... OF SCIENCE AUGUST 1992 Major Subject: Geophysics EXTENSIONAL TECTONICS IN THE GULF OF THAILAND AND SOUTH CHINA SEA A Thesis by SUSAN MARIF MARSHALL Approved as to style and content by: Steven . H der (Chairman of Committee) Robert J. Mc...

Marshall, Susan Marie

1992-01-01T23:59:59.000Z

79

An Energy Overview of the Kingdom of Thailand  

SciTech Connect (OSTI)

The DOE Office of Fossil Energy is maintaining a web site that is meant to provide useful business- and energy-related information about countries and regions of the world for exporters, project developers, and researchers. The site consists of more than 130 country pages (organized into seven different world regions), with each country page having its own set of links to information sources about that country. There are also more than 30 Country Energy Overviews at the web site -- each of these is a comprehensive review of a specific country's entire energy situation, including sections on Energy Policy, Oil, Natural Gas, Coal, Hydroelectric/Renewables, Nuclear Power, Energy Transmission Infrastructure, Electricity, Electric Industry Overview, Environmental Activities, Privatization, Trade, and Economic Situation. The specific country highlighted in this Country Energy Overview is Thailand. The site is designed to be dynamic. Updates to the overviews will be made as need and resource s permit.

anon.

2003-10-20T23:59:59.000Z

80

Preparation and gasification of a Thailand coal-water fuel  

SciTech Connect (OSTI)

In response to an inquiry by the Department of Mineral Resources (DMR) in Thailand, the Energy and Environmental Research Center (EERC) prepared a four-task program to assess the responsiveness of Wiang Haeng coal to the temperature and pressure conditions of hot-water drying (HWD). The results indicate that HWD made several improvements in the coal, notably increases in heating value and carbon content and reductions in equilibrium moisture and oxygen content. The equilibrium moisture content decreased from 37.4 wt% for the raw coal to about 20 wt% for the HWD coals. The energy density, determined at 500 cP, indicates an increase from 4450 to 6650 Btu/lb by hydrothermal treatment. Raw and HWD coal were then gasified at various mild gasification conditions of 700 C and 30 psig. The tests indicated that the coal is probably similar to other low-rank coals and will produce high levels of hydrogen and be fairly reactive.

Ness, R.O. Jr.; Anderson, C.M.; Musich, M.A.; Richter, J.J.; Dewall, R.A.; Young, B.C. [Univ. of North Dakota, Grand Forks, ND (United States). Energy and Environmental Research Center; Nakanart, A. [Ministry of Industry, Bangkok (Thailand)

1996-12-31T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Oil shale and coal in intermontane basins of Thailand  

SciTech Connect (OSTI)

The Mae Tip intermontane basin contains Cenozoic oil shales in beds up to 1 m (3.3 ft) thick interbedded with coal and mudstone. The oil shales contain lamosite-type alginite, and give a maximum oil yield of 122 L/MT (29.3 gal/ton). The beds are laterally continuous for at least 1.5 km (1.0 mi), but pass into mudstones toward the basin margin. The oil shales originated when peat swamps close to a steep basin margin were flooded by shallow lakes, allowing algae to replace rooted vegetation. This distinctive oil shale-coal assemblage is known from many small intermontane basins in Thailand, where locally high geothermal gradients suggest potential for hydrocarbons.

Gibling, M.R.; Srisuk, S.; Ukakimaphan, Y.

1985-05-01T23:59:59.000Z

82

Area Study prior to Companion Modelling to Integrate Multiple Interests in Upper Watershed Management of Northern Thailand  

E-Print Network [OSTI]

Management of Northern Thailand C. Barnaud*, G. Trébuil**, P. Dumrongrojwatthana***, J. Marie**** * CU of northern Thailand have long been accused of degrading the upper watersheds of the country's major basins communities and state agencies, calling for the need for adapted participatory methodologies to facilitate

Boyer, Edmond

83

Fluidized bed combustor 50 MW thermal power plant, Krabi, Thailand. Feasibility study. Export trade information  

SciTech Connect (OSTI)

The report presents the results of a study prepared by Burns and Roe for the Electricity Generating Authority of Thailand to examine the technical feasibility and economic attractiveness for building a 50 MW Atmospheric Fluidized Bed Combustion lignite fired power plant at Krabi, southern Thailand. The study is divided into seven main sections, plus an executive summary and appendices: (1) Introduction; (2) Atmospheric Fluidized Bed Combustion Technology Overview; (3) Fuel and Limestone Tests; (4) Site Evaluation; (5) Station Design and Arrangements; (6) Environmental Considerations; (7) Economic Analysis.

Not Available

1993-01-01T23:59:59.000Z

84

A feasibility study for underground coal gasification at Krabi Mine, Thailand  

SciTech Connect (OSTI)

A study to evaluate the technical, economical, and environmental feasibility of underground coal gasification (UCG) in the Krabi Mine, Thailand, was conducted by the Energy and Environmental Research Center (EERC) in cooperation with B.C. Technologies (BCT) and the Electricity Generating Authority of Thailand (EGAT). The selected coal resource was found suitable to fuel a UCG facility producing 460,000 MJ/h (436 million Btu/h) of 100--125 Btu/scf gas for 20 years. The raw UCG gas could be produced for a selling price of $1.94/MMBtu. The UCG facility would require a total investment of $13.8 million for installed capital equipment, and annual operating expenses for the facility would be $7.0 million. The UCG gas could be either cofired in a power plant currently under construction or power a 40 MW simple-cycle gas turbine or a 60 MW combined-cycle power plant.

Solc, J.; Steadman, E.N. [Energy and Environmental Research Center, Grand Forks, ND (United States); Boysen, J.E. [BC Technologies, Laramie, WY (United States)

1998-12-31T23:59:59.000Z

85

Knowledge-based adaptable design to support customer-oriented production system of industrial equipments  

E-Print Network [OSTI]

Engineering, Faculty of Engineering, King Mongkut's University of Technology North Bangkok (KMUTNB), Thailand 3 Thai-France Innovation Center (TFIC), King Mongkut's University of Technology North Bangkok demand and to adapt to SMEs where resources are limited is now needed. Design adaptability refers

Paris-Sud XI, Université de

86

Atmos. Chem. Phys., 11, 97359747, 2011 www.atmos-chem-phys.net/11/9735/2011/  

E-Print Network [OSTI]

, National Institute of Development Administration, Bangkok, Thailand 5Acid Depositions and Oxidant Research the contribution from the large-scale domes- tic coal/biofuel combustion for heating. The BC-CO rela- tionship

Meskhidze, Nicholas

87

Thailand-NIES Low-Carbon Society Scenarios 2050 | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump Jump to: navigation,InformationThailand-NIES Low-Carbon

88

Thailand-National Energy Efficiency Plan and Evidence-based Mitigation  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump Jump to: navigation,InformationThailand-NIES

89

Perspectives on the institutional needs of joint implementation projects for China, Egypt, India, Mexico, and Thailand  

SciTech Connect (OSTI)

One avenue for reducing the net emissions of greenhouse gases (GHG) under the Framework Convention on Climate Change (FCCC) is the joint implementation (JI) of policies and projects to the Convention. Although debate on the practical aspects of JI projects is relatively young, it already includes issues concerning the ability of governments to accept JI projects as well as the project participants` capacity to monitor, evaluate, and verify the financial and GHG benefits. The focus of this paper is an in-depth, country-by-country analysis of current and conceivable institutions in potential host countries. To understand these concerns better, in August 1994 the authors asked colleagues in five developing countries to evaluate their countries` institutional capacity for JI projects. Their perspectives are presented here as individual country case studies. The five countries--Mexico, Egypt, Thailand, India, and China--were chosen because each has significant potential for JI projects.

Mabel, M.; Watt, E.; Sathaye, J. [eds.] [and others

1995-10-01T23:59:59.000Z

90

Reclamation planning and operation at the Mae Moh Lignite Mine, Thailand  

SciTech Connect (OSTI)

The Mae Moh Mine is a large open cut lignite mine situated in Northern Thailand. The mine produces lignite for coal fired power stations located adjacent to the mine. Current mine production is approximately 9 Mtpa providing lignite to eight power stations with a total output of 1,125 MW. The power development plan for Mae Moh provides for 19 power stations by the year 1999 which will require lignite production to be increased to 30.5 Mtpa and overburden will be mined at a rate approaching 300 Mtpa. Environmental management and reclamation planning at Mae Moh are major issues due to water quality impact and land use conflicts. This paper presents the key elements of the reclamation master plan and works strategy for progressive reclamation and water pollution control.

Miller, S.D. [Stuart D. Miller & Associates, Balmain (Australia); Teparat, C. [Electricity Generating Authority of Thailand, Mae Moh (Thailand)

1990-12-31T23:59:59.000Z

91

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

92

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

93

Water Footprints of Cassava- and Molasses-Based Ethanol Production in Thailand  

SciTech Connect (OSTI)

The Thai government has been promoting renewable energy as well as stimulating the consumption of its products. Replacing transport fuels with bioethanol will require substantial amounts of water and enhance water competition locally. This study shows that the water footprint (WF) of molasses-based ethanol is less than that of cassava-based ethanol. The WF of molasses-based ethanol is estimated to be in the range of 1,510-1,990 L water/L ethanol, while that of cassava-based ethanol is estimated at 2,300-2,820 L water/L ethanol. Approximately 99% of the water in each of these WFs is used to cultivate crops. Ethanol production requires not only substantial amounts of water but also government interventions because it is not cost competitive. In Thailand, the government has exploited several strategies to lower ethanol prices such as oil tax exemptions for consumers, cost compensation for ethanol producers, and crop price assurances for farmers. For the renewable energy policy to succeed in the long run, the government may want to consider promoting molasses-based ethanol production as well as irrigation system improvements and sugarcane yield-enhancing practices, since molasses-based ethanol is more favorable than cassava-based ethanol in terms of its water consumption, chemical fertilizer use, and production costs.

Mangmeechai, Aweewan, E-mail: aweewan.m@nida.ac.th [National Institute of Development Administration, International College (Major in Public Policy and Management) (Thailand)] [National Institute of Development Administration, International College (Major in Public Policy and Management) (Thailand); Pavasant, Prasert [Chulalongkorn University, Department of Chemical Engineering, Faculty of Engineering (Thailand)] [Chulalongkorn University, Department of Chemical Engineering, Faculty of Engineering (Thailand)

2013-12-15T23:59:59.000Z

94

Density equation of bio-coal briquettes and quantity of maize cob in Phitsanulok, Thailand  

SciTech Connect (OSTI)

One of the most important crops in Phitsanulok, a province in Northern Thailand, is maize. BaseD on the calculation, the quantity of maize cob produced in this region was approximately 220 kton year{sup -1}. The net heating value of maize cob was found to be 14.2 MJ kg{sup -1}. Therefore, the total energy over 874 TJ year-1 can be obtained from this agricultural waste. In the experiments, maize cob was utilized as the major ingredient for producing biomass-coal briquettes. The maize cob was treated with sodium hydroxide solution before mixing with coal fine. The ratios of coal:maize were 1:2 and 1:3, respectively. The range of briquetting pressures was from 4-8 MPa. The result showed that the density was strongly affected by both parameters. Finally, the relationship between biomass ratio, briquetting pressures and briquette density was developed and validated by using regression technique. 13 refs., 2 figs.

Patomsok Wilaipon [Naresuan University, Phitsanulok (Thailand). Department of Mechanical Engineering

2008-07-01T23:59:59.000Z

95

Preparation and combustion of coal-water fuel from the Sin Pun coal deposit, southern Thailand  

SciTech Connect (OSTI)

In response to an inquiry by the Department of Mineral Resources in Thailand, the Energy & Environmental Research Center (EERC) prepared a program to assess the responsiveness of Sin Pun lignite to the temperature and pressure conditions of hot-water drying. The results indicate that drying made several improvements in the coal, notably increases in heating value and carbon content and reductions in equilibrium moisture and oxygen content. The equilibrium moisture content decreased from 27 wt% for the raw coal to about 15 wt% for the hot-water-dried (HWD) coals. The energy density for a pumpable coal-water fuel (CWF) indicates an increase from 4500 to 6100 Btu/lb by hot-water drying. Approximately 650 lb of HWD Sin Pun CWF were fired in the EERC`s combustion test facility. The fuel burned extremely well, with no feed problems noted during the course of the test. Fouling and slagging deposits each indicated a very low rate of ash deposition, with only a dusty layer formed on the cooled metal surfaces. The combustor was operated at between 20% and 25% excess air, resulting in a flue gas SO{sub 2} concentration averaging approximately 6500 parts per million.

NONE

1997-05-01T23:59:59.000Z

96

Wiang Haeng coal-water fuel preparation and gasification, Thailand - task 39  

SciTech Connect (OSTI)

In response to an inquiry by the Department of Mineral Resources (DMR) in Thailand, the Energy & Environmental Research Center (EERC) prepared a four-task program to assess the responsiveness of Wiang Haeng coal to the temperature and pressure conditions of hot-water drying (HWD). The results indicate that HWD made several improvements in the coal, notably increases (HWD). The results indicate that HWD made several improvements in the coal, notably increases in heating value and carbon content and reductions in equilibrium moisture and oxygen content. The equilibrium moisture content decreased from 37.4 wt% for the raw coal to about 20 wt% for the HWD coals. The energy density for a pumpable coal-water fuel indicates an increase from 4450 to 6650 Btu/lb by hydrothermal treatment. Raw and HWD coal were then gasified at various mild gasification conditions of 700{degrees}C and 30 psig. The tests indicated that the coal is probably similar to other low-rank coals, will produce high levels of hydrogen, and be fairly reactive.

Anderson, C.M.; Musich, M.A.; Young, B.C. [and others

1996-07-01T23:59:59.000Z

97

Geochemistry and mineralogy of fly-ash from the Mae Moh lignite deposit, Thailand  

SciTech Connect (OSTI)

The concentration of 21 elements in fly ash from three boilers (75 MW, 150 MW, and 300 MW) at the EGAT power plant, Mae Moh, Thailand, were determined by INAA. The concentration of 10 major elements was determined by XRF. As, Co, Cr, Ni, Mo, and Sb generally increase in concentration going from bottom ash (BA) through the sequence of electrostatic precipitator ashes (ESPA) and reach maxima of As (352 ppm), Co (45 ppm), Cr (105 ppm), Mo (32 ppm), Ni (106 ppm), and Sb (15 ppm) in the ESPA. Ce, Cs, Fe, Hf, La, Sc, Ta, Tb, and Yb did not exhibit concentration trends or are variable except in the case of one boiler, which showed an increase going from BA to ESPA. Only Br decreased in composition going from BA to ESPA. Rb, Sm, U, and Th showed marked variation in trends. The major elements identified by EDS were Al, Si, S, K, Ca, Fe, and Ba, with minor amounts of Mg, Na, Ti, Mn, and Sr. Al, Si, K, and Ca occur together and are present in most of the fly-ash particles. Ba was found as a major component with Ca, Al, and Si. Fe and Ca are usually associated with sulfur. Some small spheres (< 5 {mu}m) are comprised almost entirely of Fe (probably as oxide). Symplectite textures are noted in high-Fe phases. All elements except Br are significantly enriched in the fly ash relative to the coal, which contains 35% ash. Particle chemistry is consistent with the major mineral phases identified by XRD, which include: quartz, magnetite, mullite, gehlenite, anorthite, hematite, anhydrite, and clinopyroxene.

Hart, B.R.; Powell, M.A.; Fyfe, W.S. [Univ. of Western Ontario, London, Ontario (Canada). Dept. of Geology; Ratanasthien, B. [Univ. of Chaing Mai (Thailand). Dept. of Geology

1995-01-01T23:59:59.000Z

98

Student-based archaeological geophysics in northern Thailand Emily A. Hinz*, Lee M. Liberty, and Spencer H. Wood, Boise State University, Fongsaward Singharajawarapan  

E-Print Network [OSTI]

Student-based archaeological geophysics in northern Thailand Emily A. Hinz*, Lee M. Liberty participants to evaluate the practicality and effectiveness of various geophysical techniques: seismic methods including refraction and reflection (not discussed here), ground- penetrating-radar (GPR), DC resistivity

Barrash, Warren

99

The distribution of ten trace elements and minerals in three lignite seams from the Mae Moh Mine, Thailand  

SciTech Connect (OSTI)

Understanding the association of major, minor and trace elements in lignites and their accompanying strata is important from a number of perspectives which include: potential health problems from environmental pollutants, rehabilitation after mining, combustion for power etc. The material which follows represents some preliminary observations on the mineralogy and distribution of 10 trace elements in lignites and accompanying sediments from the Mae Moh mine, Thailand. Samples collected from freshly exposed mine faces were air dried and analyzed for moisture and ash. Trace element concentrations were determined on {open_quotes}whole{close_quotes} coals and sediments by NAA and XRF. All chemical analyses are expressed as a fraction of the total dry sediment. Mineralogy of both LTA and sediments was determined by XRD. The chemistry and morphology of individual particles were examined by the Electron microprobe. The analyses are used to make some conclusions about the spatial occurrence of these elements within the seam and their partitioning between organic and inorganic phases.

Hart, B.; Powell, M.P.; Fyfe, W.S. [Univ. of Ontario (Canada)

1994-12-31T23:59:59.000Z

100

Feasibility study for underground coal gasification at the Krabi coal mine site, Thailand: Volume 1. Progress report, December 1--31, 1995; Export trade information  

SciTech Connect (OSTI)

The report, conducted by Energy and Environmental Research Center, was funded by the US Trade and Development Agency. The objective of this report was to determine the technical, environmental and economic feasibility of developing, demonstrating, and commercializing underground coal gasification (UCG) at the Krabi coal mine site in Southern Thailand. This is Volume 1, the Progress Report for the period December 1, 1995, through December 31, 1995.

Young, B.C.; Schmit, C.R.

1996-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

5, 183218, 2008 A rainfall forecast  

E-Print Network [OSTI]

HESSD 5, 183­218, 2008 A rainfall forecast model using Artificial Neural Network N. Q. Hung et al An artificial neural network model for rainfall forecasting in Bangkok, Thailand N. Q. Hung, M. S. Babel, S Geosciences Union. 183 #12;HESSD 5, 183­218, 2008 A rainfall forecast model using Artificial Neural Network N

Paris-Sud XI, Université de

102

Design Issues for Corebased Optoelectronic Chips: A Case Study of the WARRP Network Router  

E-Print Network [OSTI]

for harnessing the potential performance benefits of multiprocessor systems which use advanced architectural­579­7566 Electrical Engineering Dept., Kasetsart University, Jatujak, Bangkok 10900, THAILAND fengmkr@ku.ac.th http, is in the range of gigabytes per second and increasing. Conventional all­electrical interconnects are not keeping

Pinkston, Timothy M.

103

Biofuels in the ASEAN Low Emission Development Strategies (LEDS) Forum  

E-Print Network [OSTI]

9/20/2012 1 Biofuels in the ASEAN Low Emission Development Strategies (LEDS) Forum Bangkok, Thailand 19-21 September 2012 Biofuel Policy Group Asian Institute of Technology Outline of the Presentation 1. Objectives of this Presentation 2. Background 3. Status of Biofuel Development in ASEAN 4

104

An Examination of the Thermodynamics of Fusion, Vaporization, and Sublimation of Several Parabens by Correlation Gas  

E-Print Network [OSTI]

An Examination of the Thermodynamics of Fusion, Vaporization, and Sublimation of Several Parabens, Kasetsart University, Bangkane, Bangkok 10900, Thailand 2 Department of Chemistry and Biochemistry.com). DOI 10.1002/jps.22423 ABSTRACT: The vaporization, fusion, and sublimation enthalpies of methyl, ethyl

Chickos, James S.

105

Assessing Evidence for a Pervasive Alteration in Tropical Tree Communities  

E-Print Network [OSTI]

of America, 13 Wildlife Conservation Society, Bronx, New York, United States of America, 14 Laboratory Thai National Park Wildlife and Plant Conservation Department, Chatuchak Bangkok, Thailand, 7 Institute Ecology Laboratory, Faculty of Science, Osaka City University, Osaka, Japan, 17 Faculty of Science

Bermingham, Eldredge

106

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

107

GSTM1 and CYP1A1 polymorphisms, tobacco, air pollution, and lung cancer: a study in rural Thailand  

SciTech Connect (OSTI)

Incidence rates of lung cancer is high in Lampang Province in northern Thailand, particularly in women. This study was conducted to quantify the risk of lung cancer associated with exposures prevalent in the area and to investigate possible interactions with genetic susceptibility. The presence of several large open-cast coal mines from 1955 close to electricity-generating plants was a particular focus of concern. A point source air pollution exposure index was calculated for each village/ township reported in residential histories based on the linear distance from the Mae Moh Center (the area of the electricity-generating plants), the year-specific gaseous (SO{sub 2} and NO{sub 2}) or total suspended particulate emissions from the Mae Moh Power Plant, and the percentage of wind from the center. Odds ratios for the disease associated with categorical variables were estimated within unconditional logistic regression. Extraction of genomic DNA and genotyping of variants in CYP1A1 and GSTM1 were conducted to assess the extent of modification of risk by these genes that are involved in the metabolism of polycyclic aromatic hydrocarbons. Smoking of local high tar unfiltered products is commonamongst women. None of the three polymorphisms examined increased the risk of lung cancer or modified the risk associated with smoking. 96% of male and 64% of female lung cancer incidence were explained by tobacco smoking. None of the potential sources of air pollution deriving from the combustion of coal and wood, or polymorphisms in the CYP1A1 gene or deletion of the GSTM1 had an effect on the risk of lung cancer, either together or separately.

Pisani, P.; Srivatanakul, P.; Randerson-Moor, J.; Vipasrinimit, S.; Lalitwongsa, S.; Unpunyo, P.; Bashir, S.; Bishop, D.T.

2006-04-15T23:59:59.000Z

108

Innovative Design Concept for the New Bangkok International Airport, NBIA  

E-Print Network [OSTI]

using photovoltaic modules covering a surface area of 55,000 m? for the immediate generation of electric power in combination with an electrically powered compression chiller system was compared to other concepts under the aspect of economy. Fig. 17... to costs for environmentally friendly systems, optimized innovative concepts using thermal solar collectors should be given preference over systems using photovoltaics technology. DESIGN - TEAM Architects: Murphy / Jahn Architects, Chicago Project...

Kessling, W.; Holst, S.; Schuler, M.

2004-01-01T23:59:59.000Z

109

Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: A population study  

SciTech Connect (OSTI)

Risk for hypertension and diabetes has not been conclusively found to be a result of cadmium exposure. A population-based study was conducted in 2009 to examine the correlations of urinary cadmium, a good biomarker of long-term cadmium exposure, with hypertension and diabetes in persons aged 35 years and older who lived in the 12 cadmium-contaminated rural villages in northwestern Thailand. A total of 5273 persons were interviewed and screened for urinary cadmium, hypertension, and diabetes. The geometric mean level of urinary cadmium for women (2.4{+-}2.3 {mu}g/g creatinine) was significantly greater than that for men (2.0{+-}2.2 {mu}g/g creatinine). Hypertension was presented in 29.8% of the study population and diabetes was detected in 6.6%. The prevalence of hypertension significantly increased from 25.0% among persons in the lowest tertile of urinary cadmium to 35.0% in the highest tertile. In women, the rate of hypertension significantly increased with increasing urinary cadmium levels in both ever and never smokers, after adjusting for age, alcohol consumption, body mass index, and diabetes. In men, such association was less significantly found in never smokers. The study revealed no significant association between urinary cadmium and diabetes in either gender. Our study supports the hypothesis that environmental exposure to cadmium may increase the risk of hypertension. Risk for diabetes in relation to cadmium exposure remains uncertain in this exposed population.

Swaddiwudhipong, Witaya, E-mail: swaddi@hotmail.com [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)] [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)] [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Limpatanachote, Pisit; Krintratun, Somyot [Department of Internal Medicine, Mae Sot General Hospital, Tak (Thailand)] [Department of Internal Medicine, Mae Sot General Hospital, Tak (Thailand)

2010-08-15T23:59:59.000Z

110

Phylogeography of mtDNA haplogroup R7 in the Indian peninsula  

E-Print Network [OSTI]

://www.fluxus-engineering.com. The samples were selected through a preliminary sequence analysis of the control region in order to include the widest possible range of R7 variation, language and geographical groups. Coales- cent times were calculated by a calibration method described... , Thosarat R: Prehistoric Thailand: From early set- tlement to Sukothai. River Books, Bangkok; 1998. 25. Diamond J, Bellwood P: Farmers and their languages: the first expansions. Science 2003, 300:597-603. 26. Diffloth G: Austroasiatic languages...

Chaubey, Gyaneshwer; Karmin, Monika; Metspalu, Ene; Metspalu, Mait; Selvi-Rani, Deepa; Singh, Vijay Kumar; Parik, Juri; Solnik, Anu; Naidu, B Prathap; Kumar, Ajay; Adarsh, Niharika; Mallick, Chandana Basu; Trivedi, Bhargav; Prakash, Swami; Reddy, Ramesh; Shukla, Parul; Bhagat, Sanjana; Verma, Swati; Vasnik, Samiksha; Khan, Imran; Barwa, Anshu; Sahoo, Dipti; Sharma, Archana; Rashid, Mamoon; Chandra, Vishal; Reddy, Alla G; Torroni, Antonio; Foley, Robert A; Thangaraj, Kumarasamy; Singh, Lalji; Kivisild, Toomas; Villems, Richard

2008-08-04T23:59:59.000Z

111

Progress in cadmium-related health effects in persons with high environmental exposure in northwestern Thailand: A five-year follow-up  

SciTech Connect (OSTI)

Food-borne cadmium was the principal source of exposure for persons living in the 12 cadmium-contaminated villages in Mae Sot District, Tak Province, northwestern Thailand. This report presents progress in cadmium-related health effects among persons with high cadmium exposure. The study included 436 persons who had urinary cadmium levels {>=}5 {mu}g/g creatinine and were screened for urinary cadmium, renal function, hypertension, diabetes and urinary stones in 2005 (baseline) and 2010 (5-year follow-up). Study renal biomarkers included urinary excretion of {beta}{sub 2}-microglobulin ({beta}{sub 2}-MG), total protein and calcium, serum creatinine and glomerular filtration rate (GFR). The geometric mean level of urinary cadmium statistically significantly reduced from 9.5{+-}1.6 {mu}g/g creatinine in 2005 to 8.8{+-}1.6 {mu}g/g creatinine in 2010. Compared to baseline, the follow-up examination revealed significant increases in urinary {beta}{sub 2}-MG (tubular effect), urinary total protein and serum creatinine, and a decrease in GFR (glomerular effects). Progressive renal dysfunctions were similarly observed in persons both with and without reduction in cadmium intake. Significant increases in prevalence of hypertension, diabetes and urinary stones were also detected at follow-up. These three disorders were found to markedly impair renal functions in the study persons. Our study indicates that in persons with prolonged excessive cadmium exposure, toxic health effects may progress even after exposure reduction. Renal damage from cadmium can be due to its direct nephrotoxic effect and also through the related disorders causing nephropathy.

Swaddiwudhipong, Witaya, E-mail: swaddi@hotmail.com [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)] [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Limpatanachote, Pisit [Department of Internal Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)] [Department of Internal Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)] [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Krintratun, Somyot [Department of Internal Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)] [Department of Internal Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Punta, Boonyarat; Funkhiew, Thippawan [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)] [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)

2012-01-15T23:59:59.000Z

112

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

113

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

114

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

115

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

116

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

117

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

118

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

119

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

120

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

122

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

123

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

124

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

125

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

126

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

127

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

128

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

129

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

130

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

131

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

132

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

133

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

134

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

135

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

136

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

137

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

138

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

139

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

140

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

142

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

143

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

144

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

145

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

146

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

147

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

148

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

149

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

150

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

151

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

152

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

153

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

154

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

155

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

156

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

157

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

158

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

159

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

160

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

162

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

163

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

164

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

165

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

166

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

167

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

168

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

169

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

170

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

171

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

172

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

173

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

174

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

175

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

176

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

177

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

178

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

179

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

180

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

182

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

183

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

184

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

185

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

186

Foreign Fishery Developments Thailand's Shrimp  

E-Print Network [OSTI]

, feeder roads, shrimp hatcheries, shrimp nurseries, feed mills, cold storage, and processing plants. Located within an hour's drive ofSong khla's new deep-waterport, the burgeon ing shrimp industry will have-production, processingand marketing-continues ata feverish pace. However, the industry faces significant problems, mostly

187

Global Cooling: Policies to Cool the World and Offset Global Warming from CO2 Using Reflective Roofs and Pavements  

E-Print Network [OSTI]

Airport Taipei Dusanbe Dar es Salaam Bangkok Chiang MauAirport Taipei Dusanbe Dar es Salaam Bangkok Chiang Mau

Akbari, Hashem

2010-01-01T23:59:59.000Z

188

Emissions mitigation of blended coals through systems optimization  

SciTech Connect (OSTI)

For coal fired power stations, such as those located in the US, that have installed NOx and SOx emissions abatement equipment substantial carbon dioxide reduction could be achieved by shifting from pure PRB coal to blended coals with local bituminous coal. Don Labbe explains how. The article is based on a presentation at Power-Gen Asia 2009, which takes place 7-9 October in Bangkok, Thailand and an ISA POWID 2009 paper (19th Annual Joint ISA POWID/EPRI Controlls and Instrumentation Conference, Chicago, Illinois, May 2009). 4 refs., 3 figs.

Don Labbe [IOM Invensys Operations Management (United States)

2009-10-15T23:59:59.000Z

189

Moving towards climate-smart flood management in Bangkok and Tokyo  

E-Print Network [OSTI]

Managing the impacts of climate change is no longer a concern of the future, but a significant reality of the present. Preparing for, and mitigating extreme weather events and adapting to the gradual shift in climatic ...

Takemoto, Shoko, M.C.P. Massachusetts Institute of Technology

2011-01-01T23:59:59.000Z

190

Sustaining tradition : design for a contemporary Thai house in northern Bangkok  

E-Print Network [OSTI]

This thesis explores and documents the evolution of a Thai house, which has transformed drastically over the years to meet changes in social aspiration. The result of this investigation had generated the design principles ...

Kanisthakhon, Bundit, 1971-

1998-01-01T23:59:59.000Z

191

APEC experts` group on clean coal technology  

SciTech Connect (OSTI)

These proceedings are the result of a Technical Seminar of the APEC Experts Group on Clean Coal Technology, held in Thailand, September 6-10, 1993. The National Energy Policy Council of Thailand requested the seminar in response to growing public, government and private sector environmental concerns related to increased use of lignite for electricity generation in Thailand. The core of the seminar was a two-day series of 25 technical papers contained in these proceedings. The goals were: (1) to inform government officials and electric utility managers on the range of CCTs, their commercial status, environmental performance, and suitability for various types of coal, including lignite; and (2) to hold a public seminar to inform the public about the same issues set in the context of energy policy concerns that were articulated by the National Energy Policy Council. Sixty people participated in the technical seminar held in Chiang Mai, and approximately 170 people attended the public seminar in Bangkok, Thailand. All papers have been abstracted and indexed separately for inclusion in the Energy Science and Technology Database.

NONE

1993-12-31T23:59:59.000Z

192

Joseph Skowronek, '06 Khao Lak, Thailand  

E-Print Network [OSTI]

for the rest of the trip. We went to the volunteer center to talk to them about where they needed the most help. This is when we decided to work construction in a village called Laem Pom, where the majority of the Tsunami in the construction work; rather they cooked in a community kitchen. The women got together and prepared all

193

Constructed Wetlands for Industry in Thailand  

E-Print Network [OSTI]

River Ecosystem Quality Improvement. ­ Environmental Public Policy About us Community wastewater Laem) About us #12;23/05/2012 2 Research Centre for Environmental and Hazardous Substance Management 4,500 - 10,000 cubic meters of wastewater per day Laem Phak Bia Five ponds 1 sedimentation pond, 3

Heal, Kate

194

Thailand: Asia Pacific energy series: Country report  

SciTech Connect (OSTI)

As part of our continuing assessment of the Asia-Pacific energy markets, the Energy Program has embarked upon country studies that discuss in detail the structure of the energy sector in each country within the region. The country studies also provide the reader with an overview of the economic situation and, when possible, of the political situation in the country under study. We have particularly highlighted petroleum and gas issues in the country studies and have attempted to show the foreign trade implications of oil and gas trade. Finally, as much as possible, we have provided the latest available statistics---more often than not, from unpublished sources. Staff members have traveled extensively in the countries under review and have spoken to top policymakers in government and industry. Thus, these reports provide not only information but the latest thinking on energy issues in various countries. It is our hope that over the next few years these country studies can be updated and will provide a continuous, long-term source of energy sector analysis for the Asia-Pacific region. 48 refs., 23 figs., 56 tabs.

Fridley, D.

1988-11-01T23:59:59.000Z

195

Thailand-IEA Activities | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTaguspark Jump to:TetraSunanalysis, Technology characterizations

196

Thailand: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTaguspark Jump to:TetraSunanalysis, TechnologyEnergy

197

Thailand Geothermal Region | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump Jump to: navigation,Information Global FlexTexsa S AThai

198

The 23rd Annual Conference of the Southeast Asian Linguistics Society May 29-31, 2013 Chulalongkorn University, Bangkok  

E-Print Network [OSTI]

, or gnzh , formed by combining a decimal cycle, the (ten) Heavenly Stems, tingn , and a duodecimal cycle of the sexagesimal cycle is jiz, formed by combining the first terms of both cycles. The second year is ychu propose an explanation of the origin of the sexagesimal cycle as the combination of two numbering systems

Boyer, Edmond

199

Earth pressure balance (EPB) shield tunneling in Bangkok : ground response and prediction of surface settlements using artificial neural networks  

E-Print Network [OSTI]

Although Earth Pressure Balance (EPB) shields have been used for several decades, very little information exists about the actual mechanisms of shield-ground interaction. The ground response mechanism induced by EPB tunneling ...

Suwansawat, Suchatvee, 1972-

2002-01-01T23:59:59.000Z

200

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

202

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

203

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

204

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

205

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

206

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

207

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

208

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

209

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schäfer, Eberhard

210

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

211

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

212

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

213

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

214

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

215

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

216

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

217

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

218

Gas treatment and by-products recovery of Thailand`s first coke plant  

SciTech Connect (OSTI)

Coke is needed in the blast furnace as the main fuel and chemical reactant and the main product of a coke plant. The second main product of the coke plant is coke oven gas. During treatment of the coke oven gas some coal chemicals like tar, ammonia, sulphur and benzole can be recovered as by-products. Since the market prices for these by-products are rather low and often erratic it does not in most cases justify the investment to recover these products. This is the reason why modern gas treatment plants only remove those impurities from the crude gas which must be removed for technical and environmental reasons. The cleaned gas, however, is a very valuable product as it replaces natural gas in steel work furnaces and can be used by other consumers. The surplus can be combusted in the boiler of a power plant. A good example for an optimal plant layout is the new coke oven facility of Thai Special Steel Industry (TSSI) in Rayong. The paper describes the TSSI`s coke oven gas treatment plant.

Diemer, P.E.; Seyfferth, W. [Krupp Uhde GmbH, Dortmund (Germany)

1997-12-31T23:59:59.000Z

219

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

220

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

(Acid rain workshop)  

SciTech Connect (OSTI)

The traveler presented a paper entitled Susceptibility of Asian Ecosystems to Soil-Mediated Acid Rain Damage'' at the Second Workshop on Acid Rain in Asia. The workshop was organized by the Asian Institute of Technology (Bangkok, Thailand), Argonne National Laboratory (Argonne, Illinois), and Resource Management Associates (Madison, Wisconsin) and was sponsored by the US Department of Energy, the United Nations Environment Program, the United Nations Economic and Social Commission for Asia and the Pacific, and the World Bank. Papers presented on the first day discussed how the experience gained with acid rain in North America and Europe might be applied to the Asian situation. Papers describing energy use projections, sulfur emissions, and effects of acid rain in several Asian countries were presented on the second day. The remaining time was allotted to discussion, planning, and writing plans for a future research program.

Turner, R.S.

1990-12-05T23:59:59.000Z

222

The desulfurization of flue gas at the Mae Moh Power Plant Units 12 and 13  

SciTech Connect (OSTI)

As pollution of air, water and ground increasingly raises worldwide concern, the responsible national and international authorities establish and issue stringent regulations in order to maintain an acceptable air quality in the environment. In Thailand, the Electricity Generating Authority of Thailand (EGAT) takes full responsibility in environmental protection matters as well as in generating the electricity needed to supply the country`s very rapid power demand growth. Due to the rapidly increasing electricity demand of the country, EGAT had decided to install two further lignite-fired units of 300 MW each (Units 12 and 13) at the Mae Moh power generation station and they are now under construction. The arrangement and the capacity of all the power plant units are as shown. In 1989, EGAT started the work on the flue gas desulfurization system of Mae Moh power plant units 12 and 13 as planned. A study has been conducted to select the most suitable and most economical process for flue gas desulfurization. The wet scrubbing limestone process was finally selected for the two new units. Local limestone will be utilized in the process, producing a by-product of gypsum. Unfortunately, natural gypsum is found in abundance in Thailand, so the produced gypsum will be treated as landfill by mixing it with ash from the boilers of the power plants and then carrying it to the ash dumping area. The water from the waste ash water lake is utilized in the process as much as possible to minimize the requirement of service water, which is a limited resource. The Mae Moh power generation station is situated in the northern region of Thailand, 600 km north of Bangkok and about 30 km east of the town of Lampang, close to the Mae Moh lignite mine. Three lignite-fired units (Units 1-3) of 75 MW each, four units (Units 4-7) of 150 MW each and four units (Units 8-11) of 300 MW each are in operation.

Haemapun, C.

1993-12-31T23:59:59.000Z

223

Thailand-Enhancing Capacity for Low Emission Development Strategies...  

Open Energy Info (EERE)

Enhancing Capacity for Low Emission Development Strategies (EC-LEDS) AgencyCompany Organization United States Agency for International Development, United States Environmental...

224

Modeling the Water and Nutrient Freshwater Aquaculture in Thailand  

E-Print Network [OSTI]

parameters 22 5.6 Biodegradation 23 6 Nile tilapia feeding on pellet: Data acquisition and results 24 6 to the canal. Catfish (lat. Clarias batrachus) has the highest production in the area and is also the most of freshwater because of the intensive production. Nutrient loads coming from catfish ponds are the highest

Richner, Heinz

225

Thailand-Key Results and Policy Recommendations for Future Bioenergy...  

Open Energy Info (EERE)

biofuel feedstock crops. How the Thai Government manages the potential pressures that the bioenergy sector will exert on its natural resources and agricultural markets and the...

226

The Impact of Climate Change on Electricity Demand in Thailand   

E-Print Network [OSTI]

Climate change is expected to lead to changes in ambient temperature, wind speed, humidity, precipitation and cloud cover. As electricity demand is closely influenced by these climatic variables, there is likely to be ...

Parkpoom, Suchao Jake

2008-01-01T23:59:59.000Z

227

Reinventing Siam: Ideas and Culture in Thailand, 1920-1944  

E-Print Network [OSTI]

foreign camera and his eyeglasses bearing a Western name,close to a When his eyeglasses are destroyed, Pachaneuk

Subrahmanyan, Arjun

2013-01-01T23:59:59.000Z

228

Environmental Impacts of Tourism in Khao Yai National Park, Thailand  

E-Print Network [OSTI]

Knowledge of visitor impacts is critical for sustainable tourism management in national parks. The focus of past tourism impact research on national parks is either on bio-physical impacts (conducted as recreation ecology research) or on social...

Phumsathan, Sangsan

2011-10-21T23:59:59.000Z

229

Thailand-Programme for Developing and Implementing a Climate...  

Open Energy Info (EERE)

Partner on behalf of the Federal Ministry for the Environment, Nature Conservation and Nuclear Safety (BMU) Sector Energy Focus Area Energy Efficiency Topics Low emission...

230

United States - Thailand (Siam) relations 1937-1954  

E-Print Network [OSTI]

:lance of independence by an accom. , od- tion r:. 1th '-he J. . p nese occup='tion i. hai relations uith the United States, ;, hich ?as attacked on t no same 'ay becaa'e diiiicult clio strained;. hen th United Stat. s ente=taine; no ic!ea of reacl". ing any accom... unforiuna-cIy p ove~. ' ineffectual a id too late. Japanese po". ier seemed! i re- sistible, and chen. exerted or Decem!aer 7, 1941, the Tilal government c!ecided after only a '" -icf defiance to rego- tiatc a cease-fire and attempt io preserve a emi...

Mosman, Timothy John

1974-01-01T23:59:59.000Z

231

Southern thailand coal fired project: Feasibility study. Export trade information  

SciTech Connect (OSTI)

This study, conducted by Black & Veatch International, was funded by the U.S. Trade and Development Agency. The report addresses various technical, environmental, and economic aspects of developing four 1,000 MW units of coal fired electric generating facilities at a site near Prachuap Khiri Khan. The study includes a cost estimate for the units and the fuel delivery port as well as the major conceptual design decisions made for the project. This volume of the report is the Feasibility Study and is divided into the following sections: (1) Introduction/Summary; (2) Generation Planning Study; (3) Site Selection Study; (4) Project Description; (5) Fuel Resource Assessment; (6) Water Resource Assessment; (7) Technical Information to Support the Environmental Impact Assessment; (8) Plant Conceptual Design; (9) Transmission Interconnection; (10) Project Capital Cost Estimate; (11) Project Schedule; (12) Project Implementation Plan; (13) Project Risk Analysis.

NONE

1995-09-01T23:59:59.000Z

232

Thailand-The Mitigation Action Implementation Network (MAIN) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTaguspark Jump to:TetraSunanalysis, Technology

233

Thailand Sectoral Study on Climate and Refrigeration Technology in  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation &InformationLoading map...Developing

234

Thailand-Clean Technology Fund (CTF) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation &InformationLoading

235

Thailand-Climate Technology Initiative Private Financing Advisory Network  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation &InformationLoading(CTI PFAN) | Open

236

Thailand-Danish Government Baseline Workstream | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation &InformationLoading(CTI PFAN) | Open

237

Thailand-Key Results and Policy Recommendations for Future Bioenergy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation &InformationLoading(CTI PFAN) |

238

Thailand-Lowering Emissions in Asia's Forests (LEAF) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation &InformationLoading(CTI PFAN)

239

Thailand-Measurement and Performance Tracking (MAPT) Initiative | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation &InformationLoading(CTI PFAN)Energy

240

Thailand-National Energy Policy and Development Plan | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation &InformationLoading(CTI

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Thailand-Programme for Developing and Implementing a Climate Protection  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation &InformationLoading(CTIPolicy | Open

242

Thailand-UNEP Risoe Technology Needs Assessment Program | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation &InformationLoading(CTIPolicy

243

Thailand-Enhancing Capacity for Low Emission Development Strategies  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump Jump to: navigation,Information Global FlexTexsa S

244

Thailand-Green Growth Planning | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump Jump to: navigation,Information Global

245

Thailand-Low Emissions Asian Development (LEAD) Program | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump Jump to: navigation,Information GlobalInformation

246

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

247

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

248

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5’GCGCGCCCATGGGCCCTGCCACCACCCGA3’ (forward primer with NcoI restriction site), 5’GCGCGCCATATGCCTGCCACCACCCGAGGG3’ (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

249

Thai group set to invest in Chinese petchem complex  

SciTech Connect (OSTI)

A $5-billion refinery and petrochemical complex is planned by Thailand's Charoen Pokphand (Bangkok) at the seaport of Nimpoh, near Shanghai. The company has discussed the project with the central government of China, and state oil and petrochemicals company Sinopec (Beijing) is due to complete a feasibility study within the next two months. Charoen's plastics processing subsidiary, Kuo Shen (Hong Kong), is expected to hold 70% in the venture, Sinopec 20%, and the Chinese government the remaining 10%. Western companies have been invited to participate. Solvay (Brussels), a 49% partner with Charoen Pokphand in the Vinythai polyvinyl chloride (PVC) joint venture at Map Ta Pud, Thailand, has not yet made a commitment. The 5-million m.t./year oil refinery would feed the complex, which will be based on a 450,000-m.t./year ethylene plant, downstream aromatics units, and a range of derivatives plants. The complex, which falls outside the many announced for Thailand's current five-year economic plan, is expcted to be implemented in stages. To begin with, a 120,000-m.t./year PVC plant will be built that will be fed on imported vinyl chloride monomer. Charoen is in discussions with process licensers, including Solvay, European Vinyl Corp., BFGoodrich, and Shinetsu. Half the PVC output will be consumed by Kuo Shen in China, where Charoen has several plastics processing units, including one in Shanghai and one in Nimpoh. Meanwhile, Sinopec's Hong Kong subsidiary is seeking partners to invest in joint venture projects in China. Sinopec president Liu Xuemin says the company is willing to cooperate with overseas companies to establish small petrochemical projects. In addition, Sinopec is negotiating with officials of Dayang in Jiangsu province and the special economic zone of Shen Zhen, near Hong Kong, on joint ventures for plastics and food additives.

Alperowicz, N.

1993-01-06T23:59:59.000Z

250

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

251

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

252

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

253

26AUTUMN 2014 Kyoto University Newsletter  

E-Print Network [OSTI]

International Offices: The European Center in Heidelberg and the ASEAN Center in Bangkok World-renowned KU

Takada, Shoji

254

Style Guide THIRD EDITION  

E-Print Network [OSTI]

Bangkok Bogotá Buenos Aires Calcutta Cape Town Chennai Dar es Salaam Delhi Florence Hong Kong Istanbul

Nizkorodov, Sergey

255

The Big Trees Were Kings: Challenges for Global Response to Climate Change and Tropical Forests Loss  

E-Print Network [OSTI]

Brazil Guyana Mexico Suriname India Vietnam Gabon ThailandMalaysia France Laos Guyana Suriname Thailand MadagascarLeone, Solomon Islands, Suriname, Thailand, Uruguay, Uganda,

Irland, Lloyd C.

2010-01-01T23:59:59.000Z

256

Nuclear power grows in China`s energy mix  

SciTech Connect (OSTI)

China`s rapid economic growth in the past two decades has caused the nations`s demand for electricity to exceed its capacity. AS of 1992, with power shortages as high as 25 percent, {open_quotes}power plant operators were often forced to resort to rolling brownouts to avoid complete system breakdowns,{close_quotes} says Xavier Chen, an assistant professor with the Asian Institute of Technology`s Energy Program in Bangkok, Thailand. To keep pace with China`s economic development, Chen estimates that {open_quotes}China must increase its electricity capacity 6 to 8 percent a year each year into the foreseeable future.{close_quotes} For now, coal is transported to power plants in the rapidly developing eastern coastal provinces at great expense. Chen also notes that the environmental disadvantages of coal make it a less desirable source of energy than nuclear. Development of nuclear energy is likely to go forward for another reason: In China, there is much less opposition to nuclear power plants than in other developing nations. {open_quotes}Nuclear energy likely will plan an important role in China`s future energy mix and help close the gap between electricity production and demand,{close_quotes} Chen says.

Chen, Xavier [Institute of Technology`s Energy Program, Bangkok (Thailand)

1996-07-01T23:59:59.000Z

257

16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers  

E-Print Network [OSTI]

on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

Short, Daniel

258

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta

259

Codes for the fast SSS QR eigens  

E-Print Network [OSTI]

Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip ...

260

Microsoft Word - VIPERS instructions.doc  

Office of Environmental Management (EM)

Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Dublin Oxford Portland New York Los Angeles Mexico City San Jose Santiago Rio de Janeiro Madrid The Hague Bern 1 of 17 Kiev Casablanca Johannesburg Amman Dubai Karachi Mumbai Tokyo Beijing Bangkok Kuala Lumpur Singapore  

E-Print Network [OSTI]

reduction mandates. This is precisely the reason emissions trading has received so much attention during the development of both domestic and international climate change policy. Properly structured, emissions trading can significantly cut the costs of achieving any given reduction target. Emissions trading can

262

Neuroculture On the implications of  

E-Print Network [OSTI]

by publishing worldwide in Oxford New York Athens Auckland Bangkok Bogotá Buenos Aires Cape-Town Chennai Dar-es-Salaam

Rolls, Edmund T.

263

E-Print Network 3.0 - autogenous arteriovenous fistula Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Engineering Department, King Mongkut's Institute of Technology North Bangkok Collection: Engineering 13 Journal of Fluids and Structures () Flow-induced vein-wall...

264

A forecasting model of tourist arrivals from major markets to Thailand  

E-Print Network [OSTI]

International tourism is a rapidly growing phenomenon hics. worldwide. However, the East Asia and Pacific Region is expected to be the focus of the worldwide tourism industry in the new millennium because tourist arrivals and receipts registered a...

Hao, Ching

2012-06-07T23:59:59.000Z

265

E-Print Network 3.0 - area central thailand Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences and Ecology 89 Information for the Commercialisation of Renewables in ASEAN (ICRA) Summary: ) 450 kWp (grid connected PV) Philippines 5.1 kWhm2 day 1 MW...

266

Behaviours and attitudes in the management of nonpoint source pollution: Ping River Basin, Thailand   

E-Print Network [OSTI]

Agricultural nonpoint source pollution is recognised as a major cause of water pollution. The characteristics of nonpoint source pollution suggest that an efficient approach should focus on a source control and hence land-use management. Recently...

Bumbudsanpharoke, Wimolpat

2010-01-01T23:59:59.000Z

267

RURAL POVERTY AND DIVERSIFICATION OF FARMING SYSTEMS IN UPPER NORTHEAST THAILAND.  

E-Print Network [OSTI]

to the Social Sciences Division, International Rice Research Institute, Los Baños, Laguna, Philippines. 3 it still help reduce poverty, like in the late sixties and seventies during the "Green Revolution", which

Paris-Sud XI, Université de

268

Determinants of Success for Community-based Tourism: The Case of Floating Markets in Thailand  

E-Print Network [OSTI]

of participatory planning in Indonesia (1999), Li’s (2006) study of community participation in tourism in China, Hipwell’s study of community- based ecotourism (CBET) in Taiwan (2007), Al-Oun and Al-Homoud’s study of CBT in 4 Jordan (2008), and Sebele’s study... “discussed without reference to sustainable development” (1997, p. 857). Due to the popularity of SD, the label of ST has been attached to various types of tourism concepts and products such as nature-based tourism, ecotourism, adventure tourism, and so on...

Vajirakachorn, Thanathorn

2012-10-19T23:59:59.000Z

269

Stakeholder perceived barriers to the use of solar energy in Thailand's buildings.  

E-Print Network [OSTI]

??Energy efficiency and use of renewable energy is currently a key topic given rising fuel prices and concerns regarding future energy security. Governments around the… (more)

Trevarthen, Manda

2011-01-01T23:59:59.000Z

270

Asian Institute of Technology (AIT), Klong Luang, Pathumthani, Thailand The Small Earth Nepal (SEN), Kathmandu, Nepal  

E-Print Network [OSTI]

Earth Nepal (SEN), Kathmandu, Nepal Center of Research for Environment Energy and Water (CREEW), Kathmandu, Nepal International Research Center for River Basin Environment-University of Yamanashi (ICRE). Kathmandu Valley Groundwater Outlook. Asian Institute of Technology (AIT), The Small Earth Nepal (SEN

Walter, M.Todd

271

Thailand-National Energy Efficiency Plan and Evidence-based Mitigation...  

Open Energy Info (EERE)

will be developed and tested as an implementation mechanism. The goal is to reduce the energy intensity of the industrial and commercial sectors by 25% by the year 2030 (from...

272

Architectures of Citizenship : : Democracy, Development, and the Politics of Participation in Northeastern Thailand's Railway Communities  

E-Print Network [OSTI]

architecture to simultaneously improve physical infrastructure, remediate poverty, build a sustainable

Elinoff, Eli Asher

273

The International Workshop on Mechatronics 2006 December 12-13, 2006, Supalai Resort, Saraburi, Thailand  

E-Print Network [OSTI]

. In addition, it has an EDLC bank for an energy buffer. Two DC motors of the wheelchair are driven by a newly for the electric wheelchair. Keywords: wheelchair, PEM fuel cell, EDLC, DC motor, four-quadrant DC chopper 1 Membrane) fuel cell. The wheelchair also has an EDLC (Electric Double Layer Capacitor) bank for an energy

Fujimoto, Hiroshi

274

Thermal and lighting performance of toplighting systems in the hot and humid climate of Thailand  

E-Print Network [OSTI]

performance of three toplighting systems were compared. For the thermal performance, total cooling loads, heat gains and losses, and interior temperature were evaluated. The lighting performance parameters examined were daylight factor, illuminance level...

Harntaweewongsa, Siritip

2006-10-30T23:59:59.000Z

275

Southern thailand coal fired project: Conceptual design. Volume 1. Export trade information  

SciTech Connect (OSTI)

The report addresses various technical, environmental, and economic aspects of developing four 1,000 MW units of coal fired electric generating facilities at a site near Prachuap Khiri Khan. The study includes a cost estimate for the units and the fuel delivery port as well as the major conceptual design decisions made for the project. The study is accompanied by four Conceptual Design manuals. The manual was prepared to communicate project design parameters and requirements to participants of the project, and to control uniformity of design concepts throughout the project. This is Volume 1 of the Conceptual Design and is divided into the following sections: (1) Project Descirption; (2) Site Investigations; (3) Permits and Licenses; (4) Site Planning and Information; (5) Meteorology; (6) Generation Plant Planning; (7) Generatioin Plant Information; (8) Economic Criteria; (9) System Design; (10) Structural Engineering Design Criteria; (11) Mechanical Engineering Design Criteria; (12) Electrical Engineering Design Criteria; (13) Control Engineering Design Criteria; (14) Chemical Engineering Design Criteria; (15) Equipment Nomenclature and Numbering.

NONE

1995-09-01T23:59:59.000Z

276

Southern thailand coal fired project: Conceptual design. Volume 3. Export trade information  

SciTech Connect (OSTI)

This study, conducted by Black & Veatch International, was funded by the U.S. Trade and Development Agency. The report addresses various technical, environmental, and economic aspects of developing four 1,000 MW units of coal fired electric generating facilities at a site near Prachuap Khiri Khan. The study includes a cost estimate for the units and the fuel delivery port as well as the major conceptual design decisions made for the project. The study is accompanied by four Conceptual Design manuals. The manual was prepared to communicate project design parameters and requirements to participants of the project, and to control uniformity of design concepts throughout the project. This is Volume 3 of the Conceptual Design manual which is divided into 12 sections pertaining to System Design Specifications.

NONE

1995-09-01T23:59:59.000Z

277

Southern thailand coal fired project: Conceptual design. Volume 2. Export trade information  

SciTech Connect (OSTI)

This study, conducted by Black & Veatch International, was funded by the U.S. Trade and Development Agency. The report addresses various technical, environmental, and economic aspects of developing four 1,000 MW units of coal fired electric generating facilities at a site near Prachuap Khiri Khan. The study includes a cost estimate for the units and the fuel delivery port as well as the major conceptual design decisions made for the project. The study is accompanied by four Conceptual Design manuals. The manual was prepared to communicate project design parameters and requirements to participants of the project, and to control uniformity of design concepts throughout the project. This is Volume 2 of the Conceptual Design and is divided into the following sections: (1) General Studies; (2) System Analyses.

NONE

1995-09-01T23:59:59.000Z

278

Southern thailand coal fired project: Conceptual design. Volume 4. Export trade information  

SciTech Connect (OSTI)

This study, conducted by Black & Veatch International, was funded by the U.S. Trade and Development Agency. The report addresses various technical, environmental, and economic aspects of developing four 1,000 MW units of coal fired electric generating facilities at a site near Prachuap Khiri Khan. The study includes a cost estimate for the units and the fuel delivery port as well as the major conceptual design decisions made for the project. The study is accompanied by four Conceptual Design manuals. The manual was prepared to commumnicate project design parameters and requirements to participants of the project, and to control uniformity of design concepts throughout the project. This is Volume 4 of the Conceptual Design manual and is divided into 12 sections pertaining to System Design Specifications.

NONE

1995-09-01T23:59:59.000Z

279

Feasibility study for underground coal gasification at the Krabi Coal Mine site, Thailand. Final report  

SciTech Connect (OSTI)

This study, conducted by Energy and Environmental Research Center, was funded by the U.S Trade and Development Agency. The report summarizes the accomplishments of field, analytical data evaluation and modeling activities focused on assessment of underground coal gasification (UCG) feasibility at Krabi over a two year period. The overall objective of the project was to determine the technical issues, environmental impact, and economic of developing and commercializing UCG at the site in Krabi. The report contains an Executive Summary followed by these chapters: (1) Project Overview; (2) Project Site Characterization; (3) Inorganic and Thermal Materials Characterization; (4) Technical and Economic Feasibility of UCG At the Krabi Site; (5) Conclusions and Recommendations; (6) Acknowledgments; (7) References.

Boysen, J.; Sole, J.; Schmit, C.R.; Harju, J.A.; Young, B.C.

1997-01-01T23:59:59.000Z

280

Thailand-EU-UNDP Low Emission Capacity Building Programme (LECBP) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTaguspark Jump to:TetraSun

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Thailand-Low Carbon Asia Research Network (LoCARNet) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTaguspark Jump to:TetraSunanalysis, Technology

282

Thailand-The World Bank Partnership for Market Readiness (PMR) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTaguspark Jump to:TetraSunanalysis, TechnologyEnergy Information

283

Thailand-Status and Potential for the Development of Biofuels and Rural  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place:Innovation &InformationLoading(CTIPolicy |

284

Thailand-Enhancing Low-carbon Development by Greening the Economy: Policy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump Jump to: navigation,Information Global FlexTexsa

285

Thailand-NAMA Programme for the Construction Sector in Asia | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd Jump Jump to: navigation,Information

286

Architectures of Citizenship : : Democracy, Development, and the Politics of Participation in Northeastern Thailand's Railway Communities  

E-Print Network [OSTI]

passive cooling system 388 Figure 7.9: Paw Raengkai’s group’s house .passive cooling system. Chumpae City Source: N/A preponderance of houses

Elinoff, Eli Asher

287

Transportation Applications for Developing Tourist Enclaves: Lessons From Koh Lanta, Thailand  

E-Print Network [OSTI]

also cause congestion and environmental damage on Lanta Noi.the likelihood of environmental damage to Lanta Noi afterdevelopment, severe environmental damage - primarily oil and

Brittany Nikole Montgomery

2008-01-01T23:59:59.000Z

288

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

289

Los Angeles San Francisco  

E-Print Network [OSTI]

international airports Average Annual Global Economic Surplus and Profit Distribution across the Air TravelAuckland Bangkok Beijing Boston Chicago London Los Angeles Melbourne Milan Mumbai Munich New Delhi Shanghai Singapore Melbourne Auckland Bangkok Chicago Paris Boston New York Sydney New Delhi Wroclaw #12

Entekhabi, Dara

290

Competing for Capital: The Diffusion of Bilateral Investment Treaties, 1960-2000  

E-Print Network [OSTI]

2000), India (2001) and Croatia (2001) initiated mini-and Zimbabwe. Thailand-Zimbabwe, Thailand-Croatia, Thailand-Iran, Zimbabwe-Croatia, Zimbabwe-Sri Lanka, Croatia- Iran,

Elkins, Zachary; Guzman, Andrew T; Simmons, Beth

2006-01-01T23:59:59.000Z

291

Evaluating greenhouse gas emissions inventories for agricultural burning using satellite observations of active fires  

E-Print Network [OSTI]

India, Indonesia, Thailand, Kazakhstan, Mexico, and Nigeria)Indonesia, Thailand, Kazakhstan, Mexico, and Nigeria werehot spots across northern Kazakhstan, along the coast of

Lin, Hsiao-Wen; Jin, Yufang; Giglio, Louis; Foley, Jonathan A; Randerson, James T

2012-01-01T23:59:59.000Z

292

E-Print Network 3.0 - area czech republic Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

15 List of participants Prague Czech Republic Summary: List of participants Austria Thailand Thailand Prague Czech Republic Austria Czech Republic Austria... Austria Warsaw...

293

An investigation of methods for reducing the use of non-renewable energy resources for housing in Thailand  

E-Print Network [OSTI]

the consumption of non-renewable energy. In residential buildings, solar energy has been utilized for space heating and domestic hot water using active solar collector systems and for generating electricity using photovoltaic (PV) systems. One photovoltaic... system, the hybrid photovoltaic-thermal (PV-T) collector system, has been developed by several researchers over the last 20 years. The hybrid photovoltaic-thermal (PV-T) collector system is a combination photovoltaic (for producing electricity...

Rasisuttha, Sakkara

2005-08-29T23:59:59.000Z

294

Voluntary environmental programmes in the developing world: an examination of the ISO 14001 environmental management system certification in Thailand  

E-Print Network [OSTI]

is particularly severe for the case of developing countries. While VEPs in general and ISO 14001 in particular have rapidly increased across the developing world, the understanding of their implications in the academic literature trail far behind...

Tambunlertchai, Kanittha

2011-11-08T23:59:59.000Z

295

Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan

296

E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

297

[ Enter captions text ] THURSDAY, AUGUST 26, 2010.  

E-Print Network [OSTI]

MARIA AND WE HAVE ZIP CAR ON CAMPUS. A CAR SHARING PROGRAM. WE HAVE AN ESCORT VAN THAT RUNS, ISSUES AROUND CAMPUS TO ZIP CAR, TRANSIT. ANYTHING ALTERNATIVE TRANSPORTATION. >> THAT'S YOUR THING

Sze, Lawrence

298

The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

299

SOLARPERMIT.ORG  

Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database  https://github.com/solarpermit/solarpermit/archive/devel.zip 

300

UCR 05/2013 Washington Academic Internship Program  

E-Print Network [OSTI]

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

AQUATIC PLANT CONTROL RESEARCH PROGRAM  

E-Print Network [OSTI]

. Michael Smart, John W. Barko Environmental Laboratory DEPARTMENT OF THE ARMY Waterways Experiment. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) PO Box 631 Vicksburg, MS NUMBER ORGANIZATION (If IIPplicable) US Army Corps of Engineers 8c. ADDRESS (City, State, and ZIP Code

US Army Corps of Engineers

302

S o u t h P a c i f i c O c e a n P a c i f i c  

E-Print Network [OSTI]

Thailand Tanzania Tajikistan Syria Switz. Sweden Swaziland Suriname Sudan Sri Lanka Spain South Africa

Hart, Gus

303

P E R F O R M I N G A R T S M A N A G E M E N T 0 2 / 2 0 1 1 S o u t h P a c i f i c O c e a n  

E-Print Network [OSTI]

Tonga Togo Thailand Tanzania Tajikistan Syria Switz. Sweden Swaziland Suriname Sudan Sri Lanka Spain

Hart, Gus

304

License Exceptions Supplement No. 1 to Part 740 page 1 Export Administration Regulations September 28, 2001  

E-Print Network [OSTI]

Islands Somalia South Africa Spain Sri Lanka Surinam Swaziland Sweden Switzerland Taiwan Tanzania Thailand

Bernstein, Daniel

305

University Health Service, University of Rochester LIST OF COUNTRIES For the Tuberculin Skin Test (PPD)  

E-Print Network [OSTI]

Somalia South Africa Spain Sri Lanka Sudan Suriname Swaziland Syrian Arab Republic Tajikistan Thailand

Mahon, Bradford Z.

306

Lake Wauburg Countries  

E-Print Network [OSTI]

Honduras Iraq Israel Japan Korea Kuwait Libya Peru Saudi Arabia Taiwan Thailand Turkey Ukraine United

Pilyugin, Sergei S.

307

China Energy Databook -- User Guide and Documentation, Version 7.0  

E-Print Network [OSTI]

Thailand Tunisia Turkey Uganda UAE United Kingdom United States Vietnam Rep. Yemen Other [4] Total Coal &

Fridley, Ed., David

2008-01-01T23:59:59.000Z

308

please recycle. Annual Fund support is the lifeblood of the Nicholas School of the  

E-Print Network [OSTI]

ecotourism sustainability in Thailand through an internship made possible by Annual Fund support. "It

Reif, John H.

310

On-Road Emissions of Motor Vehicles in Brazil: Current Status  

E-Print Network [OSTI]

4.5 5 Mexico City 91 Kathmandhu 93 Bangkok 93 Leicester 92 Mexico City 94 Denmark 92 Taipei 93) · Dirty Screen (Texas) · SMART SIGN · CARS, TRUCKS, LOCOMOTIVES, MOTORCYCLES AIRPLANES, SNOWMOBILES

Denver, University of

311

Real Estate and the Asian Crisis  

E-Print Network [OSTI]

January 15, 1997, p. 16. JOHN M. QUIGLEY FIG. 8. Hong Kongsteady increase in JOHN M. QUIGLEY FIG. 2. Bangkok officeJanuary 15, 1997, p. 62. JOHN M. QUIGLEY TABLE I Potential

Quigley, John M.

2002-01-01T23:59:59.000Z

312

The relevance of contemporary bronze casting in Ubon, Thailand for understanding the archaeological record of the Bronze Age in Peninsular Southeast Asia  

E-Print Network [OSTI]

????????????........ 109 Bowl Furnace Construction????????????.. 109 Melting the Bronze?????????????........... 110 Pouring the Molten Bronze??????????........... 111 Removing the Bronze Product from the Clay Mould........... 112... arsenides) following the addition of the arsenic material to the molten copper with its subsequent diffusion into the copper due to the miscibility (blending) qualities of the two materials. ?Once the arsenates were exhausted in copper deposits...

Everly, Daniel Eugene

2006-04-12T23:59:59.000Z

313

6-025 (O) The Joint International Conference on "Sustainable Energy and Environment (SEE)" 1-3 December 2004, Hua Hin, Thailand  

E-Print Network [OSTI]

6-025 (O) The Joint International Conference on "Sustainable Energy and Environment (SEE)" 1 fuels for the reduction of carbon monoxide emissions from the vehicles operating in the area [11, 12

314

Proceedings of the Workshop on Sentiment Analysis where AI meets Psychology (SAAIP), IJCNLP 2011, pages 7379, Chiang Mai, Thailand, November 13, 2011.  

E-Print Network [OSTI]

Cardiff Social Media Research Group, ITT Dublin / Ireland John.Cardiff@ittdublin.ie Paolo Rosso NLE Lab the second or third page in search results. In this paper, we propose the "Tell me What I Need" (TWIN

Rosso, Paolo

315

Perceptions of Caring and Nursing by Senior Level Baccalaureate Nursing Students from Thailand and the United States as Influenced by Curriculum Focus: A Descriptive, Comparative Study  

E-Print Network [OSTI]

The health care delivery system and its services are experiencing significant changes that affect nursing's core concept of caring. These changes are often complicated, influenced by the context of a particular environment, ...

Stopper, Mary Constance

2012-12-31T23:59:59.000Z

316

Fulbright U.S. Student Program, 1998-2009 Source: International Institute Fellowships Office  

E-Print Network [OSTI]

, South Africa Jeremy B. Liebowitz, Uganda Joshua D. Whitford, Italy Theodore W. Mayer, Thailand James R James Isaac, Germany Lisa Kenney, Thailand Matthew Lange, Germany Brendan Luecke, Russia Michael Messner

Turner, Monica G.

317

Fulbright U.S. Student Program, 1998-2011 Source: International Institute Fellowships Office  

E-Print Network [OSTI]

. Williams, South Africa Jeremy B. Liebowitz, Uganda Joshua D. Whitford, Italy Theodore W. Mayer, Thailand Galt, Costa Rica James Isaac, Germany Lisa Kenney, Thailand Matthew Lange, Germany Brendan Luecke

Turner, Monica G.

318

E-Print Network 3.0 - asian energy security Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

State-Wide Program for Asian Studies... in Vermont Schools View of the floating market in Thailand at the 2008 Institute in Thailand ... Source: Hayden, Nancy J. - School of...

319

Name * First Last Address Street Address Address Line 2 City State ...  

E-Print Network [OSTI]

Name * First Last; Address. Street Address Address Line 2. City State / Province / Region Postal / Zip Code. United States, United Kingdom, Australia, Canada ...

320

Encore Energy Systems formerly Energy Vision International formerly...  

Open Energy Info (EERE)

Oxford, Massachusetts Zip: 38655 Sector: Geothermal energy Product: Provider geothermal heat pumps primarily for heating and air conditioning. Coordinates: 43.781517,...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Institute of Chemical Engineering and High Temperature Chemical...  

Open Energy Info (EERE)

Chemical Processes ICEHT Jump to: navigation, search Name: Institute of Chemical Engineering and High Temperature Chemical Processes (ICEHT) Place: Hellas, Greece Zip:...

322

National Interest Security Company NISC Formerly Technology Management...  

Open Energy Info (EERE)

search Name: National Interest Security Company (NISC) (Formerly Technology & Management Services (TMS) Inc.) Place: Gaithersburg, Maryland Zip: 20879 Product: TMS provides...

323

Wind: wind power density GIS data at 50m above ground and 1km...  

Open Energy Info (EERE)

of Columns: 735Number of Rows: 949Pixel Resolution (m): 1000Data Type: integer Spatial Reference Information (End) ** Data and Resources Download DataZIP Download Data...

324

E-Print Network 3.0 - aldrich death rode Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spruce Street City, State, Zip... (S) Wear self-contained breathing apparatus, rubber boots, and heavy rubber gloves. ALDRICH - B85927 ... Source: Choi, Kyu Yong - Department of...

325

Institute of Photo Electronic Thin Film Devices and Technology...  

Open Energy Info (EERE)

Technology of Nankai University Place: Tianjin Municipality, China Zip: 300071 Sector: Solar Product: A thin-film solar cell research institute in China. References: Institute...

326

E-Print Network 3.0 - american industry classification Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Knuth, Kevin H. - Department of Physics, State University of New York at Albany Collection: Physics 22 City Zip 98104 Industry description (e.g., Manufacture of motor...

327

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Minneapolis, Minnesota Reference Buildings by Climate Zone and Representative City: 6A Minneapolis, Minnesota In addition to the ZIP file for each building type, you can directly...

328

E-Print Network 3.0 - acute abdomen pt Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PHYSICIAN'S PERSONAL COPY TO: STREET CITY ZIP Summary: % BILIRUBIN mg% RBC HOSPITAL TUBE STATION 31 Platelet Count: INR: PT: PTT: 12;GASTRO INTESTINAL ANGIOGRAPHIC... CONTRAST)...

329

Cape Peninsula University of Technology - Centre for Distributed...  

Open Energy Info (EERE)

Peninsula University of Technology Address: Symphony way, Bellville Place: Cape Town, South Africa Zip: 7535 Region: Western cape Number of Employees: 11-50 Year Founded: 2004...

330

THE JOHNS HOPKINS UNIVERSITY School of Nursing  

E-Print Network [OSTI]

: (__ __ __) __ __ __ - __ __ __ __ 8. Cell Phone: (__ __ __) __ __ __ - __ __ __ __ 9. Emergency Phone: ______________________________________________________________________ If Maryland address, County name______________________ Street City State Zip Code 5. Local Phone: (__ __ __) __ __ __ - __ __ __ __ 6. Permanent Phone: (__ __ __) __ __ __ - __ __ __ __ 7. Work Phone

Connor, Ed

331

CSUF CHILDREN'S CENTER SUMMER SESSION 2014 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

332

Furman Graduate Studies Registration Form Spring 2014 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

333

Furman Graduate Studies Registration Form 2013 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

334

Hot Topics | Photosynthetic Antenna Research Center  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

taught * Home Address Address * City * State * Zip Code * Home Phone * Work Phone * Cell Phone * Work Email * Home Email * Would you like to receive School Partnership news...

335

Furman Graduate Studies Registration Form 2012 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

336

FLORIDA ATLANTIC UNIVERSITY OFFICE OF INTERNATIONAL PROGRAMS  

E-Print Network [OSTI]

: ____________________________ Alt. Email: _______________________________ Cell phone number: ___________________ Home phone number State Zip code Cell phone number: ___________________ Office phone number: _____________________ Home: ________________________________________________________ Z number: _________________________ Office phone number: _______________________ Email

Fernandez, Eduardo

337

CSUF CHILDREN'S CENTER SUMMER SESSION 2013 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

338

Participant Medical Record Ocean Classroom Foundation  

E-Print Network [OSTI]

____________________________ Day phone (_____)________________ Evening phone (_____)________________ Cell phone/State/Zip __________________________________________________________ Day phone ____________________________________ Evening phone _____________________________ Cell ____________________________________ Evening phone _____________________________ Cell/other phone _________________________ Email

Pontius Jr., Duane H.

339

Furman Graduate Studies Registration Form Spring 2015 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

340

Furman Graduate Studies Registration Form 2014 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Indian Ministry of New and Renewable Energy formerly Ministry...  

Open Energy Info (EERE)

Renewable Energy (formerly Ministry of Non-Conventional Energy Sources) Place: New Delhi, India Zip: 110 003 Product: Involved in policy making, planning, programme formulation and...

342

E-Print Network 3.0 - assembly competent proteins Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Paper 2270 Summary: A. Voelz and Ken A. Dill, "Exploring zipping and assembly as a protein folding principle" (2007... :repositories.cdlib.orgpostprints2270 12;Exploring...

343

Hawaii Department of Land and Natural Resources Commission on...  

Open Energy Info (EERE)

Hawaii Department of Land and Natural Resources Commission on Water Resource Management Address: Kalanimoku Building 1151 Punchbowl Street Room 227 Place: Honolulu, Hawaii Zip:...

344

Hawaii Department of Land and Natural Resources Division of Forestry...  

Open Energy Info (EERE)

Name: Hawaii Department of Land and Natural Resources Division of Forestry and Wildlife Address: Kalanimoku Building 1151 Punchbowl St., Room 325 Place: Honolulu, Hawaii Zip:...

346

Tss4U BV formerly Holecsol R S Renewable Energy Systems and Shell...  

Open Energy Info (EERE)

Holecsol, R&S Renewable Energy Systems and Shell Solar Energy) Place: Veldhoven, Netherlands Zip: 5503 Sector: Solar, Wind energy Product: Provides small solar and wind for...

347

african higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

counterfactual Danforth, Bryan Nicholas 134 Application for Higher Education Internship City: Zip Code Mathematics Websites Summary: Application for Higher Education Internship...

348

affect foreign bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

349

allied irish bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

350

affects higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mathematics Websites Summary: Application for Higher Education Internship Name: Address: City: Zip Code: Country: Phone Number: E supervising faculty? Name: E-mail: Phone Number:...

351

XRAY XRAY XRAY XRAY XRAY XRAY XRAY . DUKE UNIVERSITY HOSPITAL  

E-Print Network [OSTI]

of Birth Name __________________________________ City of Birth Address City _______________________________________________________________ City ____________________________________ State Zip Date of Birth _____________________________ Social _____________________________________________________________________ Address Phone # _______________________ Certificate # (usually SS#) Group

352

E-Print Network 3.0 - attentional set shifting Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: attentional set shifting Page: << < 1 2 3 4 5 > >> 1 Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along...

353

Wind: wind power density maps at 50m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Ghana. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Ghana. Data and Resources Download MapsZIP Download Maps More...

354

Wind: wind power density maps at 50 m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Cuba. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Cuba. Data and Resources Download MapsZIP Download Maps More...

355

Empowering Women: The Role of Economic Development, Political Culture and Institutional Design in the World’s Societies  

E-Print Network [OSTI]

Paraguay, Sri Lanka, Suriname, Thailand, Turkey, Ukraine,South Africa, Spain, Suriname, Sweden, Switzerland 25 th -75

Alexander, Amy C.

2007-01-01T23:59:59.000Z

356

To appear in IEEE Transactions on Visualization and Computer Graphics Order of Magnitude Markers: An Empirical Study on Large  

E-Print Network [OSTI]

SouthAfrica KoreaSouth SriLanka Sudan Suriname Swaziland Tajikistan Tanzania Thailand Timor-Leste Togo

Jones, Mark W.

357

Paintball Countries  

E-Print Network [OSTI]

Korea Libya Niger Peru Oman Qatar Saudi Arabia Spain Sri Lanka Taiwan Thailand Turkey Ukraine UAE United

Pilyugin, Sergei S.

358

Competing for Capital: The Diffusion of Bilateral Investment Treaties, 1960-2000  

E-Print Network [OSTI]

Zimbabwe-Sri Lanka, Croatia- Iran, Thailand Kazakhstan,Zimbabwe-Kazakhstan,Croatia-Kazakhstan. Sweden also participated and concluded a

Elkins, Zachary; Guzman, Andrew T; Simmons, Beth

2006-01-01T23:59:59.000Z

359

Energy-efficiency labels and standards: A guidebook for appliances, equipment and lighting  

E-Print Network [OSTI]

Appliance Manufacturers’ (AHAM) certification program forAuthority of Thailand AEU AGO AHAM AMI ANSI ANOPR APEC ARI

McMahon, James E.; Wiel, Stephen

2001-01-01T23:59:59.000Z

360

international enrollment report  

E-Print Network [OSTI]

Singapore 22 Thailand 23 Vietnam 28 Europe 320 Albania 5 Armenia 1 Austria 8 Azerbaijan 6 Belgium 1 Bosnia

Gerber, Leah R.

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Microsoft PowerPoint - 7_James Warden_2013-05-06 123 agreements...  

National Nuclear Security Administration (NNSA)

Norway - Canada - Russian Federation - China - South Africa - Colombia - Switzerland - Egypt - Thailand - EURATOM (27 countries) - Turkey - India - Ukraine - Indonesia - United...

362

PROOF COPY [JES-11-1229R] 068110JES Comparison of Hydrogen and Methane as fuel in Micro-Tubular  

E-Print Network [OSTI]

for choosing methane is explained below. 23 The major external energy sources in Thailand are from coal and 24 of these particular cells with coal gas in Thailand. 41 At MTEC facility, the cell stack were tested in groups of 500, Columbia, South Carolina 29208, USA 5 b National Metal and Materials Technology Center, Thailand Science

Van Zee, John W.

363

Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

364

Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

365

Reference Buildings by Climate Zone and Representative City: 3C San Francisco, California  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

366

Reference Buildings by Climate Zone and Representative City: 7 Duluth, Minnesota  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

367

Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

368

STUDENT / PARENT INFORMATION MAIL DELIVERY ON CAMPUS The information below provides the basic information you need to send and receive United States  

E-Print Network [OSTI]

West Street Address (if applicable) 522 Thurstin Ave. Bowling Green State University Bowling Green State University City, State and Zip Code Bowling Green, OH 43403-4603 Please note that BGSU has its own zip code, 43403, which is unique from the city of Bowling Green (43402). Please ensure to include

Moore, Paul A.

369

Reference Buildings by Building Type: Secondary school  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

370

Reference Buildings by Building Type: Primary school  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

371

Sandia Group Medicare Advantage Plan Enrollment Form Senior Advantage Health Plan Choices (Choose One)  

E-Print Network [OSTI]

Home Phone: Cell: E-Mail Address: Permanent Residence Address: City: State: Zip Code: County: Mailing Address (only if different from your Permanent Residence Address): City: State: Zip Code: County drug coverage, including other private insurance, TRI- CARE, Federal employee health benefits coverage

Fuerschbach, Phillip

372

2011 ODU Game Development Summer Camp Registration Form Child's Name Date of Birth Sex  

E-Print Network [OSTI]

Contacts Primary Emergency Contact Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work or Cell Phone Home Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information's/Guardian's Name Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work Phone Home Phone Work Phone Address Address

373

Finance Division Employee Status Form Finance Division  

E-Print Network [OSTI]

's Date: Employee Name: Home Address: City/State: Zip/Postal Code: Work Phone Home Phone: Cell Phone Phone: Work Phone: Cell Phone: Relationship: Name (2): Address: State/Province: Zip/Postal Code: Home Phone: Work Phone: Cell Phone: Relationship: Special Notes: Department New Employee Resignation Change

Crews, Stephen

374

University of Washington Transplant Services Rev. 5/23/02  

E-Print Network [OSTI]

.: City: State: Country: Zip Code: - Home Phone: Work Phone: Ext.: Cell Phone: Home Phone: Cell phone: Work Phone: DEMOGRAPHIC INFORMATION LIVING KIDNEY DONOR FORM #12;University to you: Street Address: Apt No: City, State, Zip: Home Phone: Cell phone: Work Phone: EMPLOYER Name

Borenstein, Elhanan

375

UCR 09/2014 Washington Academic Internship Program  

E-Print Network [OSTI]

: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if different from above: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 09/2014 Do you currently receive): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship: Address: City: State

376

#~i;:~~.:(' . AQUATIC PLANT CONTROL  

E-Print Network [OSTI]

-4 EFFECTS OF WATER CHEMISTRY ON SUBMERSED AQUATIC PLANTS: A SYNTHESIS by R. Michael Smart Environmental. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City. State, and ZIP Code) 3909 Halls Ferry Road IDENTIFICATION NUMBER ORGANIZATION (If applicable) US Army Corps of Engineers Be. ADDRESS (City, Stitte

US Army Corps of Engineers

377

LES VOYAGEURS College of Agriculture Ambassadors  

E-Print Network [OSTI]

. - Uphold the policies outlined by the LSU Code of Student Conduct. - Make a commitment of time and energy area of study, questions regarding the transition into college life, campus activities, and other address City State Zip Local phone number Home phone number Home address City State Zip Country E

378

Note: The State Clearinghouse will assign identification numbers for all new projects. If a SCH number already exists for a project (e.g. Notice of Preparation or previous draft document) please fill in.  

E-Print Network [OSTI]

: City: Zip: County: Project Location: County: City/Nearest Community: Cross Streets: Zip Code: Longitude Waste Land Use Drainage/Absorption Population/Housing Balance Toxic/Hazardous Cumulative Effects For LCNG Fueling Facility California Energy Commission Donald Coe 1516 Ninth Street (916) 654

379

Reference Buildings by Building Type: Outpatient health care  

Broader source: Energy.gov [DOE]

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

380

Reference Buildings by Building Type: Hospital  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Reference Buildings by Building Type: Full service restaurant  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

382

Reference Buildings by Building Type: Large office  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

383

Introduction to SAS Programming Registration Form  

E-Print Network [OSTI]

* Date of Birth Employer Job Title Work Address * Home Address City / State / Zip * City / State / Zip a certificate, you must complete at least 80% of the online quizzes and programming activities with scores of 70% or higher. Certificates of completion may take up to two weeks to process once your program has concluded

384

UPS, the UPS brandmark and the color brown are trademarks that are used with permission by the owner, United Parcel Service of America, Inc. All rights reserved. You may type directly into this form  

E-Print Network [OSTI]

UPS, the UPS brandmark and the color brown are trademarks that are used with permission VALUE Post / Zip Post / Zip UPS NEXT DAY AIR® Most deliveries made by 10:30 a.m. UPS GROUND Delivery in 1­5 business days (in-state deliveries usually arrive next day) UPS WORLDWIDE SAVERSM Int'l Service

Jones, Michelle

385

A Second-Site Noncomplementation Screen for Modifiers of Rho1 Signaling during Imaginal Disc Morpogenesis in Drosophila  

E-Print Network [OSTI]

+/+ RhoGEF2 11-3b 21 31 (239) 25 75 (61) Rho1 E3.10 +/+ RhoGEF2 11-3b 21 20 (143) 25 20 (30) Rho1 k02107b +/+ RhoGEF2 11-3b 21 80 (5) 25 100 (9) Rho1 J3.8 +/+ RhoGEF2 11-3b 21 55 (62) 25 91 (22) Rho1 E(br)246 +/+ zip E(br) 21 50 (82) 25 66 (44) Rho1 E...(br)233 +/+ zip E(br) 21 20 (102) 25 66 (29) Rho1 E3.10 +/+ zip E(br) 21 ND 25 33 (12) Rho1 k02107b +/+ zip E(br) 21 ND 25 ND Rho1 J3.8 +/+ zip E(br) 21 95 (20) 25 97 (30) a Balanced, Rho heterozygous mutant virgin females were crossed to either w 1118...

Patch, Kistie; Stewart, Shannon; Welch, Aaron; Ward, Robert

2009-10-23T23:59:59.000Z

386

EUKARYOTIC CELL, Dec. 2006, p. 21842188 Vol. 5, No. 12 1535-9778/06/$08.00 0 doi:10.1128/EC.00274-06  

E-Print Network [OSTI]

, Massachusetts 02142,1 and Department of Microbiology, School of Dentistry, Chulalongkorn University, Bangkok demand for its chaperone functions can exceed its induction (24). This likely occurs because associations are contingent on cellular stress responses (7) and interactions with genetic variants in particular genomes (1

Carpenter, Anne E.

387

The 21_21 Museum in Tokyo, Japan, designed by Tadao Ando celebrates the  

E-Print Network [OSTI]

School of Arts & Sciences Interview: Asia 10 Smart Cities: South Korea's Jeju Island as a Smart Grid: South Korea 06 Bike City Writer: Ella Kim Master of Arts, Quantitative Methods in the Social Sciences in this topic in this particular city? Are there unique conditions in Bangkok that makes it an attractive place

Qian, Ning

388

Terrace housing : providing quality in higher-density housing  

E-Print Network [OSTI]

The higher demand of higher-density housing in Bangkok due to the rapid growth of the economy and the use of high-performance materials and modern construction methods has changed the forms of housing from low-rise buildings ...

Atthakor, Songpol

1992-01-01T23:59:59.000Z

389

Mark Gregory Robson, BS, MS, PhD, MPH, DrPH (hc), ATS Rutgers School of Environmental and Biological Sciences  

E-Print Network [OSTI]

, government service, and agribusiness as well as an owner/operator of farming enterprises. #12;Mark Gregory and entrepreneurship, energy efficiency, and niche agriculture, including agro-tourism, community-supported agriculture Professor-Senior Academic Advisor, Chulalongkorn University College of Public Health Sciences. Bangkok

Wang, Changlu

390

NOAA ARL Monthly Activity Report Bruce B. Hicks, Director  

E-Print Network [OSTI]

NOAA ARL Monthly Activity Report April 2002 Bruce B. Hicks, Director Air Resources Laboratory and Hydrology, to be held in March 2003 in Geneva. An international group of 7 women met in Silver Spring April's participation in meteorology and hydrology, which was held in December 1997 in Bangkok, and will focus on women

391

HYBRIDISATION OF NEURAL NETWORKS AND GENETIC ALGORITHMS FOR TIME-OPTIMAL CONTROL  

E-Print Network [OSTI]

into a time-energy optimal control problem which can be regarded as a Lagrangian constraint optimisation Chaiyaratana Department of Production Engineering King Mongkut's Institute of Technology North Bangkok 1518) are used to solve a multi-objective optimisation problem related to time-optimal control. The results

Coello, Carlos A. Coello

392

GIAGEMolocrcAL lNSTrrurE oF AMFRICA' 5355 Armada Drive I Carlsbad, CA 92008-4S82  

E-Print Network [OSTI]

GIAGEMolocrcAL lNSTrrurE oF AMFRICA' 5355 Armada Drive I Carlsbad, CA 92008-4S82 I:760 603-4500 | Fr 760-6031814 GIA Laboratories Bangkok Carlsbad Gaborone Johannesburg Mumbai New York www

Mathis, Wayne N.

393

Kenyan Shilling KES Stanbic Bank, Nairobi Namibian Dollar NAD Standard Bank Namibia, Ltd, Windhoek  

E-Print Network [OSTI]

Chartered Bank, Tokyo Singapore Dollar SGD The Bank of New York Mellon Thai Bhat THB HSBC Bank, Bangkok Australian Dollar AUD HSBC Bank, Sydney Fiji Dollar FJD Westpac Banking Corporation, Suva New Zealand Dollar, Port Vila British Pound GBP HSBC Bank PLC, London Czech Republic Koruna CZK Ceskoslovenska Obchodni

Qian, Ning

394

Survey of Biomass Resource Assessments and Assessment Capabilities...  

Open Energy Info (EERE)

South Korea, Malaysia, Mexico, New Zealand, Papua New Guinea, Peru, Philippines, Russia, Chinese Taipei, Thailand, United States, Vietnam Australia and New Zealand,...

395

Energy Indicators for Sustainable Development: Guidelines and...  

Open Energy Info (EERE)

FactsheetsEnglishindicators.pdf Country: Brazil, Cuba, Lithuania, Mexico, Russia, Slovakia, Thailand UN Region: South-Eastern Asia, "Latin America and Caribbean" is...

396

International reserves management and the current account  

E-Print Network [OSTI]

St. Vincent & Gren. Sudan Suriname Swaziland Syria ThailandRomania Samoa Sri Lanka Suriname Swaziland Syrian ArabVincent & Grens. Sudan Suriname Swaziland Sweden Switzerland

Aizenman, Joshua

2007-01-01T23:59:59.000Z

397

au burkina faso: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

CAMBODGE LAOS VIETNAM COLOMBIA KENYA SOUTH AFRICA BRAZIL CHILE THAILANDE BOLIVIE MAROC TUNISIE TANZANIE VENEZUELA CAMBODGE LAOS VIETNAM COLOMBIE KENYA AFRIQUE DU SUD 17 La...

398

USABC Battery Separator Development  

Broader source: Energy.gov (indexed) [DOE]

facility Corydon, IN Charlotte, NC* Owensboro, KY* Slestat, France* Wuppertal, Germany* Tokyo, Japan Shanghai, China Prachinburi, Thailand* Sao Paulo, Brazil Obernberg,...

399

The political economy of labor market liberalization  

E-Print Network [OSTI]

Lanka Mozambique Peru Kazakhstan Korea Georgia SwitzerlandThailand (2004), and Kazakhstan In addition to globalizationVietnam Taiwan Mozambique Kazakhstan Ukraine Georgia Korea

Choung, Jinhee Lee

2009-01-01T23:59:59.000Z

400

Capital flows and economic growth in the era of financial integration and crisis, 1990-2010  

E-Print Network [OSTI]

the results of comparing Kazakhstan and Thailand for theis relatively higher in Kazakhstan throughout the decade.whereas the flow to Kazakhstan declined. It is possible that

Aizenman, Joshua; Jinjarak, Yothin; Park, Donghyun

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Consumption-based accounting of CO2 emissions  

E-Print Network [OSTI]

Soviet Union (Ukraine, Kazakhstan, Belarus, and Russia),kg CO 2 /$GDP FSS Ukraine Kazakhstan Iran East Asia BelarusAsia China South Africa Kazakhstan Malaysia Russia Thailand

Davis, S. J; Caldeira, K.

2010-01-01T23:59:59.000Z

402

Cassava, a potential biofuel crop in China  

E-Print Network [OSTI]

energy analysis of fuel ethanol from cassava in Thailand.of cassava-based fuel ethanol used as an alternativediversified materials for fuel ethanol production in China.

Jansson, C.

2010-01-01T23:59:59.000Z

403

E-Print Network 3.0 - atomic exercise brigade Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Dino Buchanan Honolulu District or Joseph Bonfiglio Summary: to the Philippines, Palau, Marshall Islands, Germany, Korea, and to the Cobra Gold exercise in Thailand. Maj....

404

E-Print Network 3.0 - aflatoxin b1 biomarker Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Plant Sciences, University of Arizona Collection: Biology and Medicine 20 Aflatoxin-producing Aspergillus species from Thailand Kenneth C. Ehrlich , Kerri Kobbeman, Beverly...

405

Fast Out of the Gate: How Developing Asian Countries can Prepare...  

Open Energy Info (EERE)

Development (LEAD) program: Bangladesh, Cambodia, India, Indonesia, Laos, Malaysia, Nepal, the Philippines, Papua New Guinea, Thailand, and Vietnam. LEDSGP green logo.png This...

406

E-Print Network 3.0 - anvil project Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

P. Akwara, "Trends in Sexual and Fertility-Related Behavior: Cameroon, Kenya, Uganda, Zambia, Summary: , Uganda, Zambia, and Thailand" (The Measure Evaluation Project,...

407

amblyomma americanum ticks: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

INDEX-CATALOGUE OF MEDICAL AND VETERINARY ZOOLOGY... Doss, Mildred A.; Farr, Marion M.; Roach, Katharine F.; Anastos, George 29 SPATIAL DISTRIBUTION OF TICKS IN THAILAND: A...

408

amblyomma cajennense tick: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

INDEX-CATALOGUE OF MEDICAL AND VETERINARY ZOOLOGY... Doss, Mildred A.; Farr, Marion M.; Roach, Katharine F.; Anastos, George 25 SPATIAL DISTRIBUTION OF TICKS IN THAILAND: A...

409

amblyomma variegatum ticks: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

INDEX-CATALOGUE OF MEDICAL AND VETERINARY ZOOLOGY... Doss, Mildred A.; Farr, Marion M.; Roach, Katharine F.; Anastos, George 27 SPATIAL DISTRIBUTION OF TICKS IN THAILAND: A...

410

E-Print Network 3.0 - a549 lung adenocarcinoma Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Collection: Mathematics 48 TP53 gene mutations of lung cancer patients in upper northern Thailand and environmental risk factors Summary: TP53 gene mutations of lung cancer...

411

CHARLES WESLEY WOOD BIOGRAPHICAL SKETCH (http://www.linkedin.com/pub/wes-wood/71/499/230)  

E-Print Network [OSTI]

, Thailand, Honduras, Mexico, The Philippines, Haiti, and New Zealand. Wes served as Associate Editor Program. Consulting projects have included revegetation of coal mine refuse; monitoring nitrate movement

Jawitz, James W.

412

E-Print Network 3.0 - active single basin Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

basins... ) existed during the Late Oligocene and Miocene when the rift basins of Thailand were active because active... into three main areas and tec- tonic provinces: 1)...

413

E-Print Network 3.0 - ammonia policy context Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

<< < 1 2 3 4 5 > >> 41 Water Quality Assessment and Analysis in Tha Chin River Basin, Thailand Summary: ; most physico-chemical parameters, such as ammonia, nitrate, nitrite,...

414

U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Papua New Guinea, Philippines, Samoa, Singapore, Solomon Islands, Sri Lanka, Taiwan, Thailand, Tonga, Vanuatu, and Vietnam. 7 Includes liquids produced from energy crops,...

415

E-Print Network 3.0 - abandoned mining sites Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

processed and interpreted geophysical data at four separate sites... in Chiang Mai, Thailand. These field sites were selected to train participants in the ... Source:...

416

E-Print Network 3.0 - apec energy project Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

trade agreements Summary: Cooperation (APEC), the Trans-Pacific SEP and the New Zealand-Thailand CEP. Introduction As part... (WTO), the Asia-Pacific Economic Cooperation (APEC),...

417

E-Print Network 3.0 - activityin southern brazil Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biology and Medicine 32 Dr. David Kemp Australian Minister of Summary: - Southern StatesThailand - sustainable industry development - Southern StatesBrazil - clean coal power......

418

E-Print Network 3.0 - asia taiheiyo sekitan Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the nations... of Northeast, East, Southeast, and South Asia (e.g., Japan, Korea, China, Thailand, Brunei, Timor Leste Source: Thiruvathukal, George K. - Department of Computer...

419

E-Print Network 3.0 - artificial ab-mountains extraction Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences 34 Curriculum Vitae of Rudy Setiono Contact information Summary: , Chiang Mai, Thailand, November 2001. 11. Techniques for extracting rules from artificial neural...

420

E-Print Network 3.0 - affecting intracellular fuel Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Conference on "Sustainable Energy and Environment (SEE)" 1-3 December 2004, Hua Hin, Thailand Summary: in Denver. If so, these concentrations are expected to be affected by...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

E-Print Network 3.0 - arsenic-contaminated pyrite wastes Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Technologies 10 Proc. Natl. Acad. Sci. USA Vol. 96, pp. 34553462, March 1999 Summary: of Thailand result from arsenic contamination of the shallow groundwaters be- cause of...

422

RSAP Successful Grants 2011 Research development grants 2011 funding awards  

E-Print Network [OSTI]

, Students, Law, and Violence in Northern Thailand Howes, Stephen Crawford To develop a research scholars on coal mininginduced displacement and dispossession of indigenous peoples in Jharkhand, India

423

E-Print Network 3.0 - australian production program Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Professor of Physiology at the Summary: development programs in Kenya, Brazil, China, Thailand and India. He is a graduate of the Australian Institute... Network. He was Vice...

424

E-Print Network 3.0 - alluvial basin numerical Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

in Great Britain. Palaeocurrents and provenance of the Mae Rim Formation, Northern Thailand Summary: as alluvial fans along the basin's edge. The main goals for this study...

425

E-Print Network 3.0 - asymptomatic african migrants Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

health in the SADC region: Identifying... . . . . . . . . . . . . . . . . 19 5.14 The Thailand Response to Migrants' Access to Health. . . . . . . 19 12;Migration Health... :...

426

E-Print Network 3.0 - adult bullfrogs lithobates Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

wood frog (Lithobates sylvaticus... M C 16 Ranidae Lithobates catesbeianus M W 17 Thailand Ranidae Rana tigrina M C 18 Australia... 36 Ranidae Lithobates clamitans I, M...

427

E-Print Network 3.0 - au mineralization related Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Rock Abuse Collection: Fossil Fuels ; Geosciences 7 Quality Programs 350 4,000 Summary: (Thailand) Master of Communication (Public Relations and Professional Communication)...

428

E-Print Network 3.0 - arsenite-stimulated hemeoxygenase-1 production...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

46 Proceedings of the 2011 Named Entities Workshop, IJCNLP 2011, pages 5864, Chiang Mai, Thailand, November 12, 2011. Summary: , November 12, 2011. Product Name Identification and...

429

E-Print Network 3.0 - area 2004-2006 technical Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

May 2010 Section of Ecology, Evolution & Systematic Biology Summary: of Technology, Thailand. 2004-2006 ASEM-DUO Fellowship (5, 000). Exchange Program. Roskilde University...

430

E-Print Network 3.0 - arak markazi province Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Asian Natural Language Processing (WSSANLP), IJCNLP 2011, , pages 4045, Chiang Mai, Thailand, November 8, 2011. Summary: on Computational Approaches to Arabic Script-...

431

Shipping Data Generation for the Hunter Valley Coal Chain  

E-Print Network [OSTI]

demand for coal is expected to double in the next decade. Optimization and ...... Transportation Analysis (TRISTAN), Phuket, Thailand, 2007. [4] N.L. Boland and

2013-02-02T23:59:59.000Z

432

E-Print Network 3.0 - avoid ghg emissions Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

greenhouse gas balances of cassava-based ethanol in Vietnam Loan T. Lea, Summary: . The Thailand case considered GHG emission credits assigned for the production process...

433

E-Print Network 3.0 - aging underground reinforced Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

University Summary: -Infrastructure Developments in Southeast Asia: Case Study of Thailand Underground Suchatvee Suwansawat Dean of Engineering... is the second phase...

434

E-Print Network 3.0 - altun northwest china Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

northwest Fukien ( Fujian) Prov., China. Distribution: southern China; northern Myanmar; Thailand; Laos... ; Cambodia; Laos; Vietnam; Southern China (Hainan, Hong Kong, and...

435

E-Print Network 3.0 - action plan municipality Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

TREATMENT AND DISPOSAL IN THACHIN, Summary: successfully. 12;iii Abstract At present, Thailand does not have action plan and appropriate policy for Fecal... and Transportation...

436

E-Print Network 3.0 - australian coal industry Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Utilization 27 Dr. David Kemp Australian Minister of Summary: - Southern StatesThailand - sustainable industry development - Southern StatesBrazil - clean coal power......

437

E-Print Network 3.0 - advanced stack hardware Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Pramote - School of Applied Statistics, National Institute of Development Administration Thailand (NIDA); Mooney, Vincent - School of Electrical and Computer Engineering, Georgia...

438

E-Print Network 3.0 - argentina brazil chile Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Malaysia Maldives Mali Malta Chad Chile China Colombia Comoros Tajikistan Tanzania Thailand Togo Mauritania Source: Alechina, Natasha - School of Computer Science,...

439

E-Print Network 3.0 - anti-botulinum natural product Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 Proceedings of the 2011 Named Entities Workshop, IJCNLP 2011, pages 5864, Chiang Mai, Thailand, November 12, 2011. Summary: , November 12, 2011. Product Name Identification and...

440

E-Print Network 3.0 - arc plasma-catalyst reformer Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: by reforming their political institutions. States such as Indonesia, Thailand, the Philippines, Taiwan and East... systems and other key democratic...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

E-Print Network 3.0 - ads fuel cycle Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Conference on "Sustainable Energy and Environment (SEE)" 1-3 December 2004, Hua Hin, Thailand Summary: the use of oxygenated fuels in areas where ambient carbon monoxide (CO)...

442

Automotive Fuels ? The Challenge for Sustainable Mobility  

Broader source: Energy.gov (indexed) [DOE]

GTL Fuel launched in: Austria, Germany, Greece, Italy, Netherlands, Switzerland and Thailand Premium Fuels V-Power fuels: Best performance in Latest engine technology * In 60...

443

E-Print Network 3.0 - alluvial basins in-depth Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

in Great Britain. Palaeocurrents and provenance of the Mae Rim Formation, Northern Thailand Summary: as alluvial fans along the basin's edge. The main goals for this study...

444

E-Print Network 3.0 - america advancing prosperity Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Francesca - Dipartimento di Matematica, Politecnico di Torino Collection: Mathematics 46 Thailand Statistician July 2008; 6(2) : 163-172 Summary: of Prosperity and Depression...

445

E-Print Network 3.0 - agricultural lung diseases Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biology and Medicine 18 TP53 gene mutations of lung cancer patients in upper northern Thailand and environmental risk factors Summary: TP53 gene mutations of lung cancer...

446

ASEAN's Gradual Evolution: Challenges and Opportunities for Integrating Participatory Procedural Reforms for the Environment in an Evolving Rights-Based Framework  

E-Print Network [OSTI]

Dearden, Linking Ecotourism and Biodiversity Conservation: Athe development of ecotourism in Northern Thailand); Amatlah Mohd, Community-based Ecotourism: A New Proposition for

Abdel-Monem, Tarik

2012-01-01T23:59:59.000Z

447

THE FIRST CIRCULAR UNESCO-APEID 2011 INTERNATIONAL SYMPOSIUM ON  

E-Print Network [OSTI]

APEID The utilization and conservation of the water resources for human survival, bioproduction and the environment 8 countries: Philippines, Thailand, Indonesia,Afghanistan, Bangladesh, Malawi, Ghana and Japan

Ejiri, Shinji

448

THE FIRST CIRCULAR UNESCO-APEID 2012 INTERNATIONAL SYMPOSIUM ON  

E-Print Network [OSTI]

APEID The utilization and conservation of the water resources for human survival, bioproduction and the environment 8 countries: Philippines, Thailand, Indonesia,Afghanistan, Bangladesh, Malawi, Ghana and Japan

Ejiri, Shinji

449

China Energy and Emissions Paths to 2030  

E-Print Network [OSTI]

Financial Analysis of Cogeneration Projects. Presentation atfinancial analysis for cogeneration projects in Thailand.integrated steel mills Cogeneration for the use of untapped

Fridley, David

2012-01-01T23:59:59.000Z

450

Rheinische Friedrich-Wilhelms-Universitt Bonn Institut fr Politische Wissenschaft und Soziologie  

E-Print Network [OSTI]

globale Entwicklung. Ein Positionspapier des BMZ. Bonn 2004. The policy paper of the Federal Ministry: China, India, Indonesia, Pakistan, Thailand, Egypt, Iran, Saudi Arabia, Nigeria, South Africa, Argentina

Franz, Sven Oliver

451

Driving Demand for Home Energy Improvements: Motivating residential customers to invest in comprehensive upgrades that eliminate energy waste, avoid high utility bills, and spur the economy  

E-Print Network [OSTI]

Conservation Corporation (WECC). The project‘s goal was toConservation Corporation (WECC was contracted to support theRESNET RFP RPV SMUD VCEM WECC ZIP Baltimore Neighborhood

Fuller, Merrian C.

2011-01-01T23:59:59.000Z

452

Matlab-Kinect Interface Code  

E-Print Network [OSTI]

This .zip file contains code and installation instructions for acquiring 3d arm movements in Matlab using the Microsoft Kinect 3d camera. The provided code has been validated in 32-bit and 64-bit Matlab with 32-bit and ...

Kowalski, Kevin

2012-06-01T23:59:59.000Z

453

GT Human Resources PERSONAL DATA FORM  

E-Print Network [OSTI]

GT Human Resources PERSONAL DATA FORM Page 1 Updated: 05/01/2014 Student Employee? Yes No Print clearly using black or blue ink. Personal Information Name) __________________________________________________________________________________________ (City) (State) (Zip) (County) Personal Telephone #: (_______)________-__________ GT Work Telephone

Jacobs, Laurence J.

454

E-Print Network 3.0 - approaches reveal splicing Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

RNA Structures... Structures at Mammalian Splice Sites Keywords: RNA secondary structure; looping-out; long-range; alternative... splicing; SF1; HNRNPK; ZFX; ZIP7; SLC39A7; ZNF384;...

455

CONNECTICUT VEGETABLE & SMALL FRUIT GROWERS' Thursday, January 15, 2015  

E-Print Network [OSTI]

CONNECTICUT VEGETABLE & SMALL FRUIT GROWERS' CONFERENCE Thursday, January 15, 2015 Maneeley. Connecticut Vegetable & Small Fruit Growers' Conference (We need folks to pre-register so Maneeley's has:______________________________________ ---- Town:______________ State:_____ Zip:____________ ---- Check off: Vegetable grower ___ Fruit grower

Alpay, S. Pamir

456

ACCOUNTS PAYABLE CHECK REQUEST FORM Vendor Name  

E-Print Network [OSTI]

ACCOUNTS PAYABLE CHECK REQUEST FORM Vendor Name Remit to Address City State Zip Code SECTION 2 INSTRUCTIONS Use the link to view approved categories. Vendor Number (if known) DP Requester AP Entry Check

de Lijser, Peter

457

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

1A Miami, Florida Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida In addition to the ZIP file for each building type, you can directly view the...

458

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Boulder, Colorado Reference Buildings by Climate Zone and Representative City: 5B Boulder, Colorado In addition to the ZIP file for each building type, you can directly view the...

459

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Chicago, Illinois Reference Buildings by Climate Zone and Representative City: 5A Chicago, Illinois In addition to the ZIP file for each building type, you can directly view the...

460

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Phoenix, Arizona Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona In addition to the ZIP file for each building type, you can directly view the...

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

7 Duluth, Minnesota Reference Buildings by Climate Zone and Representative City: 7 Duluth, Minnesota In addition to the ZIP file for each building type, you can directly view the...

462

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Baltimore, Maryland Reference Buildings by Climate Zone and Representative City: 4A Baltimore, Maryland In addition to the ZIP file for each building type, you can directly view...

463

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

C Seattle, Washington Reference Buildings by Climate Zone and Representative City: 4C Seattle, Washington In addition to the ZIP file for each building type, you can directly view...

464

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Atlanta, Georgia Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia In addition to the ZIP file for each building type, you can directly view the...

465

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

8 Fairbanks, Alaska Reference Buildings by Climate Zone and Representative City: 8 Fairbanks, Alaska In addition to the ZIP file for each building type, you can directly view the...

466

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Las Vegas, Nevada Reference Buildings by Climate Zone and Representative City: 3B Las Vegas, Nevada In addition to the ZIP file for each building type, you can directly view the...

467

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Houston, Texas Reference Buildings by Climate Zone and Representative City: 2A Houston, Texas In addition to the ZIP file for each building type, you can directly view the...

468

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Helena, Montana Reference Buildings by Climate Zone and Representative City: 6B Helena, Montana In addition to the ZIP file for each building type, you can directly view the...

469

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

C San Francisco, California Reference Buildings by Climate Zone and Representative City: 3C San Francisco, California In addition to the ZIP file for each building type, you can...

470

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Los Angeles, California Reference Buildings by Climate Zone and Representative City: 3B Los Angeles, California In addition to the ZIP file for each building type, you can...

471

APPLICATION FOR ADMISSION TO UNDECIDED-GRAD CLASSIFICATION For Office Use Only GRADUATE SCHOOL, WASHINGTON STATE UNIVERSITY  

E-Print Network [OSTI]

) (State) (Zip) (County if Washington) Gender M F Date of Birth Place of Birth Are you a citizen of the U State University: Fall (year) Spring (year) Summer (year) Location: Pullman Spokane Tri-Cities Vancouver

Collins, Gary S.

472

REQUEST FOR REENROLLMENT GRADUATE SCHOOL  

E-Print Network [OSTI]

-Mail Address Present address (Street) (City) (State) (Zip) (County if Washington) Telephone (Work) (Home 20 Location: Pullman Spokane Tri-Cities Vancouver Global Campus (On-line) I am stating

Collins, Gary S.

473

The Evolution of a Modular Software Network Miguel A. Fortuna  

E-Print Network [OSTI]

The Evolution of a Modular Software Network Miguel A. Fortuna , Juan A. Bonachela, and Simon A the website of this journal as a zip folder. To whom correspondence should be addressed. E-mail: fortuna

Fortuna, Miguel A.

474

U.S. DEPARTMENT OF ENERGY  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

YLARS 1 AM I'U*CHASQVO MY HOME BY ( )MORTGAGE () UND CONTRACT NAME ADDRESS CITY STATE ZIP PHONE (HOME )..... .. (CELL) (WORK). fF.ST TIME TO CALL ( 9 am to l pm) (I pm to S pm )...

475

Furman Graduate Studies Registration Form 2013 Spring Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

476

Furman Graduate Studies Registration Form 2013 Summer Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

477

PARENT INFORMATION FORM WWEELLCCOOMMEE PPRROOUUDD AANNTTEEAATTEERR PPAARREENNTTSS!!  

E-Print Network [OSTI]

: Home / Business / Cell Home Phone: ( ) Cell Phone: ( ) Business Phone: ( ) Marital Status: Single Preferred Phone: Home / Business / Cell Home Phone: ( ) Cell Phone: ( ) Business Phone: ( ) Marital Status Last Relationship to Student: Language Spoken at Home: Address: Street City State Zip Preferred Phone

Barrett, Jeffrey A.

478

Child Information: Our Little Village  

E-Print Network [OSTI]

/State/Zip Parent Information: Student ID #: _____________________ Parent Name _______________ Cell Phone ______________ Phone 2 ________________ email _____________________ Parent Name _______________ Cell Phone ______________ Phone 2 ________________ email Insurance Information: Provider Provider Phone Policy Holder Policy

Escher, Christine

479

Schiefelbusch Hearing Clinic  

E-Print Network [OSTI]

_______ Zip_____________ E-Mail Cell Phone (____)_____________ Day Phone (____)_______________ Evening Phone to Jane Wegner by email at jwegner@ku.edu or by phone at 864-4690. Camper Information Camper Name

480

Furman Graduate Studies Registration Form 2014 Summer Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

Note: This page contains sample records for the topic "bangkok thailand zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

UT EID# __________ Student ID #: __________ AY: 20____ -20____ School: ____________________________ Grade: ________________  

E-Print Network [OSTI]

: ___________________________________________ _________________________________________________________ CITY STATE ZIP Home Phone: ___________________ Cell#: __________________ Student Email _________________ ______________ ___________ __________ Parent(1)/Guardian Address Home Phone # Work Phone # Primary Language _________________ ______________ ___________ __________ Parent(2)/Guardian Address Home Phone # Work Phone # Primary Language In case of an emergency, contact

Texas at Austin, University of

482

Trends in template/fragment-free protein structure prediction  

E-Print Network [OSTI]

1998) Pathways to a protein folding intermediate observed instudy of all-atom protein folding and structure predic-JD, Dill KA (2007) Protein folding by zipping and assembly.

Zhou, Yaoqi; Duan, Yong; Yang, Yuedong; Faraggi, Eshel; Lei, Hongxing

2011-01-01T23:59:59.000Z

483

T-612: False Positive Detection Generic.dx!yxk in DAT 6329 |...  

Broader source: Energy.gov (indexed) [DOE]

in sdatInstaller.zip. This can be deployed via a Group Policy if you have Active Directory as described below. Addthis Related Articles V-101: McAfee VirusScan Enterprise Lets...

484

arabidopsis bzip transcription: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor Texas A&M University -...

485

University of New Hampshire Project SMART  

E-Print Network [OSTI]

University of New Hampshire Project SMART Student Application Form Summer Institute: July 2: ____________________ (Please include first, middle initial and last name) Home Address: _____________________________ City/Junior): _______ School Address: ______________________________ City, State, Zip Code: ____________________ List

New Hampshire, University of

486

Covanta Energy Corporation formerly Ogden Martin Systems of Hillsborou...  

Open Energy Info (EERE)

Inc) Place: Fairfield, New Jersey Zip: 7004 Product: Owner and operator of modern waste-to-energy facilities (over 1GW). Coordinates: 47.38522, -117.171254 Show Map...

487

NORTHERN CHAPTER OF MICHIGAN SOCIETY OF PROFESSIONAL LAND SURVEYORS SCHOLARSHIP  

E-Print Network [OSTI]

program located in the state of Michigan, and qualify for some form of financial aid which can be verified __________________________________________________________ City ______________________________________ MI Zip Code ________________ App Classification: ____Fr ______________________________________ A complete Scholarship Application must include the following: 1. A statement expressing your educational

488

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name  

E-Print Network [OSTI]

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name Mailing Address City State Zip Phone BBGS-001WS 1.50 Total Fees ($) Fee Adjustment Instructions: 1. Complete the fee collector's name

489

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name  

E-Print Network [OSTI]

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name Mailing Address City State Zip Phone Verification: Instructions: 1. Complete the fee collector's name, address, phone number, crab receiver permit

490

C:\\...\\mailquestionnaire. [PFP#1121010499  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

FULL NAME OF BOTTLED GAS COMPANY BOTTLED GAS LOCATION OF COMPANY (IF KNOWN): STREET, CITY, STATE, AND ZIP CODE (LPG or Propane) ACCOUNT NUMBER (IF KNOWN) TELEPHONE NUMBER (IF...

491

Nanoscience Discovery AcademyNanoscience Discovery Academy A two-week Science Academy for 9th  

E-Print Network [OSTI]

Houston area high schools Students competitively selected What Hands-on exposure to environmental science researchers using nanotechnology to tackle civilization's grand challenges ­ energy, water, environment and Street ________________________________________________________________________ City State Zip 3. E

492

USAJOBS -Search Jobs http://jobview.usajobs.gov/...t+(Postdoctoral+Research+Associate)&jbf574=AG03&q=postdoctoral+NOT+%22RA-11-032L%22&AVSDM=2011-04-12+00%3a36%3a00[6/23/2011 2:47:01 PM  

E-Print Network [OSTI]

sensing-based energy balance ET algorithms (EB-ET) - Soil and Water Assessment Tool (SWAT) - ground water: (keywords) Where: (U.S. city, state or zip code) Go to section of this Job: #12;USAJOBS - Search Jobs http

Behmer, Spencer T.

493

THE OSHER REENTRY SCHOLARSHIP AWARD The Bernard Osher Foundation Reentry scholarship targets students who did not have the  

E-Print Network [OSTI]

PHILANTHROPY: INVESTING IN YOU Venture philanthropy brings a new intensity and energy to providing scholarships in the future of students who have demonstrated the ability to balance work and competing demands with college City Zip

Huang, Jianyu

494

E-Print Network 3.0 - aus der uebung Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Information Sciences 2 Institut fur Computational Science Dept. of Computer Science, ETH Zurich Summary: . In uebung3.zip fin- den Sie das C-Programm integrateNeedleMap zur...

495

PARS II CPP Upload Template File | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

teProjectTemplate.zip More Documents & Publications Proposed Data Elements for PARS II Web Application PARS II - Integrated Project Team Meeting PARS II End-of-Month Checklist...

496

UNITED STATES AIR FORCE OUTSIDE THE NATIONAL CAPITAL REGION  

E-Print Network [OSTI]

program in order to reduce Federal employee's contribution to traffic congestion and air pollutionUNITED STATES AIR FORCE OUTSIDE THE NATIONAL CAPITAL REGION PUBLIC TRANSPORTATION BENEFIT PROGRAM): ____________ City (Residence): __________________________State: _______________ Zip Code: ________________ Air Force

497

Designing libraries of chimeric proteins using SCHEMA recombination Matthew A. Smith and Frances H. Arnold*  

E-Print Network [OSTI]

1 Designing libraries of chimeric proteins using SCHEMA recombination and RASPP Matthew A. Smith toolbox. This is available from: http://cheme.che.caltech.edu/groups/fha/media/schema-tools.zip 3

Arnold, Frances H.

498

Non-contiguous SCHEMA protein recombination Matthew A. Smith and Frances H. Arnold*  

E-Print Network [OSTI]

1 Non-contiguous SCHEMA protein recombination Matthew A. Smith and Frances H. Arnold* Division downloaded and unpacked. This is available from: http://cheme.che.caltech.edu/groups/fha/media/ncr.zip 3

Arnold, Frances H.

499

2/1/2014 Using TinyWindmills To Power Portable Electronics http://www.simplygreen.co.za/articles/articles/using-tiny-windmills-to-power-portable-electronics.html 1/2  

E-Print Network [OSTI]

NEWSLETTERS ADVERTISE SEARCH Cost Of Solar Panels www.homeadvisor.com Enter Your Zip Code & Connect. Pre: Climate Impacts Could Lead To Drastic Increases In Food Prices Over Coming Decades Wind Power Growth

Chiao, Jung-Chih

500

International Oil and Gas Board International Oil and Gas Board...  

Open Energy Info (EERE)

Oil and Gas Board Address Place Zip Website Abu Dhabi Supreme Petroleum Council Abu Dhabi Supreme Petroleum Council Abu Dhabi http www abudhabi ae egovPoolPortal WAR appmanager...